Science.gov

Sample records for major surface protease

  1. The major surface protease (MSP or GP63) in the intracellular amastigote stage of Leishmania chagasi.

    PubMed

    Hsiao, Chia-Hung Christine; Yao, Chaoqun; Storlie, Patricia; Donelson, John E; Wilson, Mary E

    2008-02-01

    The Leishmania spp. protozoa have an abundant surface metalloprotease called MSP (major surface protease), which in Leishmania chagasi is encoded by three distinct gene classes (MSPS, MSPL, MSPC). Although MSP has been characterized primarily in extracellular promastigotes, it also facilitates survival of intracellular amastigotes. Promastigotes express MSPS, MSPL, and two forms of MSPC RNAs, whereas amastigotes express only MSPL RNA and one MSPC transcript. We confirmed the presence of MSPC protein in both promastigotes and amastigotes by liquid chromatography-tandem mass spectrometry (LC-MS/MS). More than 10 MSP isoforms were visualized in both amastigotes and promastigotes using two-dimensional immunoblots, but amastigote MSPs migrated at a more acidic pI. Promastigote MSPs were N-glycosylated, whereas most amastigote MSPs were not. Immuno-electron microscopy showed that two-thirds of the promastigote MSP is distributed along the cell surface. In contrast, most amastigote MSP localized at the flagellar pocket, the major site of leishmania endocytosis/exocytosis. Biochemical analyses indicated that most amastigote MSP is soluble in the cytosol, vesicles or organelles, whereas most promastigote MSP is membrane-associated and GPI anchored. Activity gels and immunoblots confirmed the presence of a novel proteolytically active amastigote MSP of higher Mr than the promastigote MSPs. Furthermore, promastigote MSP is shed extracellularly whereas MSP is not shed from axenic amastigotes. We conclude that amastigotes and promastigotes both express multiple MSP isoforms, but these MSPs differ biochemically and localize differently in the two parasite stages. We hypothesize that MSP plays different roles in the extracellular versus intracellular forms of Leishmania spp.

  2. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  3. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  4. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  5. Cowpea bruchid Callosobruchus maculatus counteracts dietary protease inhibitors by modulating propeptides of major digestive enzymes.

    PubMed

    Ahn, J-E; Lovingshimer, M R; Salzman, R A; Presnail, J K; Lu, A L; Koiwa, H; Zhu-Salzman, K

    2007-06-01

    Cowpea bruchids, when challenged by consumption of the soybean cysteine protease inhibitor scN, reconfigure expression of their major CmCP digestive proteases and resume normal feeding and development. Previous evidence indicated that insects selectively induced CmCPs from subfamily B, that were more efficient in autoprocessing and possessed not only higher proteolytic, but also scN-degrading activities. In contrast, dietary scN only marginally up-regulated genes from the more predominant CmCP subfamily A that were inferior to subfamily B. To gain further molecular insight into this adaptive adjustment, we performed domain swapping between the two respective subfamily members B1 and A16, the latter unable to autoprocess or degrade scN even after intermolecular processing. Swapping the propeptides did not qualitatively alter autoprocessing in either protease isoform. Incorporation of either the N- (pAmBA) or C-terminal (pAmAB) mature B1 segment into A16, however, was sufficient to prime autoprocessing of A16 to its mature form. Further, the swap at the N-terminal mature A16 protein region (pAmBA) resulted in four amino acid changes. Replacement of these amino acid residues by the corresponding B1 residues, singly and pair-wise, revealed that autoprocessing activation in pAmBA resulted from cumulative and/or coordinated individual effects. Bacterially expressed isolated propeptides (pA16 and pB1) differed in their ability to inhibit mature B1 enzyme. Lower inhibitory activity in pB1 is likely attributable to its lack of protein stability. This instability in the cleaved propeptide is necessary, although insufficient by itself, for scN-degradation by the mature B1 enzyme. Taken together, cowpea bruchids modulate proteolysis of their digestive enzymes by controlling proCmCP cleavage and propeptide stability, which explains at least in part the plasticity cowpea bruchids demonstrate in response to protease inhibitors.

  6. Identification and characterization of alkaline serine protease from goat skin surface metagenome

    PubMed Central

    2011-01-01

    Metagenomic DNA isolated from goat skin surface was used to construct plasmid DNA library in Escherichia coli DH10B. Recombinant clones were screened for functional protease activity on skim milk agar plates. Upon screening 70,000 clones, a clone carrying recombinant plasmid pSP1 exhibited protease activity. In vitro transposon mutagenesis and sequencing of the insert DNA in this clone revealed an ORF of 1890 bp encoding a protein with 630 amino acids which showed significant sequence homology to the peptidase S8 and S53 subtilisin kexin sedolisin of Shewanella sp. This ORF was cloned in pET30b and expressed in E. coli BL21 (DE3). Although the cloned Alkaline Serine protease (AS-protease) was overexpressed, it was inactive as a result of forming inclusion bodies. After solubilisation, the protease was purified using Ni-NTA chromatography and then refolded properly to retain protease activity. The purified AS-protease with a molecular mass of ~63 kDa required a divalent cation (Co2+ or Mn2+) for its improved activity. The pH and temperature optima for this protease were 10.5 and 42°C respectively. PMID:21906326

  7. Surface-associated MUC5B mucins promote protease activity in Lactobacillus fermentum biofilms

    PubMed Central

    2013-01-01

    Background Mucosal surfaces are coated with layers of mucus gel that protect the underlying tissues and promote colonization by members of the commensal microflora. Lactobacillus fermentum is a common inhabitant of the oral cavity, gastrointestinal and reproductive tracts and is one of the most important lactic acid bacteria contributing to the formation of a healthy intestinal microflora. We have investigated the proteolytic activity in L. fermentum in response to interactions with the MUC5B mucin, which is a major component of mucus gels at sites colonized by this micro-organism. Methods Biofilms of Lactobacillus fermentum were established in mini-flow cells in the presence or absence of human salivary MUC5B. The proteolytic activity of biofilm cells was examined in a confocal scanning laser microscope with a fluorescent protease substrate. Degradation of MUC5B by L. fermentum was analysed using SDS-PAGE followed by Western blotting with antisera raised against the MUC5B peptide. Cell surface proteins differentialy expressed in a MUC5B-rich environment were identified with the aid of comparative two-dimensional electrophoresis followed by LC-MS/MS. Results Lactobacillus fermentum adhered well to surfaces coated with MUC5B mucin and in biofilms of L. fermentum formed in a MUC5B environment, the proportion of proteolytically-active cells (47 ± 0.6% of the population), as shown by cleavage of a fluorescent casein substrate, was significantly greater (p < 0.01) than that in biofilms formed in nutrient broth (0.4 ± 0.04% of the population). Thus, the presence of MUC5B mucins enhanced bacterial protease activity. This effect was mainly attributable to contact with surface-associated mucins rather than those present in the fluid phase. Biofilms of L. fermentum were capable of degrading MUC5B mucins suggesting that this complex glycoprotein can be exploited as a nutrient source by the bacteria. Comparison of the surface proteomes of biofilm cells of L

  8. High-throughput screening of improved protease inhibitors using a yeast cell surface display system and a yeast cell chip.

    PubMed

    Aoki, Wataru; Yoshino, Yuichi; Morisaka, Hironobu; Tsunetomo, Keiji; Koyo, Hirotaka; Kamiya, Shinji; Kawata, Noriyuki; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2011-01-01

    Protease-targeted inhibitors have been promising pharmaceuticals. Here, we combined a yeast cell surface display system with a yeast cell chip for the high-throughput screening of protease inhibitors, and succeeded in improving the activity of a protease inhibitor.

  9. Optimization of protease extraction from horse mango (Mangifera foetida Lour) kernels by a response surface methodology.

    PubMed

    Ahmad, Mohammad Norazmi; Liew, Siew Ling; Yarmo, Mohd Ambar; Said, Mamot

    2012-01-01

    Protease is one of the most important industrial enzymes with a multitude of applications in both food and non-food sectors. Although most commercial proteases are microbial proteases, the potential of non-conventional protease sources, especially plants, should not be overlooked. In this study, horse mango (Mangifera foetida Lour) fruit, known to produce latex with a blistering effect upon contact with human skin, was chosen as a source of protease, and the effect of the extraction process on its protease activity evaluated. The crude enzyme was extracted from the kernels and extraction was optimized by a response surface methodology (RSM) using a central composite rotatable design (CCRD). The variables studied were pH (x(1)), CaCl(2) (x(2)), Triton X-100 (x(3)), and 1,4-dithryeitol (x(4)). The results obtained indicate that the quadratic model is significant for all the variables tested. Based on the RSM model generated, optimal extraction conditions were obtained at pH 6.0, 8.16 mM CaCl(2), 5.0% Triton X-100, and 10.0 mM DTT, and the estimated response was 95.5% (w/w). Verification test results showed that the difference between the calculated and the experimental protease activity value was only 2%. Based on the t-value, the effects of the variables arranged in ascending order of strength were CaCl(2) < pH < DTT < Triton X-100.

  10. Serum proteases alter the antigenicity of peptides presented by class I major histocompatibility complex molecules.

    PubMed Central

    Falo, L D; Colarusso, L J; Benacerraf, B; Rock, K L

    1992-01-01

    Any effect of serum on the antigenicity of peptides is potentially relevant to their use as immunogens in vivo. Here we demonstrate that serum contains distinct proteases that can increase or decrease the antigenicity of peptides. By using a functional assay, we show that a serum component other than beta 2-microglobulin enhances the presentation of ovalbumin peptides produced by cyanogen bromide cleavage. Three features of this serum activity implicate proteolysis: it is temperature dependent, it results in increased antigenicity in a low molecular weight peptide fraction, and it is inhibited by the protease inhibitor leupeptin. Conversely, presentation of the synthetic peptide OVA-(257-264) is inhibited by serum. This inhibition is unaffected by leupeptin but is blocked by bestatin, a protease inhibitor with distinct substrate specificities. Implications for peptide-based vaccine design and immunotherapy are discussed. PMID:1518868

  11. Evaluation of dipeptide nitriles as inhibitors of rhodesain, a major cysteine protease of Trypanosoma brucei.

    PubMed

    Schirmeister, Tanja; Schmitz, Janina; Jung, Sascha; Schmenger, Torsten; Krauth-Siegel, R Luise; Gütschow, Michael

    2017-01-01

    A series of dipeptide nitriles known as inhibitors of mammalian cathepsins were evaluated for inhibition of rhodesain, the cathepsin L-like protease of Trypanosoma brucei. Compound 35 consisting of a Leu residue fitting into the S2 pocket and a triarylic moiety consisting of thiophene, a 1,2,4-oxadiazole and a phenyl ring fitting into the S3 pocket, and compound 33 with a 3-bromo-Phe residue (S2) and a biphenyl fragment (S3) were found to inhibit rhodesain in the single-digit nanomolar range. The observed steep structure-activity relationship could be explained by covalent docking simulations. With their high selectivity indices (ca. 200) and the good antitrypanosomal activity (8μM) the compounds represent promising starting points for new rhodesain inhibitors.

  12. The structure of the cysteine protease and lectin-like domains of Cwp84, a surface layer-associated protein from Clostridium difficile

    SciTech Connect

    Bradshaw, William J.; Kirby, Jonathan M.; Thiyagarajan, Nethaji; Chambers, Christopher J.; Davies, Abigail H.; Roberts, April K.; Shone, Clifford C.; Acharya, K. Ravi

    2014-07-01

    The crystal structure of Cwp84, an S-layer protein from Clostridium difficile is presented for the first time. The cathepsin L-like fold of cysteine protease domain, a newly observed ‘lectin-like’ domain and several other features are described. Clostridium difficile is a major problem as an aetiological agent for antibiotic-associated diarrhoea. The mechanism by which the bacterium colonizes the gut during infection is poorly understood, but undoubtedly involves a myriad of components present on the bacterial surface. The mechanism of C. difficile surface-layer (S-layer) biogenesis is also largely unknown but involves the post-translational cleavage of a single polypeptide (surface-layer protein A; SlpA) into low- and high-molecular-weight subunits by Cwp84, a surface-located cysteine protease. Here, the first crystal structure of the surface protein Cwp84 is described at 1.4 Å resolution and the key structural components are identified. The truncated Cwp84 active-site mutant (amino-acid residues 33–497; C116A) exhibits three regions: a cleavable propeptide and a cysteine protease domain which exhibits a cathepsin L-like fold followed by a newly identified putative carbohydrate-binding domain with a bound calcium ion, which is referred to here as a lectin-like domain. This study thus provides the first structural insights into Cwp84 and a strong base to elucidate its role in the C. difficile S-layer maturation mechanism.

  13. Characterization of cell surface polypeptides of unfertilized, fertilized, and protease-treated zona-free mouse eggs

    SciTech Connect

    Boldt, J.; Gunter, L.E.; Howe, A.M. )

    1989-05-01

    The polypeptide composition of unfertilized, fertilized, and protease-treated zona-free mouse eggs was evaluated in this study. Zona-free eggs were radioiodinated by an Iodogen-catalyzed reaction. Light microscopic autoradiography of egg sections revealed that labeling was restricted to the cell surface. Labeled eggs were solubilized, and cell surface polypeptides were identified by one-dimensional SDS polyacrylamide gel electrophoresis and autoradiography. The unfertilized egg demonstrated 8-10 peptides that incorporated {sup 125}I, with major bands observed at approximately 145-150, 94, and 23 kilodaltons (kD). Zona-free eggs fertilized in vitro and then radiolabeled demonstrated several new bands in comparison to unfertilized eggs, with a major band appearing at approximately 36 kD. Treatment of radiolabeled unfertilized eggs with either trypsin or chymotrypsin (1 mg/ml for 5-20 min) caused enzyme-specific modifications in labeled polypeptides. Trypsin (T) treatment resulted in time-dependant modification of the three major peptides at 145-150, 94, and 23 kD. Chymotrypsin (CT) treatment, in contrast, was associated with loss or modification of the 94 kD band, with no apparent effect on either the 145-150 or 23 kD band. Taken together with previous data indicating that T or CT egg treatment interferes with sperm-egg attachment and fusion, these results suggest a possible role for the 94 kD protein in sperm-egg interaction.

  14. The Prc and RseP proteases control bacterial cell-surface signalling activity.

    PubMed

    Bastiaansen, Karlijn C; Ibañez, Aurelia; Ramos, Juan L; Bitter, Wilbert; Llamas, María A

    2014-08-01

    Extracytoplasmic function (ECF) sigma factors play a key role in the regulation of vital functions in the bacterial response to the environment. In Gram-negative bacteria, activity of these sigma factors is often controlled by cell-surface signalling (CSS), a regulatory system that also involves an outer membrane receptor and a transmembrane anti-sigma factor. To get more insight into the molecular mechanism behind CSS regulation, we have focused on the unique Iut system of Pseudomonas putida. This system contains a hybrid protein containing both a cytoplasmic ECF sigma domain and a periplasmic anti-sigma domain, apparently leading to a permanent interaction between the sigma and anti-sigma factor. We show that the Iut ECF sigma factor regulates the response to aerobactin under iron deficiency conditions and is activated by a proteolytic pathway that involves the sequential action of two proteases: Prc, which removes the periplasmic anti-sigma domain, and RseP, which subsequently removes the transmembrane domain and thereby generates the ECF active transcriptional form. We furthermore demonstrate the role of these proteases in the regulation of classical CSS systems in which the sigma and anti-sigma factors are two different proteins.

  15. Structure-activity relationships for a class of selective inhibitors of the major cysteine protease from Trypanosoma cruzi.

    PubMed

    Guido, Rafael V C; Trossini, Gustavo H G; Castilho, Marcelo S; Oliva, Glaucius; Ferreira, Elizabeth I; Andricopulo, Adriano D

    2008-12-01

    Chagas' disease is a parasitic infection widely distributed throughout Latin America, with devastating consequences in terms of human morbidity and mortality. Cruzain, the major cysteine protease from Trypanosoma cruzi, is an attractive target for antitrypanosomal chemotherapy. In the present work, classical two-dimensional quantitative structure-activity relationships (2D QSAR) and hologram QSAR (HQSAR) studies were performed on a training set of 45 thiosemicarbazone and semicarbazone derivatives as inhibitors of T. cruzi cruzain. Significant statistical models (HQSAR, q(2) = 0.75 and r(2) = 0.96; classical QSAR, q(2) = 0.72 and r(2) = 0.83) were obtained, indicating their consistency for untested compounds. The models were then used to evaluate an external test set containing 10 compounds which were not included in the training set, and the predicted values were in good agreement with the experimental results (HQSAR, r(2)(pred) = 0.95; classical QSAR, r(2)(pred) = 0.91), indicating the existence of complementary between the two ligand-based drug design techniques.

  16. Two variants of the major serine protease inhibitor from the sea anemone Stichodactyla helianthus, expressed in Pichia pastoris.

    PubMed

    García-Fernández, Rossana; Ziegelmüller, Patrick; González, Lidice; Mansur, Manuel; Machado, Yoan; Redecke, Lars; Hahn, Ulrich; Betzel, Christian; Chávez, María de Los Ángeles

    2016-07-01

    The major protease inhibitor from the sea anemone Stichodactyla helianthus (ShPI-1) is a non-specific inhibitor that binds trypsin and other trypsin-like enzymes, as well as chymotrypsin, and human neutrophil elastase. We performed site-directed mutagenesis of ShPI-1 to produce two variants (rShPI-1/K13L and rShPI/Y15S) that were expressed in Pichia pastoris, purified, and characterized. After a single purification step, 65 mg and 15 mg of protein per liter of culture supernatant were obtained for rShPI-1/K13L and rShPI/Y15S, respectively. Functional studies demonstrated a 100-fold decreased trypsin inhibitory activity as result of the K13L substitution at the reactive (P1) site. This protein variant has a novel tight-binding inhibitor activity of pancreatic elastase and increased activity toward neutrophil elastase in comparison to rShPI-1A. In contrast, the substitution Y15S at P2' site did not affect the Ki value against trypsin, but did reduce activity 10-fold against chymotrypsin and neutrophil elastase. Our results provide two new ShPI-1 variants with modified inhibitory activities, one of them with increased biomedical potential. This study also offers new insight into the functional impact of the P1 and P2' sites on ShPI-1 specificity.

  17. Streptococcus pneumoniae serine protease HtrA, but not SFP or PrtA, is a major virulence factor in pneumonia.

    PubMed

    de Stoppelaar, Sacha F; Bootsma, Hester J; Zomer, Aldert; Roelofs, Joris J T H; Hermans, Peter W M; van 't Veer, Cornelis; van der Poll, Tom

    2013-01-01

    Streptococcus (S.) pneumoniae is a common causative pathogen in pneumonia. Serine protease orthologs expressed by a variety of bacteria have been found of importance for virulence. Previous studies have identified two serine proteases in S. pneumoniae, HtrA (high-temperature requirement A) and PrtA (cell wall-associated serine protease A), that contributed to virulence in models of pneumonia and intraperitoneal infection respectively. We here sought to identify additional S. pneumoniae serine proteases and determine their role in virulence. The S. pneumoniae D39 genome contains five putative serine proteases, of which HtrA, Subtilase Family Protein (SFP) and PrtA were selected for insertional mutagenesis because they are predicted to be secreted and surface exposed. Mutant D39 strains lacking serine proteases were constructed by in-frame insertion deletion mutagenesis. Pneumonia was induced by intranasal infection of mice with wild-type or mutant D39. After high dose infection, only D39ΔhtrA showed reduced virulence, as reflected by strongly reduced bacterial loads, diminished dissemination and decreased lung inflammation. D39ΔprtA induced significantly less lung inflammation together with smaller infiltrated lung surface, but without influencing bacterial loads. After low dose infection, D39ΔhtrA again showed strongly reduced bacterial loads; notably, pneumococcal burdens were also modestly lower in lungs after infection with D39Δsfp. These data confirm the important role for HtrA in S. pneumoniae virulence. PrtA contributes to lung damage in high dose pneumonia; it does not however contribute to bacterial outgrowth in pneumococcal pneumonia. SFP may facilitate S. pneumoniae growth after low dose infection.

  18. Improving the performance of industrial ethanol-producing yeast by expressing the aspartyl protease on the cell surface.

    PubMed

    Guo, Zhong-peng; Zhang, Liang; Ding, Zhong-yang; Wang, Zheng-Xiang; Shi, Gui-Yang

    2010-12-01

    The yeasts used in fuel ethanol manufacture are unable to metabolize soluble proteins. The PEP4 gene, encoding a vacuolar aspartyl protease in Saccharomyces cerevisiae, was either secretively or cell-surface anchored expressed in industrial ethanol-producing S. cerevisiae. The obtained recombinant strains APA (expressing the protease secretively) and APB (expressing the protease on the cell wall) were studied under ethanol fermentation conditions in feed barley cultures. The effects of expression of the protease on product formation, growth and cell protein content were measured. The biomass yield of the wild-type was clearly lower than that of the recombinant strains (0.578 ± 0.12 g biomass/g glucose for APA and 0.582 ± 0.08 g biomass/g glucose for APB). In addition, nearly 98-99% of the theoretical maximum level of ethanol yield was achieved (relative to the amount of substrate consumed) for the recombinant strains, while limiting the nitrogen source resulted in dissatisfactory fermentation for the wild-type and more than 30 g/l residual sugar was detected at the end of fermentation. In addition, higher growth rate, viability and lower yields of byproducts such as glycerol and pyruvic acid for recombinant strains were observed. Expressing acid protease can be expected to lead to a significant increase in ethanol productivity.

  19. Effect of exchange of amino acid residues of the surface region of the PST-01 protease on its organic solvent-stability.

    PubMed

    Ogino, Hiroyasu; Uchiho, Takeshi; Doukyu, Noriyuki; Yasuda, Masahiro; Ishimi, Kosaku; Ishikawa, Haruo

    2007-07-13

    The PST-01 protease from an organic solvent tolerant Pseudomonas aeruginosa has high stability and activity in the presence of various organic solvents. The structure gene of the PST-01 protease was amplified by the error-prone PCR method. The mutated proteases were incubated in the presence of acetonitrile. By measuring remaining activities, two kinds of mutated PST-01 proteases of which the stabilities were changed were selected. These mutations hardly changed the profile of the activity and stability at various pHs. Their activity and stability at higher temperatures were slightly lower than those of the wild-type PST-01 protease. The stabilities of the mutated enzymes in the presence of various organic solvents were greatly reduced. In both the mutated PST-01 proteases, amino acids located at the surface of the enzyme had been substituted.

  20. Restricting detergent protease action to surface of protein fibres by chemical modification.

    PubMed

    Schroeder, M; Lenting, H B M; Kandelbauer, A; Silva, C J S M; Cavaco-Paulo, A; Gübitz, G M

    2006-10-01

    Due to their excellent properties, such as thermostability, activity over a broad range of pH and efficient stain removal, proteases from Bacillus sp. are commonly used in the textile industry including industrial processes and laundry and represent one of the most important groups of enzymes. However, due to the action of proteases, severe damage on natural protein fibres such as silk and wool result after washing with detergents containing proteases. To include the benefits of proteases in a wool fibre friendly detergent formulation, the soluble polymer polyethylene glycol (PEG) was covalently attached to a protease from Bacillus licheniformis. In contrast to activation of PEG with cyanuric chloride (50%) activation with 1,1'-carbonyldiimidazole (CDI) lead to activity recovery above 90%. With these modified enzymes, hydrolytic attack on wool fibres could be successfully prevented up to 95% compared to the native enzymes. Colour difference (DeltaE) measured in the three dimensional colour space showed good stain removal properties for the modified enzymes. Furthermore, half-life of the modified enzymes in buffers and commercial detergents solutions was nearly twice as high as those of the non-modified enzymes with values of up to 63 min. Out of the different modified proteases especially the B. licheniformis protease with the 2.0-kDa polymer attached both retained stain removal properties and did not hydrolyse/damage wool fibres.

  1. Optimization of the production of shrimp waste protein hydrolysate using microbial proteases adopting response surface methodology.

    PubMed

    Dey, Satya S; Dora, Krushna Chandra

    2014-01-01

    Protein hydrolysates were produced from shrimp waste mainly comprising head and shell of Penaeus monodon by enzymatic hydrolysis for 90 min using four microbial proteases (Alcalase, Neutrase, Protamex, Flavourzyme) where PR(%) and DH (%) of respective enzymes were compared to select best of the lot. Alcalase, which showed the best result, was used to optimize hydrolysis conditions for shrimp waste hydrolysis by response surface methodology using a central composite design. A model equation was proposed to determine effects of temperature, pH, enzyme/substrate ratio and time on DH where optimum values found to be 59.37 °C, 8.25, 1.84% and 84.42 min. for maximum degree of hydrolysis 33.13% respectively. The model showed a good fit in experimental data because 92.13% of the variability within the range of values studied could be explained by it. The protein hydrolysate obtained contained high protein content (72.3%) and amino acid (529.93 mg/gm) of which essential amino acid and flavour amino acid were was 54.67-55.93% and 39.27-38.32% respectively. Protein efficiency ratio (PER) (2.99) and chemical score (1.05) of hydrolysate was suitable enough to recommend as a functional food additive.

  2. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.

    2016-01-01

    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  3. The stromal cell-surface protease fibroblast activation protein-α localizes to lipid rafts and is recruited to invadopodia.

    PubMed

    Knopf, Julia D; Tholen, Stefan; Koczorowska, Maria M; De Wever, Olivier; Biniossek, Martin L; Schilling, Oliver

    2015-10-01

    Fibroblast activation protein alpha (FAPα) is a cell surface protease expressed by cancer-associated fibroblasts in the microenvironment of most solid tumors. As there is increasing evidence for proteases having non-catalytic functions, we determined the FAPα interactome in cancer-associated fibroblasts using the quantitative immunoprecipitation combined with knockdown (QUICK) method. Complex formation with adenosin deaminase, erlin-2, stomatin, prohibitin, Thy-1 membrane glycoprotein, and caveolin-1 was further validated by immunoblotting. Co-immunoprecipitation (co-IP) of the known stoichiometric FAPα binding partner dipeptidyl-peptidase IV (DPPIV) corroborated the proteomic strategy. Reverse co-IPs validated the FAPα interaction with caveolin-1, erlin-2, and stomatin while co-IP upon RNA-interference mediated knock-down of DPPIV excluded adenosin deaminase as a direct FAPα interaction partner. Many newly identified FAPα interaction partners localize to lipid rafts, including caveolin-1, a widely-used marker for lipid raft localization. We hypothesized that this indicates a recruitment of FAPα to lipid raft structures. In density gradient centrifugation, FAPα co-fractionates with caveolin-1. Immunofluorescence optical sectioning microscopy of FAPα and lipid raft markers further corroborates recruitment of FAPα to lipid rafts and invadopodia. FAPα is therefore an integral component of stromal lipid rafts in solid tumors. In essence, we provide one of the first interactome analyses of a cell surface protease and translate these results into novel biological aspects of a marker protein for cancer-associated fibroblasts.

  4. Contemporaneous Production of Amylase and Protease through CCD Response Surface Methodology by Newly Isolated Bacillus megaterium Strain B69

    PubMed Central

    Saxena, Rajshree

    2014-01-01

    The enormous increase in world population has resulted in generation of million tons of agricultural wastes. Biotechnological process for production of green chemicals, namely, enzymes, provides the best utilization of these otherwise unutilized wastes. The present study elaborates concomitant production of protease and amylase in solid state fermentation (SSF) by a newly isolated Bacillus megaterium B69, using agroindustrial wastes. Two-level statistical model employing Plackett-Burman and response surface methodology was designed for optimization of various physicochemical conditions affecting the production of two enzymes concomitantly. The studies revealed that the new strain concomitantly produced 1242 U/g of protease and 1666.6 U/g of amylase by best utilizing mustard oilseed cake as the substrate at 20% substrate concentration and 45% moisture content after 84 h of incubation. An increase of 2.95- and 2.04-fold from basal media was observed in protease and amylase production, respectively. ANOVA of both the design models showed high accuracy of the polynomial model with significant similarities between the predicted and the observed results. The model stood accurate at the bench level validation, suggesting that the design model could be used for multienzyme production at mass scale. PMID:25478211

  5. Biodegradation of shrimp biowaste by marine Exiguobacterium sp. CFR26M and concomitant production of extracellular protease and antioxidant materials: production and process optimization by response surface methodology.

    PubMed

    Anil Kumar, P K; Suresh, P V

    2014-04-01

    Twelve marine bacterial cultures were screened for extracellular protease activity, and the bacterium CFR26M which exhibited the highest activity on caseinate agar plate was identified as an Exiguobacterium sp. Significant amount of extracellular protease (5.9 ± 0.3 U/ml) and antioxidant materials, measured as 2,2'-diphenyl picrylhydrazyl (DPPH) radical scavenging activity (44.4 ± 0.5 %), was produced by CFR26M in submerged fermentation using a shrimp biowaste medium. Response surface methodology (RSM) was employed to optimize the process variables for maximum production of protease and antioxidant materials by CFR26M. Among the seven variables screened by two-level 2**(7-2) fractional factorial design, the concentration of shrimp biowaste, sugar, and phosphate was found to be significant (p ≤ 0.05). The optimum levels of these variables were determined by employing the central composite design (CCD) of RSM. The coefficient of determination (R (2)) values of 0.9039 and 0.8924 for protease and antioxidant, respectively, indicates the accuracy of the CCD models. The optimum levels of shrimp biowaste, sugar, and phosphate were 21.2, 10.5, and 2.3 % (w/v) for production of protease and 28.8, 12, and 0.32 % (w/v) for production of antioxidant material, respectively. The concentration of shrimp biowaste, sugar, and phosphate had linear and quadratic effect on both protease and antioxidant productions. RSM optimization yielded 6.3-fold increases in protease activity and 1.6-fold in antioxidant material production. The crude protease of CFR26M had a maximum activity at 32 ± 2 °C with pH 7.6. This is the first report on the use of marine Exiguobacterium sp. for concomitant production of protease and antioxidant materials from shrimp biowaste.

  6. Vacuolar Serine Protease Is a Major Allergen of Fusarium proliferatum and an IgE-Cross Reactive Pan-Fungal Allergen

    PubMed Central

    Yeh, Chang-Ching; Tai, Hsiao-Yun; Chou, Hong; Wu, Keh-Gong

    2016-01-01

    Purpose Fusarium species are among prevalent airborne fungi and causative agents of human respiratory atopic disorders. We previously identified a 36.5-kDa F. proliferatum component recognized by IgE antibodies in 9 (53%) of the 17 F. proliferatum-sensitized atopic serum samples. The purpose of this study is to characterize the 36.5-kDa allergen of F. proliferatum. Methods Characterization of allergens and determination of IgE cross-reactivity were performed by cDNA cloning/expression and immunoblot inhibition studies. Results Based on the finding that the 36.5-kDa IgE-binding component reacted with the mouse monoclonal antibody FUM20 against fungal vacuolar serine protease allergens, the cDNA of F. proliferatum vacuolar serine protease (Fus p 9.0101) was subsequently cloned. Nine serum samples from respiratory atopic patients with IgE binding to the vacuolar serine protease allergen of Penicillium chrysogenum (Pen ch 18) also showed IgE-immunoblot reactivity to rFus p 9.0101. The purified rFus p 9.0101 can inhibit IgE and FUM20 binding to the 36.5-kDa component of F. proliferatum. Thus, a novel and important Fus p 9.0101 was identified. The rPen ch 18 can inhibit IgE binding to Fus p 9.0101. It indicates that IgE cross-reactivity between Fus p 9.0101 and Pen ch 18 also exists. Furthermore, neither rFus p 9.0101 K88A nor rPen ch 18 K89A mutants inhibited IgE binding to rFus p 9.0101. Lys88 was considered a critical core amino acid in IgE binding to r Fus p 9.0101 and a residue responsible for IgE cross-reactivity between Fus p 9.0101 and Pen ch 18 allergens. Conclusions Results obtained from this study indicate that vacuolar serine protease may be a major allergen of F. proliferatum and an important IgE cross-reactive pan-fungal allergen, and provide important bases for clinical diagnosis of fungal allergy. PMID:27334782

  7. Optimization of protease production from surface-modified coffee pulp waste and corncobs using Bacillus sp. by SSF.

    PubMed

    Kandasamy, Selvam; Muthusamy, Govarthanan; Balakrishnan, Senthilkumar; Duraisamy, Senbagam; Thangasamy, Selvankumar; Seralathan, Kamala-Kannan; Chinnappan, Sudhakar

    2016-12-01

    The aim of the study was to identify new sources of substrate from agro-industrial waste for protease production using Bacillus sp., a local bacteria isolated from an agro-waste dumping site. The strain was identified as Bacillus sp. BT MASC 3 by 16S rRNA sequence followed by phylogenic analysis. Response surface methodology-based Box-Behnken design (BBD) was used to optimize the variables such as pH, incubation time, coffee pulp waste (CPW) and corncob (CC) substrate concentration. The BBD design showed a reasonable adjustment of the quadratic model with the experimental data. Statistics-based contour and 3-D plots were generated to evaluate the changes in the response surface and understand the relationship between the culture conditions and the enzyme yield. The maximum yield of protease production (920 U/mL) was achieved after 60 h of incubation with 3.0 g/L of CPW and 2.0 g/L of CC at pH 8 and temperature 37 °C in this study. The molecular mass of the purified enzyme was 46 kDa. The highest activity was obtained at 50 °C and pH 9 for the purified enzymes.

  8. The Folding Free Energy Surface of HIV-1 Protease: Insights into the Thermodynamic Basis for Resistance to Inhibitors

    PubMed Central

    Noel, Amanda F.; Bilsel, Osman; Kundu, Agnita; Wu, Ying; Zitzewitz, Jill A.; Matthews, C. Robert

    2009-01-01

    Spontaneous mutations at numerous sites distant from the active site of HIV-1 protease enable resistance to inhibitors while retaining enzymatic activity. As a benchmark for probing the effects of these mutations on the conformational adaptability of this dimeric β-barrel protein, the folding free energy surface of a pseudo wild-type variant, HIV-PR*, was determined by a combination of equilibrium and kinetic experiments on the urea-induced unfolding/refolding reactions. The equilibrium unfolding reaction was well-described by a two-state model involving only the native dimeric form and the unfolded monomer. The global analysis of the kinetic folding mechanism reveals the presence of a fully-folded monomeric intermediate that associates to form the native dimeric structure. Independent analysis of a stable monomeric version of the protease demonstrated that a small amplitude fluorescence phase in refolding and unfolding, not included in the global analysis of the dimeric protein, reflects the presence of a transient intermediate in the monomer folding reaction. The partially-folded and fully-folded monomers are only marginally stable with respect to the unfolded state, and the dimerization reaction provides a modest driving force at micromolar concentrations of protein. The thermodynamic properties of this system are such that mutations can readily shift the equilibrium from the dimeric native state towards weakly-folded states that have a lower affinity for inhibitors, but that could be induced to bind to their target proteolytic sites. Presumably, subsequent secondary mutations increase the stability of the native dimeric state in these variants and, thereby, optimize the catalytic properties of the resistant HIV-1 protease. PMID:19150359

  9. Control of Entamoeba histolytica adherence involves metallosurface protease 1, an M8 family surface metalloprotease with homology to leishmanolysin.

    PubMed

    Teixeira, Jose E; Sateriale, Adam; Bessoff, Kovi E; Huston, Christopher D

    2012-06-01

    Invasive amebiasis due to Entamoeba histolytica infection is an important cause of morbidity in developing countries. The E. histolytica genome contains two homologues to the metalloprotease leishmanolysin gene, Entamoeba histolytica MSP-1 (EhMSP-1) and EhMSP-2, while the commensal ameba Entamoeba dispar has lost EhMSP-1. In this study, we sought to characterize E. histolytica metallosurface protease 1 (EhMSP-1). Using immunoprecipitation and a model substrate, we found that EhMSP-1 was a functional metalloprotease. Confocal microscopy and flow cytometry revealed that EhMSP-1 localized to the cell surface and revealed the existence of distinct, nonclonal trophozoite populations with high and low EhMSP-1 surface abundance that became synchronized following serum starvation. Phenotypic assays were performed after silencing EhMSP-1. Adherence of EhMSP-1-deficient trophozoites to tissue culture cell monolayers was more than five times greater than that of control amebas, but surface staining of several antigens, including the galactose adherence lectin, was unchanged. EhMSP-1 silencing similarly increased adherence to both viable and apoptotic Jurkat lymphocytes. Tissue culture cell monolayer destruction was reduced by EhMSP-1 silencing, although it was blocked almost completely by inhibiting cysteine proteases. Consistent with a primary defect in regulation of amebic adherence, EhMSP-1 silencing also resulted in reduced mobility on tissue culture cell monolayers and in increased phagocytosis. In conclusion, EhMSP-1 was shown to be a surface metalloprotease involved in regulation of amebic adherence, with additional effects on cell motility, cell monolayer destruction, and phagocytosis.

  10. Invited review: Breaking barriers--attack on innate immune defences by omptin surface proteases of enterobacterial pathogens.

    PubMed

    Haiko, Johanna; Suomalainen, Marjo; Ojala, Teija; Lähteenmäki, Kaarina; Korhonen, Timo K

    2009-04-01

    The omptin family of Gram-negative bacterial transmembrane aspartic proteases comprises surface proteins with a highly conserved beta-barrel fold but differing biological functions. The omptins OmpT of Escherichia coli, PgtE of Salmonella enterica, and Pla of Yersinia pestis differ in their substrate specificity as well as in control of their expression. Their functional differences are in accordance with the differing pathogenesis of the infections caused by E. coli, Salmonella, and Y. pestis, which suggests that the omptins have adapted to the life-styles of their host species. The omptins Pla and PgtE attack on innate immunity by affecting the plasminogen/plasmin, complement, coagulation, fibrinolysis, and matrix metalloproteinase systems, by inactivating antimicrobial peptides, and by enhancing bacterial adhesiveness and invasiveness. Although the mechanistic details of the functions of Pla and PgtE differ, the outcome is the same: enhanced spread and multiplication of Y. pestis and S. enterica in the host. The omptin OmpT is basically a housekeeping protease but it also degrades cationic antimicrobial peptides and may enhance colonization of E. coli at uroepithelia. The catalytic residues in the omptin molecules are spatially conserved, and the differing polypeptide substrate specificities are dictated by minor sequence variations at regions surrounding the catalytic cleft. For enzymatic activity, omptins require association with lipopolysaccharide on the outer membrane. Modification of lipopolysaccharide by in vivo conditions or by bacterial gene loss has an impact on omptin function. Creation of bacterial surface proteolysis is thus a coordinated function involving several surface structures.

  11. Surface Vulnerability of Cerebral Cortex to Major Depressive Disorder

    PubMed Central

    Li, Gang; Fralick, Drew; Shen, Ting; Qiu, Meihui; Liu, Jun; Jiang, Kaida; Shen, Dinggang; Fang, Yiru

    2015-01-01

    Major depressive disorder (MDD) is accompanied by atypical brain structure. This study first presents the alterations in the cortical surface of patients with MDD using multidimensional structural patterns that reflect different neurodevelopment. Sixteen first-episode, untreated patients with MDD and 16 matched healthy controls underwent a magnetic resonance imaging (MRI) scan. The cortical maps of thickness, surface area, and gyrification were examined using the surface-based morphometry (SBM) approach. Increase of cortical thickness was observed in the right posterior cingulate region and the parietal cortex involving the bilateral inferior, left superior parietal and right paracentral regions, while decreased thickness was noted in the parietal cortex including bilateral pars opercularis and left precentral region, as well as the left rostral-middle frontal regions in patients with MDD. Likewise, increased or decreased surface area was found in five sub-regions of the cingulate gyrus, parietal and frontal cortices (e.g., bilateral inferior parietal and superior frontal regions). In addition, MDD patients exhibited a significant hypergyrification in the right precentral and supramarginal region. This integrated structural assessment of cortical surface suggests that MDD patients have cortical alterations of the frontal, parietal and cingulate regions, indicating a vulnerability to MDD during earlier neurodevelopmental process. PMID:25793287

  12. The role of electrostatic interactions in protease surface diffusion and the consequence for interfacial biocatalysis.

    PubMed

    Feller, Bob E; Kellis, James T; Cascão-Pereira, Luis G; Robertson, Channing R; Frank, Curtis W

    2010-12-21

    This study examines the influence of electrostatic interactions on enzyme surface diffusion and the contribution of diffusion to interfacial biocatalysis. Surface diffusion, adsorption, and reaction were investigated on an immobilized bovine serum albumin (BSA) multilayer substrate over a range of solution ionic strength values. Interfacial charge of the enzyme and substrate surface was maintained by performing the measurements at a fixed pH; therefore, electrostatic interactions were manipulated by changing the ionic strength. The interfacial processes were investigated using a combination of techniques: fluorescence recovery after photobleaching, surface plasmon resonance, and surface plasmon fluorescence spectroscopy. We used an enzyme charge ladder with a net charge ranging from -2 to +4 with respect to the parent to systematically probe the contribution of electrostatics in interfacial enzyme biocatalysis on a charged substrate. The correlation between reaction rate and adsorption was determined for each charge variant within the ladder, each of which displayed a maximum rate at an intermediate surface concentration. Both the maximum reaction rate and adsorption value at which this maximum rate occurs increased in magnitude for the more positive variants. In addition, the specific enzyme activity increased as the level of adsorption decreased, and for the lowest adsorption values, the specific enzyme activity was enhanced compared to the trend at higher surface concentrations. At a fixed level of adsorption, the specific enzyme activity increased with positive enzyme charge; however, this effect offers diminishing returns as the enzyme becomes more highly charged. We examined the effect of electrostatic interactions on surface diffusion. As the binding affinity was reduced by increasing the solution ionic strength, thus weakening electrostatic interaction, the rate of surface diffusion increased considerably. The enhancement in specific activity achieved at

  13. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  14. Identifying binding hot spots on protein surfaces by mixed-solvent molecular dynamics: HIV-1 protease as a test case.

    PubMed

    Ung, Peter M U; Ghanakota, Phani; Graham, Sarah E; Lexa, Katrina W; Carlson, Heather A

    2016-01-01

    Mixed-solvent molecular dynamics (MixMD) simulations use full protein flexibility and competition between water and small organic probes to achieve accurate hot-spot mapping on protein surfaces. In this study, we improved MixMD using human immunodeficiency virus type-1 protease (HIVp) as the test case. We used three probe-water solutions (acetonitrile-water, isopropanol-water, and pyrimidine-water), first at 50% w/w concentration and later at 5% v/v. Paradoxically, better mapping was achieved by using fewer probes; 5% simulations gave a superior signal-to-noise ratio and far fewer spurious hot spots than 50% MixMD. Furthermore, very intense and well-defined probe occupancies were observed in the catalytic site and potential allosteric sites that have been confirmed experimentally. The Eye site, an allosteric site underneath the flap of HIVp, has been confirmed by the presence of a 5-nitroindole fragment in a crystal structure. MixMD also mapped two additional hot spots: the Exo site (between the Gly16-Gly17 and Cys67-Gly68 loops) and the Face site (between Glu21-Ala22 and Val84-Ile85 loops). The Exo site was observed to overlap with crystallographic additives such as acetate and dimethyl sulfoxide that are present in different crystal forms of the protein. Analysis of crystal structures of HIVp in different symmetry groups has shown that some surface sites are common interfaces for crystal contacts, which means that they are surfaces that are relatively easy to desolvate and complement with organic molecules. MixMD should identify these sites; in fact, their occupancy values help establish a solid cut-off where "druggable" sites are required to have higher occupancies than the crystal-packing faces.

  15. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  16. Production of a protease inhibitor from edible mushroom Agaricus bisporus and its statistical optimization by response surface methodology.

    PubMed

    Vishvakarma, Reena; Mishra, Abha

    2017-01-31

    The production of a protease inhibitor from Agaricus bisporus through solid state fermentation was studied. The purpose was to produce protease inhibitor from natural, cheap and readily available carbon and nitrogen sources. Solid state fermentation enhanced the mycelia growth and also gave a higher yield of the product. Further, fungal growth and other production parameters were statistically optimized. The specificity of the inhibitor was tested and was effective against trypsin. Screening of significant factors (wheat bran, cyanobacterial biomass, initial pH, temperature, incubation period, and moisture content and inoculum size) was done using Plackett-Burman Design. Central Composite Design was used to determine the optimized values of the significant variables which were found to be temperature (27.5 °C), incubation time (156 hrs.), cyanobacterial biomass (1 g) and moisture content (50%) and gave a statistical yield of 980 PIU/g which was 25.6% higher than experimental yield (780 PIU/g). The inhibitor was purified by ammonium sulphate precipitation and DEAE cellulose chromatography (yield 43.89% and 0.21% respectively) and subjected to Reversed-phase HPLC to validate its identity. Since protease inhibitors act against proteases, finding ample therapeutic roles; the isolated protease inhibitor from A. bisporus can also be a probable medicinal agent after its further characterization.

  17. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  18. The surface latent heat flux anomalies related to major earthquake

    NASA Astrophysics Data System (ADS)

    Jing, Feng; Shen, Xuhui; Kang, Chunli; Xiong, Pan; Hong, Shunying

    2011-12-01

    SLHF (Surface Latent Heat Flux) is an atmospheric parameter, which can describe the heat released by phase changes and dependent on meteorological parameters such as surface temperature, relative humidity, wind speed etc. There is a sharp difference between the ocean surface and the land surface. Recently, many studies related to the SLHF anomalies prior to earthquakes have been developed. It has been shown that the energy exchange enhanced between coastal surface and atmosphere prior to earthquakes can increase the rate of the water-heat exchange, which will lead to an obviously increases in SLHF. In this paper, two earthquakes in 2010 (Haiti earthquake and southwest of Sumatra in Indonesia earthquake) have been analyzed using SLHF data by STD (standard deviation) threshold method. It is shows that the SLHF anomaly may occur in interpolate earthquakes or intraplate earthquakes and coastal earthquakes or island earthquakes. And the SLHF anomalies usually appear 5-6 days prior to an earthquake, then disappear quickly after the event. The process of anomaly evolution to a certain extent reflects a dynamic energy change process about earthquake preparation, that is, weak-strong-weak-disappeared.

  19. Giardia duodenalis Surface Cysteine Proteases Induce Cleavage of the Intestinal Epithelial Cytoskeletal Protein Villin via Myosin Light Chain Kinase

    PubMed Central

    Bhargava, Amol; Cotton, James A.; Dixon, Brent R.; Gedamu, Lashitew; Yates, Robin M.; Buret, Andre G.

    2015-01-01

    Giardia duodenalis infections are among the most common causes of waterborne diarrhoeal disease worldwide. At the height of infection, G. duodenalis trophozoites induce multiple pathophysiological processes within intestinal epithelial cells that contribute to the development of diarrhoeal disease. To date, our understanding of pathophysiological processes in giardiasis remains incompletely understood. The present study reveals a previously unappreciated role for G. duodenalis cathepsin cysteine proteases in intestinal epithelial pathophysiological processes that occur during giardiasis. Experiments first established that Giardia trophozoites indeed produce cathepsin B and L in strain-dependent fashion. Co-incubation of G. duodenalis with human enterocytes enhanced cathepsin production by Assemblage A (NF and S2 isolates) trophozoites, but not when epithelial cells were exposed to Assemblage B (GSM isolate) trophozoites. Direct contact between G. duodenalis parasites and human intestinal epithelial monolayers resulted in the degradation and redistribution of the intestinal epithelial cytoskeletal protein villin; these effects were abolished when parasite cathepsin cysteine proteases were inhibited. Interestingly, inhibition of parasite proteases did not prevent degradation of the intestinal tight junction-associated protein zonula occludens 1 (ZO-1), suggesting that G. duodenalis induces multiple pathophysiological processes within intestinal epithelial cells. Finally, this study demonstrates that G. duodenalis-mediated disruption of villin is, at least, in part dependent on activation of myosin light chain kinase (MLCK). Taken together, this study indicates a novel role for parasite cathepsin cysteine proteases in the pathophysiology of G. duodenalis infections. PMID:26334299

  20. Giardia duodenalis Surface Cysteine Proteases Induce Cleavage of the Intestinal Epithelial Cytoskeletal Protein Villin via Myosin Light Chain Kinase.

    PubMed

    Bhargava, Amol; Cotton, James A; Dixon, Brent R; Gedamu, Lashitew; Yates, Robin M; Buret, Andre G

    2015-01-01

    Giardia duodenalis infections are among the most common causes of waterborne diarrhoeal disease worldwide. At the height of infection, G. duodenalis trophozoites induce multiple pathophysiological processes within intestinal epithelial cells that contribute to the development of diarrhoeal disease. To date, our understanding of pathophysiological processes in giardiasis remains incompletely understood. The present study reveals a previously unappreciated role for G. duodenalis cathepsin cysteine proteases in intestinal epithelial pathophysiological processes that occur during giardiasis. Experiments first established that Giardia trophozoites indeed produce cathepsin B and L in strain-dependent fashion. Co-incubation of G. duodenalis with human enterocytes enhanced cathepsin production by Assemblage A (NF and S2 isolates) trophozoites, but not when epithelial cells were exposed to Assemblage B (GSM isolate) trophozoites. Direct contact between G. duodenalis parasites and human intestinal epithelial monolayers resulted in the degradation and redistribution of the intestinal epithelial cytoskeletal protein villin; these effects were abolished when parasite cathepsin cysteine proteases were inhibited. Interestingly, inhibition of parasite proteases did not prevent degradation of the intestinal tight junction-associated protein zonula occludens 1 (ZO-1), suggesting that G. duodenalis induces multiple pathophysiological processes within intestinal epithelial cells. Finally, this study demonstrates that G. duodenalis-mediated disruption of villin is, at least, in part dependent on activation of myosin light chain kinase (MLCK). Taken together, this study indicates a novel role for parasite cathepsin cysteine proteases in the pathophysiology of G. duodenalis infections.

  1. Anaplasma platys Immunoblot Test Using Major Surface Antigens.

    PubMed

    Lai, Tzung-Huei; Parraga, Maria E; Alvarez, Elizabeth; Rikihisa, Yasuko

    2016-09-01

    Anaplasma platys is an uncultivable tick-borne obligatory intracellular bacterium, which is known to infect platelets of dogs. A. platys causes infectious canine cyclic thrombocytopenia in subtropical and tropical regions throughout the world. Several cases of human infection with A. platys infection have also been reported. However, seroprevalence of A. platys exposure and infection has not been determined in most of the regions, in part, due to lack of a simple and reliable assay method. Furthermore, A. platys antigens recognized by dogs are unknown. We previously sequenced gene encoding A. platys major outer membrane proteins P44 and Omp-1X. In the present study, we obtained purified recombinant A. platys P44 and Omp-1X proteins, and using them as antigens in immunoblotting examined seroreactivity in dogs. Of 34 specimens from Venezuela where A. platys infection was previously reported, 25 specimens (73.5%) reacted to rAplP44 and/or rAplOMP-1X. Neither Anaplasma phagocytophilum-seropositive (N = 10) nor A. phagocytophilum-seronegative canine specimens (N = 10) from the geographic regions where A. platys infection has never been reported, reacted rAplP44 or rAplOMP-1X. The result indicates a high A. platys seroprevalence rate in tested dogs from Venezuela and suggests that the immunoblot analysis based on recombinant A. platys major outer membrane proteins can provide a simple and defined tool to enlighten the prevalence of A. platys infection.

  2. The anti-proliferative effect of TI1B, a major Bowman-Birk isoinhibitor from pea (Pisum sativum L.), on HT29 colon cancer cells is mediated through protease inhibition.

    PubMed

    Clemente, Alfonso; Carmen Marín-Manzano, M; Jiménez, Elisabeth; Carmen Arques, M; Domoney, Claire

    2012-08-01

    Bowman-Birk inhibitors (BBI) from legumes, such as soyabean, pea, lentil and chickpea, are naturally occurring plant protease inhibitors which have potential health-promoting properties within the mammalian gastrointestinal tract. BBI can survive both acidic conditions and the action of proteolytic enzymes within the stomach and small intestine, permitting significant amounts to reach the large intestine in active form to exert their reported anti-carcinogenic and anti-inflammatory properties. In a previous study, we reported the ability of a recombinant form of TI1B (rTI1B), representing a major BBI isoinhibitor from pea, to influence negatively the growth of human colorectal adenocarcinoma HT29 cells in vitro. In the present study, we investigate if this effect is related directly to the intrinsic ability of BBI to inhibit serine proteases. rTI1B and a novel engineered mutant, having amino acid substitutions at the P1 positions in the two inhibitory domains, were expressed in the yeast Pichia pastoris. The rTI1B proved to be active against trypsin and chymotrypsin, showing K i values at nanomolar concentrations, whereas the related mutant protein was inactive against both serine proteases. The proliferation of HT29 colon cancer cells was significantly affected by rTI1B in a dose-dependent manner (IC50 = 31 (sd 7) μm), whereas the inactive mutant did not show any significant effect on colon cancer cell growth. In addition, neither recombinant protein affected the growth of non-malignant colonic fibroblast CCD-18Co cells. These findings suggest that serine proteases should be considered as important targets in investigating the potential chemopreventive role of BBI during the early stages of colorectal carcinogenesis.

  3. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  4. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  5. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  6. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  7. Fibroblast activation protein-alpha and dipeptidyl peptidase IV (CD26): cell-surface proteases that activate cell signaling and are potential targets for cancer therapy.

    PubMed

    Kelly, Thomas

    2005-01-01

    Fibroblast activation protein-alpha (FAP-alpha) and dipeptidyl peptidase IV (DPPIV) are serine proteases with post-prolyl peptidase activities that can modify tumor cell behavior. FAP-alpha and DPPIV can form heteromeric complexes with each other and may function coordinately to modulate the growth, differentiation, adhesion, and metastasis of tumor cells. This review is focused on FAP-alpha and summarizes a series of studies showing that elevated expression of FAP-alpha results in profound changes in growth and malignant behavior of tumor cells. Depending on the model system investigated, FAP-alpha expression causes dramatic promotion or suppression of tumor growth. In the case of tumor promotion, FAP-alpha expression can drive tumor growth by increasing angiogenesis and by decreasing the anti-tumor response of the immune system. In the case of tumor suppression, FAP-alpha can decrease tumorigenicity of mouse melanoma cells and restore contact inhibition and growth factor dependence even when it is catalytically inactive, implying that protein-protein interactions mediate these effects. Understanding how FAP-alpha activates cell signaling is critical to determining how FAP-alpha mediates growth promotion versus growth suppression in the different model systems and ultimately in human cancer patients. In particular, the roles of FAP-alpha protease activity and FAP-alpha complex formation with DPPIV and other surface molecules in activating cell signaling need to be elucidated since these represent potential targets for therapeutic intervention.

  8. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  9. Response Surface Methodology Modelling of an Aqueous Two-Phase System for Purification of Protease from Penicillium candidum (PCA 1/TT031) under Solid State Fermentation and Its Biochemical Characterization

    PubMed Central

    Alhelli, Amaal M.; Abdul Manap, Mohd Yazid; Mohammed, Abdulkarim Sabo; Mirhosseini, Hamed; Suliman, Eilaf; Shad, Zahra; Mohammed, Nameer Khairulla; Meor Hussin, Anis Shobirin

    2016-01-01

    Penicillium candidum (PCA 1/TT031) synthesizes different types of extracellular proteases. The objective of this study is to optimize polyethylene glycol (PEG)/citrate based on an aqueous two-phase system (ATPS) and Response Surface Methodology (RSM) to purify protease from Penicillium candidum (PCA 1/TT031). The effects of different PEG molecular weights (1500–10,000 g/mol), PEG concentration (9%–20%), concentrations of NaCl (0%–10%) and the citrate buffer (8%–16%) on protease were also studied. The best protease purification could be achieved under the conditions of 9.0% (w/w) PEG 8000, 5.2% NaCl, and 15.9% sodium citrate concentration, which resulted in a one-sided protease partitioning for the bottom phase with a partition coefficient of 0.2, a 6.8-fold protease purification factor, and a yield of 93%. The response surface models displayed a significant (p ≤ 0.05) response which was fit for the variables that were studied as well as a high coefficient of determination (R2). Similarly, the predicted and observed values displayed no significant (p > 0.05) differences. In addition, our enzyme characterization study revealed that Penicillium candidum (PCA 1/TT031) produced a slight neutral protease with a molecular weight between 100 and 140 kDa. The optimal activity of the purified enzyme occurred at a pH of 6.0 and at a temperature of 50 °C. The stability between different pH and temperature ranges along with the effect of chemical metal ions and inhibitors were also studied. Our results reveal that the purified enzyme could be used in the dairy industry such as in accelerated cheese ripening. PMID:27845736

  10. Response Surface Methodology Modelling of an Aqueous Two-Phase System for Purification of Protease from Penicillium candidum (PCA 1/TT031) under Solid State Fermentation and Its Biochemical Characterization.

    PubMed

    Alhelli, Amaal M; Abdul Manap, Mohd Yazid; Mohammed, Abdulkarim Sabo; Mirhosseini, Hamed; Suliman, Eilaf; Shad, Zahra; Mohammed, Nameer Khairulla; Meor Hussin, Anis Shobirin

    2016-11-11

    Penicillium candidum (PCA 1/TT031) synthesizes different types of extracellular proteases. The objective of this study is to optimize polyethylene glycol (PEG)/citrate based on an aqueous two-phase system (ATPS) and Response Surface Methodology (RSM) to purify protease from Penicillium candidum (PCA 1/TT031). The effects of different PEG molecular weights (1500-10,000 g/mol), PEG concentration (9%-20%), concentrations of NaCl (0%-10%) and the citrate buffer (8%-16%) on protease were also studied. The best protease purification could be achieved under the conditions of 9.0% (w/w) PEG 8000, 5.2% NaCl, and 15.9% sodium citrate concentration, which resulted in a one-sided protease partitioning for the bottom phase with a partition coefficient of 0.2, a 6.8-fold protease purification factor, and a yield of 93%. The response surface models displayed a significant (p ≤ 0.05) response which was fit for the variables that were studied as well as a high coefficient of determination (R²). Similarly, the predicted and observed values displayed no significant (p > 0.05) differences. In addition, our enzyme characterization study revealed that Penicillium candidum (PCA 1/TT031) produced a slight neutral protease with a molecular weight between 100 and 140 kDa. The optimal activity of the purified enzyme occurred at a pH of 6.0 and at a temperature of 50 °C. The stability between different pH and temperature ranges along with the effect of chemical metal ions and inhibitors were also studied. Our results reveal that the purified enzyme could be used in the dairy industry such as in accelerated cheese ripening.

  11. Membrane proteases in the bacterial protein secretion and quality control pathway.

    PubMed

    Dalbey, Ross E; Wang, Peng; van Dijl, Jan Maarten

    2012-06-01

    Proteolytic cleavage of proteins that are permanently or transiently associated with the cytoplasmic membrane is crucially important for a wide range of essential processes in bacteria. This applies in particular to the secretion of proteins and to membrane protein quality control. Major progress has been made in elucidating the structure-function relationships of many of the responsible membrane proteases, including signal peptidases, signal peptide hydrolases, FtsH, the rhomboid protease GlpG, and the site 1 protease DegS. These enzymes employ very different mechanisms to cleave substrates at the cytoplasmic and extracytoplasmic membrane surfaces or within the plane of the membrane. This review highlights the different ways that bacterial membrane proteases degrade their substrates, with special emphasis on catalytic mechanisms and substrate delivery to the respective active sites.

  12. Activation of pro-matrix metalloproteinase-9 and degradation of gelatin by the surface protease PgtE of Salmonella enterica serovar Typhimurium.

    PubMed

    Ramu, Päivi; Lobo, Leandro Araujo; Kukkonen, Maini; Bjur, Eva; Suomalainen, Marjo; Raukola, Hanna; Miettinen, Minja; Julkunen, Ilkka; Holst, Otto; Rhen, Mikael; Korhonen, Timo K; Lähteenmäki, Kaarina

    2008-04-01

    Mammalian matrix metalloproteinases (MMPs) degrade collagen networks in extracellular matrices by cleaving collagen and its denatured form gelatin, and thus enhance migration of mammalian cells. The gastrointestinal pathogen Salmonella enterica survives and grows within host macrophages and dendritic cells, and can disseminate in the host by travelling within infected host cells. Here, we report that S. enterica serovar Typhimurium activates proMMP-9 (gelatinase B) secreted by human primary macrophages, and degrades gelatin after growth within J774A.1 murine macrophage-like cells. Both proMMP-9 activation and gelatin degradation were due to expression of the Salmonella surface protease PgtE. Following intraperitoneal infection in BALB/c mice, the amount of a pgtE deletion derivative was nearly ten-fold lower in the livers and spleens of mice than the amount of wild-type S. enterica, suggesting that PgtE contributes to dissemination of Salmonella in the host. PgtE belongs to the omptin family of bacterial beta-barrel transmembrane proteases. The ortholog of PgtE in Yersinia pestis, Pla, which is central for bacterial virulence in plague, was poor in proMMP-9 activation and in gelatin degradation. To model the evolution of these activities in the omptin barrel, we performed a substitution analysis in Pla and genetically modified it into a PgtE-like gelatinase. Our results indicate that PgtE and Pla have diverged in substrate specificity, and suggest that Salmonella PgtE has evolved to functionally mimic mammalian MMPs.

  13. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  14. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama, area 7

    USGS Publications Warehouse

    Mooty, W.S.

    1987-01-01

    The geohydrology and susceptibility of the seven major aquifers to surface contamination in Area 7 - Bibb, Dallas, Hale, Perry, and Wilcox Counties, are described. Aquifers in the northern part of the study area are in Paleozoic limestones and dolomite formations. Deposits in the central part of the study area are predominately of Cretaceous age and contain the Coker, Gordo, and Eutaw aquifers. Although the southern part of the study area has many deposits of Tertiary age, the Ripley Formation of Cretaceous age is the major aquifer. Contamination of any of the major aquifers is improbable because the majority of the recharge area for the primary aquifers is woodland, pasture, or farmland. Downdip from their outcrops, the major aquifers in the study area are protected from land surface contamination by relatively impermeable layers of clay and chalk. The aquifers that are highly susceptible to contamination are the ones in the limestone and dolomite formations in northern Bibb County. Sinkholes exist in the recharge area of these formations and could provide a direct link for contaminates from the land surface to the water table. An area northeast of the Selma well field is also highly susceptible to contamination. The Eutaw Formation in this area is overlain by alluvial deposits that could increase recharge to the aquifer by slowing the runoff rate of surface water. (USGS)

  15. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  16. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  17. Mycoplasma hyopneumoniae Surface proteins Mhp385 and Mhp384 bind host cilia and glycosaminoglycans and are endoproteolytically processed by proteases that recognize different cleavage motifs.

    PubMed

    Deutscher, Ania T; Tacchi, Jessica L; Minion, F Chris; Padula, Matthew P; Crossett, Ben; Bogema, Daniel R; Jenkins, Cheryl; Kuit, Tracey A; Walker, Mark J; Djordjevic, Steven P

    2012-03-02

    P97 and P102 paralogues occur as endoproteolytic cleavage fragments on the surface of Mycoplasma hyopneumoniae that bind glycosaminoglycans, plasminogen, and fibronectin and perform essential roles in colonization of ciliated epithelia. We show that the P102 paralogue Mhp384 is efficiently cleaved at an S/T-X-F↓X-D/E-like site, creating P60(384) and P50(384). The P97 paralogue Mhp385 is inefficiently cleaved, with tryptic peptides from a 115 kDa protein (P115(385)) and 88 kDa (P88(385)) and 27 kDa (P27(385)) cleavage fragments identified by LC-MS/MS. This is the first time a preprotein belonging to the P97 and P102 paralogue families has been identified by mass spectrometry. The semitryptic peptide (752)IQFELEPISLNV(763) denotes the C-terminus of P88(385) and defines the novel cleavage site (761)L-N-V↓A-V-S(766) in Mhp385. P115(385), P88(385), P27(385), P60(384), and P50(384) were shown to reside extracellularly, though it is unknown how the fragments remain attached to the cell surface. Heparin- and cilium-binding sites were identified within P60(384), P50(384), and P88(385). No primary function was attributed to P27(385); however, this molecule contains four tandem R1 repeats with similarity to porcine collagen type VI (α3 chain). P97 and P102 paralogue families are adhesins targeted by several proteases with different cleavage efficiencies, and this process generates combinatorial complexity on the surface of M. hyopneumoniae.

  18. The CLIP-Domain Serine Protease Homolog SPCLIP1 Regulates Complement Recruitment to Microbial Surfaces in the Malaria Mosquito Anopheles gambiae

    PubMed Central

    Tan, Lee Aun; Upton, Leanna M.; Osta, Mike A.; Christophides, George K.

    2013-01-01

    The complement C3-like protein TEP1 of the mosquito Anopheles gambiae is required for defense against malaria parasites and bacteria. Two forms of TEP1 are present in the mosquito hemolymph, the full-length TEP1-F and the proteolytically processed TEP1cut that is part of a complex including the leucine-rich repeat proteins LRIM1 and APL1C. Here we show that the non-catalytic serine protease SPCLIP1 is a key regulator of the complement-like pathway. SPCLIP1 is required for accumulation of TEP1 on microbial surfaces, a reaction that leads to lysis of malaria parasites or triggers activation of a cascade culminating with melanization of malaria parasites and bacteria. We also demonstrate that the two forms of TEP1 have distinct roles in the complement-like pathway and provide the first evidence for a complement convertase-like cascade in insects analogous to that in vertebrates. Our findings establish that core principles of complement activation are conserved throughout the evolution of animals. PMID:24039584

  19. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  20. Assessment of trace element accumulation in surface sediments off Chennai coast after a major flood event.

    PubMed

    Gopal, V; Krishnakumar, S; Simon Peter, T; Nethaji, S; Suresh Kumar, K; Jayaprakash, M; Magesh, N S

    2017-01-30

    The present study was conducted to assess the trace element concentration in marine surface sediments after major flood event of Chennai metropolis, India. Thirty surface samples were collected from off Chennai coast. Trace elements, organic matter, CaCO3, sand-silt-clay and C/N ratios were studied to understand the accumulation dynamics on sediments. The elemental concentration, calcium carbonate and OM distribution suggest that they are derived from urban runoff and transported through Adyar and Cooum Rivers. The enrichment factor reveals that the sediments are enriched by Pb, Cu, Zn, Cr, Co, Ni followed by Fe. The observed Igeo value shows that the samples are contaminated by Pb, Cu and Zn. The elemental concentration of the surface sediments is low when compared to other coastal region except Pb. The elevated level of Pb in the surface sediments is probably due to migration of contaminated urban soil from industrial and transportation sectors into marine environment.

  1. Expression of a hydrophilic surface protein in infective stages of Leishmania major.

    PubMed

    Flinn, H M; Rangarajan, D; Smith, D F

    1994-06-01

    A family of differentially expressed genes from Leishmania major contains one sequence (Gene B) that encodes a novel, hydrophilic protein found on the surface of infective parasite stages. The 177-residue, acidic Gene B protein is characterised by an amino acid repetitive element, comprising 45% of the total molecule, that is related to the cell-wall binding domain of protein A from Staphylococcus aureus. No identifiable signal peptide, membrane-spanning domain or consensus for glycosylphosphatidylinositol anchor attachment to the cell surface is found elsewhere in the deduced protein sequence. In vitro, the Gene B protein fractionates with the parasite cell surface glycoconjugates, lipophosphoglycan and the glycoinositolphospholipids. This protein is the first characterised surface peptide marker for infective stages of the Leishmania life cycle.

  2. Group B Streptococcus surface proteins as major determinants for meningeal tropism.

    PubMed

    Tazi, Asmaa; Bellais, Samuel; Tardieux, Isabelle; Dramsi, Shaynoor; Trieu-Cuot, Patrick; Poyart, Claire

    2012-02-01

    Streptococcus agalactiae (group B Streptococcus, GBS), a normal constituent of the intestinal microbiota is the major cause of human neonatal infections and a worldwide spread 'hypervirulent' clone, GBS ST-17, is strongly associated with neonatal meningitis. Adhesion to epithelial and endothelial cells constitutes a key step of the infectious process. Therefore GBS surface-anchored proteins are obvious potential adhesion mediators of barrier crossing and determinant of hypervirulence. This review addresses the most recent molecular insights gained from studies on GBS surface proteins proven to be involved in the crossing of the brain-blood barrier and emphasizes on the specificity of a hypervirulent clone that displays meningeal tropism.

  3. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  4. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; Area 8

    USGS Publications Warehouse

    Scott, J.C.; Cobb, R.H.; Castleberry, R.D.

    1987-01-01

    The U.S. Geological Survey, in cooperation with the Alabama Department of Environmental Management, is conducting a series of geohydrologic studies to delineate the major aquifers and their susceptibility to contamination in Alabama. This report delineates and describes the geohydrology and susceptibility of the major aquifers to contamination in Area 8--Autauga, Chilton, Elmore, Lowndes, and Montgomery Counties. The major aquifers in the study area are the Eutaw, Gordo, and Coker aquifers of Cretaceous age. One or more of these aquifers are sources of public water supply in each of the five counties. The recharge areas for these aquifers are in Autauga, Chilton, Elmore, and Montgomery and Prattville. Maximum groundwater use in the Prattville area is more than 8 mgd (million gallons per day). Estimated maximum groundwater withdrawal for all uses in the study area is about 65 mgd. The potentiometric map of the Gordo aquifer indicates that the Alabama River may serve as a recharging boundary to the Gordo aquifer along the flood plain of the river in the Montgomery-Prattville area. The river also is acting as a recharging boundary to the Eutaw and Coker aquifers, where the potentiometric surfaces in the aquifers have been lowered. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, the areas that are highly susceptible to contamination extend from Jemison to Clanton in Chilton County where the Coker aquifer generally is < 100 ft below land surface, and the flood plains of the Alabama, Coosa, and Tallapoosa Rivers, which are underlain by alluvial deposits that are in hydraulic contact with the major aquifers. Within the highly susceptible areas, the areas especially susceptible to contamination are the flood plain of the Alabama River in the Montgomery area and the flood plain of the Tallapoosa River. Pumpage from the major aquifers in this area has significantly lowered the potentiometric surface in the aquifers

  5. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  6. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 10

    USGS Publications Warehouse

    DeJarnette, S.S.

    1989-01-01

    This report delineates and describes the geohydrology and susceptibility of major aquifers to contamination in Area 10--Choctaw, Clarke, and Washington Counties in southwest Alabama. The major aquifers in the study area are the Nanafalia-Clayton, Lisbon, and Pliocene-Miocene aquifers of Tertiary age. The recharge areas for these aquifers generally coincide with their areas of use. Each aquifer is a source of public water supply in one or more of the three counties. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, large parts of the recharge areas are rural areas that are used for timberlands, farms, and pastures; these areas have low potential for contamination and are several miles from pumping centers. (USGS)

  7. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 6

    USGS Publications Warehouse

    DeJarnette, S.S.; Crownover, J.E.

    1987-01-01

    This report delineates and describes the geohyrology and susceptibility of the major aquifers to contamination in Area 6, Greene, Marengo, Pickens, Sumter, and Tuscaloosa Counties in west-central Alabama. The major aquifers in the study area are the Nanafalia, Eutaw, Gordo, and Coker aquifers of Tertiary and Cretaceous age. The recharge areas for one or more of these aquifers are in each of the five counties. East aquifer is a source of public water supply in one or more of the five counties. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, large parts of the recharge areas are in rural settings that are used for timberlands, farms, and pastures, and are several miles from pumping centers; therefore, these areas are not highly susceptible to contamination. (USGS)

  8. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 12

    USGS Publications Warehouse

    Scott, J.C.; Cobb, R.H.

    1988-01-01

    This report delineates and describes the geohydrology and susceptibility of major aquifers to contamination in Coffee, Dale, Henry, Houston, and Geneva Counties, Alabama. The major aquifers are the Upper Floridan, Lisbon, Nanafalia-Clayton, and Providence-Ripley aquifers. Estimated groundwater withdrawals for public water supplies are about 42 million gal/day. Maximum withdrawals for irrigation are 15 to 20 million gal/day. Withdrawals for self-supplied industrial and domestic uses are estimated to be 3 and 2.5 million gal/day, respectively. Long-term withdrawals of water from the Nanafalia-Clayton aquifer have resulted in significant declines in the potentiometric surface in Coffee, Dale, and Houston Counties. Significant declines in the potentiometric surfaces of the other major aquifers are not apparent. Recharge areas for all major aquifers are susceptible to contamination, but the probability of contamination of the Lisbon, Nanafalia-Clayton, and Providence-Ripley aquifers is low because the recharge areas are remote from areas of withdrawal. The recharge area for the Floridan aquifer, which consists largely of flat, sandy farmland , coincides with the area of use. This area is highly susceptible to contamination from insecticides and herbicides. (USGS)

  9. Generalized immunological recognition of the major merozoite surface antigen (gp195) of Plasmodium falciparum

    SciTech Connect

    Chang, S.P.; Hui, G.S.N.; Kato, A.; Siddiqui, W.A. )

    1989-08-01

    The antibody response to the Plasmodium falciparum major merozoite surface antigen (gp195) of congenic mouse strains differing in H-2 haplotype has been examined. All seven strains of mice were capable of producing gp195-specific antibodies. Generalized immune recognition of gp195 by mice of diverse H-2 haplotypes distinguished gp195 from the P. falciparum circumsporozoite protein and the 230-kDa and 48/45-kDa gamete surface antigens. However, the H-2 genetic locus appeared to influence the specificity of gp105-specific antibodies. Immunoblot patterns of mouse sera with parasite antigens revealed a complex pattern of reactivity with terminal and intermediate processing fragments of gp195. The majority of immunoblot bands observed were similar for all of the mouse strains; however, there were several strains that additionally recognized a few unique fragments or displayed more intense reactivities with specific processing fragments. These results suggest that while individuals of diverse major histocompatibility complex makeup are capable of recognizing the gp195 antigen, the recognition of specific gp195 B-cell and T-cell epitopes may be under control of the major histocompatibility complex.

  10. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  11. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 4

    USGS Publications Warehouse

    Planert, Michael; Pritchett, J.L.

    1989-01-01

    The U.S. Geological Survey, in cooperation with the Alabama Department of Environmental Management, is conducting a series of geohydrologic studies to delineate the major aquifers (those which provide water for public supplies) in Alabama, their recharge areas, and areas susceptible to contamination. This report summarizes these factors for two major aquifers in Area 4--Calhoun, Jefferson, St. Clair, Shelby, and Talladega Counties. The major aquifers in the study area are in Cambrian and Ordovician and Mississippian rocks. Highest yields from aquifers are associated with solution openings in carbonate rocks. Springs in the area provide substantial amounts of water for municipal supply. Coldwater Spring provides 17 million gal of water/day to the city of Anniston, the largest groundwater user in the area. All recharge areas for the aquifers are susceptible to contamination from land surface. Two conditions exist in the study area that may cause the aquifers to be highly susceptible to contamination on a local scale: fracturing of rock materials due to faulting and the production of a porous cherty soil through weathering. Where sinkholes are present, there may be a direct connection between the land surface and the aquifer. Areas with sinkholes are considered to be extremely susceptible to contamination. (USGS)

  12. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  13. Class I major histocompatibility proteins as cell surface receptors for simian virus 40.

    PubMed

    Atwood, W J; Norkin, L C

    1989-10-01

    Class I major histocompatibility complex proteins appear to be the major cell surface receptors for simian virus 40 (SV40), as implied by the following observations. Adsorption of SV40 to LLC-MK2 rhesus monkey kidney cells specifically inhibited binding of a monoclonal antibody (MAb) against class I human lymphocyte antigen (HLA) proteins. Conversely, pretreatment of LLC-MK2 cells with anti-HLA MAbs inhibited infection by SV40. The ability of anti-HLA to inhibit infection was greatly reduced when the order of addition of the anti-HLA and the virus was reversed. Infection was also inhibited by preincubating SV40 with purified soluble class I protein. Finally, human lymphoblastoid cells of the Daudi line, which do not express class I major histocompatibility complex proteins, were infected at relatively low levels with SV40 virions. In a control experiment, we found that pretreatment of cells with a MAb specific for the leukocytic-function-associated antigen LFA-3 actually enhanced infection. This finding may also support the premise that class I major histocompatibility complex proteins are receptors for SV40.

  14. Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens

    SciTech Connect

    Tomavo, S.; Schwarz, R.T.; Dubremetz, J.F. )

    1989-10-01

    The four major surface antigens of Toxoplasma gondii tachyzoites (P43, P35, P30, and P22) were made water soluble by phosphatidylinositol-specific phospholipase C (PI-PLC). These antigens were biosynthetically labeled with {sup 3}H-fatty acids, ({sup 3}H)ethanolamine, and ({sup 3}H)carbohydrates. Treatment of {sup 3}H-fatty-acid-labeled parasite lysates with PI-PLC removed the radioactive label from these antigens. A cross-reacting determinant was exposed on these antigens after PI-PLC treatment.

  15. Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens.

    PubMed Central

    Tomavo, S; Schwarz, R T; Dubremetz, J F

    1989-01-01

    The four major surface antigens of Toxoplasma gondii tachyzoites (P43, P35, P30, and P22) were made water soluble by phosphatidylinositol-specific phospholipase C (PI-PLC). These antigens were biosynthetically labeled with 3H-fatty acids, [3H]ethanolamine, and [3H]carbohydrates. Treatment of 3H-fatty-acid-labeled parasite lysates with PI-PLC removed the radioactive label from these antigens. A cross-reacting determinant was exposed on these antigens after PI-PLC treatment. Images PMID:2531282

  16. Temporal changes of surface wave velocity associated with major Sumatra earthquakes from ambient noise correlation.

    PubMed

    Xu, Zhen J; Song, Xiaodong

    2009-08-25

    Detecting temporal changes of the medium associated with major earthquakes has implications for understanding earthquake genesis. Here we report temporal changes of surface wave velocity over a large area associated with 3 major Sumatra earthquakes in 2004, 2005, and 2007. We use ambient noise correlation to retrieve empirical Green's function (EGF) of surface waves between stations. Because the process is completely repeatable, the technique is powerful in detecting possible temporal change of medium. We find that 1 excellent station pair (PSI in Indonesia and CHTO in Thailand) shows significant time shifts (up to 1.44 s) after the 2004 and 2005 events in the Rayleigh waves at 10-20 s but not in the Love waves, suggesting that the Rayleigh time shifts are not from clock error. The time shifts are frequency dependent with the largest shifts at the period band of 11-16 s. We also observe an unusual excursion approximately 1 month before the 2004 event. We obtain a total of 17 pairs for June, 2007 to June, 2008, which allow us to examine the temporal and spatial variation of the time shifts. We observed strong anomalies (up to 0.68 s) near the epicenter after the 2007 event, but not in the region further away from the source or before the event or 3 months after the event. The observations are interpreted as stress changes and subsequent relaxation in upper-mid crust in the immediate vicinity of the rupture and the broad area near the fault zone.

  17. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  18. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  19. Deep Sequencing of the Trypanosoma cruzi GP63 Surface Proteases Reveals Diversity and Diversifying Selection among Chronic and Congenital Chagas Disease Patients

    PubMed Central

    Llewellyn, Martin S.; Messenger, Louisa A.; Luquetti, Alejandro O.; Garcia, Lineth; Torrico, Faustino; Tavares, Suelene B. N.; Cheaib, Bachar; Derome, Nicolas; Delepine, Marc; Baulard, Céline; Deleuze, Jean-Francois; Sauer, Sascha; Miles, Michael A.

    2015-01-01

    Background Chagas disease results from infection with the diploid protozoan parasite Trypanosoma cruzi. T. cruzi is highly genetically diverse, and multiclonal infections in individual hosts are common, but little studied. In this study, we explore T. cruzi infection multiclonality in the context of age, sex and clinical profile among a cohort of chronic patients, as well as paired congenital cases from Cochabamba, Bolivia and Goias, Brazil using amplicon deep sequencing technology. Methodology/ Principal Findings A 450bp fragment of the trypomastigote TcGP63I surface protease gene was amplified and sequenced across 70 chronic and 22 congenital cases on the Illumina MiSeq platform. In addition, a second, mitochondrial target—ND5—was sequenced across the same cohort of cases. Several million reads were generated, and sequencing read depths were normalized within patient cohorts (Goias chronic, n = 43, Goias congenital n = 2, Bolivia chronic, n = 27; Bolivia congenital, n = 20), Among chronic cases, analyses of variance indicated no clear correlation between intra-host sequence diversity and age, sex or symptoms, while principal coordinate analyses showed no clustering by symptoms between patients. Between congenital pairs, we found evidence for the transmission of multiple sequence types from mother to infant, as well as widespread instances of novel genotypes in infants. Finally, non-synonymous to synonymous (dn:ds) nucleotide substitution ratios among sequences of TcGP63Ia and TcGP63Ib subfamilies within each cohort provided powerful evidence of strong diversifying selection at this locus. Conclusions/Significance Our results shed light on the diversity of parasite DTUs within each patient, as well as the extent to which parasite strains pass between mother and foetus in congenital cases. Although we were unable to find any evidence that parasite diversity accumulates with age in our study cohorts, putative diversifying selection within members of the TcGP63I

  20. Protein structural and surface water rearrangement constitute major events in the earliest aggregation stages of tau

    PubMed Central

    Pavlova, Anna; Cheng, Chi-Yuan; Kinnebrew, Maia; Lew, John; Dahlquist, Frederick W.; Han, Songi

    2016-01-01

    Protein aggregation plays a critical role in the pathogenesis of neurodegenerative diseases, and the mechanism of its progression is poorly understood. Here, we examine the structural and dynamic characteristics of transiently evolving protein aggregates under ambient conditions by directly probing protein surface water diffusivity, local protein segment dynamics, and interprotein packing as a function of aggregation time, along the third repeat domain and C terminus of Δtau187 spanning residues 255–441 of the longest isoform of human tau. These measurements were achieved with a set of highly sensitive magnetic resonance tools that rely on site-specific electron spin labeling of Δtau187. Within minutes of initiated aggregation, the majority of Δtau187 that is initially homogeneously hydrated undergoes structural transformations to form partially structured aggregation intermediates. This is reflected in the dispersion of surface water dynamics that is distinct around the third repeat domain, found to be embedded in an intertau interface, from that of the solvent-exposed C terminus. Over the course of hours and in a rate-limiting process, a majority of these aggregation intermediates proceed to convert into stable β-sheet structured species and maintain their stacking order without exchanging their subunits. The population of β-sheet structured species is >5% within 5 min of aggregation and gradually grows to 50–70% within the early stages of fibril formation, while they mostly anneal block-wisely to form elongated fibrils. Our findings suggest that the formation of dynamic aggregation intermediates constitutes a major event occurring in the earliest stages of tau aggregation that precedes, and likely facilitates, fibril formation and growth. PMID:26712030

  1. The Treponema denticola Major Sheath Protein Is Predominantly Periplasmic and Has Only Limited Surface Exposure

    PubMed Central

    Caimano, Melissa J.; Bourell, Kenneth W.; Bannister, Teresa D.; Cox, David L.; Radolf, Justin D.

    1999-01-01

    The recent discovery that the Treponema pallidum genome encodes 12 orthologs of the Treponema denticola major sheath protein (Msp) prompted us to reexamine the cellular location and topology of the T. denticola polypeptide. Experiments initially were conducted to ascertain whether Msp forms an array on or within the T. denticola outer membrane. Transmission electron microscopy (EM) of negatively stained and ultrathin-sectioned organisms failed to identify a typical surface layer, whereas freeze-fracture EM revealed that the T. denticola outer membrane contains heterogeneous transmembrane proteins but no array. In contrast, a lattice-like structure was observed in vesicles released from mildly sonicated treponemes; combined EM and biochemical analyses demonstrated that this structure was the peptidoglycan sacculus. Immunoelectron microscopy (IEM) subsequently was performed to localize Msp in T. denticola. Examination of negatively stained whole mounts identified substantial amounts of Msp in sonicated organisms. IEM of ultrathin-sectioned, intact treponemes also demonstrated that the preponderance of antigen was unassociated with the outer membrane. Lastly, immunofluorescence analysis of treponemes embedded in agarose gel microdroplets revealed that only minor portions of Msp are surface exposed. Taken as a whole, our findings challenge the widely held belief that Msp forms an array within the T. denticola outer membrane and demonstrate, instead, that it is predominantly periplasmic with only limited surface exposure. These findings also have implications for our evolving understanding of the contribution(s) of Msp/Tpr orthologs to treponemal physiology and disease pathogenesis. PMID:10417176

  2. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  3. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  4. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  5. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  6. Temporal changes of surface wave velocity associated with major Sumatra earthquakes from ambient noise correlation

    PubMed Central

    Xu, Zhen J.; Song, Xiaodong

    2009-01-01

    Detecting temporal changes of the medium associated with major earthquakes has implications for understanding earthquake genesis. Here we report temporal changes of surface wave velocity over a large area associated with 3 major Sumatra earthquakes in 2004, 2005, and 2007. We use ambient noise correlation to retrieve empirical Green's function (EGF) of surface waves between stations. Because the process is completely repeatable, the technique is powerful in detecting possible temporal change of medium. We find that 1 excellent station pair (PSI in Indonesia and CHTO in Thailand) shows significant time shifts (up to 1.44 s) after the 2004 and 2005 events in the Rayleigh waves at 10–20 s but not in the Love waves, suggesting that the Rayleigh time shifts are not from clock error. The time shifts are frequency dependent with the largest shifts at the period band of 11–16 s. We also observe an unusual excursion ∼1 month before the 2004 event. We obtain a total of 17 pairs for June, 2007 to June, 2008, which allow us to examine the temporal and spatial variation of the time shifts. We observed strong anomalies (up to 0.68 s) near the epicenter after the 2007 event, but not in the region further away from the source or before the event or 3 months after the event. The observations are interpreted as stress changes and subsequent relaxation in upper-mid crust in the immediate vicinity of the rupture and the broad area near the fault zone. PMID:19667205

  7. Pneumococcal Surface Protein A Plays a Major Role in Streptococcus pneumoniae-Induced Immunosuppression.

    PubMed

    Saumyaa; Pujanauski, Lindsey; Colino, Jesus; Flora, Michael; Torres, Raul M; Tuomanen, Elaine; Snapper, Clifford M

    2016-05-01

    Intact, inactivated Streptococcus pneumoniae [including the unencapsulated S. pneumoniae, serotype 2 strain (R36A)] markedly inhibits the humoral immune response to coimmunized heterologous proteins, a property not observed with several other intact Gram-positive or Gram-negative bacteria. In this study, we determined the nature of this immunosuppressive property. Because phosphorylcholine (PC), a major haptenic component of teichoic acid in the S. pneumoniae cell wall, and lipoteichoic acid in the S. pneumoniae membrane were previously reported to be immunosuppressive when derived from filarial parasites, we determined whether R36A lacking PC (R36A(pc-)) was inhibitory. Indeed, although R36A(pc-) exhibited a markedly reduced level of inhibition of the IgG response to coimmunized chicken OVA (cOVA), no inhibition was observed when using several other distinct PC-expressing bacteria or a soluble, protein-PC conjugate. Further, treatment of R36A with periodate, which selectively destroys PC residues, had no effect on R36A-mediated inhibition. Because R36A(pc-) also lacks choline-binding proteins (CBPs) that require PC for cell wall attachment, and because treatment of R36A with trypsin eliminated its inhibitory activity, we incubated R36A in choline chloride, which selectively strips CBPs from its surface. R36A lacking CBPs lost most of its inhibitory property, whereas the supernatant of choline chloride-treated R36A, containing CBPs, was markedly inhibitory. Coimmunization studies using cOVA and various S. pneumoniae mutants, each genetically deficient in one of the CBPs, demonstrated that only S. pneumoniae lacking the CBP pneumococcal surface protein A lost its ability to inhibit the IgG anti-cOVA response. These results strongly suggest that PspA plays a major role in mediating the immunosuppressive property of S. pneumoniae.

  8. Major surface antigen, P30, of Toxoplasma gondii is anchored by a glycolipid

    SciTech Connect

    Nagel, S.D.; Boothroyd, J.C.

    1989-04-05

    P30, the major surface antigen of the parasitic protozoan Toxoplasma gondii, can be specifically labeled with (/sup 3/H)palmitic acid and with myo-(2-/sup 3/H)inositol. The fatty acid label can be released by treatment of P30 with phosphatidylinositol-specific phospholipase C (PI-PLC). Such treatment exposes an immunological cross-reacting determinant first described on Trypanosoma brucei variant surface glycoprotein. PI-PLC cleavage of intact parasites metabolically labeled with (/sup 35/S)methionine results in the release of intact P30 polypeptide in a form which migrates faster in polyacrylamide gel electrophoresis. These results argue that P30 is anchored by a glycolipid. Results from thin layer chromatography analysis of purified (/sup 3/H) palmitate-labeled P30 treated with PI-PLC, together with susceptibility to mild alkali hydrolysis and to cleavage with phospholipase A2, suggest that the glycolipid anchor of T. gondii P30 includes a 1,2-diacylglycerol moiety.

  9. Surface nitrification: A major uncertainty in marine N2O emissions

    NASA Astrophysics Data System (ADS)

    Zamora, Lauren M.; Oschlies, Andreas

    2014-06-01

    The ocean is responsible for up to a third of total global nitrous oxide (N2O) emissions, but uncertainties in emission rates of this potent greenhouse gas are high (>100%). Here we use a marine biogeochemical model to assess six major uncertainties in estimates of N2O production, thereby providing guidance in how future studies may most effectively reduce uncertainties in current and future marine N2O emissions. Potential surface N2O production from nitrification causes the largest uncertainty in N2O emissions (estimated up to ~1.6 Tg N yr-1 or 48% of modeled values), followed by the unknown oxygen concentration at which N2O production switches to N2O consumption (0.8 Tg N yr-1 or 24% of modeled values). Other uncertainties are minor, cumulatively changing regional emissions by <15%. If production of N2O by surface nitrification could be ruled out in future studies, uncertainties in marine N2O emissions would be halved.

  10. Surface Nitrification: A Major Uncertainty in Marine N2O Emissions

    NASA Technical Reports Server (NTRS)

    Zamora, Lauren M.; Oschlies, Andreas

    2014-01-01

    The ocean is responsible for up to a third of total global nitrous oxide (N2O) emissions, but uncertainties in emission rates of this potent greenhouse gas are high (approaching 100%). Here we use a marine biogeochemical model to assess six major uncertainties in estimates of N2O production, thereby providing guidance in how future studies may most effectively reduce uncertainties in current and future marine N2O emissions. Potential surface N2O production from nitrification causes the largest uncertainty in N2O emissions (estimated up to approximately 1.6 Tg N/yr (sup -1) or 48% of modeled values), followed by the unknown oxygen concentration at which N2O production switches to N2O consumption (0.8 Tg N/yr (sup -1)or 24% of modeled values). Other uncertainties are minor, cumulatively changing regional emissions by less than 15%. If production of N2O by surface nitrification could be ruled out in future studies, uncertainties in marine N2O emissions would be halved.

  11. Relating Major Surface Processes to the Deep Earth — The Importance of the Miocene

    NASA Astrophysics Data System (ADS)

    Potter, P. E.; Szatmari, P.

    2012-12-01

    Many global scale tectonic, oceanic and climate changes began in the Tertiary with global tectonics as the underlying driving force and changed the world. In full flower by the beginning of the Middle Miocene around 16 Ma, these changes continued through the Late Miocene into the present so we can firmly say that most of our modern world, continental glaciations excepted, began in the Middle and Late Miocene. We summarize in a flow diagram how the major earth surface processes active in the Miocene are related to the Deep Earth as understood by recent advances in seismic tomography. This 11 Ma interval had two global orogenic zones, the Alpine-Tethyan orogen from Gibraltar across southern Asia into Vietnam and around the Pacific Rim, both crustal expressions of downwellings taking place, especially in the upper mantle. These downwellings are balanced by upwellings in the lower mantle in and on the rim of the African and Pacific superplumes, which are large, low-shear velocity provinces; part of the rising plumes originated from the most extensively melted regions of the core-mantle boundary layer, D", where heat flow from the outer core is highest. Together these up-and downwellings indicate that mantle convection extended, at least periodically, through the whole mantle and reflected lateral variations in convection and heat flow in the cooling and slowly crystallizing outer core. Correlation of mantle convection with surface features is most evident in the uppermost mantle whose dynamic topography is readily reflected by the subsidence and tilting of continents moving toward the downwelling zones. Because they are closely synchronous, these two orogenic belts had enormous consequences for the earth's surface, and because they are close to us in time, they are easy to study and sample. Thus the Miocene is ideal to study for both its many global intra connections and for their link to the Deep Earth. As these two orogenies developed, they changed a global warm

  12. Complex regulation of transcription from the hepatitis B virus major surface antigen promoter in human hepatoma cell lines.

    PubMed Central

    Raney, A K; Milich, D R; McLachlan, A

    1991-01-01

    A detailed mutational analysis of the regulatory DNA sequence elements that control expression of the hepatitis B virus major surface antigen gene was performed in the human hepatoma cell lines HepG2.1 and Huh7, using transient transfection assays. Seven regions (A to G) of the major surface antigen promoter located within 200 nucleotides of the RNA initiation site have been identified which influence the level of transcription from this promoter. The three distal regions (A to C), located between -188 and -68, appear to possess a level of redundancy in their ability to influence the transcriptional activity from the major surface antigen promoter. The simultaneous deletion of regions A, B, and C resulted in an approximately fourfold reduction in transcription from the major surface antigen promoter. Region D, located between -67 and -49, is an essential element of the major surface antigen promoter. The three proximal regions (E to G) are located within 45 nucleotides of the major transcription initiation site. Region E prevents the negative influence of region F and can compensate for the effect of mutation of region G on transcription from the major surface antigen promoter. Region G can compensate for the effect of the loss of a functional region E sequence on the transcriptional activity of the major surface antigen promoter only in the absence of a functional region F sequence. These results imply that the level of expression of the major surface antigen gene is controlled by the complex interplay between a minimum of six transcription factors which activate and one transcription factor which represses transcription from this gene. PMID:1651407

  13. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  14. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  15. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  16. Size-segregated composition of particulate matter (PM) in major roadways and surface streets

    NASA Astrophysics Data System (ADS)

    Kam, W.; Liacos, J. W.; Schauer, J. J.; Delfino, R. J.; Sioutas, C.

    2012-08-01

    A sampling campaign was conducted to assess on-road particulate matter (PM) composition for three size fractions (PM10-2.5, PM2.5-0.25, and PM0.25) on three representative roadways in Los Angeles: 1) the I-110, a high-traffic freeway composed mostly of light-duty vehicles (LDVs), 2) the I-710, a major freeway for heavy-duty vehicles (HDVs) traveling to and from the Ports of Los Angeles and Long Beach, and 3) Wilshire/Sunset Blvd, two major surface streets. Concurrent sampling was conducted at the University of Southern California (USC), which was used as an urban background site. Two sets of PM samples were collected for each roadway, with a sampling duration of approximately 50 h for each set. The samples were analyzed for inorganic ions, elemental carbon (EC), organic carbon (OC), water-soluble OC (WSOC), and trace elements and metals. Results showed that the PM0.25 fraction is heavily influenced by on-road vehicular emissions, as indicated by average roadway PM concentrations that were 48.0 ± 9.4% higher than those observed at USC (p < 0.05), while the PM10-2.5 fraction is mostly influenced by resuspension of road dust and the PM2.5-0.25 fraction is mainly composed of secondary species. Overall, the composition of inorganic ions (%) was relatively consistent across the three roadway environments. With very low EC levels in PM10-2.5, the most notable difference among the three roadway environments was the PM2.5 EC levels observed on the I-710, which are 2.0 ± 0.2 μg m-3 and 4.1 times greater than USC, while levels on the I-110 and Wilshire/Sunset were 1.0 ± 0.2 μg m-3 and 0.6 ± 0.01 μg m-3 and 2.1 and 1.2 times greater, respectively. PM2.5 OC and WSOC concentrations were observed to be 1.6, 2.0, and 1.7 times greater on the I-110, I-710, and Wilshire/Sunset than corresponding levels at USC, respectively. Results from this study may have major public health implications for passengers who commute frequently on high-traffic roadways. Finally, a comparison of

  17. The immunization-induced antibody response to the Anaplasma marginale major surface protein 2 and its association with protective immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many vector-borne pathogens evade clearance via rapid variation in immunogenic surface expressed proteins. In the case of A. marginale, the generation of major surface protein 2 (Msp2) variants allows for immune escape and long-term pathogen persistence. In the experiments reported here, we pose t...

  18. Functional and Immunological Relevance of Anaplasma marginale Major Surface Protein 1a Sequence and Structural Analysis

    PubMed Central

    Cabezas-Cruz, Alejandro; Passos, Lygia M. F.; Lis, Katarzyna; Kenneil, Rachel; Valdés, James J.; Ferrolho, Joana; Tonk, Miray; Pohl, Anna E.; Grubhoffer, Libor; Zweygarth, Erich; Shkap, Varda; Ribeiro, Mucio F. B.; Estrada-Peña, Agustín; Kocan, Katherine M.; de la Fuente, José

    2013-01-01

    Bovine anaplasmosis is caused by cattle infection with the tick-borne bacterium, Anaplasma marginale. The major surface protein 1a (MSP1a) has been used as a genetic marker for identifying A. marginale strains based on N-terminal tandem repeats and a 5′-UTR microsatellite located in the msp1a gene. The MSP1a tandem repeats contain immune relevant elements and functional domains that bind to bovine erythrocytes and tick cells, thus providing information about the evolution of host-pathogen and vector-pathogen interactions. Here we propose one nomenclature for A. marginale strain classification based on MSP1a. All tandem repeats among A. marginale strains were classified and the amino acid variability/frequency in each position was determined. The sequence variation at immunodominant B cell epitopes was determined and the secondary (2D) structure of the tandem repeats was modeled. A total of 224 different strains of A. marginale were classified, showing 11 genotypes based on the 5′-UTR microsatellite and 193 different tandem repeats with high amino acid variability per position. Our results showed phylogenetic correlation between MSP1a sequence, secondary structure, B-cell epitope composition and tick transmissibility of A. marginale strains. The analysis of MSP1a sequences provides relevant information about the biology of A. marginale to design vaccines with a cross-protective capacity based on MSP1a B-cell epitopes. PMID:23776456

  19. Sequence and immunogenicity of the Taenia saginata homologue of the major surface antigen of Echinococcus spp.

    PubMed

    Benitez, L; Harrison, L J; Parkhouse, R M; Gonzalez, L M; Gottstein, B; Garate, T

    1998-05-01

    A clone (R-Tso18) was isolated from a Taenia saginata oncosphere cDNA library by screening with sera from rabbits immunised with oncosphere extract. It contained a full-length cDNA sequence of 1893 bp with an open reading frame of 1680 bp, corresponding to 559 amino acids with a deduced molecular mass of 65.173 kDa and an isoelectric point of 6.08. The R-Tso18 protein showed 80-84% nucleotide identity with the major protoscolex surface antigens of Echinococcus multilocularis (EM10) and E. granulosus (EG10). Preliminary immunogenicity studies employing the radiolabeled R-Tso18 protein in immune co-precipitation assays indicated sero-positivity for T. saginata-infected calf sera (6/13), T. solium cysticercosis human (7/22) and pig (2/2) sera and E. multilocularis (6/10)- and E. granulosus (1/12)-infected human sera, whereas other helminth-infection sera were negative. As immuno-precipitation is a relatively insensitive assay, it was concluded that further studies on the diagnostic potential of the purified recombinant R-Tso18 antigen, or its peptides, are merited.

  20. Members of the salivary gland surface protein (SGS) family are major immunogenic components of mosquito saliva.

    PubMed

    King, Jonas G; Vernick, Kenneth D; Hillyer, Julián F

    2011-11-25

    Mosquitoes transmit Plasmodium and certain arboviruses during blood feeding, when they are injected along with saliva. Mosquito saliva interferes with the host's hemostasis and inflammation response and influences the transmission success of some pathogens. One family of mosquito salivary gland proteins, named SGS, is composed of large bacterial-type proteins that in Aedes aegypti were implicated as receptors for Plasmodium on the basal salivary gland surface. Here, we characterize the biology of two SGSs in the malaria mosquito, Anopheles gambiae, and demonstrate their involvement in blood feeding. Western blots and RT-PCR showed that Sgs4 and Sgs5 are produced exclusively in female salivary glands, that expression increases with age and after blood feeding, and that protein levels fluctuate in a circadian manner. Immunohistochemistry showed that SGSs are present in the acinar cells of the distal lateral lobes and in the salivary ducts of the proximal lobes. SDS-PAGE, Western blots, bite blots, and immunization via mosquito bites showed that SGSs are highly immunogenic and form major components of mosquito saliva. Last, Western and bioinformatic analyses suggest that SGSs are secreted via a non-classical pathway that involves cleavage into a 300-kDa soluble fragment and a smaller membrane-bound fragment. Combined, these data strongly suggest that SGSs play an important role in blood feeding. Together with their role in malaria transmission, we propose that SGSs could be used as markers of human exposure to mosquito bites and in the development of disease control strategies.

  1. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  2. Cockroach protease allergen induces allergic airway inflammation via epithelial cell activation

    PubMed Central

    Kale, Sagar L.; Agrawal, Komal; Gaur, Shailendra Nath; Arora, Naveen

    2017-01-01

    Protease allergens are known to enhance allergic inflammation but their exact role in initiation of allergic reactions at mucosal surfaces still remains elusive. This study was aimed at deciphering the role of serine protease activity of Per a 10, a major cockroach allergen in initiation of allergic inflammation at mucosal surfaces. We demonstrate that Per a 10 increases epithelial permeability by disruption of tight junction proteins, ZO-1 and occludin, and enhances the migration of Monocyte derived dendritic cell precursors towards epithelial layer as exhibited by trans-well studies. Per a 10 exposure also leads to secretion of IL-33, TSLP and intracellular Ca2+ dependent increase in ATP levels. Further, in vivo experiments revealed that Per a 10 administration in mice elevated allergic inflammatory parameters along with high levels of IL-33, TSLP, IL-1α and uric acid in the mice lungs. We next demonstrated that Per a 10 cleaves CD23 (low affinity IgE receptor) from the surface of PBMCs and purified B cells and CD25 (IL-2 receptor) from the surface of PBMCs and purified T cells in an activity dependent manner, which might favour Th2 responses. In conclusion, protease activity of Per a 10 plays a significant role in initiation of allergic airway inflammation at the mucosal surfaces. PMID:28198394

  3. Identification of weak points of hepatitis C virus NS3 protease inhibitors using surface plasmon resonance biosensor-based interaction kinetic analysis and genetic variants.

    PubMed

    Svahn Gustafsson, Sofia; Ehrenberg, Angelica; Schmuck, Benjamin; Anwar, Muhammad Ikram; Danielson, U Helena

    2014-03-13

    To aid the design of next generation hepatitis C virus (HCV) drugs, the kinetics of the interactions between NS3 protease inhibitors and enzyme from genotypes 1a, 1b, and 3a have been characterized. The linear mechanism-based inhibitors VX-950 (telaprevir) and SCH 503034 (boceprevir) benefited from covalent adduct formation. However, the apparent affinities were rather weak (VX-950, K(D)* of 340, 8.5, and 1000 nM for genotypes 1a, 1b and 3a, respectively; SCH 503034, K(D)* of 90 and 3.9 nM for 1b and 3a, respectively). The non-mechanism-based macrocyclic inhibitors BILN-2016 (ciluprevir) and ITMN-191 (danoprevir) had faster association and slower dissociation kinetics, indicating that rigidification is kinetically favorable. ITMN-191 had nanomolar affinities for all genotypes (K(D)* of 0.13, 1.6, and 0.52 nM), suggesting that a broad spectrum drug is conceivable. The data show that macrocyclic scaffolds and mechanism-based inhibition are advantageous but that there is considerable room for improvement of the kinetics of HCV protease targeted drugs.

  4. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  5. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  6. Vivianite is a major sink for phosphorus in methanogenic coastal surface sediments

    NASA Astrophysics Data System (ADS)

    Egger, Matthias; Jilbert, Tom; Behrends, Thilo; Rivard, Camille; Slomp, Caroline P.

    2015-11-01

    Studies of authigenic phosphorus (P) minerals in marine sediments typically focus on authigenic carbonate fluorapatite, which is considered to be the major sink for P in marine sediments and can easily be semi-quantitatively extracted with the SEDEX sequential extraction method. The role of other potentially important authigenic P phases, such as the reduced iron (Fe) phosphate mineral vivianite (Fe(II)3(PO4)*8H2O) has so far largely been ignored in marine systems. This is, in part, likely due to the fact that the SEDEX method does not distinguish between vivianite and P associated with Fe-oxides. Here, we show that vivianite can be quantified in marine sediments by combining the SEDEX method with microscopic and spectroscopic techniques such as micro X-ray fluorescence (μXRF) elemental mapping of resin-embedded sediments, as well as scanning electron microscope-energy dispersive spectroscopy (SEM-EDS) and powder X-ray diffraction (XRD). We further demonstrate that resin embedding of vertically intact sediment sub-cores enables the use of synchrotron-based microanalysis (X-ray absorption near-edge structure (XANES) spectroscopy) to differentiate between different P burial phases in aquatic sediments. Our results reveal that vivianite represents a major burial sink for P below a shallow sulfate/methane transition zone in Bothnian Sea sediments, accounting for 40-50% of total P burial. We further show that anaerobic oxidation of methane (AOM) drives a sink-switching from Fe-oxide bound P to vivianite by driving the release of both phosphate (AOM with sulfate and Fe-oxides) and ferrous Fe (AOM with Fe-oxides) to the pore water allowing supersaturation with respect to vivianite to be reached. The vivianite in the sediment contains significant amounts of manganese (∼4-8 wt.%), similar to vivianite obtained from freshwater sediments. Our results indicate that methane dynamics play a key role in providing conditions that allow for vivianite authigenesis in coastal

  7. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  8. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  9. Major Successes of Theory-and-Experiment-Combined Studies in Surface Chemistry and Heterogeneous Catalysis.

    SciTech Connect

    Somorjai, Gabor A.; Li, Yimin

    2009-11-21

    Experimental discoveries followed by theoretical interpretations that pave the way of further advances by experimentalists is a developing pattern in modern surface chemistry and catalysis. The revolution of modern surface science started with the development of surface-sensitive techniques such as LEED, XPS, AES, ISS and SIMS, in which the close collaboration between experimentalists and theorists led to the quantitative determination of surface structure and composition. The experimental discovery of the chemical activity of surface defects and the trends in the reactivity of transitional metals followed by the explanations from the theoretical studies led to the molecular level understanding of active sites in catalysis. The molecular level knowledge, in turn, provided a guide for experiments to search for new generation of catalysts. These and many other examples of successes in experiment-and-theory-combined studies demonstrate the importance of the collaboration between experimentalists and theorists in the development of modern surface science.

  10. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  11. Role of major surface structures of Escherichia coli O157:H7 in initial attachment to biotic and abiotic surfaces

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infection by human pathogens through fresh, minimally processed produce and solid plant-derived foods is a major concern of U.S. and global food industry and public health services. The enterohemorrhagic Escherichia coli O157:H7 is a frequent and potent food borne pathogen that causes severe disease...

  12. Solar Ion Processing of Major Element Surface Compositions of Mature Mare Soils: Insights from Combined XPS and Analytical TEM Observations

    NASA Technical Reports Server (NTRS)

    Christoffersen, R.; Dukes, C.; Keller, L. P.; Baragiola, R.

    2012-01-01

    Solar wind ions are capable of altering the sur-face chemistry of the lunar regolith by a number of mechanisms including preferential sputtering, radiation-enhanced diffusion and sputter erosion of space weathered surfaces containing pre-existing compositional profiles. We have previously reported in-situ ion irradiation experiments supported by X-ray photoelectron spectroscopy (XPS) and analytical TEM that show how solar ions potentially drive Fe and Ti reduction at the monolayer scale as well as the 10-100 nm depth scale in lunar soils [1]. Here we report experimental data on the effect of ion irradiation on the major element surface composition in a mature mare soil.

  13. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  14. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  15. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  16. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  17. Surface-water dynamics and land use influence landscape connectivity across a major dryland region.

    PubMed

    Bishop-Taylor, Robbi; Tulbure, Mirela G; Broich, Mark

    2017-01-24

    Landscape connectivity is important for the long-term persistence of species inhabiting dryland freshwater ecosystems, with spatiotemporal surface-water dynamics (e.g., flooding) maintaining connectivity by both creating temporary habitats and providing transient opportunities for dispersal. Improving our understanding of how landscape connectivity varies with respect to surface-water dynamics and land use is an important step to maintaining biodiversity in dynamic dryland environments. Using a newly available validated Landsat TM and ETM+ surface-water time series, we modelled landscape connectivity between dynamic surface-water habitats within Australia's 1 million km2 semi-arid Murray Darling Basin across a 25-year period (1987 to 2011). We identified key habitats that serve as well-connected 'hubs', or 'stepping-stones' that allow long-distance movements through surface-water habitat networks. We compared distributions of these habitats for short- and long-distance dispersal species during dry, average and wet seasons, and across land-use types. The distribution of stepping-stones and hubs varied both spatially and temporally, with temporal changes driven by drought and flooding dynamics. Conservation areas and natural environments contained higher than expected proportions of both stepping-stones and hubs throughout the time series; however, highly modified agricultural landscapes increased in importance during wet seasons. Irrigated landscapes contained particularly high proportions of well-connected hubs for long-distance dispersers, but remained relatively disconnected for less vagile organisms. The habitats identified by our study may serve as ideal high-priority targets for land-use specific management aimed at maintaining or improving dispersal between surface-water habitats, potentially providing benefits to biodiversity beyond the immediate site scale. Our results also highlight the importance of accounting for the influence of spatial and temporal

  18. Dust levitation as a major resurfacing process on the surface of a saturnian icy satellite, Atlas

    NASA Astrophysics Data System (ADS)

    Hirata, Naoyuki; Miyamoto, Hideaki

    2012-07-01

    A small inner satellite of Saturn, Atlas, has an enigmatic saucer-like shape explained by an accumulation of particles from A-ring of Saturn. However, its unusual smooth surface remains unexplained. Gardening through continuous particle impact events cannot be a unique explanation for the smoothness, because Prometheus does not exhibit a similar surface, though it too would have experienced a similar bombardment. Here, a detailed investigation using close-up images of Atlas reveals the surface to be (1) covered by fine particles (i.e., probably as small as several tens of micrometers); (2) mostly void of impact craters (i.e., only one has been thus far identified); and (3) continuously smooth, even between the equatorial ridge and the undulating polar region. These findings imply that some sort of crater-erasing process has been active on the surface of Atlas. From electro-static analyses, we propose that the upper-most layer of the fine particles can become electro-statically unstable and migrate as a result of dust levitation, which resulted in erasing craters on the surface of Atlas. If true, Atlas would represent the first recognized body where resurfacing is dominated by dust levitation.

  19. Surface temperature changes following the six major volcanic episodes between 1780 and 1980

    NASA Astrophysics Data System (ADS)

    Angell, J. K.; Korshover, J.

    1985-09-01

    The effects produced by volcanic eruptions on the surface temperature have been a matter of controversy for decades. The present investigation has the objective to examine volcanic eruptions individually to find out which eruptions have been followed by a cooling and which have not, taking into account possible reasons for this difference. The six volcanic episodes between 1780 and 1980 with the largest dust-veil indexes have been chosen. The variation in mean-annual surface temperature from ten years before to ten years after the eruption are considered. The events selected include the eruptions of Asama and Laki in 1783, Tambora in 1815, Coseguina in 1835, Krakatoa in 1883, Santa Maria, Soufriere, and Pelee in 1902, and Agung in 1963). It is found that, while volcanic eruptions certainly do not cause a warming of the earth's surface, the evidence that they cause cooling is not overly impressive either.

  20. The major-element composition of Mercury's surface from MESSENGER X-ray spectrometry.

    PubMed

    Nittler, Larry R; Starr, Richard D; Weider, Shoshana Z; McCoy, Timothy J; Boynton, William V; Ebel, Denton S; Ernst, Carolyn M; Evans, Larry G; Goldsten, John O; Hamara, David K; Lawrence, David J; McNutt, Ralph L; Schlemm, Charles E; Solomon, Sean C; Sprague, Ann L

    2011-09-30

    X-ray fluorescence spectra obtained by the MESSENGER spacecraft orbiting Mercury indicate that the planet's surface differs in composition from those of other terrestrial planets. Relatively high Mg/Si and low Al/Si and Ca/Si ratios rule out a lunarlike feldspar-rich crust. The sulfur abundance is at least 10 times higher than that of the silicate portion of Earth or the Moon, and this observation, together with a low surface Fe abundance, supports the view that Mercury formed from highly reduced precursor materials, perhaps akin to enstatite chondrite meteorites or anhydrous cometary dust particles. Low Fe and Ti abundances do not support the proposal that opaque oxides of these elements contribute substantially to Mercury's low and variable surface reflectance.

  1. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  2. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    SciTech Connect

    Wise K.S.; Kim, M.F.

    1987-12-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface /sup 125/I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with (/sup 35/S) methionine, /sup 14/C-amino acids, or (/sup 3/H) palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11.

  3. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  4. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  5. Structural and functional characterization of Bc28.1, major erythrocyte-binding protein from Babesia canis merozoite surface.

    PubMed

    Yang, Yin-Shan; Murciano, Brice; Moubri, Karina; Cibrelus, Prisca; Schetters, Theo; Gorenflot, André; Delbecq, Stéphane; Roumestand, Christian

    2012-03-16

    Babesiosis (formerly known as piroplasmosis) is a tick-borne disease caused by the intraerythrocytic development of protozoa parasites from the genus Babesia. Like Plasmodium falciparum, the agent of malaria, or Toxoplasma gondii, responsible for human toxoplasmosis, Babesia belongs to the Apicomplexa family. Babesia canis is the agent of the canine babesiosis in Europe. Clinical manifestations of this disease range from mild to severe and possibly lead to death by multiple organ failure. The identification and characterization of parasite surface proteins represent major goals, both for the understanding of the Apicomplexa invasion process and for the vaccine potential of such antigens. Indeed, we have already shown that Bd37, the major antigenic adhesion protein from Babesia divergens, the agent of bovine babesiosis, was able to induce complete protection against various parasite strains. The major merozoite surface antigens of Babesia canis have been described as a 28-kDa membrane protein family, anchored at the surface of the merozoite. Here, we demonstrate that Bc28.1, a major member of this multigenic family, is expressed at high levels at the surface of the merozoite. This protein is also found in the parasite in vitro culture supernatants, which are the basis of effective vaccines against canine babesiosis. We defined the erythrocyte binding function of Bc28.1 and determined its high resolution solution structure using NMR spectroscopy. Surprisingly, although these proteins are thought to play a similar role in the adhesion process, the structure of Bc28.1 from B. canis appears unrelated to the previously published structure of Bd37 from B. divergens. Site-directed mutagenesis experiments also suggest that the mechanism of the interaction with the erythrocyte membrane could be different for the two proteins. The resolution of the structure of Bc28 represents a milestone for the characterization of the parasite erythrocyte binding and its interaction with

  6. Structural and Functional Characterization of Bc28.1, Major Erythrocyte-binding Protein from Babesia canis Merozoite Surface*

    PubMed Central

    Yang, Yin-Shan; Murciano, Brice; Moubri, Karina; Cibrelus, Prisca; Schetters, Theo; Gorenflot, André; Delbecq, Stéphane; Roumestand, Christian

    2012-01-01

    Babesiosis (formerly known as piroplasmosis) is a tick-borne disease caused by the intraerythrocytic development of protozoa parasites from the genus Babesia. Like Plasmodium falciparum, the agent of malaria, or Toxoplasma gondii, responsible for human toxoplasmosis, Babesia belongs to the Apicomplexa family. Babesia canis is the agent of the canine babesiosis in Europe. Clinical manifestations of this disease range from mild to severe and possibly lead to death by multiple organ failure. The identification and characterization of parasite surface proteins represent major goals, both for the understanding of the Apicomplexa invasion process and for the vaccine potential of such antigens. Indeed, we have already shown that Bd37, the major antigenic adhesion protein from Babesia divergens, the agent of bovine babesiosis, was able to induce complete protection against various parasite strains. The major merozoite surface antigens of Babesia canis have been described as a 28-kDa membrane protein family, anchored at the surface of the merozoite. Here, we demonstrate that Bc28.1, a major member of this multigenic family, is expressed at high levels at the surface of the merozoite. This protein is also found in the parasite in vitro culture supernatants, which are the basis of effective vaccines against canine babesiosis. We defined the erythrocyte binding function of Bc28.1 and determined its high resolution solution structure using NMR spectroscopy. Surprisingly, although these proteins are thought to play a similar role in the adhesion process, the structure of Bc28.1 from B. canis appears unrelated to the previously published structure of Bd37 from B. divergens. Site-directed mutagenesis experiments also suggest that the mechanism of the interaction with the erythrocyte membrane could be different for the two proteins. The resolution of the structure of Bc28 represents a milestone for the characterization of the parasite erythrocyte binding and its interaction with

  7. Expression of the Major Surface Antigen of Plasmodium knowlesi Sporozoites in Yeast

    NASA Astrophysics Data System (ADS)

    Sharma, Shobhona; Godson, G. Nigel

    1985-05-01

    The circumsporozoite protein, a surface antigen of the sporozoite stage of the monkey malarial parasite Plasmodium knowlesi, was expressed in the yeast Saccharomyces cerevisiae by using an expression vector containing the 5' regulatory region of the yeast alcohol dehydrogenase I gene. It was necessary to eliminate the entire 5' upstream region of the parasite DNA to obtain the expression of this protein. Only the circumsporozoite precursor protein was produced by the yeast transformants, as detected by immunoblotting. About 55 and 20 percent of the circumsporozoite protein produced in yeast was associated with the 25,000g and 150,000g particulate fractions, respectively. The protein could be solubilized in Triton X-100 and was stable in solubilized extracts.

  8. Characterizing interactions between surface water and groundwater in the Jialu River basin using major ion chemistry and stable isotopes

    NASA Astrophysics Data System (ADS)

    Yang, L.; Song, X.; Zhang, Y.; Han, D.; Zhang, B.; Long, D.

    2012-11-01

    The Jialu River, a secondary tributary of the Huaihe River, has been severely contaminated from major contaminant sources, such as a number of untreated or lightly treated sewage waste in some cities. Groundwater along the river is not an isolated component of the hydrologic system, but is instead connected with the surface water. This study aims to investigate temporal and spatial variations in water chemistry affected by humans and to characterize the relationships between surface water (e.g. reservoirs, lakes and rivers) and groundwater near the river in the shallow Quaternary aquifer. Concentration of Cl- in north Zhengzhou City increased prominently due to the discharge of a large amount of domestic water. Nitrate and potassium show maximum concentrations in groundwater in Fugou County. These high levels can be attributed to the use of a large quantity of fertilizer over this region. Most surface water appeared to be continuously recharged from the surrounding groundwater (regional wells) based on comparison surface water with groundwater levels, stable-isotopes and major ion signatures. However, the groundwater of a transitional well (location SY3) seemed to be recharged by river water via bank infiltration in September 2010. Fractional contributions of river water to the groundwater were calculated based on isotopic and chemical data using a mass-balance approach. Results show that the groundwater was approximately composed of 60-70% river water. These findings should be useful for a better understanding of hydrogeological processes at the river-aquifer interface and ultimately benefit water management in the future.

  9. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  10. Surface expression, single-channel analysis and membrane topology of recombinant Chlamydia trachomatis Major Outer Membrane Protein

    PubMed Central

    Findlay, Heather E; McClafferty, Heather; Ashley, Richard H

    2005-01-01

    Background Chlamydial bacteria are obligate intracellular pathogens containing a cysteine-rich porin (Major Outer Membrane Protein, MOMP) with important structural and, in many species, immunity-related roles. MOMP forms extensive disulphide bonds with other chlamydial proteins, and is difficult to purify. Leaderless, recombinant MOMPs expressed in E. coli have yet to be refolded from inclusion bodies, and although leadered MOMP can be expressed in E. coli cells, it often misfolds and aggregates. We aimed to improve the surface expression of correctly folded MOMP to investigate the membrane topology of the protein, and provide a system to display native and modified MOMP epitopes. Results C. trachomatis MOMP was expressed on the surface of E. coli cells (including "porin knockout" cells) after optimizing leader sequence, temperature and medium composition, and the protein was functionally reconstituted at the single-channel level to confirm it was folded correctly. Recombinant MOMP formed oligomers even in the absence of its 9 cysteine residues, and the unmodified protein also formed inter- and intra-subunit disulphide bonds. Its topology was modeled as a (16-stranded) β-barrel, and specific structural predictions were tested by removing each of the four putative surface-exposed loops corresponding to highly immunogenic variable sequence (VS) domains, and one or two of the putative transmembrane strands. The deletion of predicted external loops did not prevent folding and incorporation of MOMP into the E. coli outer membrane, in contrast to the removal of predicted transmembrane strands. Conclusions C. trachomatis MOMP was functionally expressed on the surface of E. coli cells under newly optimized conditions. Tests of its predicted membrane topology were consistent with β-barrel oligomers in which major immunogenic regions are displayed on surface-exposed loops. Functional surface expression, coupled with improved understanding of MOMP's topology, could provide

  11. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  12. Terpenoids as major precursors of dissolved organic matter in landfill leachates, surface water, and groundwater

    USGS Publications Warehouse

    Leenheer, J.A.; Nanny, M.A.; McIntyre, C.

    2003-01-01

    13C NMR analyses of hydrophobic dissolved organic matter (DOM) fractions isolated from a landfill leachate contaminated groundwater near Norman, OK; the Colorado River aqueduct near Los Angeles, CA; Anaheim Lake, an infiltration basin for the Santa Ana River in Orange County, CA; and groundwater from the Tomago Sand Beds, near Sydney, Australia, found branched methyl groups and quaternary aliphatic carbon structures that are indicative of terpenoid hydrocarbon precursors. Significant amounts of lignin precursors, commonly postulated to be the major source of DOM, were found only in trace quantities by thermochemolysis/gas chromatography/mass spectrometry of the Norman Landfill and Tomago Sand Bed hydrophobic DOM fractions. Electrospray/tandem mass spectrometry of the Tomago Sand Bed hydrophobic acid DOM found an ion series differing by 14 daltons, which is indicative of aliphatic and aryl-aliphatic polycarboxylic acids. The product obtained from ozonation of the resin acid, abietic acid, gave a similar ion series. Terpenoid precursors of DOM are postulated to be derived from resin acid paper sizing agents in the Norman Landfill, algal and bacterial terpenoids in the Colorado River and Anaheim Lake, and terrestrial plant terpenoids in the Tomago Sand Beds.

  13. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  14. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    PubMed Central

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas S.; Lisby, Michael; Salanti, Ali; Fordyce, Sarah L.; Jespersen, Jakob S.; Carter, Richard; Deitsch, Kirk W.; Theander, Thor G.; Pedersen, Anders Gorm; Arnot, David E.

    2014-01-01

    Many bacterial, viral and parasitic pathogens undergo antigenic variation to counter host immune defense mechanisms. In Plasmodium falciparum, the most lethal of human malaria parasites, switching of var gene expression results in alternating expression of the adhesion proteins of the Plasmodium falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome-wide recombination hotspots in var genes, we show that during the parasite’s sexual stages, ectopic recombination between isogenous var paralogs occurs near low folding free energy DNA 50-mers and that these sequences are heavily concentrated at the boundaries of regions encoding individual Plasmodium falciparum-erythrocyte membrane protein 1 structural domains. The recombinogenic potential of these 50-mers is not parasite-specific because these sequences also induce recombination when transferred to the yeast Saccharomyces cerevisiae. Genetic cross data suggest that DNA secondary structures (DSS) act as inducers of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens. PMID:24253306

  15. Mars atmospheric phenomena during major dust storms, as measured at surface

    NASA Technical Reports Server (NTRS)

    Ryan, J. A.; Henry, R. M.

    1979-01-01

    Meteorological instrumentation aboard the Viking Mars Landers measures wind, temperature, and pressure. Two global dust storms occurred during northern autumn and winter, observed both by the orbiters and by the landers. The meteorological data from the landers has been analyzed for the period just before first storm arrival to just after second storm arrival, with the objectives of defining the meteorological phenomena during the storm period, determining those associated with storm and dust arrival, and evaluating the effects on synoptic conditions and the general circulation. Times of dust arrival over the sites could be defined fairly closely from optical and pressure (solar tide) data, and dust arrival was also accompanied by changes in diurnal temperature range, temperature maxima, and temperature minima. The arrivals of the storms at Viking Lander 1 were accompanied by significant increases in wind speed and pressure. No such changes were observed at Viking Lander 2. It is possible that surface material could have been raised locally at Viking Lander 1. Throughout the period except for the time following the second dust storm the synoptic picture at Viking Lander 2 was one of eastward moving cyclonic and anticyclonic systems. These disappeared following the second storm, a phenomenon which may be related to the storm.

  16. Major and trace element partitioning between dissolved and particulate phases in Antarctic surface snow.

    PubMed

    Grotti, M; Soggia, F; Ardini, F; Magi, E

    2011-09-01

    In order to provide a new insight into the Antarctic snow chemistry, partitioning of major and trace elements between dissolved and particulate (i.e. insoluble particles, >0.45 μm) phases have been investigated in a number of coastal and inland snow samples, along with their total and acid-dissolvable (0.5% nitric acid) concentrations. Alkaline and alkaline-earth elements (Na, K, Ca, Mg, Sr) were mainly present in the dissolved phase, while Fe and Al were predominantly associated with the particulate matter, without any significant difference between inland and coastal samples. On the other hand, partitioning of trace elements depended on the sampling site position, showing a general decrease of the particulate fraction by moving from the coast to the plateau. Cd, Cu, Pb and Zn were for the most part in the dissolved phase, while Cr was mainly associated with the particulate fraction. Co, Mn and V were equally distributed between dissolved and particulate phases in the samples collected from the plateau and preferentially associated with the particulate in the coastal samples. The correlation between the elements and the inter-sample variability of their concentration significantly decreased for the plateau samples compared to the coastal ones, according to a change in the relative contribution of the metal sources and in good agreement with the estimated marine and crustal enrichment factors. In addition, samples from the plateau were characterised by higher enrichment factors of anthropogenic elements (Cd, Cr, Cu, Pb and Zn), compared to the coastal area. Finally, it was observed that the acid-dissolvable metal concentrations were generally lower than the total concentration values, showing that the acid treatment can dissolve only a given fraction of the metal associated with the particulate (<20% for iron and aluminium).

  17. Surface Temperature Changes Following the Six Major Volcanic Episodes between 1780 and 1980.

    NASA Astrophysics Data System (ADS)

    Angell, J. K.; Korshover, J.

    1985-09-01

    Examined is the effect on surface temperature of the volcanic eruptions of Asama and Laki in 1783, Tambora in 1815, Coseguina in 1835, Krakatoa in 1883, Santa Maria, Soufrière and Pelée in 1902, and Agung in 1963, using temperature records extending back to 1781. These records include New Haven, Connecticut, in North America; Edinburgh, De Bilt, Copenhagen, Berlin and Vilnius in Northern Europe; Geneva, Basel, Hohen-peissenberg, Vienna and Budapest in Central Europe; the `Central England' data of Manley; and the merged Northern Hemisphere data of Groveman and Landsberg and Jones et al. At New Haven and in Europe there is more evidence of a cooling following eruptions in subtropical and temperate latitudes than in equatorial latitudes (despite the similarity in mean dust-veil index), with a cooling most evident following the Asama and Laki eruptions in Japan and Iceland, and next most evident following the Coseguina eruption in Nicaragua. Following the tremendous Tambora eruption, the eruption with the largest dust-veil index, there is obvious cooling at New Haven, but not in Europe and perhaps not for the hemisphere as a whole. Hemispheric cooling is indicated to have been most pronounced following the Agung eruption-of the six eruption episodes the one with the smallest dust veil index but the best temperature data. Based on an application of Student's t-test to station, regional and hemispheric data, on 27 occasions (out of a possible 96) the average temperature for the 5-year period after the eruption is significantly (at the 5% level) lower than the average temperature for the 5- year period before the eruption, but in no case is the average temperature after the eruption significantly higher. It is proposed that cooling is not more apparent following some eruptions because of the tropospheric warming associated with strong and persistent El Niño episodes occurring shortly after the eruptions.

  18. Mutations in SERPINB7, encoding a member of the serine protease inhibitor superfamily, cause Nagashima-type palmoplantar keratosis.

    PubMed

    Kubo, Akiharu; Shiohama, Aiko; Sasaki, Takashi; Nakabayashi, Kazuhiko; Kawasaki, Hiroshi; Atsugi, Toru; Sato, Showbu; Shimizu, Atsushi; Mikami, Shuji; Tanizaki, Hideaki; Uchiyama, Masaki; Maeda, Tatsuo; Ito, Taisuke; Sakabe, Jun-ichi; Heike, Toshio; Okuyama, Torayuki; Kosaki, Rika; Kosaki, Kenjiro; Kudoh, Jun; Hata, Kenichiro; Umezawa, Akihiro; Tokura, Yoshiki; Ishiko, Akira; Niizeki, Hironori; Kabashima, Kenji; Mitsuhashi, Yoshihiko; Amagai, Masayuki

    2013-11-07

    "Nagashima-type" palmoplantar keratosis (NPPK) is an autosomal recessive nonsyndromic diffuse palmoplantar keratosis characterized by well-demarcated diffuse hyperkeratosis with redness, expanding on to the dorsal surfaces of the palms and feet and the Achilles tendon area. Hyperkeratosis in NPPK is mild and nonprogressive, differentiating NPPK clinically from Mal de Meleda. We performed whole-exome and/or Sanger sequencing analyses of 13 unrelated NPPK individuals and identified biallelic putative loss-of-function mutations in SERPINB7, which encodes a cytoplasmic member of the serine protease inhibitor superfamily. We identified a major causative mutation of c.796C>T (p.Arg266(∗)) as a founder mutation in Japanese and Chinese populations. SERPINB7 was specifically present in the cytoplasm of the stratum granulosum and the stratum corneum (SC) of the epidermis. All of the identified mutants are predicted to cause premature termination upstream of the reactive site, which inhibits the proteases, suggesting a complete loss of the protease inhibitory activity of SERPINB7 in NPPK skin. On exposure of NPPK lesional skin to water, we observed a whitish spongy change in the SC, suggesting enhanced water permeation into the SC due to overactivation of proteases and a resultant loss of integrity of the SC structure. These findings provide an important framework for developing pathogenesis-based therapies for NPPK.

  19. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  20. The surface of Syrtis Major - Composition of the volcanic substrate and mixing with altered dust and soil

    NASA Astrophysics Data System (ADS)

    Mustard, J. F.; Erard, S.; Bibring, J.-P.; Head, J. W.; Hurtrez, S.; Langevin, Y.; Pieters, C. M.; Sotin, C. J.

    1993-02-01

    The study characterizes Syrtis Major, an old, low relief volcanic plateau near the equatorial regions of Mars, on the basis of ISM data in order to characterize the spectral properties of the surface, to identify the major mafic mineralogy of the volcanic materials, and to derive estimates of the chemistry of these minerals. The value and spatial distribution of four primary spectral variables (albedo, continuum slope, wavelength of the ferric-ferrous band minimum, and area of the ferric-ferrous absorption) are mapped and coregistered to Viking digital photomosaics. It is shown that although there is a high degree of overall spectral variability on the plateau, the key indicators of mafic mineralogy are relatively homogeneous.

  1. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  2. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  3. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  4. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    PubMed

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm.

  5. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  6. Cyclic diGMP regulates production of sortase substrates of Clostridium difficile and their surface exposure through ZmpI protease-mediated cleavage.

    PubMed

    Peltier, Johann; Shaw, Helen A; Couchman, Edward C; Dawson, Lisa F; Yu, Lu; Choudhary, Jyoti S; Kaever, Volkhard; Wren, Brendan W; Fairweather, Neil F

    2015-10-02

    In Gram-positive pathogens, surface proteins may be covalently anchored to the bacterial peptidoglycan by sortase, a cysteine transpeptidase enzyme. In contrast to other Gram-positive bacteria, only one single sortase enzyme, SrtB, is conserved between strains of Clostridium difficile. Sortase-mediated peptidase activity has been reported in vitro, and seven potential substrates have been identified. Here, we demonstrate the functionality of sortase in C. difficile. We identify two sortase-anchored proteins, the putative adhesins CD2831 and CD3246, and determine the cell wall anchor structure of CD2831. The C-terminal PPKTG sorting motif of CD2831 is cleaved between the threonine and glycine residues, and the carboxyl group of threonine is amide-linked to the side chain amino group of diaminopimelic acid within the peptidoglycan peptide stem. We show that CD2831 protein levels are elevated in the presence of high intracellular cyclic diGMP (c-diGMP) concentrations, in agreement with the control of CD2831 expression by a c-diGMP-dependent type II riboswitch. Low c-diGMP levels induce the release of CD2831 and presumably CD3246 from the surface of cells. This regulation is mediated by proteolytic cleavage of CD2831 and CD3246 by the zinc metalloprotease ZmpI, whose expression is controlled by a type I c-diGMP riboswitch. These data reveal a novel regulatory mechanism for expression of two sortase substrates by the secondary messenger c-diGMP, on which surface anchoring is dependent.

  7. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  8. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  9. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  10. Evidence for surface rupture in 1868 on the Hayward fault in north Oakland and major rupturing in prehistoric earthquakes

    USGS Publications Warehouse

    Lienkaemper, J.J.; Williams, P.L.

    1999-01-01

    WGCEP90 estimated the Hayward fault to have a high probability (0.45 in 30 yr) of producing a future M7 Bay Area earthquake. This was based on a generic recurrence time and an unverified segmentation model, because there were few direct observations for the southern fault and none for the northern Hayward fault. To better constrain recurrence and segmentation of the northern Hayward fault, we trenched in north Oakland. Unexpectedly, we observed evidence of surface rupture probably from the M7 1868 earthquake. This extends the limit of that surface rupture 13 km north of the segmentation boundary used in the WGCEP90 model and forces serious re-evaluation of the current two-segment paradigm. Although we found that major prehistoric ruptures have occurred here, we could not radiocarbon date them. However, the last major prehistoric event appears correlative with a recently recognized event 13 km to the north dated AD 1640-1776. Copyright 1999 by the American Geophysical Union.

  11. Thermostability of Reovirus Disassembly Intermediates (ISVPs) Correlates with Genetic, Biochemical, and Thermodynamic Properties of Major Surface Protein μ1

    PubMed Central

    Middleton, Jason K.; Severson, Tonya F.; Chandran, Kartik; Gillian, Anne Lynn; Yin, John; Nibert, Max L.

    2002-01-01

    Kinetic analyses of infectivity loss during thermal inactivation of reovirus particles revealed substantial differences between virions and infectious subvirion particles (ISVPs), as well as between the ISVPs of reoviruses type 1 Lang (T1L) and type 3 Dearing (T3D). The difference in thermal inactivation of T1L and T3D ISVPs was attributed to the major surface protein μ1 by genetic analyses with reassortant viruses and recoated cores. Irreversible conformational changes in ISVP-bound μ1 were shown to accompany thermal inactivation. The thermal inactivation of ISVPs approximated first-order kinetics over a range of temperatures, permitting the use of Arrhenius plots to estimate activation enthalpies and entropies that account for the different behaviors of T1L and T3D. An effect similar to enthalpy-entropy compensation was additionally noted for the ISVPs of these two isolates. Kinetic analyses with other ISVP-like particles, including ISVPs of a previously reported thermostable mutant, provided further insights into the role of μ1 as a determinant of thermostability. Intact virions, which contain ς3 bound to μ1 as their major surface proteins, exhibited greater thermostability than ISVPs and underwent thermal inactivation with kinetics that deviated from first order, suggesting a role for ς3 in both these properties. The distinct inactivation behaviors of ISVPs are consistent with their role as an essential intermediate in reovirus entry. PMID:11773381

  12. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  13. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  14. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions.

    PubMed

    Malloy, Jaret L; Veldhuizen, Ruud A W; Thibodeaux, Brett A; O'Callaghan, Richard J; Wright, Jo Rae

    2005-02-01

    Pulmonary surfactant has two distinct functions within the lung: reduction of surface tension at the air-liquid interface and participation in innate host defense. Both functions are dependent on surfactant-associated proteins. Pseudomonas aeruginosa is primarily responsible for respiratory dysfunction and death in cystic fibrosis patients and is also a leading pathogen in nosocomial pneumonia. P. aeruginosa secretes a number of proteases that contribute to its virulence. We hypothesized that P. aeruginosa protease IV degrades surfactant proteins and results in a reduction in pulmonary surfactant host defense and biophysical functions. Protease IV was isolated from cultured supernatant of P. aeruginosa by gel chromatography. Incubation of cell-free bronchoalveolar lavage fluid with protease IV resulted in degradation of surfactant proteins (SP)-A, -D, and -B. SPs were degraded in a time- and dose-dependent fashion by protease IV, and degradation was inhibited by the trypsin-like serine protease inhibitor Nalpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK). Degradation by protease IV inhibited SP-A- and SP-D-mediated bacterial aggregation and uptake by macrophages. Surfactant treated with protease IV was unable to reduce surface tension as effectively as untreated surfactant, and this effect was inhibited by TLCK. We speculate that protease IV may be an important contributing factor to the development and propagation of acute lung injury associated with P. aeruginosa via loss of surfactant function within the lung.

  15. Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1.

    PubMed

    Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E

    2008-05-01

    A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages

  16. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  17. A Study of Solar Magnetic Fields Below the Surface, at the Surface, and in the Solar Atmosphere - Understanding the Cause of Major Solar Activity

    NASA Astrophysics Data System (ADS)

    Chintzoglou, Georgios

    2016-05-01

    The fundamental processes regarding the origin, emergence and evolution of solar magnetic fields as well as the generation of solar activity are largely unknown or remain controversial. In this dissertation, multiple important issues regarding solar magnetism and activities are addressed, based on advanced observations obtained by the AIA and HMI instruments aboard the SDO spacecraft.This dissertation addresses the 3D magnetic structure of complex emerging Active Regions (ARs). In ARs the photospheric fields might show all aspects of complexity, from simple bipolar regions to extremely complex multipolar surface magnetic distributions. Here, we introduce a novel technique to infer the subphotospheric configuration of emerging magnetic flux tubes forming ARs on the surface. Using advanced 3D visualization tools with this technique on a complex flare and CME productive AR, we found that the magnetic flux tubes forming the complex AR may originate from a single progenitor flux tube in the SCZ. The complexity can be explained as a result of vertical and horizontal bifurcations that occurred on the progenitor flux tube.In addition, this dissertation proposes a new scenario on the origin of major solar activity. When more than one flux tubes are in close proximity to each other while they break through the photospheric surface, collision and shearing may occur as they emerge. Once this collisional shearing occurs between nonconjugated sunspots (opposite polarities not belonging to the same bipole), major solar activity is triggered. The collision and shearing occur due to the natural separation of polarities in emerging bipoles. In this continuous collision, more poloidal flux is added to the system effectively creating an expanding MFR into the corona, accompanied by filament formation above the PIL together with flare activity and CMEs. Our results reject two popular scenarios on the possible cause of solar eruptions (1) shearing motion between conjugate polarities, (2

  18. A study of solar magnetic fields below the surface, at the surface, and in the solar atmosphere - understanding the cause of major solar activity

    NASA Astrophysics Data System (ADS)

    Chintzoglou, Georgios

    2016-04-01

    Magnetic fields govern all aspects of solar activity from the 11-year solar cycle to the most energetic events in the solar system, such as solar flares and Coronal Mass Ejections (CMEs). As seen on the surface of the sun, this activity emanates from localized concentrations of magnetic fields emerging sporadically from the solar interior. These locations are called solar Active Regions (ARs). However, the fundamental processes regarding the origin, emergence and evolution of solar magnetic fields as well as the generation of solar activity are largely unknown or remain controversial. In this dissertation, multiple important issues regarding solar magnetism and activities are addressed, based on advanced observations obtained by AIA and HMI instruments aboard the SDO spacecraft. First, this work investigates the formation of coronal magnetic flux ropes (MFRs), structures associated with major solar activity such as CMEs. In the past, several theories have been proposed to explain the cause of this major activity, which can be categorized in two contrasting groups (a) the MFR is formed in the eruption, and (b) the MFR pre-exists the eruption. This remains a topic of heated debate in modern solar physics. This dissertation provides a complete treatment of the role of MFRs from their genesis all the way to their eruption and even destruction. The study has uncovered the pre-existence of two weakly twisted MFRs, which formed during confined flaring 12 hours before their associated CMEs. Thus, it provides unambiguous evidence for MFRs truly existing before the CME eruptions, resolving the pre-existing MFR controversy. Second, this dissertation addresses the 3-D magnetic structure of complex emerging ARs. In ARs the photospheric fields might show all aspects of complexity, from simple bipolar regions to extremely complex multi-polar surface magnetic distributions. In this thesis, we introduce a novel technique to infer the subphotospheric configuration of emerging

  19. Approaches for the generation of active papain-like cysteine proteases from inclusion bodies of Escherichia coli.

    PubMed

    Ling, Chunfang; Zhang, Junyan; Lin, Deqiu; Tao, Ailin

    2015-05-01

    Papain-like cysteine proteases are widely expressed, fulfill specific functions in extracellular matrix turnover, antigen presentation and processing events, and may represent viable drug targets for major diseases. In depth and rigorous studies of the potential for these proteins to be targets for drug development require sufficient amounts of protease protein that can be used for both experimental and therapeutic purposes. Escherichia coli was widely used to express papain-like cysteine proteases, but most of those proteases are produced in insoluble inclusion bodies that need solubilizing, refolding, purifying and activating. Refolding is the most critical step in the process of generating active cysteine proteases and the current approaches to refolding include dialysis, dilution and chromatography. Purification is mainly achieved by various column chromatography. Finally, the attained refolded proteases are examined regarding their protease structures and activities.

  20. Distribution of major and trace elements in surface sediments of the western Gulf of Thailand: Implications to modern sedimentation

    NASA Astrophysics Data System (ADS)

    Liu, Shengfa; Shi, Xuefa; Yang, Gang; Khokiattiwong, Somkiat; Kornkanitnan, Narumol

    2016-04-01

    In this study, we analyze major and trace elements (SiO2, Al2O3, Fe2O3, CaO, K2O, MgO, Na2O, TiO2, P2O5, MnO, Cu, Pb, Ba, Sr, V, Zn, Co, Ni, Cr, and Zr) and grain size of 157 surface sediment samples from the western Gulf of Thailand (GoT). On the basis of the space distribution characteristics, the study area can be classified into three geochemical provinces. Province I covers the northern and northwestern coastal zones of the GoT, including the whole upper GoT and thus the sediments from the rivers in the area. It contains high contents of SiO2. Province II is located in the middle of the GoT and has similar geochemistry composition as the South China Sea (SCS). It contains sediments that are characterized by higher contents of Na2O, TiO2, Ba, Cr, V, Zn, Zr, and Ni. Province Ш is located in the lower GoT, close to Malaysia. Major and trace elements in this area showed complex distribution patterns, which may be due to terrestrial materials from Malay rivers combining with some sediments from the SCS in this province. The results also indicate that grain size is the controlling factor in elemental contents, and that the hydrodynamic environment and mineral composition of the sediments play an important role in the distribution of these elements. The anthropogenic impact of heavy metal introduction (especially Cr, Zn, Cu, and Pb) can be seen in surface sediments from the nearshore region of Chantaburi province and north of Samui Island.

  1. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  2. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  3. Front surface field formation for majority carriers by functional p-NiO layer employed Si solar cell

    NASA Astrophysics Data System (ADS)

    Patel, Dipal B.; Kim, Hong-Sik; Patel, Malkeshkumar; Chauhan, Khushbu R.; Park, Jeong Eun; Lim, Donggun; Kim, Joondong

    2016-09-01

    An optically transparent and electrically conductive p-NiO layer was deposited on a conventional n-Si/p-Si solar cell, which improved the device performance. The transmittance and reflectance properties of the p-NiO layer were found to be much better than the SiNx layer in the visible light region. Impedance spectroscopic study under varying bias and illumination conditions was carried out to understand the underlying mechanisms governing the device performance. An AC signal analysis revealed that the p-NiO layer acted as a front surface field region for majority charge carriers. In addition, the p-NiO layer significantly improved Si solar cell performances due to the improved properties of parasitic resistances. The optically transparent NiO layered Si device (p-NiO/n-Si/p-Si) spontaneously enhanced the electrical properties, resulting in the substantially improved fill factor value of 74% from 34.3% of the bare n-Si/p-Si device. The existence of a front surface field increased the lifetime of carriers to 92 μs for the p-NiO/n-Si/p-Si solar cell compared to only 43 μs for an n-Si/p-Si cell. We may suggest a functional NiO layer to the efficient designs for Si solar cells.

  4. A survey of major east coast snowstorms, 1960-1983. Part 2. Summary of surface and upperlevel characteristics

    NASA Technical Reports Server (NTRS)

    Kocin, P. J.; Uccellini, L. W.

    1985-01-01

    Surface and upper-level characteristics of selected meteorological fields are summarized. Two major types of sea level development are described and applied to the cases at hand, with a few storm systems showing characteristics of both types. Aspects such as rapid sea level deepening, coastal frontogenesis, cold air damming, low level jet formation, the development of an S-shaped isotherm pattern, diffluence downwind of a negatively tilted upper level trough axis, upper level confluence and an increase of geopotential heights at the base of the upper level trough characterized the pre-cyclogenetic and cyclogenetic periods of many of the storm systems. Large variability was also observed, especially with regard to the spatial dimensions of the surface and upper level systems, as well as variations in trough/ridge amplification and the evolution of upper level jet streak systems. The influence of transverse circulations associated with a confluent jet streak entrance region and the diffluent exit region of a jet streak/trough system on the production of snowfall is also discussed.

  5. The prevalence of mutations in the major hydrophilic region of the surface antigen of hepatitis B virus varies with subgenotype.

    PubMed

    Wang, X Y; Harrison, T J; He, X; Chen, Q Y; Li, G J; Liu, M H; Li, H; Yang, J Y; Fang, Z L

    2015-12-01

    Mutations in the major hydrophilic region (MHR) of the surface antigen of hepatitis B virus (HBV) may result in vaccine escape, failure of immunotherapy and antiviral resistance. These mutants may be transmitted and constitute a public health threat. We aimed to determine the prevalence of MHR mutations of HBV in areas of high endemicity in Guangxi, China. HBV surface gene was analysed from 278 HBsAg-positive asymptomatic individuals recruited from Guangxi using cluster sampling. Three genotypes, B, C and I, were identified. The overall prevalence of MHR mutations is 17·6%. The prevalence of MHR mutations in genotype B (15·1%) is not significantly different from that in genotype C (16·4%). However, the prevalence in subgenotype C5 (31·1%) is significantly higher than in subgenotype C2 (13·0%) (χ 2 = 6·997, P < 0·05). The prevalence of escape mutations and overlapping polymerase substitutions in subgenotype C5 is significantly higher than in subgenotypes B2 and C2. In total, 7·9% of MHR mutants are escape mutations and 72·1% of MHR mutations produced amino-acid changes in the overlapping polymerase, including resistance mutations to entecavir. Our results suggest that the prevalence of MHR mutations varies with subgenotype. The prevalence of escape mutations and polymerase mutations may be associated with subgenotype.

  6. Mm19, a Mycoplasma meleagridis Major Surface Nuclease that Is Related to the RE_AlwI Superfamily of Endonucleases

    PubMed Central

    Yacoub, Elhem; Ben Abdelmoumen Mardassi, Boutheina

    2016-01-01

    Mycoplasma meleagridis infection is widespread in turkeys, causing poor growth and feathering, airsacculitis, osteodystrophy, and reduction in hatchability. Like most mycoplasma species, M. meleagridis is characterized by its inability to synthesize purine and pyrimidine nucleotides de novo. Consistent with this intrinsic deficiency, we here report the cloning, expression, and characterization of a M. meleagridis gene sequence encoding a major surface nuclease, referred to as Mm19. Mm19 consists of a 1941- bp ORF encoding a 646-amino-acid polypeptide with a predicted molecular mass of 74,825 kDa. BLASTP analysis revealed a significant match with the catalytic/dimerization domain of type II restriction enzymes of the RE_AlwI superfamily. This finding is consistent with the genomic location of Mm19 sequence, which dispalys characteristics of a typical type II restriction-modification locus. Like intact M. meleagridis cells, the E. coli-expressed Mm19 fusion product was found to exhibit a nuclease activity against plasmid DNA, double-stranded DNA, single-stranded DNA, and RNA. The Mm19-associated nuclease activity was consistently enhanced with Mg2+ divalent cations, a hallmark of type II restriction enzymes. A rabbit hyperimmune antiserum raised against the bacterially expressed Mm19 strongly reacted with M. meleagridis intact cells and fully neutralized the surface-bound nuclease activity. Collectively, the results show that M. meleagridis expresses a strong surface-bound nuclease activity, which is the product of a single gene sequence that is related to the RE_AlwI superfamily of endonucleases. PMID:27010566

  7. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  8. Secreted Aspergillus fumigatus Protease Alp1 Degrades Human Complement Proteins C3, C4, and C5▿

    PubMed Central

    Behnsen, Judith; Lessing, Franziska; Schindler, Susann; Wartenberg, Dirk; Jacobsen, Ilse D.; Thoen, Marcel; Zipfel, Peter F.; Brakhage, Axel A.

    2010-01-01

    The opportunistic human pathogenic fungus Aspergillus fumigatus is a major cause of fungal infections in immunocompromised patients. Innate immunity plays an important role in the defense against infections. The complement system represents an essential part of the innate immune system. This cascade system is activated on the surface of A. fumigatus conidia and hyphae and enhances phagocytosis of conidia. A. fumigatus conidia but not hyphae bind to their surface host complement regulators factor H, FHL-1, and CFHR1, which control complement activation. Here, we show that A. fumigatus hyphae possess an additional endogenous activity to control complement activation. A. fumigatus culture supernatant efficiently cleaved complement components C3, C4, C5, and C1q as well as immunoglobulin G. Secretome analysis and protease inhibitor studies identified the secreted alkaline protease Alp1, which is present in large amounts in the culture supernatant, as the central molecule responsible for this cleavage. An alp1 deletion strain was generated, and the culture supernatant possessed minimal complement-degrading activity. Moreover, protein extract derived from an Escherichia coli strain overproducing Alp1 cleaved C3b, C4b, and C5. Thus, the protease Alp1 is responsible for the observed cleavage and degrades a broad range of different substrates. In summary, we identified a novel mechanism in A. fumigatus that contributes to evasion from the host complement attack. PMID:20498262

  9. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  10. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  11. Optimisation of the detection of bacterial proteases using adsorbed immunoglobulins as universal substrates.

    PubMed

    Abuknesha, Ram A; Jeganathan, Fiona; Wildeboer, Dirk; Price, Robert G

    2010-06-15

    Bacterial proteases, Type XXIV from Bacillus licheniformens and Type XIV from Streptomyces griseus, were used to investigate the utility and optimisation of a solid phase assay for proteases, using immunoglobulin proteins as substrates. Immunoglobulins IgA and IgG were adsorbed on to surfaces of ELISA plates and exposed to various levels of the bacterial proteases which led to digestion and desorption of proportional amounts of the immunoglobulins. The assay signal was developed by measuring the remaining proteins on the polystyrene surface with appropriate enzyme-labelled anti-immunoglobulin reagents. The assay was fully optimised in terms of substrate levels employing ELISA techniques to titrate levels of adsorbed substrates and protease analytes. The critical factor which influences assay sensitivity was found to be the substrate concentration, the levels of adsorbed immunoglobulins. The estimated detection limits for protease XXIV and XIV were 10micro units/test and 9micro units/test using IgA as a substrate. EC(50) values were calculated as 213 and 48micro units/test for each protease respectively. Using IgG as a substrate, the estimated detection limits were 104micro units/test for protease XXIV and 9micro units/test for protease XIV. EC(50) values were calculated at 529micro units/test and 28micro units/test for protease XXIV and XIV respectively. The solid phase protease assay required no modification of the substrates and the adsorption step is merely simple addition of immunoglobulins to ELISA plates. Adsorption of the immunoglobulins to polystyrene enabled straightforward separation of reaction mixtures prior to development of assay signal. The assay exploits the advantages of the technical facilities of ELISA technology and commercially available reagents enabling the detection and measurement of a wide range of proteases. However, the key issue was found to be that in order to achieve the potential performance of the simple assay, optimisation of the

  12. Molecular docking and structure-based virtual screening studies of potential drug target, CAAX prenyl proteases, of Leishmania donovani.

    PubMed

    Singh, Shalini; Vijaya Prabhu, Sitrarasu; Suryanarayanan, Venkatesan; Bhardwaj, Ruchika; Singh, Sanjeev Kumar; Dubey, Vikash Kumar

    2016-11-01

    Targeting CAAX prenyl proteases of Leishmania donovani can be a good approach towards developing a drug molecule against Leishmaniasis. We have modeled the structure of CAAX prenyl protease I and II of L. donovani, using homology modeling approach. The structures were further validated using Ramachandran plot and ProSA. Active site prediction has shown difference in the amino acid residues present at the active site of CAAX prenyl protease I and CAAX prenyl protease II. The electrostatic potential surface of the CAAX prenyl protease I and II has revealed that CAAX prenyl protease I has more electropositive and electronegative potentials as compared CAAX prenyl protease II suggesting significant difference in their activity. Molecular docking with known bisubstrate analog inhibitors of protein farnesyl transferase and peptidyl (acyloxy) methyl ketones reveals significant binding of these molecules with CAAX prenyl protease I, but comparatively less binding with CAAX prenyl protease II. New and potent inhibitors were also found using structure-based virtual screening. The best docked compounds obtained from virtual screening were subjected to induced fit docking to get best docked configurations. Prediction of drug-like characteristics has revealed that the best docked compounds are in line with Lipinski's rule. Moreover, best docked protein-ligand complexes of CAAX prenyl protease I and II are found to be stable throughout 20 ns simulation. Overall, the study has identified potent drug molecules targeting CAAX prenyl protease I and II of L. donovani whose drug candidature can be verified further using biochemical and cellular studies.

  13. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  14. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  15. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  16. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  17. Purification and properties of a 75-kilodalton major protein, an immunodominant surface antigen, from the oral anaerobe Bacteroides gingivalis.

    PubMed Central

    Yoshimura, F; Watanabe, K; Takasawa, T; Kawanami, M; Kato, H

    1989-01-01

    A 75-kilodalton major protein (75K protein) was purified to homogeneity from the cell lysate fraction and the envelope of Bacteroides gingivalis 381. The 75K protein was originally present in the outer membrane or the outermost part of this organism as a large, stable complex with an apparent molecular weight of about 2,000,000. Heating at 80 degrees C and at higher temperatures in the presence of sodium dodecyl sulfate was needed to completely dissociate it to monomers. Amino acid analysis revealed that the 75K protein had about 50% nonpolar amino acids. Various strains of B. gingivalis but not other bacteria, including oral Bacteroides species tested, contained serologically related 75K proteins when tested in Western blotting (immunoblotting) analysis. The abundance and localization of the 75K protein in this organism suggest that it has the potential to participate in the host-parasite interaction in infection. The 75K protein was, indeed, strongly recognized in patients with adult periodontal diseases. Immunoblotting with sera from patients and with rabbit antisera generated by intravenous inoculations of whole B. gingivalis cells revealed that the 75K protein was an immunodominant antigen on the surface of B. gingivalis. Images PMID:2553610

  18. Identification of the Neutralizing Epitopes of Merkel Cell Polyomavirus Major Capsid Protein within the BC and EF Surface Loops

    PubMed Central

    Fleury, Maxime J. J.; Nicol, Jérôme T. J.; Samimi, Mahtab; Arnold, Françoise; Cazal, Raphael; Ballaire, Raphaelle; Mercey, Olivier; Gonneville, Hélène; Combelas, Nicolas; Vautherot, Jean-Francois; Moreau, Thierry; Lorette, Gérard; Coursaget, Pierre; Touzé, Antoine

    2015-01-01

    Merkel cell polyomavirus (MCPyV) is the first polyomavirus clearly associated with a human cancer, i.e. the Merkel cell carcinoma (MCC). Polyomaviruses are small naked DNA viruses that induce a robust polyclonal antibody response against the major capsid protein (VP1). However, the polyomavirus VP1 capsid protein epitopes have not been identified to date. The aim of this study was to identify the neutralizing epitopes of the MCPyV capsid. For this goal, four VP1 mutants were generated by insertional mutagenesis in the BC, DE, EF and HI loops between amino acids 88-89, 150-151, 189-190, and 296-297, respectively. The reactivity of these mutants and wild-type VLPs was then investigated with anti-VP1 monoclonal antibodies and anti-MCPyV positive human sera. The findings together suggest that immunodominant conformational neutralizing epitopes are present at the surface of the MCPyV VLPs and are clustered within BC and EF loops. PMID:25812141

  19. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  20. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  1. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola

    2007-01-01

    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  2. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.

    PubMed

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M

    2014-08-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding.

  3. Efficient proteolysis and application of an alkaline protease from halophilic Bacillus sp. EMB9.

    PubMed

    Sinha, Rajeshwari; Srivastava, A K; Khare, S K

    2014-10-03

    A salt-stable alkaline protease from moderately halophilic Bacillus sp. EMB9, isolated from the western coast of India, is described. This protease was capable of efficiently removing silver from used/waste X-Ray films, as well as hydrolyzing defatted soy flour with 31% degree of hydrolysis (DH). Production of the protease was optimized by using response surface methodology. Ca(2+) and NaCl were the most critical factors in enhancing the yield. Under optimized culture conditions, a maximum of 369 U protease/mL was obtained, which is quite comparable to the yields of commercial proteases. The elevated production level coupled with ability to efficiently hydrolyze protein-laden soy flour and complete recovery of silver from used X-Ray films makes it a prospective industrial enzyme.

  4. Role of Allergen Source-Derived Proteases in Sensitization via Airway Epithelial Cells

    PubMed Central

    Matsumura, Yasuhiro

    2012-01-01

    Protease activity is a characteristic common to many allergens. Allergen source-derived proteases interact with lung epithelial cells, which are now thought to play vital roles in both innate and adaptive immune responses. Allergen source-derived proteases act on airway epithelial cells to induce disruption of the tight junctions between epithelial cells, activation of protease-activated receptor-2, and the production of thymic stromal lymphopoietin. These facilitate allergen delivery across epithelial layers and enhance allergenicity or directly activate the immune system through a nonallergic mechanism. Furthermore, they cleave regulatory cell surface molecules involved in allergic reactions. Thus, allergen source-derived proteases are a potentially critical factor in the development of allergic sensitization and appear to be strongly associated with heightened allergenicity. PMID:22523502

  5. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms

    PubMed Central

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M.

    2014-01-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. PMID:24878526

  6. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  7. Full quantum mechanical study of binding of HIV-1 protease drugs

    NASA Astrophysics Data System (ADS)

    Zhang, Da W.; Zhang, John Z. H.

    Fully quantum mechanical studies of detailed binding interactions between HIV-1 protease and six FDA (Food and Drug Administration)-approved drugs (saquinavir, indinavir, ritonavir, nelfinavir, amprenavir, and lopinavir) are carried out using a recently developed MFCC (molecular fractionation with conjugate caps) method. The MFCC calculation produces a quantum mechanical interaction spectrum for any protease drug binding complex. Detailed quantitative analysis on binding of lopinavir to specific residues of the protease is given from the current study. The present calculation shows that the dominant binding of lopinavir to the protease is through the formation of a strong hydrogen bond between the central hydroxyl group of the drug to the aspartate oxygen of Asp25 in one of the two chains of the protease (A chain). This is closely followed by hydrogen binding of the drug to Asp29 in the B chain and somewhat weak hydrogen bonding to Asp30, Gly27, Gly48, and Ile50 in both chains. By partitioning all six drugs into four building blocks besides the central component containing the hydroxyl group, MFCC calculation finds that block III has essentially no binding interaction with the protease and the major binding interactions of these drugs are from blocks II and IV, in addition to the dominant central hydroxyl group. This detailed quantitative information on drug binding to the protease is very useful in rational design of new and improved inhibitors of HIV-1 protease and its mutants.

  8. Variability of Near-stream, Sub-surface Major-ion and Tracer Concentrations in an Acid Mine Drainage Environment

    NASA Astrophysics Data System (ADS)

    Bencala, K. E.; Kimball, B. A.; Runkel, R. L.

    2006-12-01

    In acid mine drainage environments, tracer-injection and synoptic sampling approaches provide tools for making operational estimates of solute loading within a stream segment. Identifying sub-surface contaminant sources remains a challenge both for characterization of in-stream metal loading and hydrological process research. There is a need to quantitatively define the character and source of contaminants entering streams from ground-water pathways, as well as the potential for changes in water chemistry and contaminant concentrations along these flow paths crossing the sediment-water interface. Complicating the identification of inflows is the mixing of solute sources which may occur in the `near-stream' subsurface areas and specifically along hyporheic exchange flows (HEFs). In Mineral Creek (Silverton, Colorado), major-ion (SO42-, Cl-, Na+, Ca2+, Mg2+) meter-scale sampling shows that subsurface inflows and likely HEFs occur in a hydro- geochemical setting of significant, one order-of-magnitude, spatial variation in the solute concentrations. Transient Storage Models (TSMs) are a tool for interpreting the in-stream responses of solute transport in streams influenced by hyporheic exchange flows. Simulations using the USGS TSM code OTIS are interpreted as suggesting that in Mineral Creek the strong concentration `tailing' of bromide following the tracer injection occurred, at least in part, from HEFs in a hydro - solute transport setting of likely multiple, dispersed and mixed sources of water along a 64 m sub-reach of the nominally gaining stream. In acid mine drainage environments, the ability to distinguish between local and deep solute sources is critical in modeling reactive transport along the stream, as well as in identifying the geochemical evolution of dispersed, subsurface inflows thorough the catchment.

  9. Interaction between Simian Virus 40 Major Capsid Protein VP1 and Cell Surface Ganglioside GM1 Triggers Vacuole Formation

    PubMed Central

    Luo, Yong; Motamedi, Nasim; Magaldi, Thomas G.; Gee, Gretchen V.; Atwood, Walter J.

    2016-01-01

    ABSTRACT Simian virus 40 (SV40), a polyomavirus that has served as an important model to understand many aspects of biology, induces dramatic cytoplasmic vacuolization late during productive infection of monkey host cells. Although this activity led to the discovery of the virus in 1960, the mechanism of vacuolization is still not known. Pentamers of the major SV40 capsid protein VP1 bind to the ganglioside GM1, which serves as the cellular receptor for the virus. In this report, we show that binding of VP1 to cell surface GM1 plays a key role in SV40 infection-induced vacuolization. We previously showed that SV40 VP1 mutants defective for GM1 binding fail to induce vacuolization, even though they replicate efficiently. Here, we show that interfering with GM1-VP1 binding by knockdown of GM1 after infection is established abrogates vacuolization by wild-type SV40. Vacuole formation during permissive infection requires efficient virus release, and conditioned medium harvested late during SV40 infection rapidly induces vacuoles in a VP1- and GM1-dependent fashion. Furthermore, vacuolization can also be induced by a nonreplicating SV40 pseudovirus in a GM1-dependent manner, and a mutation in BK pseudovirus VP1 that generates GM1 binding confers vacuole-inducing activity. Vacuolization can also be triggered by purified pentamers of wild-type SV40 VP1, but not by GM1 binding-defective pentamers or by intracellular expression of VP1. These results demonstrate that SV40 infection-induced vacuolization is caused by the binding of released progeny viruses to GM1, thereby identifying the molecular trigger for the activity that led to the discovery of SV40. PMID:27006465

  10. Modification of the Staphylococcus aureus fibronectin binding phenotype by V8 protease.

    PubMed Central

    McGavin, M J; Zahradka, C; Rice, K; Scott, J E

    1997-01-01

    The amount of cell surface fibronectin (Fn)-binding protein (FnBP) adhesin expressed by Staphylococcus aureus is maximal during exponential growth but disappears rapidly as the culture progresses into stationary phase. To identify factors responsible for the loss of cell surface FnBP, a culture of S. aureus L170, which shows high levels of Fn binding, was supplemented at the time of inoculation with concentrated stationary-phase supernatant from S. aureus L530, a strain which binds Fn poorly. The resulting exponential-phase cells were devoid of FnBP. The factor responsible for this activity was purified from the culture supernatant and identified as V8 protease. When cultured with 375 ng of exogenous V8 protease ml(-1), exponential-phase cells of S. aureus L170 were devoid of cell surface FnBP, and concentrations as low as 23 ng x ml(-1) resulted in reduced amounts of FnBP. Addition of the protease inhibitor alpha2-macroglobulin to the culture medium prevented the growth-phase-dependent loss of cell surface FnBP, whereas growth with exogenous V8 protease resulted in reduced adherence to the solid-phase N-terminal fragment of Fn and to the extracellular matrix synthesized by fetal rabbit lung fibroblasts. Although FnBP was extremely sensitive to V8 protease, exogenous protease did not exert a significant influence on the amount of cell surface protein A. However, a limited number of other high-molecular-weight cell surface proteins were also sensitive to V8 protease. Therefore, both the adhesive phenotype and cell surface protein profile of S. aureus can be modified by V8 protease activity. PMID:9199429

  11. Activation of influenza viruses by proteases from host cells and bacteria in the human airway epithelium.

    PubMed

    Böttcher-Friebertshäuser, Eva; Klenk, Hans-Dieter; Garten, Wolfgang

    2013-11-01

    Influenza is an acute infection of the respiratory tract, which affects each year millions of people. Influenza virus infection is initiated by the surface glycoprotein hemagglutinin (HA) through receptor binding and fusion of viral and endosomal membranes. HA is synthesized as a precursor protein and requires cleavage by host cell proteases to gain its fusion capacity. Although cleavage of HA is crucial for virus infectivity, little was known about relevant proteases in the human airways for a long time. Recent progress in the identification and characterization of HA-activating host cell proteases has been considerable however and supports the idea of targeting HA cleavage as a novel approach for influenza treatment. Interestingly, certain bacteria have been demonstrated to support HA activation either by secreting proteases that cleave HA or due to activation of cellular proteases and thereby may contribute to virus spread and enhanced pathogenicity. In this review, we give an overview on activation of influenza viruses by proteases from host cells and bacteria with the main focus on recent progress on HA cleavage by proteases HAT and TMPRSS2 in the human airway epithelium. In addition, we outline investigations of HA-activating proteases as potential drug targets for influenza treatment.

  12. Proteases, cystic fibrosis and the epithelial sodium channel (ENaC).

    PubMed

    Thibodeau, P H; Butterworth, M B

    2013-02-01

    Proteases perform a diverse array of biological functions. From simple peptide digestion for nutrient absorption to complex signaling cascades, proteases are found in organisms from prokaryotes to humans. In the human airway, proteases are associated with the regulation of the airway surface liquid layer, tissue remodeling, host defense and pathogenic infection and inflammation. A number of proteases are released in the airways under both physiological and pathophysiological states by both the host and invading pathogens. In airway diseases such as cystic fibrosis, proteases have been shown to be associated with increased morbidity and airway disease progression. In this review, we focus on the regulation of proteases and discuss specifically those proteases found in human airways. Attention then shifts to the epithelial sodium channel (ENaC), which is regulated by proteolytic cleavage and that is considered to be an important component of cystic fibrosis disease. Finally, we discuss bacterial proteases, in particular, those of the most prevalent bacterial pathogen found in cystic fibrosis, Pseudomonas aeruginosa.

  13. Dose-dependent induction of IL-6 by plant-derived proteases in vitro

    PubMed Central

    Rose, B; Herder, C; Löffler, H; Meierhoff, G; Schloot, N C; Walz, M; Martin, S

    2006-01-01

    Oral administration of proteases such as bromelain and papain is commonly used in patients with a wide range of inflammatory conditions, but their molecular and cellular mechanisms of action are still poorly understood. The aim of our study was to investigate the impact of these proteases on the release of interleukin-6 (IL-6) and other cytokines in the recently described modified mixed lymphocyte culture (MMLC) test system which is based on the mutual interaction of cells of the innate and adaptive immunity. Bromelain and papain enhanced IL-6 production dose-dependently up to 400-fold in MMLC before and up to 30-fold after neutralization of LPS content of proteases using polymyxin B, indicating that IL-6 induction by protease treatment was attributable to both protease action and LPS content of enzyme preparations. The production of IFNγ and IL-10 was not altered by bromelain or papain, indicating a selective and differential immune activation. Both proteases impaired cytokine stability, cell proliferation and expression of cell surface molecules like CD14 only marginally, suggesting no impact of these mechanisms on protease-mediated cytokine release. These findings might provide the mechanistic rationale for the current use of proteases in wound healing and tissue regeneration since these processes depend on IL-6 induction. PMID:16367938

  14. Structural basis for substrate specificity of alphavirus nsP2 proteases.

    PubMed

    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J

    2010-08-24

    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  15. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  16. Protease-inhibitor interaction predictions: Lessons on the complexity of protein-protein interactions.

    PubMed

    Fortelny, Nikolaus; Butler, Georgina S; Overall, Christopher Mark; Pavlidis, Paul

    2017-04-06

    Protein interactions shape proteome function and thus biology. Identification of protein interactions is a major goal in molecular biology, but biochemical methods, although improving, remain limited in coverage and accuracy. Whereas computational predictions can guide biochemical experiments, low validation rates of predictions remain a major limitation. Here, we investigated computational methods in the prediction of a specific type of interaction, the inhibitory interactions between proteases and their inhibitors. Proteases generate thousands of proteoforms that dynamically shape the functional state of proteomes. Despite the important regulatory role of proteases, knowledge of their inhibitors remains largely incomplete with the vast majority of proteases lacking an annotated inhibitor. To link inhibitors to their target proteases on a large scale, we applied computational methods to predict inhibitory interactions between proteases and their inhibitors based on complementary data including coexpression, phylogenetic similarity, structural information, co-annotation, and colocalization, and also surveyed general protein interaction networks for potential inhibitory interactions. In testing nine predicted interactions biochemically, we validated the inhibition of kallikrein 5 by serpin B12. Despite the use of a wide array of complementary data, we found a high false positive rate of computational predictions in biochemical follow-up. Based on a protease-specific definition of true negatives derived from the biochemical classification of proteases and inhibitors, we analyzed prediction accuracy of individual features. Thereby we identified feature-specific limitations, which also affected general protein interaction prediction methods. Interestingly, proteases were often not coexpressed with most of their functional inhibitors, contrary to what is commonly assumed and extrapolated predominantly from cell culture experiments. Predictions of inhibitory interactions

  17. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  18. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  19. Design of new potent HTLV-1 protease inhibitors: in silico study.

    PubMed

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-03-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1's ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing "Lipinsk's rule of five". Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment.

  20. Design of new potent HTLV-1 protease inhibitors: in silico study

    PubMed Central

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-01-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1’s ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing “Lipinsk’s rule of five”. Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment. PMID:27844017

  1. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  2. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  3. The Androgen-Regulated Protease TMPRSS2 Activates aProteolytic Cascade Involving Components of the Tumor Microenvironment and Promotes Prostate Cancer Metastasis

    PubMed Central

    Lucas, Jared M.; Heinlein, Cynthia; Kim, Tom; Hernandez, Susana A.; Malik, Muzdah S.; True, Lawrence D.; Morrissey, Colm; Corey, Eva; Montgomery, Bruce; Mostaghel, Elahe; Clegg, Nigel; Coleman, Ilsa; Brown, Christopher M.; Schneider, Eric L.; Craik, Charles; Simon, Julian; Bedalov, Tony; Nelson, Peter S.

    2014-01-01

    TMPRSS2 is an androgen-regulated cell surface serine protease expressed predominantly in prostate epithelium. TMPRSS2 is expressed highly in localized high-grade prostate cancers and in the majority of human prostate cancer metastasis. Through the generation of mouse models with a targeted deletion of Tmprss2, we demonstrate that the activity of this protease regulates cancer cell invasion and metastasis to distant organs. By screening combinatorial peptide libraries we identified a spectrum of TMPRSS2 substrates that include pro-hepatocyte growth factor (HGF). HGF activated by TMPRSS2 promoted c-Met receptor tyrosine kinase signaling, and initiated a pro-invasive EMT phenotype. Chemical library screens identified a potent bioavailable TMPRSS2 inhibitor that suppressed prostate cancer metastasis in vivo. Together, these findings provide a mechanistic link between androgen-regulated signaling programs and prostate cancer metastasis that operate via context-dependent interactions with extracellular constituents of the tumor microenvironment. PMID:25122198

  4. Release of an HtrA-Like Protease from the Cell Surface of Thermophilic Brevibacillus sp. WF146 via Substrate-Induced Autoprocessing of the N-terminal Membrane Anchor.

    PubMed

    Zhu, Fengtao; Yang, Xing; Wu, Yan; Wang, Yasi; Tang, Xiao-Feng; Tang, Bing

    2017-01-01

    High-temperature requirement A (HtrA)-like proteases participate in protein quality control in prokaryotes and eukaryotes by degrading damaged proteins; however, little is known about HtrAs produced by thermophiles. HtrAw is an HtrA-like protease of thermophilic Brevibacillus sp. WF146. The intact form of HtrAw (iHtrAw) consisting of a transmembrane segment-containing N-terminal domain, a trypsin-like protease domain, and a C-terminal PDZ domain was produced in Escherichia coli. Purified iHtrAw itself is unable to cleave the N-terminal domain, but requires protein substrates to autoprocess the N-terminal domain intermolecularly, yielding a short form (sHtrAw). Mutation at the substrate-binding site in the PDZ domain affects the conversion of iHtrAw to sHtrAw. Deletion analysis revealed that the N-terminal domain is not necessary for enzyme folding, activity, and thermostability. Compared with other known HtrAs, HtrAw contains an additional Ca(2+)-binding Dx[DN]xDG motif important for enzyme stability and/or activity. When produced in an htrA/htrB double deletion mutant of Bacillus subtilis, iHtrAw localized predominantly to the cell pellet, and the amount of sHtrAw in the culture supernatant increased at elevated temperatures. Moreover, HtrAw increased the heat resistance of the B. subtilis mutant. In strain WF146, HtrAw exists in both a cell-associated intact form and a cell-free short form; an increase in growth temperature enhanced HtrAw production and the amount of cell-free short form. Release of the short form of HtrAw from the membrane may have the advantage of allowing the enzyme to freely access and degrade damaged proteins surrounding the bacterium living at high temperatures.

  5. Release of an HtrA-Like Protease from the Cell Surface of Thermophilic Brevibacillus sp. WF146 via Substrate-Induced Autoprocessing of the N-terminal Membrane Anchor

    PubMed Central

    Zhu, Fengtao; Yang, Xing; Wu, Yan; Wang, Yasi; Tang, Xiao-Feng; Tang, Bing

    2017-01-01

    High-temperature requirement A (HtrA)-like proteases participate in protein quality control in prokaryotes and eukaryotes by degrading damaged proteins; however, little is known about HtrAs produced by thermophiles. HtrAw is an HtrA-like protease of thermophilic Brevibacillus sp. WF146. The intact form of HtrAw (iHtrAw) consisting of a transmembrane segment-containing N-terminal domain, a trypsin-like protease domain, and a C-terminal PDZ domain was produced in Escherichia coli. Purified iHtrAw itself is unable to cleave the N-terminal domain, but requires protein substrates to autoprocess the N-terminal domain intermolecularly, yielding a short form (sHtrAw). Mutation at the substrate-binding site in the PDZ domain affects the conversion of iHtrAw to sHtrAw. Deletion analysis revealed that the N-terminal domain is not necessary for enzyme folding, activity, and thermostability. Compared with other known HtrAs, HtrAw contains an additional Ca2+-binding Dx[DN]xDG motif important for enzyme stability and/or activity. When produced in an htrA/htrB double deletion mutant of Bacillus subtilis, iHtrAw localized predominantly to the cell pellet, and the amount of sHtrAw in the culture supernatant increased at elevated temperatures. Moreover, HtrAw increased the heat resistance of the B. subtilis mutant. In strain WF146, HtrAw exists in both a cell-associated intact form and a cell-free short form; an increase in growth temperature enhanced HtrAw production and the amount of cell-free short form. Release of the short form of HtrAw from the membrane may have the advantage of allowing the enzyme to freely access and degrade damaged proteins surrounding the bacterium living at high temperatures. PMID:28377763

  6. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  7. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  8. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  9. Host-Parasite Interaction: Parasite-Derived and -Induced Proteases That Degrade Human Extracellular Matrix

    PubMed Central

    Piña-Vázquez, Carolina; Reyes-López, Magda; Ortíz-Estrada, Guillermo; de la Garza, Mireya; Serrano-Luna, Jesús

    2012-01-01

    Parasitic protozoa are among the most important pathogens worldwide. Diseases such as malaria, leishmaniasis, amoebiasis, giardiasis, trichomoniasis, and trypanosomiasis affect millions of people. Humans are constantly threatened by infections caused by these pathogens. Parasites engage a plethora of surface and secreted molecules to attach to and enter mammalian cells. The secretion of lytic enzymes by parasites into host organs mediates critical interactions because of the invasion and destruction of interstitial tissues, enabling parasite migration to other sites within the hosts. Extracellular matrix is a complex, cross-linked structure that holds cells together in an organized assembly and that forms the basement membrane lining (basal lamina). The extracellular matrix represents a major barrier to parasites. Therefore, the evolution of mechanisms for connective-tissue degradation may be of great importance for parasite survival. Recent advances have been achieved in our understanding of the biochemistry and molecular biology of proteases from parasitic protozoa. The focus of this paper is to discuss the role of protozoan parasitic proteases in the degradation of host ECM proteins and the participation of these molecules as virulence factors. We divide the paper into two sections, extracellular and intracellular protozoa. PMID:22792442

  10. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  11. A density functional theory study of uranium-doped thoria and uranium adatoms on the major surfaces of thorium dioxide

    NASA Astrophysics Data System (ADS)

    Shields, Ashley E.; Santos-Carballal, David; de Leeuw, Nora H.

    2016-05-01

    Thorium dioxide is of significant research interest for its use as a nuclear fuel, particularly as part of mixed oxide fuels. We present the results of a density functional theory (DFT) study of uranium-substituted thorium dioxide, where we found that increasing levels of uranium substitution increases the covalent nature of the bonding in the bulk ThO2 crystal. Three low Miller index surfaces have been simulated and we propose the Wulff morphology for a ThO2 particle and STM images for the (100), (110), and (111) surfaces studied in this work. We have also calculated the adsorption of a uranium atom and the U adatom is found to absorb strongly on all three surfaces, with particular preference for the less stable (100) and (110) surfaces, thus providing a route to the incorporation of uranium into a growing thoria particle.

  12. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  13. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  14. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  15. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  16. Antimicrobial proteins and peptides in human lung diseases: A friend and foe partnership with host proteases.

    PubMed

    Lecaille, Fabien; Lalmanach, Gilles; Andrault, Pierre-Marie

    2016-03-01

    Lung antimicrobial proteins and peptides (AMPs) are major sentinels of innate immunity by preventing microbial colonization and infection. Nevertheless bactericidal activity of AMPs against Gram-positive and Gram-negative bacteria is compromised in patients with chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF) and asthma. Evidence is accumulating that expression of harmful human serine proteases, matrix metalloproteases and cysteine cathepsins is markedely increased in these chronic lung diseases. The local imbalance between proteases and protease inhibitors compromises lung tissue integrity and function, by not only degrading extracellular matrix components, but also non-matrix proteins. Despite the fact that AMPs are somewhat resistant to proteolytic degradation, some human proteases cleave them efficiently and impair their antimicrobial potency. By contrast, certain AMPs may be effective as antiproteases. Host proteases participate in concert with bacterial proteases in the degradation of key innate immunity peptides/proteins and thus may play immunomodulatory activities during chronic lung diseases. In this context, the present review highlights the current knowledge and recent discoveries on the ability of host enzymes to interact with AMPs, providing a better understanding of the role of human proteases in innate host defense.

  17. Structure of the catalytic domain of the hepatitis C virus NS2-3 protease

    SciTech Connect

    Lorenz,I.; Marcotrigiano, J.; Dentzer, T.; Rice, C.

    2006-01-01

    Hepatitis C virus is a major global health problem affecting an estimated 170 million people worldwide. Chronic infection is common and can lead to cirrhosis and liver cancer. There is no vaccine available and current therapies have met with limited success. The viral RNA genome encodes a polyprotein that includes two proteases essential for virus replication. The NS2-3 protease mediates a single cleavage at the NS2/NS3 junction, whereas the NS3-4A protease cleaves at four downstream sites in the polyprotein. NS3-4A is characterized as a serine protease with a chymotrypsin-like fold, but the enzymatic mechanism of the NS2-3 protease remains unresolved. Here we report the crystal structure of the catalytic domain of the NS2-3 protease at 2.3 Angstroms resolution. The structure reveals a dimeric cysteine protease with two composite active sites. For each active site, the catalytic histidine and glutamate residues are contributed by one monomer, and the nucleophilic cysteine by the other. The carboxy-terminal residues remain coordinated in the two active sites, predicting an inactive post-cleavage form. Proteolysis through formation of a composite active site occurs in the context of the viral polyprotein expressed in mammalian cells. These features offer unexpected insights into polyprotein processing by hepatitis C virus and new opportunities for antiviral drug design.

  18. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  19. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  20. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  1. Land Surface Phenologies and Seasonalities Using Cool Earthlight in the Major Grain Production Areas of Russia, Ukraine, and Kazakhstan

    NASA Astrophysics Data System (ADS)

    Alemu, W. G.; Henebry, G. M.

    2013-12-01

    Phenology deals with timing of biotic phenomena and seasonality concerns temporal patterns of abiotic variables. Studies of land surface phenology (LSP) and land surface seasonality (LSS) have long been limited to visible to near infrared (VNIR) wavelengths, despite degradation by atmospheric effects and solar illumination constraints. Enhanced land surface parameters derived from passive microwave data enable improved temporal monitoring of agricultural land surface dynamics compared to the vegetation index data available from VNIR data. LSPs and LSSs in grain growing regions of Russia, Ukraine and Kazakhstan were characterized using AMSR-E enhanced land surface parameters for the period from April through October for 2003 through 2010. Growing degree-days (GDDs) were calculated from AMSR-E air temperature retrievals using both ascending and descending passes with a base of 0° C and then accumulated (AGDD) with an annual restart each April 1st. Tracking the AMSR-E parameters as a function of AGDD revealed the expected seasonal pattern of thermal limitation in high latitude croplands. Vegetation optical depth (VOD), a microwave analog of a vegetation index, was modeled as a function of AGDD with the resulting fitted convex quadratic models yielding both high coefficients of determination (r2 > 0.90) and phenometrics that could characterize cropland dynamics in our study sites. The AMSR-E data were also able to capture the effects of the 2010 heat wave that devastated grain production in European Russia. These results showed the potential of AMSR-E in monitoring and modeling cropland dynamics.

  2. Major role for carbohydrate epitopes preferentially recognized by chronically infected mice in the determination of Schistosoma mansoni schistosomulum surface antigenicity

    SciTech Connect

    Omer-ali, P.; Magee, A.I.; Kelly, C.; Simpson, A.J.G.

    1986-12-01

    A radioimmunoassay that makes use of whole Schistosomula and /sup 125/I-labeled protein A has been used to characterize and to quantify the binding of antisera to the surface of 3 hr mechanically transformed schistosomula of Schistosoma mansoni. This technique facilitates the determination of epitopes on the schistosomula in addition to those detected by surface labeling and immunoprecipitation. By using this technique, it has been demonstrated that there is a much greater binding to the parasite surface of antibodies from chronically infected mice (CMS) than of antibodies from mice infected with highly irradiated cercariae (VMS), and CMS recognizes epitopes that VMS does not. Treatment of the surface of the schistosomula with trifluoromethanesulphonic acid and sodium metaperiodate has suggested that the discrepancy of the binding between the two sera is due to the recognition of a large number of additional epitopes by CMS, which are carbohydrate in nature. Some of the carbohydrate epitopes are expressed on the previously described surface glycoprotein antigens of M/sub r/ 200,000, 38,000, and 17,000.

  3. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries

    PubMed Central

    Yi, Li; Gebhard, Mark C.; Li, Qing; Taft, Joseph M.; Georgiou, George; Iverson, Brent L.

    2013-01-01

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase. PMID:23589865

  4. Single Cell Analysis of Leukocyte Protease Activity Using Integrated Continuous-Flow Microfluidics.

    PubMed

    Jing, Tengyang; Lai, Zhangxing; Wu, Lidan; Han, Jongyoon; Lim, Chwee Teck; Chen, Chia-Hung

    2016-12-06

    Leukocytes are the essential cells of the immune system that protect the human body against bacteria, viruses, and other foreign invaders. Secretory products of individual leukocytes, such as matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase (ADAMs), are critical for regulating the inflammatory response and mediating host defense. Conventional single cell analytical methods, such as flow cytometry for cellular surface biomarker studies, are insufficient for performing functional assays of the protease activity of individual leukocytes. Here, an integrated continuous-flow microfluidic assay is developed to effectively detect secretory protease activity of individual viable leukocytes. Leukocytes in blood are first washed on-chip with defined buffer to remove background activity, followed by encapsulating individual leukocytes with protease sensors in water-in-oil droplets and incubating for 1 h to measure protease secretion. With this design, single leukocyte protease profiles under naive and phorbol 12-myristate 13-acetate (PMA)-stimulated conditions are reliably measured. It is found that PMA treatment not only elevates the average protease activity level but also reduces the cellular heterogeneity in protease secretion, which is important in understanding immune capability and the disease condition of individual patients.

  5. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  6. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries.

    PubMed

    Yi, Li; Gebhard, Mark C; Li, Qing; Taft, Joseph M; Georgiou, George; Iverson, Brent L

    2013-04-30

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase.

  7. Statistical optimization of alkaline protease production from Penicillium citrinum YL-1 under solid-state fermentation.

    PubMed

    Xiao, Yun-Zhu; Wu, Duan-Kai; Zhao, Si-Yang; Lin, Wei-Min; Gao, Xiang-Yang

    2015-01-01

    Proteases from halotolerant and halophilic microorganisms were found in traditional Chinese fish sauce. In this study, 30 fungi were isolated from fermented fish sauce in five growth media based on their morphology. However, only one strain, YL-1, which was identified as Penicillium citrinum by internal transcribed spacer (ITS) sequence analysis, can produce alkaline protease. This study is the first to report that a protease-producing fungus strain was isolated and identified in traditional Chinese fish sauce. Furthermore, the culture conditions of alkaline protease production by P. citrinum YL-1 in solid-state fermentation were optimized by response surface methodology. First, three variables including peptone, initial pH, and moisture content were selected by Plackett-Burman design as the significant variables for alkaline protease production. The Box-Behnken design was then adopted to further investigate the interaction effects between the three variables on alkaline protease production and determine the optimal values of the variables. The maximal production (94.30 U/mL) of alkaline protease by P. citrinum YL-1 took place under the optimal conditions of peptone, initial pH, and moisture content (v/w) of 35.5 g/L, 7.73, and 136%, respectively.

  8. Clitocypin, a fungal cysteine protease inhibitor, exerts its insecticidal effect on Colorado potato beetle larvae by inhibiting their digestive cysteine proteases.

    PubMed

    Šmid, Ida; Rotter, Ana; Gruden, Kristina; Brzin, Jože; Buh Gašparič, Meti; Kos, Janko; Žel, Jana; Sabotič, Jerica

    2015-07-01

    Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a major potato pest that adapts readily to insecticides. Several types of protease inhibitors have previously been investigated as potential control agents, but with limited success. Recently, cysteine protease inhibitors from parasol mushroom, the macrocypins, were reported to inhibit growth of CPB larvae. To further investigate the insecticidal potential and mode of action of cysteine protease inhibitors of fungal origin, clitocypin, a cysteine protease inhibitor from clouded agaric (Clitocybe nebularis), was evaluated for its lethal effects on CPB larvae. Clitocypin isolated from fruiting bodies and recombinant clitocypin produced in Escherichia coli slowed growth and reduced survival of CPB larvae in a concentration dependent manner. Clitocypin was also expressed by transgenic potato, but only at low levels. Nevertheless, it reduced larval weight gain and delayed development. We have additionally shown that younger larvae are more susceptible to the action of clitocypin. The inhibition of digestive cysteine proteases, intestains, by clitocypin was shown to be the underlying mode of action. Protease inhibitors from mushrooms are confirmed as promising candidates for biopesticides.

  9. A single point in protein trafficking by Plasmodium falciparum determines the expression of major antigens on the surface of infected erythrocytes targeted by human antibodies.

    PubMed

    Chan, Jo-Anne; Howell, Katherine B; Langer, Christine; Maier, Alexander G; Hasang, Wina; Rogerson, Stephen J; Petter, Michaela; Chesson, Joanne; Stanisic, Danielle I; Duffy, Michael F; Cooke, Brian M; Siba, Peter M; Mueller, Ivo; Bull, Peter C; Marsh, Kevin; Fowkes, Freya J I; Beeson, James G

    2016-11-01

    Antibodies to blood-stage antigens of Plasmodium falciparum play a pivotal role in human immunity to malaria. During parasite development, multiple proteins are trafficked from the intracellular parasite to the surface of P. falciparum-infected erythrocytes (IEs). However, the relative importance of different proteins as targets of acquired antibodies, and key pathways involved in trafficking major antigens remain to be clearly defined. We quantified antibodies to surface antigens among children, adults, and pregnant women from different malaria-exposed regions. We quantified the importance of antigens as antibody targets using genetically engineered P. falciparum with modified surface antigen expression. Genetic deletion of the trafficking protein skeleton-binding protein-1 (SBP1), which is involved in trafficking the surface antigen PfEMP1, led to a dramatic reduction in antibody recognition of IEs and the ability of human antibodies to promote opsonic phagocytosis of IEs, a key mechanism of parasite clearance. The great majority of antibody epitopes on the IE surface were SBP1-dependent. This was demonstrated using parasite isolates with different genetic or phenotypic backgrounds, and among antibodies from children, adults, and pregnant women in different populations. Comparisons of antibody reactivity to parasite isolates with SBP1 deletion or inhibited PfEMP1 expression suggest that PfEMP1 is the dominant target of acquired human antibodies, and that other P. falciparum IE surface proteins are minor targets. These results establish SBP1 as part of a critical pathway for the trafficking of major surface antigens targeted by human immunity, and have key implications for vaccine development, and quantifying immunity in populations.

  10. Enabling Low Cost Biopharmaceuticals: A Systematic Approach to Delete Proteases from a Well-Known Protein Production Host Trichoderma reesei

    PubMed Central

    Landowski, Christopher P.; Huuskonen, Anne; Wahl, Ramon; Westerholm-Parvinen, Ann; Kanerva, Anne; Hänninen, Anna-Liisa; Salovuori, Noora; Penttilä, Merja; Natunen, Jari; Ostermeier, Christian; Helk, Bernhard; Saarinen, Juhani; Saloheimo, Markku

    2015-01-01

    The filamentous fungus Trichoderma reesei has tremendous capability to secrete proteins. Therefore, it would be an excellent host for producing high levels of therapeutic proteins at low cost. Developing a filamentous fungus to produce sensitive therapeutic proteins requires that protease secretion is drastically reduced. We have identified 13 major secreted proteases that are related to degradation of therapeutic antibodies, interferon alpha 2b, and insulin like growth factor. The major proteases observed were aspartic, glutamic, subtilisin-like, and trypsin-like proteases. The seven most problematic proteases were sequentially removed from a strain to develop it for producing therapeutic proteins. After this the protease activity in the supernatant was dramatically reduced down to 4% of the original level based upon a casein substrate. When antibody was incubated in the six protease deletion strain supernatant, the heavy chain remained fully intact and no degradation products were observed. Interferon alpha 2b and insulin like growth factor were less stable in the same supernatant, but full length proteins remained when incubated overnight, in contrast to the original strain. As additional benefits, the multiple protease deletions have led to faster strain growth and higher levels of total protein in the culture supernatant. PMID:26309247

  11. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar

    2016-01-01

    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  12. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  13. Dynamic redistribution of major platelet surface receptors after contact-induced platelet activation and spreading. An immunoelectron microscopy study.

    PubMed Central

    Kieffer, N.; Guichard, J.; Breton-Gorius, J.

    1992-01-01

    The authors used an immunogold labeling procedure to investigate the redistribution of platelet receptors and their ligands on the surface of contact-activated adherent platelets before and after thrombin stimulation. During the initial stage of platelet adhesion, a typical segregation of receptors occurred. Gold particles identifying glycoprotein (GP) Ib (CD42b) and GPIIb-IIIa (CD41a) remained distributed over the entire platelet surface, whereas gold particles identifying GPIa-IIa (CDw 49b) and GPIV (CD36) were found essentially overlying the granulomere; p24 (CD9) was present at the peripheral platelet rim and over the cell body. An increased labeling of GPIIb-IIIa, GPIV and p24 was also observed on pseudopods, with GPIIb-IIIa and GPIV concentrated at the enlarged extremities and at sites of contact between two platelets, whereas GPIb was absent from pseudopods. After thrombin stimulation of adherent platelets, GPIb underwent a relocation to the cell center, in contrast to GPIIb-IIIa which still remained randomly distributed over the cell body. To investigate whether ligand distribution paralleled this receptor segregation, platelet released von Willebrand factor (vWF), fibrinogen (Fg) and thrombospondin (TSP) were visualized. During the early stages of platelet activation, surface labeling for all three adhesive proteins was minimal and almost undetectable. Occasionally, intragranular Fg and vWF was accessible to gold-coupled antibodies, with vWF exhibiting the typical eccentric alpha-granular localization. At later stages of activation and especially after thrombin stimulation, no surface labeling for vWF was observed, whereas immunogold particles identifying vWF were still present inside enlarged clear vacuoles. In contrast, labeling of Fg and TSP was increased over the granulomere and extended to the cell periphery and the pseudopods, but was absent from the hyalomere, despite the presence of GPIIb-IIIa molecules. Double labeling experiments showed

  14. Structural basis of ubiquitin recognition by the deubiquitinating protease USP2.

    PubMed

    Renatus, Martin; Parrado, Shirley Gil; D'Arcy, Allan; Eidhoff, Ulf; Gerhartz, Bernd; Hassiepen, Ulrich; Pierrat, Benoit; Riedl, Ralph; Vinzenz, Daniela; Worpenberg, Susanne; Kroemer, Markus

    2006-08-01

    Deubiquitinating proteases reverse protein ubiquitination and rescue their target proteins from destruction by the proteasome. USP2, a cysteine protease and a member of the ubiquitin specific protease family, is overexpressed in prostate cancer and stabilizes fatty acid synthase, which has been associated with the malignancy of some aggressive prostate cancers. Here, we report the structure of the human USP2 catalytic domain in complex with ubiquitin. Ubiquitin uses two major sites for the interaction with the protease. Both sites are required simultaneously, as shown by USP2 inhibition assays with peptides and ubiquitin mutants. In addition, a layer of ordered water molecules mediates key interactions between ubiquitin and USP2. As several of those molecules are found at identical positions in the previously solved USP7/ubiquitin-aldehyde complex structure, we suggest a general mechanism of water-mediated ubiquitin recognition by USPs.

  15. Function, therapeutic potential and cell biology of BACE proteases: current status and future prospects.

    PubMed

    Vassar, Robert; Kuhn, Peer-Hendrik; Haass, Christian; Kennedy, Matthew E; Rajendran, Lawrence; Wong, Philip C; Lichtenthaler, Stefan F

    2014-07-01

    The β-site APP cleaving enzymes 1 and 2 (BACE1 and BACE2) were initially identified as transmembrane aspartyl proteases cleaving the amyloid precursor protein (APP). BACE1 is a major drug target for Alzheimer's disease because BACE1-mediated cleavage of APP is the first step in the generation of the pathogenic amyloid-β peptides. BACE1, which is highly expressed in the nervous system, is also required for myelination by cleaving neuregulin 1. Several recent proteomic and in vivo studies using BACE1- and BACE2-deficient mice demonstrate a much wider range of physiological substrates and functions for both proteases within and outside of the nervous system. For BACE1 this includes axon guidance, neurogenesis, muscle spindle formation, and neuronal network functions, whereas BACE2 was shown to be involved in pigmentation and pancreatic β-cell function. This review highlights the recent progress in understanding cell biology, substrates, and functions of BACE proteases and discusses the therapeutic options and potential mechanism-based liabilities, in particular for BACE inhibitors in Alzheimer's disease. The protease BACE1 is a major drug target in Alzheimer disease. Together with its homolog BACE2, both proteases have an increasing number of functions within and outside of the nervous system. This review highlights recent progress in understanding cell biology, substrates, and functions of BACE proteases and discusses the therapeutic options and potential mechanism-based liabilities, in particular for BACE inhibitors in Alzheimer disease.

  16. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  17. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  18. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  19. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  20. Cysteine Proteases Inhibitors with immunoglobulin-like fold in protozoan parasites and their role in pathogenesis.

    PubMed

    Jimenez-Sandoval, Pedro; Lopez-Castillo, Laura Margarita; Trasviña-Arenas, Carlos H; Brieba, Luis G

    2016-08-13

    The number of protein folds in nature is limited, thus is not surprising that proteins with the same fold are able to exert different functions. The cysteine protease inhibitors that adopt an immunoglobulin-like fold (Ig-ICPs) are inhibitors encoded in bacteria and protozoan parasites. Structural studies indicate that these inhibitors resemble the structure of archetypical proteins with an Ig fold, like antibodies, cadherins or cell receptors. The structure of Ig-ICPs from four different protozoan parasites clearly shows the presence of three loops that form part of a protein-ligand interaction surface that resembles the antigen binding sites of antibodies. Thus, Ig-ICPs bind to different cysteine proteases using a tripartite mechanism in which their BC, DE and FG loops are responsible for the main interactions with the target cysteine protease. Ig-ICPs from different protozoan parasites regulate the enzymatic activity of host or parasite's proteases and thus regulate virulence and pathogenesis.

  1. Role of an extracellular neutral protease in infection against nematodes by Brevibacillus laterosporus strain G4.

    PubMed

    Tian, Baoyu; Yang, Jinkui; Lian, Lihui; Wang, Chunyan; Li, Ning; Zhang, Ke-Qin

    2007-02-01

    Proteases have been proposed as virulence factors in microbial pathogenicity against nematodes. However, what kinds of extracellular proteases from these pathogens and how they contribute to the pathogenesis of infections against nematode in vivo remain largely unknown. A previous analysis using a strain with a deletion in an extracellular alkaline protease BLG4 gene from Brevibacillus laterosporus demonstrated that BLG4 was responsible for the majority of nematicidal activity by destroying host's cuticle. In recent studies, a neutral protease NPE-4, purified from the mutant BLG4-6, was found to be responsible for the majority of the remaining EDTA-inhibited protease activity. However, the purified NPE-4 and recombinant NPE-4 in a related species Bacillus subtilis showed little nematicidal activity in vitro and were unable to degrade the intact cuticle of the host. It is interesting to note that the addition of NPE-4 improved the pathogenicity of crude enzyme extract from wild-type B. laterosporus but had no effect on the BLG4-deficient mutant. This result suggests that NPE-4 functions in the presence of protease BLG4. Moreover, NPE-4 could degrade proteins from the inner layer of purified cuticles from nematode Panagrellus redivivus in vitro. These results indicated that the two different bacterial extracellular proteases might play differential roles at different stages of infection or a synthetic role in penetration of nematode cuticle in B. laterosporus. This is among the first reports to systematically evaluate and define the roles of different bacterial extracellular proteases in infection against nematodes.

  2. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  3. A novel and rapid assay for HIV-1 protease detection using magnetic bead mediation.

    PubMed

    Esseghaier, Chiheb; Ng, Andy; Zourob, Mohammed

    2013-03-15

    A simple sensing assay was established for label-free detection of HIV-1 protease. HIV-1 protease peptide substrate conjugated to magnetic beads via its N-terminus is directly fixed onto the sensor gold surface through the sulphur atom of cysteine. Surface plasmon resonance (SPR) was used to study the peptide substrate cleavage efficiency of the protease with magnetic beads of different sizes (1 μm and 30 nm). Cyclic voltammetry and faradic impedance spectroscopy were employed in order to characterize the functionalized gold electrode. It was found that the nano-sized beads are a more efficient sensing probe for the protease. Electrochemical biosensing showed a gradual decrease in charge transfer resistance after injection of the HIV-1 protease. The experimental data established a detection limit of 10 pg/ml, as well as demonstrated a drug screening assay. This HIV-1 protease biosensor represents a new detection approach which will lead to low-cost point-of-care devices for sensitive HIV-1 diagnosis, as well as high-throughput drug screening platforms.

  4. Direct Visualization of Peptide/MHC Complexes at the Surface and in the Intracellular Compartments of Cells Infected In Vivo by Leishmania major

    PubMed Central

    Cazareth, Julie; Hoebeke, Johan; Lippuner, Christoph; Davalos-Misslitz, Ana; Aebischer, Toni; Muller, Sylviane; Glaichenhaus, Nicolas; Mougneau, Evelyne

    2010-01-01

    Protozoa and bacteria infect various types of phagocytic cells including macrophages, monocytes, dendritic cells and eosinophils. However, it is not clear which of these cells process and present microbial antigens in vivo and in which cellular compartments parasite peptides are loaded onto Major Histocompatibility Complex molecules. To address these issues, we have infected susceptible BALB/c (H-2d) mice with a recombinant Leishmania major parasite expressing a fluorescent tracer. To directly visualize the antigen presenting cells that present parasite-derived peptides to CD4+ T cells, we have generated a monoclonal antibody that reacts to an antigenic peptide derived from the parasite LACK antigen bound to I-Ad Major Histocompatibility Complex class II molecule. Immunogold electron microscopic analysis of in vivo infected cells showed that intracellular I-Ad/LACK complexes were present in the membrane of amastigote-containing phagosomes in dendritic cells, eosinophils and macrophages/monocytes. In both dendritic cells and macrophages, these complexes were also present in smaller vesicles that did not contain amastigote. The presence of I-Ad/LACK complexes at the surface of dendritic cells, but neither on the plasma membrane of macrophages nor eosinophils was independently confirmed by flow cytometry and by incubating sorted phagocytes with highly sensitive LACK-specific hybridomas. Altogether, our results suggest that peptides derived from Leishmania proteins are loaded onto Major Histocompatibility Complex class II molecules in the phagosomes of infected phagocytes. Although these complexes are transported to the cell surface in dendritic cells, therefore allowing the stimulation of parasite-specific CD4+ T cells, this does not occur in other phagocytic cells. To our knowledge, this is the first study in which Major Histocompatibility Complex class II molecules bound to peptides derived from a parasite protein have been visualized within and at the surface of

  5. Plasmodium subtilisin-like protease 1 (SUB1): Insights into the active-site structure, specificity and function of a pan-malaria drug target

    PubMed Central

    Withers-Martinez, Chrislaine; Suarez, Catherine; Fulle, Simone; Kher, Samir; Penzo, Maria; Ebejer, Jean-Paul; Koussis, Kostas; Hackett, Fiona; Jirgensons, Aigars; Finn, Paul; Blackman, Michael J.

    2012-01-01

    Release of the malaria merozoite from its host erythrocyte (egress) and invasion of a fresh cell are crucial steps in the life cycle of the malaria pathogen. Subtilisin-like protease 1 (SUB1) is a parasite serine protease implicated in both processes. In the most dangerous human malarial species, Plasmodium falciparum, SUB1 has previously been shown to have several parasite-derived substrates, proteolytic cleavage of which is important both for egress and maturation of the merozoite surface to enable invasion. Here we have used molecular modelling, existing knowledge of SUB1 substrates, and recombinant expression and characterisation of additional Plasmodium SUB1 orthologues, to examine the active site architecture and substrate specificity of P. falciparum SUB1 and its orthologues from the two other major human malaria pathogens Plasmodium vivax and Plasmodium knowlesi, as well as from the rodent malaria species, Plasmodium berghei. Our results reveal a number of unusual features of the SUB1 substrate binding cleft, including a requirement to interact with both prime and non-prime side residues of the substrate recognition motif. Cleavage of conserved parasite substrates is mediated by SUB1 in all parasite species examined, and the importance of this is supported by evidence for species-specific co-evolution of protease and substrates. Two peptidyl alpha-ketoamides based on an authentic PfSUB1 substrate inhibit all SUB1 orthologues examined, with inhibitory potency enhanced by the presence of a carboxyl moiety designed to introduce prime side interactions with the protease. Our findings demonstrate that it should be possible to develop ‘pan-reactive’ drug-like compounds that inhibit SUB1 in all three major human malaria pathogens, enabling production of broad-spectrum antimalarial drugs targeting SUB1. PMID:22543039

  6. Molecular and functional characterisation of a stress responsive cysteine protease, EhCP6 from Entamoeba histolytica.

    PubMed

    Ghosh, Anupama; Raha, Sanghamitra

    2015-05-01

    Entamoeba histolytica cysteine protease 6 (EhCP6) is a stress responsive cysteine protease that is upregulated in response to heat shock and during pathogen invasion of the host tissue. In the present study an attempt has been made to express and purify recombinant EhCP6 in order to gain insights into its biochemical properties. The recombinant and refolded protein has been shown to undergo autoproteolysis in the presence of DTT and SDS to give rise to ∼25kDa mature form. The mature form of the protein was found to exhibit a protease activity that is sensitive to E-64, a specific cysteine protease inhibitor. In silico homology modelling of EhCP6 revealed that the protein exhibits conservation of almost all the major structural features of cathepsin-L like cysteine proteases. Further in vivo studies are needed to decipher the function of the protein in response to different stressed conditions.

  7. Concentrations and patterns of perfluoroalkyl acids in Georgia, USA surface waters near and distant to a major use source

    USGS Publications Warehouse

    Konwick, B.J.; Tomy, G.T.; Ismail, N.; Peterson, J.T.; Fauver, R.J.; Higginbotham, D.; Fisk, A.T.

    2008-01-01

    Perfluoroalkyl acids (PFAAs) are widespread contaminants emanating from, among other sources, the production/degradation of fluorinated chemicals used in surface repellant applications, such as carpet manufacturing. The goal of the present study was to assess the concentrations of PFAAs, including perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), perfluorodecanoic acid (PFDA), perfluoroundecanoic acid (PFUA), and perfluorooctane sulfonamide (PFOSA), in surface waters both near a wastewater land application system (LAS) in Dalton (GA, USA), home to North America's largest carpet manufacturing site, and distant to this location (Altamaha River, GA, USA) to understand the fate of PFAAs in freshwater. Levels of PFAAs were high in the Conasauga River (GA, USA) downstream of the LAS (PFOA, 253-1,150 ng/L; PFOS, 192-318 ng/L; PFNA, 202-369 ng/L; PFDA, 30.1-113 ng/L; PFUA, 58.0-99.2 ng/L; PFOSA, 162-283 ng/L) and in streams and ponds in Dalton (PFOA, 49.9-299 ng/L; PFOS, 15.8-120 ng/L), and were among the highest measured at a nonspill or directrelease location. Perfluoroalkyl acids in the Altamaha River were much lower (PFOA, 3.0-3.1 ng/L; PFOS, 2.6-2.7 ng/L), but were a source of PFAAs to Georgia's estuaries. A preliminary hazard assessment indicated that concentrations of PFOS at two sites in the Conasauga River exceeded the threshold effect predicted for birds consuming aquatic organisms that are exposed continuously to the PFOS levels at these sites. Assuming that toxicity for all PFAAs quantified is equal to that of PFOS, the sum total PFAAs at two sites within the Conasauga River exceeded PFOS thresholds for aquatic and avian species, warranting additional research. ?? 2008 SETAC Printed in the USA.

  8. Major factors influencing the elemental composition of surface estuarine sediments: the case of 15 estuaries in Portugal.

    PubMed

    Mil-Homens, M; Vale, C; Raimundo, J; Pereira, P; Brito, P; Caetano, M

    2014-07-15

    Upper sediments (0-5 cm) were sampled in 94 sites of water bodies of the fifteen Portuguese estuaries characterized by distinct settings of climate, topography and lithology, and marked by diverse anthropogenic pressures. Confined areas recognized as highly anthropogenic impacted, as well as areas dominated by erosion or frequently dredged were not sampled. Grain size, organic carbon (Corg), Al and trace elements (As, Cd, Co, Cr, Cu, Hg, Ni, Pb and Zn) were determined. Normalisation of trace element concentrations to Al and Corg, correlations between elements and Principal Component Analysis (PCA) allowed identifying elemental associations and the relevance of grain-size, lithology and anthropogenic inputs on sediment chemical composition. Whereas grain-size is the dominant effect for the majority of the studied estuaries, the southern estuaries Mira, Arade and Guadiana are dominated by specific lithologies of their river basins, and anthropogenic effects are identified in Ave, Leça, Tagus and Sado. This study emphasizes how baseline values of trace elements in sediments may vary within and among estuarine systems.

  9. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  10. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  11. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  12. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 1 May 2002) The Science This image is from the region of Syrtis Major, which is dominated by a low-relief shield volcano. This area is believed to be an area of vigorous aeolian activity with strong winds in the east-west direction. The effects of these winds are observed as relatively bright streaks across the image, extending from topographic features such as craters. The brighter surface material probably indicates a smaller relative particle size in these areas, as finer particles have a higher albedo. The bright streaks seen off of craters are believed to have formed during dust storms. A raised crater rim can cause a reduction in the wind velocity directly behind it, which results in finer particles being preferentially deposited in this location. In the top half of the image, there is a large bright streak that crosses the entire image. There is no obvious topographic obstacle, therefore it is unclear whether it was formed in the same manner as described above. This image is located northwest of Nili Patera, a large caldera in Syrtis Major. Different flows from the caldera eruptions can be recognized as raised ridges, representing the edge of a flow lobe. The Story In the 17th century, Holland was in its Golden Age, a time of cultural greatness and immense political and economic influence in the world. In that time, lived a inquisitive person named Christian Huygens. As a boy, he loved to draw and to figure out problems in mathematics. As a man, he used these talents to make the first detailed drawings of the Martian surface - - only 50 years or so after Galileo first turned his telescope on Mars. Mars suddenly became something other than a small red dot in the sky. One of the drawings Huygens made was of a dark marking on the red planet's surface named Syrtis Major. Almost 350 years later, here we are with an orbiter that can show us this place in detail. Exploration lives! It's great we can study this area up close. In earlier periods of history

  13. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  14. Functional proteomics-aided selection of protease inhibitors for herbivore insect control

    PubMed Central

    Rasoolizadeh, Asieh; Munger, Aurélie; Goulet, Marie-Claire; Sainsbury, Frank; Cloutier, Conrad; Michaud, Dominique

    2016-01-01

    Studies have reported the potential of protease inhibitors to engineer insect resistance in transgenic plants but the general usefulness of this approach in crop protection still remains to be established. Insects have evolved strategies to cope with dietary protease inhibitors, such as the use of proteases recalcitrant to inhibition, that often make the selection of effective inhibitors very challenging. Here, we used a functional proteomics approach for the ‘capture’ of Cys protease targets in crude protein extracts as a tool to identify promising cystatins for plant improvement. Two cystatins found to differ in their efficiency to capture Cys proteases of the coleopteran pest Leptinotarsa decemlineata also differed in their usefulness to produce transgenic potato lines resistant to this insect. Plants expressing the most potent cystatin at high level had a strong repressing effect on larval growth and leaf intake, while plants expressing the weakest cystatin showed no effect on both two parameters compared to untransformed parental line used for genetic transformation. Our data underline the relevance of considering the whole range of possible protease targets when selecting an inhibitor for plant pest control. They also confirm the feasibility of developing cystatin-expressing transgenics resistant to a major pest of potato. PMID:27958307

  15. Structures of HIV Protease Guide Inhibitor Design to Overcome Drug Resistance

    SciTech Connect

    Weber, Irene T.; Kovalevsky, Andrey Y.; Harrison, Robert W.

    2008-06-03

    The HIV/AIDS infection continues to be a major epidemic worldwide despite the initial promise of antiviral drugs. Current therapy includes a combination of drugs that inhibit two of the virally-encoded enzymes, the reverse transcriptase and the protease. The first generation of HIV protease inhibitors that have been in clinical use for treatment of AIDS since 1995 was developed with the aid of structural analysis of protease-inhibitor complexes. These drugs were successful in improving the life span of HIV-infected people. Subsequently, the rapid emergence of drug resistance has necessitated the design of new inhibitors that target mutant proteases. This second generation of antiviral protease inhibitors has been developed with the aid of data from medicinal chemistry, kinetics, and X-ray crystallographic analysis. Traditional computational methods such as molecular mechanics and dynamics can be supplemented with intelligent data mining approaches. One approach, based on similarities to the protease interactions with substrates, is to incorporate additional interactions with main chain atoms that cannot easily be eliminated by mutations. Our structural and inhibition data for darunavir have helped to understand its antiviral activity and effectiveness on drug resistant HIV and demonstrate the success of this approach.

  16. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 6 June 2002) The Science This image, located near the equator and 288W (72E), is near the southern edge of a low, broad volcanic feature called Syrtis Major. A close look at this image reveals a wrinkly texture that indicates a very rough surface that is associated with the lava flows that cover this region. On a larger scale, there are numerous bright streaks that trail topographic features such as craters. These bright streaks are in the wind shadows of the craters where dust that settles onto the surface is not as easily scoured away. It is important to note that these streaks are only bright in a relative sense to the surrounding image. Syrtis Major is one of the darkest regions on Mars and it is as dark as fresh basalt flows or dunes are on Earth. The Story Cool! It almost looks as if nature has 'painted' comets on the surface of Mars, using craters as comet cores and dust as streaky tails. Of course, that's just an illusion. As in many areas of Mars, the wind is behind the creation of such fantastic landforms. The natural phenomenon seen here gives this particular surface of Mars a very dynamic, fast-moving, almost luminous 'cosmic personality.' The bright, powdery-looking streaks of dust are in the 'wind shadows' of craters, where dust that settles onto the surface is not as easily scoured away. That's because the wind moves across the land in a particular direction, and a raised surface like the rim of a crater 'protects' dust from being completely blown away on the other side. The raised landforms basically act as a buffer. From the streaks seen above, you can tell the wind was blowing in a northeast to southwest direction. Why are the streaks so bright? Because they contrast with the really dark underlying terrain in this volcanic area of Mars. Syrtis Major is one of the darkest regions on Mars because it is made of basalt. Basalt is typically dark gray or black, and forms when a certain type of molten lava cools. The meaning of the word basalt

  17. Identification of potential transmembrane protease serine 4 inhibitors as anti-cancer agents by integrated computational approach.

    PubMed

    Ilamathi, M; Hemanth, R; Nishanth, S; Sivaramakrishnan, V

    2016-01-21

    Transmembrane protease serine 4 is a well known cell surface protease facilitating the extracellular matrix degradation and epithelial mesenchymal transition in hepatocellular carcinoma. Henceforth targeting transmembrane protease serine 4 is strongly believed to provide therapeutic intervention against hepatocellular carcinoma. Owing to lack of crystal structure for human transmembrane protease serine 4, we predicted its three dimensional structure for the first time in this study. Experimentally proven inhibitor-Tyroserleutide (TSL) against hepatocellular carcinoma via transmembrane protease serine 4 was used as a benchmark to identify structurally similar candidates from PubChem database to create the TSL library. Virtual screening of TSL library against modeled transmembrane protease serine 4 revealed the top four potential inhibitors. Further binding free energy (ΔGbind) analysis of the potential inhibitors revealed the best potential lead compound against transmembrane protease serine 4. Drug likeliness nature of the top four potential hits were additionally analyzed in comparison to TSL to confirm on the best potential lead compound with the highest % of human oral absorption. Consequently, e-pharmacophore mapping of the best potential lead compound yielded a six point feature. It was observed to contain four hydrogen bond donor sites (D), one positively ionizable site (P) and one aromatic ring (R). Such e-pharmacophore insight obtained from structural determinants by integrated computational analysis could serve as a framework for further advancement of drug discovery process of new anti-cancer agents with less toxicity and high specificity targeting transmembrane protease serine 4 and hepatocellular carcinoma.

  18. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  19. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  20. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  1. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  2. Protease specificity determination by using cellular libraries of peptide substrates (CLiPS).

    PubMed

    Boulware, Kevin T; Daugherty, Patrick S

    2006-05-16

    We report a general combinatorial approach to identify optimal substrates of a given protease by using quantitative kinetic screening of cellular libraries of peptide substrates (CLiPS). A whole-cell protease activity assay was developed by displaying fluorescent reporter substrates on the surface of Escherichia coli as N-terminal fusions. This approach enabled generation of substrate libraries of arbitrary amino acid composition and length that are self-renewing. Substrate hydrolysis by a target protease was measured quantitatively via changes in whole-cell fluorescence by using FACS. FACS enabled efficient screening to identify optimal substrates for a given protease and characterize their cleavage kinetics. The utility of CLiPS was demonstrated by determining the substrate specificity of two unrelated proteases, caspase-3 and enteropeptidase (or enterokinase). CLiPS unambiguously identified the caspase-3 consensus cleavage sequence DXVDG. Enteropeptidase was unexpectedly promiscuous, but exhibited a preference for substrates with the motif (D/E)RM, which were cleaved substantially faster than the canonical DDDDK recognition sequence, widely used for protein purification. CLiPS provides a straightforward and versatile approach to determine protease specificity and discover optimal substrates on the basis of cleavage kinetics.

  3. Equine herpesvirus type 4 UL56 and UL49.5 proteins downregulate cell surface major histocompatibility complex class I expression independently of each other.

    PubMed

    Said, Abdelrahman; Azab, Walid; Damiani, Armando; Osterrieder, Nikolaus

    2012-08-01

    Major histocompatibility complex class I (MHC-I) molecules are critically important in the host defense against various pathogens through presentation of viral peptides to cytotoxic T lymphocytes (CTLs), a process resulting in the destruction of virus-infected cells. Herpesviruses interfere with CTL-mediated elimination of infected cells by various mechanisms, including inhibition of peptide transport and loading, perturbation of MHC-I trafficking, and rerouting and proteolysis of cell surface MHC-I. In this study, we show that equine herpesvirus type 4 (EHV-4) modulates MHC-I cell surface expression through two different mechanisms. First, EHV-4 can lead to a significant downregulation of MHC-I expression at the cell surface through the product of ORF1, a protein expressed with early kinetics from a gene that is homologous to herpes simplex virus 1 UL56. The EHV-4 UL56 protein reduces cell surface MHC-I as early as 4 h after infection. Second, EHV-4 can interfere with MHC-I antigen presentation, starting at 6 h after infection, by inhibition of the transporter associated with antigen processing (TAP) through its UL49.5 protein. Although pUL49.5 has no immediate effect on overall surface MHC-I levels in infected cells, it blocks the supply of antigenic peptides to the endoplasmic reticulum (ER) and transport of peptide-loaded MHC-I to the cell surface. Taken together, our results show that EHV-4 encodes at least two viral immune evasion proteins: pUL56 reduces MHC-I molecules on the cell surface at early times after infection, and pUL49.5 interferes with MHC-I antigen presentation by blocking peptide transport in the ER.

  4. The Taenia saginata homologue of the major surface antigen of Echinococcus spp. is immunogenic and 97% identical to its Taenia solium homologue.

    PubMed

    González, Luis Miguel; Ferrer, Elizabeth; Spickett, Andrea; Michael, Lynne M; Vatta, Adriano F; Gárate, Teresa; Harrison, Leslie J S; Parkhouse, R Michael E

    2007-11-01

    The TEG-Tsag gene of Taenia saginata is homologous to the genes expressing the two major surface antigens of Echinococcus spp. (EM10 and EG10). Surface antigens of parasites are logical candidates for vaccines, and in this paper we demonstrate that cattle vaccinated with the recombinant TEG-Tsag protein, either used singly or in conjunction with the recombinant HP6-Tsag protein, the major 18 kDa surface/secreted antigen of T. saginata oncospheres, produce excellent antibody responses to both these recombinant proteins. Thus TEG-Tsag may have utility as a vaccine and also as a diagnostic tool for bovine cysticercosis. In addition, as we now demonstrate a 97% homology between TEG-Tsag and its Taenia solium homologue, TEG-Tsol, this latter molecule may have similar potential in the control of human and porcine cysticercosis. The TEG molecule is characterized by an N-terminal FERM domain and a C-terminal ERM domain which are found in a number of cytoskeletal-associated proteins located at the interface between the plasma membrane and the cytoskeleton and in proteins that interact with lipid membranes. The FERM domain is also postulated to bind to adhesion proteins, in a PIP2-regulated fashion, providing a link between cytoskeletal signals and membrane dynamics. Thus TEG protein may play a role in tegument function and interaction with the host.

  5. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  6. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  7. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine.

    PubMed

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R; Ketterman, Albert J

    2015-11-24

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target.

  8. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine

    PubMed Central

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R.; Ketterman, Albert J.

    2015-01-01

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target. PMID:26597768

  9. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  10. Biochemical and biophysical characterization of the major outer surface protein, OSP-A from North American and European isolates of Borrelia burgdorferi

    SciTech Connect

    McGrath, B.C.; Dunn, J.J.; France, L.L.; Jaing, W.; Polin, D.; Gorgone, G.; Luft, B.; Dykhuizen, D.

    1995-12-31

    Lyme borreliosis, caused by the spirochete Borrelia burgdorferi, is the most common vector-borne disease in North America and Western Europe. As the major delayed immune response in humans, a better understanding of the major outer surface lipoproteins OspA and OspB are of much interest. These proteins have been shown to exhibit three distinct phylogenetic genotypes based on their DNA sequences. This paper describes the cloning of genomic DNA for each variant and amplification of PCR. DNA sequence data was used to derive computer driven phylogenetic analysis and deduced amino acid sequences. Overproduction of variant OspAs was carried out in E. coli using a T7-based expression system. Circular dichroism and fluorescence studies was carried out on the recombinant B31 PspA yielding evidence supporting a B31 protein containing 11% alpha-helix, 34% antiparallel beta-sheet, 12% parallel beta sheet.

  11. Aspartic acid protease from Botrytis cinerea removes haze-forming proteins during white winemaking.

    PubMed

    Van Sluyter, Steven C; Warnock, Nicholas I; Schmidt, Simon; Anderson, Peter; van Kan, Jan A L; Bacic, Antony; Waters, Elizabeth J

    2013-10-09

    White wines suffer from heat-induced protein hazes during transport and storage unless the proteins are removed prior to bottling. Bentonite fining is by far the most commonly used method, but it is inefficient and creates several other process challenges. An alternative to bentonite is the enzymatic removal of haze-forming grape pathogenesis-related proteins using added proteases. The major problem with this approach is that grape pathogenesis-related proteins are highly protease resistant unless they are heat denatured in combination with enzymatic treatment. This paper demonstrates that the protease BcAP8, from the grape fungal pathogen Botrytis cinerea , is capable of degrading chitinase, a major class of haze-forming proteins, without heat denaturation. Because BcAP8 effectively removes haze-forming proteins under normal winemaking conditions, it could potentially benefit winemakers by reducing bentonite requirements.

  12. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  13. Functional analysis of rhomboid proteases during Toxoplasma invasion.

    PubMed

    Shen, Bang; Buguliskis, Jeffrey S; Lee, Tobie D; Sibley, L David

    2014-10-21

    Host cell invasion by Toxoplasma gondii and other apicomplexan parasites requires transmembrane adhesins that mediate binding to receptors on the substrate and host cell to facilitate motility and invasion. Rhomboid proteases (ROMs) are thought to cleave adhesins within their transmembrane segments, thus allowing the parasite to disengage from receptors and completely enter the host cell. To examine the specific roles of individual ROMs during invasion, we generated single, double, and triple knockouts for the three ROMs expressed in T. gondii tachyzoites. Analysis of these mutants demonstrated that ROM4 is the primary protease involved in adhesin processing and host cell invasion, whereas ROM1 or ROM5 plays negligible roles in these processes. Deletion of ROM4 blocked the shedding of adhesins such as MIC2 (microneme protein 2), causing them to accumulate on the surface of extracellular parasites. Increased surface adhesins led to nonproductive attachment, altered gliding motility, impaired moving junction formation, and reduced invasion efficiency. Despite the importance of ROM4 for efficient invasion, mutants lacking all three ROMs were viable and MIC2 was still efficiently removed from the surface of invaded mutant parasites, implying the existence of ROM-independent mechanisms for adhesin removal during invasion. Collectively, these results suggest that although ROM processing of adhesins is not absolutely essential, it is important for efficient host cell invasion by T. gondii. Importance: Apicomplexan parasites such as Toxoplasma gondii express surface proteins that bind host cell receptors to aid invasion. Many of these adhesins are subject to cleavage by rhomboid proteases (ROMs) within their transmembrane segments during invasion. Previous studies have demonstrated the importance of adhesin cleavage for parasite invasion and proposed that the ROMs responsible for processing would be essential for parasite survival. In T. gondii, ROM5 was thought to be the

  14. On the methane paradox: Transport from shallow water zones rather than in situ methanogenesis is the major source of CH4 in the open surface water of lakes

    NASA Astrophysics Data System (ADS)

    Encinas Fernández, Jorge; Peeters, Frank; Hofmann, Hilmar

    2016-10-01

    Estimates of global methane (CH4) emissions from lakes and the contributions of different pathways are currently under debate. In situ methanogenesis linked to algae growth was recently suggested to be the major source of CH4 fluxes from aquatic systems. However, based on our very large data set on CH4 distributions within lakes, we demonstrate here that methane-enriched water from shallow water zones is the most likely source of the basin-wide mean CH4 concentrations in the surface water of lakes. Consistently, the mean surface CH4 concentrations are significantly correlated with the ratio between the surface area of the shallow water zone and the entire lake, fA,s/t, but not with the total surface area. The categorization of CH4 fluxes according to fA,s/t may therefore improve global estimates of CH4 emissions from lakes. Furthermore, CH4 concentrations increase substantially with water temperature, indicating that seasonally resolved data are required to accurately estimate annual CH4 emissions.

  15. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  16. The effect of limited proteolysis by different proteases on the formation of whey protein fibrils.

    PubMed

    Gao, Yu-Zhe; Xu, Hong-Hua; Ju, Ting-Ting; Zhao, Xin-Huai

    2013-01-01

    Four proteases: trypsin, protease A, pepsin, and protease M were selected to modify whey protein concentrate (WPC) at a low degree of hydrolysis (0.1, 0.2, and 0.3%) before adjusting to pH 2.0 and heating at 90°C to gain insight into the influence of proteolysis on fibril formation. The kinetics of fibril formation were performed on native and modified WPC using the fluorescent dye thioflavin T in conjunction with transmission electron microscopy and far-UV circular dichroism spectroscopy for the morphological and secondary structural analyses. The change in surface hydrophobicity and content of free sulfhydryl groups were also observed during the formation of fibrils for the native and modified WPC. The content of aggregation and thioflavin T kinetic data indicated that the ability of fibril formation was apparently different for WPC modified by the 4 proteases. Whey protein concentrate modified by trypsin aggregated more during heating and the fibril formation rate was faster than that of the native WPC. Whey protein concentrate modified by the other proteases showed slower aggregation with worse amyloid fibril morphology. Compared with the native WPC, the structure of WPC changed differently after being modified by proteases. The state of α-helix structure for modified WPC played the most important role in the formation of fibrils. Under the mild conditions used in this work, the α-helix structure of WPC modified by trypsin caused little destruction and resulted in fibrils with good morphology; the content of α-helices for WPC modified by other proteases decreased to 36.19 to 50.94%; thus, fibril formation was inhibited. In addition, it was beneficial for the modified WPC to form fibrils such that the surface hydrophobicity increased and the content of free sulfhydryl groups slightly decreased during heating.

  17. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  18. Identification of Major Risk Sources for Surface Water Pollution by Risk Indexes (RI) in the Multi-Provincial Boundary Region of the Taihu Basin, China

    PubMed Central

    Yao, Hong; Li, Weixin; Qian, Xin

    2015-01-01

    Environmental safety in multi-district boundary regions has been one of the focuses in China and is mentioned many times in the Environmental Protection Act of 2014. Five types were categorized concerning the risk sources for surface water pollution in the multi-provincial boundary region of the Taihu basin: production enterprises, waste disposal sites, chemical storage sites, agricultural non-point sources and waterway transportations. Considering the hazard of risk sources, the purification property of environmental medium and the vulnerability of risk receptors, 52 specific attributes on the risk levels of each type of risk source were screened out. Continuous piecewise linear function model, expert consultation method and fuzzy integral model were used to calculate the integrated risk indexes (RI) to characterize the risk levels of pollution sources. In the studied area, 2716 pollution sources were characterized by RI values. There were 56 high-risk sources screened out as major risk sources, accounting for about 2% of the total. The numbers of sources with high-moderate, moderate, moderate-low and low pollution risk were 376, 1059, 101 and 1124, respectively, accounting for 14%, 38%, 5% and 41% of the total. The procedure proposed could be included in the integrated risk management systems of the multi-district boundary region of the Taihu basin. It could help decision makers to identify major risk sources in the risk prevention and reduction of surface water pollution. PMID:26308032

  19. Identification of Major Risk Sources for Surface Water Pollution by Risk Indexes (RI) in the Multi-Provincial Boundary Region of the Taihu Basin, China.

    PubMed

    Yao, Hong; Li, Weixin; Qian, Xin

    2015-08-21

    Environmental safety in multi-district boundary regions has been one of the focuses in China and is mentioned many times in the Environmental Protection Act of 2014. Five types were categorized concerning the risk sources for surface water pollution in the multi-provincial boundary region of the Taihu basin: production enterprises, waste disposal sites, chemical storage sites, agricultural non-point sources and waterway transportations. Considering the hazard of risk sources, the purification property of environmental medium and the vulnerability of risk receptors, 52 specific attributes on the risk levels of each type of risk source were screened out. Continuous piecewise linear function model, expert consultation method and fuzzy integral model were used to calculate the integrated risk indexes (RI) to characterize the risk levels of pollution sources. In the studied area, 2716 pollution sources were characterized by RI values. There were 56 high-risk sources screened out as major risk sources, accounting for about 2% of the total. The numbers of sources with high-moderate, moderate, moderate-low and low pollution risk were 376, 1059, 101 and 1124, respectively, accounting for 14%, 38%, 5% and 41% of the total. The procedure proposed could be included in the integrated risk management systems of the multi-district boundary region of the Taihu basin. It could help decision makers to identify major risk sources in the risk prevention and reduction of surface water pollution.

  20. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    PubMed

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study

  1. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  2. Organohalogen pollutants in surface particulates from workshop floors of four major e-waste recycling sites in China and implications for emission lists.

    PubMed

    Zeng, Yan-Hong; Tang, Bin; Luo, Xiao-Jun; Zheng, Xiao-Bo; Peng, Ping-An; Mai, Bi-Xian

    2016-11-01

    To examine the environmental pollution associated with e-waste recycling activities, the concentrations of organohologenated pollutants (OHPs), i.e., short- and medium-chain chlorinated paraffins (SCCPs and MCCPs), polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), and several other halogenated flame retardants (OHFRs), were investigated in surface particulates from the workshop floors of four major e-waste recycling sites (Taizhou, Guiyu, Dali and Qingyuan) in China. The mean levels of SCCPs, MCCPs, PCBs, PBDEs and OHFRs in surface particulates ranged from 30,000-61,000, 170,000-890,000, 2700-27,000, 52,000-240,000, and 62,000-140,000ng/g dry weight (dw), respectively. OHFRs, including decabromodiphenyl ethane, dechlorane plus, 1,2-bis(2,4,6-tribromophenoxy)ethane, tetrabromobisphenol A, hexabromocyclododecanes, polybrominated biphenyls, hexabromobenzene, pentabromotoluene, and pentabromoethylbenzene, were frequently (>50% detection frequency) detected in surface particulates with mean concentration ranges of 39,000-63,000, 310-2700, 98-16,000, 21,000-56,000, 55-5700, 1700-27,000, 42-1600, 3.2-220, and 5.8-12ng/g dw, respectively. The composition of OHPs varied depend on the e-waste items processing in different regions. Guiyu and Dali were typical sites contaminated by halogenated flame retardants (HFRs) and CPs, respectively, while Qingyuan, and Taizhou were representative PCB-polluted regions. The evidence produced by this preliminary study indicated that electronic devices and plastics may account for the high content of HFRs and the metal products are likely the major source of CPs in these e-waste sites.

  3. Major depression

    MedlinePlus

    Depression - major; Depression - clinical; Clinical depression; Unipolar depression; Major depressive disorder ... providers do not know the exact causes of depression. It is believed that chemical changes in the ...

  4. A multifaceted analysis of HIV-1 protease multidrug resistance phenotypes

    PubMed Central

    2011-01-01

    Background Great strides have been made in the effective treatment of HIV-1 with the development of second-generation protease inhibitors (PIs) that are effective against historically multi-PI-resistant HIV-1 variants. Nevertheless, mutation patterns that confer decreasing susceptibility to available PIs continue to arise within the population. Understanding the phenotypic and genotypic patterns responsible for multi-PI resistance is necessary for developing PIs that are active against clinically-relevant PI-resistant HIV-1 variants. Results In this work, we use globally optimal integer programming-based clustering techniques to elucidate multi-PI phenotypic resistance patterns using a data set of 398 HIV-1 protease sequences that have each been phenotyped for susceptibility toward the nine clinically-approved HIV-1 PIs. We validate the information content of the clusters by evaluating their ability to predict the level of decreased susceptibility to each of the available PIs using a cross validation procedure. We demonstrate the finding that as a result of phenotypic cross resistance, the considered clinical HIV-1 protease isolates are confined to ~6% or less of the clinically-relevant phenotypic space. Clustering and feature selection methods are used to find representative sequences and mutations for major resistance phenotypes to elucidate their genotypic signatures. We show that phenotypic similarity does not imply genotypic similarity, that different PI-resistance mutation patterns can give rise to HIV-1 isolates with similar phenotypic profiles. Conclusion Rather than characterizing HIV-1 susceptibility toward each PI individually, our study offers a unique perspective on the phenomenon of PI class resistance by uncovering major multidrug-resistant phenotypic patterns and their often diverse genotypic determinants, providing a methodology that can be applied to understand clinically-relevant phenotypic patterns to aid in the design of novel inhibitors that

  5. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  6. Assessment of spatial variability of major-ion concentrations and del oxygen-18 values in surface snow, Upper Fremont Glacier, Wyoming, USA

    USGS Publications Warehouse

    Naftz, D.L.; Schuster, P.F.; Reddy, M.M.

    1994-01-01

    One hundred samples were collected from the surface of the Upper Fremont Glacier at equally spaced intervals defined by an 8100m2 snow grid to asesss the significance of lateral variability in major-ion concentrations and del oxygen-18 values. Comparison of the observed variability of each chemical constituent to the variability expected by measurement error indicated substantial lateral variability with the surface-snow layer. Results of the nested ANOVA indicate most of the variance for every constituent is in the values grouped at the two smaller geographic scales (between 506m2 and within 506m2 sections). The variance data from the snow grid were used to develop equations to evaluate the significance of both positive and negative concentration/value peaks of nitrate and del oxygen-18 with depth, in a 160m ice core. Values of del oxygen-18 in the section from 110-150m below the surface consistently vary outside the expected limits and possibly represents cooler temperatures during the Little Ice Age from about 1810 to 1725 A.D. -from Authors

  7. Lazarus and Group Psychotherapy: AIDS in the Era of Protease Inhibitors

    ERIC Educational Resources Information Center

    Gushue, George V.; Brazaitis, Sarah J.

    2003-01-01

    A new class of medications, protease inhibitors, has dramatically improved the health of many people with Human Immunodeficiency Virus (HIV) and Acquired Immune Deficiency Syndrome (AIDS). This development has had a major impact on the lives of those affected by HIV/AIDS. This article considers how a group is affected by the larger systems of…

  8. The major parasite surface antigen associated with human resistance to schistosomiasis is a 37-kD glyceraldehyde-3P-dehydrogenase

    PubMed Central

    1989-01-01

    Schistosomiasis, due to Schistosoma mansoni, is a major health problem in many subtropical countries, and major efforts are being made to define a vaccine. In this regard, we have reported that sera from subjects with low susceptibility to infection by S. mansoni react with a major larval surface antigen (P-37), having an apparent molecular mass of 37 kD, against which sera of susceptible individuals show little reactivity. We have now cloned the cDNA for this antigen by screening a schistosome cDNA expression library with antibodies against the purified protein. The selected cDNAs encode a protein that is specifically identified by immune human sera containing antibodies against P-37, while sera exhibiting low or no reactivity toward P-37 fail to recognize the recombinant protein. The cloned cDNAs hybridize with a 1.2-kb RNA that is the transcript of a single copy gene. This RNA directs the synthesis of a 36.5-kD polypeptide that is precipitated by sera from the most resistant subjects. The amino acid sequence of the encoded polypeptide shows homology with the glycolytic enzyme Glyceraldehyde-3P-dehydrogenase (72.5% of positional identity with human Glyceraldehyde-3P-dehydrogenase). Antibodies against the recombinant protein identified P-37 on the larva. These findings, together with other reports, indicate that a number of conserved proteins may be major targets of host-protective immunity against S. mansoni. The hypothesis is discussed that genetic restriction of the immune response to these antigens may occur in heterogeneous human populations because of the limited number of T cell epitopes carried by these host-like proteins. Such genetic effects might allow parasite transmission through nonresponder (susceptible) individuals. This hypothesis and the protective properties of P-37 can now be tested using the recombinant protein and synthetic peptides derived from selected regions of the polypeptide chain. PMID:2584935

  9. An 11-kDa form of human immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic activity.

    PubMed Central

    Graves, M C; Lim, J J; Heimer, E P; Kramer, R A

    1988-01-01

    In order to define the protease domain of human immunodeficiency virus 1, various regions of the pol open reading frame were cloned and expressed in Escherichia coli. Antiserum directed against the conserved retroviral protease active site was used to identify pol precursor and processed species containing the presumed protease domain. The smallest product that accumulates is about 11 kDa as measured by NaDodSO4/PAGE. This size agrees with that predicted from the presence in this region of two Phe-Pro sequences, which is one of the cleavage sites recognized by HIV protease. DNA encoding only the predicted 11-kDa protein was cloned, bypassing the need for autoprocessing, and the protein was expressed to a high level in E. coli. This form is active as demonstrated by its ability to specifically cleave protease-deficient pol protein in vivo in E. coli. Extracts of E. coli containing the 11-kDa protease also process human immunodeficiency virus gag substrates in vitro. These results demonstrate that the 11-kDa protease is sufficient for enzymatic activity and are consistent with a major role for this form in virus maturation. Images PMID:3282230

  10. Cowpea bruchid Callosobruchus maculatus uses a three-component strategy to overcome a plant defensive cysteine protease inhibitor.

    PubMed

    Zhu-Salzman, K; Koiwa, H; Salzman, R A; Shade, R E; Ahn, J-E

    2003-04-01

    The soybean cysteine protease inhibitor, soyacystatin N (scN), negatively impacts growth and development of the cowpea bruchid, Callosobruchus maculatus[Koiwa et al. (1998) Plant J 14: 371-379]. However, the developmental delay and feeding inhibition caused by dietary scN occurred only during the early developmental stages (the 1st, 2nd and 3rd instars) of the cowpea bruchid. The 4th instar larvae reared on scN diet (adapted) exhibited rates of feeding and development which were comparable to those feeding on an scN-free diet (unadapted) prior to pupation. Total gut proteolytic capacity at this larval stage significantly increased in the scN-adapted insects. The elevated enzymatic activity was attributed to a differential expression of insect gut cysteine proteases (representing the major digestive enzymes), and of aspartic proteases. scN degradation by the gut extract was observed only in adapted bruchids, and this activity appeared to be a combined effect of scN-induced cysteine and aspartic proteases. Thirty cDNAs encoding cathepsin L-like cysteine proteases were isolated from insect guts, and they were differentially regulated by dietary scN. Our results suggest that the cowpea bruchid adapts to the challenge of scN by qualitative and quantitative remodelling of its digestive protease complement, and by activating scN-degrading protease activity.

  11. Cysteine and Aspartyl Proteases Contribute to Protein Digestion in the Gut of Freshwater Planaria

    PubMed Central

    Goupil, Louise S.; Ivry, Sam L.; Hsieh, Ivy; Suzuki, Brian M.; Craik, Charles S.; O’Donoghue, Anthony J.; McKerrow, James H.

    2016-01-01

    Proteases perform numerous vital functions in flatworms, many of which are likely to be conserved throughout the phylum Platyhelminthes. Within this phylum are several parasitic worms that are often poorly characterized due to their complex life-cycles and lack of responsiveness to genetic manipulation. The flatworm Schmidtea mediterranea, or planaria, is an ideal model organism to study the complex role of protein digestion due to its simple life cycle and amenability to techniques like RNA interference (RNAi). In this study, we were interested in deconvoluting the digestive protease system that exists in the planarian gut. To do this, we developed an alcohol-induced regurgitation technique to enrich for the gut enzymes in S. mediterranea. Using a panel of fluorescent substrates, we show that this treatment produces a sharp increase in proteolytic activity. These enzymes have broad yet diverse substrate specificity profiles. Proteomic analysis of the gut contents revealed the presence of cysteine and metallo-proteases. However, treatment with class-specific inhibitors showed that aspartyl and cysteine proteases are responsible for the majority of protein digestion. Specific RNAi knockdown of the cathepsin B-like cysteine protease (SmedCB) reduced protein degradation in vivo. Immunohistochemistry and whole-mount in situ hybridization (WISH) confirmed that the full-length and active forms of SmedCB are found in secretory cells surrounding the planaria intestinal lumen. Finally, we show that the knockdown of SmedCB reduces the speed of tissue regeneration. Defining the roles of proteases in planaria can provide insight to functions of conserved proteases in parasitic flatworms, potentially uncovering drug targets in parasites. PMID:27501047

  12. Purification and biochemical characterization of a novel alkaline protease produced by Penicillium nalgiovense.

    PubMed

    Papagianni, M; Sergelidis, D

    2014-04-01

    Penicillium nalgiovense PNA9 produces an extracellular protease during fermentation with characteristics of growth-associated product. Enzyme purification involved ammonium sulfate precipitation, dialysis, and ultrafiltration, resulting in 12.1-fold increase of specific activity (19.5 U/mg). The protein was isolated through a series of BN-PAGE and native PAGE runs. ESI-MS analysis confirmed the molecular mass of 45.2 kDa. N-Terminal sequencing (MGFLKLLKGSLATLAVVNAGKLLTANDGDE) revealed 93 % similarity to a Penicillium chrysogenum protease, identified as major allergen. The protease exhibits simple Michaelis-Menten kinetics and K m (1.152 mg/ml), V max (0.827 mg/ml/min), and k cat (3.2 × 10(2)) (1/s) values against azocasein show that it possesses high substrate affinity and catalytic efficiency. The protease is active within 10-45 °C, pH 4.0-10.0, and 0-3 M NaCl, while maximum activity was observed at 35 °C, pH 8.0, and 0.25 M NaCl. It is active against the muscle proteins actin and myosin and inactive against myoglobin. It is highly stable in the presence of non-ionic surfactants, hydrogen peroxide, BTNB, and EDTA. Activity was inhibited by SDS, Mn(2+) and Zn(2+), and by the serine protease inhibitor PMSF, indicating the serine protease nature of the enzyme. These properties make the novel protease a suitable candidate enzyme in meat ripening and other biotechnological applications.

  13. Observed and simulated sensitivities of summertime urban surface air temperatures to anthropogenic heat in downtown areas of two Japanese Major Cities, Tokyo and Osaka

    NASA Astrophysics Data System (ADS)

    Kikegawa, Yukihiro; Tanaka, Ai; Ohashi, Yukitaka; Ihara, Tomohiko; Shigeta, Yoshinori

    2014-07-01

    In this study, the sensitivities of surface air temperatures to anthropogenic heat (AH) were investigated in downtowns of the two Japanese major cities, Tokyo and Osaka. First, meteorological measurements were made with the simultaneous monitoring of electricity demand in a contrastive couple of a downtown commercial area (C-area) and a residential area (R-area) within each city in summer 2007. From the measurements, the areal-mean surface air temperatures were obtained as and for each of the C-area and R-area, respectively. Using the actual electricity demand and the estimated motor fuels consumption, their areal total was evaluated as the energy-consumption-basis AH. The estimated C-areas' AH indicated greater values up to 220 W/m2 on weekdays and remarkable decrease about by half on weekends, whereas that in the R-areas showed less values of 10-20 W/m2 stably. Then, on calm and fine days were found to be systematically decreased from weekdays to weekends in both cities roughly indicating a proportional relationship with the reductions in the C-areas' AH on weekends. The result suggested a common afternoon sensitivity for both C-areas of around 1.0°C/100 W/m2, which indicated an intensity of the AH impact on surface air temperature there. Next, to simulate the observed AH impact, the authors' CM-BEM (a multilayer urban canopy model coupled with a building energy model) was newly implemented in the mesoscale Weather Research and Forecasting (WMF) model. This new system, WRF-CM-BEM, was applied to Tokyo and almost reasonably validated from the aspects of the reproducibility of urban surface air temperature and electricity demand in the observation areas. The simulations also suggested that WRF-CM-BEM underestimated the observed air temperature sensitivity to AH in the Tokyo C-area roughly by half but still in the same order of magnitude.

  14. A modeling study of the impact of major storms on waves, surface and near-bed currents on the Grand Banks of Newfoundland

    NASA Astrophysics Data System (ADS)

    Li, Michael Z.; Wu, Yongsheng; Prescott, Robert H.; Tang, Charles C. L.; Han, Guoqi

    2015-08-01

    Waves and current processes, both surface and near-bed were simulated for major storms on the Grand Banks of Newfoundland using integrated wave, 3-D tidal and ocean current models. Most storms track southwest to northeast and pass to the north or northwest of the Grand Banks. Significant wave heights can reach up to ˜14 m and are predominantly to the northeast at the peak of storms. Extreme surface currents reach approximately 1 m s-1 and are largely to the southeast. The strongest bottom currents, up to 0.8 m s-1, occur on St. Pierre Bank and are dominantly to the south and southeast. While wave height and wind-driven current generally increase with wind speed, factors such as storm paths, the relative location of the storm center at the storm peak, and storm translation speed also affect waves and currents. Surface and near-bed wind-driven currents both rotate clockwise and decrease in strength as the storm traverses the Grand Banks. While the spatial variability of the storm impact on surface currents is relatively small, bottom currents show significant spatial variation of magnitude and direction as well as timing of peak current conditions. These spatial variations are controlled by the changes of bathymetry and mixed layer depth over the model domain. The storm-generated currents can be 7 to 10 times stronger than the background mean currents. These strong currents interact with wave oscillatory flows to produce shear velocities up to 15 cm s-1 and cause wide occurrences of strong sediment transport over nearly the entire Grand Banks.

  15. Identification of non-peptidic cysteine reactive fragments as inhibitors of cysteine protease rhodesain.

    PubMed

    McShan, Danielle; Kathman, Stefan; Lowe, Brittiney; Xu, Ziyang; Zhan, Jennifer; Statsyuk, Alexander; Ogungbe, Ifedayo Victor

    2015-10-15

    Rhodesain, the major cathepsin L-like cysteine protease in the protozoan Trypanosoma brucei rhodesiense, the causative agent of African sleeping sickness, is a well-validated drug target. In this work, we used a fragment-based approach to identify inhibitors of this cysteine protease, and identified inhibitors of T. brucei. To discover inhibitors active against rhodesain and T. brucei, we screened a library of covalent fragments against rhodesain and conducted preliminary SAR studies. We envision that in vitro enzymatic assays will further expand the use of the covalent tethering method, a simple fragment-based drug discovery technique to discover covalent drug leads.

  16. Design of HIV Protease Inhibitors Targeting Protein Backbone: An Effective Strategy for Combating Drug Resistance

    SciTech Connect

    Ghosh, Arun K.; Chapsal, Bruno D.; Weber, Irene T.; Mitsuya, Hiroaki

    2008-06-03

    The discovery of human immunodeficiency virus (HIV) protease inhibitors (PIs) and their utilization in highly active antiretroviral therapy (HAART) have been a major turning point in the management of HIV/acquired immune-deficiency syndrome (AIDS). However, despite the successes in disease management and the decrease of HIV/AIDS-related mortality, several drawbacks continue to hamper first-generation protease inhibitor therapies. The rapid emergence of drug resistance has become the most urgent concern because it renders current treatments ineffective and therefore compels the scientific community to continue efforts in the design of inhibitors that can efficiently combat drug resistance.

  17. Isolation and characterization of two serine proteases from metagenomic libraries of the Gobi and Death Valley deserts.

    PubMed

    Neveu, Julie; Regeard, Christophe; DuBow, Michael S

    2011-08-01

    The screening of environmental DNA metagenome libraries for functional activities can provide an important source of new molecules and enzymes. In this study, we identified 17 potential protease-producing clones from two metagenomic libraries derived from samples of surface sand from the Gobi and Death Valley deserts. Two of the proteases, DV1 and M30, were purified and biochemically examined. These two proteases displayed a molecular mass of 41.5 kDa and 45.7 kDa, respectively, on SDS polyacrylamide gels. Alignments with known protease sequences showed less than 55% amino acid sequence identity. These two serine proteases appear to belong to the subtilisin (S8A) family and displayed several unique biochemical properties. Protease DV1 had an optimum pH of 8 and an optimal activity at 55°C, while protease M30 had an optimum pH >11 and optimal activity at 40°C. The properties of these enzymes make them potentially useful for biotechnological applications and again demonstrate that metagenomic approaches can be useful, especially when coupled with the study of novel environments such as deserts.

  18. An Alkaline Protease from Bacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive

    PubMed Central

    Baweja, Mehak; Tiwari, Rameshwar; Singh, Puneet K.; Nain, Lata; Shukla, Pratyoosh

    2016-01-01

    A proteolytic strain of Bacillus pumilus MP 27 was isolated from water samples of Southern ocean produced alkaline protease. Since protease production need expensive ingredients, an economically viable process was developed by using low cost carbon source, wheat straw, supplemented with peptone. This protease was active within temperature ranges 10–70°C at pH 9. This process was optimized by response surface methodology using a Box Bekhman design by Design Expert 7.0 software that increased the protease activity to 776.5 U/ml. Moreover, the enzyme was extremely stable at a broad range of temperature and pH retaining 69% of its activity at 50°C and 70% at pH 11. The enzyme exhibited excellent compatibility with surfactants and commercial detergents, showing 87% stability with triton X-100 and 100% stability with Tide commercial detergent. The results of the wash performance analysis demonstrated considerably good de-staining at 50 and 4°C with low supplementation (109 U/ml). Molecular modeling of the protease revealed the presence of serine proteases, subtilase family and serine active site and further docking supported the association of catalytic site with the various substrates. Certainly, such protease can be considered as a good detergent additive in detergent industry with a possibility to remove the stains effectively even in a cold wash. PMID:27536284

  19. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  20. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  1. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  2. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  3. Structure of the Autocatalytic Cysteine Protease Domain of Potyvirus Helper-component Proteinase*

    PubMed Central

    Guo, Bihong; Lin, Jinzhong; Ye, Keqiong

    2011-01-01

    The helper-component proteinase (HC-Pro) of potyvirus is involved in polyprotein processing, aphid transmission, and suppression of antiviral RNA silencing. There is no high resolution structure reported for any part of HC-Pro, hindering mechanistic understanding of its multiple functions. We have determined the crystal structure of the cysteine protease domain of HC-Pro from turnip mosaic virus at 2.0 Å resolution. As a protease, HC-Pro only cleaves a Gly-Gly dipeptide at its own C terminus. The structure represents a postcleavage state in which the cleaved C terminus remains tightly bound at the active site cleft to prevent trans activity. The structure adopts a compact α/β-fold, which differs from papain-like cysteine proteases and shows weak similarity to nsP2 protease from Venezuelan equine encephalitis alphavirus. Nevertheless, the catalytic cysteine and histidine residues constitute an active site that is highly similar to these in papain-like and nsP2 proteases. HC-Pro recognizes a consensus sequence YXVGG around the cleavage site between the two glycine residues. The structure delineates the sequence specificity at sites P1–P4. Structural modeling and covariation analysis across the Potyviridae family suggest a tryptophan residue accounting for the glycine specificity at site P1′. Moreover, a surface of the protease domain is conserved in potyvirus but not in other genera of the Potyviridae family, likely due to extra functional constrain. The structure provides insight into the catalysis mechanism, cis-acting mode, cleavage site specificity, and other functions of the HC-Pro protease domain. PMID:21543324

  4. Recent patents and emerging therapeutics for HIV infections: a focus on protease inhibitors.

    PubMed

    Patel, Mitesh; Mandava, Nanda K; Vadlapatla, Ramya Krishna; Mitra, Ashim K

    2013-07-01

    The inclusion of protease inhibitors (PIs) in highly active antiretroviral therapy has significantly improved clinical outcomes in HIV-1-infected patients. To date, PIs are considered to be the most important therapeutic agents for the treatment of HIV infections. Despite high anti-HIV-1 potency, poor oral bioavailability of PIs has been a major concern. For achieving therapeutic concentrations, large doses of PIs are administered, which results in unacceptable systemic toxicities. Such severe and long-term toxicities necessitate the development of safer and potentially promising PIs. Recently, considerable attention has been paid to the development of newer compounds capable of inhibiting wild-type and resistant HIV-1 protease. Some of these PIs have displayed potent HIV-1 protease inhibitory activity. In this review, we have made an attempt to provide an overview on clinically approved and newly developing PIs, and related recent patents in the development of novel PIs.

  5. Structural basis for the immunomodulatory function of cysteine protease inhibitor from human roundworm Ascaris lumbricoides.

    PubMed

    Mei, Guoqiang; Dong, Jianmei; Li, Zhaotao; Liu, Sanling; Liu, Yunfeng; Sun, Mingze; Liu, Guiyun; Su, Zhong; Liu, Jinsong

    2014-01-01

    Immunosuppression associated with infections of nematode parasites has been documented. Cysteine protease inhibitor (CPI) released by the nematode parasites is identified as one of the major modulators of host immune response. In this report, we demonstrated that the recombinant CPI protein of Ascaris lumbricoides (Al-CPI) strongly inhibited the activities of cathepsin L, C, S, and showed weaker effect to cathepsin B. Crystal structure of Al-CPI was determined to 2.1 Å resolution. Two segments of Al-CPI, loop 1 and loop 2, were proposed as the key structure motifs responsible for Al-CPI binding with proteases and its inhibitory activity. Mutations at loop 1 and loop 2 abrogated the protease inhibition activity to various extents. These results provide the molecular insight into the interaction between the nematode parasite and its host and will facilitate the development of anthelmintic agents or design of anti-autoimmune disease drugs.

  6. The Hypervariable Amino-Terminus of P1 Protease Modulates Potyviral Replication and Host Defense Responses

    PubMed Central

    Pasin, Fabio; Simón-Mateo, Carmen; García, Juan Antonio

    2014-01-01

    The replication of many RNA viruses involves the translation of polyproteins, whose processing by endopeptidases is a critical step for the release of functional subunits. P1 is the first protease encoded in plant potyvirus genomes; once activated by an as-yet-unknown host factor, it acts in cis on its own C-terminal end, hydrolyzing the P1-HCPro junction. Earlier research suggests that P1 cooperates with HCPro to inhibit host RNA silencing defenses. Using Plum pox virus as a model, we show that although P1 does not have a major direct role in RNA silencing suppression, it can indeed modulate HCPro function by its self-cleavage activity. To study P1 protease regulation, we used bioinformatic analysis and in vitro activity experiments to map the core C-terminal catalytic domain. We present evidence that the hypervariable region that precedes the protease domain is predicted as intrinsically disordered, and that it behaves as a negative regulator of P1 proteolytic activity in in vitro cleavage assays. In viral infections, removal of the P1 protease antagonistic regulator is associated with greater symptom severity, induction of salicylate-dependent pathogenesis-related proteins, and reduced viral loads. We suggest that fine modulation of a viral protease activity has evolved to keep viral amplification below host-detrimental levels, and thus to maintain higher long-term replicative capacity. PMID:24603811

  7. Proteases from Canavalia ensiformis: Active and Thermostable Enzymes with Potential of Application in Biotechnology

    PubMed Central

    Gonçalves, Rayane Natshe; Gozzini Barbosa, Suellen Duarte

    2016-01-01

    Extracts of leaves, seeds, roots, and stem from a tropical legume, C. ensiformis, were prepared employing buffers and detergent in aqueous solution. Leaf extracts had the highest protein content and the most pronounced peptidase activity with optimal pH in the neutral to alkaline range. All extracts exhibited peaks of activity at various pH values, suggesting the presence of distinctive classes of proteases. N-α-Tosyl-L-arginine methyl ester hydrolysis was maximal at 30°C to 60°C and peptidase activity from all extracts presented very good thermal stability after 24 h incubation at 70°C. C. ensiformis proteases exhibited molecular masses of about 200–57, 40–37, and 20–15 kDa by SDS-PAGE analysis. These enzymes cleaved hemoglobin, bovine serum albumin, casein, and gelatin at different levels. Serine and metalloproteases are the major proteases in C. ensiformis extracts, modulated by divalent cations, stable at 1% of surfactant Triton X-100 and at different concentrations of the reducing agent β-mercaptoethanol. Thus, C. ensiformis expresses a particular set of proteases in distinctive organs with high activity and stability, making this legume an important source of proteases with biotechnological potential. PMID:27630776

  8. Secreted protease mediates interspecies interaction and promotes cell aggregation of the photosynthetic bacterium Chloroflexus aggregans.

    PubMed

    Morohoshi, Sho; Matsuura, Katsumi; Haruta, Shin

    2015-01-01

    Interspecies interactions were studied in hot spring microbial mats where diverse species of bacterial cells are densely packed. The anoxygenic photosynthetic bacterium, Chloroflexus aggregans, has been widely found in the microbial mats as a major component in terrestrial hot springs in Japan at the temperature from 50 to 70°C. C. aggregans shows cellular motility to form a microbial mat-like dense cell aggregate. The aggregating ability of C. aggregans was affected by another bacterial species, strain BL55a (related to Bacillus licheniformis) isolated from the microbial mats containing C. aggregans. Cell aggregation rate of C. aggregans was promoted by the addition of culture supernatants of strain BL55a. Similar effects were also detected from other bacterial isolates, specifically Geobacillus sp. and Aeribacillus sp. Protease activity was detected from the culture supernatants from all of these isolates. The promoting effect of strain BL55a was suppressed by a serine protease inhibitor, phenylmethylsulfonyl fluoride. A purified serine protease, subtilisin obtained from B. licheniformis, showed a promoting effect on the cell aggregation. These results suggest that an extracellular protease, secreted from co-existing bacterial species promoted the aggregating motility of C. aggregans. This is the first report that exogenous protease affects bacterial cellular motility.

  9. Machines of destruction - AAA+ proteases and the adaptors that control them.

    PubMed

    Gur, Eyal; Ottofueling, Ralf; Dougan, David A

    2013-01-01

    Bacteria are frequently exposed to changes in environmental conditions, such as fluctuations in temperature, pH or the availability of nutrients. These assaults can be detrimental to cell as they often result in a proteotoxic stress, which can cause the accumulation of unfolded proteins. In order to restore a productive folding environment in the cell, bacteria have evolved a network of proteins, known as the protein quality control (PQC) network, which is composed of both chaperones and AAA+ proteases. These AAA+ proteases form a major part of this PQC network, as they are responsible for the removal of unwanted and damaged proteins. They also play an important role in the turnover of specific regulatory or tagged proteins. In this review, we describe the general features of an AAA+ protease, and using two of the best-characterised AAA+ proteases in Escherichia coli (ClpAP and ClpXP) as a model for all AAA+ proteases, we provide a detailed mechanistic description of how these machines work. Specifically, the review examines the physiological role of these machines, as well as the substrates and the adaptor proteins that modulate their substrate specificity.

  10. The role of AAA+ proteases in mitochondrial protein biogenesis, homeostasis and activity control.

    PubMed

    Voos, Wolfgang; Ward, Linda A; Truscott, Kaye N

    2013-01-01

    Mitochondria are specialised organelles that are structurally and functionally integrated into cells in the vast majority of eukaryotes. They are the site of numerous enzymatic reactions, some of which are essential for life. The double lipid membrane of the mitochondrion, that spatially defines the organelle and is necessary for some functions, also creates a physical but semi-permeable barrier to the rest of the cell. Thus to ensure the biogenesis, regulation and maintenance of a functional population of proteins, an autonomous protein handling network within mitochondria is required. This includes resident mitochondrial protein translocation machinery, processing peptidases, molecular chaperones and proteases. This review highlights the contribution of proteases of the AAA+ superfamily to protein quality and activity control within the mitochondrion. Here they are responsible for the degradation of unfolded, unassembled and oxidatively damaged proteins as well as the activity control of some enzymes. Since most knowledge about these proteases has been gained from studies in the eukaryotic microorganism Saccharomyces cerevisiae, much of the discussion here centres on their role in this organism. However, reference is made to mitochondrial AAA+ proteases in other organisms, particularly in cases where they play a unique role such as the mitochondrial unfolded protein response. As these proteases influence mitochondrial function in both health and disease in humans, an understanding of their regulation and diverse activities is necessary.

  11. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  12. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  13. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  14. Isopeptide bonds of the major pilin protein BcpA influence pilus structure and bundle formation on the surface of Bacillus cereus

    SciTech Connect

    Hendrickx, Antoni P.A.; Poor, Catherine B.; Jureller, Justin E.; Budzik, Jonathan M.; He, Chuan; Schneewind, Olaf

    2012-09-05

    Bacillus cereus strains elaborate pili on their surface using a mechanism of sortase-mediated cross-linking of major and minor pilus components. Here we used a combination of electron microscopy and atomic force microscopy to visualize these structures. Pili occur as single, double or higher order assemblies of filaments formed from monomers of the major pilin, BcpA, capped by the minor pilin, BcpB. Previous studies demonstrated that within assembled pili, four domains of BcpA -- CNA{sub 1}, CNA{sub 2}, XNA and CNA{sub 3} -- each acquire intramolecular lysine-asparagine isopeptide bonds formed via catalytic glutamic acid or aspartic acid residues. Here we showed that mutants unable to form the intramolecular isopeptide bonds in the CNA2 or CNA3 domains retain the ability to form pilus bundles. A mutant lacking the CNA{sub 1} isopeptide bond assembled deformed pilin subunits that failed to associate as bundles. X-ray crystallography revealed that the BcpA variant Asp{sup 312}Ala, lacking an aspartyl catalyst, did not generate the isopeptide bond within the jelly-roll structure of XNA. The Asp{sup 312}Ala mutant was also unable to form bundles and promoted the assembly of deformed pili. Thus, structural integrity of the CNA{sub 1} and XNA domains are determinants for the association of pili into higher order bundle structures and determine native pilus structure.

  15. Papain protects papaya trees from herbivorous insects: role of cysteine proteases in latex.

    PubMed

    Konno, Kotaro; Hirayama, Chikara; Nakamura, Masatoshi; Tateishi, Ken; Tamura, Yasumori; Hattori, Makoto; Kohno, Katsuyuki

    2004-02-01

    Many plants contain latex that exudes when leaves are damaged, and a number of proteins and enzymes have been found in it. The roles of those latex proteins and enzymes are as yet poorly understood. We found that papain, a cysteine protease in latex of the Papaya tree (Carica papaya, Caricaceae), is a crucial factor in the defense of the papaya tree against lepidopteran larvae such as oligophagous Samia ricini (Saturniidae) and two notorious polyphagous pests, Mamestra brassicae (Noctuidae) and Spodoptera litura (Noctuidae). Leaves of a number of laticiferous plants, including papaya and a wild fig, Ficus virgata (Moraceae), showed strong toxicity and growth inhibition against lepidopteran larvae, though no apparent toxic factors from these species have been reported. When the latex was washed off, the leaves of these lactiferous plants lost toxicity. Latexes of both papaya and the wild fig were rich in cysteine-protease activity. E-64, a cysteine protease-specific inhibitor, completely deprived the leaves of toxicity when painted on the surface of papaya and fig leaves. Cysteine proteases, such as papain, ficin, and bromelain, all showed toxicity. The results suggest that plant latex and the proteins in it, cysteine proteases in particular, provide plants with a general defense mechanism against herbivorous insects.

  16. Studies on alkaline serine protease produced by Bacillus clausii GMBE 22.

    PubMed

    Kazan, Dilek; Bal, Hulya; Denizci, Aziz Akin; Ozturk, Nurcin Celik; Ozturk, Hasan Umit; Dilgimen, Aydan Salman; Ozturk, Dilek Coskuner; Erarslan, Altan

    2009-01-01

    An alkali tolerant Bacillus strain having extracellular serine alkaline protease activity was newly isolated from compost and identified as Bacillus clausii GMBE 22. An alkaline protease (AP22) was 4.66-fold purified in 51.5% yield from Bacillus clausii GMBE 22 by ethanol precipitation and DEAE-cellulose anion exchange chromatography. The purified enzyme was identified as serine protease by LC-ESI-MS analysis. Its complete inhibition by phenylmethanesulfonylfluoride (PMSF) also justified that it is a serine alkaline protease. The molecular weight of the enzyme is 25.4 kDa. Optimal temperature and pH values are 60 degrees C and 12.0, respectively. The enzyme showed highest specificity to N-Suc-Ala-Ala-Pro-Phe-pNA. The K(m) and k(cat) values for hydrolysis of this substrate are 0.347 mM and 1141 min(-1) respectively. The enzyme was affected by surface active agents to varying extents. The enzyme is stable for 2 h at 30 degrees C and pH 10.5. AP22 is also stable for 5 days over the pH range 9.0-11.0 at room temperature. AP22 has good pH stability compared with the alkaline proteases belonging to other strains of Bacillus clausii reported in the literature.

  17. The QSAR and docking calculations of fullerene derivatives as HIV-1 protease inhibitors

    NASA Astrophysics Data System (ADS)

    Saleh, Noha A.

    2015-02-01

    The inhibition of HIV-1 protease is considered as one of the most important targets for drug design and the deactivation of HIV-1. In the present work, the fullerene surface (C60) is modified by adding oxygen atoms as well as hydroxymethylcarbonyl (HMC) groups to form 6 investigated fullerene derivative compounds. These compounds have one, two, three, four or five O atoms + HMC groups at different positions on phenyl ring. The effect of the repeating of these groups on the ability of suggested compounds to inhibit the HIV protease is studied by calculating both Quantitative Structure Activity Relationship (QSAR) properties and docking simulation. Based on the QSAR descriptors, the solubility and the hydrophilicity of studied fullerene derivatives increased with increasing the number of oxygen atoms + HMC groups in the compound. While docking calculations indicate that, the compound with two oxygen atoms + HMC groups could interact and binds with HIV-1 protease active site. This is could be attributed to the active site residues of HIV-1 protease are hydrophobic except the two aspartic acids. So that, the increase in the hydrophilicity and polarity of the compound is preventing and/or decreasing the hydrophobic interaction between the compound and HIV-1 protease active site.

  18. Production of bioactive peptide hydrolysates from deer, sheep and pig plasma using plant and fungal protease preparations.

    PubMed

    Bah, Clara S F; Bekhit, Alaa El-Din A; Carne, Alan; McConnell, Michelle A

    2015-06-01

    Plasma separated from deer, sheep and pig blood, obtained from abattoirs, was hydrolysed using protease preparations from plant (papain and bromelain) and fungal (FP400 and FPII) sources. Antioxidant and antimicrobial activities of the peptide hydrolysates obtained after 1, 2, 4 and 24h of hydrolysis, were investigated. The release of trichloroacetic acid-soluble peptides over the hydrolysis period was monitored using the o-phthaldialdehyde (OPA) assay, while the hydrolysis profiles were visualised using SDS-PAGE. The major plasma proteins in the animal plasmas were identified using MALDI-TOF-TOF MS. Hydrolysates of plasma generated with fungal proteases exhibited higher DPPH radical-scavenging, oxygen radical-scavenging capacity (ORAC) and ferric reducing antioxidant power (FRAP) than those generated with plant proteases for all three animal plasmas. No antimicrobial activity was detected in the hydrolysates. The results indicated that proteolytic hydrolysis of animal blood plasmas, using fungal protease preparations in particular, produces hydrolysates with high antioxidant properties.

  19. Development of a glutathione production process from proteinaceous biomass resources using protease-displaying Saccharomyces cerevisiae.

    PubMed

    Hara, Kiyotaka Y; Kim, Songhee; Yoshida, Hideyo; Kiriyama, Kentaro; Kondo, Takashi; Okai, Naoko; Ogino, Chiaki; Fukuda, Hideki; Kondo, Akihiko

    2012-02-01

    Glutathione is a valuable tri-peptide that is widely used in the pharmaceutical, food, and cosmetic industries. Glutathione is produced industrially by fermentation using Saccharomyces cerevisiae, and supplementation of fermentation with several amino acids can increase intracellular GSH content. More recently, however, focus has been given to protein as a resource for biofuel and fine chemical production. We demonstrate that expression of a protease on the cell surface of S. cerevisiae enables the direct use of keratin and soy protein as a source of amino acids and that these substrates enhanced intracellular GSH content. Furthermore, fermentation using soy protein also enhanced cell concentration. GSH fermentation from keratin and to a greater extent from soy protein using protease-displaying yeast yielded greater GSH productivity compared to GSH fermentation with amino acid supplementation. This protease-displaying yeast is potentially applicable to a variety of processes for the bio-production of value-added chemicals from proteinaceous biomass resources.

  20. Covalent immobilization of mixed proteases, trypsin and chymotrypsin, onto modified polyvinyl chloride microspheres.

    PubMed

    Li, Dong-Fang; Ding, Hao-Chen; Zhou, Tao

    2013-11-06

    A commercially available trypsin-chymotrypsin mixture was covalently immobilized onto modified polyvinyl chloride (PVC) microspheres, which were activated by the subsequent treatment of PVC microspheres with ethylenediamine and glutaraldehyde. The immobilized mixed protease was characterized by FT-IR and SEM analyses. Immobilization conditions were optimized by Box-Behnken design and the response surface method. The activity of the immobilized mixed protease prepared under optimal conditions (pH 6.6, 23 °C, 2 h) reached 1341 U/g. Compared with the free form, the immobilized enzyme possesses a slightly higher optimal pH value and a wider pH-activity profile, superior thermal stability, and a higher Km value. Reusability of the immobilized mixed protease indicated that >70% of the original activity was retained after having been recycled six times.

  1. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  2. Archaeal membrane-associated proteases: insights on Haloferax volcanii and other haloarchaea

    PubMed Central

    Giménez, María I.; Cerletti, Micaela; De Castro, Rosana E.

    2015-01-01

    The function of membrane proteases range from general house-keeping to regulation of cellular processes. Although the biological role of these enzymes in archaea is poorly understood, some of them are implicated in the biogenesis of the archaeal cell envelope and surface structures. The membrane-bound ATP-dependent Lon protease is essential for cell viability and affects membrane carotenoid content in Haloferax volcanii. At least two different proteases are needed in this archaeon to accomplish the posttranslational modifications of the S-layer glycoprotein. The rhomboid protease RhoII is involved in the N-glycosylation of the S-layer protein with a sulfoquinovose-containing oligosaccharide while archaeosortase ArtA mediates the proteolytic processing coupled-lipid modification of this glycoprotein facilitating its attachment to the archaeal cell surface. Interestingly, two different signal peptidase I homologs exist in H. volcanii, Sec11a and Sec11b, which likely play distinct physiological roles. Type IV prepilin peptidase PibD processes flagellin/pilin precursors, being essential for the biogenesis and function of the archaellum and other cell surface structures in H. volcanii. PMID:25774151

  3. Archaeal membrane-associated proteases: insights on Haloferax volcanii and other haloarchaea.

    PubMed

    Giménez, María I; Cerletti, Micaela; De Castro, Rosana E

    2015-01-01

    The function of membrane proteases range from general house-keeping to regulation of cellular processes. Although the biological role of these enzymes in archaea is poorly understood, some of them are implicated in the biogenesis of the archaeal cell envelope and surface structures. The membrane-bound ATP-dependent Lon protease is essential for cell viability and affects membrane carotenoid content in Haloferax volcanii. At least two different proteases are needed in this archaeon to accomplish the posttranslational modifications of the S-layer glycoprotein. The rhomboid protease RhoII is involved in the N-glycosylation of the S-layer protein with a sulfoquinovose-containing oligosaccharide while archaeosortase ArtA mediates the proteolytic processing coupled-lipid modification of this glycoprotein facilitating its attachment to the archaeal cell surface. Interestingly, two different signal peptidase I homologs exist in H. volcanii, Sec11a and Sec11b, which likely play distinct physiological roles. Type IV prepilin peptidase PibD processes flagellin/pilin precursors, being essential for the biogenesis and function of the archaellum and other cell surface structures in H. volcanii.

  4. Site-Directed Mutagenesis and Structural Studies Suggest that the Germination Protease, GPR, in Spores of Bacillus Species Is an Atypical Aspartic Acid Protease

    PubMed Central

    Carroll, Thomas M.; Setlow, Peter

    2005-01-01

    Germination protease (GPR) initiates the degradation of small, acid-soluble spore proteins (SASP) during germination of spores of Bacillus and Clostridium species. The GPR amino acid sequence is not homologous to members of the major protease families, and previous work has not identified residues involved in GPR catalysis. The current work has focused on identifying catalytically essential amino acids by mutagenesis of Bacillus megaterium gpr. A residue was selected for alteration if it (i) was conserved among spore-forming bacteria, (ii) was a potential nucleophile, and (iii) had not been ruled out as inessential for catalysis. GPR variants were overexpressed in Escherichia coli, and the active form (P41) was assayed for activity against SASP and the zymogen form (P46) was assayed for the ability to autoprocess to P41. Variants inactive against SASP and unable to autoprocess were analyzed by circular dichroism spectroscopy and multiangle laser light scattering to determine whether the variant's inactivity was due to loss of secondary or quaternary structure, respectively. Variation of D127 and D193, but no other residues, resulted in inactive P46 and P41, while variants of each form were well structured and tetrameric, suggesting that D127 and D193 are essential for activity and autoprocessing. Mapping these two aspartate residues and a highly conserved lysine onto the B. megaterium P46 crystal structure revealed a striking similarity to the catalytic residues and propeptide lysine of aspartic acid proteases. These data indicate that GPR is an atypical aspartic acid protease. PMID:16199582

  5. Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

    PubMed Central

    Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

    2015-01-01

    Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites

  6. Spatial distribution of trace elements in the surface sediments of a major European estuary (Loire Estuary, France): Source identification and evaluation of anthropogenic contribution

    NASA Astrophysics Data System (ADS)

    Coynel, Alexandra; Gorse, Laureline; Curti, Cécile; Schafer, Jörg; Grosbois, Cécile; Morelli, Guia; Ducassou, Emmanuelle; Blanc, Gérard; Maillet, Grégoire M.; Mojtahid, Meryem

    2016-12-01

    Assessing the extent of metal contamination in estuarine surface sediments is hampered by the high heterogeneity of sediment characteristics, the spatial variability of trace element sources, sedimentary dynamics and geochemical processes in addition to the need of accurate reference values for deciphering natural to anthropogenic contribution. Based on 285 surface sediment samples from the Loire Estuary, the first high-resolution spatial distributions are presented for grain-size, particulate organic carbon (POC) and the eight metals/metalloids identified as priority contaminants (Cd, Zn, Pb, Cu, As, Cr, Ni, Hg) plus Ag (an urban tracer). Grain-size and/or POC are major factors controlling the spatial distribution of trace element concentrations. The V-normalized trace metal concentrations divided by the V-normalized concentrations in the basin geochemical background showed the highest Enrichment Factors for Ag and Hg (EF; up to 34 and 140, respectively). These results suggest a severe contamination in the Loire Estuary for both elements. Intra-estuarine Ag and Hg anomalies were identified by comparison between respective normalized concentrations in the Loire Estuary surface sediments and those measured in the surface sediments at the outlet of the Loire River System (watershed-derived). Anthropogenic intra-estuarine Ag and Hg stocks in the uppermost centimetre of the sediment compared with rough annual fluvial flux estimates suggest that the overall strong Enrichment Factors for Ag (EFAg) and and Hg (EFHg) in the Loire Estuary sediments are mainly due to watershed-derived inputs, highlighting the need of high temporal hydro-geochemical monitoring to establish reliable incoming fluxes. Significant correlations obtained between EFCd and EFAg, EFCu and POC and EFHg and POC revealed common behavior and/or sources. Comparison of trace element concentrations with ecotoxicological indices (Sediment Quality Guidelines) provides first standardized information on the

  7. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  8. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  9. Downregulation of an Entamoeba histolytica rhomboid protease reveals roles in regulating parasite adhesion and phagocytosis.

    PubMed

    Baxt, Leigh A; Rastew, Elena; Bracha, Rivka; Mirelman, David; Singh, Upinder

    2010-08-01

    Entamoeba histolytica is a deep-branching eukaryotic pathogen. Rhomboid proteases are intramembrane serine proteases, which cleave transmembrane proteins in, or in close proximity to, their transmembrane domain. We have previously shown that E. histolytica contains a single functional rhomboid protease (EhROM1) and has unique substrate specificity. EhROM1 is present on the trophozoite surface and relocalizes to internal vesicles during erythrophagocytosis and to the base of the cap during surface receptor capping. In order to further examine the biological function of EhROM1 we downregulated EhROM1 expression by >95% by utilizing the epigenetic silencing mechanism of the G3 parasite strain. Despite the observation that EhROM1 relocalized to the cap during surface receptor capping, EhROM1 knockdown [ROM(KD)] parasites had no gross changes in cap formation or complement resistance. However, ROM(KD) parasites demonstrated decreased host cell adhesion, a result recapitulated by treatment of wild-type parasites with DCI, a serine protease inhibitor with activity against rhomboid proteases. The reduced adhesion phenotype of ROM(KD) parasites was noted exclusively with healthy cells, and not with apoptotic cells. Additionally, ROM(KD) parasites had decreased phagocytic ability with reduced ingestion of healthy cells, apoptotic cells, and rice starch. Decreased phagocytic ability is thus independent of the reduced adhesion phenotype, since phagocytosis of apoptotic cells was reduced despite normal adhesion levels. The defect in host cell adhesion was not explained by altered expression or localization of the heavy subunit of the Gal/GalNAc surface lectin. These results suggest no significant role of EhROM1 in complement resistance but unexpected roles in parasite adhesion and phagocytosis.

  10. MOFzyme: Intrinsic protease-like activity of Cu-MOF

    NASA Astrophysics Data System (ADS)

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-01

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu2(C9H3O6)4/3 MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  11. MOFzyme: Intrinsic protease-like activity of Cu-MOF.

    PubMed

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-24

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu₂(C₉H₃O₆)₄/₃ MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  12. Relation between flexibility and positively selected HIV-1 protease mutants against inhibitors.

    PubMed

    Braz, Antônio S K; Tufanetto, Patrícia; Perahia, David; Scott, Luis P B

    2012-12-01

    The antiretroviral chemotherapy helps to reduce the mortality of HIVs infected patients. However, RNA dependant virus replication has a high mutation rate. Human immunodeficiency virus Type 1 protease plays an essential role in viral replication cycle. This protein is an important target for therapy with viral protein inhibitors. There are few works using normal mode analysis to investigate this problem from the structural changes viewpoint. The investigation of protein flexibility may be important for the study of processes associated with conformational changes and state transitions. The normal mode analysis allowed us to investigate structural changes in the protease (such as flexibility) in a straightforward way and try to associate these changes with the increase of fitness for each positively selected HIV-1 mutant protease of patients treated with several protease inhibitors (saquinavir, indinavir, ritonavir, nelfinavir, lopinavir, fosamprenavir, atazanavir, darunavir, and tripanavir) in combination or separately. These positively selected mutations introduce significant flexibility in important regions such as the active site cavity and flaps. These mutations were also able to cause changes in accessible solvent area. This study showed that the majority of HIV-1 protease mutants can be grouped into two main classes of protein flexibility behavior. We presented a new approach to study structural changes caused by positively selected mutations in a pathogen protein, for instance the HIV-1 protease and their relationship with their resistance mechanism against known inhibitors. The method can be applied to any pharmaceutically relevant pathogen proteins and could be very useful to understand the effects of positively selected mutations in the context of structural changes.

  13. Cardioprotection by a novel recombinant serine protease inhibitor in myocardial ischemia and reperfusion injury.

    PubMed

    Murohara, T; Guo, J P; Lefer, A M

    1995-09-01

    Polymorphonuclear neutrophils (PMN) play an important role in myocardial ischemia/reperfusion (MI/R) injury; however, the role of neutrophilic proteases is less understood. The effects of a novel serine protease inhibitor (serpin), LEX032, were investigated in a murine model of MI (20 min) and R (24 hr) injury in vivo. LEX032 is a recombinant human alpha 1-antichymotrypsin in which six amino acid residues were replaced around the active center with those of alpha-1 protease inhibitor. LEX032 has the ability to inhibit both neutrophil elastase and cathepsin G, two major neutral serine proteases in neutrophils, as well as superoxide generation. LEX032 (25 or 50 mg/kg) administered i.v. 1 min before reperfusion significantly attenuated myocardial necrotic injury evaluated by cardiac creatine kinase loss compared to MI/R rats receiving only vehicle (P < .001). Moreover, cardiac myeloperoxidase activity, an index of PMN accumulation, in the ischemic myocardium was significantly attenuated by LEX032 as compared with rats receiving vehicle (P < .001). LEX032 also moderately attenuated leukotriene B4-stimulated PMN adherence to rat superior mesenteric artery endothelium and markedly diminished superoxide radical release from LTB4-stimulated PMN in vitro. In a glycogen-induced rat peritonitis model, LEX032 (50 mg/kg) significantly attenuated PMN transmigration into the peritoneal cavity in vivo. In conclusion, the recombinant serine protease inhibitor, LEX032, appears to be an effective agent for attenuating MI/R injury by inhibiting neutrophil-accumulation into the ischemic-reperfused myocardium and by inactivating cytotoxic metabolites (proteases and superoxide radical) released from neutrophils.

  14. Predicting the response of the Amazon rainforest to persistent drought conditions under current and future climates: a major challenge for global land surface models

    NASA Astrophysics Data System (ADS)

    Joetzjer, E.; Delire, C.; Douville, H.; Ciais, P.; Decharme, B.; Fisher, R.; Christoffersen, B.; Calvet, J. C.; da Costa, A. C. L.; Ferreira, L. V.; Meir, P.

    2014-12-01

    While a majority of global climate models project drier and longer dry seasons over the Amazon under higher CO2 levels, large uncertainties surround the response of vegetation to persistent droughts in both present-day and future climates. We propose a detailed evaluation of the ability of the ISBACC (Interaction Soil-Biosphere-Atmosphere Carbon Cycle) land surface model to capture drought effects on both water and carbon budgets, comparing fluxes and stocks at two recent throughfall exclusion (TFE) experiments performed in the Amazon. We also explore the model sensitivity to different water stress functions (WSFs) and to an idealized increase in CO2 concentration and/or temperature. In spite of a reasonable soil moisture simulation, ISBACC struggles to correctly simulate the vegetation response to TFE whose amplitude and timing is highly sensitive to the WSF. Under higher CO2 concentrations, the increased water-use efficiency (WUE) mitigates the sensitivity of ISBACC to drought. While one of the proposed WSF formulations improves the response of most ISBACC fluxes, except respiration, a parameterization of drought-induced tree mortality is missing for an accurate estimate of the vegetation response. Also, a better mechanistic understanding of the forest responses to drought under a warmer climate and higher CO2 concentration is clearly needed.

  15. Phylogenetic analysis of benign Theileria species based on major piroplasm surface protein (MPSP) genes from ticks of grazing cattle in Korea.

    PubMed

    Kang, Seung Won; Nguyen, Lien Thi Kim; Noh, Jin Hyeong; Reddy, Kondreddy Eswar; Kweon, Chang Hee; Choe, Se Eun

    2012-10-26

    Complete major piroplasm surface protein (MPSP) gene sequences of benign Theileria parasites were isolated from ticks of grazing cattle in Korea. A total of 556 tick samples were collected in five provinces: Chungbuk, Jeonbuk, Jeonnam, Gyeongbuk, and Jeju during 2010-2011. Fifteen samples from Chungbuk and Jeonnam were positive for the Theileria MPSP gene by PCR amplification using a specific primer set. A phylogenetic tree was constructed with the amplified gene sequences and 26 additional sequences published in GenBank. The benign Theileria parasites were classified into eight types, those isolated from Korean cattle ticks belonged to Types 1 (Ikeda), 2 (Chitose), 4, and 8. Types 2 and 4 were the most common types, with the rate of 40%, followed by Types 1 and 8 (with the rate of 13% and 7%, respectively). Nucleotide sequence identities of 23 theilerial MPSP sequences (15 MPSP gene sequences amplified and 8 sequences published) ranged from 67.3 to 99.8%. Multiple alignments of the deduced amino acid sequences also showed that each type was characterized by specific amino acids: 7 for Type 1, 9 for Type 2, 4 for Type 4, and 3 for Type 8.

  16. Predicting the response of the Amazon rainforest to persistent drought conditions under current and future climates: a major challenge for global land surface models

    NASA Astrophysics Data System (ADS)

    Joetzjer, E.; Delire, C.; Douville, H.; Ciais, P.; Decharme, B.; Fisher, R.; Christoffersen, B.; Calvet, J. C.; da Costa, A. C. L.; Ferreira, L. V.; Meir, P.

    2014-08-01

    While a majority of Global Climate Models project dryer and longer dry seasons over the Amazon under higher CO2 levels, large uncertainties surround the response of vegetation to persistent droughts in both present-day and future climates. We propose a detailed evaluation of the ability of the ISBACC Land Surface Model to capture drought effects on both water and carbon budgets, comparing fluxes and stocks at two recent ThroughFall Exclusion (TFE) experiments performed in the Amazon. We also explore the model sensitivity to different Water Stress Function (WSF) and to an idealized increase in CO2 concentration and/or temperature. In spite of a reasonable soil moisture simulation, ISBACC struggles to correctly simulate the vegetation response to TFE whose amplitude and timing is highly sensitive to the WSF. Under higher CO2 concentration, the increased Water Use Efficiency (WUE) mitigates the ISBACC's sensitivity to drought. While one of the proposed WSF formulation improves the response of most ISBACC fluxes, except respiration, a parameterization of drought-induced tree mortality is missing for an accurate estimate of the vegetation response. Also, a better mechanistic understanding of the forest responses to drought under a warmer climate and higher CO2 concentration is clearly needed.

  17. The maize tapetum employs diverse mechanisms to synthesize and store proteins and flavonoids and transfer them to the pollen surface.

    PubMed

    Li, Yubing; Suen, Der Fen; Huang, Chien-Yu; Kung, Shung-Yee; Huang, Anthony H C

    2012-04-01

    In anthers, the tapetum synthesizes and stores proteins and flavonoids, which will be transferred to the surface of adjacent microspores. The mechanism of synthesis, storage, and transfer of these pollen-coat materials in maize (Zea mays) differs completely from that reported in Arabidopsis (Arabidopsis thaliana), which stores major pollen-coat materials in tapetosomes and elaioplasts. On maize pollen, three proteins, glucanase, xylanase, and a novel protease, Zea mays pollen coat protease (ZmPCP), are predominant. During anther development, glucanase and xylanase transcripts appeared at a mid developmental stage, whereas protease transcript emerged at a late developmental stage. Protease and xylanase transcripts were present only in the anther tapetum of the plant, whereas glucanase transcript was distributed ubiquitously. ZmPCP belongs to the cysteine protease family but has no closely related paralogs. Its nascent polypeptide has a putative amino-terminal endoplasmic reticulum (ER)-targeting peptide and a propeptide. All three proteins were synthesized in the tapetum and were present on mature pollen after tapetum death. Electron microscopy of tapetum cells of mid to late developmental stages revealed small vacuoles distributed throughout the cytoplasm and numerous secretory vesicles concentrated near the locular side. Immunofluorescence microscopy and subcellular fractionation localized glucanase in ER-derived vesicles in the cytoplasm and the wall facing the locule, xylanase in the cytosol, protease in vacuoles, and flavonoids in subdomains of ER rather than in vacuoles. The nonoverlapping subcellular locations of the three proteins and flavonoids indicate distinct modes of their storage in tapetum cells and transfer to the pollen surface, which in turn reflect their respective functions in tapetum cells or the pollen surface.

  18. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    SciTech Connect

    Nishikado, Hideto; Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2015-05-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity.

  19. Chitin extraction from blue crab (Portunus segnis) and shrimp (Penaeus kerathurus) shells using digestive alkaline proteases from P. segnis viscera.

    PubMed

    Hamdi, Marwa; Hammami, Amal; Hajji, Sawssen; Jridi, Mourad; Nasri, Moncef; Nasri, Rim

    2017-03-20

    Since chitin is closely associated with proteins, deproteinization is a crucial step in the process of extracting chitin. Thus, this research aimed to extract chitin from Portunus segnis and Penaeus kerathurus shells by means of crude digestive alkaline proteases from the viscera of P. segnis, regarding deproteinization step, as an alternative to chemical treatment. Casein zymography revealed that five caseinolytic proteases bands exist, suggesting the presence of at least five different major proteases. The optimum pH and temperature for protease activity were pH 8.0 and 60°C, respectively, using casein as a substrate. The crude enzymes extract was highly stable at low temperatures and over a wide range of pH from 6.0 to 12.0. The crude alkaline protease extract was found to be effective in the deproteinization of blue crab and shrimp shells, to produce chitin. The best efficiency in deproteinization (84.69±0.65% for blue crab shells and 91.06±1.40% for shrimp shells) was achieved with an E/S ratio of 5U/mg of proteins after 3h incubation at 50°C. These results suggest that enzymatic deproteinization of crab and shrimp wastes by fish endogenous alkaline proteases could be a potential alternative in the chitin production process.

  20. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  1. Isolation and Characterization of Gut Bacterial Proteases Involved in Inducing Pathogenicity of Bacillus thuringiensis Toxin in Cotton Bollworm, Helicoverpa armigera

    PubMed Central

    Regode, Visweshwar; Kuruba, Sreeramulu; Mohammad, Akbar S.; Sharma, Hari C.

    2016-01-01

    Bacillus thuringiensis toxin proteins are deployed in transgenic plants for pest management. The present studies were aimed at characterization of gut bacterial proteases involved in activation of inactive Cry1Ac protoxin (pro-Cry1Ac) to active toxin in Helicoverpa armigera. Bacterial strains were isolated from H. armigera midgut and screened for their proteolytic activation toward pro-Cry1Ac. Among 12 gut bacterial isolates seven isolates showed proteolytic activity, and proteases from three isolates (IVS1, IVS2, and IVS3) were found to be involved in the proteolytic conversion of pro-Cry1Ac into active toxin. The proteases from IVS1, IVS2, and IVS3 isolates were purified to 11.90-, 15.50-, and 17.20-fold, respectively. The optimum pH and temperature for gut bacterial protease activity was 8.0 and 40°C. Maximum inhibition of total proteolytic activity was exerted by phenylmethane sulfonyl fluoride followed by EDTA. Fluorescence zymography revealed that proteases from IVS1, IVS2, and IVS3 were chymotrypsin-like and showing protease band at ~15, 65, and 15 kDa, respectively. Active Cry1Ac formed from processing pro-Cry1Ac by gut bacterial proteases exhibited toxicity toward H. armigera. The gut bacterial isolates IVS1, IVS2, and IVS3 showed homology with B. thuringiensis (CP003763.1), Vibrio fischeri (CP000020.2), and Escherichia coli (CP011342.1), respectively. Proteases produced by midgut bacteria are involved in proteolytic processing of B. thuringiensis protoxin and play a major role in inducing pathogenicity of B. thuringiensis toxins in H. armigera. PMID:27766093

  2. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  3. Major Links.

    ERIC Educational Resources Information Center

    Henderson, Tona

    1995-01-01

    Provides electronic mail addresses for resources and discussion groups related to the following academic majors: art, biology, business, chemistry, computer science, economics, health sciences, history, literature, math, music, philosophy, political science, psychology, sociology, and theater. (AEF)

  4. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  5. Trypanosomatid cysteine protease activity may be enhanced by a kininogen-like moiety from host serum.

    PubMed Central

    Lonsdale-Eccles, J D; Mpimbaza, G W; Nkhungulu, Z R; Olobo, J; Smith, L; Tosomba, O M; Grab, D J

    1995-01-01

    African trypanosomes contain cysteine proteases (trypanopains) the activity of which can be measured by in vitro digestion of fibrinogen, after electrophoresis in fibrinogen-containing SDS/polyacrylamide gels. When assessed by this procedure, trypanopain from Trypanosoma brucei (trypanopain-Tb) is estimated to have a molecular mass of 28 kDa. However, two additional bands of trypanopain activity (87 kDa and 105 kDa) are observed if serum is added to the trypanopain before electrophoresis. Formation of the 87 and 105 kDa bands is frequently accompanied by a reduction in the intensity of the 28 kDa activity which suggests that the extra bands are complexes of the 28 kDa trypanopain-Tb and a molecule from rat serum called rat trypanopain moledulator (rTM). The rTM-induced activation of cysteine proteases is not restricted to T. brucei as it is also observed with proteases from other protozoan parasites such as bloodstream forms of Trypanosoma congolense and the mammalian-infective in vitro-derived promastigote forms of Leishmania donovani and Leishmania major. The physical properties of rTM resemble those of the kininogen family of cysteine protease inhibitors. rTM is an acidic (pI 4.7) heat-stable 68 kDa glycoprotein with 15 kDa protease-susceptible domains. This resemblance between rTM and kininogens was confirmed by the positive, albeit weak, immunoreactivity between anti-(human low-molecular-mass kininogen) antibody and rTM as well as anti-rTM antibody and human low-molecular-mass kininogen. Furthermore, commercial preparations of human-low-molecular-mass kininogen and chicken egg white cystatin mimicked rTM by forming extra bands of proteolytic activity in the presence of trypanopain-Tb. In some instances, low-molecular-mass kininogen was also observed to increase the rate of hydrolysis of 7-(benzyloxycarbonyl-phenylalanyl-arginyl-amido)-4- methylcoumarin by live T. brucei. Although this effect was rather erratic, in no instance was significant inhibition

  6. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  7. Design, synthesis and evaluation of a potent substrate analog inhibitor identified by scanning Ala/Phe mutagenesis, mimicking substrate co-evolution, against multidrug-resistant HIV-1 protease

    SciTech Connect

    Yedidi, Ravikiran S.; Muhuhi, Joseck M.; Liu, Zhigang; Bencze, Krisztina Z.; Koupparis, Kyriacos; O’Connor, Carrie E.; Kovari, Iulia A.; Spaller, Mark R.; Kovari, Ladislau C.

    2013-09-06

    Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC{sub 50}: 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the {sup 15}N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC{sub 50}: 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of {sup 15}N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV.

  8. Paleomagnetism and Mineralogy of Unusual Silicate Glasses and Baked Soils on the Surface of the Atacama Desert of Northern Chile: A Major Airburst Impact ~12ka ago?.

    NASA Astrophysics Data System (ADS)

    Roperch, P. J.; Blanco, N.; Valenzuela, M.; Gattacceca, J.; Devouard, B.; Lorand, J. P.; Tomlinson, A. J.; Arriagada, C.; Rochette, P.

    2015-12-01

    Unusual silicate glasses were found in northern Chile in one of the driest place on earth, the Atacama Desert. The scoria-type melted rocks are littered on the ground at several localities distributed along a longitudinal band of about 50km. The silicate glasses have a stable natural remanent magnetization carried by fine-grained magnetite and acquired during cooling. At one locality, fine-grained overbank sediments were heated to form a 10 to 20 cm-thick layer of brick-type samples. Magnetic experiments on oriented samples demonstrate that the baked clays record a thermoremanent magnetization acquired in situ above 600°C down to more than 10cm depth and cooled under a normal polarity geomagnetic field with a paleointensity of 40μT. In some samples of the silicate glass, large grains of iron sulphides (troilite) are found in the glass matrix with numerous droplets of native iron, iron sulphides and iron phosphides indicating high temperature and strong redox conditions during melting. The paleomagnetic record of the baked clays and the unusual mineralogy of the silicate glasses indicate a formation mainly by in situ high temperature radiation. Paleomagnetic experiments and chemical analyses indicate that the silicate glasses are not fulgurite type rocks due to lightning events, nor volcanic glasses or even metallurgical slags related to mining activity. The existence of a well-developped baked clay layer indicates that the silicate glasses are not impact-related ejectas. The field, paleomagnetic and mineralogical observations support evidence for a thermal event likely related to a major airburst. The youngest calibrated 14C age on a charcoal sample closely associated with the glass indicates that the thermal event occurred around 12 to 13 ka BP. The good conservation of the surface effects of this thermal event in the Atacama Desert could provide a good opportunity to further estimate the threats posed by large asteroid airbursts.

  9. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  10. The Proline-Rich Motif of the proDer p 3 Allergen Propeptide Is Crucial for Protease-Protease Interaction

    PubMed Central

    Dumez, Marie-Eve; Herman, Julie; Campisi, Vincenzo; Bouaziz, Ahlem; Rosu, Frédéric; Luxen, André; Vandenberghe, Isabel; de Pauw, Edwin; Frère, Jean-Marie; Matagne, André; Chevigné, Andy; Galleni, Moreno

    2013-01-01

    The majority of proteases are synthesized in an inactive form, termed zymogen, which consists of a propeptide and a protease domain. The propeptide is commonly involved in the correct folding and specific inhibition of the enzyme. The propeptide of the house dust mite allergen Der p 3, NPILPASPNAT, contains a proline-rich motif (PRM), which is unusual for a trypsin-like protease. By truncating the propeptide or replacing one or all of the prolines in the non-glycosylated zymogen with alanine(s), we demonstrated that the full-length propeptide is not required for correct folding and thermal stability and that the PRM is important for the resistance of proDer p 3 to undesired proteolysis when the protein is expressed in Pichia pastoris. Additionally, we followed the maturation time course of proDer p 3 by coupling a quenched-flow assay to mass spectrometry analysis. This approach allowed to monitor the evolution of the different species and to determine the steady-state kinetic parameters for activation of the zymogen by the major allergen Der p 1. This experiment demonstrated that prolines 5 and 8 are crucial for proDer p 3-Der p 1 interaction and for activation of the zymogen. PMID:24073192

  11. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  12. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  13. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  14. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  15. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  16. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  17. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  18. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  19. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  20. Suppression of Helicobacter pylori protease activity towards growth factors by sulglycotide.

    PubMed

    Piotrowski, J; Slomiany, A; Slomiany, B L

    1997-09-01

    Infection with H. pylori is now recognized as a major factor in the pathogenesis of gastric disease. Here, we examined the susceptibility of epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), transforming growth factor-beta (TGF beta) and platelet derived growth factor (PDGF) to degradation by H. pylori protease, and assessed the effect of a cytoprotective agent, sulglycotide, on this process. The 125I-labeled EGF, bFGF, TGF beta and PDGF were incubatet with H. pylori protease, obtained from the filtrates of saline washes of the bacterium culture, in the presence of 0-100 micrograms sulglycotide. The results showed that, under the assay conditions, H. pylori protease caused only 5% degradation of EGF and 7% degradation of bFGF. However, the protease evoked a 61.7% degradation of PDGF and a 62.3% degradation of TGF beta. Introduction of sulglycotide to the reaction assay system caused a dose-dependent inhibition in PDGF and TGF beta proteolysis by the H. pylori enzyme. The maximal inhibitory effect was obtained with sulglycotide at 100 micrograms/ml, at which dose an 84.4% decrease in PDGF and 88.3% decrease in TGF beta degradation was achieved. The results provide a strong evidence for the effectiveness of sulglycotide in the protection of gastric mucosal growth factors against degradation by H. pylori.

  1. Adjustments of serine proteases of Daphnia pulex in response to temperature changes.

    PubMed

    Dölling, Ramona; Becker, Dörthe; Hawat, Susan; Koch, Marita; Schwarzenberger, Anke; Zeis, Bettina

    2016-01-01

    Elevated temperatures considerably challenge aquatic invertebrates, and enhanced energy metabolism and protein turnover require adjustments of digestion. In Daphnia, the serine proteases chymotrypsin and trypsin represent the major proteolytic enzymes. Daphnia pulex acclimated to different temperature conditions or subjected to acute heat stress showed increased expression level of serine proteases with rising temperatures. Transcripts of trypsin isoforms were always present in higher amounts than observed for chymotrypsin. Additionally, trypsin isoform transcripts were induced by elevated temperatures to a larger extent. Correspondingly, trypsin activity dominated in cold-acclimated animals. However, the enzymatic activity of chymotrypsin increased at elevated temperatures, whereas trypsin activity slightly decreased, resulting in a shift to dominating chymotrypsin activity in warm-acclimated animals. Zymograms revealed eight bands with proteolytic activity in the range of 20 to 86 kDa. The single bands were assigned to trypsin or chymotrypsin activity applying specific inhibitors or from casein cleavage products identified by mass spectrometric analysis. The total amount of proteolytic activity was elevated with acclimation temperature increase and showed a transient decrease under acute heat stress. The contribution of the different isoforms to protein digestion indicated induction of chymotrypsin with increasing acclimation temperature. For trypsin, the share of one isoform decreased with elevated temperature, while another isoform was enhanced. Thus differential expression of serine proteases was observed in response to chronic and acute temperature changes. The observed phenotypic plasticity adjusts the set of active proteases to the altered needs of protein metabolism optimizing protein digestion for the temperature conditions experienced in the habitat.

  2. Comparative analysis of proteases in the injected and dissected venom of cone snail species.

    PubMed

    Möller, Carolina; Vanderweit, Nicole; Bubis, José; Marí, Frank

    2013-04-01

    The venom of cone snails has been the subject of intense studies because it contains small neuroactive peptides of therapeutic value. However, much less is known about their larger proteins counterparts and their role in prey envenomation. Here, we analyzed the proteolytic enzymes in the injected venom of Conus purpurascens and Conus ermineus (piscivorous), and the dissected venom of C. purpurascens, Conus marmoreus (molluscivorous) and Conus virgo (vermivorous). Zymograms show that all venom samples displayed proteolytic activity on gelatin. However, the electrophoresis patterns and sizes of the proteases varied considerably among these four species. The protease distribution also varied dramatically between the injected and dissected venom of C. purpurascens. Protease inhibitors demonstrated that serine and metalloproteases are responsible for the gelatinolytic activity. We found fibrinogenolytic activity in the injected venom of C. ermineus suggesting that this venom might have effects on the hemostatic system of the prey. Remarkable differences in protein and protease expression were found in different sections of the venom duct, indicating that these components are related to the storage granules and that they participate in venom biosynthesis. Consequently, different conoproteases play major roles in venom processing and prey envenomation.

  3. Hemoglobinase activity of the lysine gingipain protease (Kgp) of Porphyromonas gingivalis W83.

    PubMed

    Lewis, J P; Dawson, J A; Hannis, J C; Muddiman, D; Macrina, F L

    1999-08-01

    Porphyromonas gingivalis, an important periodontal disease pathogen, forms black-pigmented colonies on blood agar. Pigmentation is believed to result from accumulation of iron protoporphyrin IX (FePPIX) derived from erythrocytic hemoglobin. The Lys-X (Lys-gingipain) and Arg-X (Arg-gingipain) cysteine proteases of P. gingivalis bind and degrade erythrocytes. We have observed that mutations abolishing activity of the Lys-X-specific cysteine protease, Kgp, resulted in loss of black pigmentation of P. gingivalis W83. Because the hemagglutinating and hemolytic potentials of mutant strains were reduced but not eliminated, we hypothesized that this protease played a role in acquisition of FePPIX from hemoglobin. In contrast to Arg-gingipain, Lys-gingipain was not inhibited by hemin, suggesting that this protease played a role near the cell surface where high concentrations of hemin confer the black pigmentation. Human hemoglobin contains 11 Lys residues in the alpha chain and 10 Lys residues in the beta chain. In contrast, there are only three Arg residues in each of the alpha and beta chains. These observations are consistent with human hemoglobin being a preferred substrate for Lys-gingipain but not Arg-gingipain. The ability of the Lys-gingipain to cleave human hemoglobin at Lys residues was confirmed by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry of hemoglobin fragments resulting from digestion with the purified protease. We were able to detect several of the predicted hemoglobin fragments rendered by digestion with purified Lys-gingipain. Thus, we postulate that the Lys-gingipain of P. gingivalis is a hemoglobinase which plays a role in heme and iron uptake by effecting the accumulation of FePPIX on the bacterial cell surface.

  4. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects

    PubMed Central

    Takahashi, Daisuke; Garcia, Brandon L.; Kanost, Michael R.

    2015-01-01

    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses. PMID:26504233

  5. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects.

    PubMed

    Takahashi, Daisuke; Garcia, Brandon L; Kanost, Michael R

    2015-11-10

    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses.

  6. Effectiveness of Ritonavir-Boosted Protease Inhibitor Monotherapy in Clinical Practice Even with Previous Virological Failures to Protease Inhibitor-Based Regimens

    PubMed Central

    López-Cortés, Luis F.; Castaño, Manuel A.; López-Ruz, Miguel A.; Rios-Villegas, María J.; Hernández-Quero, José; Merino, Dolores; Jiménez-Aguilar, Patricia; Marquez-Solero, Manuel; Terrón-Pernía, Alberto; Tellez-Pérez, Francisco; Viciana, Pompeyo; Orihuela-Cañadas, Francisco; Palacios-Baena, Zaira; Vinuesa-Garcia, David; Fajardo-Pico, Jose M.; Romero-Palacios, Alberto; Ojeda-Burgos, Guillermo; Pasquau-Liaño, Juan

    2016-01-01

    Background and Objective Significant controversy still exists about ritonavir-boosted protease inhibitor monotherapy (mtPI/rtv) as a simplification strategy that is used up to now to treat patients that have not experienced previous virological failure (VF) while on protease inhibitor (PI) -based regimens. We have evaluated the effectiveness of two mtPI/rtv regimens in an actual clinical practice setting, including patients that had experienced previous VF with PI-based regimens. Methods This retrospective study analyzed 1060 HIV-infected patients with undetectable viremia that were switched to lopinavir/ritonavir or darunavir/ritonavir monotherapy. In cases in which the patient had previously experienced VF while on a PI-based regimen, the lack of major HIV protease resistance mutations to lopinavir or darunavir, respectively, was mandatory. The primary endpoint of this study was the percentage of participants with virological suppression after 96 weeks according to intention-to-treat analysis (non-complete/missing = failure). Results A total of 1060 patients were analyzed, including 205 with previous VF while on PI-based regimens, 90 of whom were on complex therapies due to extensive resistance. The rates of treatment effectiveness (intention-to-treat analysis) and virological efficacy (on-treatment analysis) at week 96 were 79.3% (CI95, 76.8−81.8) and 91.5% (CI95, 89.6–93.4), respectively. No relationships were found between VF and earlier VF while on PI-based regimens, the presence of major or minor protease resistance mutations, the previous time on viral suppression, CD4+ T-cell nadir, and HCV-coinfection. Genotypic resistance tests were available in 49 out of the 74 patients with VFs and only four patients presented new major protease resistance mutations. Conclusion Switching to mtPI/rtv achieves sustained virological control in most patients, even in those with previous VF on PI-based regimens as long as no major resistance mutations are present for

  7. Major depression.

    PubMed

    Bentley, Susan M; Pagalilauan, Genevieve L; Simpson, Scott A

    2014-09-01

    Major depression is a common, disabling condition seen frequently in primary care practices. Non-psychiatrist ambulatory providers are increasingly responsible for diagnosing, and primarily managing patients suffering from major depressive disorder (MDD). The goal of this review is to help primary care providers to understand the natural history of MDD, identify practical tools for screening, and a thoughtful approach to management. Clinically challenging topics like co-morbid conditions, treatment resistant depression and pharmacotherapy selection with consideration to side effects and medication interactions, are also covered.

  8. Major Andre

    ERIC Educational Resources Information Center

    Henisch, B. A.; Henisch, H. K.

    1976-01-01

    If most Revolutionary era people seem two-dimensional their lives simpler to understand than ours, it may be only that history, with the benefit of hindsight, clarifies. Examines a profile of Major John Andre, the British liaison officer in Benedict Arnold's plan to surrender West Point, as both hero and villain to show the complexity of early…

  9. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  10. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  11. Structural Basis for SENP2 Protease Interactions with SUMO Precursers and Conjugated Substrates

    SciTech Connect

    Reverter,D.; Lima, C.

    2007-01-01

    SUMO processing and deconjugation are essential proteolytic activities for nuclear metabolism and cell-cycle progression in yeast and higher eukaryotes. To elucidate the mechanisms used during substrate lysine deconjugation, SUMO isoform processing and SUMO isoform interactions, X-ray structures were determined for a catalytically inert SENP2 protease domain in complex with conjugated RanGAP1-SUMO-1 or RanGAP1-SUMO-2, or in complex with SUMO-2 or SUMO-3 precursors. Common features within the active site include a 90 degree kink proximal to the scissile bond that forces C-terminal amino acid residues or the lysine side chain toward a protease surface that appears optimized for lysine deconjugation. Analysis of this surface reveals SENP2 residues, particularly Met497, that mediate, and in some instances reverse, in vitro substrate specificity. Mutational analysis and biochemistry provide a mechanism for SENP2 substrate preferences that explains why SENP2 catalyzes SUMO deconjugation more efficiently than processing.

  12. The Maize Tapetum Employs Diverse Mechanisms to Synthesize and Store Proteins and Flavonoids and Transfer Them to the Pollen Surface1[W][OA

    PubMed Central

    Li, Yubing; Suen, Der Fen; Huang, Chien-Yu; Kung, Shung-Yee; Huang, Anthony H.C.

    2012-01-01

    In anthers, the tapetum synthesizes and stores proteins and flavonoids, which will be transferred to the surface of adjacent microspores. The mechanism of synthesis, storage, and transfer of these pollen-coat materials in maize (Zea mays) differs completely from that reported in Arabidopsis (Arabidopsis thaliana), which stores major pollen-coat materials in tapetosomes and elaioplasts. On maize pollen, three proteins, glucanase, xylanase, and a novel protease, Zea mays pollen coat protease (ZmPCP), are predominant. During anther development, glucanase and xylanase transcripts appeared at a mid developmental stage, whereas protease transcript emerged at a late developmental stage. Protease and xylanase transcripts were present only in the anther tapetum of the plant, whereas glucanase transcript was distributed ubiquitously. ZmPCP belongs to the cysteine protease family but has no closely related paralogs. Its nascent polypeptide has a putative amino-terminal endoplasmic reticulum (ER)-targeting peptide and a propeptide. All three proteins were synthesized in the tapetum and were present on mature pollen after tapetum death. Electron microscopy of tapetum cells of mid to late developmental stages revealed small vacuoles distributed throughout the cytoplasm and numerous secretory vesicles concentrated near the locular side. Immunofluorescence microscopy and subcellular fractionation localized glucanase in ER-derived vesicles in the cytoplasm and the wall facing the locule, xylanase in the cytosol, protease in vacuoles, and flavonoids in subdomains of ER rather than in vacuoles. The nonoverlapping subcellular locations of the three proteins and flavonoids indicate distinct modes of their storage in tapetum cells and transfer to the pollen surface, which in turn reflect their respective functions in tapetum cells or the pollen surface. PMID:22291199

  13. Mitochondrial Lon protease in human disease and aging: Including an etiologic classification of Lon-related diseases and disorders

    PubMed Central

    Bota, Daniela A.; Davies, Kelvin J.A.

    2016-01-01

    The Mitochondrial Lon protease, also called LonP1 is a product of the nuclear gene LONP1. Lon is a major regulator of mitochondrial metabolism and response to free radical damage, as well as an essential factor for the maintenance and repair of mitochondrial DNA. Lon is an ATP-stimulated protease that cycles between being bound (at the inner surface of the inner mitochondrial membrane) to the mitochondrial genome, and being released into the mitochondrial matrix where it can degrade matrix proteins. At least three different roles or functions have been ascribed to Lon: 1) Proteolytic digestion of oxidized proteins and the turnover of specific essential mitochondrial enzymes such as aconitase, TFAM, and StAR; 2) Mitochondrial (mt)DNA-binding protein, involved in mtDNA replication and mitogenesis; and 3) Protein chaperone, interacting with the Hsp60–mtHsp70 complex. LONP1 orthologs have been studied in bacteria, yeast, flies, worms, and mammals, evincing the widespread importance of the gene, as well as its remarkable evolutionary conservation. In recent years, we have witnessed a significant increase in knowledge regarding Lon's involvement in physiological functions, as well as in an expanding array of human disorders, including cancer, neurodegeneration, heart disease, and stroke. In addition, Lon appears to have a significant role in the aging process. A number of mitochondrial diseases have now been identified whose mechanisms involve various degrees of Lon dysfunction. In this paper we review current knowledge of Lon's function, under normal conditions, and we propose a new classification of human diseases characterized by a either over-expression or decline or loss of function of Lon. Lon has also been implicated in human aging, and we review the data currently available as well as speculating about possible interactions of aging and disease. Finally, we also discuss Lon as potential therapeutic target in human disease. PMID:27387767

  14. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  15. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  16. Protease digestion of hepatitis A virus: disparate effects on capsid proteins, antigenicity, and infectivity.

    PubMed Central

    Lemon, S M; Amphlett, E; Sangar, D

    1991-01-01

    High concentrations of either trypsin or chymotrypsin caused nearly complete cleavage of capsid protein VP2 of hepatitis A virus but did not significantly reduce the infectivity, thermostability, or antigenicity of the virus. Chymotrypsin also had a lesser effect on VP1. These findings indicate the presence of a protease-accessible VP2 surface site which neither contributes significantly to the dominant antigenic site nor plays a role in the attachment of the virus to putative cell receptors. Images PMID:1654460

  17. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  18. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  19. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  20. Enhancement of Alkaline Protease Activity and Stability via Covalent Immobilization onto Hollow Core-Mesoporous Shell Silica Nanospheres

    PubMed Central

    Ibrahim, Abdelnasser Salah Shebl; Al-Salamah, Ali A.; El-Toni, Ahmed M.; Almaary, Khalid S.; El-Tayeb, Mohamed A.; Elbadawi, Yahya B.; Antranikian, Garabed

    2016-01-01

    The stability and reusability of soluble enzymes are of major concerns, which limit their industrial applications. Herein, alkaline protease from Bacillus sp. NPST-AK15 was immobilized onto hollow core-mesoporous shell silica (HCMSS) nanospheres. Subsequently, the properties of immobilized proteases were evaluated. Non-, ethane- and amino-functionalized HCMSS nanospheres were synthesized and characterized. NPST-AK15 was immobilized onto the synthesized nano-supports by physical and covalent immobilization approaches. However, protease immobilization by covalent attachment onto the activated HCMSS–NH2 nanospheres showed highest immobilization yield (75.6%) and loading capacity (88.1 μg protein/mg carrier) and was applied in the further studies. In comparison to free enzyme, the covalently immobilized protease exhibited a slight shift in the optimal pH from 10.5 to 11.0, respectively. The optimum temperature for catalytic activity of both free and immobilized enzyme was seen at 60 °C. However, while the free enzyme was completely inactivated when treated at 60 °C for 1 h the immobilized enzyme still retained 63.6% of its initial activity. The immobilized protease showed higher Vmax, kcat and kcat/Km, than soluble enzyme by 1.6-, 1.6- and 2.4-fold, respectively. In addition, the immobilized protease affinity to the substrate increased by about 1.5-fold. Furthermore, the enzyme stability in various organic solvents was significantly enhanced upon immobilization. Interestingly, the immobilized enzyme exhibited much higher stability in several commercial detergents including OMO, Tide, Ariel, Bonux and Xra by up to 5.2-fold. Finally, the immobilized protease maintained significant catalytic efficiency for twelve consecutive reaction cycles. These results suggest the effectiveness of the developed nanobiocatalyst as a candidate for detergent formulation and peptide synthesis in non-aqueous media. PMID:26840303

  1. Enhancement of Alkaline Protease Activity and Stability via Covalent Immobilization onto Hollow Core-Mesoporous Shell Silica Nanospheres.

    PubMed

    Ibrahim, Abdelnasser Salah Shebl; Al-Salamah, Ali A; El-Toni, Ahmed M; Almaary, Khalid S; El-Tayeb, Mohamed A; Elbadawi, Yahya B; Antranikian, Garabed

    2016-01-29

    The stability and reusability of soluble enzymes are of major concerns, which limit their industrial applications. Herein, alkaline protease from Bacillus sp. NPST-AK15 was immobilized onto hollow core-mesoporous shell silica (HCMSS) nanospheres. Subsequently, the properties of immobilized proteases were evaluated. Non-, ethane- and amino-functionalized HCMSS nanospheres were synthesized and characterized. NPST-AK15 was immobilized onto the synthesized nano-supports by physical and covalent immobilization approaches. However, protease immobilization by covalent attachment onto the activated HCMSS-NH₂ nanospheres showed highest immobilization yield (75.6%) and loading capacity (88.1 μg protein/mg carrier) and was applied in the further studies. In comparison to free enzyme, the covalently immobilized protease exhibited a slight shift in the optimal pH from 10.5 to 11.0, respectively. The optimum temperature for catalytic activity of both free and immobilized enzyme was seen at 60 °C. However, while the free enzyme was completely inactivated when treated at 60 °C for 1 h the immobilized enzyme still retained 63.6% of its initial activity. The immobilized protease showed higher V(max), k(cat) and k(cat)/K(m), than soluble enzyme by 1.6-, 1.6- and 2.4-fold, respectively. In addition, the immobilized protease affinity to the substrate increased by about 1.5-fold. Furthermore, the enzyme stability in various organic solvents was significantly enhanced upon immobilization. Interestingly, the immobilized enzyme exhibited much higher stability in several commercial detergents including OMO, Tide, Ariel, Bonux and Xra by up to 5.2-fold. Finally, the immobilized protease maintained significant catalytic efficiency for twelve consecutive reaction cycles. These results suggest the effectiveness of the developed nanobiocatalyst as a candidate for detergent formulation and peptide synthesis in non-aqueous media.

  2. The Molecular Basis of Drug Resistance against Hepatitis C Virus NS3/4A Protease Inhibitors

    PubMed Central

    Romano, Keith P.; Ali, Akbar; Aydin, Cihan; Soumana, Djade; Özen, Ayşegül; Deveau, Laura M.; Silver, Casey; Cao, Hong; Newton, Alicia; Petropoulos, Christos J.; Huang, Wei; Schiffer, Celia A.

    2012-01-01

    Hepatitis C virus (HCV) infects over 170 million people worldwide and is the leading cause of chronic liver diseases, including cirrhosis, liver failure, and liver cancer. Available antiviral therapies cause severe side effects and are effective only for a subset of patients, though treatment outcomes have recently been improved by the combination therapy now including boceprevir and telaprevir, which inhibit the viral NS3/4A protease. Despite extensive efforts to develop more potent next-generation protease inhibitors, however, the long-term efficacy of this drug class is challenged by the rapid emergence of resistance. Single-site mutations at protease residues R155, A156 and D168 confer resistance to nearly all inhibitors in clinical development. Thus, developing the next-generation of drugs that retain activity against a broader spectrum of resistant viral variants requires a comprehensive understanding of the molecular basis of drug resistance. In this study, 16 high-resolution crystal structures of four representative protease inhibitors – telaprevir, danoprevir, vaniprevir and MK-5172 – in complex with the wild-type protease and three major drug-resistant variants R155K, A156T and D168A, reveal unique molecular underpinnings of resistance to each drug. The drugs exhibit differential susceptibilities to these protease variants in both enzymatic and antiviral assays. Telaprevir, danoprevir and vaniprevir interact directly with sites that confer resistance upon mutation, while MK-5172 interacts in a unique conformation with the catalytic triad. This novel mode of MK-5172 binding explains its retained potency against two multi-drug-resistant variants, R155K and D168A. These findings define the molecular basis of HCV N3/4A protease inhibitor resistance and provide potential strategies for designing robust therapies against this rapidly evolving virus. PMID:22910833

  3. The Role of Vibrio cholerae Haemagglutinin Protease (HAP) in Extra-Intestinal Infection

    PubMed Central

    Koley, Hemanta; Pal, Amit

    2016-01-01

    Introduction Based on the diversity of surface O antigen Vibrio cholerae can be classified into 206 serogroups. Vibrio cholerae is the causative agent of cholera and extra intestinal infections like, septicemia, wound infection and haemorrhagic reactions. Pathogenic factors of V. cholerae extra-intestinal infection are yet to be explored. Aim To identify the pathogenic factor associated with V. cholerae extra-intestinal infection. Materials and Methods This study was carried out between April, 2007 to October 2007 in National Institute of Cholera and Enteric Diseases (NICED). Haemagglutinin Protease (HAP), a major secreted proteolytic enzyme, was purified from the culture supernatant of Vibrio cholerae O1 strain C6709 after removal of outer membrane vesicles using a single step ion-exchange chromatography. Function of HAP was characterized by animal model, like, subcutaneous mouse assay, basement membrane component’s degradation assays and tissue culture assays. Result When suckling mouse was subcutaneously injected with culture supernatant of C6709 strain or purified HAP in both cases, distinct in vivo haemorrhagic response along with histopathological changes like necrosis of the capillaries and muscle layer, acute myofibre degeneration as well as moderate number of erythrocyte scattered through the skin, capillary necrosis, acute myofiber degeneration and necrosis of muscle layer were found. When Tryptic Soy Broth (TSB) media was used, the haemorrhagic effects in suckling mouse were not detectable. The major protein components, laminin and collagen, of basement membrane comprising of vascular endothelial cells, were degraded by HAP. Purified HAP showed cell rounding effects on Int 407 cells. Conclusion Result indicates that HAP may be a causative agent of Vibrio cholerae mediated extra-intestinal infection. This study confirms that Vibrio cholera as a sole pathogen can cause the extra-intestinal infection. This information is important for public health

  4. A study on trypsin, Aspergillus flavus and Bacillus sp. protease inhibitory activity in Cassia tora (L.) syn Senna tora (L.) Roxb. seed extract

    PubMed Central

    2011-01-01

    extract for 60 min. The inhibitory activity was evident in gelatin SDS-PAGE where a major band (~17-19 kD) of protease inhibitor (PI) was detected in dialyzed and SEC elute. The conidial germination of Aspergillus flavus was moderately inhibited (30%) by the dialyzed seed extract. Conclusions Cassia tora seed extract has strong protease inhibitory activity against trypsin, Aspergillus flavus and Bacillus sp. proteases. The inhibitor in Cassia tora may attenuate microbial proteases and also might be used as phytoprotecting agent. PMID:21749682

  5. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  6. Biochemical and Structural Characterization of SplD Protease from Staphylococcus aureus

    PubMed Central

    Zdzalik, Michal; Kalinska, Magdalena; Wysocka, Magdalena; Stec-Niemczyk, Justyna; Cichon, Przemyslaw; Stach, Natalia; Gruba, Natalia; Stennicke, Henning R.; Jabaiah, Abeer; Markiewicz, Michal; Kedracka-Krok, Sylwia; Wladyka, Benedykt; Daugherty, Patrick S.; Lesner, Adam; Rolka, Krzysztof; Dubin, Adam; Potempa, Jan; Dubin, Grzegorz

    2013-01-01

    Staphylococcus aureus is a dangerous human pathogen. A number of the proteins secreted by this bacterium are implicated in its virulence, but many of the components of its secretome are poorly characterized. Strains of S. aureus can produce up to six homologous extracellular serine proteases grouped in a single spl operon. Although the SplA, SplB, and SplC proteases have been thoroughly characterized, the properties of the other three enzymes have not yet been investigated. Here, we describe the biochemical and structural characteristics of the SplD protease. The active enzyme was produced in an Escherichia coli recombinant system and purified to homogeneity. P1 substrate specificity was determined using a combinatorial library of synthetic peptide substrates showing exclusive preference for threonine, serine, leucine, isoleucine, alanine, and valine. To further determine the specificity of SplD, we used high-throughput synthetic peptide and cell surface protein display methods. The results not only confirmed SplD preference for a P1 residue, but also provided insight into the specificity of individual primed- and non-primed substrate-binding subsites. The analyses revealed a surprisingly narrow specificity of the protease, which recognized five consecutive residues (P4-P3-P2-P1-P1’) with a consensus motif of R-(Y/W)-(P/L)-(T/L/I/V)↓S. To understand the molecular basis of the strict substrate specificity, we crystallized the enzyme in two different conditions, and refined the structures at resolutions of 1.56 Å and 2.1 Å. Molecular modeling and mutagenesis studies allowed us to define a consensus model of substrate binding, and illustrated the molecular mechanism of protease specificity. PMID:24130791

  7. Neutrophil Protease Cleavage of Von Willebrand Factor in Glomeruli - An Anti-thrombotic Mechanism in the Kidney.

    PubMed

    Tati, Ramesh; Kristoffersson, Ann-Charlotte; Manea Hedström, Minola; Mörgelin, Matthias; Wieslander, Jörgen; van Kooten, Cees; Karpman, Diana

    2017-02-01

    Adequate cleavage of von Willebrand factor (VWF) prevents formation of thrombi. ADAMTS13 is the main VWF-cleaving protease and its deficiency results in development of thrombotic microangiopathy. Besides ADAMTS13 other proteases may also possess VWF-cleaving activity, but their physiological importance in preventing thrombus formation is unknown. This study investigated if, and which, proteases could cleave VWF in the glomerulus. The content of the glomerular basement membrane (GBM) was studied as a reflection of processes occurring in the subendothelial glomerular space. VWF was incubated with human GBMs and VWF cleavage was assessed by multimer structure analysis, immunoblotting and mass spectrometry. VWF was cleaved into the smallest multimers by the GBM, which contained ADAMTS13 as well as neutrophil proteases, elastase, proteinase 3 (PR3), cathepsin-G and matrix-metalloproteinase 9. The most potent components of the GBM capable of VWF cleavage were in the serine protease or metalloprotease category, but not ADAMTS13. Neutralization of neutrophil serine proteases inhibited GBM-mediated VWF-cleaving activity, demonstrating a marked contribution of elastase and/or PR3. VWF-platelet strings formed on the surface of primary glomerular endothelial cells, in a perfusion system, were cleaved by both elastase and the GBM, a process blocked by elastase inhibitor. Ultramorphological studies of the human kidney demonstrated neutrophils releasing elastase into the GBM. Neutrophil proteases may contribute to VWF cleavage within the subendothelium, adjacent to the GBM, and thus regulate thrombus size. This anti-thrombotic mechanism would protect the normal kidney during inflammation and could also explain why most patients with ADAMTS13 deficiency do not develop severe kidney failure.

  8. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  9. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  10. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  11. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  12. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  13. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  14. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  15. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.

    PubMed

    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena

    2017-02-23

    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  16. Statistical medium optimization of an alkaline protease from Pseudomonas aeruginosa MTCC 10501, its characterization and application in leather processing.

    PubMed

    Boopathy, Naidu Ramachandra; Indhuja, Devadas; Srinivasan, Krishnan; Uthirappan, Mani; Gupta, Rishikesh; Ramudu, Kamini Numbi; Chellan, Rose

    2013-04-01

    Proteases are shown to have greener mode of application in leather processing for dehairing of goat skins and cow hides. Production of protease by submerged fermentation with potent activity is reported using a new isolate P. aeruginosa MTCC 10501. The production parameters were optimized by statistical methods such as Plackett-Burman and response surface methodology. The optimized production medium contained (g/L); tryptone, 2.5; yeast extract, 3.0; skim milk 30.0; dextrose 1.0; inoculum concentration 4%: initial pH 6.0; incubation temperature 30 degrees C and optimum production at 48 h with protease activity of 7.6 U/mL. The protease had the following characteristics: pH optima, 9.0; temperature optima 50 degrees C; pH stability between 5.0-10.0 and temperature stability between 10-40 degrees C. The protease was observed to have high potential for dehairing of goat skins in the pre- tanning process comparable to that of the chemical process as evidenced by histology. The method offers cleaner processing using enzyme only instead of toxic chemicals in the pre-tanning process of leather manufacture.

  17. Chloroplast Proteases: Updates on Proteolysis within and across Suborganellar Compartments1[OPEN

    PubMed Central

    Nishimura, Kenji

    2016-01-01

    Chloroplasts originated from the endosymbiosis of ancestral cyanobacteria and maintain transcription and translation machineries for around 100 proteins. Most endosymbiont genes, however, have been transferred to the host nucleus, and the majority of the chloroplast proteome is composed of nucleus-encoded proteins that are biosynthesized in the cytosol and then imported into chloroplasts. How chloroplasts and the nucleus communicate to control the plastid proteome remains an important question. Protein-degrading machineries play key roles in chloroplast proteome biogenesis, remodeling, and maintenance. Research in the past few decades has revealed more than 20 chloroplast proteases, which are localized to specific suborganellar locations. In particular, two energy-dependent processive proteases of bacterial origin, Clp and FtsH, are central to protein homeostasis. Processing endopeptidases such as stromal processing peptidase and thylakoidal processing peptidase are involved in the maturation of precursor proteins imported into chloroplasts by cleaving off the amino-terminal transit peptides. Presequence peptidases and organellar oligopeptidase subsequently degrade the cleaved targeting peptides. Recent findings have indicated that not only intraplastidic but also extraplastidic processive protein-degrading systems participate in the regulation and quality control of protein translocation across the envelopes. In this review, we summarize current knowledge of the major chloroplast proteases in terms of type, suborganellar localization, and diversification. We present details of these degradation processes as case studies according to suborganellar compartment (envelope, stroma, and thylakoids). Key questions and future directions in this field are discussed. PMID:27288365

  18. Diversity of 1,213 hepatitis C virus NS3 protease sequences from a clinical virology laboratory database in Marseille university hospitals, southeastern France.

    PubMed

    Hajji, Hind; Aherfi, Sarah; Motte, Anne; Ravaux, Isabelle; Mokhtari, Saadia; Ruiz, Jean-Marie; Poizot-Martin, Isabelle; Tourres, Christian; Tivoli, Natacha; Gérolami, René; Tamalet, Catherine; Colson, Philippe

    2015-11-01

    Infection with hepatitis C virus (HCV) represents a major public health concern worldwide. Recent therapeutic advances have been considerable, HCV genotype continuing to guide therapeutic management. Since 2008, HCV genotyping in our clinical microbiology laboratory at university hospitals of Marseille, Southeastern France, has been based on NS3 protease gene population sequencing, to allow concurrent HCV genotype and protease inhibitor (PI) genotypic resistance determinations. We aimed, first, to analyze the genetic diversity of HCV NS3 protease obtained from blood samples collected between 2003 and 2013 from patients monitored at university hospitals of Marseille and detect possible atypical sequences; and, second, to identify NS3 protease amino acid patterns associated with decreased susceptibility to HCV PIs. A total of 1,213 HCV NS3 protease sequences were available in our laboratory sequence database. We implemented a strategy based on bioinformatic tools to determine whether HCV sequences are representative of our local HCV genetic diversity, or divergent. In our 2003-2012 HCV NS3 protease sequence database, we delineated 32 clusters representative of the majority HCV genetic diversity, and 61 divergent sequences. Five of these divergent sequences showed less than 85% nucleotide identity with their top GenBank hit. In addition, among the 294 sequences obtained in 2013, three were divergent relative to these 32 previously delineated clusters. Finally, we detected both natural and on-treatment genotypic resistance to HCV NS3 PIs, including a substantial prevalence of Q80K substitutions associated with decreased susceptibility to simeprevir, a second generation PI.

  19. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  20. Conservation and revised annotation of the Treponema denticola prcB-prcA-prtP locus encoding the dentilisin (CTLP) protease complex.

    PubMed

    Goetting-Minesky, M P; Godovikova, V; Li, J J; Seshadrinathan, S; Timm, J C; Kamodia, S S; Fenno, J C

    2013-06-01

    Interstrain differences in antigenic surface proteins may reflect immunological pressure or differences in receptor specificity of the antigen. Treponema denticola exhibits considerable interstrain variability in its major surface protein (Msp), but no studies have addressed this issue in dentilisin (CTLP), a surface protease complex that has a significant role in T. denticola-host interactions in periodontal disease. Furthermore, the genome annotation of the prcB-prcA-prtP operon encoding dentilisin contains apparent errors and lacks a deduced PrtP amino acid sequence. To address these issues we analysed the protease operon from diverse T. denticola strains, as well as clones of the ATCC 35405 Type strain from which the genome sequence and original GenBank prtP sequence were derived. 6xHis-tagging of the PrtP C-terminus in ATCC 35405 demonstrated absence of the 'authentic frameshift' in PrtP reported in the genome databases. We propose that T. denticola genome annotations be updated to reflect this new information. PrcB and the PrtP N-terminal region that includes the catalytic domain were highly conserved in common laboratory strains and clinical isolates of T. denticola. Dentilisin proteolytic activity varied considerably between strains. Antibodies against PrcB, PrcA and PrtP from the type strain recognized these proteins in most T. denticola strains. PrtP varied up to 20% over the C-terminal 270 residues between strains. The PrtP C-terminal eight-residues (DWFYVEYP) was present in all strains, with two strains containing an additional Y-residue preceding the stop codon. Such conserved PrtP domains may be required for interactions with PrcA and PrcB, or for substrate interactions.

  1. Conservation and revised annotation of the Treponema denticola prcB-prcA-prtP locus encoding the dentilisin (CTLP) protease complex

    PubMed Central

    Goetting-Minesky, M. Paula; Godovikova, Valentina; Li, Jiean J.; Seshadrinathan, Suchithra; Timm, John C.; Kamodia, Shalini S.; Fenno, J. Christopher

    2015-01-01

    Summary Interstrain differences in antigenic surface proteins may reflect immunological pressure or differences in receptor specificity of the antigen. Treponema denticola exhibits considerable interstrain variability in its major surface protein (Msp), but no studies have addressed this issue in dentilisin (CTLP), a surface protease complex that has a significant role in T. denticola – host interactions in periodontal disease. Furthermore, the genome annotation of the prcB-prcA-prtP operon encoding dentilisin contains apparent errors and lacks a deduced PrtP amino acid sequence. To address these issues we analyzed the protease operon from diverse T. denticola strains, as well as clones of the ATCC 35405 Type strain from which the genome sequence and original Genbank prtP sequence were derived. 6xHis-tagging of the PrtP C-terminus in ATCC 35405 demonstrated absence of the “authentic frameshift” in PrtP reported in the genome databases. We propose that T. denticola genome annotations be updated to reflect this new information. PrcB and the PrtP N-terminal region that includes the catalytic domain were highly conserved in common laboratory strains and clinical isolates of T. denticola. Dentilisin proteolytic activity varied considerably between strains. Antibodies against PrcB, PrcA and PrtP from the Type strain recognized these proteins in most T. denticola strains. PrtP varied up to 20% over the C-terminal 270 residues between strains. The PrtP C-terminal 8-residues (DWFYVEYP) was present in all strains, with two strains contained an additional Y-residue preceding the stop codon. Such conserved PrtP domains may be required for interactions with PrcA and PrcB, or for substrate interactions. PMID:23253337

  2. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  3. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  4. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  5. ATP-dependent Lon protease controls tumor bioenergetics by reprogramming mitochondrial activity.

    PubMed

    Quirós, Pedro M; Español, Yaiza; Acín-Pérez, Rebeca; Rodríguez, Francisco; Bárcena, Clea; Watanabe, Kenta; Calvo, Enrique; Loureiro, Marta; Fernández-García, M Soledad; Fueyo, Antonio; Vázquez, Jesús; Enríquez, José Antonio; López-Otín, Carlos

    2014-07-24

    We generated mice deficient in Lon protease (LONP1), a major enzyme of the mitochondrial quality control machinery. Homozygous deletion of Lonp1 causes early embryonic lethality, whereas its haploinsufficiency protects against colorectal and skin tumors. Furthermore, LONP1 knockdown inhibits cellular proliferation and tumor and metastasis formation, whereas its overexpression increases tumorigenesis. Clinical studies indicate that high levels of LONP1 are a poor prognosis marker in human colorectal cancer and melanoma. Additionally, functional analyses show that LONP1 plays a key role in metabolic reprogramming by remodeling OXPHOS complexes and protecting against senescence. Our findings demonstrate the relevance of LONP1 for cellular and organismal viability and identify this protease as a central regulator of mitochondrial activity in oncogenesis.

  6. N-glycosylation of asparagine 8 regulates surface expression of major histocompatibility complex class I chain-related protein A (MICA) alleles dependent on threonine 24.

    PubMed

    Mellergaard, Maiken; Skovbakke, Sarah Line; Schneider, Christine L; Lauridsen, Felicia; Andresen, Lars; Jensen, Helle; Skov, Søren

    2014-07-18

    NKG2D is an activating receptor expressed on several types of human lymphocytes. NKG2D ligands can be induced upon cell stress and are frequently targeted post-translationally in infected or transformed cells to avoid immune recognition. Virus infection and inflammation alter protein N-glycosylation, and we have previously shown that changes in cellular N-glycosylation are involved in regulation of NKG2D ligand surface expression. The specific mode of regulation through N-glycosylation is, however, unknown. Here we investigated whether direct N-glycosylation of the NKG2D ligand MICA itself is critical for cell surface expression and sought to identify the essential residues. We found that a single N-glycosylation site (Asn(8)) was important for MICA018 surface expression. The frequently expressed MICA allele 008, with an altered transmembrane and intracellular domain, was not affected by mutation of this N-glycosylation site. Mutational analysis revealed that a single amino acid (Thr(24)) in the extracellular domain of MICA018 was essential for the N-glycosylation dependence, whereas the intracellular domain was not involved. The HHV7 immunoevasin, U21, was found to inhibit MICA018 surface expression by affecting N-glycosylation, and the retention was rescued by T24A substitution. Our study reveals N-glycosylation as an allele-specific regulatory mechanism important for regulation of surface expression of MICA018, and we pinpoint the residues essential for this N-glycosylation dependence. In addition, we show that this regulatory mechanism of MICA surface expression is likely targeted during different pathological conditions.

  7. Functional regulation of PVBV Nuclear Inclusion protein-a protease activity upon interaction with Viral Protein genome-linked and phosphorylation

    SciTech Connect

    Mathur, C.; Jimsheena, V.K.; Banerjee, S.; Makinen, K.; Gowda, L.R.; Savithri, H.S.

    2012-01-20

    Regulation of NIa-Pro is crucial for polyprotein processing and hence, for successful infection of potyviruses. We have examined two novel mechanisms that could regulate NIa-Pro activity. Firstly, the influence of VPg domain on the proteolytic activity of NIa-Pro was investigated. It was shown that the turnover number of the protease increases when these two domains interact (cis: two-fold; trans: seven-fold) with each other. Secondly, the protease activity of NIa-Pro could also be modulated by phosphorylation at Ser129. A mutation of this residue either to aspartate (phosphorylation-mimic) or alanine (phosphorylation-deficient) drastically reduces the protease activity. Based on these observations and molecular modeling studies, we propose that interaction with VPg as well as phosphorylation of Ser129 could relay a signal through Trp143 present at the protein surface to the active site pocket by subtle conformational changes, thus modulating protease activity of NIa-Pro.

  8. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  9. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  10. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  11. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  12. Medium optimization of protease production by Brevibacterium linens DSM 20158, using statistical approach

    PubMed Central

    Shabbiri, Khadija; Adnan, Ahmad; Jamil, Sania; Ahmad, Waqar; Noor, Bushra; Rafique, H.M.

    2012-01-01

    Various cultivation parameters were optimized for the production of extra cellular protease by Brevibacterium linens DSM 20158 grown in solid state fermentation conditions using statistical approach. The cultivation variables were screened by the Plackett–Burman design and four significant variables (soybean meal, wheat bran, (NH4)2SO4 and inoculum size were further optimized via central composite design (CCD) using a response surface methodological approach. Using the optimal factors (soybean meal 12.0g, wheat bran 8.50g, (NH4)2SO4) 0.45g and inoculum size 3.50%), the rate of protease production was found to be twofold higher in the optimized medium as compared to the unoptimized reference medium. PMID:24031928

  13. Type II transmembrane serine proteases as potential targets for cancer therapy

    PubMed Central

    Murray, Andrew S.; Varela, Fausto A.

    2016-01-01

    Carcinogenesis is accompanied by increased protein and activity levels of extracellular cell-surface proteases that are capable of modifying the tumor micro-environment by directly cleaving the extracellular matrix, as well as activating growth factors and proinflammatory mediators involved in proliferation and invasion of cancer cells, and recruitment of inflammatory cells. These complex processes ultimately potentiate neoplastic progression leading to local tumor cell invasion, entry into the vasculature, and metastasis to distal sites. Several members of the type II transmembrane serine protease (TTSP) family have been shown to play critical roles in cancer progression. In this review the knowledge collected over the past two decades about the molecular mechanisms underlying the pro-cancerous properties of selected TTSPs will be summarized. Furthermore, we will discuss how these insights may facilitate the translation into clinical settings in the future by specifically targeting TTSPs as part of novel cancer treatment regimens. PMID:27078673

  14. Inhibition of human natural killer cell activity by Pseudomonas aeruginosa alkaline protease and elastase.

    PubMed Central

    Pedersen, B K; Kharazmi, A

    1987-01-01

    The present study was designed to examine the effect of Pseudomonas aeruginosa alkaline protease (AP) and elastase (Ela) on human natural killer (NK) cell activity in vitro. AP and Ela were found to inhibit NK cell function. Addition of alpha interferon and interleukin-2 did not abolish this inhibition of NK cell activity. Adhesion of effector to target cells was studied in a single-cell agarose assay of monocyte-depleted NK-cell-enriched cell populations. AP and Ela were shown to inhibit effector/target cell conjugate formation. Furthermore, AP and Ela inhibited the binding of the monoclonal antibody Leu-11, which reacts with the Fc receptor of NK cells. The inhibition of NK cell binding to the target cell by P. aeruginosa proteases is most likely due to proteolytic cleavage of the surface receptors involved in the binding of the effector cell to the target cell. PMID:3030937

  15. Medium optimization of protease production by Brevibacterium linens DSM 20158, using statistical approach.

    PubMed

    Shabbiri, Khadija; Adnan, Ahmad; Jamil, Sania; Ahmad, Waqar; Noor, Bushra; Rafique, H M

    2012-07-01

    Various cultivation parameters were optimized for the production of extra cellular protease by Brevibacterium linens DSM 20158 grown in solid state fermentation conditions using statistical approach. The cultivation variables were screened by the Plackett-Burman design and four significant variables (soybean meal, wheat bran, (NH4)2SO4 and inoculum size were further optimized via central composite design (CCD) using a response surface methodological approach. Using the optimal factors (soybean meal 12.0g, wheat bran 8.50g, (NH4)2SO4) 0.45g and inoculum size 3.50%), the rate of protease production was found to be twofold higher in the optimized medium as compared to the unoptimized reference medium.

  16. Targeting microbial biofilms using Ficin, a nonspecific plant protease

    PubMed Central

    Baidamshina, Diana R.; Trizna, Elena Y.; Holyavka, Marina G.; Bogachev, Mikhail I.; Artyukhov, Valeriy G.; Akhatova, Farida S.; Rozhina, Elvira V.; Fakhrullin, Rawil F.; Kayumov, Airat R.

    2017-01-01

    Biofilms, the communities of surface-attached bacteria embedded into extracellular matrix, are ubiquitous microbial consortia securing the effective resistance of constituent cells to environmental impacts and host immune responses. Biofilm-embedded bacteria are generally inaccessible for antimicrobials, therefore the disruption of biofilm matrix is the potent approach to eradicate microbial biofilms. We demonstrate here the destruction of Staphylococcus aureus and Staphylococcus epidermidis biofilms with Ficin, a nonspecific plant protease. The biofilm thickness decreased two-fold after 24 hours treatment with Ficin at 10 μg/ml and six-fold at 1000 μg/ml concentration. We confirmed the successful destruction of biofilm structures and the significant decrease of non-specific bacterial adhesion to the surfaces after Ficin treatment using confocal laser scanning and atomic force microscopy. Importantly, Ficin treatment enhanced the effects of antibiotics on biofilms-embedded cells via disruption of biofilm matrices. Pre-treatment with Ficin (1000 μg/ml) considerably reduced the concentrations of ciprofloxacin and bezalkonium chloride required to suppress the viable Staphylococci by 3 orders of magnitude. We also demonstrated that Ficin is not cytotoxic towards human breast adenocarcinoma cells (MCF7) and dog adipose derived stem cells. Overall, Ficin is a potent tool for staphylococcal biofilm treatment and fabrication of novel antimicrobial therapeutics for medical and veterinary applications. PMID:28387349

  17. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  18. Hybridization of different antisense oligonucleotides on the surface of gold nanoparticles to silence zinc metalloproteinase gene after uptake by Leishmania major.

    PubMed

    Jebali, Ali; Anvari-Tafti, Mohammad Hosssein

    2015-05-01

    The use of antisense oligonucleotides is a novel strategy to treat infectious diseases. In this approach, vital mRNAs are targeted by antisense oligonucleotides. The aim of this study was to evaluate the effects of gold nanoparticles hybridized with different antisense oligonucleotides on Leishmania (L) major. In this project, gold nanoparticles were first synthesized, and then conjugated with primary oligonucleotides, 3'-AAA-5'. Next, conjugated gold nanoparticles (NP1) were separately hybridized with three types of antisense oligonucleotide from coding reign of GP63 gene (NP2), non-coding reign of GP63 gene (NP3), and both coding and non-coding reigns of GP63 (NP4). Then, 1mL of L. major suspension was separately added to 1mL of different hybridized gold nanoparticles at serial concentrations (1-200μg/mL), and incubated for 24, 48, and 72h at 37°C. Next, the uptake of each nanoparticle was separately measured by atomic absorption spectroscopy. After incubation, the cell viability was separately evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay. Also, the expression of GP63 gene was read out by quantitative-real-time PCR. This study showed that NP2 and NP3 had higher (5-fold) uptake than NP1 and NP4. Moreover, NP2 and NP3 led to less cell viability and gene expression, compared with NP1 and NP4. It could be concluded that both sequence and size of antisense oligonucleotide were important for transfection of L. major. Importantly, these antisense oligonucleotides can be obtained from both coding and non-coding reign of GP63 gene. Moreover, hybridized gold nanoparticles not only could silence GP63 gene, but also could kill L. major.

  19. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  20. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  1. Unique Thermodynamic Response of Tipranavir to Human Immunodeficiency Virus Type 1 Protease Drug Resistance Mutations

    SciTech Connect

    Muzammil,S.; Armstrong, A.; Kang, L.; Jakalian, A.; Bonneau, P.; Schmelmer, V.; Amzel, L.; Freire, E.

    2007-01-01

    Drug resistance is a major problem affecting the clinical efficacy of antiretroviral agents, including protease inhibitors, in the treatment of infection with human immunodeficiency virus type 1 (HIV-1)/AIDS. Consequently, the elucidation of the mechanisms by which HIV-1 protease inhibitors maintain antiviral activity in the presence of mutations is critical to the development of superior inhibitors. Tipranavir, a nonpeptidic HIV-1 protease inhibitor, has been recently approved for the treatment of HIV infection. Tipranavir inhibits wild-type protease with high potency (K{sub i} = 19 pM) and demonstrates durable efficacy in the treatment of patients infected with HIV-1 strains containing multiple common mutations associated with resistance. The high potency of tipranavir results from a very large favorable entropy change (-T{Delta}S = -14.6 kcal/mol) combined with a favorable, albeit small, enthalpy change ({Delta}H = -0.7 kcal/mol, 25{sup o}C). Characterization of tipranavir binding to wild-type protease, active site mutants I50V and V82F/I84V, the multidrug-resistant mutant L10I/L33I/M46I/I54V/L63I/V82A/I84V/L90M, and the tipranavir in vitro-selected mutant I13V/V32L/L33F/K45I/V82L/I84V was performed by isothermal titration calorimetry and crystallography. Thermodynamically, the good response of tipranavir arises from a unique behavior: it compensates for entropic losses by actual enthalpic gains or by sustaining minimal enthalpic losses when facing the mutants. The net result is a small loss in binding affinity. Structurally, tipranavir establishes a very strong hydrogen bond network with invariant regions of the protease, which is maintained with the mutants, including catalytic Asp25 and the backbone of Asp29, Asp30, Gly48 and Ile50. Moreover, tipranavir forms hydrogen bonds directly to Ile50, while all other inhibitors do so by being mediated by a water molecule.

  2. The killing of Leishmania major by human macrophages is mediated by nitric oxide induced after ligation of the Fc epsilon RII/CD23 surface antigen.

    PubMed Central

    Vouldoukis, I; Riveros-Moreno, V; Dugas, B; Ouaaz, F; Bécherel, P; Debré, P; Moncada, S; Mossalayi, M D

    1995-01-01

    Serum IgE concentrations and the expression of the low-affinity receptor for IgE (Fc epsilon RII/CD23) are increased in cutaneous leishmaniasis or after immune challenge with Leishmania antigens. In vitro, the ligation of CD23 by IgE-anti-IgE immune complexes (IgE-IC) or by anti-CD23 monoclonal antibody (mAb) induces nitric oxide (NO) synthase and the generation of various cytokines by human monocytes/macrophages. The present study shows that IgE-IC, via CD23 binding, induce intracellular killing of Leishmania major in human monocyte-derived macrophages through the induction of the L-arginine:NO pathway. This was demonstrated by increased generation of nitrite (NO2-), the stable oxidation product of NO, and by the ability of NG-monomethyl-L-arginine to block both NO generation and parasite killing. A similar NO-dependent effect was observed with interferon gamma-treated cells. Tumor necrosis factor alpha is involved in this process, since both the induction of NO synthase and the killing of parasites caused by anti-CD23 mAb were inhibited by an anti-tumor necrosis factor alpha mAb. Treatment of noninfected CD23+ macrophages with IgE-IC provided protection against subsequent in vitro infection of these cells by Leishmania major promastigotes. Thus, IgE-IC promote killing of L. major by inducing NO synthase in human macrophages. Images Fig. 1 Fig. 5 PMID:7544003

  3. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  4. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  5. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  6. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  7. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  8. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  9. In Vivo Assessment of Protease Dynamics in Cutaneous Wound Healing by Degradomics Analysis of Porcine Wound Exudates*

    PubMed Central

    Sabino, Fabio; Hermes, Olivia; Egli, Fabian E.; Kockmann, Tobias; Schlage, Pascal; Croizat, Pierre; Kizhakkedathu, Jayachandran N.; Smola, Hans; auf dem Keller, Ulrich

    2015-01-01

    Proteases control complex tissue responses by modulating inflammation, cell proliferation and migration, and matrix remodeling. All these processes are orchestrated in cutaneous wound healing to restore the skin's barrier function upon injury. Altered protease activity has been implicated in the pathogenesis of healing impairments, and proteases are important targets in diagnosis and therapy of this pathology. Global assessment of proteolysis at critical turning points after injury will define crucial events in acute healing that might be disturbed in healing disorders. As optimal biospecimens, wound exudates contain an ideal proteome to detect extracellular proteolytic events, are noninvasively accessible, and can be collected at multiple time points along the healing process from the same wound in the clinics. In this study, we applied multiplexed Terminal Amine Isotopic Labeling of Substrates (TAILS) to globally assess proteolysis in early phases of cutaneous wound healing. By quantitative analysis of proteins and protein N termini in wound fluids from a clinically relevant pig wound model, we identified more than 650 proteins and discerned major healing phases through distinctive abundance clustering of markers of inflammation, granulation tissue formation, and re-epithelialization. TAILS revealed a high degree of proteolysis at all time points after injury by detecting almost 1300 N-terminal peptides in ∼450 proteins. Quantitative positional proteomics mapped pivotal interdependent processing events in the blood coagulation and complement cascades, temporally discerned clotting and fibrinolysis during the healing process, and detected processing of complement C3 at distinct time points after wounding and by different proteases. Exploiting data on primary cleavage specificities, we related candidate proteases to cleavage events and revealed processing of the integrin adapter protein kindlin-3 by caspase-3, generating new hypotheses for protease

  10. Purification and characterization of the subtilisin-like protease of Streptococcus suis that contributes to its virulence.

    PubMed

    Bonifait, Laetitia; Vaillancourt, Katy; Gottschalk, Marcelo; Frenette, Michel; Grenier, Daniel

    2011-03-24

    Streptococcus suis is a major swine pathogen that is responsible for severe infections such as meningitis, endocarditis, and septicemia. S. suis is also recognized as a zoonotic agent and expresses several virulence factors. The recently identified subtilisin-like protease (SspA) of S. suis plays an important role in the pathogenicity of this bacterium in animal models. The objective of the present study was to clone, purify, and characterize the SspA of serotype 2 S. suis P1/7. The SSU0757 gene encoding SspA was amplified and a 4798-bp DNA fragment was obtained. It was cloned into the expression plasmid pBAD/HisB and then inserted into Escherichia coli to overproduce the protein. The recombinant protease was purified by chromatography procedures and showed a molecular weight of 170 kDa by SDS-PAGE. Its activity was optimal at pH 7 and at temperatures ranging from 25°C to 37°C. It had a high specificity for the chromogenic substrate succinyl-Ala-Ala-Pro-Phe-pNa while specific inhibitors of serine proteases inhibited its activity. In addition to degrading gelatin, the protease hydrolyzed the Aα chain of fibrinogen, which prevented fibrin formation by thrombin. The recombinant subtilisin-like protease also showed toxicity towards brain microvascular endothelial cells. Lastly, sera from pigs infected with S. suis reacted with the recombinant SspA, indicating that it is produced during infections. In conclusion, the SspA of S. suis shared similarities with subtilisin-like proteases produced by other pathogenic streptococci and may contribute to the pathogenic process of S. suis infections.

  11. Interleukin-1 beta-converting enzyme-like protease cleaves DNA- dependent protein kinase in cytotoxic T cell killing

    PubMed Central

    1996-01-01

    Cytotoxic T cells (CTL) represent the major defense mechanism against the spread of virus infection. It is believed that the pore-forming protein, perforin, facilitates the entry of a series of serine proteases (particularly granzyme B) into the target cell which ultimately leads to DNA fragmentation and apoptosis. We demonstrate here that during CTL-mediated cytolysis the catalytic subunit of DNA- dependent protein kinase (DNA-PKcs), an enzyme implicated in the repair of double strand breaks in DNA, is specifically cleaved by an interleukin (IL)-1 beta-converting enzyme (ICE)-like protease. A serine protease inhibitor, 3,4-dichloroisocoumarin (DCl), which is known to block granzyme B activity, inhibited CTL-induced apoptosis and prevented the degradation of DNA-PKcs in cells but failed to prevent the degradation of purified DNA-PKcs by CTL extracts. However, Tyr-Val- Ala-Asp-CH2Cl (YVAD-CMK) and other cysteine protease inhibitors prevented the degradation of purified DNA-PKcs by CTL extracts. Furthermore, incubation of DNA-PKcs with granzyme B did not produce the same cleavage pattern observed in cells undergoing apoptosis and when this substrate was incubated with either CTL extracts or the ICE-like protease, CPP32. Sequence analysis revealed that the cleavage site in DNA-PKcs during CTL killing was the same as that when this substrate was exposed to CPP32. This study demonstrates for the first time that the cleavage of DNA-PKcs in this intact cell system is exclusively due to an ICE-like protease. PMID:8760815

  12. In vivo assessment of protease dynamics in cutaneous wound healing by degradomics analysis of porcine wound exudates.

    PubMed

    Sabino, Fabio; Hermes, Olivia; Egli, Fabian E; Kockmann, Tobias; Schlage, Pascal; Croizat, Pierre; Kizhakkedathu, Jayachandran N; Smola, Hans; auf dem Keller, Ulrich

    2015-02-01

    Proteases control complex tissue responses by modulating inflammation, cell proliferation and migration, and matrix remodeling. All these processes are orchestrated in cutaneous wound healing to restore the skin's barrier function upon injury. Altered protease activity has been implicated in the pathogenesis of healing impairments, and proteases are important targets in diagnosis and therapy of this pathology. Global assessment of proteolysis at critical turning points after injury will define crucial events in acute healing that might be disturbed in healing disorders. As optimal biospecimens, wound exudates contain an ideal proteome to detect extracellular proteolytic events, are noninvasively accessible, and can be collected at multiple time points along the healing process from the same wound in the clinics. In this study, we applied multiplexed Terminal Amine Isotopic Labeling of Substrates (TAILS) to globally assess proteolysis in early phases of cutaneous wound healing. By quantitative analysis of proteins and protein N termini in wound fluids from a clinically relevant pig wound model, we identified more than 650 proteins and discerned major healing phases through distinctive abundance clustering of markers of inflammation, granulation tissue formation, and re-epithelialization. TAILS revealed a high degree of proteolysis at all time points after injury by detecting almost 1300 N-terminal peptides in ∼450 proteins. Quantitative positional proteomics mapped pivotal interdependent processing events in the blood coagulation and complement cascades, temporally discerned clotting and fibrinolysis during the healing process, and detected processing of complement C3 at distinct time points after wounding and by different proteases. Exploiting data on primary cleavage specificities, we related candidate proteases to cleavage events and revealed processing of the integrin adapter protein kindlin-3 by caspase-3, generating new hypotheses for protease

  13. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

    PubMed

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

    2011-10-01

    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  14. Proteomic approaches to identify substrates of the three Deg/HtrA proteases of the cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Tam, Lam X; Aigner, Harald; Timmerman, Evy; Gevaert, Kris; Funk, Christiane

    2015-06-15

    The family of Deg/HtrA proteases plays an important role in quality control of cellular proteins in a wide range of organisms. In the genome of the cyanobacterium Synechocystis sp. PCC 6803, a model organism for photosynthetic research and renewable energy products, three Deg proteases are encoded, termed HhoA, HhoB and HtrA. In the present study, we compared wild-type (WT) Synechocystis cells with the single insertion mutants ΔhhoA, ΔhhoB and ΔhtrA. Protein expression of the remaining Deg/HtrA proteases was strongly affected in the single insertion mutants. Detailed proteomic studies using DIGE (difference gel electrophoresis) and N-terminal COFRADIC (N-terminal combined fractional diagonal chromatography) revealed that inactivation of a single Deg protease has similar impact on the proteomes of the three mutants; differences to WT were observed in enzymes involved in the major metabolic pathways. Changes in the amount of phosphate permease system Pst-1 were observed only in the insertion mutant ΔhhoB. N-terminal COFRADIC analyses on cell lysates of ΔhhoB confirmed changed amounts of many cell envelope proteins, including the phosphate permease systems, compared with WT. In vitro COFRADIC studies were performed to identify the specificity profiles of the recombinant proteases rHhoA, rHhoB or rHtrA added to the Synechocystis WT proteome. The combined in vivo and in vitro N-terminal COFRADIC datasets propose RbcS as a natural substrate for HhoA, PsbO for HhoB and HtrA and Pbp8 for HtrA. We therefore suggest that each Synechocystis Deg protease protects the cell through different, but connected mechanisms.

  15. Three-dimensional structure of a simian immunodeficiency virus protease/inhibitor complex. Implications for the design of human immunodeficiency virus type 1 and 2 protease inhibitors.

    PubMed

    Zhao, B; Winborne, E; Minnich, M D; Culp, J S; Debouck, C; Abdel-Meguid, S S

    1993-12-07

    Simian immunodeficiency virus (SIV) proteins have considerable amino acid sequence homology to those from human immunodeficiency virus (HIV); thus monkeys are considered useful models for the preclinical evaluation of acquired immune deficiency syndrome (AIDS) therapeutics. We have crystallized and determined the three-dimensional structure of SIV protease bound to the hydroxyethylene isostere inhibitor SKF107457. Crystals of the complex were grown from 25-32% saturated sodium chloride, by the hanging drop method of vapor diffusion. They belong to the orthorhombic space group I222, with a = 46.3 A, b = 101.5 A, and c = 118.8 A. The structure has been determined at 2.5-A resolution by molecular replacement and refined to a crystallographic discrepancy factor, R (= sigma parallel Fo magnitude of - magnitude of Fc parallel/sigma magnitude of Fo magnitude of), of 0.189. The overall structure of the complex is very similar to previously reported structures of HIV-1 protease bound to inhibitors. The inhibitor is bound in a conformation that is almost identical to that found for the same inhibitor bound to HIV-1 protease, except for an overall translation of the inhibitor, varying along the backbone atoms from about 1.0 A at the termini to about 0.5 A around the scissile bond surrogate. The structures of the SIV and HIV-1 proteins vary significantly only in three surface loops composed of amino acids 15-20, 34-45, and 65-70. Superposition of the 1188 protein backbone atoms from the two structures gives an rms deviation of 1.0 A; this number is reduced to 0.6 A when atoms from the three surface loops are eliminated from the rms calculation.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. A new autocatalytic activation mechanism for cysteine proteases revealed by Prevotella intermedia interpain A

    PubMed Central

    Mallorquí-Fernández, Noemí; Manandhar, Surya P.; Mallorquí-Fernández, Goretti; Usón, Isabel; Wawrzonek, Katarzyna; Kantyka, Tomasz; Solà, Maria; Thøgersen, Ida B.; Enghild, Jan J.; Potempa, Jan; Gomis-Rüth, F.Xavier

    2009-01-01

    Prevotella intermedia is a major periodontopathogen contributing to human gingivitis and periodontitis. Such pathogens release proteases as virulence factors that cause deterrence of host defences and tissue destruction. A new cysteine protease from the cysteine-histidine-dyad class, interpain A, was studied in its zymogenic and its self-processed mature form. The latter consists of a bivalved moiety made up by two subdomains. In the structure of a catalytic cysteine-to-alanine zymogen variant, the right subdomain interacts with an unusual prodomain, thus contributing to latency. Unlike the catalytic cysteine residue, already in its competent conformation in the zymogen, the catalytic histidine is swung out from its active conformation and trapped in a cage shaped by a backing helix, a zymogenic hairpin and a latency flap in the zymogen. Dramatic rearrangement of up to 20Å of these elements triggered by a tryptophan switch occurs during activation and accounts for a new activation mechanism for proteolytic enzymes. These findings can be extrapolated to related potentially pathogenic cysteine proteases such as Streprococcus pyogenes SpeB and Porphyromonas gingivalis periodontain. PMID:17993455

  17. Function, therapeutic potential and cell biology of BACE proteases: current status and future prospects

    PubMed Central

    Vassar, Robert; Kuhn, Peer-Hendrik; Haass, Christian; Kennedy, Matthew E.; Rajendran, Lawrence; Wong, Philip C.; Lichtenthaler, Stefan F.

    2014-01-01

    The β-site APP cleaving enzymes 1 and 2 (BACE1 and BACE2) were initially identified as transmembrane aspartyl proteases cleaving the amyloid precursor protein (APP). BACE1 is a major drug target for Alzheimer’s disease because BACE1-mediated cleavage of APP is the first step in the generation of the pathogenic amyloid-β peptides. BACE1, which is highly expressed in the nervous system, is also required for myelination by cleaving neuregulin 1. Several recent proteomic and in vivo studies usingBACE1-andBACE2-deficient mice demonstrate a much wider range of physiological substrates and functions for both proteases within and outside of the nervous system. For BACE1 this includes axon guidance, neurogenesis, muscle spindle formation, and neuronal network functions, whereas BACE2 was shown to be involved in pigmentation and pancreatic β-cell function. This review highlights the recent progress in understanding cell biology, substrates, and functions of BACE proteases and discusses the therapeutic options and potential mechanism-based liabilities, in particular for BACE inhibitors in Alzheimer’s disease. PMID:24646365

  18. Purification and some characteristics of the human epidermal SH-protease inhibitor.

    PubMed

    Järvinen, M

    1978-08-01

    An inhibitor of papain and other SH-proteases was purified 520-fold from human epidermis extracts by acetone fractionation, heat treatment, papain-Sepharose affinity chromatography, and Sephadex G-50 chromatography. The purified inhibitor had a molecular weight of 12,600 and contained no hexose, as tested by the anthrone reaction. The inhibitor survived in a boiling water bath, in 5% trichloroacetic acid, 20 mM Na3PO4 (pH 12.1) and 4 M NH4OH (pH 11.9). By isoelectric focusing 2 major activity peaks with pI's of 4.6 and 4.8, and a minor peak with a pI of 4.9 was fractioned, and 3 corresponding protein bands were seen after analytical isoelectric focusing. Immunization of rabbits with the purified inhibitor yielded a highly specific anti-inhibitor serum. The purified inhibitor inhibited papain, ficin, human cathepsins B and C, and slightly inhibited bromelain. No inhibition of serine proteases (bovine trypsin and chymotrypsin A, porcine elastase) or an acid protease (human cathepsin D) was observed. Evidence was obtained that the inhibitor formed a complex with both dithiothreitol-activated papain and enzymatically inactive mercuripapain.

  19. A new autocatalytic activation mechanism for cysteine proteases revealed by Prevotella intermedia interpain A.

    PubMed

    Mallorquí-Fernández, Noemí; Manandhar, Surya P; Mallorquí-Fernández, Goretti; Usón, Isabel; Wawrzonek, Katarzyna; Kantyka, Tomasz; Solà, Maria; Thøgersen, Ida B; Enghild, Jan J; Potempa, Jan; Gomis-Rüth, F Xavier

    2008-02-01

    Prevotella intermedia is a major periodontopathogen contributing to human gingivitis and periodontitis. Such pathogens release proteases as virulence factors that cause deterrence of host defenses and tissue destruction. A new cysteine protease from the cysteine-histidine-dyad class, interpain A, was studied in its zymogenic and self-processed mature forms. The latter consists of a bivalved moiety made up by two subdomains. In the structure of a catalytic cysteine-to-alanine zymogen variant, the right subdomain interacts with an unusual prodomain, thus contributing to latency. Unlike the catalytic cysteine residue, already in its competent conformation in the zymogen, the catalytic histidine is swung out from its active conformation and trapped in a cage shaped by a backing helix, a zymogenic hairpin, and a latency flap in the zymogen. Dramatic rearrangement of up to 20A of these elements triggered by a tryptophan switch occurs during activation and accounts for a new activation mechanism for proteolytic enzymes. These findings can be extrapolated to related potentially pathogenic cysteine proteases such as Streprococcus pyogenes SpeB and Porphyromonas gingivalis periodontain.

  20. Inhibition of Aeromonas sobria serine protease (ASP) by α2-macroglobulin.

    PubMed

    Murakami, Yoji; Wada, Yoshihiro; Kobayashi, Hidetomo; Irie, Atsushi; Hasegawa, Makoto; Yamanaka, Hiroyasu; Okamoto, Keinosuke; Eto, Masatoshi; Imamura, Takahisa

    2012-10-01

    ASP is a serine protease secreted by Aeromonas sobria. ASP cleaves various plasma proteins, which is associated with onset of sepsis complications, such as shock and blood coagulation disorder. To investigate a host defense mechanism against this virulence factor, we examined the plasma for ASP inhibitor(s). Human plasma inhibited ASP activity for azocasein, which was almost completely abolished by treating plasma with methylamine, which inactivates α2-macroglobulin (α2-MG). The ASP-inhibitor complex in ASP-added plasma was not detected by immunoblotting using anti-ASP antibody; however, using gel filtration of the plasma ASP activity for an oligopeptide, the ASP substrate was eluted in the void fraction (Mw>200 000), suggesting ASP trapping by α2-MG. Indeed, human α2-MG inhibited ASP azocaseinolytic activity in a dose-dependent manner, rapidly forming a complex with the ASP. Fibrinogen degradation by ASP was completely inhibited in the presence of α2-MG. α1-Protease inhibitor, antithrombin, and α2-plasmin inhibitor neither inhibited ASP activity nor formed a complex with ASP. Surprisingly, ASP degraded these plasma serine protease inhibitors. Thus, α2-MG is the major ASP inhibitor in the human plasma and can limit ASP virulence activities in A. sobria infection sites. However, as shown by fluorescence correlation spectroscopy, slow ASP inhibition by α2-MG in plasma may indicate insufficient ASP control in vivo.

  1. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  2. Cleavage of Treponema denticola PrcA polypeptide to yield protease complex-associated proteins Prca1 and Prca2 is dependent on PrtP.

    PubMed

    Lee, Si Young; Bian, Xue-Lin; Wong, Grace W K; Hannam, Pauline M; McBride, Barry C; Fenno, J Christopher

    2002-07-01

    Analysis of potential virulence factors of oral spirochetes focuses on surface and secreted proteins. The Treponema denticola chymotrypsin-like protease (CTLP) is implicated in degradation of host cell molecules and contributes to tissue invasion. The CTLP complex, composed of the 72-kDa PrtP protein and two auxiliary proteins with molecular masses of approximately 40 and 30 kDa, is also involved in localization and oligomerization of the T. denticola major surface protein (Msp). The larger auxiliary protein was reported to be encoded by an open reading frame (ORF2) directly upstream of prtP. The deduced 39-kDa translation product of ORF2 contains a sequence matching the N-terminal sequence determined from one of the CTLP complex proteins. No proteins with significant homology are known, nor was information available on the third protein of the complex. DNA sequence analysis showed that ORF2 extended an additional 852 bp upstream of the reported sequence. The complete gene, designated prcA, encodes a predicted N-terminally-acylated polypeptide of approximately 70 kDa. Isogenic mutants with mutations in prtP, prcA, and prcA-prtP all lacked CTLP protease activity. The prcA mutant lacked all three CTLP proteins. The prcA-prtP mutant produced only a C-terminally-truncated 62-kDa PrcA protein. The prtP mutant produced a full-length 70-kDa PrcA. Immunoblot analysis of recombinant PrcA constructs confirmed that PrcA is cleaved to yield the two smaller proteins of the CTLP complex, designated PrcA1 and PrcA2. These data indicate that PrtP is required for cleavage of PrcA and suggest that this cleavage may be required for formation or stability of outer membrane complexes.

  3. Cleavage of Treponema denticola PrcA Polypeptide To Yield Protease Complex-Associated Proteins Prca1 and Prca2 Is Dependent on PrtP

    PubMed Central

    Lee, Si Young; Bian, Xue-Lin; Wong, Grace W. K.; Hannam, Pauline M.; McBride, Barry C.; Fenno, J. Christopher

    2002-01-01

    Analysis of potential virulence factors of oral spirochetes focuses on surface and secreted proteins. The Treponema denticola chymotrypsin-like protease (CTLP) is implicated in degradation of host cell molecules and contributes to tissue invasion. The CTLP complex, composed of the 72-kDa PrtP protein and two auxiliary proteins with molecular masses of approximately 40 and 30 kDa, is also involved in localization and oligomerization of the T. denticola major surface protein (Msp). The larger auxiliary protein was reported to be encoded by an open reading frame (ORF2) directly upstream of prtP. The deduced 39-kDa translation product of ORF2 contains a sequence matching the N-terminal sequence determined from one of the CTLP complex proteins. No proteins with significant homology are known, nor was information available on the third protein of the complex. DNA sequence analysis showed that ORF2 extended an additional 852 bp upstream of the reported sequence. The complete gene, designated prcA, encodes a predicted N-terminally-acylated polypeptide of approximately 70 kDa. Isogenic mutants with mutations in prtP, prcA, and prcA-prtP all lacked CTLP protease activity. The prcA mutant lacked all three CTLP proteins. The prcA-prtP mutant produced only a C-terminally-truncated 62-kDa PrcA protein. The prtP mutant produced a full-length 70-kDa PrcA. Immunoblot analysis of recombinant PrcA constructs confirmed that PrcA is cleaved to yield the two smaller proteins of the CTLP complex, designated PrcA1 and PrcA2. These data indicate that PrtP is required for cleavage of PrcA and suggest that this cleavage may be required for formation or stability of outer membrane complexes. PMID:12081957

  4. Cleavage and activation of human factor IX by serine proteases

    SciTech Connect

    Enfield, D.L.; Thompson, A.R.

    1984-10-01

    Human factor IX circulates as a single-chain glycoprotein. Upon activation in vitro, it is cleaved into disulfide-linked light and heavy chains and an activation peptide. After reduction of activated /sup 125/I-factor IX, the heavy and light chains are readily identified by gel electrophoresis. A direct, immunoradiometric assay for factor IXa was developed to assess activation of factor IX for proteases that cleaved it. The assay utilized radiolabeled antithrombin III with heparin to identify the active site and antibodies to distinguish factor IX. After cleavage of factor IX by factor XIa, factor VIIa-tissue thromboplastin complex, or the factor X-activating enzyme from Russell's viper venom, antithrombin III bound readily to factor IXa. Cleavage of /sup 125/I-factor IX by trypsin, chymotrypsin, and granulocyte elastase in the presence of calcium yielded major polypeptide fragments of the sizes of the factor XIa-generated light and heavy chains. When the immunoradiometric assay was used to assess trypsin-cleaved factor IX, the product bound antithrombin III, but not maximally. After digesting with insolubilized trypsin, clotting activity confirmed activation. In evaluating activation of factor IX, physical evidence of activation cleavages does not necessarily correlate with generation of an active site.

  5. Vibrio cholerae Hemagglutinin/Protease Degrades Chironomid Egg Masses

    PubMed Central

    Halpern, Malka; Gancz, Hanan; Broza, Meir; Kashi, Yechezkel

    2003-01-01

    Cholera is a severe diarrheal disease caused by specific serogroups of Vibrio cholerae that are pathogenic to humans. The disease does not persist in a chronic state in humans or animals. The pathogen is naturally present as a free-living organism in the environment. Recently, it was suggested that egg masses of the nonbiting midge Chironomus sp. (Diptera) harbor and serve as a nutritive source for V. cholerae, thereby providing a natural reservoir for the organism. Here we report that V. cholerae O9, O1, and O139 supernatants lysed the gelatinous matrix of the chironomid egg mass and inhibited eggs from hatching. The extracellular factor responsible for the degradation of chironomid egg masses (egg mass degrading factor) was purified from V. cholerae O9 and O139 and was identified as the major secreted hemagglutinin/protease (HA/P) of V. cholerae. The substrate in the egg mass was characterized as a glycoprotein. These findings show that HA/P plays an important role in the interaction of V. cholerae and chironomid egg masses. PMID:12839800

  6. Flap Conformations in HIV-1 Protease are Altered by Mutations

    NASA Astrophysics Data System (ADS)

    Fanucci, Gail; Blackburn, Mandy; Veloro, Angelo; Galiano, Luis; Fangu, Ding; Simmerling, Carlos

    2009-03-01

    HIV-1 protease (PR) is an enzyme that is a major drug target in the treatment of AIDS. Although the structure and function of HIV-1 PR have been studied for over 20 years, questions remain regarding the conformations and dynamics of the β-hairpin turns (flaps) that cover the active site cavity. Distance measurements with pulsed EPR spectroscopy of spin labeled constructs of HIV-1 PR have been used to characterize the flap conformations in the apo and inhibitor bound states. From the most probably distances and the breadth of the distance distribution profiles from analysis of the EPR data, insights regarding the flap conformations and flexibility are gained. The EPR results clearly show how drug pressure selected mutations alter the average conformation of the flaps and the degree of opening of the flaps. Molecular dynamics simulations successfully regenerate the experimentally determined distance distribution profiles, and more importantly, provide structural models for full interpretation of the EPR results. By combining experiment and theory to understand the role that altered flap flexibility/conformations play in the mechanism of drug resistance, key insights are gained toward the rational development of new inhibitors of this important enzyme.

  7. Molecular mechanisms of tolerance to cyanobacterial protease inhibitors revealed by clonal differences in Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Kuster, Christian J; Von Elert, Eric

    2012-10-01

    Protease inhibitors of primary producers are a major food quality constraint for herbivores. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is mainly represented by Daphnia and cyanobacteria. Protease inhibitors have been found in many cyanobacterial blooms. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the daphnid's gut, that is, trypsins and chymotrypsins. In this study, we fed four different Daphnia magna genotypes with the trypsin-inhibitor-containing cyanobacterial strain Microcystis aeruginosa PCC 7806 Mut. Upon exposure to dietary trypsin inhibitors, all D. magna genotypes showed increased gene expression of digestive trypsins and chymotrypsins. Exposure to dietary trypsin inhibitors resulted in increased activity of chymotrypsins and reduced activity of trypsin. Strong intraspecific differences in tolerance of the four D. magna genotypes to the dietary trypsin inhibitors were found. The degree of tolerance depended on the D. magna genotype. The genotypes' tolerance was positively correlated with the residual trypsin activity and the different IC(50) values of the trypsins. On the genetic level, the different trypsin loci varied between the D. magna genotypes. The two tolerant Daphnia genotypes that both originate from the same lake, which frequently produces cyanobacterial blooms, clustered in a neighbour-joining phylogenetic tree based on the three trypsin loci. This suggests that the genetic variability of trypsin loci was an important cause for the observed intraspecific variability in tolerance to cyanobacterial trypsin inhibitors. Based on these findings, it is reasonable to assume that such genetic variability can also be found in natural populations and thus constitutes the basis for local adaptation of natural populations to dietary protease inhibitors.

  8. Sweet potato cysteine proteases SPAE and SPCP2 participate in sporamin degradation during storage root sprouting.

    PubMed

    Chen, Hsien-Jung; Liang, Shu-Hao; Huang, Guan-Jhong; Lin, Yaw-Huei

    2015-08-15

    Sweet potato sporamins are trypsin inhibitors and exhibit strong resistance to digestion by pepsin, trypsin and chymotrypsin. In addition, they constitute the major storage proteins in the sweet potato and, after degradation, provide nitrogen as a nutrient for seedling regrowth in sprouting storage roots. In this report, four cysteine proteases-one asparaginyl endopeptidase (SPAE), two papain-like cysteine proteases (SPCP1 and SPCP2), and one granulin-containing cysteine protease (SPCP3)-were studied to determine their association with sporamin degradation in sprouting storage roots. Sporamin degradation became significant in the flesh of storage roots starting from week 4 after sprouting and this correlated with expression levels of SPAE and SPCP2, but not of SPCP1 and SPCP3. In the outer flesh near the skin, sporamin degradation was more evident and occurred earlier than in the inner flesh of storage roots. Degradation of sporamins in the outer flesh was inversely correlated with the distance of the storage root from the sprout. Exogenous application of SPAE and SPCP2, but not SPCP3, fusion proteins to crude extracts of the outer flesh (i.e., extracted from a depth of 0.3cm and within 2cm of one-week-old sprouts) promoted in vitro sporamin degradation in a dose-dependent manner. Pre-treatment of SPAE and SPCP2 fusion proteins at 95°C for 5min prior to their application to the crude extracts reduced sporamin degradation. These data show that sweet potato asparaginyl endopeptidase SPAE and papain-like cysteine protease SPCP2 participate in sporamin degradation during storage root sprouting.

  9. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  10. Antigen receptor-induced B lymphocyte apoptosis mediated via a protease of the caspase family.

    PubMed

    Andjelic, S; Liou, H C

    1998-02-01

    An extensive body of data, in a variety of systems, denoted the caspase family of proteases as a key player in the execution of programmed cell death. This family consists of cysteine proteases that cleave after asparagine-containing motifs. It is well established that the caspases are essential for the apoptosis mediated by Fas (CD95) and TNF receptor p55, molecules that contain the "death domain" in the cytoplasmic tail. However, little is known about the mechanisms underlying the antigen receptor-mediated cell death in B lymphocytes, a process instrumental in negative selection of potentially autoreactive B cells. Here, we investigated the involvement of caspases in cell death triggered via the antigen receptor in B lymphocytes (BCR) by using specific inhibitors. Initially, we used a well-established cell line, CH31, which is a model of B cell tolerance, to demonstrate that these proteases indeed participate in the BCR-induced apoptotic pathway. Next, we confirmed the physiological relevance of the caspase-mediated cell death pathway in splenic B cell populations isolated ex vivo that were induced to undergo apoptosis by extensive cross-linking of their BCR. Most interestingly, our data demonstrated that caspases regulate not only the nuclear DNA fragmentation, but also the surface membrane phosphatidylserine translocation as well as the degradation of a specific nuclear substrate. Taken together, this report supports the hypothesis that regulation of the caspase family is crucial in controlling the life/death decision in B lymphocytes mediated by the antigen receptor signal transduction.

  11. Simultaneous production of amylases and proteases by Bacillus subtilis in brewery wastes.

    PubMed

    Sánchez Blanco, Alina; Palacios Durive, Osmar; Batista Pérez, Sulema; Díaz Montes, Zoraida; Pérez Guerra, Nelson

    2016-01-01

    The simultaneous production of amylase (AA) and protease (PA) activity by Bacillus subtilis UO-01 in brewery wastes was studied by combining the response surface methodology with the kinetic study of the process. The optimum conditions (T=36.0°C and pH=6.8) for high biomass production (0.92g/L) were similar to the conditions (T=36.8°C and pH=6.6) for high AA synthesis (9.26EU/mL). However, the maximum PA level (9.77EU/mL) was obtained at pH 7.1 and 37.8°C. Under these conditions, a considerably high reduction (between 69.9 and 77.8%) of the initial chemical oxygen demand of the waste was achieved. In verification experiments under the optimized conditions for production of each enzyme, the AA and PA obtained after 15h of incubation were, respectively, 9.35 and 9.87EU/mL. By using the Luedeking and Piret model, both enzymes were classified as growth-associated metabolites. Protease production delay seemed to be related to the consumption of non-protein and protein nitrogen. These results indicate that the brewery waste could be successfully used for a high scale production of amylases and proteases at a low cost.

  12. Proteases and proteomics: cutting to the core of human skin pathologies.

    PubMed

    de Veer, Simon J; Furio, Laetitia; Harris, Jonathan M; Hovnanian, Alain

    2014-06-01

    Preserving the integrity of the skin's outermost layer (the epidermis) is vital for humans to thrive in hostile surroundings. Covering the entire body, the epidermis forms a thin but impenetrable cellular cordon that repels external assaults and blocks escape of water and electrolytes from within. This structure exists in a perpetual state of regeneration where the production of new cellular subunits at the base of the epidermis is offset by the release of terminally differentiated corneocytes from the surface. It is becoming increasingly clear that proteases hold vital roles in assembling and maintaining the epidermal barrier. More than 30 proteases are expressed by keratinocytes or infiltrating immune cells and the activity of each must be maintained within narrow limits and confined to the correct time and place. Accordingly, over- or under-exertion of proteolytic activity is a common factor in a multitude of skin disorders that range in severity from relatively mild to life-threatening. This review explores the current state of knowledge on the involvement of proteases in skin diseases and the latest findings from proteomic and transcriptomic studies focused on uncovering novel (patho)physiological roles for these enzymes.

  13. Electrochemical Protease Biosensor Based on Enhanced AC Voltammetry Using Carbon Nanofiber Nanoelectrode Arrays

    PubMed Central

    Swisher, Luxi Z.; Syed, Lateef U.; Prior, Allan M.; Madiyar, Foram R.; Carlson, Kyle R.; Nguyen, Thu A.; Hua, Duy H.; Li, Jun

    2013-01-01

    We report an electrochemical method for measuring the activity of proteases using nanoelectrode arrays (NEAs) fabricated with vertically aligned carbon nanofibers (VACNFs). The VACNFs of ~150 nm in diameter and 3 to 5 μm in length were grown on conductive substrates and encapsulated in SiO2 matrix. After polishing and plasma etching, controlled VACNF tips are exposed to form an embedded VACNF NEA. Two types of tetrapeptides specific to cancer-mediated proteases legumain and cathepsin B are covalently attached to the exposed VACNF tip, with a ferrocene (Fc) moiety linked at the distal end. The redox signal of Fc can be measured with AC voltammetry (ACV) at ~1 kHz frequency on VACNF NEAs, showing distinct properties from macroscopic glassy carbon electrodes due to VACNF’s unique interior structure. The enhanced ACV properties enable the kinetic measurements of proteolytic cleavage of the surface-attached tetrapeptides by proteases, further validated with a fluorescence assay. The data can be analyzed with a heterogeneous Michaelis-Menten model, giving “specificity constant” kcat/Km as (4.3 ± 0.8) × 104 M−1s−1 for cathepsin B and (1.13 ± 0.38) × 104 M−1s−1 for legumain. This method could be developed as portable multiplex electronic techniques for rapid cancer diagnosis and treatment monitoring. PMID:23814632

  14. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  15. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  16. Staphylococcus aureus protease: a probe of exposed, non-basic histone sequences in nucleosomes

    SciTech Connect

    Rill, R.L.; Oosterhof, D.K.

    1980-01-01

    The digestion of histones in chicken erythrocyte nucleosome cores and chromatin by Staphylococcus aureus protease was examined. This protease cleaves specifically at acidic residues and prefers glu-X bonds under the conditions used. Only 1 of 24 glutamic and 2 of 13 aspartic acids among all four core histones are located in basic, amino-terminal tails, hence staph. protease is a highly specific probe of exposed non-basic sequences. Staph. protease readily degraded H1, H5, and H3; moderately degraded H2b, and only slightly degraded H2a and H4 in nucleosomes and nucleosome cores. Electrophoresis of core histone fragments from limited digests showed that most glutamic acids were inaccessible, but at least five sites in non-basic sequences were readily cleaved. Tentative assignments of these fragments based on comparisons with products from limited digests of pure histones suggested that most accessible sites in nucleosome cores occur in H3. The most probable sites of H3 cutting are glutamic acids at positions 51, 60, 73, 94, and 97. At least one site in H2b, probably the equivalent of glu-105 in the calf H2b sequence, was accessible. No sites in H2a and H4 appeared highly accessible. H5 was readily cleaved at a site near the amino-terminus. These data substantiate the other evidence that non-basic core histone sequences are located primarily in the nucleosome interior, but that H3 binds to the ends of core DNA and thereby is partly exposed as the upper and lower surfaces of the disk-shaped core.

  17. Determination of antigenicity-altering patches on the major surface protein of human influenza A/H3N2 viruses.

    PubMed

    Kratsch, Christina; Klingen, Thorsten R; Mümken, Linda; Steinbrück, Lars; McHardy, Alice C

    2016-01-01

    Human influenza viruses are rapidly evolving RNA viruses that cause short-term respiratory infections with substantial morbidity and mortality in annual epidemics. Uncovering the general principles of viral coevolution with human hosts is important for pathogen surveillance and vaccine design. Protein regions are an appropriate model for the interactions between two macromolecules, but the currently used epitope definition for the major antigen of influenza viruses, namely hemagglutinin, is very broad. Here, we combined genetic, evolutionary, antigenic, and structural information to determine the most relevant regions of the hemagglutinin of human influenza A/H3N2 viruses for interaction with human immunoglobulins. We estimated the antigenic weights of amino acid changes at individual sites from hemagglutination inhibition data using antigenic tree inference followed by spatial clustering of antigenicity-altering protein sites on the protein structure. This approach determined six relevant areas (patches) for antigenic variation that had a key role in the past antigenic evolution of the viruses. Previous transitions between successive predominating antigenic types of H3N2 viruses always included amino acid changes in either the first or second antigenic patch. Interestingly, there was only partial overlap between the antigenic patches and the patches under strong positive selection. Therefore, besides alterations of antigenicity, other interactions with the host may shape the evolution of human influenza A/H3N2 viruses.

  18. Endocrine disruption due to estrogens derived from humans predicted to be low in the majority of U.S. surface waters.

    PubMed

    Anderson, Paul D; Johnson, Andrew C; Pfeiffer, Danielle; Caldwell, Daniel J; Hannah, Robert; Mastrocco, Frank; Sumpter, John P; Williams, Richard J

    2012-06-01

    In an effort to assess the combined risk estrone (E1), 17β-estradiol (E2), 17α-ethinyl estradiol (EE2), and estriol (E3) pose to aquatic wildlife across United States watersheds, two sets of predicted-no-effect concentrations (PNECs) for significant reproductive effects in fish were compared to predicted environmental concentrations (PECs). One set of PNECs was developed for evaluation of effects following long-term exposures. A second set was derived for short-term exposures. Both sets of PNECs are expressed as a 17β-estradiol equivalent (E2-eq), with 2 and 5 ng/L being considered the most likely levels above which fish reproduction may be harmed following long-term and short-term exposures, respectively. A geographic information system-based water quality model, Pharmaceutical Assessment and Transport Evaluation (PhATE™), was used to compare these PNECs to mean and low flow concentrations of the steroid estrogens across 12 U.S. watersheds. These watersheds represent approximately 19% of the surface area of the 48 North American states, contain 40 million people, and include over 44,000 kilometers of rivers. This analysis determined that only 0.8% of the segments (less than 1.1% of kilometers) of these watersheds would have a mean flow E2-eq concentration exceeding the long-term PNEC of 2.0 ng/L; only 0.5% of the segments (less than 0.8% of kilometers) would have a critical low flow E2-eq exceeding the short-term PNEC of 5 ng/L. Those few river segments where the PNECs were exceeded were effluent dominated, being either headwater streams with a publicly owned treatment works (POTW), or flowing through a highly urbanized environment with one or several POTWs. These results suggest that aquatic species in most U.S. surface waters are not at risk from steroid estrogens that may be present as a result of human releases.

  19. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. The