Science.gov

Sample records for major surface protease

  1. The major surface protease (MSP or GP63) in the intracellular amastigote stage of Leishmania chagasi.

    PubMed

    Hsiao, Chia-Hung Christine; Yao, Chaoqun; Storlie, Patricia; Donelson, John E; Wilson, Mary E

    2008-02-01

    The Leishmania spp. protozoa have an abundant surface metalloprotease called MSP (major surface protease), which in Leishmania chagasi is encoded by three distinct gene classes (MSPS, MSPL, MSPC). Although MSP has been characterized primarily in extracellular promastigotes, it also facilitates survival of intracellular amastigotes. Promastigotes express MSPS, MSPL, and two forms of MSPC RNAs, whereas amastigotes express only MSPL RNA and one MSPC transcript. We confirmed the presence of MSPC protein in both promastigotes and amastigotes by liquid chromatography-tandem mass spectrometry (LC-MS/MS). More than 10 MSP isoforms were visualized in both amastigotes and promastigotes using two-dimensional immunoblots, but amastigote MSPs migrated at a more acidic pI. Promastigote MSPs were N-glycosylated, whereas most amastigote MSPs were not. Immuno-electron microscopy showed that two-thirds of the promastigote MSP is distributed along the cell surface. In contrast, most amastigote MSP localized at the flagellar pocket, the major site of leishmania endocytosis/exocytosis. Biochemical analyses indicated that most amastigote MSP is soluble in the cytosol, vesicles or organelles, whereas most promastigote MSP is membrane-associated and GPI anchored. Activity gels and immunoblots confirmed the presence of a novel proteolytically active amastigote MSP of higher Mr than the promastigote MSPs. Furthermore, promastigote MSP is shed extracellularly whereas MSP is not shed from axenic amastigotes. We conclude that amastigotes and promastigotes both express multiple MSP isoforms, but these MSPs differ biochemically and localize differently in the two parasite stages. We hypothesize that MSP plays different roles in the extracellular versus intracellular forms of Leishmania spp.

  2. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  3. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  4. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  5. Cowpea bruchid Callosobruchus maculatus counteracts dietary protease inhibitors by modulating propeptides of major digestive enzymes.

    PubMed

    Ahn, J-E; Lovingshimer, M R; Salzman, R A; Presnail, J K; Lu, A L; Koiwa, H; Zhu-Salzman, K

    2007-06-01

    Cowpea bruchids, when challenged by consumption of the soybean cysteine protease inhibitor scN, reconfigure expression of their major CmCP digestive proteases and resume normal feeding and development. Previous evidence indicated that insects selectively induced CmCPs from subfamily B, that were more efficient in autoprocessing and possessed not only higher proteolytic, but also scN-degrading activities. In contrast, dietary scN only marginally up-regulated genes from the more predominant CmCP subfamily A that were inferior to subfamily B. To gain further molecular insight into this adaptive adjustment, we performed domain swapping between the two respective subfamily members B1 and A16, the latter unable to autoprocess or degrade scN even after intermolecular processing. Swapping the propeptides did not qualitatively alter autoprocessing in either protease isoform. Incorporation of either the N- (pAmBA) or C-terminal (pAmAB) mature B1 segment into A16, however, was sufficient to prime autoprocessing of A16 to its mature form. Further, the swap at the N-terminal mature A16 protein region (pAmBA) resulted in four amino acid changes. Replacement of these amino acid residues by the corresponding B1 residues, singly and pair-wise, revealed that autoprocessing activation in pAmBA resulted from cumulative and/or coordinated individual effects. Bacterially expressed isolated propeptides (pA16 and pB1) differed in their ability to inhibit mature B1 enzyme. Lower inhibitory activity in pB1 is likely attributable to its lack of protein stability. This instability in the cleaved propeptide is necessary, although insufficient by itself, for scN-degradation by the mature B1 enzyme. Taken together, cowpea bruchids modulate proteolysis of their digestive enzymes by controlling proCmCP cleavage and propeptide stability, which explains at least in part the plasticity cowpea bruchids demonstrate in response to protease inhibitors.

  6. Identification of the cysteine protease Amb a 11 as a novel major allergen from short ragweed.

    PubMed

    Bouley, Julien; Groeme, Rachel; Le Mignon, Maxime; Jain, Karine; Chabre, Henri; Bordas-Le Floch, Véronique; Couret, Marie-Noëlle; Bussières, Laetitia; Lautrette, Aurélie; Naveau, Marie; Baron-Bodo, Véronique; Lombardi, Vincent; Mascarell, Laurent; Batard, Thierry; Nony, Emmanuel; Moingeon, Philippe

    2015-10-01

    Allergy to pollen from short ragweed (Ambrosia artemisiifolia) is a serious and expanding health problem in the United States and in Europe. We sought to investigate the presence of undescribed allergens in ragweed pollen. Ragweed pollen proteins were submitted to high-resolution gel electrophoresis and tested for IgE reactivity by using sera from 92 American or European donors with ragweed allergy. Pollen transcriptome sequencing, mass spectrometry (MS), and recombinant DNA technologies were applied to characterize new IgE-binding proteins. High-resolution IgE immunoblotting experiments revealed that 50 (54%) of 92 patients with ragweed allergy were sensitized to a 37-kDa allergen distinct from Amb a 1. The full-length cDNA sequence for this molecule was obtained by means of PCR cloning after MS sequencing of the protein combined with ragweed pollen RNA sequencing. The purified allergen, termed Amb a 11, was fully characterized by MS and confirmed to react with IgEs from 66% of patients. This molecule is a 262-amino-acid thiol protease of the papain family expressed as a combination of isoforms and glycoforms after proteolytic removal of N- and C-terminal propeptides from a proform. Three-dimensional modeling revealed a high structural homology with known cysteine proteases, including the mite Der p 1 allergen. The protease activity of Amb a 11, as well as its capacity to activate basophils from patients with ragweed allergy, were confirmed. The production of a nonglycosylated recombinant form of Amb a 11 in Escherichia coli established that glycosylation is not required for IgE binding. We identified the cysteine protease Amb a 11 as a new major allergen from ragweed pollen. Given the similar physicochemical properties shared by the 2 major allergens, we hypothesize that part of the allergenic activity previously ascribed to Amb a 1 is rather borne by Amb a 11. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All

  7. Identification and characterization of alkaline serine protease from goat skin surface metagenome

    PubMed Central

    2011-01-01

    Metagenomic DNA isolated from goat skin surface was used to construct plasmid DNA library in Escherichia coli DH10B. Recombinant clones were screened for functional protease activity on skim milk agar plates. Upon screening 70,000 clones, a clone carrying recombinant plasmid pSP1 exhibited protease activity. In vitro transposon mutagenesis and sequencing of the insert DNA in this clone revealed an ORF of 1890 bp encoding a protein with 630 amino acids which showed significant sequence homology to the peptidase S8 and S53 subtilisin kexin sedolisin of Shewanella sp. This ORF was cloned in pET30b and expressed in E. coli BL21 (DE3). Although the cloned Alkaline Serine protease (AS-protease) was overexpressed, it was inactive as a result of forming inclusion bodies. After solubilisation, the protease was purified using Ni-NTA chromatography and then refolded properly to retain protease activity. The purified AS-protease with a molecular mass of ~63 kDa required a divalent cation (Co2+ or Mn2+) for its improved activity. The pH and temperature optima for this protease were 10.5 and 42°C respectively. PMID:21906326

  8. Surface-associated MUC5B mucins promote protease activity in Lactobacillus fermentum biofilms

    PubMed Central

    2013-01-01

    Background Mucosal surfaces are coated with layers of mucus gel that protect the underlying tissues and promote colonization by members of the commensal microflora. Lactobacillus fermentum is a common inhabitant of the oral cavity, gastrointestinal and reproductive tracts and is one of the most important lactic acid bacteria contributing to the formation of a healthy intestinal microflora. We have investigated the proteolytic activity in L. fermentum in response to interactions with the MUC5B mucin, which is a major component of mucus gels at sites colonized by this micro-organism. Methods Biofilms of Lactobacillus fermentum were established in mini-flow cells in the presence or absence of human salivary MUC5B. The proteolytic activity of biofilm cells was examined in a confocal scanning laser microscope with a fluorescent protease substrate. Degradation of MUC5B by L. fermentum was analysed using SDS-PAGE followed by Western blotting with antisera raised against the MUC5B peptide. Cell surface proteins differentialy expressed in a MUC5B-rich environment were identified with the aid of comparative two-dimensional electrophoresis followed by LC-MS/MS. Results Lactobacillus fermentum adhered well to surfaces coated with MUC5B mucin and in biofilms of L. fermentum formed in a MUC5B environment, the proportion of proteolytically-active cells (47 ± 0.6% of the population), as shown by cleavage of a fluorescent casein substrate, was significantly greater (p < 0.01) than that in biofilms formed in nutrient broth (0.4 ± 0.04% of the population). Thus, the presence of MUC5B mucins enhanced bacterial protease activity. This effect was mainly attributable to contact with surface-associated mucins rather than those present in the fluid phase. Biofilms of L. fermentum were capable of degrading MUC5B mucins suggesting that this complex glycoprotein can be exploited as a nutrient source by the bacteria. Comparison of the surface proteomes of biofilm cells of L

  9. High-throughput screening of improved protease inhibitors using a yeast cell surface display system and a yeast cell chip.

    PubMed

    Aoki, Wataru; Yoshino, Yuichi; Morisaka, Hironobu; Tsunetomo, Keiji; Koyo, Hirotaka; Kamiya, Shinji; Kawata, Noriyuki; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2011-01-01

    Protease-targeted inhibitors have been promising pharmaceuticals. Here, we combined a yeast cell surface display system with a yeast cell chip for the high-throughput screening of protease inhibitors, and succeeded in improving the activity of a protease inhibitor.

  10. Optimization of protease extraction from horse mango (Mangifera foetida Lour) kernels by a response surface methodology.

    PubMed

    Ahmad, Mohammad Norazmi; Liew, Siew Ling; Yarmo, Mohd Ambar; Said, Mamot

    2012-01-01

    Protease is one of the most important industrial enzymes with a multitude of applications in both food and non-food sectors. Although most commercial proteases are microbial proteases, the potential of non-conventional protease sources, especially plants, should not be overlooked. In this study, horse mango (Mangifera foetida Lour) fruit, known to produce latex with a blistering effect upon contact with human skin, was chosen as a source of protease, and the effect of the extraction process on its protease activity evaluated. The crude enzyme was extracted from the kernels and extraction was optimized by a response surface methodology (RSM) using a central composite rotatable design (CCRD). The variables studied were pH (x(1)), CaCl(2) (x(2)), Triton X-100 (x(3)), and 1,4-dithryeitol (x(4)). The results obtained indicate that the quadratic model is significant for all the variables tested. Based on the RSM model generated, optimal extraction conditions were obtained at pH 6.0, 8.16 mM CaCl(2), 5.0% Triton X-100, and 10.0 mM DTT, and the estimated response was 95.5% (w/w). Verification test results showed that the difference between the calculated and the experimental protease activity value was only 2%. Based on the t-value, the effects of the variables arranged in ascending order of strength were CaCl(2) < pH < DTT < Triton X-100.

  11. Using every trick in the book: the Pla surface protease of Yersinia pestis.

    PubMed

    Suomalainen, Marjo; Haiko, Johanna; Ramu, Päivi; Lobo, Leandro; Kukkonen, Maini; Westerlund-Wikström, Benita; Virkola, Ritva; Lähteenmäki, Kaarina; Korhonen, Timo K

    2007-01-01

    The Pla surface protease of Yersinia pestis, encoded by the Y. pestis-specific plasmid pPCP1, is a versatile virulence factor. In vivo studies have shown that Pla is essential in the establishment of bubonic plague, and in vitro studies have demonstrated various putative virulence functions for the Pla molecule. Pla is a surface protease of the omptin family, and its proteolytic targets include the abundant, circulating human zymogen plasminogen, which is activated by Pla to the serine protease plasmin. Plasmin is important in cell migration, and Pla also proteolytically inactivates the main circulating inhibitor of plasmin, alpha2-antiplasmin. Pla also is an adhesin with affinity for laminin, a major glycoprotein of mammalian basement membranes, which is degraded by plasmin but not by Pla. Together, these functions create uncontrolled plasmin proteolysis targeted at tissue barriers. Other proteolytic targets for Pla include complement proteins. Pla also mediates bacterial invasion into human endothelial cell lines; the adhesive and invasive charateristics of Pla can be genetically dissected from its proteolytic activity. Pla is a 10-stranded antiparallel beta-barrel with five surface-exposed short loops, where the catalytic residues are oriented inwards at the top of the beta-barrel. The sequence of Pla contains a three-dimensional motif for protein binding to lipid A of the lipopolysaccharide. Indeed, the proteolytic activity of Pla requires rough lipopolysaccharide but is sterically inhibited by the O antigen in smooth LPS, which may be the selective advantage of the loss of O antigen in Y. pestis. Members of the omptin family are highly similar in structure but differ in functions and virulence association. The catalytic residues of omptins are conserved, but the variable substrate specificities in proteolysis by Pla and other omptins are dictated by the amino acid sequences near or at the surface loops, and hence reflect differences in substrate binding. The

  12. Serum proteases alter the antigenicity of peptides presented by class I major histocompatibility complex molecules.

    PubMed Central

    Falo, L D; Colarusso, L J; Benacerraf, B; Rock, K L

    1992-01-01

    Any effect of serum on the antigenicity of peptides is potentially relevant to their use as immunogens in vivo. Here we demonstrate that serum contains distinct proteases that can increase or decrease the antigenicity of peptides. By using a functional assay, we show that a serum component other than beta 2-microglobulin enhances the presentation of ovalbumin peptides produced by cyanogen bromide cleavage. Three features of this serum activity implicate proteolysis: it is temperature dependent, it results in increased antigenicity in a low molecular weight peptide fraction, and it is inhibited by the protease inhibitor leupeptin. Conversely, presentation of the synthetic peptide OVA-(257-264) is inhibited by serum. This inhibition is unaffected by leupeptin but is blocked by bestatin, a protease inhibitor with distinct substrate specificities. Implications for peptide-based vaccine design and immunotherapy are discussed. PMID:1518868

  13. Coating polypropylene surfaces with protease weakens the adhesion and increases the dispersion of Candida albicans cells.

    PubMed

    Andreani, Eugenio Spadoni; Villa, Federica; Cappitelli, Francesca; Krasowska, Anna; Biniarz, Piotr; Łukaszewicz, Marcin; Secundo, Francesco

    2017-03-01

    To investigate the ability of the proteases, subtilisin and α-chymotrypsin (aCT), to inhibit the adhesion of Candida albicans biofilm to a polypropylene surface. The proteases were immobilized on plasma-treated polypropylene by covalently linking them with either glutaraldehyde (GA) or N'-diisopropylcarbodiimide (DIC) and N-hydroxysuccinimide (NHS). The immobilization did not negatively affect the enzyme activity and in the case of subtilisin, the activity was up to 640% higher than that of the free enzyme when using N-acetyl phenylalanine ethyl ester as the substrate. The efficacies against biofilm dispersal for the GA-linked SubC and aCT coatings were 41 and 55% higher than the control (polypropylene coated with only GA), respectively, whereas no effect was observed with enzymes immobilized with DIC and NHS. The higher dispersion efficacy observed for the proteases immobilized with GA could be both steric (proper orientation of the active site) and dynamic (higher protein mobility/flexibility). Proteases immobilized on a polypropylene surface reduced the adhesion of C. albicans biofilms and therefore may be useful in developing anti-biofilm surfaces based on non-toxic molecules and sustainable strategies.

  14. Structural basis for the resilience of Darunavir (TMC114) resistance major flap mutations of HIV-1 protease.

    PubMed

    Purohit, Rituraj; Sethumadhavan, Rao

    2009-12-01

    To understand the origin of the apparent low sensitivity to mutations exhibited by Darunavir, the binding energetics of this inhibitor to the HIV-1 protease was studied. Our research indicates that the observed effectiveness of Darunavir against the wild type HIV-1 protease is due to an extremely high affinity towards the wild-type and a relatively mild effect to the I50V and I54M mutations is due to low affinity towards the inhibitor. Good affinity of Darunavir accounts for the additive effects of well accommodation at binding site, good ligand-receptor electrostatic and van der waals energy while, the low susceptibility to I50V and I54M can be rationalized in terms of flexibility in the binding site residues that do not permit drug accommodation to the binding site distortions created by the mutation. The major flap mutations I50V and I54M lower the binding affinity of Darunavir by altering the position of binding site residues in 3D space. It decreases the electrostatic and van der waals interaction energy and further reduction in total receptor-ligand interaction energy. The results summarized in this paper emphasize the importance of shape complementarity and protein flexibility analysis of binding residual interactions in drug design. These data together with an interaction energy and flexibility analysis have established rigorous guidelines for the design of new and more powerful inhibitors. The principles learned from the HIV-1 protease can be applied to other design problems.

  15. Evaluation of dipeptide nitriles as inhibitors of rhodesain, a major cysteine protease of Trypanosoma brucei.

    PubMed

    Schirmeister, Tanja; Schmitz, Janina; Jung, Sascha; Schmenger, Torsten; Krauth-Siegel, R Luise; Gütschow, Michael

    2017-01-01

    A series of dipeptide nitriles known as inhibitors of mammalian cathepsins were evaluated for inhibition of rhodesain, the cathepsin L-like protease of Trypanosoma brucei. Compound 35 consisting of a Leu residue fitting into the S2 pocket and a triarylic moiety consisting of thiophene, a 1,2,4-oxadiazole and a phenyl ring fitting into the S3 pocket, and compound 33 with a 3-bromo-Phe residue (S2) and a biphenyl fragment (S3) were found to inhibit rhodesain in the single-digit nanomolar range. The observed steep structure-activity relationship could be explained by covalent docking simulations. With their high selectivity indices (ca. 200) and the good antitrypanosomal activity (8μM) the compounds represent promising starting points for new rhodesain inhibitors.

  16. The structure of the cysteine protease and lectin-like domains of Cwp84, a surface layer-associated protein from Clostridium difficile

    SciTech Connect

    Bradshaw, William J.; Kirby, Jonathan M.; Thiyagarajan, Nethaji; Chambers, Christopher J.; Davies, Abigail H.; Roberts, April K.; Shone, Clifford C.; Acharya, K. Ravi

    2014-07-01

    The crystal structure of Cwp84, an S-layer protein from Clostridium difficile is presented for the first time. The cathepsin L-like fold of cysteine protease domain, a newly observed ‘lectin-like’ domain and several other features are described. Clostridium difficile is a major problem as an aetiological agent for antibiotic-associated diarrhoea. The mechanism by which the bacterium colonizes the gut during infection is poorly understood, but undoubtedly involves a myriad of components present on the bacterial surface. The mechanism of C. difficile surface-layer (S-layer) biogenesis is also largely unknown but involves the post-translational cleavage of a single polypeptide (surface-layer protein A; SlpA) into low- and high-molecular-weight subunits by Cwp84, a surface-located cysteine protease. Here, the first crystal structure of the surface protein Cwp84 is described at 1.4 Å resolution and the key structural components are identified. The truncated Cwp84 active-site mutant (amino-acid residues 33–497; C116A) exhibits three regions: a cleavable propeptide and a cysteine protease domain which exhibits a cathepsin L-like fold followed by a newly identified putative carbohydrate-binding domain with a bound calcium ion, which is referred to here as a lectin-like domain. This study thus provides the first structural insights into Cwp84 and a strong base to elucidate its role in the C. difficile S-layer maturation mechanism.

  17. Identification of thaumatin-like protein and aspartyl protease as new major allergens in lettuce (Lactuca sativa).

    PubMed

    Muñoz-García, Esther; Luengo-Sánchez, Olga; Haroun-Díaz, Elisa; Maroto, Aroa Sanz; Palacín, Arancha; Díaz-Perales, Araceli; de las Heras Gozalo, Manuel; Labrador-Horrillo, Moisés; Vivanco, Fernando; Cuesta-Herranz, Javier; Pastor-Vargas, Carlos

    2013-12-01

    Today, about 2-8% of the population of Western countries exhibits some type of food allergy whose impact ranges from localized symptoms confined to the oral mucosa to severe anaphylactic reactions. Consumed worldwide, lettuce is a Compositae family vegetable that can elicit allergic reactions. To date, however, only one lipid transfer protein has been described in allergic reaction to lettuce. The aim of this study was to identify potential new allergens involved in lettuce allergy. Sera from 42 Spanish lettuce-allergic patients were obtained from patients recruited at the outpatient clinic. IgE-binding proteins were detected by SDS-PAGE and immunoblotting. Molecular characterization of IgE-binding bands was performed by MS. Thaumatin was purified using the Agilent 3100 OFFGEL system. The IgE-binding bands recognized in the sera of more than 50% of patients were identified as lipid transfer protein (9 kDa), a thaumatin-like protein (26 kDa), and an aspartyl protease (35 and 45 kDa). ELISA inhibition studies were performed to confirm the IgE reactivity of the purified allergen. Two new major lettuce allergens-a thaumatin-like protein and an aspartyl protease-have been identified and characterized. These allergens may be used to improve both diagnosis and treatment of lettuce-allergic patients. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Characterization of cell surface polypeptides of unfertilized, fertilized, and protease-treated zona-free mouse eggs

    SciTech Connect

    Boldt, J.; Gunter, L.E.; Howe, A.M. )

    1989-05-01

    The polypeptide composition of unfertilized, fertilized, and protease-treated zona-free mouse eggs was evaluated in this study. Zona-free eggs were radioiodinated by an Iodogen-catalyzed reaction. Light microscopic autoradiography of egg sections revealed that labeling was restricted to the cell surface. Labeled eggs were solubilized, and cell surface polypeptides were identified by one-dimensional SDS polyacrylamide gel electrophoresis and autoradiography. The unfertilized egg demonstrated 8-10 peptides that incorporated {sup 125}I, with major bands observed at approximately 145-150, 94, and 23 kilodaltons (kD). Zona-free eggs fertilized in vitro and then radiolabeled demonstrated several new bands in comparison to unfertilized eggs, with a major band appearing at approximately 36 kD. Treatment of radiolabeled unfertilized eggs with either trypsin or chymotrypsin (1 mg/ml for 5-20 min) caused enzyme-specific modifications in labeled polypeptides. Trypsin (T) treatment resulted in time-dependant modification of the three major peptides at 145-150, 94, and 23 kD. Chymotrypsin (CT) treatment, in contrast, was associated with loss or modification of the 94 kD band, with no apparent effect on either the 145-150 or 23 kD band. Taken together with previous data indicating that T or CT egg treatment interferes with sperm-egg attachment and fusion, these results suggest a possible role for the 94 kD protein in sperm-egg interaction.

  19. The Prc and RseP proteases control bacterial cell-surface signalling activity.

    PubMed

    Bastiaansen, Karlijn C; Ibañez, Aurelia; Ramos, Juan L; Bitter, Wilbert; Llamas, María A

    2014-08-01

    Extracytoplasmic function (ECF) sigma factors play a key role in the regulation of vital functions in the bacterial response to the environment. In Gram-negative bacteria, activity of these sigma factors is often controlled by cell-surface signalling (CSS), a regulatory system that also involves an outer membrane receptor and a transmembrane anti-sigma factor. To get more insight into the molecular mechanism behind CSS regulation, we have focused on the unique Iut system of Pseudomonas putida. This system contains a hybrid protein containing both a cytoplasmic ECF sigma domain and a periplasmic anti-sigma domain, apparently leading to a permanent interaction between the sigma and anti-sigma factor. We show that the Iut ECF sigma factor regulates the response to aerobactin under iron deficiency conditions and is activated by a proteolytic pathway that involves the sequential action of two proteases: Prc, which removes the periplasmic anti-sigma domain, and RseP, which subsequently removes the transmembrane domain and thereby generates the ECF active transcriptional form. We furthermore demonstrate the role of these proteases in the regulation of classical CSS systems in which the sigma and anti-sigma factors are two different proteins.

  20. Improving the performance of industrial ethanol-producing yeast by expressing the aspartyl protease on the cell surface.

    PubMed

    Guo, Zhong-peng; Zhang, Liang; Ding, Zhong-yang; Wang, Zheng-Xiang; Shi, Gui-Yang

    2010-12-01

    The yeasts used in fuel ethanol manufacture are unable to metabolize soluble proteins. The PEP4 gene, encoding a vacuolar aspartyl protease in Saccharomyces cerevisiae, was either secretively or cell-surface anchored expressed in industrial ethanol-producing S. cerevisiae. The obtained recombinant strains APA (expressing the protease secretively) and APB (expressing the protease on the cell wall) were studied under ethanol fermentation conditions in feed barley cultures. The effects of expression of the protease on product formation, growth and cell protein content were measured. The biomass yield of the wild-type was clearly lower than that of the recombinant strains (0.578 ± 0.12 g biomass/g glucose for APA and 0.582 ± 0.08 g biomass/g glucose for APB). In addition, nearly 98-99% of the theoretical maximum level of ethanol yield was achieved (relative to the amount of substrate consumed) for the recombinant strains, while limiting the nitrogen source resulted in dissatisfactory fermentation for the wild-type and more than 30 g/l residual sugar was detected at the end of fermentation. In addition, higher growth rate, viability and lower yields of byproducts such as glycerol and pyruvic acid for recombinant strains were observed. Expressing acid protease can be expected to lead to a significant increase in ethanol productivity.

  1. Streptococcus pneumoniae serine protease HtrA, but not SFP or PrtA, is a major virulence factor in pneumonia.

    PubMed

    de Stoppelaar, Sacha F; Bootsma, Hester J; Zomer, Aldert; Roelofs, Joris J T H; Hermans, Peter W M; van 't Veer, Cornelis; van der Poll, Tom

    2013-01-01

    Streptococcus (S.) pneumoniae is a common causative pathogen in pneumonia. Serine protease orthologs expressed by a variety of bacteria have been found of importance for virulence. Previous studies have identified two serine proteases in S. pneumoniae, HtrA (high-temperature requirement A) and PrtA (cell wall-associated serine protease A), that contributed to virulence in models of pneumonia and intraperitoneal infection respectively. We here sought to identify additional S. pneumoniae serine proteases and determine their role in virulence. The S. pneumoniae D39 genome contains five putative serine proteases, of which HtrA, Subtilase Family Protein (SFP) and PrtA were selected for insertional mutagenesis because they are predicted to be secreted and surface exposed. Mutant D39 strains lacking serine proteases were constructed by in-frame insertion deletion mutagenesis. Pneumonia was induced by intranasal infection of mice with wild-type or mutant D39. After high dose infection, only D39ΔhtrA showed reduced virulence, as reflected by strongly reduced bacterial loads, diminished dissemination and decreased lung inflammation. D39ΔprtA induced significantly less lung inflammation together with smaller infiltrated lung surface, but without influencing bacterial loads. After low dose infection, D39ΔhtrA again showed strongly reduced bacterial loads; notably, pneumococcal burdens were also modestly lower in lungs after infection with D39Δsfp. These data confirm the important role for HtrA in S. pneumoniae virulence. PrtA contributes to lung damage in high dose pneumonia; it does not however contribute to bacterial outgrowth in pneumococcal pneumonia. SFP may facilitate S. pneumoniae growth after low dose infection.

  2. Streptococcus pneumoniae Serine Protease HtrA, but Not SFP or PrtA, Is a Major Virulence Factor in Pneumonia

    PubMed Central

    de Stoppelaar, Sacha F.; Bootsma, Hester J.; Zomer, Aldert; Roelofs, Joris J. T. H.; Hermans, Peter W. M.; van ’t Veer, Cornelis; van der Poll, Tom

    2013-01-01

    Streptococcus (S.) pneumoniae is a common causative pathogen in pneumonia. Serine protease orthologs expressed by a variety of bacteria have been found of importance for virulence. Previous studies have identified two serine proteases in S. pneumoniae, HtrA (high-temperature requirement A) and PrtA (cell wall-associated serine protease A), that contributed to virulence in models of pneumonia and intraperitoneal infection respectively. We here sought to identify additional S. pneumoniae serine proteases and determine their role in virulence. The S. pneumoniae D39 genome contains five putative serine proteases, of which HtrA, Subtilase Family Protein (SFP) and PrtA were selected for insertional mutagenesis because they are predicted to be secreted and surface exposed. Mutant D39 strains lacking serine proteases were constructed by in-frame insertion deletion mutagenesis. Pneumonia was induced by intranasal infection of mice with wild-type or mutant D39. After high dose infection, only D39ΔhtrA showed reduced virulence, as reflected by strongly reduced bacterial loads, diminished dissemination and decreased lung inflammation. D39ΔprtA induced significantly less lung inflammation together with smaller infiltrated lung surface, but without influencing bacterial loads. After low dose infection, D39ΔhtrA again showed strongly reduced bacterial loads; notably, pneumococcal burdens were also modestly lower in lungs after infection with D39Δsfp. These data confirm the important role for HtrA in S. pneumoniae virulence. PrtA contributes to lung damage in high dose pneumonia; it does not however contribute to bacterial outgrowth in pneumococcal pneumonia. SFP may facilitate S. pneumoniae growth after low dose infection. PMID:24244609

  3. Structure-activity relationships for a class of selective inhibitors of the major cysteine protease from Trypanosoma cruzi.

    PubMed

    Guido, Rafael V C; Trossini, Gustavo H G; Castilho, Marcelo S; Oliva, Glaucius; Ferreira, Elizabeth I; Andricopulo, Adriano D

    2008-12-01

    Chagas' disease is a parasitic infection widely distributed throughout Latin America, with devastating consequences in terms of human morbidity and mortality. Cruzain, the major cysteine protease from Trypanosoma cruzi, is an attractive target for antitrypanosomal chemotherapy. In the present work, classical two-dimensional quantitative structure-activity relationships (2D QSAR) and hologram QSAR (HQSAR) studies were performed on a training set of 45 thiosemicarbazone and semicarbazone derivatives as inhibitors of T. cruzi cruzain. Significant statistical models (HQSAR, q(2) = 0.75 and r(2) = 0.96; classical QSAR, q(2) = 0.72 and r(2) = 0.83) were obtained, indicating their consistency for untested compounds. The models were then used to evaluate an external test set containing 10 compounds which were not included in the training set, and the predicted values were in good agreement with the experimental results (HQSAR, r(2)(pred) = 0.95; classical QSAR, r(2)(pred) = 0.91), indicating the existence of complementary between the two ligand-based drug design techniques.

  4. Two variants of the major serine protease inhibitor from the sea anemone Stichodactyla helianthus, expressed in Pichia pastoris.

    PubMed

    García-Fernández, Rossana; Ziegelmüller, Patrick; González, Lidice; Mansur, Manuel; Machado, Yoan; Redecke, Lars; Hahn, Ulrich; Betzel, Christian; Chávez, María de Los Ángeles

    2016-07-01

    The major protease inhibitor from the sea anemone Stichodactyla helianthus (ShPI-1) is a non-specific inhibitor that binds trypsin and other trypsin-like enzymes, as well as chymotrypsin, and human neutrophil elastase. We performed site-directed mutagenesis of ShPI-1 to produce two variants (rShPI-1/K13L and rShPI/Y15S) that were expressed in Pichia pastoris, purified, and characterized. After a single purification step, 65 mg and 15 mg of protein per liter of culture supernatant were obtained for rShPI-1/K13L and rShPI/Y15S, respectively. Functional studies demonstrated a 100-fold decreased trypsin inhibitory activity as result of the K13L substitution at the reactive (P1) site. This protein variant has a novel tight-binding inhibitor activity of pancreatic elastase and increased activity toward neutrophil elastase in comparison to rShPI-1A. In contrast, the substitution Y15S at P2' site did not affect the Ki value against trypsin, but did reduce activity 10-fold against chymotrypsin and neutrophil elastase. Our results provide two new ShPI-1 variants with modified inhibitory activities, one of them with increased biomedical potential. This study also offers new insight into the functional impact of the P1 and P2' sites on ShPI-1 specificity.

  5. Aspartic Proteases and Major Cell Wall Components in Candida albicans Trigger the Release of Neutrophil Extracellular Traps.

    PubMed

    Zawrotniak, Marcin; Bochenska, Oliwia; Karkowska-Kuleta, Justyna; Seweryn-Ozog, Karolina; Aoki, Wataru; Ueda, Mitsuyoshi; Kozik, Andrzej; Rapala-Kozik, Maria

    2017-01-01

    Neutrophils use different mechanisms to cope with pathogens that invade the host organism. The most intriguing of these responses is a release of neutrophil extracellular traps (NETs) composed of decondensed chromatin and granular proteins with antimicrobial activity. An important potential target of NETs is Candida albicans-an opportunistic fungal pathogen that employs morphological and phenotype switches and biofilm formation during contact with neutrophils, accompanied by changes in epitope exposition that mask the pathogen from host recognition. These processes differ depending on infection conditions and are thus influenced by the surrounding environment. In the current study, we compared the NET release by neutrophils upon contact with purified main candidal cell surface components. We show here for the first time that in addition to the main cell wall-building polysaccharides (mannans and β-glucans), secreted aspartic proteases (Saps) trigger NETs with variable intensities. The most efficient NET-releasing response is with Sap4 and Sap6, which are known to be secreted by fungal hyphae. This involves mixed, ROS-dependent and ROS-independent signaling pathways, mainly through interactions with the CD11b receptor. In comparison, upon contact with the cell wall-bound Sap9 and Sap10, neutrophils responded via a ROS-dependent mechanism using CD16 and CD18 receptors for protease recognition. In addition to the Saps tested, the actuation of selected mediating kinases (Src, Syk, PI3K, and ERK) was also investigated. β-Glucans were found to trigger a ROS-dependent process of NET production with engagement of Dectin-1 as well as CD11b and CD18 receptors. Mannans were observed to be recognized by TLRs, CD14, and Dectin-1 receptors and triggered NET release mainly via a ROS-independent pathway. Our results thus strongly suggest that neutrophils activate NET production in response to different candidal components that are presented locally at low concentrations at the

  6. Aspartic Proteases and Major Cell Wall Components in Candida albicans Trigger the Release of Neutrophil Extracellular Traps

    PubMed Central

    Zawrotniak, Marcin; Bochenska, Oliwia; Karkowska-Kuleta, Justyna; Seweryn-Ozog, Karolina; Aoki, Wataru; Ueda, Mitsuyoshi; Kozik, Andrzej; Rapala-Kozik, Maria

    2017-01-01

    Neutrophils use different mechanisms to cope with pathogens that invade the host organism. The most intriguing of these responses is a release of neutrophil extracellular traps (NETs) composed of decondensed chromatin and granular proteins with antimicrobial activity. An important potential target of NETs is Candida albicans—an opportunistic fungal pathogen that employs morphological and phenotype switches and biofilm formation during contact with neutrophils, accompanied by changes in epitope exposition that mask the pathogen from host recognition. These processes differ depending on infection conditions and are thus influenced by the surrounding environment. In the current study, we compared the NET release by neutrophils upon contact with purified main candidal cell surface components. We show here for the first time that in addition to the main cell wall-building polysaccharides (mannans and β-glucans), secreted aspartic proteases (Saps) trigger NETs with variable intensities. The most efficient NET-releasing response is with Sap4 and Sap6, which are known to be secreted by fungal hyphae. This involves mixed, ROS-dependent and ROS-independent signaling pathways, mainly through interactions with the CD11b receptor. In comparison, upon contact with the cell wall-bound Sap9 and Sap10, neutrophils responded via a ROS-dependent mechanism using CD16 and CD18 receptors for protease recognition. In addition to the Saps tested, the actuation of selected mediating kinases (Src, Syk, PI3K, and ERK) was also investigated. β-Glucans were found to trigger a ROS-dependent process of NET production with engagement of Dectin-1 as well as CD11b and CD18 receptors. Mannans were observed to be recognized by TLRs, CD14, and Dectin-1 receptors and triggered NET release mainly via a ROS-independent pathway. Our results thus strongly suggest that neutrophils activate NET production in response to different candidal components that are presented locally at low concentrations at the

  7. The Clostridium difficile Protease Cwp84 Modulates both Biofilm Formation and Cell-Surface Properties.

    PubMed

    Pantaléon, Véronique; Soavelomandroso, Anna Philibertine; Bouttier, Sylvie; Briandet, Romain; Roxas, Bryan; Chu, Michele; Collignon, Anne; Janoir, Claire; Vedantam, Gayatri; Candela, Thomas

    2015-01-01

    Clostridium difficile is responsible for 15-20% of antibiotic-associated diarrheas, and nearly all cases of pseudomembranous colitis. Among the cell wall proteins involved in the colonization process, Cwp84 is a protease that cleaves the S-layer protein SlpA into two subunits. A cwp84 mutant was previously shown to be affected for in vitro growth but not in its virulence in a hamster model. In this study, the cwp84 mutant elaborated biofilms with increased biomass compared with the parental strain, allowing the mutant to grow more robustly in the biofilm state. Proteomic analyses of the 630Δerm bacteria growing within the biofilm revealed the distribution of abundant proteins either in cell surface, matrix or supernatant fractions. Of note, the toxin TcdA was found in the biofilm matrix. Although the overall proteome differences between the cwp84 mutant and the parental strains were modest, there was still a significant impact on bacterial surface properties such as altered hydrophobicity. In vitro and in vivo competition assays revealed that the mutant was significantly impaired for growth only in the planktonic state, but not in biofilms or in vivo. Taken together, our results suggest that the phenotypes in the cwp84 mutant come from either the accumulation of uncleaved SlpA, or the ability of Cwp84 to cleave as yet undetermined proteins.

  8. The Clostridium difficile Protease Cwp84 Modulates both Biofilm Formation and Cell-Surface Properties

    PubMed Central

    Pantaléon, Véronique; Soavelomandroso, Anna Philibertine; Bouttier, Sylvie; Briandet, Romain; Roxas, Bryan; Chu, Michele; Collignon, Anne; Janoir, Claire; Vedantam, Gayatri; Candela, Thomas

    2015-01-01

    Clostridium difficile is responsible for 15-20% of antibiotic-associated diarrheas, and nearly all cases of pseudomembranous colitis. Among the cell wall proteins involved in the colonization process, Cwp84 is a protease that cleaves the S-layer protein SlpA into two subunits. A cwp84 mutant was previously shown to be affected for in vitro growth but not in its virulence in a hamster model. In this study, the cwp84 mutant elaborated biofilms with increased biomass compared with the parental strain, allowing the mutant to grow more robustly in the biofilm state. Proteomic analyses of the 630Δerm bacteria growing within the biofilm revealed the distribution of abundant proteins either in cell surface, matrix or supernatant fractions. Of note, the toxin TcdA was found in the biofilm matrix. Although the overall proteome differences between the cwp84 mutant and the parental strains were modest, there was still a significant impact on bacterial surface properties such as altered hydrophobicity. In vitro and in vivo competition assays revealed that the mutant was significantly impaired for growth only in the planktonic state, but not in biofilms or in vivo. Taken together, our results suggest that the phenotypes in the cwp84 mutant come from either the accumulation of uncleaved SlpA, or the ability of Cwp84 to cleave as yet undetermined proteins. PMID:25922949

  9. Restricting detergent protease action to surface of protein fibres by chemical modification.

    PubMed

    Schroeder, M; Lenting, H B M; Kandelbauer, A; Silva, C J S M; Cavaco-Paulo, A; Gübitz, G M

    2006-10-01

    Due to their excellent properties, such as thermostability, activity over a broad range of pH and efficient stain removal, proteases from Bacillus sp. are commonly used in the textile industry including industrial processes and laundry and represent one of the most important groups of enzymes. However, due to the action of proteases, severe damage on natural protein fibres such as silk and wool result after washing with detergents containing proteases. To include the benefits of proteases in a wool fibre friendly detergent formulation, the soluble polymer polyethylene glycol (PEG) was covalently attached to a protease from Bacillus licheniformis. In contrast to activation of PEG with cyanuric chloride (50%) activation with 1,1'-carbonyldiimidazole (CDI) lead to activity recovery above 90%. With these modified enzymes, hydrolytic attack on wool fibres could be successfully prevented up to 95% compared to the native enzymes. Colour difference (DeltaE) measured in the three dimensional colour space showed good stain removal properties for the modified enzymes. Furthermore, half-life of the modified enzymes in buffers and commercial detergents solutions was nearly twice as high as those of the non-modified enzymes with values of up to 63 min. Out of the different modified proteases especially the B. licheniformis protease with the 2.0-kDa polymer attached both retained stain removal properties and did not hydrolyse/damage wool fibres.

  10. Optimization of the production of shrimp waste protein hydrolysate using microbial proteases adopting response surface methodology.

    PubMed

    Dey, Satya S; Dora, Krushna Chandra

    2014-01-01

    Protein hydrolysates were produced from shrimp waste mainly comprising head and shell of Penaeus monodon by enzymatic hydrolysis for 90 min using four microbial proteases (Alcalase, Neutrase, Protamex, Flavourzyme) where PR(%) and DH (%) of respective enzymes were compared to select best of the lot. Alcalase, which showed the best result, was used to optimize hydrolysis conditions for shrimp waste hydrolysis by response surface methodology using a central composite design. A model equation was proposed to determine effects of temperature, pH, enzyme/substrate ratio and time on DH where optimum values found to be 59.37 °C, 8.25, 1.84% and 84.42 min. for maximum degree of hydrolysis 33.13% respectively. The model showed a good fit in experimental data because 92.13% of the variability within the range of values studied could be explained by it. The protein hydrolysate obtained contained high protein content (72.3%) and amino acid (529.93 mg/gm) of which essential amino acid and flavour amino acid were was 54.67-55.93% and 39.27-38.32% respectively. Protein efficiency ratio (PER) (2.99) and chemical score (1.05) of hydrolysate was suitable enough to recommend as a functional food additive.

  11. Use of a cloned multidrug resistance gene for coamplification and overproduction of major excreted protein, a transformation-regulated secreted acid protease

    SciTech Connect

    Kane, S.E.; Troen, B.R.; Gal, S.; Ueda, K.; Pastan, I.; Gottesman, M.M.

    1988-08-01

    Malignantly transformed mouse fibroblasts synthesize and secrete large amounts of major excreted protein (MEP), a 39,000-dalton precursor to an acid protease (cathepsin L). To evaluate the possible role of this protease in the transformed phenotype, the authors transfected cloned genes for mouse or human MEP into mouse MIH 3T3 cells with an expression vector for the dominant, selectable human multidrug resistance (MDR1) gene. The cotransfected MEP sequences were efficiently coamplified and transcribed during stepwise selection for multidrug resistance in colchicine. The transfected NIH 3T3 cell lines containing amplified MEP sequences synthesized as much MEP as did Kirsten sarcoma virus-transformed NIH 3T3 cells. The MEP synthesized by cells transfected with the cloned mouse and human MEP genes were also secreted. Elevated synthesis and secretion of MEP by NIH 3T3 cells did not change the nontransformed phenotype of these cells.

  12. The stromal cell-surface protease fibroblast activation protein-α localizes to lipid rafts and is recruited to invadopodia.

    PubMed

    Knopf, Julia D; Tholen, Stefan; Koczorowska, Maria M; De Wever, Olivier; Biniossek, Martin L; Schilling, Oliver

    2015-10-01

    Fibroblast activation protein alpha (FAPα) is a cell surface protease expressed by cancer-associated fibroblasts in the microenvironment of most solid tumors. As there is increasing evidence for proteases having non-catalytic functions, we determined the FAPα interactome in cancer-associated fibroblasts using the quantitative immunoprecipitation combined with knockdown (QUICK) method. Complex formation with adenosin deaminase, erlin-2, stomatin, prohibitin, Thy-1 membrane glycoprotein, and caveolin-1 was further validated by immunoblotting. Co-immunoprecipitation (co-IP) of the known stoichiometric FAPα binding partner dipeptidyl-peptidase IV (DPPIV) corroborated the proteomic strategy. Reverse co-IPs validated the FAPα interaction with caveolin-1, erlin-2, and stomatin while co-IP upon RNA-interference mediated knock-down of DPPIV excluded adenosin deaminase as a direct FAPα interaction partner. Many newly identified FAPα interaction partners localize to lipid rafts, including caveolin-1, a widely-used marker for lipid raft localization. We hypothesized that this indicates a recruitment of FAPα to lipid raft structures. In density gradient centrifugation, FAPα co-fractionates with caveolin-1. Immunofluorescence optical sectioning microscopy of FAPα and lipid raft markers further corroborates recruitment of FAPα to lipid rafts and invadopodia. FAPα is therefore an integral component of stromal lipid rafts in solid tumors. In essence, we provide one of the first interactome analyses of a cell surface protease and translate these results into novel biological aspects of a marker protein for cancer-associated fibroblasts.

  13. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.

    2016-01-01

    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  14. A cluster of basic amino acids in the factor X serine protease mediates surface attachment of adenovirus/FX complexes.

    PubMed

    Duffy, Margaret R; Bradshaw, Angela C; Parker, Alan L; McVey, John H; Baker, Andrew H

    2011-10-01

    Hepatocyte transduction following intravenous administration of adenovirus 5 (Ad5) is mediated by interaction between coagulation factor X (FX) and the hexon. The FX serine protease (SP) domain tethers the Ad5/FX complex to hepatocytes through binding heparan sulfate proteoglycans (HSPGs). Here, we identify the critical HSPG-interacting residues of FX. We generated an FX mutant by modifying seven residues in the SP domain. Surface plasmon resonance demonstrated that mutations did not affect binding to Ad5. FX-mediated, HSPG-associated cell binding and transduction were abolished. A cluster of basic amino acids in the SP domain therefore mediates surface interaction of the Ad/FX complex.

  15. Isolation and expression of the gene for a major surface protein of Giardia lamblia.

    PubMed Central

    Gillin, F D; Hagblom, P; Harwood, J; Aley, S B; Reiner, D S; McCaffery, M; So, M; Guiney, D G

    1990-01-01

    To study the interactions between the parasitic protozoan Giardia lamblia and its environment, we have cloned the gene that encodes the two major surface-labeled trophozoite protein species. Sequence analysis of this gene reveals a single open reading frame specifying a hydrophilic, cysteine-rich (11.8%) protein of 72.5-kDa molecular mass with an amino-terminal signal peptide and a postulated hydrophobic membrane-spanning anchor region near the carboxyl terminus. Most of the cysteine residues (58 of 84) are in the motif Cys-Xaa-Xaa-Cys, which is dispersed 29 times throughout the sequence. Antibodies against the recombinant protein react with the entire surface of live trophozoites, including flagella and adhesive disc. These antibodies inhibit trophozoite attachment, prevent growth, and immunoprecipitate the major approximately 66- and 85-kDa proteins from surface-labeled live trophozoites. The recombinant Escherichia coli also expresses polypeptides of approximately 66- and 85-kDa molecular mass, which are not fusion proteins. This suggests that the processing and/or conformational changes that lead to production of these two peptide species in E. coli reflect those that occur in Giardia. The abundance of cysteine residues suggests that the native proteins on the parasite surface may contain numerous disulfide bonds, which would promote resistance to intestinal fluid proteases and to the detergent activity of bile salts and would help to explain the survival of Giardia in the human small intestine. Images PMID:2352929

  16. Contemporaneous Production of Amylase and Protease through CCD Response Surface Methodology by Newly Isolated Bacillus megaterium Strain B69

    PubMed Central

    Saxena, Rajshree

    2014-01-01

    The enormous increase in world population has resulted in generation of million tons of agricultural wastes. Biotechnological process for production of green chemicals, namely, enzymes, provides the best utilization of these otherwise unutilized wastes. The present study elaborates concomitant production of protease and amylase in solid state fermentation (SSF) by a newly isolated Bacillus megaterium B69, using agroindustrial wastes. Two-level statistical model employing Plackett-Burman and response surface methodology was designed for optimization of various physicochemical conditions affecting the production of two enzymes concomitantly. The studies revealed that the new strain concomitantly produced 1242 U/g of protease and 1666.6 U/g of amylase by best utilizing mustard oilseed cake as the substrate at 20% substrate concentration and 45% moisture content after 84 h of incubation. An increase of 2.95- and 2.04-fold from basal media was observed in protease and amylase production, respectively. ANOVA of both the design models showed high accuracy of the polynomial model with significant similarities between the predicted and the observed results. The model stood accurate at the bench level validation, suggesting that the design model could be used for multienzyme production at mass scale. PMID:25478211

  17. Contemporaneous Production of Amylase and Protease through CCD Response Surface Methodology by Newly Isolated Bacillus megaterium Strain B69.

    PubMed

    Saxena, Rajshree; Singh, Rajni

    2014-01-01

    The enormous increase in world population has resulted in generation of million tons of agricultural wastes. Biotechnological process for production of green chemicals, namely, enzymes, provides the best utilization of these otherwise unutilized wastes. The present study elaborates concomitant production of protease and amylase in solid state fermentation (SSF) by a newly isolated Bacillus megaterium B69, using agroindustrial wastes. Two-level statistical model employing Plackett-Burman and response surface methodology was designed for optimization of various physicochemical conditions affecting the production of two enzymes concomitantly. The studies revealed that the new strain concomitantly produced 1242 U/g of protease and 1666.6 U/g of amylase by best utilizing mustard oilseed cake as the substrate at 20% substrate concentration and 45% moisture content after 84 h of incubation. An increase of 2.95- and 2.04-fold from basal media was observed in protease and amylase production, respectively. ANOVA of both the design models showed high accuracy of the polynomial model with significant similarities between the predicted and the observed results. The model stood accurate at the bench level validation, suggesting that the design model could be used for multienzyme production at mass scale.

  18. Phosphorylation of the type II transmembrane serine protease, TMPRSS13, in hepatocyte growth factor activator inhibitor-1 and -2-mediated cell-surface localization.

    PubMed

    Murray, Andrew S; Varela, Fausto A; Hyland, Thomas E; Schoenbeck, Andrew J; White, Jordan M; Tanabe, Lauren M; Todi, Sokol V; List, Karin

    2017-09-08

    TMPRSS13 is a member of the type II transmembrane serine protease (TTSP) family. Although various TTSPs have been characterized in detail biochemically and functionally, the basic properties of TMPRSS13 remain unclear. Here, we investigate the activation, inhibition, post-translational modification, and localization of TMPRSS13. We show that TMPRSS13 is a glycosylated, active protease and that its own proteolytic activity mediates zymogen cleavage. Full-length, active TMPRSS13 exhibits impaired cell-surface expression in the absence of the cognate Kunitz-type serine protease inhibitors, hepatocyte growth factor activator inhibitor (HAI)-1 or HAI-2. Concomitant presence of TMPRSS13 with either HAI-1 or -2 mediates phosphorylation of residues in the intracellular domain of the protease, and it coincides with efficient transport of the protease to the cell surface and its subsequent shedding. Cell-surface labeling experiments indicate that the dominant form of TMPRSS13 on the cell surface is phosphorylated, whereas intracellular TMPRSS13 is predominantly non-phosphorylated. These data provide novel insight into the cellular properties of TMPRSS13 and highlight phosphorylation of TMPRSS13 as a novel post-translational modification of this TTSP family member and potentially other members of this family of proteases. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Biodegradation of shrimp biowaste by marine Exiguobacterium sp. CFR26M and concomitant production of extracellular protease and antioxidant materials: production and process optimization by response surface methodology.

    PubMed

    Anil Kumar, P K; Suresh, P V

    2014-04-01

    Twelve marine bacterial cultures were screened for extracellular protease activity, and the bacterium CFR26M which exhibited the highest activity on caseinate agar plate was identified as an Exiguobacterium sp. Significant amount of extracellular protease (5.9 ± 0.3 U/ml) and antioxidant materials, measured as 2,2'-diphenyl picrylhydrazyl (DPPH) radical scavenging activity (44.4 ± 0.5 %), was produced by CFR26M in submerged fermentation using a shrimp biowaste medium. Response surface methodology (RSM) was employed to optimize the process variables for maximum production of protease and antioxidant materials by CFR26M. Among the seven variables screened by two-level 2**(7-2) fractional factorial design, the concentration of shrimp biowaste, sugar, and phosphate was found to be significant (p ≤ 0.05). The optimum levels of these variables were determined by employing the central composite design (CCD) of RSM. The coefficient of determination (R (2)) values of 0.9039 and 0.8924 for protease and antioxidant, respectively, indicates the accuracy of the CCD models. The optimum levels of shrimp biowaste, sugar, and phosphate were 21.2, 10.5, and 2.3 % (w/v) for production of protease and 28.8, 12, and 0.32 % (w/v) for production of antioxidant material, respectively. The concentration of shrimp biowaste, sugar, and phosphate had linear and quadratic effect on both protease and antioxidant productions. RSM optimization yielded 6.3-fold increases in protease activity and 1.6-fold in antioxidant material production. The crude protease of CFR26M had a maximum activity at 32 ± 2 °C with pH 7.6. This is the first report on the use of marine Exiguobacterium sp. for concomitant production of protease and antioxidant materials from shrimp biowaste.

  20. Optimization of protease production from surface-modified coffee pulp waste and corncobs using Bacillus sp. by SSF.

    PubMed

    Kandasamy, Selvam; Muthusamy, Govarthanan; Balakrishnan, Senthilkumar; Duraisamy, Senbagam; Thangasamy, Selvankumar; Seralathan, Kamala-Kannan; Chinnappan, Sudhakar

    2016-12-01

    The aim of the study was to identify new sources of substrate from agro-industrial waste for protease production using Bacillus sp., a local bacteria isolated from an agro-waste dumping site. The strain was identified as Bacillus sp. BT MASC 3 by 16S rRNA sequence followed by phylogenic analysis. Response surface methodology-based Box-Behnken design (BBD) was used to optimize the variables such as pH, incubation time, coffee pulp waste (CPW) and corncob (CC) substrate concentration. The BBD design showed a reasonable adjustment of the quadratic model with the experimental data. Statistics-based contour and 3-D plots were generated to evaluate the changes in the response surface and understand the relationship between the culture conditions and the enzyme yield. The maximum yield of protease production (920 U/mL) was achieved after 60 h of incubation with 3.0 g/L of CPW and 2.0 g/L of CC at pH 8 and temperature 37 °C in this study. The molecular mass of the purified enzyme was 46 kDa. The highest activity was obtained at 50 °C and pH 9 for the purified enzymes.

  1. The Folding Free Energy Surface of HIV-1 Protease: Insights into the Thermodynamic Basis for Resistance to Inhibitors

    PubMed Central

    Noel, Amanda F.; Bilsel, Osman; Kundu, Agnita; Wu, Ying; Zitzewitz, Jill A.; Matthews, C. Robert

    2009-01-01

    Spontaneous mutations at numerous sites distant from the active site of HIV-1 protease enable resistance to inhibitors while retaining enzymatic activity. As a benchmark for probing the effects of these mutations on the conformational adaptability of this dimeric β-barrel protein, the folding free energy surface of a pseudo wild-type variant, HIV-PR*, was determined by a combination of equilibrium and kinetic experiments on the urea-induced unfolding/refolding reactions. The equilibrium unfolding reaction was well-described by a two-state model involving only the native dimeric form and the unfolded monomer. The global analysis of the kinetic folding mechanism reveals the presence of a fully-folded monomeric intermediate that associates to form the native dimeric structure. Independent analysis of a stable monomeric version of the protease demonstrated that a small amplitude fluorescence phase in refolding and unfolding, not included in the global analysis of the dimeric protein, reflects the presence of a transient intermediate in the monomer folding reaction. The partially-folded and fully-folded monomers are only marginally stable with respect to the unfolded state, and the dimerization reaction provides a modest driving force at micromolar concentrations of protein. The thermodynamic properties of this system are such that mutations can readily shift the equilibrium from the dimeric native state towards weakly-folded states that have a lower affinity for inhibitors, but that could be induced to bind to their target proteolytic sites. Presumably, subsequent secondary mutations increase the stability of the native dimeric state in these variants and, thereby, optimize the catalytic properties of the resistant HIV-1 protease. PMID:19150359

  2. Vacuolar Serine Protease Is a Major Allergen of Fusarium proliferatum and an IgE-Cross Reactive Pan-Fungal Allergen

    PubMed Central

    Yeh, Chang-Ching; Tai, Hsiao-Yun; Chou, Hong; Wu, Keh-Gong

    2016-01-01

    Purpose Fusarium species are among prevalent airborne fungi and causative agents of human respiratory atopic disorders. We previously identified a 36.5-kDa F. proliferatum component recognized by IgE antibodies in 9 (53%) of the 17 F. proliferatum-sensitized atopic serum samples. The purpose of this study is to characterize the 36.5-kDa allergen of F. proliferatum. Methods Characterization of allergens and determination of IgE cross-reactivity were performed by cDNA cloning/expression and immunoblot inhibition studies. Results Based on the finding that the 36.5-kDa IgE-binding component reacted with the mouse monoclonal antibody FUM20 against fungal vacuolar serine protease allergens, the cDNA of F. proliferatum vacuolar serine protease (Fus p 9.0101) was subsequently cloned. Nine serum samples from respiratory atopic patients with IgE binding to the vacuolar serine protease allergen of Penicillium chrysogenum (Pen ch 18) also showed IgE-immunoblot reactivity to rFus p 9.0101. The purified rFus p 9.0101 can inhibit IgE and FUM20 binding to the 36.5-kDa component of F. proliferatum. Thus, a novel and important Fus p 9.0101 was identified. The rPen ch 18 can inhibit IgE binding to Fus p 9.0101. It indicates that IgE cross-reactivity between Fus p 9.0101 and Pen ch 18 also exists. Furthermore, neither rFus p 9.0101 K88A nor rPen ch 18 K89A mutants inhibited IgE binding to rFus p 9.0101. Lys88 was considered a critical core amino acid in IgE binding to r Fus p 9.0101 and a residue responsible for IgE cross-reactivity between Fus p 9.0101 and Pen ch 18 allergens. Conclusions Results obtained from this study indicate that vacuolar serine protease may be a major allergen of F. proliferatum and an important IgE cross-reactive pan-fungal allergen, and provide important bases for clinical diagnosis of fungal allergy. PMID:27334782

  3. Cell surface serine protease matriptase-2 suppresses fetuin-A/AHSG-mediated induction of hepcidin.

    PubMed

    Stirnberg, Marit; Maurer, Eva; Arenz, Katharina; Babler, Anne; Jahnen-Dechent, Willi; Gütschow, Michael

    2015-01-01

    Matriptase-2 is a type II transmembrane serine protease controlling the expression of hepcidin, the key regulator of iron homeostasis. By cleaving hemojuvelin, matriptase-2 suppresses bone morphogenetic protein/sons of mothers against decapentaplegic signaling. So far, the only known putative substrates of matriptase-2 are hemojuvelin and matriptase-2 itself. In this study, fetuin-A (α2-Heremans-Schmid glycoprotein) was identified in vitro as a substrate of matriptase-2. The protease-substrate interaction was validated by isolating matriptase-2 via the affinity to fetuin-A. Fetuin-A is a liver-derived plasma protein with multiple functions, which is proteolytically processed to yield a disulfide-linked two-chain form. In co-transfected cells, a matriptase-2-dependent conversion of unprocessed fetuin-A into a two-chain form was detected. Conversely, downregulation of endogenously expressed matriptase-2 stabilized fetuin-A. Arg and Lys residues located within the 40 residue spanning connecting peptide of fetuin-A were identified as cleavage sites for matriptase-2. Analysis of hepcidin expression revealed an inductive effect of fetuin-A, which was abolished by matriptase-2. Fetuin-A deficiency in mice resulted in decreased hepcidin mRNA levels. These findings implicate a role of fetuin-A in iron homeostasis and provide new insights into the mechanism of how matriptase-2 might modulate hepcidin expression.

  4. Control of Entamoeba histolytica adherence involves metallosurface protease 1, an M8 family surface metalloprotease with homology to leishmanolysin.

    PubMed

    Teixeira, Jose E; Sateriale, Adam; Bessoff, Kovi E; Huston, Christopher D

    2012-06-01

    Invasive amebiasis due to Entamoeba histolytica infection is an important cause of morbidity in developing countries. The E. histolytica genome contains two homologues to the metalloprotease leishmanolysin gene, Entamoeba histolytica MSP-1 (EhMSP-1) and EhMSP-2, while the commensal ameba Entamoeba dispar has lost EhMSP-1. In this study, we sought to characterize E. histolytica metallosurface protease 1 (EhMSP-1). Using immunoprecipitation and a model substrate, we found that EhMSP-1 was a functional metalloprotease. Confocal microscopy and flow cytometry revealed that EhMSP-1 localized to the cell surface and revealed the existence of distinct, nonclonal trophozoite populations with high and low EhMSP-1 surface abundance that became synchronized following serum starvation. Phenotypic assays were performed after silencing EhMSP-1. Adherence of EhMSP-1-deficient trophozoites to tissue culture cell monolayers was more than five times greater than that of control amebas, but surface staining of several antigens, including the galactose adherence lectin, was unchanged. EhMSP-1 silencing similarly increased adherence to both viable and apoptotic Jurkat lymphocytes. Tissue culture cell monolayer destruction was reduced by EhMSP-1 silencing, although it was blocked almost completely by inhibiting cysteine proteases. Consistent with a primary defect in regulation of amebic adherence, EhMSP-1 silencing also resulted in reduced mobility on tissue culture cell monolayers and in increased phagocytosis. In conclusion, EhMSP-1 was shown to be a surface metalloprotease involved in regulation of amebic adherence, with additional effects on cell motility, cell monolayer destruction, and phagocytosis.

  5. Plasmodium falciparum subtilisin-like protease 2, a merozoite candidate for the merozoite surface protein 1–42 maturase

    PubMed Central

    Barale, Jean-Christophe; Blisnick, Thierry; Fujioka, Hisashi; Alzari, Pedro M.; Aikawa, Masamishi; Braun-Breton, Catherine; Langsley, Gordon

    1999-01-01

    The process of human erythrocyte invasion by Plasmodium falciparum parasites involves a calcium-dependent serine protease with properties consistent with a subtilisin-like activity. This enzyme achieves the last crucial maturation step of merozoite surface protein 1 (MSP1) necessary for parasite entry into the host erythrocyte. In eukaryotic cells, such processing steps are performed by subtilisin-like maturases, known as proprotein convertases. In an attempt to characterize the MSP1 maturase, we have identified a gene that encodes a P. falciparum subtilisin-like protease (PfSUB2) whose deduced active site sequence resembles more bacterial subtilisins. Therefore, we propose that PfSUB2 belongs to a subclass of eukaryotic subtilisins different from proprotein convertases. Pfsub2 is expressed during merozoite differentiation and encodes an integral membrane protein localized in the merozoite dense granules, a secretory organelle whose contents are believed to participate in a late step of the erythrocyte invasion. PfSUB2’s subcellular localization, together with its predicted enzymatic properties, leads us to propose that PfSUB2 could be responsible for the late MSP1 maturation step and thus is an attractive target for the development of new antimalarial drugs. PMID:10339607

  6. Partial characterization of a protease inhibitor which inhibits the major endopeptidase present in the cotyledons of mung beans.

    PubMed

    Baumgartner, B; Chrispeels, M J

    1976-07-01

    Germination of mung beans (Phaseolus aureus, Roxb.) is accompanied by an increase in the activity of the endopeptidase involved in storage protein metabolism. Enzyme activity in the cotyledons increases 25-fold during the first 5 days of germination. The cotyledons also contain inhibitory activity against the endopeptidase, and this inhibitory activity declines during germination, suggesting that inhibitors may play a role in regulating the activity of the endopeptidase.The inhibitory activity against the mung bean endopeptidase is due to the presence of two inhibitors which can be separated by chromatography on Sephadex G-100. The two inhibitors have approximate molecular weights of 12,000 and smaller than 2,000 daltons. The large inhibitor coelutes with trypsin inhibitor on Sephadex G-100, but these two inhibitory activities can be separated by means of a trypsin affinity column.The inhibitory activity disappears slowly from crude extracts incubated at 6 C and more rapidly when the extracts are incubated at 25 C or 37 C. The disappearance of inhibitory activity is accompanied by a rise of the endopeptidase activity, but an examination of the kinetics of these two phenomena suggests that they are not causally related. Fractionation of the cellular organelles on sucrose gradients shows that the inhibitory activity is not associated with the protein bodies, but rather with the cytosol. Our results suggest that the endopeptidase inhibitor(s) does not regulate the increase in endopeptidase activity which accompanies germination or the metabolism of storage protein. We, therefore, postulate that the inhibitor(s) may function in protecting the cytoplasm from accidental rupturing of the protease-containing protein bodies.

  7. Invited review: Breaking barriers--attack on innate immune defences by omptin surface proteases of enterobacterial pathogens.

    PubMed

    Haiko, Johanna; Suomalainen, Marjo; Ojala, Teija; Lähteenmäki, Kaarina; Korhonen, Timo K

    2009-04-01

    The omptin family of Gram-negative bacterial transmembrane aspartic proteases comprises surface proteins with a highly conserved beta-barrel fold but differing biological functions. The omptins OmpT of Escherichia coli, PgtE of Salmonella enterica, and Pla of Yersinia pestis differ in their substrate specificity as well as in control of their expression. Their functional differences are in accordance with the differing pathogenesis of the infections caused by E. coli, Salmonella, and Y. pestis, which suggests that the omptins have adapted to the life-styles of their host species. The omptins Pla and PgtE attack on innate immunity by affecting the plasminogen/plasmin, complement, coagulation, fibrinolysis, and matrix metalloproteinase systems, by inactivating antimicrobial peptides, and by enhancing bacterial adhesiveness and invasiveness. Although the mechanistic details of the functions of Pla and PgtE differ, the outcome is the same: enhanced spread and multiplication of Y. pestis and S. enterica in the host. The omptin OmpT is basically a housekeeping protease but it also degrades cationic antimicrobial peptides and may enhance colonization of E. coli at uroepithelia. The catalytic residues in the omptin molecules are spatially conserved, and the differing polypeptide substrate specificities are dictated by minor sequence variations at regions surrounding the catalytic cleft. For enzymatic activity, omptins require association with lipopolysaccharide on the outer membrane. Modification of lipopolysaccharide by in vivo conditions or by bacterial gene loss has an impact on omptin function. Creation of bacterial surface proteolysis is thus a coordinated function involving several surface structures.

  8. Surface Vulnerability of Cerebral Cortex to Major Depressive Disorder

    PubMed Central

    Li, Gang; Fralick, Drew; Shen, Ting; Qiu, Meihui; Liu, Jun; Jiang, Kaida; Shen, Dinggang; Fang, Yiru

    2015-01-01

    Major depressive disorder (MDD) is accompanied by atypical brain structure. This study first presents the alterations in the cortical surface of patients with MDD using multidimensional structural patterns that reflect different neurodevelopment. Sixteen first-episode, untreated patients with MDD and 16 matched healthy controls underwent a magnetic resonance imaging (MRI) scan. The cortical maps of thickness, surface area, and gyrification were examined using the surface-based morphometry (SBM) approach. Increase of cortical thickness was observed in the right posterior cingulate region and the parietal cortex involving the bilateral inferior, left superior parietal and right paracentral regions, while decreased thickness was noted in the parietal cortex including bilateral pars opercularis and left precentral region, as well as the left rostral-middle frontal regions in patients with MDD. Likewise, increased or decreased surface area was found in five sub-regions of the cingulate gyrus, parietal and frontal cortices (e.g., bilateral inferior parietal and superior frontal regions). In addition, MDD patients exhibited a significant hypergyrification in the right precentral and supramarginal region. This integrated structural assessment of cortical surface suggests that MDD patients have cortical alterations of the frontal, parietal and cingulate regions, indicating a vulnerability to MDD during earlier neurodevelopmental process. PMID:25793287

  9. Identification of Major Outer Surface Proteins of Streptococcus agalactiae

    PubMed Central

    Hughes, Martin J. G.; Moore, Joanne C.; Lane, Jonathan D.; Wilson, Rebecca; Pribul, Philippa K.; Younes, Zabin N.; Dobson, Richard J.; Everest, Paul; Reason, Andrew J.; Redfern, Joanne M.; Greer, Fiona M.; Paxton, Thanai; Panico, Maria; Morris, Howard R.; Feldman, Robert G.; Santangelo, Joseph D.

    2002-01-01

    To identify the major outer surface proteins of Streptococcus agalactiae (group B streptococcus), a proteomic analysis was undertaken. An extract of the outer surface proteins was separated by two-dimensional electrophoresis. The visualized spots were identified through a combination of peptide sequencing and reverse genetic methodologies. Of the 30 major spots identified as S. agalactiae specific, 27 have been identified. Six of these proteins, previously unidentified in S. agalactiae, were sequenced and cloned. These were ornithine carbamoyltransferase, phosphoglycerate kinase, nonphosphorylating glyceraldehyde-3-phosphate dehydrogenase, purine nucleoside phosphorylase, enolase, and glucose-6-phosphate isomerase. Using a gram-positive expression system, we have overexpressed two of these proteins in an in vitro system. These recombinant, purified proteins were used to raise antisera. The identification of these proteins as residing on the outer surface was confirmed by the ability of the antisera to react against whole, live bacteria. Further, in a neonatal-animal model system, we demonstrate that some of these sera are protective against lethal doses of bacteria. These studies demonstrate the successful application of proteomics as a technique for identifying vaccine candidates. PMID:11854208

  10. Variation in the Major Surface Glycoprotein Genes in Pneumocystis jirovecii

    PubMed Central

    Kutty, Geetha; Maldarelli, Frank; Achaz, Guillaume; Kovacs, Joseph A.

    2008-01-01

    The genome of Pneumocystis, which causes life-threatening pneumonia in immunosuppressed patients, contains a multi-copy gene family that encodes the major surface glycoprotein (Msg). Pneumocystis can vary the expressed Msg, presumably as a mechanism to avoid host immune responses. Analysis of 24 msg gene sequences obtained from a single human Pneumocystis isolate demonstrated that the sequences segregate into two branches. Based on a number of analyses, recombination among msg genes appears to be an important mechanism for generating msg diversity. Intra-branch recombination occurred more frequently than inter-branch recombination. Restriction fragment length polymorphism analysis demonstrated substantial variation in the repertoire of the msg gene family among isolates of human Pneumocystis, which was not observed in laboratory isolates of rat or mouse Pneumocystis; this may be the result of examining outbred vs. captive populations. Increased diversity in the Msg repertoire, generated in part by recombination, increases the potential for antigenic variation in this abundant surface protein. PMID:18627244

  11. The role of electrostatic interactions in protease surface diffusion and the consequence for interfacial biocatalysis.

    PubMed

    Feller, Bob E; Kellis, James T; Cascão-Pereira, Luis G; Robertson, Channing R; Frank, Curtis W

    2010-12-21

    This study examines the influence of electrostatic interactions on enzyme surface diffusion and the contribution of diffusion to interfacial biocatalysis. Surface diffusion, adsorption, and reaction were investigated on an immobilized bovine serum albumin (BSA) multilayer substrate over a range of solution ionic strength values. Interfacial charge of the enzyme and substrate surface was maintained by performing the measurements at a fixed pH; therefore, electrostatic interactions were manipulated by changing the ionic strength. The interfacial processes were investigated using a combination of techniques: fluorescence recovery after photobleaching, surface plasmon resonance, and surface plasmon fluorescence spectroscopy. We used an enzyme charge ladder with a net charge ranging from -2 to +4 with respect to the parent to systematically probe the contribution of electrostatics in interfacial enzyme biocatalysis on a charged substrate. The correlation between reaction rate and adsorption was determined for each charge variant within the ladder, each of which displayed a maximum rate at an intermediate surface concentration. Both the maximum reaction rate and adsorption value at which this maximum rate occurs increased in magnitude for the more positive variants. In addition, the specific enzyme activity increased as the level of adsorption decreased, and for the lowest adsorption values, the specific enzyme activity was enhanced compared to the trend at higher surface concentrations. At a fixed level of adsorption, the specific enzyme activity increased with positive enzyme charge; however, this effect offers diminishing returns as the enzyme becomes more highly charged. We examined the effect of electrostatic interactions on surface diffusion. As the binding affinity was reduced by increasing the solution ionic strength, thus weakening electrostatic interaction, the rate of surface diffusion increased considerably. The enhancement in specific activity achieved at

  12. Analysis of surface structures of major strike-slip faults

    NASA Astrophysics Data System (ADS)

    Hsieh, Shang Yu; Neubauer, Franz

    2013-04-01

    Strike-slip faults commonly appear with complex fractures and deformation structures on the surface, which also reveal the 3-D geometry with variable structures at depth. The aim of our study is finding the systematic features and correlations of various surface expressions including width, length, height and angle (to the main fault trace) of individual structures like pressure ridges, sag ponds, riedel and anti-riedel faults and oversteps, and also doing a classification with these data. The variation might by caused by distinct convergence angles along strike-slip fault. We study the above mentioned properties on Altyn Tagh fault (ATF), Kunlun, San Andrea and Greendale (Darfield earthquake) faults, which are large strike-slip tectonic structures accommodating major displacement along plate boundaries. Especially the recent events of 2001 Kunlun earthquake and 2010 Darfield earthquake allow a detailed study of structures formed by a single earthquake. Along the fault valley of a 610 km segment of ATF, many large-scale pressure ridges, few pressure basins and horizontal offsets of wadi channels were found; similarly, around 20 features with large scale pressure ridges and pressure basins are found in Carrizo Plain of San Andreas fault. Surface ruptures are uncommon, and dominated by anti-riedels in the case of the Altyn fault. Interpretations show the range of length, width and height in pressure ridges located between 150 and ~6400 m, 35 and ~800 m, and 1 to ~80 m, respectively, along ATF and 255 to ~5750 m, 33 to ~800 m, 2 to ~65 m in Carrizo plain of San Andreas fault. These parameters exhibit a good correlation among each other implying a common cause. Compared with these two strike-slip faults, fault valley portions of the Greendale and Kunlun faults show more surface ruptures for instance riedel shears and anti-riedel structures, which have been caused by the last major earthquake, and also the scale of deformations along the ATF and San Andreas fault is

  13. Antibodies inhibit the protease-mediated processing of a malaria merozoite surface protein

    PubMed Central

    1994-01-01

    When merozoites of the malaria parasite Plasmodium falciparum are released from infected erythrocytes and invade new red cells, a component of a protein complex derived from the merozoite surface protein 1 (MSP-1) precursor undergoes a single proteolytic cleavage known as secondary processing. This releases the complex from the parasite surface, except for a small membrane-bound fragment consisting of two epidermal growth factor (EGF)-like domains, which is the only part of MSP-1 to be carried into invaded erythrocytes. We report that, a group of monoclonal antibodies specific for epitopes within the EGF- like domains, some interfere with secondary processing whereas others do not. Those that most effectively inhibit processing have previously been shown to prevent invasion. Other antibodies, some of which can block this inhibition, not only do not prevent invasion but are carried into the host cell bound to the merozoite surface. These observations unequivocally demonstrate that the binding of antibody to the COOH- terminal region of MSP-1 on the merozoite surface may not be sufficient to prevent erythrocyte invasion, and show that the interaction of different antibodies with adjacent epitopes within the EGF-like domains of MSP-1 can have distinct biochemical effects on the molecule. Inhibition of MSP-1 processing on merozoites may be a mechanism by which protective antibodies interrupt the asexual cycle of the malaria parasite. PMID:7516416

  14. Protease signalling: the cutting edge

    PubMed Central

    Turk, Boris; Turk, Dus̆an; Turk, Vito

    2012-01-01

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research. PMID:22367392

  15. Protease signalling: the cutting edge.

    PubMed

    Turk, Boris; Turk, Dušan; Turk, Vito

    2012-04-04

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research.

  16. Identifying binding hot spots on protein surfaces by mixed-solvent molecular dynamics: HIV-1 protease as a test case.

    PubMed

    Ung, Peter M U; Ghanakota, Phani; Graham, Sarah E; Lexa, Katrina W; Carlson, Heather A

    2016-01-01

    Mixed-solvent molecular dynamics (MixMD) simulations use full protein flexibility and competition between water and small organic probes to achieve accurate hot-spot mapping on protein surfaces. In this study, we improved MixMD using human immunodeficiency virus type-1 protease (HIVp) as the test case. We used three probe-water solutions (acetonitrile-water, isopropanol-water, and pyrimidine-water), first at 50% w/w concentration and later at 5% v/v. Paradoxically, better mapping was achieved by using fewer probes; 5% simulations gave a superior signal-to-noise ratio and far fewer spurious hot spots than 50% MixMD. Furthermore, very intense and well-defined probe occupancies were observed in the catalytic site and potential allosteric sites that have been confirmed experimentally. The Eye site, an allosteric site underneath the flap of HIVp, has been confirmed by the presence of a 5-nitroindole fragment in a crystal structure. MixMD also mapped two additional hot spots: the Exo site (between the Gly16-Gly17 and Cys67-Gly68 loops) and the Face site (between Glu21-Ala22 and Val84-Ile85 loops). The Exo site was observed to overlap with crystallographic additives such as acetate and dimethyl sulfoxide that are present in different crystal forms of the protein. Analysis of crystal structures of HIVp in different symmetry groups has shown that some surface sites are common interfaces for crystal contacts, which means that they are surfaces that are relatively easy to desolvate and complement with organic molecules. MixMD should identify these sites; in fact, their occupancy values help establish a solid cut-off where "druggable" sites are required to have higher occupancies than the crystal-packing faces.

  17. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  18. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  19. Regulation of cell surface protease matriptase by HAI2 is essential for placental development, neural tube closure and embryonic survival in mice.

    PubMed

    Szabo, Roman; Hobson, John P; Christoph, Kristina; Kosa, Peter; List, Karin; Bugge, Thomas H

    2009-08-01

    Hypomorphic mutations in the human SPINT2 gene cause a broad spectrum of abnormalities in organogenesis, including organ and digit duplications, atresia, fistulas, hypertelorism, cleft palate and hamartoma. SPINT2 encodes the transmembrane serine protease inhibitor HAI2 (placental bikunin), and the severe developmental effects of decreased HAI2 activity can be hypothesized to be a consequence of excess pericellular proteolytic activity. Indeed, we show here that HAI2 is a potent regulator of protease-guided cellular responses, including motogenic activity and transepithelial resistance of epithelial monolayers. Furthermore, we show that inhibition of the transmembrane serine protease matriptase (encoded by St14) is an essential function of HAI2 during tissue morphogenesis. Genetic inactivation of the mouse Spint2 gene led to defects in neural tube closure, abnormal placental labyrinth development associated with loss of epithelial cell polarity, and embryonic demise. Developmental defects observed in HAI2-deficient mice were caused by unregulated matriptase activity, as both placental development and embryonic survival in HAI2-deficient embryos were completely restored by the simultaneous genetic inactivation of matriptase. However, neural tube defects were detected in HAI2-deficient mice even in the absence of matriptase, although at lower frequency, indicating that the inhibition of additional serine protease(s) by HAI2 is required to complete neural development. Finally, by genetic complementation analysis, we uncovered a unique and complex functional interaction between HAI2 and the related HAI1 in the regulation of matriptase activity during development. This study indicates that unregulated matriptase-dependent cell surface proteolysis can cause a diverse array of abnormalities in mammalian development.

  20. Response surface optimization of enzymatic hydrolysis of duck blood corpuscle using commercial proteases.

    PubMed

    Zheng, Zhaojun; Huang, Yan; Wu, Rujuan; Zhao, Longmei; Wang, Chunfeng; Zhang, Rijun

    2014-10-01

    With the rapid development in livestock and poultry husbandry and increasing shortage of protein sources, recycling of wastes from agricultural and food processing such as blood corpuscles has been regarded as an important industrial procedure to obtain protein sources. This study aimed to find an appropriate method for recycling the considerable amounts of blood corpuscle so as to improve its nutritional value and organoleptic quality. An effective production process for enzymatic hydrolysis of duck blood corpuscle was successfully developed and optimized by response surface methodology. Optimal conditions based on achieving a high value of trichloroacetic acid solubility index were substrate concentration of 14 g/100 mL, temperature 51°C, initial pH 7.0, and time 7.5 h. The electrophoretic patterns of the protein hydrolysate were investigated, and a large diffuse band was observed in the vicinity of 5 kDa. The organoleptic quality of spray-dried blood corpuscle hydrolysate was also evaluated, indicating that enzymatic hydrolysis and decoloration methods were feasible and cost-effective to achieve the desirable bright yellow product without bitterness. In vitro protein digestibility of blood corpuscle hydrolysate was 96.32 ± 0.50%, which was better than that of soybean, fish meal, and casein. Based on the amino acid composition and nutritional parameters, we found that the spray-dried blood corpuscle hydrolysate had abundant nutritional value and high potential for application as an ingredient in nonruminant animal feed. ©2014 Poultry Science Association Inc.

  1. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  2. Production of a protease inhibitor from edible mushroom Agaricus bisporus and its statistical optimization by response surface methodology.

    PubMed

    Vishvakarma, Reena; Mishra, Abha

    2017-01-31

    The production of a protease inhibitor from Agaricus bisporus through solid state fermentation was studied. The purpose was to produce protease inhibitor from natural, cheap and readily available carbon and nitrogen sources. Solid state fermentation enhanced the mycelia growth and also gave a higher yield of the product. Further, fungal growth and other production parameters were statistically optimized. The specificity of the inhibitor was tested and was effective against trypsin. Screening of significant factors (wheat bran, cyanobacterial biomass, initial pH, temperature, incubation period, and moisture content and inoculum size) was done using Plackett-Burman Design. Central Composite Design was used to determine the optimized values of the significant variables which were found to be temperature (27.5 °C), incubation time (156 hrs.), cyanobacterial biomass (1 g) and moisture content (50%) and gave a statistical yield of 980 PIU/g which was 25.6% higher than experimental yield (780 PIU/g). The inhibitor was purified by ammonium sulphate precipitation and DEAE cellulose chromatography (yield 43.89% and 0.21% respectively) and subjected to Reversed-phase HPLC to validate its identity. Since protease inhibitors act against proteases, finding ample therapeutic roles; the isolated protease inhibitor from A. bisporus can also be a probable medicinal agent after its further characterization.

  3. Approach toward enhancement of halophilic protease production by Halobacterium sp. strain LBU50301 using statistical design response surface methodology.

    PubMed

    Chuprom, Julalak; Bovornreungroj, Preeyanuch; Ahmad, Mehraj; Kantachote, Duangporn; Dueramae, Sawitree

    2016-06-01

    A new potent halophilic protease producer, Halobacterium sp. strain LBU50301 was isolated from salt-fermented fish samples (budu) and identified by phenotypic analysis, and 16S rDNA gene sequencing. Thereafter, sequential statistical strategy was used to optimize halophilic protease production from Halobacterium sp. strain LBU50301 by shake-flask fermentation. The classical one-factor-at-a-time (OFAT) approach determined gelatin was the best nitrogen source. Based on Plackett-Burman (PB) experimental design; gelatin, MgSO4·7H2O, NaCl and pH significantly influenced the halophilic protease production. Central composite design (CCD) determined the optimum level of medium components. Subsequently, an 8.78-fold increase in corresponding halophilic protease yield (156.22 U/mL) was obtained, compared with that produced in the original medium (17.80 U/mL). Validation experiments proved the adequacy and accuracy of model, and the results showed the predicted value agreed well with the experimental values. An overall 13-fold increase in halophilic protease yield was achieved using a 3 L laboratory fermenter and optimized medium (231.33 U/mL).

  4. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  5. Giardia duodenalis Surface Cysteine Proteases Induce Cleavage of the Intestinal Epithelial Cytoskeletal Protein Villin via Myosin Light Chain Kinase

    PubMed Central

    Bhargava, Amol; Cotton, James A.; Dixon, Brent R.; Gedamu, Lashitew; Yates, Robin M.; Buret, Andre G.

    2015-01-01

    Giardia duodenalis infections are among the most common causes of waterborne diarrhoeal disease worldwide. At the height of infection, G. duodenalis trophozoites induce multiple pathophysiological processes within intestinal epithelial cells that contribute to the development of diarrhoeal disease. To date, our understanding of pathophysiological processes in giardiasis remains incompletely understood. The present study reveals a previously unappreciated role for G. duodenalis cathepsin cysteine proteases in intestinal epithelial pathophysiological processes that occur during giardiasis. Experiments first established that Giardia trophozoites indeed produce cathepsin B and L in strain-dependent fashion. Co-incubation of G. duodenalis with human enterocytes enhanced cathepsin production by Assemblage A (NF and S2 isolates) trophozoites, but not when epithelial cells were exposed to Assemblage B (GSM isolate) trophozoites. Direct contact between G. duodenalis parasites and human intestinal epithelial monolayers resulted in the degradation and redistribution of the intestinal epithelial cytoskeletal protein villin; these effects were abolished when parasite cathepsin cysteine proteases were inhibited. Interestingly, inhibition of parasite proteases did not prevent degradation of the intestinal tight junction-associated protein zonula occludens 1 (ZO-1), suggesting that G. duodenalis induces multiple pathophysiological processes within intestinal epithelial cells. Finally, this study demonstrates that G. duodenalis-mediated disruption of villin is, at least, in part dependent on activation of myosin light chain kinase (MLCK). Taken together, this study indicates a novel role for parasite cathepsin cysteine proteases in the pathophysiology of G. duodenalis infections. PMID:26334299

  6. Giardia duodenalis Surface Cysteine Proteases Induce Cleavage of the Intestinal Epithelial Cytoskeletal Protein Villin via Myosin Light Chain Kinase.

    PubMed

    Bhargava, Amol; Cotton, James A; Dixon, Brent R; Gedamu, Lashitew; Yates, Robin M; Buret, Andre G

    2015-01-01

    Giardia duodenalis infections are among the most common causes of waterborne diarrhoeal disease worldwide. At the height of infection, G. duodenalis trophozoites induce multiple pathophysiological processes within intestinal epithelial cells that contribute to the development of diarrhoeal disease. To date, our understanding of pathophysiological processes in giardiasis remains incompletely understood. The present study reveals a previously unappreciated role for G. duodenalis cathepsin cysteine proteases in intestinal epithelial pathophysiological processes that occur during giardiasis. Experiments first established that Giardia trophozoites indeed produce cathepsin B and L in strain-dependent fashion. Co-incubation of G. duodenalis with human enterocytes enhanced cathepsin production by Assemblage A (NF and S2 isolates) trophozoites, but not when epithelial cells were exposed to Assemblage B (GSM isolate) trophozoites. Direct contact between G. duodenalis parasites and human intestinal epithelial monolayers resulted in the degradation and redistribution of the intestinal epithelial cytoskeletal protein villin; these effects were abolished when parasite cathepsin cysteine proteases were inhibited. Interestingly, inhibition of parasite proteases did not prevent degradation of the intestinal tight junction-associated protein zonula occludens 1 (ZO-1), suggesting that G. duodenalis induces multiple pathophysiological processes within intestinal epithelial cells. Finally, this study demonstrates that G. duodenalis-mediated disruption of villin is, at least, in part dependent on activation of myosin light chain kinase (MLCK). Taken together, this study indicates a novel role for parasite cathepsin cysteine proteases in the pathophysiology of G. duodenalis infections.

  7. The surface latent heat flux anomalies related to major earthquake

    NASA Astrophysics Data System (ADS)

    Jing, Feng; Shen, Xuhui; Kang, Chunli; Xiong, Pan; Hong, Shunying

    2011-12-01

    SLHF (Surface Latent Heat Flux) is an atmospheric parameter, which can describe the heat released by phase changes and dependent on meteorological parameters such as surface temperature, relative humidity, wind speed etc. There is a sharp difference between the ocean surface and the land surface. Recently, many studies related to the SLHF anomalies prior to earthquakes have been developed. It has been shown that the energy exchange enhanced between coastal surface and atmosphere prior to earthquakes can increase the rate of the water-heat exchange, which will lead to an obviously increases in SLHF. In this paper, two earthquakes in 2010 (Haiti earthquake and southwest of Sumatra in Indonesia earthquake) have been analyzed using SLHF data by STD (standard deviation) threshold method. It is shows that the SLHF anomaly may occur in interpolate earthquakes or intraplate earthquakes and coastal earthquakes or island earthquakes. And the SLHF anomalies usually appear 5-6 days prior to an earthquake, then disappear quickly after the event. The process of anomaly evolution to a certain extent reflects a dynamic energy change process about earthquake preparation, that is, weak-strong-weak-disappeared.

  8. Phage display as a powerful tool to engineer protease inhibitors.

    PubMed

    Zani, Marie-Louise; Moreau, Thierry

    2010-11-01

    Since its introduction by Georges Smith some 25 years ago, phage display has proved to be a powerful molecular technique for selecting proteins with desired biological properties from huge libraries. Early on, various protease inhibitor scaffolds were displayed at the surface of filamentous phages to select new inhibitors with shifted specificities and enhanced affinities towards one or more target protease(s). The past two decades have seen a number of natural protease inhibitors subjected to phage display, mostly to shift and increase their inhibitory specificity, but also to explore the molecular mechanisms by which they interact with their cognate enzymes with low or very high selectivity. This review focuses on the major uses of phage display in the field of protein protease inhibitors. The exquisite molecular mechanisms by which natural protease inhibitors prevent unwanted or excessive proteolysis in cells and tissues are also examined along with some of the general principles underlying the way phage display is applied to these molecules. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  9. Proteases in gastrointestinal neoplastic diseases.

    PubMed

    Herszényi, L; Plebani, M; Carraro, P; De Paoli, M; Roveroni, G; Cardin, R; Foschia, F; Tulassay, Z; Naccarato, R; Farinati, F

    2000-02-15

    Cysteine and serine proteases are involved in cancer invasion and metastasis. In the past few years we investigated the tissue levels of these proteases in gastric cancer (GC), gastric precancerous changes (CAG), colorectal cancer (CRC) and the plasma and serum levels of proteases in several gastrointestinal tumours, using ELISA methods. Significantly higher antigen levels were found not only in GC tissue but also in CAG with respect to the levels found normal tissue; with respect to CAG, patients with dysplasia had higher levels than patients without dysplasia. The same findings were obtained in CRC. In general protease levels correlated with the major histomorphological parameters, such as grading and histotype in GC as well as in CRC. Tissue protease levels had a strong prognostic impact in GC, in which UPA was singled out by multivariate analysis as the major prognostic factor, and CRC. The plasma levels of urokinase-type plasminogen activator (UPA) and the serum levels of cathepsin B were significantly increased in patients with gastrointestinal tumours. In conclusions, cysteine and serine proteases may have a part not only in GC and CRC invasion and metastasis, but also in the progression of gastric precancerous changes into cancer. They are strong prognostic factors in GC and CRC. These proteases may also have a role as tumour markers in the early diagnosis of gastrointestinal tract tumours.

  10. The positions of secular resonance surfaces. [for major planet orbits

    NASA Technical Reports Server (NTRS)

    Williams, J. G.; Faulkner, J.

    1981-01-01

    The surfaces for the three strongest secular resonances have been located as a function of proper semimajor axis, eccentricity, and inclination for semimajor axes between 1.25 and 3.5 AU. The results are presented graphically. The nu5 resonance only occurs at high inclinations (approximately greater than 23 deg). The nu6 resonance passes through both the main belt and Mars-crossing space. The nu16 resonance starts near the inner edge of the belt and, at low inclinations at least, folds around a portion of the Mars-crossing space until it runs nearly parallel with the earth-crossing boundary.

  11. Anaplasma platys Immunoblot Test Using Major Surface Antigens.

    PubMed

    Lai, Tzung-Huei; Parraga, Maria E; Alvarez, Elizabeth; Rikihisa, Yasuko

    2016-09-01

    Anaplasma platys is an uncultivable tick-borne obligatory intracellular bacterium, which is known to infect platelets of dogs. A. platys causes infectious canine cyclic thrombocytopenia in subtropical and tropical regions throughout the world. Several cases of human infection with A. platys infection have also been reported. However, seroprevalence of A. platys exposure and infection has not been determined in most of the regions, in part, due to lack of a simple and reliable assay method. Furthermore, A. platys antigens recognized by dogs are unknown. We previously sequenced gene encoding A. platys major outer membrane proteins P44 and Omp-1X. In the present study, we obtained purified recombinant A. platys P44 and Omp-1X proteins, and using them as antigens in immunoblotting examined seroreactivity in dogs. Of 34 specimens from Venezuela where A. platys infection was previously reported, 25 specimens (73.5%) reacted to rAplP44 and/or rAplOMP-1X. Neither Anaplasma phagocytophilum-seropositive (N = 10) nor A. phagocytophilum-seronegative canine specimens (N = 10) from the geographic regions where A. platys infection has never been reported, reacted rAplP44 or rAplOMP-1X. The result indicates a high A. platys seroprevalence rate in tested dogs from Venezuela and suggests that the immunoblot analysis based on recombinant A. platys major outer membrane proteins can provide a simple and defined tool to enlighten the prevalence of A. platys infection.

  12. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  13. Comparative one-factor-at-a-time, response surface (statistical) and bench-scale bioreactor level optimization of thermoalkaline protease production from a psychrotrophic Pseudomonas putida SKG-1 isolate.

    PubMed

    Singh, Santosh K; Singh, Sanjay K; Tripathi, Vinayak R; Khare, Sunil K; Garg, Satyendra K

    2011-12-28

    Production of alkaline protease from various bacterial strains using statistical methods is customary now-a-days. The present work is first attempt for the production optimization of a solvent stable thermoalkaline protease by a psychrotrophic Pseudomonas putida isolate using conventional, response surface methods, and fermentor level optimization. The pre-screening medium amended with optimized (w/v) 1.0% glucose, 2.0% gelatin and 0.5% yeast extract, produced 278 U protease ml(-1) at 72 h incubation. Enzyme production increased to 431 Uml(-1) when Mg2+ (0.01%, w/v) was supplemented. Optimization of physical factors further enhanced protease to 514 Uml(-1) at pH 9.0, 25°C and 200 rpm within 60 h. The combined effect of conventionally optimized variables (glucose, yeast extract, MgSO4 and pH), thereafter predicted by response surface methodology yielded 617 U protease ml(-1) at glucose 1.25% (w/v), yeast extract 0.5% (w/v), MgSO4 0.01% (w/v) and pH 8.8. Bench-scale bioreactor level optimization resulted in enhanced production of 882 U protease ml(-1) at 0.8 vvm aeration and 150 rpm agitation during only 48 h incubation. The optimization of fermentation variables using conventional, statistical approaches and aeration/agitation at fermentor level resulted in ~13.5 folds increase (882 Uml(-1)) in protease production compared to un-optimized conditions (65 Uml(-1)). This is the highest level of thermoalkaline protease reported so far by any psychrotrophic bacterium.

  14. Comparative one-factor-at-a-time, response surface (statistical) and bench-scale bioreactor level optimization of thermoalkaline protease production from a psychrotrophic Pseudomonas putida SKG-1 isolate

    PubMed Central

    2011-01-01

    Background Production of alkaline protease from various bacterial strains using statistical methods is customary now-a-days. The present work is first attempt for the production optimization of a solvent stable thermoalkaline protease by a psychrotrophic Pseudomonas putida isolate using conventional, response surface methods, and fermentor level optimization. Results The pre-screening medium amended with optimized (w/v) 1.0% glucose, 2.0% gelatin and 0.5% yeast extract, produced 278 U protease ml-1 at 72 h incubation. Enzyme production increased to 431 Uml-1 when Mg2+ (0.01%, w/v) was supplemented. Optimization of physical factors further enhanced protease to 514 Uml-1 at pH 9.0, 25°C and 200 rpm within 60 h. The combined effect of conventionally optimized variables (glucose, yeast extract, MgSO4 and pH), thereafter predicted by response surface methodology yielded 617 U protease ml-1 at glucose 1.25% (w/v), yeast extract 0.5% (w/v), MgSO4 0.01% (w/v) and pH 8.8. Bench-scale bioreactor level optimization resulted in enhanced production of 882 U protease ml-1 at 0.8 vvm aeration and 150 rpm agitation during only 48 h incubation. Conclusions The optimization of fermentation variables using conventional, statistical approaches and aeration/agitation at fermentor level resulted in ~13.5 folds increase (882 Uml-1) in protease production compared to un-optimized conditions (65 Uml-1). This is the highest level of thermoalkaline protease reported so far by any psychrotrophic bacterium. PMID:22204659

  15. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  16. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  17. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  18. Fibroblast activation protein-alpha and dipeptidyl peptidase IV (CD26): cell-surface proteases that activate cell signaling and are potential targets for cancer therapy.

    PubMed

    Kelly, Thomas

    2005-01-01

    Fibroblast activation protein-alpha (FAP-alpha) and dipeptidyl peptidase IV (DPPIV) are serine proteases with post-prolyl peptidase activities that can modify tumor cell behavior. FAP-alpha and DPPIV can form heteromeric complexes with each other and may function coordinately to modulate the growth, differentiation, adhesion, and metastasis of tumor cells. This review is focused on FAP-alpha and summarizes a series of studies showing that elevated expression of FAP-alpha results in profound changes in growth and malignant behavior of tumor cells. Depending on the model system investigated, FAP-alpha expression causes dramatic promotion or suppression of tumor growth. In the case of tumor promotion, FAP-alpha expression can drive tumor growth by increasing angiogenesis and by decreasing the anti-tumor response of the immune system. In the case of tumor suppression, FAP-alpha can decrease tumorigenicity of mouse melanoma cells and restore contact inhibition and growth factor dependence even when it is catalytically inactive, implying that protein-protein interactions mediate these effects. Understanding how FAP-alpha activates cell signaling is critical to determining how FAP-alpha mediates growth promotion versus growth suppression in the different model systems and ultimately in human cancer patients. In particular, the roles of FAP-alpha protease activity and FAP-alpha complex formation with DPPIV and other surface molecules in activating cell signaling need to be elucidated since these represent potential targets for therapeutic intervention.

  19. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  20. Response Surface Methodology Modelling of an Aqueous Two-Phase System for Purification of Protease from Penicillium candidum (PCA 1/TT031) under Solid State Fermentation and Its Biochemical Characterization.

    PubMed

    Alhelli, Amaal M; Abdul Manap, Mohd Yazid; Mohammed, Abdulkarim Sabo; Mirhosseini, Hamed; Suliman, Eilaf; Shad, Zahra; Mohammed, Nameer Khairulla; Meor Hussin, Anis Shobirin

    2016-11-11

    Penicillium candidum (PCA 1/TT031) synthesizes different types of extracellular proteases. The objective of this study is to optimize polyethylene glycol (PEG)/citrate based on an aqueous two-phase system (ATPS) and Response Surface Methodology (RSM) to purify protease from Penicillium candidum (PCA 1/TT031). The effects of different PEG molecular weights (1500-10,000 g/mol), PEG concentration (9%-20%), concentrations of NaCl (0%-10%) and the citrate buffer (8%-16%) on protease were also studied. The best protease purification could be achieved under the conditions of 9.0% (w/w) PEG 8000, 5.2% NaCl, and 15.9% sodium citrate concentration, which resulted in a one-sided protease partitioning for the bottom phase with a partition coefficient of 0.2, a 6.8-fold protease purification factor, and a yield of 93%. The response surface models displayed a significant (p ≤ 0.05) response which was fit for the variables that were studied as well as a high coefficient of determination (R²). Similarly, the predicted and observed values displayed no significant (p > 0.05) differences. In addition, our enzyme characterization study revealed that Penicillium candidum (PCA 1/TT031) produced a slight neutral protease with a molecular weight between 100 and 140 kDa. The optimal activity of the purified enzyme occurred at a pH of 6.0 and at a temperature of 50 °C. The stability between different pH and temperature ranges along with the effect of chemical metal ions and inhibitors were also studied. Our results reveal that the purified enzyme could be used in the dairy industry such as in accelerated cheese ripening.

  1. Response Surface Methodology Modelling of an Aqueous Two-Phase System for Purification of Protease from Penicillium candidum (PCA 1/TT031) under Solid State Fermentation and Its Biochemical Characterization

    PubMed Central

    Alhelli, Amaal M.; Abdul Manap, Mohd Yazid; Mohammed, Abdulkarim Sabo; Mirhosseini, Hamed; Suliman, Eilaf; Shad, Zahra; Mohammed, Nameer Khairulla; Meor Hussin, Anis Shobirin

    2016-01-01

    Penicillium candidum (PCA 1/TT031) synthesizes different types of extracellular proteases. The objective of this study is to optimize polyethylene glycol (PEG)/citrate based on an aqueous two-phase system (ATPS) and Response Surface Methodology (RSM) to purify protease from Penicillium candidum (PCA 1/TT031). The effects of different PEG molecular weights (1500–10,000 g/mol), PEG concentration (9%–20%), concentrations of NaCl (0%–10%) and the citrate buffer (8%–16%) on protease were also studied. The best protease purification could be achieved under the conditions of 9.0% (w/w) PEG 8000, 5.2% NaCl, and 15.9% sodium citrate concentration, which resulted in a one-sided protease partitioning for the bottom phase with a partition coefficient of 0.2, a 6.8-fold protease purification factor, and a yield of 93%. The response surface models displayed a significant (p ≤ 0.05) response which was fit for the variables that were studied as well as a high coefficient of determination (R2). Similarly, the predicted and observed values displayed no significant (p > 0.05) differences. In addition, our enzyme characterization study revealed that Penicillium candidum (PCA 1/TT031) produced a slight neutral protease with a molecular weight between 100 and 140 kDa. The optimal activity of the purified enzyme occurred at a pH of 6.0 and at a temperature of 50 °C. The stability between different pH and temperature ranges along with the effect of chemical metal ions and inhibitors were also studied. Our results reveal that the purified enzyme could be used in the dairy industry such as in accelerated cheese ripening. PMID:27845736

  2. Membrane proteases in the bacterial protein secretion and quality control pathway.

    PubMed

    Dalbey, Ross E; Wang, Peng; van Dijl, Jan Maarten

    2012-06-01

    Proteolytic cleavage of proteins that are permanently or transiently associated with the cytoplasmic membrane is crucially important for a wide range of essential processes in bacteria. This applies in particular to the secretion of proteins and to membrane protein quality control. Major progress has been made in elucidating the structure-function relationships of many of the responsible membrane proteases, including signal peptidases, signal peptide hydrolases, FtsH, the rhomboid protease GlpG, and the site 1 protease DegS. These enzymes employ very different mechanisms to cleave substrates at the cytoplasmic and extracytoplasmic membrane surfaces or within the plane of the membrane. This review highlights the different ways that bacterial membrane proteases degrade their substrates, with special emphasis on catalytic mechanisms and substrate delivery to the respective active sites.

  3. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  4. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  5. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  6. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central

    2010-01-01

    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  7. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  8. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  9. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama, area 7

    USGS Publications Warehouse

    Mooty, W.S.

    1987-01-01

    The geohydrology and susceptibility of the seven major aquifers to surface contamination in Area 7 - Bibb, Dallas, Hale, Perry, and Wilcox Counties, are described. Aquifers in the northern part of the study area are in Paleozoic limestones and dolomite formations. Deposits in the central part of the study area are predominately of Cretaceous age and contain the Coker, Gordo, and Eutaw aquifers. Although the southern part of the study area has many deposits of Tertiary age, the Ripley Formation of Cretaceous age is the major aquifer. Contamination of any of the major aquifers is improbable because the majority of the recharge area for the primary aquifers is woodland, pasture, or farmland. Downdip from their outcrops, the major aquifers in the study area are protected from land surface contamination by relatively impermeable layers of clay and chalk. The aquifers that are highly susceptible to contamination are the ones in the limestone and dolomite formations in northern Bibb County. Sinkholes exist in the recharge area of these formations and could provide a direct link for contaminates from the land surface to the water table. An area northeast of the Selma well field is also highly susceptible to contamination. The Eutaw Formation in this area is overlain by alluvial deposits that could increase recharge to the aquifer by slowing the runoff rate of surface water. (USGS)

  10. Mycoplasma hyopneumoniae Surface proteins Mhp385 and Mhp384 bind host cilia and glycosaminoglycans and are endoproteolytically processed by proteases that recognize different cleavage motifs.

    PubMed

    Deutscher, Ania T; Tacchi, Jessica L; Minion, F Chris; Padula, Matthew P; Crossett, Ben; Bogema, Daniel R; Jenkins, Cheryl; Kuit, Tracey A; Walker, Mark J; Djordjevic, Steven P

    2012-03-02

    P97 and P102 paralogues occur as endoproteolytic cleavage fragments on the surface of Mycoplasma hyopneumoniae that bind glycosaminoglycans, plasminogen, and fibronectin and perform essential roles in colonization of ciliated epithelia. We show that the P102 paralogue Mhp384 is efficiently cleaved at an S/T-X-F↓X-D/E-like site, creating P60(384) and P50(384). The P97 paralogue Mhp385 is inefficiently cleaved, with tryptic peptides from a 115 kDa protein (P115(385)) and 88 kDa (P88(385)) and 27 kDa (P27(385)) cleavage fragments identified by LC-MS/MS. This is the first time a preprotein belonging to the P97 and P102 paralogue families has been identified by mass spectrometry. The semitryptic peptide (752)IQFELEPISLNV(763) denotes the C-terminus of P88(385) and defines the novel cleavage site (761)L-N-V↓A-V-S(766) in Mhp385. P115(385), P88(385), P27(385), P60(384), and P50(384) were shown to reside extracellularly, though it is unknown how the fragments remain attached to the cell surface. Heparin- and cilium-binding sites were identified within P60(384), P50(384), and P88(385). No primary function was attributed to P27(385); however, this molecule contains four tandem R1 repeats with similarity to porcine collagen type VI (α3 chain). P97 and P102 paralogue families are adhesins targeted by several proteases with different cleavage efficiencies, and this process generates combinatorial complexity on the surface of M. hyopneumoniae.

  11. The CLIP-Domain Serine Protease Homolog SPCLIP1 Regulates Complement Recruitment to Microbial Surfaces in the Malaria Mosquito Anopheles gambiae

    PubMed Central

    Tan, Lee Aun; Upton, Leanna M.; Osta, Mike A.; Christophides, George K.

    2013-01-01

    The complement C3-like protein TEP1 of the mosquito Anopheles gambiae is required for defense against malaria parasites and bacteria. Two forms of TEP1 are present in the mosquito hemolymph, the full-length TEP1-F and the proteolytically processed TEP1cut that is part of a complex including the leucine-rich repeat proteins LRIM1 and APL1C. Here we show that the non-catalytic serine protease SPCLIP1 is a key regulator of the complement-like pathway. SPCLIP1 is required for accumulation of TEP1 on microbial surfaces, a reaction that leads to lysis of malaria parasites or triggers activation of a cascade culminating with melanization of malaria parasites and bacteria. We also demonstrate that the two forms of TEP1 have distinct roles in the complement-like pathway and provide the first evidence for a complement convertase-like cascade in insects analogous to that in vertebrates. Our findings establish that core principles of complement activation are conserved throughout the evolution of animals. PMID:24039584

  12. Expression and secretion of the Giardia duodenalis variant surface protein 9B10A by transfected trophozoites causes damage to epithelial cell monolayers mediated by protease activity.

    PubMed

    Cabrera-Licona, Ariana; Solano-González, Eduardo; Fonseca-Liñán, Rocío; Bazán-Tejeda, Ma Luisa; Raúl Argüello-García; Bermúdez-Cruz, Rosa Ma; Ortega-Pierres, Guadalupe

    2017-08-01

    Giardia duodenalis is the protozoan parasite responsible for most cases of parasitic diarrhea worldwide. The pathogenic mechanisms of giardiasis have not yet been fully characterized. In this context parasite's excretory/secretory products have been related to the damage induced by the parasite on enterocytes. Among these is the Variable Surface Proteins (VSPs) family involved in antigenic variation and in the induction of protective response. In proteomic analyses carried out to identify the proteases with high molecular weight secreted by Giardia trophozoites during the initial phase of interaction with IEC-6 cell monolayers we identified the VSP9B10A protein. In silico bioinformatics analyses predicted a central region in residues 324-684 displaying the catalytic triad and the substrate binding pocket of cysteine proteases. The analysis of the effect of the VSP9B10A protein on epithelial cell monolayers using trophozoites that were transfected with a plasmid carrying the vsp9b10a gene sequence under the control of a constitutive promoter showed that transfected trophozoites expressing the VSP9B10A protein caused cytotoxic damages on IEC-6 and MDCK cell monolayers. This was characterized by loss of cell-cell contacts and cell detachment from the substrate while no damage was observed with trophozoites that did not express the VSP9B10A protein. The same cytotoxic effect was detected when IEC-6 cell monolayers were incubated only with supernatants from co-cultures of IEC-6 cell monolayers with VSP9B10A transfected trophozoites and this effect was not observed when transfected trophozoites were incubated with a monospecific polyclonal antibody anti-VSP9B10A previous to interaction with IEC-6 monolayers. These results demonstrate that the VSP9B10A protein secreted upon interaction with epithelial cells caused damage in these cells. Thus this protein might be considered as a conditional virulence factor candidate. To our knowledge this is the first report on the

  13. Cell surface protease activation during RAS transformation: Critical role of the plasminogen receptor, S100A10

    PubMed Central

    Madureira, Patricia A.; Bharadwaj, Alamelu G.; Bydoun, Moamen; Garant, Katy; O'Connell, Paul; Lee, Patrick; Waisman, David M.

    2016-01-01

    The link between oncogenic RAS expression and the acquisition of the invasive phenotype has been attributed to alterations in cellular activities that control degradation of the extracellular matrix. Oncogenic RAS-mediated upregulation of matrix metalloproteinase 2 (MMP-2), MMP-9 and urokinase-type plasminogen activator (uPA) is critical for invasion through the basement membrane and extracellular matrix. The uPA converts cell surface-bound plasminogen to plasmin, a process that is regulated by the binding of plasminogen to specific receptors on the cell surface, however, the identity of the plasminogen receptors that function in this capacity is unclear. We have observed that transformation of cancer cells with oncogenic forms of RAS increases plasmin proteolytic activity by 2- to 4-fold concomitant with a 3-fold increase in cell invasion. Plasminogen receptor profiling revealed RAS-dependent increases in both S100A10 and cytokeratin 8. Oncogenic RAS expression increased S100A10 gene expression which resulted in an increase in S100A10 protein levels. Analysis with the RAS effector-loop mutants that interact specifically with Raf, Ral GDS pathways highlighted the importance of the RalGDS pathways in the regulation of S100A10 gene expression. Depletion of S100A10 from RAS-transformed cells resulted in a loss of both cellular plasmin generation and invasiveness. These results strongly suggest that increases in cell surface levels of S100A10, by oncogenic RAS, plays a critical role in RAS-stimulated plasmin generation, and subsequently, in the invasiveness of oncogenic RAS expressing cancer cells. PMID:27351226

  14. The S-layer Associated Serine Protease Homolog PrtX Impacts Cell Surface-Mediated Microbe-Host Interactions of Lactobacillus acidophilus NCFM.

    PubMed

    Johnson, Brant R; O'Flaherty, Sarah; Goh, Yong Jun; Carroll, Ian; Barrangou, Rodolphe; Klaenhammer, Todd R

    2017-01-01

    Health-promoting aspects attributed to probiotic microorganisms, including adhesion to intestinal epithelia and modulation of the host mucosal immune system, are mediated by proteins found on the bacterial cell surface. Notably, certain probiotic and commensal bacteria contain a surface (S-) layer as the outermost stratum of the cell wall. S-layers are non-covalently bound semi-porous, crystalline arrays of self-assembling, proteinaceous subunits called S-layer proteins (SLPs). Recent evidence has shown that multiple proteins are non-covalently co-localized within the S-layer, designated S-layer associated proteins (SLAPs). In Lactobacillus acidophilus NCFM, SLP and SLAPs have been implicated in both mucosal immunomodulation and adhesion to the host intestinal epithelium. In this study, a S-layer associated serine protease homolog, PrtX (prtX, lba1578), was deleted from the chromosome of L. acidophilus NCFM. Compared to the parent strain, the PrtX-deficient strain (ΔprtX) demonstrated increased autoaggregation, an altered cellular morphology, and pleiotropic increases in adhesion to mucin and fibronectin, in vitro. Furthermore, ΔprtX demonstrated increased in vitro immune stimulation of IL-6, IL-12, and IL-10 compared to wild-type, when exposed to mouse dendritic cells. Finally, in vivo colonization of germ-free mice with ΔprtX led to an increase in epithelial barrier integrity. The absence of PrtX within the exoproteome of a ΔprtX strain caused morphological changes, resulting in a pleiotropic increase of the organisms' immunomodulatory properties and interactions with some intestinal epithelial cell components.

  15. The S-layer Associated Serine Protease Homolog PrtX Impacts Cell Surface-Mediated Microbe-Host Interactions of Lactobacillus acidophilus NCFM

    PubMed Central

    Johnson, Brant R.; O’Flaherty, Sarah; Goh, Yong Jun; Carroll, Ian; Barrangou, Rodolphe; Klaenhammer, Todd R.

    2017-01-01

    Health-promoting aspects attributed to probiotic microorganisms, including adhesion to intestinal epithelia and modulation of the host mucosal immune system, are mediated by proteins found on the bacterial cell surface. Notably, certain probiotic and commensal bacteria contain a surface (S-) layer as the outermost stratum of the cell wall. S-layers are non-covalently bound semi-porous, crystalline arrays of self-assembling, proteinaceous subunits called S-layer proteins (SLPs). Recent evidence has shown that multiple proteins are non-covalently co-localized within the S-layer, designated S-layer associated proteins (SLAPs). In Lactobacillus acidophilus NCFM, SLP and SLAPs have been implicated in both mucosal immunomodulation and adhesion to the host intestinal epithelium. In this study, a S-layer associated serine protease homolog, PrtX (prtX, lba1578), was deleted from the chromosome of L. acidophilus NCFM. Compared to the parent strain, the PrtX-deficient strain (ΔprtX) demonstrated increased autoaggregation, an altered cellular morphology, and pleiotropic increases in adhesion to mucin and fibronectin, in vitro. Furthermore, ΔprtX demonstrated increased in vitro immune stimulation of IL-6, IL-12, and IL-10 compared to wild-type, when exposed to mouse dendritic cells. Finally, in vivo colonization of germ-free mice with ΔprtX led to an increase in epithelial barrier integrity. The absence of PrtX within the exoproteome of a ΔprtX strain caused morphological changes, resulting in a pleiotropic increase of the organisms’ immunomodulatory properties and interactions with some intestinal epithelial cell components. PMID:28713337

  16. HIV-1 Protease: Structure, Dynamics and Inhibition

    SciTech Connect

    Louis, John M.; Ishima, R.; Torchia, D.A.; Weber, Irene T.

    2008-06-03

    The HIV-1 protease is synthesized as part of a large Gag-Pol precursor protein. It is responsible for its own release from the precursor and the processing of the Gag and Gag-Pol polyproteins into the mature structural and functional proteins required for virus maturation. Because of its indispensable role, the mature HIV-1 protease dimer has proven to be a successful target for the development of antiviral agents. In the last 5 years, a major emphasis in protease research has been to improve inhibitor design and treatment regimens.

  17. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  18. Molecular Cloning and Immunochemical Characterization of a New Japanese Cedar Pollen Allergen Homologous to Plant Subtilisin-Like Serine Protease

    PubMed Central

    2010-01-01

    Protease activities in allergen sources are thought to be involved in triggering allergic inflammation through the disruption of epithelial barrier or the induction of proinflammatory cytokines. Protease allergens may also work as type 2 helper T cell (TH2) adjuvants through the cleavage of cell surface receptors. Here, we report molecular cloning and immunochemical characterization of a new Japanese cedar (Cryptomeria japonica) pollen allergen (CPA9) homologous to serine protease, which is initially found as a high IgE-binding spot on our two-dimensional (2-D) IgE immunoblotting map. The cpa9 cDNA encoded a 757 amino acid polypeptide showing a significant sequence identity with plant subtilisin-like serine protease family members including melon major allergen Cuc m 1. We found that native CPA9 purified from C. japonica pollen showed a high IgE-binding frequency and IgE cross-reactivity with melon extract. PMID:23282945

  19. Assessment of trace element accumulation in surface sediments off Chennai coast after a major flood event.

    PubMed

    Gopal, V; Krishnakumar, S; Simon Peter, T; Nethaji, S; Suresh Kumar, K; Jayaprakash, M; Magesh, N S

    2017-01-30

    The present study was conducted to assess the trace element concentration in marine surface sediments after major flood event of Chennai metropolis, India. Thirty surface samples were collected from off Chennai coast. Trace elements, organic matter, CaCO3, sand-silt-clay and C/N ratios were studied to understand the accumulation dynamics on sediments. The elemental concentration, calcium carbonate and OM distribution suggest that they are derived from urban runoff and transported through Adyar and Cooum Rivers. The enrichment factor reveals that the sediments are enriched by Pb, Cu, Zn, Cr, Co, Ni followed by Fe. The observed Igeo value shows that the samples are contaminated by Pb, Cu and Zn. The elemental concentration of the surface sediments is low when compared to other coastal region except Pb. The elevated level of Pb in the surface sediments is probably due to migration of contaminated urban soil from industrial and transportation sectors into marine environment.

  20. Expression of a hydrophilic surface protein in infective stages of Leishmania major.

    PubMed

    Flinn, H M; Rangarajan, D; Smith, D F

    1994-06-01

    A family of differentially expressed genes from Leishmania major contains one sequence (Gene B) that encodes a novel, hydrophilic protein found on the surface of infective parasite stages. The 177-residue, acidic Gene B protein is characterised by an amino acid repetitive element, comprising 45% of the total molecule, that is related to the cell-wall binding domain of protein A from Staphylococcus aureus. No identifiable signal peptide, membrane-spanning domain or consensus for glycosylphosphatidylinositol anchor attachment to the cell surface is found elsewhere in the deduced protein sequence. In vitro, the Gene B protein fractionates with the parasite cell surface glycoconjugates, lipophosphoglycan and the glycoinositolphospholipids. This protein is the first characterised surface peptide marker for infective stages of the Leishmania life cycle.

  1. Knockout of the gamma subunit of the AP-1 adaptor complex in the human parasite Trypanosoma cruzi impairs infectivity and differentiation and prevents the maturation and targeting of the major protease cruzipain.

    PubMed

    Moreira, Claudia Maria do Nascimento; Batista, Cassiano Martin; Fernandes, Jessica Chimenes; Kessler, Rafael Luis; Soares, Maurilio José; Fragoso, Stenio Perdigão

    2017-01-01

    The AP-1 Adaptor Complex assists clathrin-coated vesicle assembly in the trans-Golgi network (TGN) of eukaryotic cells. However, the role of AP-1 in the protozoan Trypanosoma cruzi-the Chagas disease parasite-has not been addressed. Here, we studied the function and localization of AP-1 in different T. cruzi life cycle forms, by generating a gene knockout of the large AP-1 subunit gamma adaptin (TcAP1-γ), and raising a monoclonal antibody against TcAP1-γ. Co-localization with a Golgi marker and with the clathrin light chain showed that TcAP1-γ is located in the Golgi, and it may interact with clathrin in vivo, at the TGN. Epimastigote (insect form) parasites lacking TcAP1-γ (TcγKO) have reduced proliferation and differentiation into infective metacyclic trypomastigotes (compared with wild-type parasites). TcγKO parasites have also displayed significantly reduced infectivity towards mammalian cells. Importantly, TcAP1-γ knockout impaired maturation and transport to lysosome-related organelles (reservosomes) of a key cargo-the major cysteine protease cruzipain, which is important for parasite nutrition, differentiation and infection. In conclusion, the defective processing and transport of cruzipain upon AP-1 ablation may underlie the phenotype of TcγKO parasites.

  2. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  3. A multifunctional protease inhibitor to regulate endolysosomal function.

    PubMed

    van Kasteren, Sander I; Berlin, Ilana; Colbert, Jeff D; Keane, Doreen; Ovaa, Huib; Watts, Colin

    2011-11-18

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin-pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses.

  4. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  5. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; Area 8

    USGS Publications Warehouse

    Scott, J.C.; Cobb, R.H.; Castleberry, R.D.

    1987-01-01

    The U.S. Geological Survey, in cooperation with the Alabama Department of Environmental Management, is conducting a series of geohydrologic studies to delineate the major aquifers and their susceptibility to contamination in Alabama. This report delineates and describes the geohydrology and susceptibility of the major aquifers to contamination in Area 8--Autauga, Chilton, Elmore, Lowndes, and Montgomery Counties. The major aquifers in the study area are the Eutaw, Gordo, and Coker aquifers of Cretaceous age. One or more of these aquifers are sources of public water supply in each of the five counties. The recharge areas for these aquifers are in Autauga, Chilton, Elmore, and Montgomery and Prattville. Maximum groundwater use in the Prattville area is more than 8 mgd (million gallons per day). Estimated maximum groundwater withdrawal for all uses in the study area is about 65 mgd. The potentiometric map of the Gordo aquifer indicates that the Alabama River may serve as a recharging boundary to the Gordo aquifer along the flood plain of the river in the Montgomery-Prattville area. The river also is acting as a recharging boundary to the Eutaw and Coker aquifers, where the potentiometric surfaces in the aquifers have been lowered. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, the areas that are highly susceptible to contamination extend from Jemison to Clanton in Chilton County where the Coker aquifer generally is < 100 ft below land surface, and the flood plains of the Alabama, Coosa, and Tallapoosa Rivers, which are underlain by alluvial deposits that are in hydraulic contact with the major aquifers. Within the highly susceptible areas, the areas especially susceptible to contamination are the flood plain of the Alabama River in the Montgomery area and the flood plain of the Tallapoosa River. Pumpage from the major aquifers in this area has significantly lowered the potentiometric surface in the aquifers

  6. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 10

    USGS Publications Warehouse

    DeJarnette, S.S.

    1989-01-01

    This report delineates and describes the geohydrology and susceptibility of major aquifers to contamination in Area 10--Choctaw, Clarke, and Washington Counties in southwest Alabama. The major aquifers in the study area are the Nanafalia-Clayton, Lisbon, and Pliocene-Miocene aquifers of Tertiary age. The recharge areas for these aquifers generally coincide with their areas of use. Each aquifer is a source of public water supply in one or more of the three counties. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, large parts of the recharge areas are rural areas that are used for timberlands, farms, and pastures; these areas have low potential for contamination and are several miles from pumping centers. (USGS)

  7. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 6

    USGS Publications Warehouse

    DeJarnette, S.S.; Crownover, J.E.

    1987-01-01

    This report delineates and describes the geohyrology and susceptibility of the major aquifers to contamination in Area 6, Greene, Marengo, Pickens, Sumter, and Tuscaloosa Counties in west-central Alabama. The major aquifers in the study area are the Nanafalia, Eutaw, Gordo, and Coker aquifers of Tertiary and Cretaceous age. The recharge areas for one or more of these aquifers are in each of the five counties. East aquifer is a source of public water supply in one or more of the five counties. All recharge areas for the major aquifers are susceptible to contamination from the surface. However, large parts of the recharge areas are in rural settings that are used for timberlands, farms, and pastures, and are several miles from pumping centers; therefore, these areas are not highly susceptible to contamination. (USGS)

  8. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 12

    USGS Publications Warehouse

    Scott, J.C.; Cobb, R.H.

    1988-01-01

    This report delineates and describes the geohydrology and susceptibility of major aquifers to contamination in Coffee, Dale, Henry, Houston, and Geneva Counties, Alabama. The major aquifers are the Upper Floridan, Lisbon, Nanafalia-Clayton, and Providence-Ripley aquifers. Estimated groundwater withdrawals for public water supplies are about 42 million gal/day. Maximum withdrawals for irrigation are 15 to 20 million gal/day. Withdrawals for self-supplied industrial and domestic uses are estimated to be 3 and 2.5 million gal/day, respectively. Long-term withdrawals of water from the Nanafalia-Clayton aquifer have resulted in significant declines in the potentiometric surface in Coffee, Dale, and Houston Counties. Significant declines in the potentiometric surfaces of the other major aquifers are not apparent. Recharge areas for all major aquifers are susceptible to contamination, but the probability of contamination of the Lisbon, Nanafalia-Clayton, and Providence-Ripley aquifers is low because the recharge areas are remote from areas of withdrawal. The recharge area for the Floridan aquifer, which consists largely of flat, sandy farmland , coincides with the area of use. This area is highly susceptible to contamination from insecticides and herbicides. (USGS)

  9. Generalized immunological recognition of the major merozoite surface antigen (gp195) of Plasmodium falciparum

    SciTech Connect

    Chang, S.P.; Hui, G.S.N.; Kato, A.; Siddiqui, W.A. )

    1989-08-01

    The antibody response to the Plasmodium falciparum major merozoite surface antigen (gp195) of congenic mouse strains differing in H-2 haplotype has been examined. All seven strains of mice were capable of producing gp195-specific antibodies. Generalized immune recognition of gp195 by mice of diverse H-2 haplotypes distinguished gp195 from the P. falciparum circumsporozoite protein and the 230-kDa and 48/45-kDa gamete surface antigens. However, the H-2 genetic locus appeared to influence the specificity of gp105-specific antibodies. Immunoblot patterns of mouse sera with parasite antigens revealed a complex pattern of reactivity with terminal and intermediate processing fragments of gp195. The majority of immunoblot bands observed were similar for all of the mouse strains; however, there were several strains that additionally recognized a few unique fragments or displayed more intense reactivities with specific processing fragments. These results suggest that while individuals of diverse major histocompatibility complex makeup are capable of recognizing the gp195 antigen, the recognition of specific gp195 B-cell and T-cell epitopes may be under control of the major histocompatibility complex.

  10. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  11. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  12. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama; area 4

    USGS Publications Warehouse

    Planert, Michael; Pritchett, J.L.

    1989-01-01

    The U.S. Geological Survey, in cooperation with the Alabama Department of Environmental Management, is conducting a series of geohydrologic studies to delineate the major aquifers (those which provide water for public supplies) in Alabama, their recharge areas, and areas susceptible to contamination. This report summarizes these factors for two major aquifers in Area 4--Calhoun, Jefferson, St. Clair, Shelby, and Talladega Counties. The major aquifers in the study area are in Cambrian and Ordovician and Mississippian rocks. Highest yields from aquifers are associated with solution openings in carbonate rocks. Springs in the area provide substantial amounts of water for municipal supply. Coldwater Spring provides 17 million gal of water/day to the city of Anniston, the largest groundwater user in the area. All recharge areas for the aquifers are susceptible to contamination from land surface. Two conditions exist in the study area that may cause the aquifers to be highly susceptible to contamination on a local scale: fracturing of rock materials due to faulting and the production of a porous cherty soil through weathering. Where sinkholes are present, there may be a direct connection between the land surface and the aquifer. Areas with sinkholes are considered to be extremely susceptible to contamination. (USGS)

  13. Deep Sequencing of the Trypanosoma cruzi GP63 Surface Proteases Reveals Diversity and Diversifying Selection among Chronic and Congenital Chagas Disease Patients

    PubMed Central

    Llewellyn, Martin S.; Messenger, Louisa A.; Luquetti, Alejandro O.; Garcia, Lineth; Torrico, Faustino; Tavares, Suelene B. N.; Cheaib, Bachar; Derome, Nicolas; Delepine, Marc; Baulard, Céline; Deleuze, Jean-Francois; Sauer, Sascha; Miles, Michael A.

    2015-01-01

    Background Chagas disease results from infection with the diploid protozoan parasite Trypanosoma cruzi. T. cruzi is highly genetically diverse, and multiclonal infections in individual hosts are common, but little studied. In this study, we explore T. cruzi infection multiclonality in the context of age, sex and clinical profile among a cohort of chronic patients, as well as paired congenital cases from Cochabamba, Bolivia and Goias, Brazil using amplicon deep sequencing technology. Methodology/ Principal Findings A 450bp fragment of the trypomastigote TcGP63I surface protease gene was amplified and sequenced across 70 chronic and 22 congenital cases on the Illumina MiSeq platform. In addition, a second, mitochondrial target—ND5—was sequenced across the same cohort of cases. Several million reads were generated, and sequencing read depths were normalized within patient cohorts (Goias chronic, n = 43, Goias congenital n = 2, Bolivia chronic, n = 27; Bolivia congenital, n = 20), Among chronic cases, analyses of variance indicated no clear correlation between intra-host sequence diversity and age, sex or symptoms, while principal coordinate analyses showed no clustering by symptoms between patients. Between congenital pairs, we found evidence for the transmission of multiple sequence types from mother to infant, as well as widespread instances of novel genotypes in infants. Finally, non-synonymous to synonymous (dn:ds) nucleotide substitution ratios among sequences of TcGP63Ia and TcGP63Ib subfamilies within each cohort provided powerful evidence of strong diversifying selection at this locus. Conclusions/Significance Our results shed light on the diversity of parasite DTUs within each patient, as well as the extent to which parasite strains pass between mother and foetus in congenital cases. Although we were unable to find any evidence that parasite diversity accumulates with age in our study cohorts, putative diversifying selection within members of the TcGP63I

  14. Class I major histocompatibility proteins as cell surface receptors for simian virus 40.

    PubMed Central

    Atwood, W J; Norkin, L C

    1989-01-01

    Class I major histocompatibility complex proteins appear to be the major cell surface receptors for simian virus 40 (SV40), as implied by the following observations. Adsorption of SV40 to LLC-MK2 rhesus monkey kidney cells specifically inhibited binding of a monoclonal antibody (MAb) against class I human lymphocyte antigen (HLA) proteins. Conversely, pretreatment of LLC-MK2 cells with anti-HLA MAbs inhibited infection by SV40. The ability of anti-HLA to inhibit infection was greatly reduced when the order of addition of the anti-HLA and the virus was reversed. Infection was also inhibited by preincubating SV40 with purified soluble class I protein. Finally, human lymphoblastoid cells of the Daudi line, which do not express class I major histocompatibility complex proteins, were infected at relatively low levels with SV40 virions. In a control experiment, we found that pretreatment of cells with a MAb specific for the leukocytic-function-associated antigen LFA-3 actually enhanced infection. This finding may also support the premise that class I major histocompatibility complex proteins are receptors for SV40. PMID:2476575

  15. Group B Streptococcus surface proteins as major determinants for meningeal tropism.

    PubMed

    Tazi, Asmaa; Bellais, Samuel; Tardieux, Isabelle; Dramsi, Shaynoor; Trieu-Cuot, Patrick; Poyart, Claire

    2012-02-01

    Streptococcus agalactiae (group B Streptococcus, GBS), a normal constituent of the intestinal microbiota is the major cause of human neonatal infections and a worldwide spread 'hypervirulent' clone, GBS ST-17, is strongly associated with neonatal meningitis. Adhesion to epithelial and endothelial cells constitutes a key step of the infectious process. Therefore GBS surface-anchored proteins are obvious potential adhesion mediators of barrier crossing and determinant of hypervirulence. This review addresses the most recent molecular insights gained from studies on GBS surface proteins proven to be involved in the crossing of the brain-blood barrier and emphasizes on the specificity of a hypervirulent clone that displays meningeal tropism. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens

    SciTech Connect

    Tomavo, S.; Schwarz, R.T.; Dubremetz, J.F. )

    1989-10-01

    The four major surface antigens of Toxoplasma gondii tachyzoites (P43, P35, P30, and P22) were made water soluble by phosphatidylinositol-specific phospholipase C (PI-PLC). These antigens were biosynthetically labeled with {sup 3}H-fatty acids, ({sup 3}H)ethanolamine, and ({sup 3}H)carbohydrates. Treatment of {sup 3}H-fatty-acid-labeled parasite lysates with PI-PLC removed the radioactive label from these antigens. A cross-reacting determinant was exposed on these antigens after PI-PLC treatment.

  17. Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens.

    PubMed Central

    Tomavo, S; Schwarz, R T; Dubremetz, J F

    1989-01-01

    The four major surface antigens of Toxoplasma gondii tachyzoites (P43, P35, P30, and P22) were made water soluble by phosphatidylinositol-specific phospholipase C (PI-PLC). These antigens were biosynthetically labeled with 3H-fatty acids, [3H]ethanolamine, and [3H]carbohydrates. Treatment of 3H-fatty-acid-labeled parasite lysates with PI-PLC removed the radioactive label from these antigens. A cross-reacting determinant was exposed on these antigens after PI-PLC treatment. Images PMID:2531282

  18. Detection of protease and protease activity using a single nanocrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2015-09-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  19. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  20. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  1. Regulatory Characteristics of Bacillus pumilus Protease Promoters.

    PubMed

    Toymentseva, Anna A; Mascher, Thorsten; Sharipova, Margarita R

    2017-05-01

    Expression of extracellular protease genes of Bacilli is subject to regulation by many positive and negative regulators. Here we analyzed 5' regulatory regions of genes encoding proteolytic proteases AprBp, GseBp, and MprBp from Bacillus pumilus strain 3-19. Gfp fusion constructs with upstream genomic regions of different lengths were created for all three genes to identify their natural promoters (regulatory regions). Our results suggest that the aprBp gene, encoding the major subtilisin-like protease, has the most extensive promoter region of approximately 445 bp, while the minor protease genes encoding glutamyl endopeptidase (gseBp) and metalloproteinase (mprBp) are preceded by promoters of 150 and 250 bp in length, respectively. Promoter analysis of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporter fusion constructs in degU and spo0A mutants indicates a positive regulatory effect of DegU and Spo0A on protease expression, while the disruption of abrB, sinR, and scoC repressor genes did not significantly affect promoter activities of all protease genes. On the other hand, the expression of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporters increased 1.6- and 3.0-fold, respectively, in sigD-deficient cells, indicating that the prevention of motility gene expression promotes protease expression. Our results indicate that all examined regulators regulated serine proteases production in B. subtilis.

  2. Temporal changes of surface wave velocity associated with major Sumatra earthquakes from ambient noise correlation.

    PubMed

    Xu, Zhen J; Song, Xiaodong

    2009-08-25

    Detecting temporal changes of the medium associated with major earthquakes has implications for understanding earthquake genesis. Here we report temporal changes of surface wave velocity over a large area associated with 3 major Sumatra earthquakes in 2004, 2005, and 2007. We use ambient noise correlation to retrieve empirical Green's function (EGF) of surface waves between stations. Because the process is completely repeatable, the technique is powerful in detecting possible temporal change of medium. We find that 1 excellent station pair (PSI in Indonesia and CHTO in Thailand) shows significant time shifts (up to 1.44 s) after the 2004 and 2005 events in the Rayleigh waves at 10-20 s but not in the Love waves, suggesting that the Rayleigh time shifts are not from clock error. The time shifts are frequency dependent with the largest shifts at the period band of 11-16 s. We also observe an unusual excursion approximately 1 month before the 2004 event. We obtain a total of 17 pairs for June, 2007 to June, 2008, which allow us to examine the temporal and spatial variation of the time shifts. We observed strong anomalies (up to 0.68 s) near the epicenter after the 2007 event, but not in the region further away from the source or before the event or 3 months after the event. The observations are interpreted as stress changes and subsequent relaxation in upper-mid crust in the immediate vicinity of the rupture and the broad area near the fault zone.

  3. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  4. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  5. Protein structural and surface water rearrangement constitute major events in the earliest aggregation stages of tau

    PubMed Central

    Pavlova, Anna; Cheng, Chi-Yuan; Kinnebrew, Maia; Lew, John; Dahlquist, Frederick W.; Han, Songi

    2016-01-01

    Protein aggregation plays a critical role in the pathogenesis of neurodegenerative diseases, and the mechanism of its progression is poorly understood. Here, we examine the structural and dynamic characteristics of transiently evolving protein aggregates under ambient conditions by directly probing protein surface water diffusivity, local protein segment dynamics, and interprotein packing as a function of aggregation time, along the third repeat domain and C terminus of Δtau187 spanning residues 255–441 of the longest isoform of human tau. These measurements were achieved with a set of highly sensitive magnetic resonance tools that rely on site-specific electron spin labeling of Δtau187. Within minutes of initiated aggregation, the majority of Δtau187 that is initially homogeneously hydrated undergoes structural transformations to form partially structured aggregation intermediates. This is reflected in the dispersion of surface water dynamics that is distinct around the third repeat domain, found to be embedded in an intertau interface, from that of the solvent-exposed C terminus. Over the course of hours and in a rate-limiting process, a majority of these aggregation intermediates proceed to convert into stable β-sheet structured species and maintain their stacking order without exchanging their subunits. The population of β-sheet structured species is >5% within 5 min of aggregation and gradually grows to 50–70% within the early stages of fibril formation, while they mostly anneal block-wisely to form elongated fibrils. Our findings suggest that the formation of dynamic aggregation intermediates constitutes a major event occurring in the earliest stages of tau aggregation that precedes, and likely facilitates, fibril formation and growth. PMID:26712030

  6. The Death Valley turtlebacks reinterpreted as Miocene­ Pliocene folds of a major detachment surface

    USGS Publications Warehouse

    Holm, Daniel K.; Fleck, Robert J.; Lux, Daniel R.

    1994-01-01

    Determining the origin of extension parallel folds in metamorphic core complexes is fundamental to understanding the development of detachment faults. An excellent example of such a feature occurs in the Death Valley region of California where a major, undulatory, detachment fault is exposed along the well-known turtleback (antiformal) surfaces of the Black Mountains. In the hanging wall of this detachment fault are deformed strata of the Copper Canyon Formation. New age constraints indicate that the Copper Canyon Formation was deposited from ~6 to 3 Ma. The formation was folded during deposition into a SE-plunging syncline with an axial surface coplanar with that of a synform in the underlying detachment. This relation suggests the turtlebacks are a folded detachment surface formed during large-scale extension in an overall constrictional strain field. The present, more planar, Black Mountains frontal fault system may be the result of out-stepping of a normal fault system away from an older detachment fault that was deactivated by folding.

  7. The Treponema denticola Major Sheath Protein Is Predominantly Periplasmic and Has Only Limited Surface Exposure

    PubMed Central

    Caimano, Melissa J.; Bourell, Kenneth W.; Bannister, Teresa D.; Cox, David L.; Radolf, Justin D.

    1999-01-01

    The recent discovery that the Treponema pallidum genome encodes 12 orthologs of the Treponema denticola major sheath protein (Msp) prompted us to reexamine the cellular location and topology of the T. denticola polypeptide. Experiments initially were conducted to ascertain whether Msp forms an array on or within the T. denticola outer membrane. Transmission electron microscopy (EM) of negatively stained and ultrathin-sectioned organisms failed to identify a typical surface layer, whereas freeze-fracture EM revealed that the T. denticola outer membrane contains heterogeneous transmembrane proteins but no array. In contrast, a lattice-like structure was observed in vesicles released from mildly sonicated treponemes; combined EM and biochemical analyses demonstrated that this structure was the peptidoglycan sacculus. Immunoelectron microscopy (IEM) subsequently was performed to localize Msp in T. denticola. Examination of negatively stained whole mounts identified substantial amounts of Msp in sonicated organisms. IEM of ultrathin-sectioned, intact treponemes also demonstrated that the preponderance of antigen was unassociated with the outer membrane. Lastly, immunofluorescence analysis of treponemes embedded in agarose gel microdroplets revealed that only minor portions of Msp are surface exposed. Taken as a whole, our findings challenge the widely held belief that Msp forms an array within the T. denticola outer membrane and demonstrate, instead, that it is predominantly periplasmic with only limited surface exposure. These findings also have implications for our evolving understanding of the contribution(s) of Msp/Tpr orthologs to treponemal physiology and disease pathogenesis. PMID:10417176

  8. Arabidopsis AtSerpin1, Crystal Structure and in Vivo Interaction with Its Target Protease RESPONSIVE TO DESICCATION-21 (RD21)

    SciTech Connect

    Lampl, Nardy; Budai-Hadrian, Ofra; Davydov, Olga; Joss, Tom V.; Harrop, Stephen J.; Curmi, Paul M.G.; Roberts, Thomas H.; Fluhr, Robert

    2010-05-25

    In animals, protease inhibitors of the serpin family are associated with many physiological processes, including blood coagulation and innate immunity. Serpins feature a reactive center loop (RCL), which displays a protease target sequence as a bait. RCL cleavage results in an irreversible, covalent serpin-protease complex. AtSerpin1 is an Arabidopsis protease inhibitor that is expressed ubiquitously throughout the plant. The x-ray crystal structure of recombinant AtSerpin1 in its native stressed conformation was determined at 2.2 {angstrom}. The electrostatic surface potential below the RCL was found to be highly positive, whereas the breach region critical for RCL insertion is an unusually open structure. AtSerpin1 accumulates in plants as a full-length and a cleaved form. Fractionation of seedling extracts by nonreducing SDS-PAGE revealed the presence of an additional slower migrating complex that was absent when leaves were treated with the specific cysteine protease inhibitor l-trans-epoxysuccinyl-l-leucylamido (4-guanidino)butane. Significantly, RESPONSIVE TO DESICCATION-21 (RD21) was the major protease labeled with the l-trans-epoxysuccinyl-l-leucylamido (4-guanidino)butane derivative DCG-04 in wild type extracts but not in extracts of mutant plants constitutively overexpressing AtSerpin1, indicating competition. Fractionation by nonreducing SDS-PAGE followed by immunoblotting with RD21-specific antibody revealed that the protease accumulated both as a free enzyme and in a complex with AtSerpin1. Importantly, both RD21 and AtSerpin1 knock-out mutants lacked the serpin-protease complex. The results establish that the major Arabidopsis plant serpin interacts with RD21. This is the first report of the structure and in vivo interaction of a plant serpin with its target protease.

  9. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  10. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  11. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier

    PubMed Central

    Hasnain, Sumaira Z.; McGuckin, Michael A.; Grencis, Richard K.; Thornton, David J.

    2012-01-01

    The polymeric mucin component of the intestinal mucus barrier changes during nematode infection to provide not only physical protection but also to directly affect pathogenic nematodes and aid expulsion. Despite this, the direct interaction of the nematodes with the mucins and the mucus barrier has not previously been addressed. We used the well-established Trichuris muris nematode model to investigate the effect on mucins of the complex mixture of immunogenic proteins secreted by the nematode called excretory/secretory products (ESPs). Different regimes of T. muris infection were used to simulate chronic (low dose) or acute (high dose) infection. Mucus/mucins isolated from mice and from the human intestinal cell line, LS174T, were treated with ESPs. We demonstrate that serine protease(s) secreted by the nematode have the ability to change the properties of the mucus barrier, making it more porous by degrading the mucin component of the mucus gel. Specifically, the serine protease(s) acted on the N-terminal polymerising domain of the major intestinal mucin Muc2, resulting in depolymerisation of Muc2 polymers. Importantly, the respiratory/gastric mucin Muc5ac, which is induced in the intestine and is critical for worm expulsion, was protected from the depolymerising effect exerted by ESPs. Furthermore, serine protease inhibitors (Serpins) which may protect the mucins, in particular Muc2, from depolymerisation, were highly expressed in mice resistant to chronic infection. Thus, we demonstrate that nematodes secrete serine protease(s) to degrade mucins within the mucus barrier, which may modify the niche of the parasite to prevent clearance from the host or facilitate efficient mating and egg laying from the posterior end of the parasite that is in intimate contact with the mucus barrier. However, during a TH2-mediated worm expulsion response, serpins, Muc5ac and increased levels of Muc2 protect the barrier from degradation by the nematode secreted protease(s). PMID

  12. Pneumococcal Surface Protein A Plays a Major Role in Streptococcus pneumoniae-Induced Immunosuppression.

    PubMed

    Saumyaa; Pujanauski, Lindsey; Colino, Jesus; Flora, Michael; Torres, Raul M; Tuomanen, Elaine; Snapper, Clifford M

    2016-05-01

    Intact, inactivated Streptococcus pneumoniae [including the unencapsulated S. pneumoniae, serotype 2 strain (R36A)] markedly inhibits the humoral immune response to coimmunized heterologous proteins, a property not observed with several other intact Gram-positive or Gram-negative bacteria. In this study, we determined the nature of this immunosuppressive property. Because phosphorylcholine (PC), a major haptenic component of teichoic acid in the S. pneumoniae cell wall, and lipoteichoic acid in the S. pneumoniae membrane were previously reported to be immunosuppressive when derived from filarial parasites, we determined whether R36A lacking PC (R36A(pc-)) was inhibitory. Indeed, although R36A(pc-) exhibited a markedly reduced level of inhibition of the IgG response to coimmunized chicken OVA (cOVA), no inhibition was observed when using several other distinct PC-expressing bacteria or a soluble, protein-PC conjugate. Further, treatment of R36A with periodate, which selectively destroys PC residues, had no effect on R36A-mediated inhibition. Because R36A(pc-) also lacks choline-binding proteins (CBPs) that require PC for cell wall attachment, and because treatment of R36A with trypsin eliminated its inhibitory activity, we incubated R36A in choline chloride, which selectively strips CBPs from its surface. R36A lacking CBPs lost most of its inhibitory property, whereas the supernatant of choline chloride-treated R36A, containing CBPs, was markedly inhibitory. Coimmunization studies using cOVA and various S. pneumoniae mutants, each genetically deficient in one of the CBPs, demonstrated that only S. pneumoniae lacking the CBP pneumococcal surface protein A lost its ability to inhibit the IgG anti-cOVA response. These results strongly suggest that PspA plays a major role in mediating the immunosuppressive property of S. pneumoniae.

  13. Pneumococcal surface protein A plays a major role in Streptococcus pneumoniae-induced immunosuppression

    PubMed Central

    Saumyaa; Pujanauski, Lindsey; Colino, Jesus; Flora, Michael; Torres, Raul M; Tuomanen, Elaine; Snapper, Clifford M

    2016-01-01

    Intact, inactivated Streptococcus pneumoniae (Pn) [including the unencapsulated strain, R36A], markedly inhibits the humoral immune response to co-immunized heterologous proteins, a property not observed with several other intact Gram-positive or Gram-negative bacteria. In this study, we determined the nature of this immunosuppressive property. Since phosphorylcholine (PC), a major haptenic component of teichoic acid in the Pn cell wall, and lipoteichoic acid in the Pn membrane, was previously reported to be immunosuppresive when derived from filarial parasites, we determined whether R36A lacking PC (R36Apc-) was inhibitory. Indeed, although R36Apc- exhibited a markedly reduced level of inhibition of the IgG response to co-immunized cOVA, no inhibition was observed when using several other distinct PC-expressing bacteria or a soluble, protein-PC conjugate. Further, treatment of R36A with periodate, which selectively destroys PC residues, had no effect on R36A-mediated inhibition. Since R36Apc- also lacks choline-binding proteins (CBPs), that require PC for cell wall attachment, and since treatment of R36A with trypsin eliminated its inhibitory activity, we incubated R36A in choline chloride, which selectively strips CBPs from its surface. R36A lacking CBPs lost most of its inhibitory property, whereas the supernatant of choline chloride-treated R36A, containing CBPs, was markedly inhibitory. Co-immunization studies using cOVA and various Pn mutants, each genetically deficient in one of the CBPs, demonstrated that only Pn lacking the CBP, pneumococcal surface protein A (PspA), lost its ability to inhibit the IgG anti-cOVA response. These results strongly suggest that PspA plays a major role in mediating the immunosuppressive property of Pn. PMID:27029587

  14. Temporal changes of surface wave velocity associated with major Sumatra earthquakes from ambient noise correlation

    PubMed Central

    Xu, Zhen J.; Song, Xiaodong

    2009-01-01

    Detecting temporal changes of the medium associated with major earthquakes has implications for understanding earthquake genesis. Here we report temporal changes of surface wave velocity over a large area associated with 3 major Sumatra earthquakes in 2004, 2005, and 2007. We use ambient noise correlation to retrieve empirical Green's function (EGF) of surface waves between stations. Because the process is completely repeatable, the technique is powerful in detecting possible temporal change of medium. We find that 1 excellent station pair (PSI in Indonesia and CHTO in Thailand) shows significant time shifts (up to 1.44 s) after the 2004 and 2005 events in the Rayleigh waves at 10–20 s but not in the Love waves, suggesting that the Rayleigh time shifts are not from clock error. The time shifts are frequency dependent with the largest shifts at the period band of 11–16 s. We also observe an unusual excursion ∼1 month before the 2004 event. We obtain a total of 17 pairs for June, 2007 to June, 2008, which allow us to examine the temporal and spatial variation of the time shifts. We observed strong anomalies (up to 0.68 s) near the epicenter after the 2007 event, but not in the region further away from the source or before the event or 3 months after the event. The observations are interpreted as stress changes and subsequent relaxation in upper-mid crust in the immediate vicinity of the rupture and the broad area near the fault zone. PMID:19667205

  15. Temporal trends of surface urban heat islands and associated determinants in major Chinese cities.

    PubMed

    Yao, Rui; Wang, Lunche; Huang, Xin; Niu, Zigeng; Liu, Fongfu; Wang, Qing

    2017-12-31

    There are many studies focusing on spatial variations of surface urban heat islands (SUHIs) in literature. In this study, MODIS land surface temperature (LST) data and China's Land Use/Cover Datasets (CLUDs) were used to examine the temporal trends of SUHIs in 31 major Chinese cities during 2001-2015 using three indicators: SUHI intensity (SUHII), area of the SUHI (AreaSUHI) and percentage of area with increasing SUHII (PAISUHII). Correlation analyses between SUHII and background (rural) LST (extracted from MODIS LST), vegetation coverage (reflected by MODIS EVI data) and anthropogenic heat release (reflected by nighttime light data) were performed from temporal rather than spatial perspectives. Our findings showed that the SUHII and AreaSUHI in urbanized areas increased significantly in most cities in summer days, whereas they increased significantly in approximately half and more than half of the cities in summer and winter nights, respectively. In summer days, summer nights and winter nights, the PAISUHII was approximately 80% and over 50% in union areas and the 20km buffer, respectively. Correlation analyses indicated that the SUHII in stable urban areas was negatively correlated with the background LST in summer and winter days for most cities, especially in northern China. A reduction in vegetation contributed to the increasing SUHII in urbanized areas in summer days and nights. The increasing anthropogenic heat release was an important factor for increases in the SUHII in urbanized areas. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Surface Nitrification: A Major Uncertainty in Marine N2O Emissions

    NASA Technical Reports Server (NTRS)

    Zamora, Lauren M.; Oschlies, Andreas

    2014-01-01

    The ocean is responsible for up to a third of total global nitrous oxide (N2O) emissions, but uncertainties in emission rates of this potent greenhouse gas are high (approaching 100%). Here we use a marine biogeochemical model to assess six major uncertainties in estimates of N2O production, thereby providing guidance in how future studies may most effectively reduce uncertainties in current and future marine N2O emissions. Potential surface N2O production from nitrification causes the largest uncertainty in N2O emissions (estimated up to approximately 1.6 Tg N/yr (sup -1) or 48% of modeled values), followed by the unknown oxygen concentration at which N2O production switches to N2O consumption (0.8 Tg N/yr (sup -1)or 24% of modeled values). Other uncertainties are minor, cumulatively changing regional emissions by less than 15%. If production of N2O by surface nitrification could be ruled out in future studies, uncertainties in marine N2O emissions would be halved.

  17. Major surface antigen, P30, of Toxoplasma gondii is anchored by a glycolipid

    SciTech Connect

    Nagel, S.D.; Boothroyd, J.C.

    1989-04-05

    P30, the major surface antigen of the parasitic protozoan Toxoplasma gondii, can be specifically labeled with (/sup 3/H)palmitic acid and with myo-(2-/sup 3/H)inositol. The fatty acid label can be released by treatment of P30 with phosphatidylinositol-specific phospholipase C (PI-PLC). Such treatment exposes an immunological cross-reacting determinant first described on Trypanosoma brucei variant surface glycoprotein. PI-PLC cleavage of intact parasites metabolically labeled with (/sup 35/S)methionine results in the release of intact P30 polypeptide in a form which migrates faster in polyacrylamide gel electrophoresis. These results argue that P30 is anchored by a glycolipid. Results from thin layer chromatography analysis of purified (/sup 3/H) palmitate-labeled P30 treated with PI-PLC, together with susceptibility to mild alkali hydrolysis and to cleavage with phospholipase A2, suggest that the glycolipid anchor of T. gondii P30 includes a 1,2-diacylglycerol moiety.

  18. Surface nitrification: A major uncertainty in marine N2O emissions

    NASA Astrophysics Data System (ADS)

    Zamora, Lauren M.; Oschlies, Andreas

    2014-06-01

    The ocean is responsible for up to a third of total global nitrous oxide (N2O) emissions, but uncertainties in emission rates of this potent greenhouse gas are high (>100%). Here we use a marine biogeochemical model to assess six major uncertainties in estimates of N2O production, thereby providing guidance in how future studies may most effectively reduce uncertainties in current and future marine N2O emissions. Potential surface N2O production from nitrification causes the largest uncertainty in N2O emissions (estimated up to ~1.6 Tg N yr-1 or 48% of modeled values), followed by the unknown oxygen concentration at which N2O production switches to N2O consumption (0.8 Tg N yr-1 or 24% of modeled values). Other uncertainties are minor, cumulatively changing regional emissions by <15%. If production of N2O by surface nitrification could be ruled out in future studies, uncertainties in marine N2O emissions would be halved.

  19. Nearest-neighbor interactions of the major RNA tumor virus glycoprotein on murine cell surfaces.

    PubMed Central

    Takemoto, L J; Fox, C F; Jensen, F C; Elder, J H; Lerner, R A

    1978-01-01

    Formaldehyde-fixed Staphylococcus aureus and monospecific antiserum to gp70, the major envelope glycoprotein of murine leukemia virus, were used to immunoadsorb gp70 from Nonidet P40 extracts prepared from surface-radioiodinated murine cells. The labeled gp70 molecules in these cells were linked to a protein of approximately 15,000 daltons via native disulfide bonding. Prior treatment of cells with the reversible, bifunctional, crosslinking reagent dimethyl-3,3'-dithiobispropionimidate, followed by immunoadsorption and two-dimensional diagonal electrophoresis, revealed apparent homodimers and homotrimers of the 85,000-dalton complex. Identical treatment of purified type C RNA tumor virus from murine cells also revealed homodimeric and homotrimeric species, demonstrating similar self-associating tendencies of this glycoprotein in both intact virus and the plasma membrane of nonproducing murine cells. One cross-linked product consistently detected on the surfaces of murine cells was not present after crosslinking of a representative strain of murine leukemia virus. Images PMID:211503

  20. Relating Major Surface Processes to the Deep Earth — The Importance of the Miocene

    NASA Astrophysics Data System (ADS)

    Potter, P. E.; Szatmari, P.

    2012-12-01

    Many global scale tectonic, oceanic and climate changes began in the Tertiary with global tectonics as the underlying driving force and changed the world. In full flower by the beginning of the Middle Miocene around 16 Ma, these changes continued through the Late Miocene into the present so we can firmly say that most of our modern world, continental glaciations excepted, began in the Middle and Late Miocene. We summarize in a flow diagram how the major earth surface processes active in the Miocene are related to the Deep Earth as understood by recent advances in seismic tomography. This 11 Ma interval had two global orogenic zones, the Alpine-Tethyan orogen from Gibraltar across southern Asia into Vietnam and around the Pacific Rim, both crustal expressions of downwellings taking place, especially in the upper mantle. These downwellings are balanced by upwellings in the lower mantle in and on the rim of the African and Pacific superplumes, which are large, low-shear velocity provinces; part of the rising plumes originated from the most extensively melted regions of the core-mantle boundary layer, D", where heat flow from the outer core is highest. Together these up-and downwellings indicate that mantle convection extended, at least periodically, through the whole mantle and reflected lateral variations in convection and heat flow in the cooling and slowly crystallizing outer core. Correlation of mantle convection with surface features is most evident in the uppermost mantle whose dynamic topography is readily reflected by the subsidence and tilting of continents moving toward the downwelling zones. Because they are closely synchronous, these two orogenic belts had enormous consequences for the earth's surface, and because they are close to us in time, they are easy to study and sample. Thus the Miocene is ideal to study for both its many global intra connections and for their link to the Deep Earth. As these two orogenies developed, they changed a global warm

  1. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  2. Optimizing protease production from an isolate of the nematophagous fungus Duddingtonia flagrans using response surface methodology and its larvicidal activity on horse cyathostomins.

    PubMed

    Braga, F R; Araújo, J V; Soares, F E F; Araujo, J M; Genier, H L A; Silva, A R; Carvalho, R O; Queiroz, J H; Ferreira, S R

    2011-06-01

    Protease production from Duddingtonia flagrans (isolate AC001) was optimized and the larvicidal activity of the enzymatic extract was evaluated on infective horse cyathostomin larvae (L3). Duddingtonia flagrans was grown in liquid medium with eight different variables: glucose, casein, bibasic potassium phosphate (K2HPO4), magnesium sulphate (MgSO4), zinc sulphate (ZnSO4), ferrous sulphate (FeSO4), copper sulphate (CuSO4) and temperature. The Plackett-Burman analysis showed a significant influence of MgSO4, CuSO4 and casein (P < 0.05) on protease production by D. flagrans in liquid medium. Central composite design indicated that the highest proteolytic activity was 39.56 U/ml as a function of the concentrations of casein (18.409 g/l), MgSO4 (0.10 g/l) and CuSO4 (0.50 mg/l). A significant difference (P < 0.01) was found for the larval number between the treated and control groups at the end of the experiment. A reduction of 95.46% in the number of free-living larvae was found in the treated group compared with the control. The results of this study suggest that protease production by D. flagrans (AC001) in liquid medium was optimized by MgSO4, CuSO4 and casein, showing that the optimized enzymatic extract exerted larvicidal activity on cyathostomins and therefore may contribute to large-scale industrial production.

  3. Complex regulation of transcription from the hepatitis B virus major surface antigen promoter in human hepatoma cell lines.

    PubMed Central

    Raney, A K; Milich, D R; McLachlan, A

    1991-01-01

    A detailed mutational analysis of the regulatory DNA sequence elements that control expression of the hepatitis B virus major surface antigen gene was performed in the human hepatoma cell lines HepG2.1 and Huh7, using transient transfection assays. Seven regions (A to G) of the major surface antigen promoter located within 200 nucleotides of the RNA initiation site have been identified which influence the level of transcription from this promoter. The three distal regions (A to C), located between -188 and -68, appear to possess a level of redundancy in their ability to influence the transcriptional activity from the major surface antigen promoter. The simultaneous deletion of regions A, B, and C resulted in an approximately fourfold reduction in transcription from the major surface antigen promoter. Region D, located between -67 and -49, is an essential element of the major surface antigen promoter. The three proximal regions (E to G) are located within 45 nucleotides of the major transcription initiation site. Region E prevents the negative influence of region F and can compensate for the effect of mutation of region G on transcription from the major surface antigen promoter. Region G can compensate for the effect of the loss of a functional region E sequence on the transcriptional activity of the major surface antigen promoter only in the absence of a functional region F sequence. These results imply that the level of expression of the major surface antigen gene is controlled by the complex interplay between a minimum of six transcription factors which activate and one transcription factor which represses transcription from this gene. PMID:1651407

  4. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  5. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  6. Protease inhibitor studies enrolling.

    PubMed

    1995-01-01

    The protease enzyme is essential for HIV to make copies of itself. So far, research has failed to find a protease inhibitor that works against HIV. It is believed that, regardless of what type of protease inhibitor someone takes, it will need to be supplemented with other anti-HIV drugs. Three protease inhibitors have thus far been found to be safe, although long-term effects are unknown. These drugs are saquinavir, ABT-538, and L-735,524 produced by Hoffman-LaRoche, Abbott, and Merck respectively. Clinical trials of saquinavir are promising but it has not been shown to be the knock-out drug needed. ABT-538 has high bioavailability, but studies are showing it can cause liver and eye damage. L-735,524 studies are showing that resistance develops quite quickly. Future studies at higher doses are expected. To obtain information on protease studies currently looking for participants, contact The Network. Information on other approved, alternative, and experimental drugs is also available.

  7. Saquinavir, the pioneer antiretroviral protease inhibitor.

    PubMed

    la Porte, Charles J L

    2009-10-01

    The treatment of HIV infection underwent a major change in 1995 when saquinavir was the first protease inhibitor introduced into the market. This drug made the use of combination therapy in the treatment of HIV possible and increased the success rate of treatment. This article will review recent literature on saquinavir to define its current role in HIV treatment, among the newer antiretroviral drugs. Scientific literature and conference presentations were evaluated for relevant information pertaining to saquinavir. Although underused, saquinavir has good efficacy and tolerability when compared to other protease inhibitors. The film-coated tablet formulation improved pill burden. Saquinavir still has potential in the treatment of adults, children and pregnant women.

  8. Identification of weak points of hepatitis C virus NS3 protease inhibitors using surface plasmon resonance biosensor-based interaction kinetic analysis and genetic variants.

    PubMed

    Svahn Gustafsson, Sofia; Ehrenberg, Angelica; Schmuck, Benjamin; Anwar, Muhammad Ikram; Danielson, U Helena

    2014-03-13

    To aid the design of next generation hepatitis C virus (HCV) drugs, the kinetics of the interactions between NS3 protease inhibitors and enzyme from genotypes 1a, 1b, and 3a have been characterized. The linear mechanism-based inhibitors VX-950 (telaprevir) and SCH 503034 (boceprevir) benefited from covalent adduct formation. However, the apparent affinities were rather weak (VX-950, K(D)* of 340, 8.5, and 1000 nM for genotypes 1a, 1b and 3a, respectively; SCH 503034, K(D)* of 90 and 3.9 nM for 1b and 3a, respectively). The non-mechanism-based macrocyclic inhibitors BILN-2016 (ciluprevir) and ITMN-191 (danoprevir) had faster association and slower dissociation kinetics, indicating that rigidification is kinetically favorable. ITMN-191 had nanomolar affinities for all genotypes (K(D)* of 0.13, 1.6, and 0.52 nM), suggesting that a broad spectrum drug is conceivable. The data show that macrocyclic scaffolds and mechanism-based inhibition are advantageous but that there is considerable room for improvement of the kinetics of HCV protease targeted drugs.

  9. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  10. Lunar mare soils: Space weathering and the major effects of surface-correlated nanophase Fe

    NASA Astrophysics Data System (ADS)

    Taylor, Lawrence A.; Pieters, Carlé M.; Keller, Lindsay P.; Morris, Richard V.; McKay, David S.

    2001-11-01

    Lunar soils form the ``ground truth'' for calibration and modeling of reflectance spectra for quantitative remote sensing. The Lunar Soil Characterization Consortium, a group of lunar sample and remote sensing scientists, has undertaken the extensive task of characterization of lunar soils, with respect to their mineralogical and chemical makeup. This endeavor is aimed at deciphering the effects of space weathering of soils from the Moon, and these results should apply to other airless bodies. Modal abundances and chemistries of minerals and glasses in the <45 μm size fractions of nine selected mare soils have been determined, along with the bulk chemistry of each size fraction, and their IS/FeO values. These data can be addressed at http:/web.utk.edu/~pgi/data.html. As grain size decreases, the bulk composition of each size fraction continuously changes and approaches the composition of the agglutinitic glasses. Past dogma had it that the majority of the nanophase Fe0 resides in the agglutinitic glasses. However, as grain size of a soil decreases, the percentage of the total iron present as nanophase-sized Fe0 increases dramatically, while the agglutinitic glass content rises only slightly. This is evidence for a large contribution to the IS/FeO values from surface-correlated nanophase Fe0, particularly in the <10 μm size fraction. This surficial nanophase Fe0 is present largely as vapor-deposited patinas on the surfaces of almost every particle of the mature soils. It is proposed that these vapor-deposited, nanophase Fe0-bearing patinas may have far greater effects upon reflectance spectra of mare soils than the agglutinitic Fe0.

  11. Ecological risk assessment of heavy metals in surface sediments of six major chinese freshwater lakes.

    PubMed

    Ma, Zongwei; Chen, Kai; Yuan, Zengwei; Bi, Jun; Huang, Lei

    2013-01-01

    An overall and comparative ecological risk assessment of heavy metal pollution (including Cu, Zn, Pb, Cd, Hg, Cr, As, and Ni) in surface sediments was conducted for six major shallow freshwater lakes (Taihu Lake, Chaohu Lake, Nansihu Lake, Dongting Lake, Poyang Lake, and Hongze Lake) in China. A spatial database with 339 sediment samples was created through an extensive literature survey. Consensus-based sediment quality guidelines (SQGs) were used as the effect thresholds due to the lack of local eco-toxicological information about heavy metals in the six lakes. The results show that the ecological risk of heavy metal pollution in surface sediments is highest in Dongting Lake, followed by Taihu Lake. Lakes Chaohu, Nansihu, Poyang, and Hongze are at a similar risk level, which is a little lower than that of Lake Taihu. High-risk areas that should be given more attention were identified by spatial analysis. The estuaries of the inlets and outlets of Dongting Lake and the Meiliang Bay in Taihu Lake were found to be such areas. Ineffective environmental supervision and management during the recent years of rapid economic and industrial development in China have led to the pollution of lake sediments by heavy metals. Rigid control and effective management measures to prevent heavy metal pollution are urgently needed in China. In addition, it is necessary for China to develop basic research on the local eco-toxicity and SQGs of freshwater sediments to provide a scientific basis for the management of lake sediment pollution. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  12. Cockroach protease allergen induces allergic airway inflammation via epithelial cell activation

    PubMed Central

    Kale, Sagar L.; Agrawal, Komal; Gaur, Shailendra Nath; Arora, Naveen

    2017-01-01

    Protease allergens are known to enhance allergic inflammation but their exact role in initiation of allergic reactions at mucosal surfaces still remains elusive. This study was aimed at deciphering the role of serine protease activity of Per a 10, a major cockroach allergen in initiation of allergic inflammation at mucosal surfaces. We demonstrate that Per a 10 increases epithelial permeability by disruption of tight junction proteins, ZO-1 and occludin, and enhances the migration of Monocyte derived dendritic cell precursors towards epithelial layer as exhibited by trans-well studies. Per a 10 exposure also leads to secretion of IL-33, TSLP and intracellular Ca2+ dependent increase in ATP levels. Further, in vivo experiments revealed that Per a 10 administration in mice elevated allergic inflammatory parameters along with high levels of IL-33, TSLP, IL-1α and uric acid in the mice lungs. We next demonstrated that Per a 10 cleaves CD23 (low affinity IgE receptor) from the surface of PBMCs and purified B cells and CD25 (IL-2 receptor) from the surface of PBMCs and purified T cells in an activity dependent manner, which might favour Th2 responses. In conclusion, protease activity of Per a 10 plays a significant role in initiation of allergic airway inflammation at the mucosal surfaces. PMID:28198394

  13. Size-segregated composition of particulate matter (PM) in major roadways and surface streets

    NASA Astrophysics Data System (ADS)

    Kam, W.; Liacos, J. W.; Schauer, J. J.; Delfino, R. J.; Sioutas, C.

    2012-08-01

    A sampling campaign was conducted to assess on-road particulate matter (PM) composition for three size fractions (PM10-2.5, PM2.5-0.25, and PM0.25) on three representative roadways in Los Angeles: 1) the I-110, a high-traffic freeway composed mostly of light-duty vehicles (LDVs), 2) the I-710, a major freeway for heavy-duty vehicles (HDVs) traveling to and from the Ports of Los Angeles and Long Beach, and 3) Wilshire/Sunset Blvd, two major surface streets. Concurrent sampling was conducted at the University of Southern California (USC), which was used as an urban background site. Two sets of PM samples were collected for each roadway, with a sampling duration of approximately 50 h for each set. The samples were analyzed for inorganic ions, elemental carbon (EC), organic carbon (OC), water-soluble OC (WSOC), and trace elements and metals. Results showed that the PM0.25 fraction is heavily influenced by on-road vehicular emissions, as indicated by average roadway PM concentrations that were 48.0 ± 9.4% higher than those observed at USC (p < 0.05), while the PM10-2.5 fraction is mostly influenced by resuspension of road dust and the PM2.5-0.25 fraction is mainly composed of secondary species. Overall, the composition of inorganic ions (%) was relatively consistent across the three roadway environments. With very low EC levels in PM10-2.5, the most notable difference among the three roadway environments was the PM2.5 EC levels observed on the I-710, which are 2.0 ± 0.2 μg m-3 and 4.1 times greater than USC, while levels on the I-110 and Wilshire/Sunset were 1.0 ± 0.2 μg m-3 and 0.6 ± 0.01 μg m-3 and 2.1 and 1.2 times greater, respectively. PM2.5 OC and WSOC concentrations were observed to be 1.6, 2.0, and 1.7 times greater on the I-110, I-710, and Wilshire/Sunset than corresponding levels at USC, respectively. Results from this study may have major public health implications for passengers who commute frequently on high-traffic roadways. Finally, a comparison of

  14. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  15. The immunization-induced antibody response to the Anaplasma marginale major surface protein 2 and its association with protective immunity

    USDA-ARS?s Scientific Manuscript database

    Many vector-borne pathogens evade clearance via rapid variation in immunogenic surface expressed proteins. In the case of A. marginale, the generation of major surface protein 2 (Msp2) variants allows for immune escape and long-term pathogen persistence. In the experiments reported here, we pose t...

  16. Functional and Immunological Relevance of Anaplasma marginale Major Surface Protein 1a Sequence and Structural Analysis

    PubMed Central

    Cabezas-Cruz, Alejandro; Passos, Lygia M. F.; Lis, Katarzyna; Kenneil, Rachel; Valdés, James J.; Ferrolho, Joana; Tonk, Miray; Pohl, Anna E.; Grubhoffer, Libor; Zweygarth, Erich; Shkap, Varda; Ribeiro, Mucio F. B.; Estrada-Peña, Agustín; Kocan, Katherine M.; de la Fuente, José

    2013-01-01

    Bovine anaplasmosis is caused by cattle infection with the tick-borne bacterium, Anaplasma marginale. The major surface protein 1a (MSP1a) has been used as a genetic marker for identifying A. marginale strains based on N-terminal tandem repeats and a 5′-UTR microsatellite located in the msp1a gene. The MSP1a tandem repeats contain immune relevant elements and functional domains that bind to bovine erythrocytes and tick cells, thus providing information about the evolution of host-pathogen and vector-pathogen interactions. Here we propose one nomenclature for A. marginale strain classification based on MSP1a. All tandem repeats among A. marginale strains were classified and the amino acid variability/frequency in each position was determined. The sequence variation at immunodominant B cell epitopes was determined and the secondary (2D) structure of the tandem repeats was modeled. A total of 224 different strains of A. marginale were classified, showing 11 genotypes based on the 5′-UTR microsatellite and 193 different tandem repeats with high amino acid variability per position. Our results showed phylogenetic correlation between MSP1a sequence, secondary structure, B-cell epitope composition and tick transmissibility of A. marginale strains. The analysis of MSP1a sequences provides relevant information about the biology of A. marginale to design vaccines with a cross-protective capacity based on MSP1a B-cell epitopes. PMID:23776456

  17. Sequence and immunogenicity of the Taenia saginata homologue of the major surface antigen of Echinococcus spp.

    PubMed

    Benitez, L; Harrison, L J; Parkhouse, R M; Gonzalez, L M; Gottstein, B; Garate, T

    1998-05-01

    A clone (R-Tso18) was isolated from a Taenia saginata oncosphere cDNA library by screening with sera from rabbits immunised with oncosphere extract. It contained a full-length cDNA sequence of 1893 bp with an open reading frame of 1680 bp, corresponding to 559 amino acids with a deduced molecular mass of 65.173 kDa and an isoelectric point of 6.08. The R-Tso18 protein showed 80-84% nucleotide identity with the major protoscolex surface antigens of Echinococcus multilocularis (EM10) and E. granulosus (EG10). Preliminary immunogenicity studies employing the radiolabeled R-Tso18 protein in immune co-precipitation assays indicated sero-positivity for T. saginata-infected calf sera (6/13), T. solium cysticercosis human (7/22) and pig (2/2) sera and E. multilocularis (6/10)- and E. granulosus (1/12)-infected human sera, whereas other helminth-infection sera were negative. As immuno-precipitation is a relatively insensitive assay, it was concluded that further studies on the diagnostic potential of the purified recombinant R-Tso18 antigen, or its peptides, are merited.

  18. Onset of Major Antarctic Ice-Sheet Retreat Driven by Extensive Surface Melt

    NASA Astrophysics Data System (ADS)

    Deconto, R. M.; Pollard, D.

    2016-12-01

    New Antarctic ice-sheet modeling that considers previously underappreciated effects of surface meltwater on ice-sheet dynamics has demonstrated the sensitivity of the ice sheet to atmospheric warming in addition to sub-ice oceanic warming. Here, we improve on our paleo-calibrated modeling of future ice-sheet retreat, using a bias-corrected, high-resolution regional atmospheric model that synchronizes time-evolving atmospheric climatologies with the SSTs and subsurface ocean temperatures that drive oceanic sub-ice melt rates. This approach avoids previous assumptions about the lagged response of Southern Ocean SSTs and Antarctic air temperatures relative to future greenhouse-gas forcing and produces future Antarctic climatologies in better agreement with other recent studies. The specification of modern observed climate, used to apply anomaly corrections with our atmospheric model, is also improved by using a monthly climatology provided by the RACMO2 regional climate model. We find that predicted future rates and magnitudes of ice-sheet retreat and sea-level rise are similar to our previous simulations. However, the revised atmospheric forcing delays the timing of the onset of retreat, with potential implications for coastal planning and policy. These results show that the future onset of major Antarctic ice-sheet retreat will be highly dependent on the details of evolving Antarctic climate, which remains uncertain due to complex linkages with lower-latitude atmospheric dynamics, ocean-ice feedbacks, recovery of the ozone hole, and uncertain future greenhouse-gas forcing.

  19. Members of the salivary gland surface protein (SGS) family are major immunogenic components of mosquito saliva.

    PubMed

    King, Jonas G; Vernick, Kenneth D; Hillyer, Julián F

    2011-11-25

    Mosquitoes transmit Plasmodium and certain arboviruses during blood feeding, when they are injected along with saliva. Mosquito saliva interferes with the host's hemostasis and inflammation response and influences the transmission success of some pathogens. One family of mosquito salivary gland proteins, named SGS, is composed of large bacterial-type proteins that in Aedes aegypti were implicated as receptors for Plasmodium on the basal salivary gland surface. Here, we characterize the biology of two SGSs in the malaria mosquito, Anopheles gambiae, and demonstrate their involvement in blood feeding. Western blots and RT-PCR showed that Sgs4 and Sgs5 are produced exclusively in female salivary glands, that expression increases with age and after blood feeding, and that protein levels fluctuate in a circadian manner. Immunohistochemistry showed that SGSs are present in the acinar cells of the distal lateral lobes and in the salivary ducts of the proximal lobes. SDS-PAGE, Western blots, bite blots, and immunization via mosquito bites showed that SGSs are highly immunogenic and form major components of mosquito saliva. Last, Western and bioinformatic analyses suggest that SGSs are secreted via a non-classical pathway that involves cleavage into a 300-kDa soluble fragment and a smaller membrane-bound fragment. Combined, these data strongly suggest that SGSs play an important role in blood feeding. Together with their role in malaria transmission, we propose that SGSs could be used as markers of human exposure to mosquito bites and in the development of disease control strategies.

  20. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  1. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  2. Vivianite is a major sink for phosphorus in methanogenic coastal surface sediments

    NASA Astrophysics Data System (ADS)

    Egger, Matthias; Jilbert, Tom; Behrends, Thilo; Rivard, Camille; Slomp, Caroline P.

    2015-11-01

    Studies of authigenic phosphorus (P) minerals in marine sediments typically focus on authigenic carbonate fluorapatite, which is considered to be the major sink for P in marine sediments and can easily be semi-quantitatively extracted with the SEDEX sequential extraction method. The role of other potentially important authigenic P phases, such as the reduced iron (Fe) phosphate mineral vivianite (Fe(II)3(PO4)*8H2O) has so far largely been ignored in marine systems. This is, in part, likely due to the fact that the SEDEX method does not distinguish between vivianite and P associated with Fe-oxides. Here, we show that vivianite can be quantified in marine sediments by combining the SEDEX method with microscopic and spectroscopic techniques such as micro X-ray fluorescence (μXRF) elemental mapping of resin-embedded sediments, as well as scanning electron microscope-energy dispersive spectroscopy (SEM-EDS) and powder X-ray diffraction (XRD). We further demonstrate that resin embedding of vertically intact sediment sub-cores enables the use of synchrotron-based microanalysis (X-ray absorption near-edge structure (XANES) spectroscopy) to differentiate between different P burial phases in aquatic sediments. Our results reveal that vivianite represents a major burial sink for P below a shallow sulfate/methane transition zone in Bothnian Sea sediments, accounting for 40-50% of total P burial. We further show that anaerobic oxidation of methane (AOM) drives a sink-switching from Fe-oxide bound P to vivianite by driving the release of both phosphate (AOM with sulfate and Fe-oxides) and ferrous Fe (AOM with Fe-oxides) to the pore water allowing supersaturation with respect to vivianite to be reached. The vivianite in the sediment contains significant amounts of manganese (∼4-8 wt.%), similar to vivianite obtained from freshwater sediments. Our results indicate that methane dynamics play a key role in providing conditions that allow for vivianite authigenesis in coastal

  3. Vivianite represents a major sink for phosphorus in methanogenic coastal surface sediments

    NASA Astrophysics Data System (ADS)

    Egger, Matthias; Jilbert, Tom; Behrends, Thilo; Rivard, Camille; Slomp, Caroline P.

    2015-04-01

    Studies of authigenic phosphorus (P) minerals in marine sediments typically focus on authigenic carbonate fluorapatite, which is considered to be the major sink for P in marine sediments and can easily be quantified with the SEDEX sequential extraction method for P (Ruttenberg, 1992). The role of other potentially important authigenic P phases, such as the reduced iron (Fe) phosphate mineral vivianite (Fe(II)3(PO4)*8H2O) has so far largely been ignored. This is likely partly due to the fact that the SEDEX method does not distinguish between vivianite and P associated with Fe-oxides. In this study, we show that vivianite can be quantified in marine sediments by combining the SEDEX method with more direct technical and analytical tools such as scanning electron microscope energy dispersive spectroscopy (SEM-EDS) and powder X-ray diffraction (XRD) of wet-sieved sediment samples, as well as synchrotron-based microanalysis (X-ray absorption near-edge structure, XANES) of resin-embedded sediments. Our results demonstrate that vivianite represents a major burial sink for P below the sulfate/methane transition zone in Bothnian Sea sediments, accounting for up to 50 % of the total P burial. The vivianite in the brackish sediment contains significant amounts of Mn (~ 4-8 wt.%) but lower contents of Mg (~ 1-3 wt.%) similar to vivianite obtained from freshwater sediments. We further show that anaerobic oxidation of methane (AOM) drives a sink-switching from Fe-oxide bound P to vivianite by causing the release of both phosphate (AOM with sulfate and Fe-oxides) and ferrous Fe (AOM with Fe-oxides) to the porewater allowing supersaturation with respect to vivianite to be reached. Our results indicate that methane likely plays a key role in providing conditions that allow for vivianite authigenesis in coastal surface sediments. We suggest that vivianite formation may provide an important burial sink for P in many brackish coastal environments worldwide. References: Ruttenberg K. C

  4. Genetic diversity and molecular evolution of the major human metapneumovirus surface glycoproteins over a decade.

    PubMed

    Papenburg, Jesse; Carbonneau, Julie; Isabel, Sandra; Bergeron, Michel G; Williams, John V; De Serres, Gaston; Hamelin, Marie-Ève; Boivin, Guy

    2013-11-01

    Human metapneumovirus (HMPV) is a recently discovered paramyxovirus that is a major cause of respiratory infections worldwide. We aim to describe the molecular evolution of the HMPV F (fusion) and G (attachment) surface glycoproteins because they are targets for vaccines, monoclonal antibodies and antivirals currently in development. Nasopharyngeal aspirates were collected in children <3 years old with acute respiratory infection in Quebec City during 2001-2010. HMPV-positive samples (n = 163) underwent HMPV-F and -G gene sequencing. Furthermore, HMPV-F (n = 124) and -G (n = 217) sequences were obtained from GenBank and other studies. Evolutionary analyses (phylogenetic reconstruction, sequence identity, detection of recombination and adaptive evolution) were computed. Sequences clustered into 5 genetic lineages (A1, A2a, A2b, B1 and B2). Multiple lineages circulated each year in Quebec City. With the exception of B1, each of the 5 subgroups was the predominant lineage during ≥1 season. The A1 lineage was not detected since 2002-2003 in our local cohort. There was no evidence of inter- or intragenic recombination. HMPV-F was highly conserved, whereas HMPV-G exhibited greater diversity. HMPV-F demonstrated strong evidence of purifying selection, both overall and in an abundance of negatively selected amino acid sites. In contrast, sites under diversifying selection were detected in all HMPV-G lineages (range, 4-15), all of which were located in the ectodomain. Predominant circulating HMPV lineages vary by year. HMPV-F is highly constrained and undergoes significant purifying selection. Given its high genetic variability, we found a modest number of positively selected sites in HMPV-G. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Factors controlling pollutant plume length downwind of major roadways in nocturnal surface inversions

    NASA Astrophysics Data System (ADS)

    Choi, W.; Winer, A. M.; Paulson, S. E.

    2013-09-01

    A curve fit method using a Gaussian dispersion model solution was successfully applied to obtain both dispersion coefficients and a particle number emission factor (PNEF) directly from ultrafine particle (UFP) concentration profiles observed downwind of major roadways in California's South Coast Air Basin (SoCAB). The Briggs' formulation for the vertical dispersion parameter σz was adopted in this study due to its better performance in describing the observed profiles compared to other formulations examined. The two dispersion coefficients in Briggs' formulation, α and β, ranged from 0.02 to 0.07 and from -0.5 × 10-3 to 2.8 × 10-3, respectively, for the four freeway transects studied and are significantly different for freeways passing over vs. under the street on which measurements of the freeway plume were made. These ranges are wider than literature values for α and β under stable conditions. The dispersion coefficients derived from observations showed strong correlations with both surface meteorology (wind speed/direction, temperature, and air stability) and differences in concentrations between the background and plume peak. The relationships were applied to predict freeway plume transport using a multivariate regression, and produced excellent agreement with observed UFP concentration profiles. The mean PNEF for a mixed vehicle fleet on the four freeways was estimated as 1.2 × 1014 particles mi-1 vehicle-1, which is about 15% of the value estimated in 2001 for the I-405 freeway, implying significant reductions in UFP emissions over the past decade in the SoCAB.

  6. Factors controlling pollutant plume length downwind of major roadways in nocturnal surface inversions

    NASA Astrophysics Data System (ADS)

    Choi, W.; Winer, A. M.; Paulson, S. E.

    2014-07-01

    A fitting method using a semi-empirical Gaussian dispersion model solution was successfully applied to obtain both dispersion coefficients and a particle number emission factor (PNEF) directly from ultrafine particle (UFP; particles smaller than <0.1 μm in diameter) concentration profiles observed downwind of major roadways in California's South Coast Air Basin (SoCAB). The effective Briggs' formulation for the vertical dispersion parameter σz was adopted in this study due to its better performance in describing the observed profiles compared to other formulations examined. The two dispersion coefficients in Briggs' formulation, α and β, ranged from 0.02 to 0.07 and from -0.5 × 10-3 to 2.8 × 10-3, respectively, for the four freeway transects studied and are significantly different for freeways passing over vs. under the street on which measurements of the freeway plume were made. These ranges are wider than literature values for α and β under stable conditions. The dispersion coefficients derived from observations showed strong correlations with both surface meteorology (wind speed/direction, temperature, and air stability) and differences in concentrations between the background and plume peak. The relationships were applied to predict freeway plume transport using a multivariate regression, and produced excellent agreement with observed UFP concentration profiles. The mean PNEF for a mixed vehicle fleet on the four freeways was estimated as 7.5 × 1013 particles km-1 vehicle-1, which is about 15% of the value estimated in 2001 for the I-405 freeway, implying significant reductions in UFP emissions over the past decade in the SoCAB.

  7. Rapid qualitative protease microassay (RPM).

    PubMed

    Mohan, S; Ma, P W K; Luthe, D S

    2005-09-30

    A rapid qualitative protease microassay (RPM) was developed as an alternative to conventional assays of cysteine protease activity in HPLC fractions. Using this technique protease activity in samples could be visually determined within 5 min. The method was sensitive to 3.3x10(-7) U/mL of papain and detected cysteine protease activity in dilute HPLC fractions with activity of 5.4x10(-5) U/mL. Because the method monitors the decolorization of Coomassie Brilliant Blue stained substrate, it can be modified to detect other classes of proteases.

  8. Major Successes of Theory-and-Experiment-Combined Studies in Surface Chemistry and Heterogeneous Catalysis.

    SciTech Connect

    Somorjai, Gabor A.; Li, Yimin

    2009-11-21

    Experimental discoveries followed by theoretical interpretations that pave the way of further advances by experimentalists is a developing pattern in modern surface chemistry and catalysis. The revolution of modern surface science started with the development of surface-sensitive techniques such as LEED, XPS, AES, ISS and SIMS, in which the close collaboration between experimentalists and theorists led to the quantitative determination of surface structure and composition. The experimental discovery of the chemical activity of surface defects and the trends in the reactivity of transitional metals followed by the explanations from the theoretical studies led to the molecular level understanding of active sites in catalysis. The molecular level knowledge, in turn, provided a guide for experiments to search for new generation of catalysts. These and many other examples of successes in experiment-and-theory-combined studies demonstrate the importance of the collaboration between experimentalists and theorists in the development of modern surface science.

  9. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  10. Staphylococcal proteases aid in evasion of the human complement system

    PubMed Central

    Jusko, Monika; Potempa, Jan; Kantyka, Tomasz; Bielecka, Ewa; Miller, Halie K.; Kalinska, Magdalena; Dubin, Grzegorz; Garred, Peter; Shaw, Lindsey N.; Blom, Anna M.

    2014-01-01

    Staphylococcus aureus is an opportunistic pathogen that presents severe healthcare concerns due to the prevalence of multiple antibiotic resistant strains. New treatment strategies are urgently needed, which requires an understanding of disease causation mechanisms. Complement is one of the first lines of defense against bacterial pathogens, and S. aureus expresses several specific complement inhibitors. The effect of extracellular proteases from this bacterium on complement, however, has been the subject of limited investigation, except for a recent report regarding cleavage of the C3 component by aureolysin. We demonstrate here that four major extracellular proteases of S. aureus are potent complement inhibitors. Incubation of human serum with the cysteine proteases staphopain A and staphopain B, the serine protease V8, and the metalloproteinase aureolysin resulted in a drastic decrease in the haemolytic activity of serum; whereas two serine-protease like enzymes, SplD and SplE, had no effect. These four proteases were found to inhibit all pathways of complement due to the efficient degradation of several crucial components. Furthermore, S. aureus mutants lacking proteolytic enzymes were found to be more efficiently killed in human blood. Taken together, the major proteases of S. aureus appear to be important for pathogen-mediated evasion of the human complement system. PMID:23838186

  11. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  12. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  13. Role of major surface structures of Escherichia coli O157:H7 in initial attachment to biotic and abiotic surfaces

    USDA-ARS?s Scientific Manuscript database

    Infection by human pathogens through fresh, minimally processed produce and solid plant-derived foods is a major concern of U.S. and global food industry and public health services. The enterohemorrhagic Escherichia coli O157:H7 is a frequent and potent food borne pathogen that causes severe disease...

  14. [The extracellular proteases of the phytopathogenic bacterium Xanthomonas campestris].

    PubMed

    Kalashnikova, E E; Chernyshova, M P; Ignatov, V V

    2003-01-01

    The culture liquids of three Xanthomonas campestris pv. campestris strains were found to possess proteolytic activity. The culture liquid of strain B-611 with the highest proteolytic activity was fractionated by salting-out with ammonium sulfate, gel filtration, and ion-exchange chromatography. The electrophoretic analysis of active fractions showed the presence of two proteases in the culture liquid of strain B-611, the major of which being serine protease. The treatment of cabbage seedlings with the proteases augmented the activity of peroxidase in the cabbage roots by 28%.

  15. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  16. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  17. Solar Ion Processing of Major Element Surface Compositions of Mature Mare Soils: Insights from Combined XPS and Analytical TEM Observations

    NASA Technical Reports Server (NTRS)

    Christoffersen, R.; Dukes, C.; Keller, L. P.; Baragiola, R.

    2012-01-01

    Solar wind ions are capable of altering the sur-face chemistry of the lunar regolith by a number of mechanisms including preferential sputtering, radiation-enhanced diffusion and sputter erosion of space weathered surfaces containing pre-existing compositional profiles. We have previously reported in-situ ion irradiation experiments supported by X-ray photoelectron spectroscopy (XPS) and analytical TEM that show how solar ions potentially drive Fe and Ti reduction at the monolayer scale as well as the 10-100 nm depth scale in lunar soils [1]. Here we report experimental data on the effect of ion irradiation on the major element surface composition in a mature mare soil.

  18. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  19. Dysregulation of Protease and Protease Inhibitors in a Mouse Model of Human Pelvic Organ Prolapse

    PubMed Central

    Budatha, Madhusudhan; Silva, Simone; Montoya, Teodoro Ignacio; Suzuki, Ayako; Shah-Simpson, Sheena; Wieslander, Cecilia Karin; Yanagisawa, Masashi; Word, Ruth Ann; Yanagisawa, Hiromi

    2013-01-01

    Mice deficient for the fibulin-5 gene (Fbln5−/−) develop pelvic organ prolapse (POP) due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP)-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5−/− mice, herein named V1 (25 kDa). V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS) 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5−/− mice. PRSS3 was (a) localized in epithelial secretions, (b) detected in media of vaginal organ culture from both Fbln5−/− and wild type mice, and (c) cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin) and Elafin] was dysregulated in Fbln5−/− epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice. PMID:23437119

  20. Cryogenic changes in proteases and antiprotease activities of buffalo (Bubalus bubalis) and cattle (Bos taurus) semen.

    PubMed

    Gurupriya, Vijayasaraswathy S; Divyashree, Bannur C; Roy, Sudhir C

    2014-02-01

    The postthaw motility and fertility of buffalo and cattle semen is reduced when they are cryopreserved for artificial insemination. In the present study, an attempt was made to characterize the cryogenic changes in proteases and antiprotease activities (APA) of buffalo and cattle semen because these proteolysis regulators have been reported to be associated with sperm motility and fertility. Buffalo sperm demonstrated at least two major proteases of 45 and 42 kDa and three minor proteases of 95, 52, and 33 kDa. Similarly, cattle sperm demonstrated three major proteases of 62, 45, and 42 kDa and two minor proteases of 85 and 78 kDa. Buffalo seminal plasma demonstrated at least three major proteases of 78, 68, and 62 kDa and one minor protease of 98 kDa and cattle seminal plasma demonstrated one major protease of 68 kDa and two minor proteases of 78 and 75 kDa. Except for the 45 kDa protease, most of the previously mentioned proteases were found to be metalloproteinases. Compared with fresh sperm, cryopreserved buffalo and cattle sperm demonstrated a major protease band of 52/49 kDa and the activity of this protease reduced progressively with the duration of cryopreservation. On the contrary, compared with the fresh seminal plasma, cryopreserved buffalo and cattle semen extenders displayed the presence of a new protease band of 45 kDa and demonstrated that this protease activity was leaked from buffalo and cattle cryopreserved spermatozoa. Buffalo and cattle seminal plasmas displayed at least two major APA of 86 and 26 kDa. Compared with buffalo, cattle seminal plasma demonstrated significantly greater APA. Thus, the present study demonstrated the presence of an array of proteases and APA in buffalo and cattle semen and the activities of which changed during cryopreservation. The leakage of the specific protease activity and changes in the proteases and APA might be attributed to reduced motility and fertility of cryopreserved semen in these species. Copyright

  1. Wet-surface-enhanced ellipsometric contrast microscopy identifies slime as a major adhesion factor during bacterial surface motility.

    PubMed

    Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier

    2012-06-19

    In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces.

  2. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  3. Surface-water dynamics and land use influence landscape connectivity across a major dryland region.

    PubMed

    Bishop-Taylor, Robbi; Tulbure, Mirela G; Broich, Mark

    2017-01-24

    Landscape connectivity is important for the long-term persistence of species inhabiting dryland freshwater ecosystems, with spatiotemporal surface-water dynamics (e.g., flooding) maintaining connectivity by both creating temporary habitats and providing transient opportunities for dispersal. Improving our understanding of how landscape connectivity varies with respect to surface-water dynamics and land use is an important step to maintaining biodiversity in dynamic dryland environments. Using a newly available validated Landsat TM and ETM+ surface-water time series, we modelled landscape connectivity between dynamic surface-water habitats within Australia's 1 million km2 semi-arid Murray Darling Basin across a 25-year period (1987 to 2011). We identified key habitats that serve as well-connected 'hubs', or 'stepping-stones' that allow long-distance movements through surface-water habitat networks. We compared distributions of these habitats for short- and long-distance dispersal species during dry, average and wet seasons, and across land-use types. The distribution of stepping-stones and hubs varied both spatially and temporally, with temporal changes driven by drought and flooding dynamics. Conservation areas and natural environments contained higher than expected proportions of both stepping-stones and hubs throughout the time series; however, highly modified agricultural landscapes increased in importance during wet seasons. Irrigated landscapes contained particularly high proportions of well-connected hubs for long-distance dispersers, but remained relatively disconnected for less vagile organisms. The habitats identified by our study may serve as ideal high-priority targets for land-use specific management aimed at maintaining or improving dispersal between surface-water habitats, potentially providing benefits to biodiversity beyond the immediate site scale. Our results also highlight the importance of accounting for the influence of spatial and temporal

  4. Dust levitation as a major resurfacing process on the surface of a saturnian icy satellite, Atlas

    NASA Astrophysics Data System (ADS)

    Hirata, Naoyuki; Miyamoto, Hideaki

    2012-07-01

    A small inner satellite of Saturn, Atlas, has an enigmatic saucer-like shape explained by an accumulation of particles from A-ring of Saturn. However, its unusual smooth surface remains unexplained. Gardening through continuous particle impact events cannot be a unique explanation for the smoothness, because Prometheus does not exhibit a similar surface, though it too would have experienced a similar bombardment. Here, a detailed investigation using close-up images of Atlas reveals the surface to be (1) covered by fine particles (i.e., probably as small as several tens of micrometers); (2) mostly void of impact craters (i.e., only one has been thus far identified); and (3) continuously smooth, even between the equatorial ridge and the undulating polar region. These findings imply that some sort of crater-erasing process has been active on the surface of Atlas. From electro-static analyses, we propose that the upper-most layer of the fine particles can become electro-statically unstable and migrate as a result of dust levitation, which resulted in erasing craters on the surface of Atlas. If true, Atlas would represent the first recognized body where resurfacing is dominated by dust levitation.

  5. Surface pressure measurements of human tears and individual tear film components indicate that proteins are major contributors to the surface pressure.

    PubMed

    Tragoulias, Sophia T; Anderton, Philip J; Dennis, Gary R; Miano, Fausto; Millar, Thomas J

    2005-03-01

    Tear film stability has been associated with a low surface tension (high surface pressure), which has been attributed to a variety of tear film components. In this study, we examined the contribution of various tear proteins, mucin, and meibomian lipids to the surface pressure of human tears. A Langmuir trough was used to measure and compare the surface activities of albumin, lipocalin, beta-lactoglobulin, lactoferrin, lysozyme, secretory IgA, mucin, meibomian lipid, and tears. All proteins exhibited surface activity. The surface pressure-area (Pi-A) profiles of most protein films at equilibrium surface pressure (Pieq) were sigmoidal and showed hysteresis between the expansion and compression phases of the cycle. Pieq of most proteins took 4-9 hours to occur. By contrast, the Pi-A profiles for meibomian lipid films were hyperbolic rather than sigmoidal and had little hysteresis, and Pieq was attained within 1 hour. The Pi-A profiles of mucin films showed mostly hyperbolic characteristics with small hysteresis. The Pi-A profiles of films of tears were sigmoidal, showed strong hysteresis, and reached Pieq at about 5 hours. Partitioning of the proteins and whole tears into the subphase also occurred. Comparison between the dynamic Pi-A profiles of tears and those of individual tear film components shows that tear film proteins not only are capable of surface activity but also are major contributors to the surface activity of the tear film.

  6. Surface temperature changes following the six major volcanic episodes between 1780 and 1980

    NASA Astrophysics Data System (ADS)

    Angell, J. K.; Korshover, J.

    1985-09-01

    The effects produced by volcanic eruptions on the surface temperature have been a matter of controversy for decades. The present investigation has the objective to examine volcanic eruptions individually to find out which eruptions have been followed by a cooling and which have not, taking into account possible reasons for this difference. The six volcanic episodes between 1780 and 1980 with the largest dust-veil indexes have been chosen. The variation in mean-annual surface temperature from ten years before to ten years after the eruption are considered. The events selected include the eruptions of Asama and Laki in 1783, Tambora in 1815, Coseguina in 1835, Krakatoa in 1883, Santa Maria, Soufriere, and Pelee in 1902, and Agung in 1963). It is found that, while volcanic eruptions certainly do not cause a warming of the earth's surface, the evidence that they cause cooling is not overly impressive either.

  7. The major-element composition of Mercury's surface from MESSENGER X-ray spectrometry.

    PubMed

    Nittler, Larry R; Starr, Richard D; Weider, Shoshana Z; McCoy, Timothy J; Boynton, William V; Ebel, Denton S; Ernst, Carolyn M; Evans, Larry G; Goldsten, John O; Hamara, David K; Lawrence, David J; McNutt, Ralph L; Schlemm, Charles E; Solomon, Sean C; Sprague, Ann L

    2011-09-30

    X-ray fluorescence spectra obtained by the MESSENGER spacecraft orbiting Mercury indicate that the planet's surface differs in composition from those of other terrestrial planets. Relatively high Mg/Si and low Al/Si and Ca/Si ratios rule out a lunarlike feldspar-rich crust. The sulfur abundance is at least 10 times higher than that of the silicate portion of Earth or the Moon, and this observation, together with a low surface Fe abundance, supports the view that Mercury formed from highly reduced precursor materials, perhaps akin to enstatite chondrite meteorites or anhydrous cometary dust particles. Low Fe and Ti abundances do not support the proposal that opaque oxides of these elements contribute substantially to Mercury's low and variable surface reflectance.

  8. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  9. Major membrane surface proteins of Mycoplasma hyopneumoniae selectively modified by covalently bound lipid

    SciTech Connect

    Wise K.S.; Kim, M.F.

    1987-12-01

    Surface protein antigens of Mycoplasma hyopneumoniae were identified by direct antibody-surface binding or by radioimmunoprecipitation of surface /sup 125/I-labeled proteins with a series of monoclonal antibodies (MAbs). Radioimmunoprecipitation of TX-114-phase proteins from cells labeled with (/sup 35/S) methionine, /sup 14/C-amino acids, or (/sup 3/H) palmitic acid showed that proteins p65, p50, and p44 were abundant and (with one other hydrophobic protein, p60) were selectively labeled with lipid. Alkaline hydroxylamine treatment of labeled proteins indicated linkage of lipids by amide or stable O-linked ester bonds. Proteins p65, p50, and p44 were highly immunogenic in the natural host as measured by immunoblots of TX-114-phase proteins with antisera from swine inoculated with whole organisms. These proteins were antigenically and structurally unrelated, since hyperimmune mouse antibodies to individual gel-purified proteins were monospecific and gave distinct proteolytic epitope maps. Intraspecies size variants of one surface antigen of M. hyopneumoniae were revealed by a MAb to p70 (defined in strain J, ATCC 25934), which recognized a large p73 component on strain VPP11 (ATCC 25617). In addition, MAb to internal, aqueous-phase protein p82 of strain J failed to bind an analogous antigen in strain VPP11.

  10. Cysteine Protease Inhibitors as Chemotherapy: Lessons from a Parasite Target

    NASA Astrophysics Data System (ADS)

    Selzer, Paul M.; Pingel, Sabine; Hsieh, Ivy; Ugele, Bernhard; Chan, Victor J.; Engel, Juan C.; Bogyo, Matthew; Russell, David G.; Sakanari, Judy A.; McKerrow, James H.

    1999-09-01

    Papain family cysteine proteases are key factors in the pathogenesis of cancer invasion, arthritis, osteoporosis, and microbial infections. Targeting this enzyme family is therefore one strategy in the development of new chemotherapy for a number of diseases. Little is known, however, about the efficacy, selectivity, and safety of cysteine protease inhibitors in cell culture or in vivo. We now report that specific cysteine protease inhibitors kill Leishmania parasites in vitro, at concentrations that do not overtly affect mammalian host cells. Inhibition of Leishmania cysteine protease activity was accompanied by defects in the parasite's lysosome/endosome compartment resembling those seen in lysosomal storage diseases. Colocalization of anti-protease antibodies with biotinylated surface proteins and accumulation of undigested debris and protease in the flagellar pocket of treated parasites were consistent with a pathway of protease trafficking from flagellar pocket to the lysosome/endosome compartment. The inhibitors were sufficiently absorbed and stable in vivo to ameliorate the pathology associated with a mouse model of Leishmania infection.

  11. Geohydrology and susceptibility of major aquifers to surface contamination in Alabama, area 1

    USGS Publications Warehouse

    Bossong, C.R.; Harris, W.F.

    1987-01-01

    This report delineates and describes the geohydrology and susceptibility of the major aquifers to contamination in Area 1 - Colbert, Franklin, Lauderdale, Lawrence, Limeston, Madison, and Morgan Counties. Most of the area is underlain by a Mississippian carbonate sequence that includes two major aquifers, the Tuscumbia-Fort Payne aquifer and the Bangor aquifer. A third major aquifer, the Tuscaloosa aquifer of Cretaceous age, occurs in the southwest part of the area. The Mississippi carbonate aquifers are the Tuscumbia-Fort Payne aquifer which includes most Tuscumbia Limestone and the Fort Payne Chert, and a small area of the Monteagle Limestone, and the Bangor aquifer which includes the Bangor Limestone and Hartselle Sandstone. Both of these aquifers possess highly-variable secondary porosity and permeability related to fractures that have been enlarged, sometimes to cavernous proportions, due to solution processes. The Tuscaloosa aquifer consists of the Tuscaloosa Group, an unconsolidated clastic deposit that has relatively uniform primary porosity and permeability. Significant quantities of groundwater are available from each of the aquifers. Water levels at nearly 2 ,000 wells indicate that, for each aquifer, general groundwater movement is from topographically high to low areas. Each of the aquifers is recharged throughout its outcrop in the study area and is susceptible to contamination within the outcrop. Generalized topographic settings such as closed-contour depressions are identified as areas that are highly susceptible to contamination. Specific features such as sinkholes also are identified as extremely susceptible to contamination. (USGS)

  12. Small cavities as major active sites for surface enhanced Raman scattering

    NASA Astrophysics Data System (ADS)

    Seki, H.; Chuang, T. J.; Escobar, J. F.; Morawitz, H.; Albano, E. V.

    1985-07-01

    Recently it has been proposed that extremely small cavities or pores may be important active sites for the surface enhanced Raman scattering (SERS) process on coldly deposited silver films in UHV. There is an interesting correlation between the temperature for annealing out these small cavities and the temperature at which the high-temperature anneal in SERS occurs. In order to further investigate this high-temperature anneal in terms of the cavity site model, experiments have been carried out in which varying amounts of very thin silver films are deposited over the substrate just before the Raman signal reaches a maximum by the high-temperature anneal. Further enhancements are observed when the average thickness of the silver overlayer is about 20 Å. These results are discussed in relation to theoretical considerations based on collective electronic resonances of a small spherical void in the metal near a surface.

  13. Surface Waves as Major Controls on Particle Backscattering in Southern California Coastal Waters

    NASA Astrophysics Data System (ADS)

    Henderikx Freitas, F.; Fields, E.; Maritorena, S.; Siegel, D.

    2016-02-01

    Satellite observations of particle loads and optical backscattering coefficients (bbp) in the Southern California Bight (SCB) have been thought to be driven by episodic inputs from storm runoff. Here we show however that surface waves have a larger role in controlling remotely sensed bbp values than previously considered. More than 14 years of 2-km resolution SeaWiFS, MODIS and MERIS satellite imagery spectrally-merged with the Garver-Siegel-Maritorena bio-optical model were used to assess the relative importance of terrestrial runoff and surface wave forcings in determining changes in particle load in the SCB. The space-time distributions of particle backscattering at 443nm and chlorophyll concentration estimates from the model were analyzed using Empirical Orthogonal Function analysis, and patterns were compared with several environmental variables. While offshore values of bbp are tightly related to chlorophyll concentrations, as expected for productive Case-1 waters, values of bbp in a 10km band near the coast are primarily modulated by surface waves. The relationship with waves holds throughout all seasons and is most apparent around the 40m isobath, but extends offshore until about 100m in depth. Riverine inputs are associated with elevated bbp near the coast mostly during the larger El Nino events of 1997/1998 and 2005. These findings are consistent with bio-optical glider and field observations from the Santa Barbara Channel taken as part of the Santa Barbara Coastal Long-Term Ecological Research and Plumes and Blooms programs. The implication of surface waves determining bbp variability beyond the surf zone has large consequences for the life cycle of many marine organisms, as well as for the interpretation of remote sensing signals near the coast.

  14. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  15. Characterization of the major phosphoprotein and its kinase on the surface of the rat adipocyte

    SciTech Connect

    Kang, E.S.; Chiang, T.M.

    1986-12-01

    Intact rat fat cell exposed to 12.5 ..mu..M (..gamma..-32P)ATP incorporate label into specific proteins within minutes. By solubilizing the reaction mixture with SDS which bypasses the subcellular fractionation steps, the labeled proteins can be identified in autoradiographs of SDS-PAGE gels. The most prominently labeled protein has an M/sub r/ of 42,000. Localization of this component to the cell surface can be made on the basis of inhibition of phosphorylation by addition of a protein derived from the rat brain with protein kinase inhibitory property, susceptibility of the phosphorylated protein to the tryptic digestion, inhibition of phosphorylation of this protein after brief exposure to melittin. To rule out the possibility that the cell surface protein might be a mitochondrial contaminant from broken cells, /sup 32/Pi-labeled and (..gamma..-/sup 32/P)ATP-labeled cells were chromatographed on a rabbit anti-pyruvate dehydrogenase antibody-Sepharose 4B column. A single labeled peak was detected upon elution of the bound fraction only in the /sup 32/pi-labeled sample, and not in the (..gamma..-/sup 32/P)ATP-labeled sample. Subcellular fractionation studies of intact cells labeled depending on whether a continuous sucrose gradient or a discontinuous sucrose gradient was used. Finally, comparison of the autoradiographs of two-dimensional (2D) gels show different isoelectric points for 42,000 M/sub r/ components in (..gamma..-/sup 32/P)ATP- and /sup 32/Pi-labeled cells. These and other experiments support the likelihood that phosphoproteins of 42,000 M/sub r/ are present at two sites in the intact rat fat cell, the cell surface and at an intracellular site, most likely the mitochondria.

  16. The influence of recent major crater impacts on the surrounding surfaces of (21) Lutetia

    NASA Astrophysics Data System (ADS)

    Jutzi, M.; Thomas, N.; Benz, W.; El Maarry, M. R.; Jorda, L.; Kührt, E.; Preusker, F.

    2013-09-01

    We present 3-D simulations of impacts into Asteroid 21 Lutetia, the subject of a fly-by by the European Space Agency’s Rosetta mission to Comet 67P/Churyumov-Gerasimenko. Using a 3-D shape model of the asteroid, impacts of sizes sufficient to reproduce the observed craters in Lutetia’s North Polar Crater Cluster (NPCC) as observed by the OSIRIS experiment have been simulated using the Smoothed Particle Hydrodynamics technique. The asteroid itself has been modelled both as a homogeneous body and as a body with an iron core. Crater erasure in the vicinity of the NPCC has been observed by OSIRIS. The results show that this erasure has most probably been caused by ejecta deposition following the impact of a 2.3 km diameter projectile impacting at a velocity of 5 km s-1 (or an impact with similar energy). This would produce a crater of roughly 34 km in diameter comparable to the largest (and oldest) member of the NPCC. Erasure of craters via the shock associated with such an impact is shown to be less significant and does not reproduce the observed spatial distribution of erased craters or “ghost” craters. Time series of the surface velocity fields resulting from the simulated impacts are also presented. It is suggested that the surface velocity field and velocity shear may play a role in the generation of lineaments. Our model calculations show that the velocity field lines around 50 s after impact exhibit a reasonable qualitative correlation with the orientation of lineaments observed on the entire visible surface of Lutetia. It is also shown that incorporation of a core of 25-30 km in diameter does not modify the velocity field evolution with time and, as such, the presence or otherwise of such a core cannot be inferred from lineament observations if this concept for their formation is valid.

  17. Improving Viral Protease Inhibitors to Counter Drug Resistance

    PubMed Central

    Yilmaz, Nese Kurt; Swanstrom, Ronald; Schiffer, Celia A.

    2016-01-01

    Drug resistance is a major problem in health care, undermining therapy outcomes and necessitating novel approaches to drug design. Extensive studies on resistance to viral protease inhibitors, particularly those of HIV-1 and hepatitis C virus (HCV) protease, revealed a plethora of information on the structural and molecular mechanisms underlying resistance. These insights led to several strategies to improve viral protease inhibitors to counter resistance, such as exploiting the essential biological function and leveraging evolutionary constraints. Incorporation of these strategies into structure-based drug design can minimize vulnerability to resistance, not only for viral proteases but for other quickly evolving drug targets as well, toward designing inhibitors one step ahead of evolution to counter resistance with more intelligent and rational design. PMID:27090931

  18. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases

    PubMed Central

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers. PMID:22461953

  19. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  20. Structural and functional characterization of Bc28.1, major erythrocyte-binding protein from Babesia canis merozoite surface.

    PubMed

    Yang, Yin-Shan; Murciano, Brice; Moubri, Karina; Cibrelus, Prisca; Schetters, Theo; Gorenflot, André; Delbecq, Stéphane; Roumestand, Christian

    2012-03-16

    Babesiosis (formerly known as piroplasmosis) is a tick-borne disease caused by the intraerythrocytic development of protozoa parasites from the genus Babesia. Like Plasmodium falciparum, the agent of malaria, or Toxoplasma gondii, responsible for human toxoplasmosis, Babesia belongs to the Apicomplexa family. Babesia canis is the agent of the canine babesiosis in Europe. Clinical manifestations of this disease range from mild to severe and possibly lead to death by multiple organ failure. The identification and characterization of parasite surface proteins represent major goals, both for the understanding of the Apicomplexa invasion process and for the vaccine potential of such antigens. Indeed, we have already shown that Bd37, the major antigenic adhesion protein from Babesia divergens, the agent of bovine babesiosis, was able to induce complete protection against various parasite strains. The major merozoite surface antigens of Babesia canis have been described as a 28-kDa membrane protein family, anchored at the surface of the merozoite. Here, we demonstrate that Bc28.1, a major member of this multigenic family, is expressed at high levels at the surface of the merozoite. This protein is also found in the parasite in vitro culture supernatants, which are the basis of effective vaccines against canine babesiosis. We defined the erythrocyte binding function of Bc28.1 and determined its high resolution solution structure using NMR spectroscopy. Surprisingly, although these proteins are thought to play a similar role in the adhesion process, the structure of Bc28.1 from B. canis appears unrelated to the previously published structure of Bd37 from B. divergens. Site-directed mutagenesis experiments also suggest that the mechanism of the interaction with the erythrocyte membrane could be different for the two proteins. The resolution of the structure of Bc28 represents a milestone for the characterization of the parasite erythrocyte binding and its interaction with

  1. Structural and Functional Characterization of Bc28.1, Major Erythrocyte-binding Protein from Babesia canis Merozoite Surface*

    PubMed Central

    Yang, Yin-Shan; Murciano, Brice; Moubri, Karina; Cibrelus, Prisca; Schetters, Theo; Gorenflot, André; Delbecq, Stéphane; Roumestand, Christian

    2012-01-01

    Babesiosis (formerly known as piroplasmosis) is a tick-borne disease caused by the intraerythrocytic development of protozoa parasites from the genus Babesia. Like Plasmodium falciparum, the agent of malaria, or Toxoplasma gondii, responsible for human toxoplasmosis, Babesia belongs to the Apicomplexa family. Babesia canis is the agent of the canine babesiosis in Europe. Clinical manifestations of this disease range from mild to severe and possibly lead to death by multiple organ failure. The identification and characterization of parasite surface proteins represent major goals, both for the understanding of the Apicomplexa invasion process and for the vaccine potential of such antigens. Indeed, we have already shown that Bd37, the major antigenic adhesion protein from Babesia divergens, the agent of bovine babesiosis, was able to induce complete protection against various parasite strains. The major merozoite surface antigens of Babesia canis have been described as a 28-kDa membrane protein family, anchored at the surface of the merozoite. Here, we demonstrate that Bc28.1, a major member of this multigenic family, is expressed at high levels at the surface of the merozoite. This protein is also found in the parasite in vitro culture supernatants, which are the basis of effective vaccines against canine babesiosis. We defined the erythrocyte binding function of Bc28.1 and determined its high resolution solution structure using NMR spectroscopy. Surprisingly, although these proteins are thought to play a similar role in the adhesion process, the structure of Bc28.1 from B. canis appears unrelated to the previously published structure of Bd37 from B. divergens. Site-directed mutagenesis experiments also suggest that the mechanism of the interaction with the erythrocyte membrane could be different for the two proteins. The resolution of the structure of Bc28 represents a milestone for the characterization of the parasite erythrocyte binding and its interaction with

  2. Alteration of Surface EMG amplitude levels of five major trunk muscles by defined electrode location displacement.

    PubMed

    Huebner, Agnes; Faenger, Bernd; Schenk, Philipp; Scholle, Hans-Christoph; Anders, Christoph

    2015-04-01

    Exact electrode positioning is vital for obtaining reliable results in Surface EMG. This study aimed at systematically assessing the influence of defined electrode shifts on measured Surface EMG amplitudes of trunk muscles in a group of 15 middle aged healthy male subjects. The following leftsided muscles were investigated: rectus abdominis muscle, internal and external oblique abdominal muscles, lumbar multifidus muscle, and longissimus muscle. In addition to the recommended electrode positions, extra electrodes were placed parallel to these and along muscle fiber direction. Measurements were performed under isometric conditions in upright body position. Gradually changing, but defined loads were applied considering subject's upper body weight. For the abdominal muscles amplitude differences varied considerably depending on load level, magnitude, and direction. For both back muscles amplitudes dropped consistently but rather little for parallel electrode displacements. However, for the longissimus muscle a caudal electrode shift resulted in an amplitude increase of similar extent and independent from load level. Influence of electrode position variations can be proven for all trunk muscles but are more evident in abdominal than back muscles. Those muscle-specific effects confirm the necessity for an exact definition of electrode positioning to allow comparisons between individual subjects, groups of subjects, and studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  4. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  5. Expression of the Major Surface Antigen of Plasmodium knowlesi Sporozoites in Yeast

    NASA Astrophysics Data System (ADS)

    Sharma, Shobhona; Godson, G. Nigel

    1985-05-01

    The circumsporozoite protein, a surface antigen of the sporozoite stage of the monkey malarial parasite Plasmodium knowlesi, was expressed in the yeast Saccharomyces cerevisiae by using an expression vector containing the 5' regulatory region of the yeast alcohol dehydrogenase I gene. It was necessary to eliminate the entire 5' upstream region of the parasite DNA to obtain the expression of this protein. Only the circumsporozoite precursor protein was produced by the yeast transformants, as detected by immunoblotting. About 55 and 20 percent of the circumsporozoite protein produced in yeast was associated with the 25,000g and 150,000g particulate fractions, respectively. The protein could be solubilized in Triton X-100 and was stable in solubilized extracts.

  6. Characterizing interactions between surface water and groundwater in the Jialu River basin using major ion chemistry and stable isotopes

    NASA Astrophysics Data System (ADS)

    Yang, L.; Song, X.; Zhang, Y.; Han, D.; Zhang, B.; Long, D.

    2012-11-01

    The Jialu River, a secondary tributary of the Huaihe River, has been severely contaminated from major contaminant sources, such as a number of untreated or lightly treated sewage waste in some cities. Groundwater along the river is not an isolated component of the hydrologic system, but is instead connected with the surface water. This study aims to investigate temporal and spatial variations in water chemistry affected by humans and to characterize the relationships between surface water (e.g. reservoirs, lakes and rivers) and groundwater near the river in the shallow Quaternary aquifer. Concentration of Cl- in north Zhengzhou City increased prominently due to the discharge of a large amount of domestic water. Nitrate and potassium show maximum concentrations in groundwater in Fugou County. These high levels can be attributed to the use of a large quantity of fertilizer over this region. Most surface water appeared to be continuously recharged from the surrounding groundwater (regional wells) based on comparison surface water with groundwater levels, stable-isotopes and major ion signatures. However, the groundwater of a transitional well (location SY3) seemed to be recharged by river water via bank infiltration in September 2010. Fractional contributions of river water to the groundwater were calculated based on isotopic and chemical data using a mass-balance approach. Results show that the groundwater was approximately composed of 60-70% river water. These findings should be useful for a better understanding of hydrogeological processes at the river-aquifer interface and ultimately benefit water management in the future.

  7. Localization of Cysteine Protease, Cathepsin S, to the Surface of Vascular Smooth Muscle Cells by Association with Integrin ανβ3

    PubMed Central

    Cheng, Xian Wu; Kuzuya, Masafumi; Nakamura, Kae; Di, Qun; Liu, Zexuan; Sasaki, Takeshi; Kanda, Shigeru; Jin, Hai; Shi, Guo-Ping; Murohara, Toyoaki; Yokota, Mitsuhiro; Iguchi, Akihisa

    2006-01-01

    Smooth muscle cell (SMC) migration from the tunica media to the intima, a key event in neointimal formation, requires proteolytic degradation of elastin-rich extracellular matrix barriers. Although cathepsin S (Cat S) is overexpressed in atherosclerotic and neointimal lesions, its exact role in SMC behavior remains primarily unresolved. We examined the involvement of Cat S on SMC migration through an extracellular matrix barrier and its localization in SMCs. A selective Cat S inhibitor and the endogenous inhibitor cystatin C significantly attenuated SMC invasion across elastin gel. Western blotting and cell surface biotinylation analysis demonstrated localization of the 28-kd active form of Cat S on the SMC surface, consistent with its role in the proteolysis of subcellular matrices. Treatment with interferon-γ or interleukin-β1 significantly augmented the ability of SMC membranes to degrade elastin along with a significant increase in the level of active Cat S compared with controls. Immunofluorescence and confocal microscopy showed a punctuated pattern of Cat S clusters at the periphery of SMCs; further studies demonstrated partial co-localization of Cat S and integrin ανβ3 at the cell surfaces. These findings demonstrate that active Cat S co-localizes with integrin ανβ3 as a receptor on the SMC surface, playing an important role in the invasive behavior of SMCs. PMID:16436681

  8. Surface expression, single-channel analysis and membrane topology of recombinant Chlamydia trachomatis Major Outer Membrane Protein

    PubMed Central

    Findlay, Heather E; McClafferty, Heather; Ashley, Richard H

    2005-01-01

    Background Chlamydial bacteria are obligate intracellular pathogens containing a cysteine-rich porin (Major Outer Membrane Protein, MOMP) with important structural and, in many species, immunity-related roles. MOMP forms extensive disulphide bonds with other chlamydial proteins, and is difficult to purify. Leaderless, recombinant MOMPs expressed in E. coli have yet to be refolded from inclusion bodies, and although leadered MOMP can be expressed in E. coli cells, it often misfolds and aggregates. We aimed to improve the surface expression of correctly folded MOMP to investigate the membrane topology of the protein, and provide a system to display native and modified MOMP epitopes. Results C. trachomatis MOMP was expressed on the surface of E. coli cells (including "porin knockout" cells) after optimizing leader sequence, temperature and medium composition, and the protein was functionally reconstituted at the single-channel level to confirm it was folded correctly. Recombinant MOMP formed oligomers even in the absence of its 9 cysteine residues, and the unmodified protein also formed inter- and intra-subunit disulphide bonds. Its topology was modeled as a (16-stranded) β-barrel, and specific structural predictions were tested by removing each of the four putative surface-exposed loops corresponding to highly immunogenic variable sequence (VS) domains, and one or two of the putative transmembrane strands. The deletion of predicted external loops did not prevent folding and incorporation of MOMP into the E. coli outer membrane, in contrast to the removal of predicted transmembrane strands. Conclusions C. trachomatis MOMP was functionally expressed on the surface of E. coli cells under newly optimized conditions. Tests of its predicted membrane topology were consistent with β-barrel oligomers in which major immunogenic regions are displayed on surface-exposed loops. Functional surface expression, coupled with improved understanding of MOMP's topology, could provide

  9. Terpenoids as major precursors of dissolved organic matter in landfill leachates, surface water, and groundwater

    USGS Publications Warehouse

    Leenheer, J.A.; Nanny, M.A.; McIntyre, C.

    2003-01-01

    13C NMR analyses of hydrophobic dissolved organic matter (DOM) fractions isolated from a landfill leachate contaminated groundwater near Norman, OK; the Colorado River aqueduct near Los Angeles, CA; Anaheim Lake, an infiltration basin for the Santa Ana River in Orange County, CA; and groundwater from the Tomago Sand Beds, near Sydney, Australia, found branched methyl groups and quaternary aliphatic carbon structures that are indicative of terpenoid hydrocarbon precursors. Significant amounts of lignin precursors, commonly postulated to be the major source of DOM, were found only in trace quantities by thermochemolysis/gas chromatography/mass spectrometry of the Norman Landfill and Tomago Sand Bed hydrophobic DOM fractions. Electrospray/tandem mass spectrometry of the Tomago Sand Bed hydrophobic acid DOM found an ion series differing by 14 daltons, which is indicative of aliphatic and aryl-aliphatic polycarboxylic acids. The product obtained from ozonation of the resin acid, abietic acid, gave a similar ion series. Terpenoid precursors of DOM are postulated to be derived from resin acid paper sizing agents in the Norman Landfill, algal and bacterial terpenoids in the Colorado River and Anaheim Lake, and terrestrial plant terpenoids in the Tomago Sand Beds.

  10. Mars atmospheric phenomena during major dust storms, as measured at surface

    NASA Technical Reports Server (NTRS)

    Ryan, J. A.; Henry, R. M.

    1979-01-01

    Meteorological instrumentation aboard the Viking Mars Landers measures wind, temperature, and pressure. Two global dust storms occurred during northern autumn and winter, observed both by the orbiters and by the landers. The meteorological data from the landers has been analyzed for the period just before first storm arrival to just after second storm arrival, with the objectives of defining the meteorological phenomena during the storm period, determining those associated with storm and dust arrival, and evaluating the effects on synoptic conditions and the general circulation. Times of dust arrival over the sites could be defined fairly closely from optical and pressure (solar tide) data, and dust arrival was also accompanied by changes in diurnal temperature range, temperature maxima, and temperature minima. The arrivals of the storms at Viking Lander 1 were accompanied by significant increases in wind speed and pressure. No such changes were observed at Viking Lander 2. It is possible that surface material could have been raised locally at Viking Lander 1. Throughout the period except for the time following the second dust storm the synoptic picture at Viking Lander 2 was one of eastward moving cyclonic and anticyclonic systems. These disappeared following the second storm, a phenomenon which may be related to the storm.

  11. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    PubMed Central

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas S.; Lisby, Michael; Salanti, Ali; Fordyce, Sarah L.; Jespersen, Jakob S.; Carter, Richard; Deitsch, Kirk W.; Theander, Thor G.; Pedersen, Anders Gorm; Arnot, David E.

    2014-01-01

    Many bacterial, viral and parasitic pathogens undergo antigenic variation to counter host immune defense mechanisms. In Plasmodium falciparum, the most lethal of human malaria parasites, switching of var gene expression results in alternating expression of the adhesion proteins of the Plasmodium falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome-wide recombination hotspots in var genes, we show that during the parasite’s sexual stages, ectopic recombination between isogenous var paralogs occurs near low folding free energy DNA 50-mers and that these sequences are heavily concentrated at the boundaries of regions encoding individual Plasmodium falciparum-erythrocyte membrane protein 1 structural domains. The recombinogenic potential of these 50-mers is not parasite-specific because these sequences also induce recombination when transferred to the yeast Saccharomyces cerevisiae. Genetic cross data suggest that DNA secondary structures (DSS) act as inducers of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens. PMID:24253306

  12. Mars atmospheric phenomena during major dust storms, as measured at surface

    NASA Technical Reports Server (NTRS)

    Ryan, J. A.; Henry, R. M.

    1979-01-01

    Meteorological instrumentation aboard the Viking Mars Landers measures wind, temperature, and pressure. Two global dust storms occurred during northern autumn and winter, observed both by the orbiters and by the landers. The meteorological data from the landers has been analyzed for the period just before first storm arrival to just after second storm arrival, with the objectives of defining the meteorological phenomena during the storm period, determining those associated with storm and dust arrival, and evaluating the effects on synoptic conditions and the general circulation. Times of dust arrival over the sites could be defined fairly closely from optical and pressure (solar tide) data, and dust arrival was also accompanied by changes in diurnal temperature range, temperature maxima, and temperature minima. The arrivals of the storms at Viking Lander 1 were accompanied by significant increases in wind speed and pressure. No such changes were observed at Viking Lander 2. It is possible that surface material could have been raised locally at Viking Lander 1. Throughout the period except for the time following the second dust storm the synoptic picture at Viking Lander 2 was one of eastward moving cyclonic and anticyclonic systems. These disappeared following the second storm, a phenomenon which may be related to the storm.

  13. HIV-1 protease inhibitor mutations affect the development of HIV-1 resistance to the maturation inhibitor bevirimat.

    PubMed

    Fun, Axel; van Maarseveen, Noortje M; Pokorná, Jana; Maas, Renée Em; Schipper, Pauline J; Konvalinka, Jan; Nijhuis, Monique

    2011-08-24

    Maturation inhibitors are an experimental class of antiretrovirals that inhibit Human Immunodeficiency Virus (HIV) particle maturation, the structural rearrangement required to form infectious virus particles. This rearrangement is triggered by the ordered cleavage of the precursor Gag polyproteins into their functional counterparts by the viral enzyme protease. In contrast to protease inhibitors, maturation inhibitors impede particle maturation by targeting the substrate of protease (Gag) instead of the protease enzyme itself. Direct cross-resistance between protease and maturation inhibitors may seem unlikely, but the co-evolution of protease and its substrate, Gag, during protease inhibitor therapy, could potentially affect future maturation inhibitor therapy. Previous studies showed that there might also be an effect of protease inhibitor resistance mutations on the development of maturation inhibitor resistance, but the exact mechanism remains unclear. We used wild-type and protease inhibitor resistant viruses to determine the impact of protease inhibitor resistance mutations on the development of maturation inhibitor resistance. Our resistance selection studies demonstrated that the resistance profiles for the maturation inhibitor bevirimat are more diverse for viruses with a mutated protease compared to viruses with a wild-type protease. Viral replication did not appear to be a major factor during emergence of bevirimat resistance. In all in vitro selections, one of four mutations was selected: Gag V362I, A364V, S368N or V370A. The impact of these mutations on maturation inhibitor resistance and viral replication was analyzed in different protease backgrounds. The data suggest that the protease background affects development of HIV-1 resistance to bevirimat and the replication profiles of bevirimat-selected HIV-1. The protease-dependent bevirimat resistance and replication levels can be explained by differences in CA/p2 cleavage processing by the different

  14. Zebra chip disease decreases tuber (Solanum tuberosum L.) protein content by attenuating protease inhibitor levels and increasing protease activities.

    PubMed

    Kumar, G N Mohan; Knowles, Lisa O; Knowles, N Richard

    2015-11-01

    Zebra chip disease of potato decreases protease inhibitor levels resulting in enhanced serine-type protease activity, decreased protein content and altered protein profiles of fully mature tubers. Zebra-chip (ZC), caused by Candidatus Liberibacter solanacearum (CLso), is a relatively new disease of potato that negatively affects growth, yield, propagation potential, and fresh and process qualities of tubers. Diseased plants produce tubers with characteristic brown discoloration of vascular tissue accompanied by elevated levels of free amino acids and reducing sugars. Here we demonstrate that ZC disease induces selective protein catabolism in tubers through modulating protease inhibitor levels. Soluble protein content of tubers from CLso-infected plants was 33% lower than from non-infected plants and electrophoretic analyses revealed substantial reductions in major tuber proteins. Patatin (~40 kDa) and ser-, asp- (22 kDa) and cys-type (85 kDa) protease inhibitors were either absent or greatly reduced in ZC-afflicted tubers. In contrast to healthy (non-infected) tubers, the proteolytic activity in CLso infected tubers was high and the ability of extracts from infected tubers to inhibit trypsin (ser-type) and papain (cys-type) proteases greatly attenuated. Moreover, extracts from CLso-infected tubers rapidly catabolized proteins purified from healthy tubers (40 kDa patatin, 22 kDa protease inhibitors, 85 kDa potato multicystatin) when subjected to proteolysis individually. In contrast, crude extracts from non-infected tubers effectively inhibited the proteolytic activity from ZC-afflicted tubers. These results suggest that the altered protein profile of ZC afflicted tubers is largely due to loss of ser- and cys-type protease inhibitors. Further analysis revealed a novel PMSF-sensitive (ser) protease (ca. 80-120 kDa) in CLso infected tubers. PMSF abolished the proteolytic activities responsible for degrading patatin, the 22 kDa protease inhibitor(s) and potato

  15. Major and trace element partitioning between dissolved and particulate phases in Antarctic surface snow.

    PubMed

    Grotti, M; Soggia, F; Ardini, F; Magi, E

    2011-09-01

    In order to provide a new insight into the Antarctic snow chemistry, partitioning of major and trace elements between dissolved and particulate (i.e. insoluble particles, >0.45 μm) phases have been investigated in a number of coastal and inland snow samples, along with their total and acid-dissolvable (0.5% nitric acid) concentrations. Alkaline and alkaline-earth elements (Na, K, Ca, Mg, Sr) were mainly present in the dissolved phase, while Fe and Al were predominantly associated with the particulate matter, without any significant difference between inland and coastal samples. On the other hand, partitioning of trace elements depended on the sampling site position, showing a general decrease of the particulate fraction by moving from the coast to the plateau. Cd, Cu, Pb and Zn were for the most part in the dissolved phase, while Cr was mainly associated with the particulate fraction. Co, Mn and V were equally distributed between dissolved and particulate phases in the samples collected from the plateau and preferentially associated with the particulate in the coastal samples. The correlation between the elements and the inter-sample variability of their concentration significantly decreased for the plateau samples compared to the coastal ones, according to a change in the relative contribution of the metal sources and in good agreement with the estimated marine and crustal enrichment factors. In addition, samples from the plateau were characterised by higher enrichment factors of anthropogenic elements (Cd, Cr, Cu, Pb and Zn), compared to the coastal area. Finally, it was observed that the acid-dissolvable metal concentrations were generally lower than the total concentration values, showing that the acid treatment can dissolve only a given fraction of the metal associated with the particulate (<20% for iron and aluminium).

  16. Surface Temperature Changes Following the Six Major Volcanic Episodes between 1780 and 1980.

    NASA Astrophysics Data System (ADS)

    Angell, J. K.; Korshover, J.

    1985-09-01

    Examined is the effect on surface temperature of the volcanic eruptions of Asama and Laki in 1783, Tambora in 1815, Coseguina in 1835, Krakatoa in 1883, Santa Maria, Soufrière and Pelée in 1902, and Agung in 1963, using temperature records extending back to 1781. These records include New Haven, Connecticut, in North America; Edinburgh, De Bilt, Copenhagen, Berlin and Vilnius in Northern Europe; Geneva, Basel, Hohen-peissenberg, Vienna and Budapest in Central Europe; the `Central England' data of Manley; and the merged Northern Hemisphere data of Groveman and Landsberg and Jones et al. At New Haven and in Europe there is more evidence of a cooling following eruptions in subtropical and temperate latitudes than in equatorial latitudes (despite the similarity in mean dust-veil index), with a cooling most evident following the Asama and Laki eruptions in Japan and Iceland, and next most evident following the Coseguina eruption in Nicaragua. Following the tremendous Tambora eruption, the eruption with the largest dust-veil index, there is obvious cooling at New Haven, but not in Europe and perhaps not for the hemisphere as a whole. Hemispheric cooling is indicated to have been most pronounced following the Agung eruption-of the six eruption episodes the one with the smallest dust veil index but the best temperature data. Based on an application of Student's t-test to station, regional and hemispheric data, on 27 occasions (out of a possible 96) the average temperature for the 5-year period after the eruption is significantly (at the 5% level) lower than the average temperature for the 5- year period before the eruption, but in no case is the average temperature after the eruption significantly higher. It is proposed that cooling is not more apparent following some eruptions because of the tropospheric warming associated with strong and persistent El Niño episodes occurring shortly after the eruptions.

  17. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  18. Mutations in SERPINB7, encoding a member of the serine protease inhibitor superfamily, cause Nagashima-type palmoplantar keratosis.

    PubMed

    Kubo, Akiharu; Shiohama, Aiko; Sasaki, Takashi; Nakabayashi, Kazuhiko; Kawasaki, Hiroshi; Atsugi, Toru; Sato, Showbu; Shimizu, Atsushi; Mikami, Shuji; Tanizaki, Hideaki; Uchiyama, Masaki; Maeda, Tatsuo; Ito, Taisuke; Sakabe, Jun-ichi; Heike, Toshio; Okuyama, Torayuki; Kosaki, Rika; Kosaki, Kenjiro; Kudoh, Jun; Hata, Kenichiro; Umezawa, Akihiro; Tokura, Yoshiki; Ishiko, Akira; Niizeki, Hironori; Kabashima, Kenji; Mitsuhashi, Yoshihiko; Amagai, Masayuki

    2013-11-07

    "Nagashima-type" palmoplantar keratosis (NPPK) is an autosomal recessive nonsyndromic diffuse palmoplantar keratosis characterized by well-demarcated diffuse hyperkeratosis with redness, expanding on to the dorsal surfaces of the palms and feet and the Achilles tendon area. Hyperkeratosis in NPPK is mild and nonprogressive, differentiating NPPK clinically from Mal de Meleda. We performed whole-exome and/or Sanger sequencing analyses of 13 unrelated NPPK individuals and identified biallelic putative loss-of-function mutations in SERPINB7, which encodes a cytoplasmic member of the serine protease inhibitor superfamily. We identified a major causative mutation of c.796C>T (p.Arg266(∗)) as a founder mutation in Japanese and Chinese populations. SERPINB7 was specifically present in the cytoplasm of the stratum granulosum and the stratum corneum (SC) of the epidermis. All of the identified mutants are predicted to cause premature termination upstream of the reactive site, which inhibits the proteases, suggesting a complete loss of the protease inhibitory activity of SERPINB7 in NPPK skin. On exposure of NPPK lesional skin to water, we observed a whitish spongy change in the SC, suggesting enhanced water permeation into the SC due to overactivation of proteases and a resultant loss of integrity of the SC structure. These findings provide an important framework for developing pathogenesis-based therapies for NPPK.

  19. Cyclic diGMP regulates production of sortase substrates of Clostridium difficile and their surface exposure through ZmpI protease-mediated cleavage.

    PubMed

    Peltier, Johann; Shaw, Helen A; Couchman, Edward C; Dawson, Lisa F; Yu, Lu; Choudhary, Jyoti S; Kaever, Volkhard; Wren, Brendan W; Fairweather, Neil F

    2015-10-02

    In Gram-positive pathogens, surface proteins may be covalently anchored to the bacterial peptidoglycan by sortase, a cysteine transpeptidase enzyme. In contrast to other Gram-positive bacteria, only one single sortase enzyme, SrtB, is conserved between strains of Clostridium difficile. Sortase-mediated peptidase activity has been reported in vitro, and seven potential substrates have been identified. Here, we demonstrate the functionality of sortase in C. difficile. We identify two sortase-anchored proteins, the putative adhesins CD2831 and CD3246, and determine the cell wall anchor structure of CD2831. The C-terminal PPKTG sorting motif of CD2831 is cleaved between the threonine and glycine residues, and the carboxyl group of threonine is amide-linked to the side chain amino group of diaminopimelic acid within the peptidoglycan peptide stem. We show that CD2831 protein levels are elevated in the presence of high intracellular cyclic diGMP (c-diGMP) concentrations, in agreement with the control of CD2831 expression by a c-diGMP-dependent type II riboswitch. Low c-diGMP levels induce the release of CD2831 and presumably CD3246 from the surface of cells. This regulation is mediated by proteolytic cleavage of CD2831 and CD3246 by the zinc metalloprotease ZmpI, whose expression is controlled by a type I c-diGMP riboswitch. These data reveal a novel regulatory mechanism for expression of two sortase substrates by the secondary messenger c-diGMP, on which surface anchoring is dependent.

  20. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  1. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  3. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases. PMID:28405139

  4. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    PubMed

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm.

  5. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  6. The surface of Syrtis Major - Composition of the volcanic substrate and mixing with altered dust and soil

    NASA Astrophysics Data System (ADS)

    Mustard, J. F.; Erard, S.; Bibring, J.-P.; Head, J. W.; Hurtrez, S.; Langevin, Y.; Pieters, C. M.; Sotin, C. J.

    1993-02-01

    The study characterizes Syrtis Major, an old, low relief volcanic plateau near the equatorial regions of Mars, on the basis of ISM data in order to characterize the spectral properties of the surface, to identify the major mafic mineralogy of the volcanic materials, and to derive estimates of the chemistry of these minerals. The value and spatial distribution of four primary spectral variables (albedo, continuum slope, wavelength of the ferric-ferrous band minimum, and area of the ferric-ferrous absorption) are mapped and coregistered to Viking digital photomosaics. It is shown that although there is a high degree of overall spectral variability on the plateau, the key indicators of mafic mineralogy are relatively homogeneous.

  7. Hepatitis B surface antigen carrier rate in unvaccinated and vaccinated children with thalassaemia major at Bahawal Victoria Hospital, Bahawalpur, Pakistan.

    PubMed

    Rehman, A; Mazhar, A; Sheikh, M A; Naeem, M M; Bhatti, I A

    2012-04-01

    Screening of blood reduces but does not eliminate the risk of hepatitis B virus (HBV) infection in multi-transfused thalassaemia patients. This study was done to evaluate efficacy of HBV vaccination on hepatitis B virus surface antigen (HBsAg) carrier rate in children with thalassaemia major receiving multiple blood transfusions. In a cohort study conducted at a hospital in Bahawalpur, Pakistan, during 2009-10, children with thalassaemia major aged < 60 months who received more than 24 blood transfusions and were HBsAg negative at the time of first blood transfusion were included. Of 196 unvaccinated children, the seropositive rate was 12.2%; while among 218 children vaccinated during the first year of life via the Pakistan Expanded Programme on Immunization, the seropositive rate was only 0.9%. The HBV vaccine was highly effective in reducing the HBsAg carrier rate in hildren with thalassaemia aged < 5 years.

  8. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  9. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  10. [Advances in researches on epididymal WFDC-type serine protease inhibitors].

    PubMed

    Liu, Juan; Wang, Hai-Yan; Li, Jian-Yuan

    2008-11-01

    Sperm maturation in the epididymis is regulated by changes of luminal ion concentration and processing of sperm surface membrane by several glycosidases and proteases, and the actions of the proteases are controlled by protease inhibitors present in specific areas of the epididymis. WFDC-type serine protease inhibitors that are highly expressed in the epididymis play an important role in natural immunity and male reproduction. This paper gives an overview of the structure and function of the protein and its application prospects in the development of drugs for male reproductive tract infection and immunocontraception.

  11. Exogenous proteases for meat tenderization.

    PubMed

    Bekhit, Alaa A; Hopkins, David L; Geesink, Geert; Bekhit, Adnan A; Franks, Philip

    2014-01-01

    The use of exogenous proteases to improve meat tenderness has attracted much interest recently, with a view to consistent production of tender meat and added value to lower grade meat cuts. This review discusses the sources, characteristics, and use of exogenous proteases in meat tenderization to highlight the specificity of the proteases toward meat proteins and their impact on meat quality. Plant enzymes (such as papain, bromelain, and ficin) have been extensively investigated as meat tenderizers. New plant proteases (actinidin and zingibain) and microbial enzyme preparations have been of recent interest due to controlled meat tenderization and other advantages. Successful use of these enzymes in fresh meat requires their enzymatic kinetics and characteristics to be determined, together with an understanding of the impact of the surrounding environmental conditions of the meat (pH, temperature) on enzyme function. This enables the optimal conditions for tenderizing fresh meat to be established, and the elimination or reduction of any negative impacts on other quality attributes.

  12. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  13. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  14. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions.

    PubMed

    Malloy, Jaret L; Veldhuizen, Ruud A W; Thibodeaux, Brett A; O'Callaghan, Richard J; Wright, Jo Rae

    2005-02-01

    Pulmonary surfactant has two distinct functions within the lung: reduction of surface tension at the air-liquid interface and participation in innate host defense. Both functions are dependent on surfactant-associated proteins. Pseudomonas aeruginosa is primarily responsible for respiratory dysfunction and death in cystic fibrosis patients and is also a leading pathogen in nosocomial pneumonia. P. aeruginosa secretes a number of proteases that contribute to its virulence. We hypothesized that P. aeruginosa protease IV degrades surfactant proteins and results in a reduction in pulmonary surfactant host defense and biophysical functions. Protease IV was isolated from cultured supernatant of P. aeruginosa by gel chromatography. Incubation of cell-free bronchoalveolar lavage fluid with protease IV resulted in degradation of surfactant proteins (SP)-A, -D, and -B. SPs were degraded in a time- and dose-dependent fashion by protease IV, and degradation was inhibited by the trypsin-like serine protease inhibitor Nalpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK). Degradation by protease IV inhibited SP-A- and SP-D-mediated bacterial aggregation and uptake by macrophages. Surfactant treated with protease IV was unable to reduce surface tension as effectively as untreated surfactant, and this effect was inhibited by TLCK. We speculate that protease IV may be an important contributing factor to the development and propagation of acute lung injury associated with P. aeruginosa via loss of surfactant function within the lung.

  15. Conservation of major surface protein 1 genes of Anaplasma marginale during cyclic transmission between ticks and cattle.

    PubMed

    Bowie, Michael V; de la Fuente, Jose; Kocan, Katherine M; Blouin, Edmour F; Barbet, Anthony F

    2002-01-09

    Bovine anaplasmosis is a rickettsial disease of world-wide economic importance caused by Anaplasma marginale. Several major surface proteins with conserved gene sequences have been examined as potential candidates for vaccines and/or diagnostic assays. Major surface protein 1 (MSP1) is composed of polypeptides MSP1a and MSP1b. MSP1a is expressed from the single copy gene msp1 alpha and MSP1b is expressed by members of the msp1 beta multigene family. In order to determine if the msp1 genes are conserved, primers specific for msp1 alpha, msp1 beta(1), and msp1 beta(2) genes were synthesized and used to amplify msp1 sequences of A. marginale from tick cell cultures, from cattle during acute and chronic infections and from salivary glands of Dermacentor variabilis. Protein sequences of MSP1a, MSP1b(1) and MSP1b(2) were conserved during the life cycle of the parasite. No amino acid changes were observed in MSP1a. However, small variations were observed in the MSP1b(1) and MSP1b(2) protein sequences, which could be attributed to recombination, selection for sub-populations of A. marginale in the vertebrate host and/or PCR errors. Several isolate-specific sequences were also observed. Based on the information obtained in this study, the MSP1 protein appears to be fairly well conserved and a potential vaccine candidate.

  16. Evidence for surface rupture in 1868 on the Hayward fault in north Oakland and major rupturing in prehistoric earthquakes

    USGS Publications Warehouse

    Lienkaemper, J.J.; Williams, P.L.

    1999-01-01

    WGCEP90 estimated the Hayward fault to have a high probability (0.45 in 30 yr) of producing a future M7 Bay Area earthquake. This was based on a generic recurrence time and an unverified segmentation model, because there were few direct observations for the southern fault and none for the northern Hayward fault. To better constrain recurrence and segmentation of the northern Hayward fault, we trenched in north Oakland. Unexpectedly, we observed evidence of surface rupture probably from the M7 1868 earthquake. This extends the limit of that surface rupture 13 km north of the segmentation boundary used in the WGCEP90 model and forces serious re-evaluation of the current two-segment paradigm. Although we found that major prehistoric ruptures have occurred here, we could not radiocarbon date them. However, the last major prehistoric event appears correlative with a recently recognized event 13 km to the north dated AD 1640-1776. Copyright 1999 by the American Geophysical Union.

  17. Thermostability of Reovirus Disassembly Intermediates (ISVPs) Correlates with Genetic, Biochemical, and Thermodynamic Properties of Major Surface Protein μ1

    PubMed Central

    Middleton, Jason K.; Severson, Tonya F.; Chandran, Kartik; Gillian, Anne Lynn; Yin, John; Nibert, Max L.

    2002-01-01

    Kinetic analyses of infectivity loss during thermal inactivation of reovirus particles revealed substantial differences between virions and infectious subvirion particles (ISVPs), as well as between the ISVPs of reoviruses type 1 Lang (T1L) and type 3 Dearing (T3D). The difference in thermal inactivation of T1L and T3D ISVPs was attributed to the major surface protein μ1 by genetic analyses with reassortant viruses and recoated cores. Irreversible conformational changes in ISVP-bound μ1 were shown to accompany thermal inactivation. The thermal inactivation of ISVPs approximated first-order kinetics over a range of temperatures, permitting the use of Arrhenius plots to estimate activation enthalpies and entropies that account for the different behaviors of T1L and T3D. An effect similar to enthalpy-entropy compensation was additionally noted for the ISVPs of these two isolates. Kinetic analyses with other ISVP-like particles, including ISVPs of a previously reported thermostable mutant, provided further insights into the role of μ1 as a determinant of thermostability. Intact virions, which contain ς3 bound to μ1 as their major surface proteins, exhibited greater thermostability than ISVPs and underwent thermal inactivation with kinetics that deviated from first order, suggesting a role for ς3 in both these properties. The distinct inactivation behaviors of ISVPs are consistent with their role as an essential intermediate in reovirus entry. PMID:11773381

  18. Strains of Sarcocystis neurona exhibit differences in their surface antigens, including the absence of the major surface antigen SnSAG1.

    PubMed

    Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E

    2008-05-01

    A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages

  19. Ecotin-Like ISP of L. major Promastigotes Fine-Tunes Macrophage Phagocytosis by Limiting the Pericellular Release of Bradykinin from Surface-Bound Kininogens: A Survival Strategy Based on the Silencing of Proinflammatory G-Protein Coupled Kinin B2 and B1 Receptors

    PubMed Central

    Svensjö, Erik; Vellasco, Lucas; Scharfstein, Julio

    2014-01-01

    Inhibitors of serine peptidases (ISPs) expressed by Leishmania major enhance intracellular parasitism in macrophages by targeting neutrophil elastase (NE), a serine protease that couples phagocytosis to the prooxidative TLR4/PKR pathway. Here we investigated the functional interplay between ISP-expressing L. major and the kallikrein-kinin system (KKS). Enzymatic assays showed that NE inhibitor or recombinant ISP-2 inhibited KKS activation in human plasma activated by dextran sulfate. Intravital microscopy in the hamster cheek pouch showed that topically applied L. major promastigotes (WT and Δisp2/3 mutants) potently induced plasma leakage through the activation of bradykinin B2 receptors (B2R). Next, using mAbs against kininogen domains, we showed that these BK-precursor proteins are sequestered by L. major promastigotes, being expressed at higher % in the Δisp2/3 mutant population. Strikingly, analysis of the role of kinin pathway in the phagocytic uptake of L. major revealed that antagonists of B2R or B1R reversed the upregulated uptake of Δisp2/3 mutants without inhibiting macrophage internalization of WT L. major. Collectively, our results suggest that L. major ISP-2 fine-tunes macrophage phagocytosis by inhibiting the pericellular release of proinflammatory kinins from surface bound kininogens. Ongoing studies should clarify whether L. major ISP-2 subverts TLR4/PKR-dependent prooxidative responses of macrophages by preventing activation of G-protein coupled B2R/B1R. PMID:25294952

  20. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  1. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior

    PubMed Central

    Almonte, Antoine G.; Sweatt, J. David

    2011-01-01

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes—coagulation, inflammation, and digestion, for example—have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation. PMID:21782155

  2. A Study of Solar Magnetic Fields Below the Surface, at the Surface, and in the Solar Atmosphere - Understanding the Cause of Major Solar Activity

    NASA Astrophysics Data System (ADS)

    Chintzoglou, Georgios

    2016-05-01

    The fundamental processes regarding the origin, emergence and evolution of solar magnetic fields as well as the generation of solar activity are largely unknown or remain controversial. In this dissertation, multiple important issues regarding solar magnetism and activities are addressed, based on advanced observations obtained by the AIA and HMI instruments aboard the SDO spacecraft.This dissertation addresses the 3D magnetic structure of complex emerging Active Regions (ARs). In ARs the photospheric fields might show all aspects of complexity, from simple bipolar regions to extremely complex multipolar surface magnetic distributions. Here, we introduce a novel technique to infer the subphotospheric configuration of emerging magnetic flux tubes forming ARs on the surface. Using advanced 3D visualization tools with this technique on a complex flare and CME productive AR, we found that the magnetic flux tubes forming the complex AR may originate from a single progenitor flux tube in the SCZ. The complexity can be explained as a result of vertical and horizontal bifurcations that occurred on the progenitor flux tube.In addition, this dissertation proposes a new scenario on the origin of major solar activity. When more than one flux tubes are in close proximity to each other while they break through the photospheric surface, collision and shearing may occur as they emerge. Once this collisional shearing occurs between nonconjugated sunspots (opposite polarities not belonging to the same bipole), major solar activity is triggered. The collision and shearing occur due to the natural separation of polarities in emerging bipoles. In this continuous collision, more poloidal flux is added to the system effectively creating an expanding MFR into the corona, accompanied by filament formation above the PIL together with flare activity and CMEs. Our results reject two popular scenarios on the possible cause of solar eruptions (1) shearing motion between conjugate polarities, (2

  3. Approaches for the generation of active papain-like cysteine proteases from inclusion bodies of Escherichia coli.

    PubMed

    Ling, Chunfang; Zhang, Junyan; Lin, Deqiu; Tao, Ailin

    2015-05-01

    Papain-like cysteine proteases are widely expressed, fulfill specific functions in extracellular matrix turnover, antigen presentation and processing events, and may represent viable drug targets for major diseases. In depth and rigorous studies of the potential for these proteins to be targets for drug development require sufficient amounts of protease protein that can be used for both experimental and therapeutic purposes. Escherichia coli was widely used to express papain-like cysteine proteases, but most of those proteases are produced in insoluble inclusion bodies that need solubilizing, refolding, purifying and activating. Refolding is the most critical step in the process of generating active cysteine proteases and the current approaches to refolding include dialysis, dilution and chromatography. Purification is mainly achieved by various column chromatography. Finally, the attained refolded proteases are examined regarding their protease structures and activities.

  4. A study of solar magnetic fields below the surface, at the surface, and in the solar atmosphere - understanding the cause of major solar activity

    NASA Astrophysics Data System (ADS)

    Chintzoglou, Georgios

    2016-04-01

    Magnetic fields govern all aspects of solar activity from the 11-year solar cycle to the most energetic events in the solar system, such as solar flares and Coronal Mass Ejections (CMEs). As seen on the surface of the sun, this activity emanates from localized concentrations of magnetic fields emerging sporadically from the solar interior. These locations are called solar Active Regions (ARs). However, the fundamental processes regarding the origin, emergence and evolution of solar magnetic fields as well as the generation of solar activity are largely unknown or remain controversial. In this dissertation, multiple important issues regarding solar magnetism and activities are addressed, based on advanced observations obtained by AIA and HMI instruments aboard the SDO spacecraft. First, this work investigates the formation of coronal magnetic flux ropes (MFRs), structures associated with major solar activity such as CMEs. In the past, several theories have been proposed to explain the cause of this major activity, which can be categorized in two contrasting groups (a) the MFR is formed in the eruption, and (b) the MFR pre-exists the eruption. This remains a topic of heated debate in modern solar physics. This dissertation provides a complete treatment of the role of MFRs from their genesis all the way to their eruption and even destruction. The study has uncovered the pre-existence of two weakly twisted MFRs, which formed during confined flaring 12 hours before their associated CMEs. Thus, it provides unambiguous evidence for MFRs truly existing before the CME eruptions, resolving the pre-existing MFR controversy. Second, this dissertation addresses the 3-D magnetic structure of complex emerging ARs. In ARs the photospheric fields might show all aspects of complexity, from simple bipolar regions to extremely complex multi-polar surface magnetic distributions. In this thesis, we introduce a novel technique to infer the subphotospheric configuration of emerging

  5. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  6. Technical Brief: a novel strategy for enrichment of trabecular meshwork protease proteome.

    PubMed

    Picciani, Renata; Junk, Anna K; Bhattacharya, Sanjoy K

    2008-05-14

    We present a novel and simple enrichment strategy to capture trabecular meshwork (TM) protease proteome. The method relies on fractionation of TM tissue into cytosolic and nuclear extracts and subsequent affinity enrichment of proteases on peptide inhibitors. A large repertoire of available protease substrate analog peptides enables an improved capture of TM protease proteome compared to SDS-PAGE fractionation alone. Peptide analog inhibitors of protease substrates are immobilized on a protein A or G column using 254 nm intense ultraviolet (UV) light. The TM cytosolic protein extract incubated on the column is eluted with salt or a buffer with a low hydrogen ion concentration. The resultant protein solution is precipitated with acetone, fractionated on SDS-PAGE, in situ trypsin digested, and subjected to mass spectrometry. This relatively simple protocol enables improved capture of cytosolic proteases. We identified 20 previously reported TM proteins from a single donor tissue using affinity enrichment. The majority of identified proteins were either intracellular proteases or known protease inhibitors. Both serine and cysteine proteases were captured using this strategy with improved coverage compared to our previous identification without affinity enrichment.

  7. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases.

    PubMed

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-12-21

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein.

  8. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  9. Distribution of major and trace elements in surface sediments of the western Gulf of Thailand: Implications to modern sedimentation

    NASA Astrophysics Data System (ADS)

    Liu, Shengfa; Shi, Xuefa; Yang, Gang; Khokiattiwong, Somkiat; Kornkanitnan, Narumol

    2016-04-01

    In this study, we analyze major and trace elements (SiO2, Al2O3, Fe2O3, CaO, K2O, MgO, Na2O, TiO2, P2O5, MnO, Cu, Pb, Ba, Sr, V, Zn, Co, Ni, Cr, and Zr) and grain size of 157 surface sediment samples from the western Gulf of Thailand (GoT). On the basis of the space distribution characteristics, the study area can be classified into three geochemical provinces. Province I covers the northern and northwestern coastal zones of the GoT, including the whole upper GoT and thus the sediments from the rivers in the area. It contains high contents of SiO2. Province II is located in the middle of the GoT and has similar geochemistry composition as the South China Sea (SCS). It contains sediments that are characterized by higher contents of Na2O, TiO2, Ba, Cr, V, Zn, Zr, and Ni. Province Ш is located in the lower GoT, close to Malaysia. Major and trace elements in this area showed complex distribution patterns, which may be due to terrestrial materials from Malay rivers combining with some sediments from the SCS in this province. The results also indicate that grain size is the controlling factor in elemental contents, and that the hydrodynamic environment and mineral composition of the sediments play an important role in the distribution of these elements. The anthropogenic impact of heavy metal introduction (especially Cr, Zn, Cu, and Pb) can be seen in surface sediments from the nearshore region of Chantaburi province and north of Samui Island.

  10. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  11. Modeling and structural analysis of PA clan serine proteases

    PubMed Central

    2012-01-01

    Background Serine proteases account for over a third of all known proteolytic enzymes; they are involved in a variety of physiological processes and are classified into clans sharing structural homology. The PA clan of endopeptidases is the most abundant and over two thirds of this clan is comprised of the S1 family of serine proteases, which bear the archetypal trypsin fold and have a catalytic triad in the order Histidine, Aspartate, Serine. These proteases have been studied in depth and many three dimensional structures have been experimentally determined. However, these structures mostly consist of bacterial and animal proteases, with a small number of plant and fungal proteases and as yet no structures have been determined for protozoa or archaea. The core structure and active site geometry of these proteases is of interest for many applications. This study investigated the structural properties of different S1 family serine proteases from a diverse range of taxa using molecular modeling techniques. Results Our predicted models from protozoa, archaea, fungi and plants were combined with the experimentally determined structures of 16 S1 family members and used for analysis of the catalytic core. Amino acid sequences were submitted to SWISS-MODEL for homology-based structure prediction or the LOOPP server for threading-based structure prediction. Predicted models were refined using INSIGHT II and SCRWL and validated against experimental structures. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. The structural geometry of the catalytic core shows clear deviations between taxa, but the relative positions of the catalytic triad residues were conserved. Some highly conserved residues potentially contributing to the stability of the structural core were identified. Evolutionary divergence was also exhibited by large variation in secondary structure features outside the core, differences in overall amino acid

  12. A survey of major east coast snowstorms, 1960-1983. Part 2. Summary of surface and upperlevel characteristics

    NASA Technical Reports Server (NTRS)

    Kocin, P. J.; Uccellini, L. W.

    1985-01-01

    Surface and upper-level characteristics of selected meteorological fields are summarized. Two major types of sea level development are described and applied to the cases at hand, with a few storm systems showing characteristics of both types. Aspects such as rapid sea level deepening, coastal frontogenesis, cold air damming, low level jet formation, the development of an S-shaped isotherm pattern, diffluence downwind of a negatively tilted upper level trough axis, upper level confluence and an increase of geopotential heights at the base of the upper level trough characterized the pre-cyclogenetic and cyclogenetic periods of many of the storm systems. Large variability was also observed, especially with regard to the spatial dimensions of the surface and upper level systems, as well as variations in trough/ridge amplification and the evolution of upper level jet streak systems. The influence of transverse circulations associated with a confluent jet streak entrance region and the diffluent exit region of a jet streak/trough system on the production of snowfall is also discussed.

  13. The prevalence of mutations in the major hydrophilic region of the surface antigen of hepatitis B virus varies with subgenotype.

    PubMed

    Wang, X Y; Harrison, T J; He, X; Chen, Q Y; Li, G J; Liu, M H; Li, H; Yang, J Y; Fang, Z L

    2015-12-01

    Mutations in the major hydrophilic region (MHR) of the surface antigen of hepatitis B virus (HBV) may result in vaccine escape, failure of immunotherapy and antiviral resistance. These mutants may be transmitted and constitute a public health threat. We aimed to determine the prevalence of MHR mutations of HBV in areas of high endemicity in Guangxi, China. HBV surface gene was analysed from 278 HBsAg-positive asymptomatic individuals recruited from Guangxi using cluster sampling. Three genotypes, B, C and I, were identified. The overall prevalence of MHR mutations is 17·6%. The prevalence of MHR mutations in genotype B (15·1%) is not significantly different from that in genotype C (16·4%). However, the prevalence in subgenotype C5 (31·1%) is significantly higher than in subgenotype C2 (13·0%) (χ 2 = 6·997, P < 0·05). The prevalence of escape mutations and overlapping polymerase substitutions in subgenotype C5 is significantly higher than in subgenotypes B2 and C2. In total, 7·9% of MHR mutants are escape mutations and 72·1% of MHR mutations produced amino-acid changes in the overlapping polymerase, including resistance mutations to entecavir. Our results suggest that the prevalence of MHR mutations varies with subgenotype. The prevalence of escape mutations and polymerase mutations may be associated with subgenotype.

  14. Homology modelling of the major peanut allergen Ara h 2 and surface mapping of IgE-binding epitopes.

    PubMed

    Barre, Annick; Borges, Jean-Philippe; Culerrier, Raphaël; Rougé, Pierre

    2005-09-15

    Three-dimensional models built for the peanut Ara h 2 allergen and other structurally-related 2S albumin allergens of dietary nuts exhibited an overall three-dimensional fold stabilized by disulphide bridges well conserved among all the members of the 2S albumin superfamily. Conformational analysis of the linear IgE-binding epitopes mapped on the molecular surface of Ara h 2 showed no structural homology with the corresponding regions of the walnut Jug r 1, the pecan nut Car i 1 or the Brazil nut Ber e 1 allergens. The absence of epitopic community does not support the allergenic cross-reactivity observed between peanut and walnut or Brazil nut, which presumably depends on other ubiquitous seed storage protein allergens, namely the vicilins. However, the major IgE-binding epitope identified on the molecular surface of the walnut Jug r 1 allergen shared a pronounced structural homology with the corresponding region of the pecan nut Car i 1 allergen. With the exception of peanut, 2S albumins could thus account for the IgE-binding cross-reactivity observed between some other dietary nuts, e.g. walnut and pecan nut.

  15. Front surface field formation for majority carriers by functional p-NiO layer employed Si solar cell

    NASA Astrophysics Data System (ADS)

    Patel, Dipal B.; Kim, Hong-Sik; Patel, Malkeshkumar; Chauhan, Khushbu R.; Park, Jeong Eun; Lim, Donggun; Kim, Joondong

    2016-09-01

    An optically transparent and electrically conductive p-NiO layer was deposited on a conventional n-Si/p-Si solar cell, which improved the device performance. The transmittance and reflectance properties of the p-NiO layer were found to be much better than the SiNx layer in the visible light region. Impedance spectroscopic study under varying bias and illumination conditions was carried out to understand the underlying mechanisms governing the device performance. An AC signal analysis revealed that the p-NiO layer acted as a front surface field region for majority charge carriers. In addition, the p-NiO layer significantly improved Si solar cell performances due to the improved properties of parasitic resistances. The optically transparent NiO layered Si device (p-NiO/n-Si/p-Si) spontaneously enhanced the electrical properties, resulting in the substantially improved fill factor value of 74% from 34.3% of the bare n-Si/p-Si device. The existence of a front surface field increased the lifetime of carriers to 92 μs for the p-NiO/n-Si/p-Si solar cell compared to only 43 μs for an n-Si/p-Si cell. We may suggest a functional NiO layer to the efficient designs for Si solar cells.

  16. Establishment of monoclonal antibodies against a novel eosinophil-specific cell surface molecule, major facilitator super family domain containing 10.

    PubMed

    Motoi, Yuji; Saeki, Mayumi; Nishimura, Tomoe; Katayama, Kazufumi; Kitamura, Noriko; Ichikawa, Hitoshi; Miyoshi, Hiroyuki; Kaminuma, Osamu; Hiroi, Takachika

    2012-09-01

    Eosinophilic inflammation is the prominent feature of bronchial asthma, though the importance of eosinophils in the pathogenesis of this disease is controversial. We here established monoclonal antibodies against a newly identified cell surface molecule specifically expressed on mouse eosinophils. Eosinophils were highly purified from small intestine lamina propria and thymus as CD11c(+)Gr1(low)F4/80(+)B220(-) cells. Upon comparative microarray analysis for mRNA expressed in eosinophils and other leukocytes, major facilitator super family domain containing 10 (Mfsd10) was identified as a novel eosinophil-specific cell surface molecule. Hybridomas were established from spleen cells of rats immunized with Mfsd10-introduced Ba/F3 cells. One of three monoclonal antibodies against Mfsd10 displayed selective binding activity against eosinophils recovered in bronchoalveolar lavage fluid of ovalbumin-immunized and -challenged mice. Administration of this antibody in vivo induced a significant reduction of eosinophils recruited in the allergic lungs. Anti-Mfsd10 antibody is useful for investigating the pathophysiological roles of eosinophils with its selective binding and neutralizing activity for mouse eosinophils. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Mm19, a Mycoplasma meleagridis Major Surface Nuclease that Is Related to the RE_AlwI Superfamily of Endonucleases

    PubMed Central

    Yacoub, Elhem; Ben Abdelmoumen Mardassi, Boutheina

    2016-01-01

    Mycoplasma meleagridis infection is widespread in turkeys, causing poor growth and feathering, airsacculitis, osteodystrophy, and reduction in hatchability. Like most mycoplasma species, M. meleagridis is characterized by its inability to synthesize purine and pyrimidine nucleotides de novo. Consistent with this intrinsic deficiency, we here report the cloning, expression, and characterization of a M. meleagridis gene sequence encoding a major surface nuclease, referred to as Mm19. Mm19 consists of a 1941- bp ORF encoding a 646-amino-acid polypeptide with a predicted molecular mass of 74,825 kDa. BLASTP analysis revealed a significant match with the catalytic/dimerization domain of type II restriction enzymes of the RE_AlwI superfamily. This finding is consistent with the genomic location of Mm19 sequence, which dispalys characteristics of a typical type II restriction-modification locus. Like intact M. meleagridis cells, the E. coli-expressed Mm19 fusion product was found to exhibit a nuclease activity against plasmid DNA, double-stranded DNA, single-stranded DNA, and RNA. The Mm19-associated nuclease activity was consistently enhanced with Mg2+ divalent cations, a hallmark of type II restriction enzymes. A rabbit hyperimmune antiserum raised against the bacterially expressed Mm19 strongly reacted with M. meleagridis intact cells and fully neutralized the surface-bound nuclease activity. Collectively, the results show that M. meleagridis expresses a strong surface-bound nuclease activity, which is the product of a single gene sequence that is related to the RE_AlwI superfamily of endonucleases. PMID:27010566

  18. Secreted Aspergillus fumigatus Protease Alp1 Degrades Human Complement Proteins C3, C4, and C5▿

    PubMed Central

    Behnsen, Judith; Lessing, Franziska; Schindler, Susann; Wartenberg, Dirk; Jacobsen, Ilse D.; Thoen, Marcel; Zipfel, Peter F.; Brakhage, Axel A.

    2010-01-01

    The opportunistic human pathogenic fungus Aspergillus fumigatus is a major cause of fungal infections in immunocompromised patients. Innate immunity plays an important role in the defense against infections. The complement system represents an essential part of the innate immune system. This cascade system is activated on the surface of A. fumigatus conidia and hyphae and enhances phagocytosis of conidia. A. fumigatus conidia but not hyphae bind to their surface host complement regulators factor H, FHL-1, and CFHR1, which control complement activation. Here, we show that A. fumigatus hyphae possess an additional endogenous activity to control complement activation. A. fumigatus culture supernatant efficiently cleaved complement components C3, C4, C5, and C1q as well as immunoglobulin G. Secretome analysis and protease inhibitor studies identified the secreted alkaline protease Alp1, which is present in large amounts in the culture supernatant, as the central molecule responsible for this cleavage. An alp1 deletion strain was generated, and the culture supernatant possessed minimal complement-degrading activity. Moreover, protein extract derived from an Escherichia coli strain overproducing Alp1 cleaved C3b, C4b, and C5. Thus, the protease Alp1 is responsible for the observed cleavage and degrades a broad range of different substrates. In summary, we identified a novel mechanism in A. fumigatus that contributes to evasion from the host complement attack. PMID:20498262

  19. Optimisation of the detection of bacterial proteases using adsorbed immunoglobulins as universal substrates.

    PubMed

    Abuknesha, Ram A; Jeganathan, Fiona; Wildeboer, Dirk; Price, Robert G

    2010-06-15

    Bacterial proteases, Type XXIV from Bacillus licheniformens and Type XIV from Streptomyces griseus, were used to investigate the utility and optimisation of a solid phase assay for proteases, using immunoglobulin proteins as substrates. Immunoglobulins IgA and IgG were adsorbed on to surfaces of ELISA plates and exposed to various levels of the bacterial proteases which led to digestion and desorption of proportional amounts of the immunoglobulins. The assay signal was developed by measuring the remaining proteins on the polystyrene surface with appropriate enzyme-labelled anti-immunoglobulin reagents. The assay was fully optimised in terms of substrate levels employing ELISA techniques to titrate levels of adsorbed substrates and protease analytes. The critical factor which influences assay sensitivity was found to be the substrate concentration, the levels of adsorbed immunoglobulins. The estimated detection limits for protease XXIV and XIV were 10micro units/test and 9micro units/test using IgA as a substrate. EC(50) values were calculated as 213 and 48micro units/test for each protease respectively. Using IgG as a substrate, the estimated detection limits were 104micro units/test for protease XXIV and 9micro units/test for protease XIV. EC(50) values were calculated at 529micro units/test and 28micro units/test for protease XXIV and XIV respectively. The solid phase protease assay required no modification of the substrates and the adsorption step is merely simple addition of immunoglobulins to ELISA plates. Adsorption of the immunoglobulins to polystyrene enabled straightforward separation of reaction mixtures prior to development of assay signal. The assay exploits the advantages of the technical facilities of ELISA technology and commercially available reagents enabling the detection and measurement of a wide range of proteases. However, the key issue was found to be that in order to achieve the potential performance of the simple assay, optimisation of the

  20. Protease signaling in animal and plant-regulated cell death.

    PubMed

    Salvesen, Guy S; Hempel, Anne; Coll, Nuria S

    2016-07-01

    This review aims to highlight the proteases required for regulated cell death mechanisms in animals and plants. The aim is to be incisive, and not inclusive of all the animal proteases that have been implicated in various publications. The review also aims to focus on instances when several publications from disparate groups have demonstrated the involvement of an animal protease, and also when there is substantial biochemical, mechanistic and genetic evidence. In doing so, the literature can be culled to a handful of proteases, covering most of the known regulated cell death mechanisms: apoptosis, regulated necrosis, necroptosis, pyroptosis and NETosis in animals. In plants, the literature is younger and not as extensive as for mammals, although the molecular drivers of vacuolar death, necrosis and the hypersensitive response in plants are becoming clearer. Each of these death mechanisms has at least one proteolytic component that plays a major role in controlling the pathway, and sometimes they combine in networks to regulate cell death/survival decision nodes. Some similarities are found among animal and plant cell death proteases but, overall, the pathways that they govern are kingdom-specific with very little overlap. © 2015 FEBS.

  1. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  2. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  3. Molecular docking and structure-based virtual screening studies of potential drug target, CAAX prenyl proteases, of Leishmania donovani.

    PubMed

    Singh, Shalini; Vijaya Prabhu, Sitrarasu; Suryanarayanan, Venkatesan; Bhardwaj, Ruchika; Singh, Sanjeev Kumar; Dubey, Vikash Kumar

    2016-11-01

    Targeting CAAX prenyl proteases of Leishmania donovani can be a good approach towards developing a drug molecule against Leishmaniasis. We have modeled the structure of CAAX prenyl protease I and II of L. donovani, using homology modeling approach. The structures were further validated using Ramachandran plot and ProSA. Active site prediction has shown difference in the amino acid residues present at the active site of CAAX prenyl protease I and CAAX prenyl protease II. The electrostatic potential surface of the CAAX prenyl protease I and II has revealed that CAAX prenyl protease I has more electropositive and electronegative potentials as compared CAAX prenyl protease II suggesting significant difference in their activity. Molecular docking with known bisubstrate analog inhibitors of protein farnesyl transferase and peptidyl (acyloxy) methyl ketones reveals significant binding of these molecules with CAAX prenyl protease I, but comparatively less binding with CAAX prenyl protease II. New and potent inhibitors were also found using structure-based virtual screening. The best docked compounds obtained from virtual screening were subjected to induced fit docking to get best docked configurations. Prediction of drug-like characteristics has revealed that the best docked compounds are in line with Lipinski's rule. Moreover, best docked protein-ligand complexes of CAAX prenyl protease I and II are found to be stable throughout 20 ns simulation. Overall, the study has identified potent drug molecules targeting CAAX prenyl protease I and II of L. donovani whose drug candidature can be verified further using biochemical and cellular studies.

  4. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  5. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  6. Microbial proteases: detection, production, and genetic improvement.

    PubMed

    Kasana, Ramesh Chand; Salwan, Richa; Yadav, Sudesh Kumar

    2011-08-01

    Microbial proteases are one of the important groups of industrially and commercially produced enzymes contributing approximately 2/3 of all enzyme sales. Though proteases are produced by many microorganisms, emphasis is on the microorganisms producing proteases with desired characters. As demand for novel proteases is increasing day by day the initial screening methods and assays for protease detection are of utmost importance. This review focuses attention on present status of knowledge on the various methods and protocols available for protease screening, detection, and quantification starting from plate assays to spectrophotometric, fluorometric, and nanoparticles based assays. The review will help in making strategies for exploitation of protease resources and improvement of enzymes to obtain more robust proteases.

  7. Characterization and inhibition of norovirus proteases of genogroups I and II using a fluorescence resonance energy transfer assay

    SciTech Connect

    Chang, Kyeong-Ok; Takahashi, Daisuke; Prakash, Om; Kim, Yunjeong

    2012-02-20

    Noroviruses are the major cause of food- or water-borne gastroenteritis outbreaks in humans. The norovirus protease that cleaves a large viral polyprotein to nonstructural proteins is essential for virus replication and an attractive target for antiviral drug development. Noroviruses show high genetic diversity with at least five genogroups, GI-GV, of which GI and GII are responsible for the majority of norovirus infections in humans. We cloned and expressed proteases of Norwalk virus (GI) and MD145 virus (GII) and characterized the enzymatic activities with fluorescence resonance energy transfer substrates. We demonstrated that the GI and GII proteases cleaved the substrates derived from the naturally occurring cleavage site in the open reading frame (ORF) 1 of G1 norovirus with similar efficiency, and that enzymatic activity of both proteases was inhibited by commercial protease inhibitors including chymostatin. The interaction of chymostatin to Norwalk virus protease was validated by nuclear magnetic resonance (NMR) spectroscopy.

  8. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  9. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  10. Platinum-based anticancer drugs in waste waters of a major UK hospital and predicted concentrations in recipient surface waters.

    PubMed

    Vyas, Nitin; Turner, Andrew; Sewell, Graham

    2014-09-15

    Concentrations of the cytotoxic platinum-based anticancer drugs, as total Pt, have been measured over a three week period in one of the main drains and in the effluent of the oncology ward of a major UK hospital (Derriford, Plymouth). Concentrations of Pt were highly variable in both discharges, and ranged from about 0.02 to 140 μg L(-1) in the oncology effluent and from about 0.03 to 100 μg L(-1) in the main drain. A comparison of drug administration figures over the study period with an estimate of the quantity of Pt discharged through the drains suggests that about 22% of total Pt is emitted to the environment from the hospital with the remainder being discharged by treated patients in the wider community. Administration figures for the three Pt-based drugs used in the hospital (cisplatin, carboplatin and oxaliplatin) coupled with published measurements on the removal of the drugs by conventional sewage treatment allowed the concentrations of Pt arising from each drug to be predicted in recipient surface waters as a function of water flow rate. For conditions representative of the region under study, concentrations of total Pt between a few tens and in excess of 100 pg L(-1) are predicted, with the principal form of the metal occurring as carboplatin and its metabolites. Although predicted concentrations are below EMEA guidelines warranting further risk assessment, the presence of substances in surface waters that are potentially carcinogenic, mutagenic and teratogenic and yet whose environmental effects are not understood is cause for concern.

  11. Surface anatomy of major anatomical landmarks of the neck in an adult population: A Ct Evaluation of Vertebral Level.

    PubMed

    Badshah, Masroor; Soames, Roger; Ibrahim, Muhammad; Khan, Muhammad Jaffar; Khan, Adnan

    2017-09-01

    To compare the projectional surface anatomy of healthy individuals in an adult population with those with a thyroid mass, using computed tomography (CT). Sixteen slice CT images of 101 individuals were analyzed using a 32-bit Radiant DICOM viewer to establish the relationships among major anatomical landmarks in the neck and their vertebral levels. The structures investigated included: hard palate (HP), hyoid bone (HB) including body and lesser horns, soft palate (SP), thyroid gland (TG) (both superior and inferior poles), thyroid gland anteroposterior (APD) and superoinferior (SID) diameters, thyroid isthmus (TI) superoinferior dimension, epiglottis, vertebral arteries (right and left), and both right and left parotid glands (superior and inferior extents). The vertebral levels noted most frequently were: body of hyoid bone (C4, 42.71%); lesser horns of hyoid bone (C3, 36.46%); thyroid gland superior pole (C6, 31.25%); and thyroid gland inferior pole (T2, 30.2%). TG-ID, TG-APD, and TG-SID were not significantly different between males and females in the healthy group; however, there was a significant gender difference in thyroid gland inferior diameter in the pathology group [males 2.16(±1.16) vs. females 3.37(±1.30), P = 0.01, paired sample t-test]. Further studies are needed to determine whether neck pathology in those with a thyroid mass affects the dimensions of the thyroid gland. Moreover, the surface anatomy of the neck should be revisited using modern imaging techniques to address inconsistencies in anatomy and clinical reference texts. Clin. Anat. 30:781-787, 2017. © 2017Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  13. Proteases in Fas-mediated apoptosis.

    PubMed

    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S

    1997-01-01

    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  14. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola

    2007-01-01

    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  15. Improving Production of Protease from Pseudoalteromonas sp. CSN423 by Random Mutagenesis.

    PubMed

    Wu, Cuiling; Liu, Dan; Yang, Xinghao; Wu, Ribang; Zhang, Jiang; Huang, Jiafeng; He, Hailun

    2016-10-01

    Pseudoalteromonas sp. CSN423, a marine strain, can express a major protease designated as E423 and it was secreted into the supernatant. To improve the protease E423 yield, Pseudoalteromonas sp. CSN423 was subjected to mutagenesis using UV irradiation. Mutant strain with 5.1-fold higher protease yield was isolated and named as Pseudoalteromonas sp. CSN423-M. Three protease bands were detected by zymography with casein as substrate, and results of mass spectrometry (MS) showed that two lower molecular weight protein bands were the same protease but with different mature forms. The entire protease operon was sequenced and no mutation was found. Mutant strain-associated changes of expression levels of protease synthesis and secretion-related genes were determined by quantitative real-time polymerase chain reaction (qRT-PCR). Mutant strain had higher expression of e423 than wild-type strain. Such result was consistent with protease activity profiles. Moreover, the mutant strain had higher transcriptional levels of citrate synthase (cs), α-ketoglutarate decarboxylase (kgd), cytochrome c oxidase subunit I (coxI), tolC, hlyD (membrane protein), luxR3, luxO, and luxT (transcriptional regulator). However, hexokinase (hk), pyruvate dehydrogenase E1 (pd-e1), epsD (membrane protein), and luxR1 remained unchanged, and luxR2 decreased sharply in the mutant. These results suggested that the redox pathway was promoted in the mutant strain, and LuxR family transcriptional regulators in Pseudoalteromonas spp. may play some role in regulating protease expression. Meanwhile, the secretion of extracellular protease was closely related to ABC transport system. These results may shed some light on the molecular mechanism underlying higher yield of protease E423 from Pseudoalteromonas sp. CSN423-M.

  16. Kinetic Intermediates en Route to the Final Serpin-Protease Complex

    PubMed Central

    Maddur, Ashoka A.; Swanson, Richard; Izaguirre, Gonzalo; Gettins, Peter G. W.; Olson, Steven T.

    2013-01-01

    Serpin protein protease inhibitors inactivate their target proteases through a unique mechanism in which a major serpin conformational change, resulting in a 70-Å translocation of the protease from its initial reactive center loop docking site to the opposite pole of the serpin, kinetically traps the acyl-intermediate complex. Although the initial Michaelis and final trapped acyl-intermediate complexes have been well characterized structurally, the intermediate stages involved in this remarkable transformation are not well understood. To better characterize such intermediate steps, we undertook rapid kinetic studies of the FRET and fluorescence perturbation changes of site-specific fluorophore-labeled derivatives of the serpin, α1-protease inhibitor (α1PI), which report the serpin and protease conformational changes involved in transforming the Michaelis complex to the trapped acyl-intermediate complex in reactions with trypsin. Two kinetically resolvable conformational changes were observed in the reactions, ascribable to (i) serpin reactive center loop insertion into sheet A with full protease translocation but incomplete protease distortion followed by, (ii) full conformational distortion and movement of the protease and coupled serpin conformational changes involving the F helix-sheet A interface. Kinetic studies of calcium effects on the labeled α1PI-trypsin reactions demonstrated both inactive and low activity states of the distorted protease in the final complex that were distinct from the intermediate distorted state. These studies provide new insights into the nature of the serpin and protease conformational changes involved in trapping the acyl-intermediate complex in serpin-protease reactions and support a previously proposed role for helix F in the trapping mechanism. PMID:24047901

  17. Identification of the Neutralizing Epitopes of Merkel Cell Polyomavirus Major Capsid Protein within the BC and EF Surface Loops

    PubMed Central

    Fleury, Maxime J. J.; Nicol, Jérôme T. J.; Samimi, Mahtab; Arnold, Françoise; Cazal, Raphael; Ballaire, Raphaelle; Mercey, Olivier; Gonneville, Hélène; Combelas, Nicolas; Vautherot, Jean-Francois; Moreau, Thierry; Lorette, Gérard; Coursaget, Pierre; Touzé, Antoine

    2015-01-01

    Merkel cell polyomavirus (MCPyV) is the first polyomavirus clearly associated with a human cancer, i.e. the Merkel cell carcinoma (MCC). Polyomaviruses are small naked DNA viruses that induce a robust polyclonal antibody response against the major capsid protein (VP1). However, the polyomavirus VP1 capsid protein epitopes have not been identified to date. The aim of this study was to identify the neutralizing epitopes of the MCPyV capsid. For this goal, four VP1 mutants were generated by insertional mutagenesis in the BC, DE, EF and HI loops between amino acids 88-89, 150-151, 189-190, and 296-297, respectively. The reactivity of these mutants and wild-type VLPs was then investigated with anti-VP1 monoclonal antibodies and anti-MCPyV positive human sera. The findings together suggest that immunodominant conformational neutralizing epitopes are present at the surface of the MCPyV VLPs and are clustered within BC and EF loops. PMID:25812141

  18. Purification and properties of a 75-kilodalton major protein, an immunodominant surface antigen, from the oral anaerobe Bacteroides gingivalis.

    PubMed Central

    Yoshimura, F; Watanabe, K; Takasawa, T; Kawanami, M; Kato, H

    1989-01-01

    A 75-kilodalton major protein (75K protein) was purified to homogeneity from the cell lysate fraction and the envelope of Bacteroides gingivalis 381. The 75K protein was originally present in the outer membrane or the outermost part of this organism as a large, stable complex with an apparent molecular weight of about 2,000,000. Heating at 80 degrees C and at higher temperatures in the presence of sodium dodecyl sulfate was needed to completely dissociate it to monomers. Amino acid analysis revealed that the 75K protein had about 50% nonpolar amino acids. Various strains of B. gingivalis but not other bacteria, including oral Bacteroides species tested, contained serologically related 75K proteins when tested in Western blotting (immunoblotting) analysis. The abundance and localization of the 75K protein in this organism suggest that it has the potential to participate in the host-parasite interaction in infection. The 75K protein was, indeed, strongly recognized in patients with adult periodontal diseases. Immunoblotting with sera from patients and with rabbit antisera generated by intravenous inoculations of whole B. gingivalis cells revealed that the 75K protein was an immunodominant antigen on the surface of B. gingivalis. Images PMID:2553610

  19. Generation of a mosaic pattern of diversity in the major merozoite-piroplasm surface antigen of Theileria annulata.

    PubMed

    Gubbels, M J; Katzer, F; Hide, G; Jongejan, F; Shiels, B R

    2000-09-01

    The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of the protozoan parasite Theileria annulata. Generation and selection of divergent antigenic types has implications for the inclusion of the Tams1 antigen in a subunit recombinant vaccine or use in the development of a diagnostic ELISA. In this study a total of 129 Tams1 sequences from parasites isolated in Bahrain, India, Italy, Mauritania, Portugal, Spain, Sudan, Tunisia and Turkey were obtained to estimate the extent of Tams1 diversity throughout a wide geographical range. Significant sequence diversity was found both within and between isolates and many of the sequences were unique. No geographical specificity of sequence types was observed and almost identical sequences occurred in different geographical areas and a panmictic population structure is suggested by our results. A sliding window analysis identified sub-regions of the molecule where selection for amino acid changes may operate. Evidence is also presented for the generation of diversity through intragenic recombination with switching of corresponding variable domains between alleles. Recombination to exchange variable domains appears to occur throughout the length of the gene sequence, and has the potential to generate a mosaic pattern of diversity.

  20. Galectin-3 Is a Target for Proteases Involved in the Virulence of Staphylococcus aureus.

    PubMed

    Elmwall, Jonas; Kwiecinski, Jakub; Na, Manli; Ali, Abukar Ahmed; Osla, Veronica; Shaw, Lindsey N; Wang, Wanzhong; Sävman, Karin; Josefsson, Elisabet; Bylund, Johan; Jin, Tao; Welin, Amanda; Karlsson, Anna

    2017-07-01

    Staphylococcus aureus is a major cause of skin and soft tissue infection. The bacterium expresses four major proteases that are emerging as virulence factors: aureolysin (Aur), V8 protease (SspA), staphopain A (ScpA), and staphopain B (SspB). We hypothesized that human galectin-3, a β-galactoside-binding lectin involved in immune regulation and antimicrobial defense, is a target for these proteases and that proteolysis of galectin-3 is a novel immune evasion mechanism. Indeed, supernatants from laboratory strains and clinical isolates of S. aureus caused galectin-3 degradation. Similar proteolytic capacities were found in Staphylococcus epidermidis isolates but not in Staphylococcus saprophyticus Galectin-3-induced activation of the neutrophil NADPH oxidase was abrogated by bacterium-derived proteolysis of galectin-3, and SspB was identified as the major protease responsible. The impact of galectin-3 and protease expression on S. aureus virulence was studied in a murine skin infection model. In galectin-3(+/+) mice, SspB-expressing S. aureus caused larger lesions and resulted in higher bacterial loads than protease-lacking bacteria. No such difference in bacterial load or lesion size was detected in galectin-3(-/-) mice, which overall showed smaller lesion sizes than the galectin-3(+/+) animals. In conclusion, the staphylococcal protease SspB inactivates galectin-3, abrogating its stimulation of oxygen radical production in human neutrophils and increasing tissue damage during skin infection. Copyright © 2017 American Society for Microbiology.

  1. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms

    PubMed Central

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M.

    2014-01-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. PMID:24878526

  2. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.

    PubMed

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M

    2014-08-01

    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding.

  3. Efficient proteolysis and application of an alkaline protease from halophilic Bacillus sp. EMB9.

    PubMed

    Sinha, Rajeshwari; Srivastava, A K; Khare, S K

    2014-10-03

    A salt-stable alkaline protease from moderately halophilic Bacillus sp. EMB9, isolated from the western coast of India, is described. This protease was capable of efficiently removing silver from used/waste X-Ray films, as well as hydrolyzing defatted soy flour with 31% degree of hydrolysis (DH). Production of the protease was optimized by using response surface methodology. Ca(2+) and NaCl were the most critical factors in enhancing the yield. Under optimized culture conditions, a maximum of 369 U protease/mL was obtained, which is quite comparable to the yields of commercial proteases. The elevated production level coupled with ability to efficiently hydrolyze protein-laden soy flour and complete recovery of silver from used X-Ray films makes it a prospective industrial enzyme.

  4. Role of Allergen Source-Derived Proteases in Sensitization via Airway Epithelial Cells

    PubMed Central

    Matsumura, Yasuhiro

    2012-01-01

    Protease activity is a characteristic common to many allergens. Allergen source-derived proteases interact with lung epithelial cells, which are now thought to play vital roles in both innate and adaptive immune responses. Allergen source-derived proteases act on airway epithelial cells to induce disruption of the tight junctions between epithelial cells, activation of protease-activated receptor-2, and the production of thymic stromal lymphopoietin. These facilitate allergen delivery across epithelial layers and enhance allergenicity or directly activate the immune system through a nonallergic mechanism. Furthermore, they cleave regulatory cell surface molecules involved in allergic reactions. Thus, allergen source-derived proteases are a potentially critical factor in the development of allergic sensitization and appear to be strongly associated with heightened allergenicity. PMID:22523502

  5. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  6. Function and Regulation of SUMO Proteases

    PubMed Central

    Hickey, Christopher M.; Wilson, Nicole R.; Hochstrasser, Mark

    2013-01-01

    Covalent attachment of small ubiquitin-like modifier (SUMO) to proteins is highly dynamic, and both SUMO-protein conjugation and cleavage can be regulated. Protein desumoylation is performed by SUMO proteases, which control cellular mechanisms ranging from transcription and cell division to ribosome biogenesis. Recent advances include the discovery of two novel classes of SUMO proteases, insights regarding SUMO protease specificity, and revelations of previously unappreciated SUMO protease functions in several key cellular pathways. These developments, together with new connections between SUMO proteases and the recently discovered SUMO-targeted ubiquitin ligases (STUbLs), make this an exciting period for the study of these enzymes. PMID:23175280

  7. Full quantum mechanical study of binding of HIV-1 protease drugs

    NASA Astrophysics Data System (ADS)

    Zhang, Da W.; Zhang, John Z. H.

    Fully quantum mechanical studies of detailed binding interactions between HIV-1 protease and six FDA (Food and Drug Administration)-approved drugs (saquinavir, indinavir, ritonavir, nelfinavir, amprenavir, and lopinavir) are carried out using a recently developed MFCC (molecular fractionation with conjugate caps) method. The MFCC calculation produces a quantum mechanical interaction spectrum for any protease drug binding complex. Detailed quantitative analysis on binding of lopinavir to specific residues of the protease is given from the current study. The present calculation shows that the dominant binding of lopinavir to the protease is through the formation of a strong hydrogen bond between the central hydroxyl group of the drug to the aspartate oxygen of Asp25 in one of the two chains of the protease (A chain). This is closely followed by hydrogen binding of the drug to Asp29 in the B chain and somewhat weak hydrogen bonding to Asp30, Gly27, Gly48, and Ile50 in both chains. By partitioning all six drugs into four building blocks besides the central component containing the hydroxyl group, MFCC calculation finds that block III has essentially no binding interaction with the protease and the major binding interactions of these drugs are from blocks II and IV, in addition to the dominant central hydroxyl group. This detailed quantitative information on drug binding to the protease is very useful in rational design of new and improved inhibitors of HIV-1 protease and its mutants.

  8. Modification of the Staphylococcus aureus fibronectin binding phenotype by V8 protease.

    PubMed Central

    McGavin, M J; Zahradka, C; Rice, K; Scott, J E

    1997-01-01

    The amount of cell surface fibronectin (Fn)-binding protein (FnBP) adhesin expressed by Staphylococcus aureus is maximal during exponential growth but disappears rapidly as the culture progresses into stationary phase. To identify factors responsible for the loss of cell surface FnBP, a culture of S. aureus L170, which shows high levels of Fn binding, was supplemented at the time of inoculation with concentrated stationary-phase supernatant from S. aureus L530, a strain which binds Fn poorly. The resulting exponential-phase cells were devoid of FnBP. The factor responsible for this activity was purified from the culture supernatant and identified as V8 protease. When cultured with 375 ng of exogenous V8 protease ml(-1), exponential-phase cells of S. aureus L170 were devoid of cell surface FnBP, and concentrations as low as 23 ng x ml(-1) resulted in reduced amounts of FnBP. Addition of the protease inhibitor alpha2-macroglobulin to the culture medium prevented the growth-phase-dependent loss of cell surface FnBP, whereas growth with exogenous V8 protease resulted in reduced adherence to the solid-phase N-terminal fragment of Fn and to the extracellular matrix synthesized by fetal rabbit lung fibroblasts. Although FnBP was extremely sensitive to V8 protease, exogenous protease did not exert a significant influence on the amount of cell surface protein A. However, a limited number of other high-molecular-weight cell surface proteins were also sensitive to V8 protease. Therefore, both the adhesive phenotype and cell surface protein profile of S. aureus can be modified by V8 protease activity. PMID:9199429

  9. Activation of influenza viruses by proteases from host cells and bacteria in the human airway epithelium.

    PubMed

    Böttcher-Friebertshäuser, Eva; Klenk, Hans-Dieter; Garten, Wolfgang

    2013-11-01

    Influenza is an acute infection of the respiratory tract, which affects each year millions of people. Influenza virus infection is initiated by the surface glycoprotein hemagglutinin (HA) through receptor binding and fusion of viral and endosomal membranes. HA is synthesized as a precursor protein and requires cleavage by host cell proteases to gain its fusion capacity. Although cleavage of HA is crucial for virus infectivity, little was known about relevant proteases in the human airways for a long time. Recent progress in the identification and characterization of HA-activating host cell proteases has been considerable however and supports the idea of targeting HA cleavage as a novel approach for influenza treatment. Interestingly, certain bacteria have been demonstrated to support HA activation either by secreting proteases that cleave HA or due to activation of cellular proteases and thereby may contribute to virus spread and enhanced pathogenicity. In this review, we give an overview on activation of influenza viruses by proteases from host cells and bacteria with the main focus on recent progress on HA cleavage by proteases HAT and TMPRSS2 in the human airway epithelium. In addition, we outline investigations of HA-activating proteases as potential drug targets for influenza treatment.

  10. Proteases, cystic fibrosis and the epithelial sodium channel (ENaC).

    PubMed

    Thibodeau, P H; Butterworth, M B

    2013-02-01

    Proteases perform a diverse array of biological functions. From simple peptide digestion for nutrient absorption to complex signaling cascades, proteases are found in organisms from prokaryotes to humans. In the human airway, proteases are associated with the regulation of the airway surface liquid layer, tissue remodeling, host defense and pathogenic infection and inflammation. A number of proteases are released in the airways under both physiological and pathophysiological states by both the host and invading pathogens. In airway diseases such as cystic fibrosis, proteases have been shown to be associated with increased morbidity and airway disease progression. In this review, we focus on the regulation of proteases and discuss specifically those proteases found in human airways. Attention then shifts to the epithelial sodium channel (ENaC), which is regulated by proteolytic cleavage and that is considered to be an important component of cystic fibrosis disease. Finally, we discuss bacterial proteases, in particular, those of the most prevalent bacterial pathogen found in cystic fibrosis, Pseudomonas aeruginosa.

  11. Dose-dependent induction of IL-6 by plant-derived proteases in vitro

    PubMed Central

    Rose, B; Herder, C; Löffler, H; Meierhoff, G; Schloot, N C; Walz, M; Martin, S

    2006-01-01

    Oral administration of proteases such as bromelain and papain is commonly used in patients with a wide range of inflammatory conditions, but their molecular and cellular mechanisms of action are still poorly understood. The aim of our study was to investigate the impact of these proteases on the release of interleukin-6 (IL-6) and other cytokines in the recently described modified mixed lymphocyte culture (MMLC) test system which is based on the mutual interaction of cells of the innate and adaptive immunity. Bromelain and papain enhanced IL-6 production dose-dependently up to 400-fold in MMLC before and up to 30-fold after neutralization of LPS content of proteases using polymyxin B, indicating that IL-6 induction by protease treatment was attributable to both protease action and LPS content of enzyme preparations. The production of IFNγ and IL-10 was not altered by bromelain or papain, indicating a selective and differential immune activation. Both proteases impaired cytokine stability, cell proliferation and expression of cell surface molecules like CD14 only marginally, suggesting no impact of these mechanisms on protease-mediated cytokine release. These findings might provide the mechanistic rationale for the current use of proteases in wound healing and tissue regeneration since these processes depend on IL-6 induction. PMID:16367938

  12. Structural basis for substrate specificity of alphavirus nsP2 proteases.

    PubMed

    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J

    2010-08-24

    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  13. Discovery of an Unexplored Protein Structural Scaffold of Serine Protease from Big Blue Octopus (Octopus cyanea): A New Prospective Lead Molecule.

    PubMed

    Panda, Subhamay; Kumari, Leena

    2017-01-01

    Serine proteases are a group of enzymes that hydrolyses the peptide bonds in proteins. In mammals, these enzymes help in the regulation of several major physiological functions such as digestion, blood clotting, responses of immune system, reproductive functions and the complement system. Serine proteases obtained from the venom of Octopodidae family is a relatively unexplored area of research. In the present work, we tried to effectively utilize comparative composite molecular modeling technique. Our key aim was to propose the first molecular model structure of unexplored serine protease 5 derived from big blue octopus. The other objective of this study was to analyze the distribution of negatively and positively charged amino acid over molecular modeled structure, distribution of secondary structural elements, hydrophobicity molecular surface analysis and electrostatic potential analysis with the aid of different bioinformatic tools. In the present study, molecular model has been generated with the help of I-TASSER suite. Afterwards the refined structural model was validated with standard methods. For functional annotation of protein molecule we used Protein Information Resource (PIR) database. Serine protease 5 of big blue octopus was analyzed with different bioinformatical algorithms for the distribution of negatively and positively charged amino acid over molecular modeled structure, distribution of secondary structural elements, hydrophobicity molecular surface analysis and electrostatic potential analysis. The functionally critical amino acids and ligand- binding site (LBS) of the proteins (modeled) were determined using the COACH program. The molecular model data in cooperation to other pertinent post model analysis data put forward molecular insight to proteolytic activity of serine protease 5, which helps in the clear understanding of procoagulant and anticoagulant characteristics of this natural lead molecule. Our approach was to investigate the octopus

  14. Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web

    PubMed Central

    Fortelny, Nikolaus; Cox, Jennifer H.; Kappelhoff, Reinhild; Starr, Amanda E.; Lange, Philipp F.; Pavlidis, Paul; Overall, Christopher M.

    2014-01-01

    Proteolytic processing is an irreversible posttranslational modification affecting a large portion of the proteome. Protease-cleaved mediators frequently exhibit altered activity, and biological pathways are often regulated by proteolytic processing. Many of these mechanisms have not been appreciated as being protease-dependent, and the potential in unraveling a complex new dimension of biological control is increasingly recognized. Proteases are currently believed to act individually or in isolated cascades. However, conclusive but scattered biochemical evidence indicates broader regulation of proteases by protease and inhibitor interactions. Therefore, to systematically study such interactions, we assembled curated protease cleavage and inhibition data into a global, computational representation, termed the protease web. This revealed that proteases pervasively influence the activity of other proteases directly or by cleaving intermediate proteases or protease inhibitors. The protease web spans four classes of proteases and inhibitors and so links both recently and classically described protease groups and cascades, which can no longer be viewed as operating in isolation in vivo. We demonstrated that this observation, termed reachability, is robust to alterations in the data and will only increase in the future as additional data are added. We further show how subnetworks of the web are operational in 23 different tissues reflecting different phenotypes. We applied our network to develop novel insights into biologically relevant protease interactions using cell-specific proteases of the polymorphonuclear leukocyte as a system. Predictions from the protease web on the activity of matrix metalloproteinase 8 (MMP8) and neutrophil elastase being linked by an inactivating cleavage of serpinA1 by MMP8 were validated and explain perplexing Mmp8 −/− versus wild-type polymorphonuclear chemokine cleavages in vivo. Our findings supply systematically derived and

  15. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  16. Simultaneous multiplexed quantification of caffeine and its major metabolites theobromine and paraxanthine using surface-enhanced Raman scattering.

    PubMed

    Alharbi, Omar; Xu, Yun; Goodacre, Royston

    2015-11-01

    Accurate quantitative measurement of drugs and their metabolites is important as this can be used to establish long-term abuse of illicit materials as well as establish accurate drug dosing for legal therapeutics. However, the levels of drugs and xenometabolites found in human body fluids necessitate methods that are highly sensitive as well as reproducible with the potential for portability. Raman spectroscopy does offer excellent reproducibility, portability and chemical specificity, but unfortunately, the Raman effect is generally too weak unless it is enhanced. We therefore developed surface-enhanced Raman scattering (SERS) and combined it with the powerful machine learning technique of artificial neural networks to enable rapid quantification of caffeine and its two major metabolites theobromine and paraxanthine. We established a three-way mixture analysis from 10(-5) to 10(-7) mol/dm(3), and excellent predictions were generated for all three analytes in tertiary mixtures. The range we selected reflects the levels found in human body fluids, and the typical errors for our portable SERS analysis were 1.7 × 10(-6) mol/dm(3) for caffeine, 8.8 × 10(-7) mol/dm(3) for theobromine and 9.6 × 10(-7) mol/dm(3) for paraxanthine. We believe this demonstrates the exciting prospect of using SERS for the quantitative analysis of multiple analytes simultaneously without recourse to lengthy and time-consuming chromatography, a method that often has to be combined with mass spectrometry.

  17. Analysis of complete genome sequence and major surface antigens of Neorickettsia helminthoeca, causative agent of salmon poisoning disease.

    PubMed

    Lin, Mingqun; Bachman, Katherine; Cheng, Zhihui; Daugherty, Sean C; Nagaraj, Sushma; Sengamalay, Naomi; Ott, Sandra; Godinez, Al; Tallon, Luke J; Sadzewicz, Lisa; Fraser, Claire; Dunning Hotopp, Julie C; Rikihisa, Yasuko

    2017-07-01

    Neorickettsia helminthoeca, a type species of the genus Neorickettsia, is an endosymbiont of digenetic trematodes of veterinary importance. Upon ingestion of salmonid fish parasitized with infected trematodes, canids develop salmon poisoning disease (SPD), an acute febrile illness that is particularly severe and often fatal in dogs without adequate treatment. We determined and analysed the complete genome sequence of N. helminthoeca: a single small circular chromosome of 884 232 bp encoding 774 potential proteins. N. helminthoeca is unable to synthesize lipopolysaccharides and most amino acids, but is capable of synthesizing vitamins, cofactors, nucleotides and bacterioferritin. N. helminthoeca is, however, distinct from majority of the family Anaplasmataceae to which it belongs, as it encodes nearly all enzymes required for peptidoglycan biosynthesis, suggesting its structural hardiness and inflammatory potential. Using sera from dogs that were experimentally infected by feeding with parasitized fish or naturally infected in southern California, Western blot analysis revealed that among five predicted N. helminthoeca outer membrane proteins, P51 and strain-variable surface antigen were uniformly recognized. Our finding will help understanding pathogenesis, prevalence of N. helminthoeca infection among trematodes, canids and potentially other animals in nature to develop effective SPD diagnostic and preventive measures. Recent progresses in large-scale genome sequencing have been uncovering broad distribution of Neorickettsia spp., the comparative genomics will facilitate understanding of biology and the natural history of these elusive environmental bacteria. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  18. Determination of antigenic domain in GST fused major surface protein (Nc-p43) of Neospora caninum

    PubMed Central

    Son, Eui-Sun; Ahn, Hye-Jin; Kim, Jae-Hoon; Kim, Dae-Yong

    2001-01-01

    The antigenic domain of the major surface protein (Nc-p43) of Neospora caninum was examined by polymerase chain reaction of its gene fragments and recombinant expression as GST fusion proteins. The fragments of Nc-p43 were as follow: a total open reading frame (OFR), T; OFR without signal sequence and C-terminal hydrophobic sequence, S; N-terminal 2/3 parts of S, A; C-terminal 2/3 parts, P; N-terminal 1/3 part, X; middle 1/3 part, Y; and C-terminal 1/3 part, Z, respectively. The DNA fragments were cloned into pGEX-4T vector. Recombinant plasmids transformed into Escherichia coli of BL21 pLysS (DE3) strain were induced to express GST or GST fused fragments of Nc-p43 such as 69 kDa protein for T, 66 kDa for S, 52 kDa for A, 53 kDa for P, and 40 kDa proteins for X, Y, and Z, respectively in SDS-PAGE. The Nc-p43 fragments of T, S, and P reacted with a bovine serum of neosporosis while those of A, X, Y, and Z together with GST did not in the western blot. These findings suggest that the antigenic domain of Nc-p43 of N. caninum may be localized in the C-terminal 2/3 parts. Together with A19 clone in SAG1 of Toxoplasma gondii (Nam et al., 1996), the P fragment of Nc-p43 could be used as efficient antigens to diagnose and differentiate those infections with both species. PMID:11590914

  19. Interaction between Simian Virus 40 Major Capsid Protein VP1 and Cell Surface Ganglioside GM1 Triggers Vacuole Formation

    PubMed Central

    Luo, Yong; Motamedi, Nasim; Magaldi, Thomas G.; Gee, Gretchen V.; Atwood, Walter J.

    2016-01-01

    ABSTRACT Simian virus 40 (SV40), a polyomavirus that has served as an important model to understand many aspects of biology, induces dramatic cytoplasmic vacuolization late during productive infection of monkey host cells. Although this activity led to the discovery of the virus in 1960, the mechanism of vacuolization is still not known. Pentamers of the major SV40 capsid protein VP1 bind to the ganglioside GM1, which serves as the cellular receptor for the virus. In this report, we show that binding of VP1 to cell surface GM1 plays a key role in SV40 infection-induced vacuolization. We previously showed that SV40 VP1 mutants defective for GM1 binding fail to induce vacuolization, even though they replicate efficiently. Here, we show that interfering with GM1-VP1 binding by knockdown of GM1 after infection is established abrogates vacuolization by wild-type SV40. Vacuole formation during permissive infection requires efficient virus release, and conditioned medium harvested late during SV40 infection rapidly induces vacuoles in a VP1- and GM1-dependent fashion. Furthermore, vacuolization can also be induced by a nonreplicating SV40 pseudovirus in a GM1-dependent manner, and a mutation in BK pseudovirus VP1 that generates GM1 binding confers vacuole-inducing activity. Vacuolization can also be triggered by purified pentamers of wild-type SV40 VP1, but not by GM1 binding-defective pentamers or by intracellular expression of VP1. These results demonstrate that SV40 infection-induced vacuolization is caused by the binding of released progeny viruses to GM1, thereby identifying the molecular trigger for the activity that led to the discovery of SV40. PMID:27006465

  20. Variability of Near-stream, Sub-surface Major-ion and Tracer Concentrations in an Acid Mine Drainage Environment

    NASA Astrophysics Data System (ADS)

    Bencala, K. E.; Kimball, B. A.; Runkel, R. L.

    2006-12-01

    In acid mine drainage environments, tracer-injection and synoptic sampling approaches provide tools for making operational estimates of solute loading within a stream segment. Identifying sub-surface contaminant sources remains a challenge both for characterization of in-stream metal loading and hydrological process research. There is a need to quantitatively define the character and source of contaminants entering streams from ground-water pathways, as well as the potential for changes in water chemistry and contaminant concentrations along these flow paths crossing the sediment-water interface. Complicating the identification of inflows is the mixing of solute sources which may occur in the `near-stream' subsurface areas and specifically along hyporheic exchange flows (HEFs). In Mineral Creek (Silverton, Colorado), major-ion (SO42-, Cl-, Na+, Ca2+, Mg2+) meter-scale sampling shows that subsurface inflows and likely HEFs occur in a hydro- geochemical setting of significant, one order-of-magnitude, spatial variation in the solute concentrations. Transient Storage Models (TSMs) are a tool for interpreting the in-stream responses of solute transport in streams influenced by hyporheic exchange flows. Simulations using the USGS TSM code OTIS are interpreted as suggesting that in Mineral Creek the strong concentration `tailing' of bromide following the tracer injection occurred, at least in part, from HEFs in a hydro - solute transport setting of likely multiple, dispersed and mixed sources of water along a 64 m sub-reach of the nominally gaining stream. In acid mine drainage environments, the ability to distinguish between local and deep solute sources is critical in modeling reactive transport along the stream, as well as in identifying the geochemical evolution of dispersed, subsurface inflows thorough the catchment.

  1. Protease-inhibitor interaction predictions: Lessons on the complexity of protein-protein interactions.

    PubMed

    Fortelny, Nikolaus; Butler, Georgina S; Overall, Christopher Mark; Pavlidis, Paul

    2017-04-06

    Protein interactions shape proteome function and thus biology. Identification of protein interactions is a major goal in molecular biology, but biochemical methods, although improving, remain limited in coverage and accuracy. Whereas computational predictions can guide biochemical experiments, low validation rates of predictions remain a major limitation. Here, we investigated computational methods in the prediction of a specific type of interaction, the inhibitory interactions between proteases and their inhibitors. Proteases generate thousands of proteoforms that dynamically shape the functional state of proteomes. Despite the important regulatory role of proteases, knowledge of their inhibitors remains largely incomplete with the vast majority of proteases lacking an annotated inhibitor. To link inhibitors to their target proteases on a large scale, we applied computational methods to predict inhibitory interactions between proteases and their inhibitors based on complementary data including coexpression, phylogenetic similarity, structural information, co-annotation, and colocalization, and also surveyed general protein interaction networks for potential inhibitory interactions. In testing nine predicted interactions biochemically, we validated the inhibition of kallikrein 5 by serpin B12. Despite the use of a wide array of complementary data, we found a high false positive rate of computational predictions in biochemical follow-up. Based on a protease-specific definition of true negatives derived from the biochemical classification of proteases and inhibitors, we analyzed prediction accuracy of individual features. Thereby we identified feature-specific limitations, which also affected general protein interaction prediction methods. Interestingly, proteases were often not coexpressed with most of their functional inhibitors, contrary to what is commonly assumed and extrapolated predominantly from cell culture experiments. Predictions of inhibitory interactions

  2. Genetically Engineered Mouse Models Reveal the Importance of Proteases as Drug Targets in Osteoarthritis

    PubMed Central

    Miller, Rachel E.; Lu, Yongzhi; Tortorella, Micky D.; Malfait, Anne-Marie

    2014-01-01

    More than two decades of research has revealed a network of proteases that orchestrates cartilage degradation in osteoarthritis. This network includes not only metalloproteinases that degrade the major macromolecules in cartilage, aggrecan and type II collagen, but also serine proteases and cysteine proteases, such as cathepsin K. The current review summarizes the role of proteases in osteoarthritis progression, based on studies in genetically engineered mouse models. In addition, a brief overview of the biochemical characteristics and features of several key proteases in this network is provided, with the aim of increasing our understanding of how they function. Collectively, based on the data published to date, it can be concluded that at least three enzymes stand out as major targets for osteoarthritis drug development: ADAMTS-5, MMP-13, and cathepsin K. Mice that lack these enzymes are protected from cartilage damage and, to a varying degree, from bone changes in surgical models of osteoarthritis. In vivo studies with selective small molecule inhibitors targeting these proteases have been performed in various animal models. Going forward, mouse models will provide a tremendous opportunity for testing the therapeutic effects of protease inhibitors, not just on progression of structural damage to the joint, but also on associated pain. PMID:23926636

  3. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  4. Effects of cysteine protease inhibitors on rabbit cathepsin D maturation

    SciTech Connect

    Samarel, A.M.; Ferguson, A.G.; Decker, R.S.; Lesch, M. )

    1989-12-01

    To examine the effects of cysteine protease inhibitors on cathepsin D intracellular transport, proteolytic processing, and secretion, primary cultures of rabbit cardiac fibroblasts were grown to confluence and exposed to media containing leupeptin, E 64, or chloroquine. Cathepsin D maturation was then evaluated in pulse-chase biosynthetic labeling experiments. None of the three agents affected the charge modification of procathepsin D within the Golgi apparatus. However, all three agents interfered with the subsequent proteolytic processing of procathepsin D isoforms to active cathepsin D. Both leupeptin and E 64 caused the intracellular accumulation of large amounts of a Mr 51,000 processing intermediate. Trace amounts of this intermediate were also detected in chloroquine-treated cells. Combined activity assay and radioimmunoassay of cell lysates indicated that this partially processed form of cathepsin D possessed proteolytic activity. Whereas low medium concentrations of leupeptin (10-100 microM) but not E 64 appeared to stimulate procathepsin D secretion, neither agent appeared to have a major effect on the rate of proenzyme secretion at doses required to inhibit proteolytic maturation (1-10 mM). Furthermore, pretreatment of cells with 10 mM leupeptin appeared only to delay, but not prevent, the intracellular transport of cathepsin D to lysosomes. In contrast, chloroquine increased procathepsin D secretion in a dose-dependent manner, diverting the majority of newly synthesized procathepsin D from the intracellular protease(s) responsible for proteolytic processing. These results suggest that cysteine proteases participate in the proteolytic maturation of procathepsin D during the transport of newly synthesized enzyme to lysosomes, but cysteine protease-mediated proteolytic processing is not required for cathepsin D activation or lysosomal translocation.

  5. Serine Protease Activity of Calnuc

    PubMed Central

    Kanuru, Madhavi; Raman, Rajeev; Aradhyam, Gopala Krishna

    2013-01-01

    The functions of calnuc, a novel Ca2+-binding protein with multiple structural domains and diverse interacting partners, are yet unknown. We demonstrate unknown facets of calnuc, which is a serine protease in which Ser-378 of GXSXG motif, Asp-328 of DTG motif, and His-339 form the “catalytic triad,” locating the enzyme active site in the C-terminal region. Analogous to the active site of Zn2+ carboxypeptidases, calnuc has two high affinity (Kd ∼ 20 nm), well conserved Zn2+-binding sites near its N terminus, although it is inactive as a peptidase. Zn2+ binding allosterically and negatively regulates the serine protease activity of calnuc, inhibition being caused by an “open to close” change in its conformation not seen upon Ca2+ binding. Most strikingly, interaction with G protein α subunit completely inhibits the enzymatic activity of calnuc. We thus illustrate that G proteins and Zn2+ act as two “keys” that control enzymatic activity of calnuc, arresting it in “locked” state. Calnuc, therefore, exists dynamically in two different forms, (i) as a Ca2+-binding protein in Zn2+-bound form and (ii) as a protease in Zn2+-free form, commissioning it to perform multiple functions. PMID:23195954

  6. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  7. Design of new potent HTLV-1 protease inhibitors: in silico study.

    PubMed

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-03-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1's ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing "Lipinsk's rule of five". Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment.

  8. Comparative site-directed mutagenesis in the catalytic amino acid triad in calicivirus proteases.

    PubMed

    Oka, Tomoichiro; Murakami, Kosuke; Wakita, Takaji; Katayama, Kazuhiko

    2011-02-01

    Calicivirus proteases cleave the viral precursor polyprotein encoded by open reading frame 1 (ORF1) into multiple intermediate and mature proteins. These proteases have conserved histidine (His), glutamic acid (Glu) or aspartic acid (Asp), and cysteine (Cys) residues that are thought to act as a catalytic triad (i.e. general base, acid and nucleophile, respectively). However, is the triad critical for processing the polyprotein? In the present study, we examined these amino acids in viruses representing the four major genera of Caliciviridae: Norwalk virus (NoV), Rabbit hemorrhagic disease virus (RHDV), Sapporo virus (SaV) and Feline calicivirus (FCV). Using single amino-acid substitutions, we found that an acidic amino acid (Glu or Asp), as well as the His and Cys in the putative catalytic triad, cannot be replaced by Ala for normal processing activity of the ORF1 polyprotein in vitro. Similarly, normal activity is not retained if the nucleophile Cys is replaced with Ser. These results showed the calicivirus protease is a Cys protease and the catalytic triad formation is important for protease activity. Our study is the first to directly compare the proteases of the four representative calicivirus genera. Interestingly, we found that RHDV and SaV proteases critically need the acidic residues during catalysis, whereas proteolytic cleavage occurs normally at several cleavage sites in the ORF1 polyprotein without a functional acid residue in the NoV and FCV proteases. Thus, the substrate recognition mechanism may be different between the SaV and RHDV proteases and the NoV and FCV proteases. © 2011 The Societies and Blackwell Publishing Asia Pty Ltd.

  9. Design of new potent HTLV-1 protease inhibitors: in silico study

    PubMed Central

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-01-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1’s ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing “Lipinsk’s rule of five”. Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment. PMID:27844017

  10. Identification of high molecular weight serine-proteases in Loxosceles intermedia (brown spider) venom.

    PubMed

    Veiga, S S; da Silveira, R B; Dreyfus, J L; Haoach, J; Pereira, A M; Mangili, O C; Gremski, W

    2000-06-01

    High molecular weight serine-proteases have been identified in Loxosceles intermedia (brown spider) venom. The mechanism by which Loxosceles spp venoms cause dermonecrotic injury (a hallmark of loxoscelism) is currently under investigation, but it seems to be molecularly complex and in some instance proteases might be expected to play a role in this skin lesion. In the present investigation, when we submitted L. intermedia venom to linear gradient 3-20% SDS-PAGE stained by a monochromatic silver method we detected a heterogeneous protein profile in molecular weight, ranging from 850- to 5-kDa. In an attempt to detect zymogen molecules of proteolytic enzymes, venom aliquots were treated with several exogenous proteases. Among them, trypsin activated two gelatinolytic molecules of 85- and 95-kDa in the venom. In experiments of hydrolysis inactivation using different protease inhibitors for four major class of proteases, we detected that only serine-type protease inhibitors were able to inactivate the 85- and 95-kDa enzymes in the venom. An examination of the 85- and 95-kDa gelatinolytic activities as a function of pH showed that these proteases had no apparent activities at pH below 5.0 and higher than 9.0 and displayed little activity at pH 6.0. with the optimal pH for their activities ranging from 7.0 to 8.0. Evaluation of the functional specificities of the 85- and 95-kDa venom proteases showed that these proteases efficiently degrade gelatin (denatured collagen) but have no proteolytic activity on hemoglobin, immunoglobulin, albumin, librinogen or laminin, suggesting specificity of their proteolytic actions. We describe here two serine-proteases activities in L. intermedia venom probably involved in the harmful effects of the venom.

  11. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  12. Structure of Rhomboid Protease in a Lipid Environment

    PubMed Central

    Vinothkumar, Kutti R.

    2011-01-01

    Structures of the prokaryotic homologue of rhomboid proteases reveal a core of six transmembrane helices, with the active-site residues residing in a hydrophilic cavity. The native environment of rhomboid protease is a lipid bilayer, yet all the structures determined thus far are in a nonnative detergent environment. There remains a possibility of structural artefacts arising from the use of detergents. In an attempt to address the effect of detergents on the structure of rhomboid protease, crystals of GlpG, an Escherichia coli rhomboid protease in a lipid environment, were obtained using two alternative approaches. The structure of GlpG refined to 1. 7-Å resolution was obtained from crystals grown in the presence of lipid bicelles. This structure reveals well-ordered and partly ordered lipid molecules forming an annulus around the protein. Lipid molecules adapt to the surface features of protein and arrange such that they match the hydrophobic thickness of GlpG. Virtually identical two-dimensional crystals were also obtained after detergent removal by dialysis. A comparison of an equivalent structure determined in a completely delipidated detergent environment provides insights on how detergent substitutes for lipid. A detergent molecule is also observed close to the active site, helping to postulate a model for substrate binding and hydrolysis in rhomboids. PMID:21256137

  13. Release of an HtrA-Like Protease from the Cell Surface of Thermophilic Brevibacillus sp. WF146 via Substrate-Induced Autoprocessing of the N-terminal Membrane Anchor

    PubMed Central

    Zhu, Fengtao; Yang, Xing; Wu, Yan; Wang, Yasi; Tang, Xiao-Feng; Tang, Bing

    2017-01-01

    High-temperature requirement A (HtrA)-like proteases participate in protein quality control in prokaryotes and eukaryotes by degrading damaged proteins; however, little is known about HtrAs produced by thermophiles. HtrAw is an HtrA-like protease of thermophilic Brevibacillus sp. WF146. The intact form of HtrAw (iHtrAw) consisting of a transmembrane segment-containing N-terminal domain, a trypsin-like protease domain, and a C-terminal PDZ domain was produced in Escherichia coli. Purified iHtrAw itself is unable to cleave the N-terminal domain, but requires protein substrates to autoprocess the N-terminal domain intermolecularly, yielding a short form (sHtrAw). Mutation at the substrate-binding site in the PDZ domain affects the conversion of iHtrAw to sHtrAw. Deletion analysis revealed that the N-terminal domain is not necessary for enzyme folding, activity, and thermostability. Compared with other known HtrAs, HtrAw contains an additional Ca2+-binding Dx[DN]xDG motif important for enzyme stability and/or activity. When produced in an htrA/htrB double deletion mutant of Bacillus subtilis, iHtrAw localized predominantly to the cell pellet, and the amount of sHtrAw in the culture supernatant increased at elevated temperatures. Moreover, HtrAw increased the heat resistance of the B. subtilis mutant. In strain WF146, HtrAw exists in both a cell-associated intact form and a cell-free short form; an increase in growth temperature enhanced HtrAw production and the amount of cell-free short form. Release of the short form of HtrAw from the membrane may have the advantage of allowing the enzyme to freely access and degrade damaged proteins surrounding the bacterium living at high temperatures. PMID:28377763

  14. Release of an HtrA-Like Protease from the Cell Surface of Thermophilic Brevibacillus sp. WF146 via Substrate-Induced Autoprocessing of the N-terminal Membrane Anchor.

    PubMed

    Zhu, Fengtao; Yang, Xing; Wu, Yan; Wang, Yasi; Tang, Xiao-Feng; Tang, Bing

    2017-01-01

    High-temperature requirement A (HtrA)-like proteases participate in protein quality control in prokaryotes and eukaryotes by degrading damaged proteins; however, little is known about HtrAs produced by thermophiles. HtrAw is an HtrA-like protease of thermophilic Brevibacillus sp. WF146. The intact form of HtrAw (iHtrAw) consisting of a transmembrane segment-containing N-terminal domain, a trypsin-like protease domain, and a C-terminal PDZ domain was produced in Escherichia coli. Purified iHtrAw itself is unable to cleave the N-terminal domain, but requires protein substrates to autoprocess the N-terminal domain intermolecularly, yielding a short form (sHtrAw). Mutation at the substrate-binding site in the PDZ domain affects the conversion of iHtrAw to sHtrAw. Deletion analysis revealed that the N-terminal domain is not necessary for enzyme folding, activity, and thermostability. Compared with other known HtrAs, HtrAw contains an additional Ca(2+)-binding Dx[DN]xDG motif important for enzyme stability and/or activity. When produced in an htrA/htrB double deletion mutant of Bacillus subtilis, iHtrAw localized predominantly to the cell pellet, and the amount of sHtrAw in the culture supernatant increased at elevated temperatures. Moreover, HtrAw increased the heat resistance of the B. subtilis mutant. In strain WF146, HtrAw exists in both a cell-associated intact form and a cell-free short form; an increase in growth temperature enhanced HtrAw production and the amount of cell-free short form. Release of the short form of HtrAw from the membrane may have the advantage of allowing the enzyme to freely access and degrade damaged proteins surrounding the bacterium living at high temperatures.

  15. The Androgen-Regulated Protease TMPRSS2 Activates aProteolytic Cascade Involving Components of the Tumor Microenvironment and Promotes Prostate Cancer Metastasis

    PubMed Central

    Lucas, Jared M.; Heinlein, Cynthia; Kim, Tom; Hernandez, Susana A.; Malik, Muzdah S.; True, Lawrence D.; Morrissey, Colm; Corey, Eva; Montgomery, Bruce; Mostaghel, Elahe; Clegg, Nigel; Coleman, Ilsa; Brown, Christopher M.; Schneider, Eric L.; Craik, Charles; Simon, Julian; Bedalov, Tony; Nelson, Peter S.

    2014-01-01

    TMPRSS2 is an androgen-regulated cell surface serine protease expressed predominantly in prostate epithelium. TMPRSS2 is expressed highly in localized high-grade prostate cancers and in the majority of human prostate cancer metastasis. Through the generation of mouse models with a targeted deletion of Tmprss2, we demonstrate that the activity of this protease regulates cancer cell invasion and metastasis to distant organs. By screening combinatorial peptide libraries we identified a spectrum of TMPRSS2 substrates that include pro-hepatocyte growth factor (HGF). HGF activated by TMPRSS2 promoted c-Met receptor tyrosine kinase signaling, and initiated a pro-invasive EMT phenotype. Chemical library screens identified a potent bioavailable TMPRSS2 inhibitor that suppressed prostate cancer metastasis in vivo. Together, these findings provide a mechanistic link between androgen-regulated signaling programs and prostate cancer metastasis that operate via context-dependent interactions with extracellular constituents of the tumor microenvironment. PMID:25122198

  16. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  18. Secretion of proteases from Pasteurella multocida isolates.

    PubMed

    Negrete-Abascal, E; Tenorio, V R; de la Garza, M

    1999-01-01

    The capability of Pasteurella multocida to secrete proteases to the culture medium and their characterization were studied in five animal isolates (bovine, chicken, sheep, and two from pig). All the isolates produced proteases in a wide range of molecular mass. It is suggested that they are neutral metalloproteases, since they were optimally active between pH 6 and 7, inhibited by chelating agents but not by other protease inhibitors, and reactivated by calcium. Proteases from isolates were able to degrade IgG. Several proteins from supernatants of cultures precipitated with 70% (NH4)2SO4 of all the P. multocida isolates were recognized by a polyclonal antiserum raised against a purified protease from Actinobacillus pleuropneumoniae. Protease production might play an important role during tissue colonization and in P. multocida diseases.

  19. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  20. Structure and Mechanism of Rhomboid Protease*

    PubMed Central

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-01-01

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases. PMID:23585569

  1. Host-Parasite Interaction: Parasite-Derived and -Induced Proteases That Degrade Human Extracellular Matrix

    PubMed Central

    Piña-Vázquez, Carolina; Reyes-López, Magda; Ortíz-Estrada, Guillermo; de la Garza, Mireya; Serrano-Luna, Jesús

    2012-01-01

    Parasitic protozoa are among the most important pathogens worldwide. Diseases such as malaria, leishmaniasis, amoebiasis, giardiasis, trichomoniasis, and trypanosomiasis affect millions of people. Humans are constantly threatened by infections caused by these pathogens. Parasites engage a plethora of surface and secreted molecules to attach to and enter mammalian cells. The secretion of lytic enzymes by parasites into host organs mediates critical interactions because of the invasion and destruction of interstitial tissues, enabling parasite migration to other sites within the hosts. Extracellular matrix is a complex, cross-linked structure that holds cells together in an organized assembly and that forms the basement membrane lining (basal lamina). The extracellular matrix represents a major barrier to parasites. Therefore, the evolution of mechanisms for connective-tissue degradation may be of great importance for parasite survival. Recent advances have been achieved in our understanding of the biochemistry and molecular biology of proteases from parasitic protozoa. The focus of this paper is to discuss the role of protozoan parasitic proteases in the degradation of host ECM proteins and the participation of these molecules as virulence factors. We divide the paper into two sections, extracellular and intracellular protozoa. PMID:22792442

  2. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  3. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  4. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  5. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  6. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  7. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  8. Structure of the catalytic domain of the hepatitis C virus NS2-3 protease

    SciTech Connect

    Lorenz,I.; Marcotrigiano, J.; Dentzer, T.; Rice, C.

    2006-01-01

    Hepatitis C virus is a major global health problem affecting an estimated 170 million people worldwide. Chronic infection is common and can lead to cirrhosis and liver cancer. There is no vaccine available and current therapies have met with limited success. The viral RNA genome encodes a polyprotein that includes two proteases essential for virus replication. The NS2-3 protease mediates a single cleavage at the NS2/NS3 junction, whereas the NS3-4A protease cleaves at four downstream sites in the polyprotein. NS3-4A is characterized as a serine protease with a chymotrypsin-like fold, but the enzymatic mechanism of the NS2-3 protease remains unresolved. Here we report the crystal structure of the catalytic domain of the NS2-3 protease at 2.3 Angstroms resolution. The structure reveals a dimeric cysteine protease with two composite active sites. For each active site, the catalytic histidine and glutamate residues are contributed by one monomer, and the nucleophilic cysteine by the other. The carboxy-terminal residues remain coordinated in the two active sites, predicting an inactive post-cleavage form. Proteolysis through formation of a composite active site occurs in the context of the viral polyprotein expressed in mammalian cells. These features offer unexpected insights into polyprotein processing by hepatitis C virus and new opportunities for antiviral drug design.

  9. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    PubMed Central

    2010-01-01

    Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota. PMID:20416045

  10. Antimicrobial proteins and peptides in human lung diseases: A friend and foe partnership with host proteases.

    PubMed

    Lecaille, Fabien; Lalmanach, Gilles; Andrault, Pierre-Marie

    2016-03-01

    Lung antimicrobial proteins and peptides (AMPs) are major sentinels of innate immunity by preventing microbial colonization and infection. Nevertheless bactericidal activity of AMPs against Gram-positive and Gram-negative bacteria is compromised in patients with chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF) and asthma. Evidence is accumulating that expression of harmful human serine proteases, matrix metalloproteases and cysteine cathepsins is markedely increased in these chronic lung diseases. The local imbalance between proteases and protease inhibitors compromises lung tissue integrity and function, by not only degrading extracellular matrix components, but also non-matrix proteins. Despite the fact that AMPs are somewhat resistant to proteolytic degradation, some human proteases cleave them efficiently and impair their antimicrobial potency. By contrast, certain AMPs may be effective as antiproteases. Host proteases participate in concert with bacterial proteases in the degradation of key innate immunity peptides/proteins and thus may play immunomodulatory activities during chronic lung diseases. In this context, the present review highlights the current knowledge and recent discoveries on the ability of host enzymes to interact with AMPs, providing a better understanding of the role of human proteases in innate host defense.

  11. Identification and biochemical characterization of vivapains, cysteine proteases of the malaria parasite Plasmodium vivax.

    PubMed Central

    Na, Byoung-Kuk; Shenai, Bhaskar R; Sijwali, Puran S; Choe, Youngchool; Pandey, Kailash C; Singh, Ajay; Craik, Charles S; Rosenthal, Philip J

    2004-01-01

    Cysteine proteases play important roles in the life cycles of malaria parasites. Cysteine protease inhibitors block haemoglobin hydrolysis and development in Plasmodium falciparum, suggesting that the cysteine proteases of this major human pathogen, termed falcipains, are appropriate therapeutic targets. To expand our understanding of plasmodial proteases to Plasmodium vivax, the other prevalent human malaria parasite, we identified and cloned genes encoding the P. vivax cysteine proteases, vivapain-2 and vivapain-3, and functionally expressed the proteases in Escherichia coli. The vivapain-2 and vivapain-3 genes predicted papain-family cysteine proteases, which shared a number of unusual features with falcipain-2 and falcipain-3, including large prodomains and short N-terminal extensions on the catalytic domain. Recombinant vivapain-2 and vivapain-3 shared properties with the falcipains, including acidic pH optima, requirements for reducing conditions for activity and hydrolysis of substrates with positively charged residues at P1 and Leu at P2. Both enzymes hydrolysed native haemoglobin at acidic pH and the erythrocyte cytoskeletal protein 4.1 at neutral pH, suggesting similar biological roles to the falcipains. Considering inhibitor profiles, the vivapains were inhibited by fluoromethylketone and vinyl sulphone inhibitors that also inhibited falcipains and have demonstrated potent antimalarial activity. PMID:14629194

  12. A density functional theory study of uranium-doped thoria and uranium adatoms on the major surfaces of thorium dioxide

    NASA Astrophysics Data System (ADS)

    Shields, Ashley E.; Santos-Carballal, David; de Leeuw, Nora H.

    2016-05-01

    Thorium dioxide is of significant research interest for its use as a nuclear fuel, particularly as part of mixed oxide fuels. We present the results of a density functional theory (DFT) study of uranium-substituted thorium dioxide, where we found that increasing levels of uranium substitution increases the covalent nature of the bonding in the bulk ThO2 crystal. Three low Miller index surfaces have been simulated and we propose the Wulff morphology for a ThO2 particle and STM images for the (100), (110), and (111) surfaces studied in this work. We have also calculated the adsorption of a uranium atom and the U adatom is found to absorb strongly on all three surfaces, with particular preference for the less stable (100) and (110) surfaces, thus providing a route to the incorporation of uranium into a growing thoria particle.

  13. The cysteine-rich domain regulates ADAM protease function in vivo.

    PubMed

    Smith, Katherine M; Gaultier, Alban; Cousin, Helene; Alfandari, Dominique; White, Judith M; DeSimone, Douglas W

    2002-12-09

    ADAMs are membrane-anchored proteases that regulate cell behavior by proteolytically modifying the cell surface and ECM. Like other membrane-anchored proteases, ADAMs contain candidate "adhesive" domains downstream of their metalloprotease domains. The mechanism by which membrane-anchored cell surface proteases utilize these putative adhesive domains to regulate protease function in vivo is not well understood. We address this important question by analyzing the relative contributions of downstream extracellular domains (disintegrin, cysteine rich, and EGF-like repeat) of the ADAM13 metalloprotease during Xenopus laevis development. When expressed in embryos, ADAM13 induces hyperplasia of the cement gland, whereas ADAM10 does not. Using chimeric constructs, we find that the metalloprotease domain of ADAM10 can substitute for that of ADAM13, but that specificity for cement gland expansion requires a downstream extracellular domain of ADAM13. Analysis of finer resolution chimeras indicates an essential role for the cysteine-rich domain and a supporting role for the disintegrin domain. These and other results reveal that the cysteine-rich domain of ADAM13 cooperates intramolecularly with the ADAM13 metalloprotease domain to regulate its function in vivo. Our findings thus provide the first evidence that a downstream extracellular adhesive domain plays an active role in regulating ADAM protease function in vivo. These findings are likely relevant to other membrane-anchored cell surface proteases.

  14. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  15. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  16. Intramembrane protease RasP boosts protein production in Bacillus.

    PubMed

    Neef, Jolanda; Bongiorni, Cristina; Goosens, Vivianne J; Schmidt, Brian; van Dijl, Jan Maarten

    2017-04-04

    The microbial cell factory Bacillus subtilis is a popular industrial platform for high-level production of secreted technical enzymes. Nonetheless, the effective secretion of particular heterologous enzymes remains challenging. Over the past decades various studies have tackled this problem, and major improvements were achieved by optimizing signal peptides or removing proteases involved in product degradation. On the other hand, serious bottlenecks in the protein export process per se remained enigmatic, especially for protein secretion at commercially significant levels by cells grown to high density. The aim of our present study was to assess the relevance of the intramembrane protease RasP for high-level protein production in B. subtilis. Deletion of the rasP gene resulted in reduced precursor processing and extracellular levels of the overproduced α-amylases AmyE from B. subtilis and AmyL from Bacillus licheniformis. Further, secretion of the overproduced serine protease BPN' from Bacillus amyloliquefaciens was severely impaired in the absence of RasP. Importantly, overexpression of rasP resulted in threefold increased production of a serine protease from Bacillus clausii, and 2.5- to 10-fold increased production of an AmyAc α-amylase from Paenibacillus curdlanolyticus, depending on the culture conditions. Of note, growth defects due to overproduction of the two latter enzymes were suppressed by rasP-overexpression. Here we show that an intramembrane protease, RasP, sets a limit to high-level production of two secreted heterologous enzymes that are difficult to produce in the B. subtilis cell factory. This finding was unexpected and suggests that proteolytic membrane sanitation is key to effective enzyme production in Bacillus.

  17. Single Cell Analysis of Leukocyte Protease Activity Using Integrated Continuous-Flow Microfluidics.

    PubMed

    Jing, Tengyang; Lai, Zhangxing; Wu, Lidan; Han, Jongyoon; Lim, Chwee Teck; Chen, Chia-Hung

    2016-12-06

    Leukocytes are the essential cells of the immune system that protect the human body against bacteria, viruses, and other foreign invaders. Secretory products of individual leukocytes, such as matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase (ADAMs), are critical for regulating the inflammatory response and mediating host defense. Conventional single cell analytical methods, such as flow cytometry for cellular surface biomarker studies, are insufficient for performing functional assays of the protease activity of individual leukocytes. Here, an integrated continuous-flow microfluidic assay is developed to effectively detect secretory protease activity of individual viable leukocytes. Leukocytes in blood are first washed on-chip with defined buffer to remove background activity, followed by encapsulating individual leukocytes with protease sensors in water-in-oil droplets and incubating for 1 h to measure protease secretion. With this design, single leukocyte protease profiles under naive and phorbol 12-myristate 13-acetate (PMA)-stimulated conditions are reliably measured. It is found that PMA treatment not only elevates the average protease activity level but also reduces the cellular heterogeneity in protease secretion, which is important in understanding immune capability and the disease condition of individual patients.

  18. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  19. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries.

    PubMed

    Yi, Li; Gebhard, Mark C; Li, Qing; Taft, Joseph M; Georgiou, George; Iverson, Brent L

    2013-04-30

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase.

  20. Statistical optimization of alkaline protease production from Penicillium citrinum YL-1 under solid-state fermentation.

    PubMed

    Xiao, Yun-Zhu; Wu, Duan-Kai; Zhao, Si-Yang; Lin, Wei-Min; Gao, Xiang-Yang

    2015-01-01

    Proteases from halotolerant and halophilic microorganisms were found in traditional Chinese fish sauce. In this study, 30 fungi were isolated from fermented fish sauce in five growth media based on their morphology. However, only one strain, YL-1, which was identified as Penicillium citrinum by internal transcribed spacer (ITS) sequence analysis, can produce alkaline protease. This study is the first to report that a protease-producing fungus strain was isolated and identified in traditional Chinese fish sauce. Furthermore, the culture conditions of alkaline protease production by P. citrinum YL-1 in solid-state fermentation were optimized by response surface methodology. First, three variables including peptone, initial pH, and moisture content were selected by Plackett-Burman design as the significant variables for alkaline protease production. The Box-Behnken design was then adopted to further investigate the interaction effects between the three variables on alkaline protease production and determine the optimal values of the variables. The maximal production (94.30 U/mL) of alkaline protease by P. citrinum YL-1 took place under the optimal conditions of peptone, initial pH, and moisture content (v/w) of 35.5 g/L, 7.73, and 136%, respectively.

  1. Modulation of the Epithelial Sodium Channel (ENaC) by Bacterial Metalloproteases and Protease Inhibitors

    PubMed Central

    Butterworth, Michael B.; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M.; Thibodeau, Patrick H.

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions. PMID:24963801

  2. Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries

    PubMed Central

    Yi, Li; Gebhard, Mark C.; Li, Qing; Taft, Joseph M.; Georgiou, George; Iverson, Brent L.

    2013-01-01

    Myriad new applications of proteases would be enabled by an ability to fine-tune substrate specificity and activity. Herein we present a general strategy for engineering protease selectivity and activity by capitalizing on sequestration of the protease to be engineered within the yeast endoplasmic reticulum (ER). A substrate fusion protein composed of yeast adhesion receptor subunit Aga2, selection and counterselection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence is coexpressed with a protease library. Cleavage of the substrate fusion protein by the protease eliminates the ER retention sequence, facilitating transport to the yeast surface. Yeast cells that display Aga2 fusions in which only the selection substrate is cleaved are isolated by multicolor FACS with fluorescently labeled antiepitope tag antibodies. Using this system, the Tobacco Etch Virus protease (TEV-P), which strongly prefers Gln at P1 of its canonical ENLYFQ↓S substrate, was engineered to recognize selectively Glu or His at P1. Kinetic analysis indicated an overall 5,000-fold and 1,100-fold change in selectivity, respectively, for the Glu- and His-specific TEV variants, both of which retained high catalytic turnover. Human granzyme K and the hepatitis C virus protease were also shown to be amenable to this unique approach. Further, by adjusting the signaling strategy to identify phosphorylated as opposed to cleaved sequences, this unique system was shown to be compatible with the human Abelson tyrosine kinase. PMID:23589865

  3. Crystal Structures of Yellowtail Ascites Virus VP4 Protease

    PubMed Central

    Chung, Ivy Yeuk Wah; Paetzel, Mark

    2013-01-01

    Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

  4. Clitocypin, a fungal cysteine protease inhibitor, exerts its insecticidal effect on Colorado potato beetle larvae by inhibiting their digestive cysteine proteases.

    PubMed

    Šmid, Ida; Rotter, Ana; Gruden, Kristina; Brzin, Jože; Buh Gašparič, Meti; Kos, Janko; Žel, Jana; Sabotič, Jerica

    2015-07-01

    Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a major potato pest that adapts readily to insecticides. Several types of protease inhibitors have previously been investigated as potential control agents, but with limited success. Recently, cysteine protease inhibitors from parasol mushroom, the macrocypins, were reported to inhibit growth of CPB larvae. To further investigate the insecticidal potential and mode of action of cysteine protease inhibitors of fungal origin, clitocypin, a cysteine protease inhibitor from clouded agaric (Clitocybe nebularis), was evaluated for its lethal effects on CPB larvae. Clitocypin isolated from fruiting bodies and recombinant clitocypin produced in Escherichia coli slowed growth and reduced survival of CPB larvae in a concentration dependent manner. Clitocypin was also expressed by transgenic potato, but only at low levels. Nevertheless, it reduced larval weight gain and delayed development. We have additionally shown that younger larvae are more susceptible to the action of clitocypin. The inhibition of digestive cysteine proteases, intestains, by clitocypin was shown to be the underlying mode of action. Protease inhibitors from mushrooms are confirmed as promising candidates for biopesticides.

  5. Major role for carbohydrate epitopes preferentially recognized by chronically infected mice in the determination of Schistosoma mansoni schistosomulum surface antigenicity

    SciTech Connect

    Omer-ali, P.; Magee, A.I.; Kelly, C.; Simpson, A.J.G.

    1986-12-01

    A radioimmunoassay that makes use of whole Schistosomula and /sup 125/I-labeled protein A has been used to characterize and to quantify the binding of antisera to the surface of 3 hr mechanically transformed schistosomula of Schistosoma mansoni. This technique facilitates the determination of epitopes on the schistosomula in addition to those detected by surface labeling and immunoprecipitation. By using this technique, it has been demonstrated that there is a much greater binding to the parasite surface of antibodies from chronically infected mice (CMS) than of antibodies from mice infected with highly irradiated cercariae (VMS), and CMS recognizes epitopes that VMS does not. Treatment of the surface of the schistosomula with trifluoromethanesulphonic acid and sodium metaperiodate has suggested that the discrepancy of the binding between the two sera is due to the recognition of a large number of additional epitopes by CMS, which are carbohydrate in nature. Some of the carbohydrate epitopes are expressed on the previously described surface glycoprotein antigens of M/sub r/ 200,000, 38,000, and 17,000.

  6. Land Surface Phenologies and Seasonalities Using Cool Earthlight in the Major Grain Production Areas of Russia, Ukraine, and Kazakhstan

    NASA Astrophysics Data System (ADS)

    Alemu, W. G.; Henebry, G. M.

    2013-12-01

    Phenology deals with timing of biotic phenomena and seasonality concerns temporal patterns of abiotic variables. Studies of land surface phenology (LSP) and land surface seasonality (LSS) have long been limited to visible to near infrared (VNIR) wavelengths, despite degradation by atmospheric effects and solar illumination constraints. Enhanced land surface parameters derived from passive microwave data enable improved temporal monitoring of agricultural land surface dynamics compared to the vegetation index data available from VNIR data. LSPs and LSSs in grain growing regions of Russia, Ukraine and Kazakhstan were characterized using AMSR-E enhanced land surface parameters for the period from April through October for 2003 through 2010. Growing degree-days (GDDs) were calculated from AMSR-E air temperature retrievals using both ascending and descending passes with a base of 0° C and then accumulated (AGDD) with an annual restart each April 1st. Tracking the AMSR-E parameters as a function of AGDD revealed the expected seasonal pattern of thermal limitation in high latitude croplands. Vegetation optical depth (VOD), a microwave analog of a vegetation index, was modeled as a function of AGDD with the resulting fitted convex quadratic models yielding both high coefficients of determination (r2 > 0.90) and phenometrics that could characterize cropland dynamics in our study sites. The AMSR-E data were also able to capture the effects of the 2010 heat wave that devastated grain production in European Russia. These results showed the potential of AMSR-E in monitoring and modeling cropland dynamics.

  7. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar

    2016-01-01

    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  8. A single point in protein trafficking by Plasmodium falciparum determines the expression of major antigens on the surface of infected erythrocytes targeted by human antibodies.

    PubMed

    Chan, Jo-Anne; Howell, Katherine B; Langer, Christine; Maier, Alexander G; Hasang, Wina; Rogerson, Stephen J; Petter, Michaela; Chesson, Joanne; Stanisic, Danielle I; Duffy, Michael F; Cooke, Brian M; Siba, Peter M; Mueller, Ivo; Bull, Peter C; Marsh, Kevin; Fowkes, Freya J I; Beeson, James G

    2016-11-01

    Antibodies to blood-stage antigens of Plasmodium falciparum play a pivotal role in human immunity to malaria. During parasite development, multiple proteins are trafficked from the intracellular parasite to the surface of P. falciparum-infected erythrocytes (IEs). However, the relative importance of different proteins as targets of acquired antibodies, and key pathways involved in trafficking major antigens remain to be clearly defined. We quantified antibodies to surface antigens among children, adults, and pregnant women from different malaria-exposed regions. We quantified the importance of antigens as antibody targets using genetically engineered P. falciparum with modified surface antigen expression. Genetic deletion of the trafficking protein skeleton-binding protein-1 (SBP1), which is involved in trafficking the surface antigen PfEMP1, led to a dramatic reduction in antibody recognition of IEs and the ability of human antibodies to promote opsonic phagocytosis of IEs, a key mechanism of parasite clearance. The great majority of antibody epitopes on the IE surface were SBP1-dependent. This was demonstrated using parasite isolates with different genetic or phenotypic backgrounds, and among antibodies from children, adults, and pregnant women in different populations. Comparisons of antibody reactivity to parasite isolates with SBP1 deletion or inhibited PfEMP1 expression suggest that PfEMP1 is the dominant target of acquired human antibodies, and that other P. falciparum IE surface proteins are minor targets. These results establish SBP1 as part of a critical pathway for the trafficking of major surface antigens targeted by human immunity, and have key implications for vaccine development, and quantifying immunity in populations.

  9. Enabling Low Cost Biopharmaceuticals: A Systematic Approach to Delete Proteases from a Well-Known Protein Production Host Trichoderma reesei

    PubMed Central

    Landowski, Christopher P.; Huuskonen, Anne; Wahl, Ramon; Westerholm-Parvinen, Ann; Kanerva, Anne; Hänninen, Anna-Liisa; Salovuori, Noora; Penttilä, Merja; Natunen, Jari; Ostermeier, Christian; Helk, Bernhard; Saarinen, Juhani; Saloheimo, Markku

    2015-01-01

    The filamentous fungus Trichoderma reesei has tremendous capability to secrete proteins. Therefore, it would be an excellent host for producing high levels of therapeutic proteins at low cost. Developing a filamentous fungus to produce sensitive therapeutic proteins requires that protease secretion is drastically reduced. We have identified 13 major secreted proteases that are related to degradation of therapeutic antibodies, interferon alpha 2b, and insulin like growth factor. The major proteases observed were aspartic, glutamic, subtilisin-like, and trypsin-like proteases. The seven most problematic proteases were sequentially removed from a strain to develop it for producing therapeutic proteins. After this the protease activity in the supernatant was dramatically reduced down to 4% of the original level based upon a casein substrate. When antibody was incubated in the six protease deletion strain supernatant, the heavy chain remained fully intact and no degradation products were observed. Interferon alpha 2b and insulin like growth factor were less stable in the same supernatant, but full length proteins remained when incubated overnight, in contrast to the original strain. As additional benefits, the multiple protease deletions have led to faster strain growth and higher levels of total protein in the culture supernatant. PMID:26309247

  10. Enabling Low Cost Biopharmaceuticals: A Systematic Approach to Delete Proteases from a Well-Known Protein Production Host Trichoderma reesei.

    PubMed

    Landowski, Christopher P; Huuskonen, Anne; Wahl, Ramon; Westerholm-Parvinen, Ann; Kanerva, Anne; Hänninen, Anna-Liisa; Salovuori, Noora; Penttilä, Merja; Natunen, Jari; Ostermeier, Christian; Helk, Bernhard; Saarinen, Juhani; Saloheimo, Markku

    2015-01-01

    The filamentous fungus Trichoderma reesei has tremendous capability to secrete proteins. Therefore, it would be an excellent host for producing high levels of therapeutic proteins at low cost. Developing a filamentous fungus to produce sensitive therapeutic proteins requires that protease secretion is drastically reduced. We have identified 13 major secreted proteases that are related to degradation of therapeutic antibodies, interferon alpha 2b, and insulin like growth factor. The major proteases observed were aspartic, glutamic, subtilisin-like, and trypsin-like proteases. The seven most problematic proteases were sequentially removed from a strain to develop it for producing therapeutic proteins. After this the protease activity in the supernatant was dramatically reduced down to 4% of the original level based upon a casein substrate. When antibody was incubated in the six protease deletion strain supernatant, the heavy chain remained fully intact and no degradation products were observed. Interferon alpha 2b and insulin like growth factor were less stable in the same supernatant, but full length proteins remained when incubated overnight, in contrast to the original strain. As additional benefits, the multiple protease deletions have led to faster strain growth and higher levels of total protein in the culture supernatant.

  11. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  12. Structural basis of ubiquitin recognition by the deubiquitinating protease USP2.

    PubMed

    Renatus, Martin; Parrado, Shirley Gil; D'Arcy, Allan; Eidhoff, Ulf; Gerhartz, Bernd; Hassiepen, Ulrich; Pierrat, Benoit; Riedl, Ralph; Vinzenz, Daniela; Worpenberg, Susanne; Kroemer, Markus

    2006-08-01

    Deubiquitinating proteases reverse protein ubiquitination and rescue their target proteins from destruction by the proteasome. USP2, a cysteine protease and a member of the ubiquitin specific protease family, is overexpressed in prostate cancer and stabilizes fatty acid synthase, which has been associated with the malignancy of some aggressive prostate cancers. Here, we report the structure of the human USP2 catalytic domain in complex with ubiquitin. Ubiquitin uses two major sites for the interaction with the protease. Both sites are required simultaneously, as shown by USP2 inhibition assays with peptides and ubiquitin mutants. In addition, a layer of ordered water molecules mediates key interactions between ubiquitin and USP2. As several of those molecules are found at identical positions in the previously solved USP7/ubiquitin-aldehyde complex structure, we suggest a general mechanism of water-mediated ubiquitin recognition by USPs.

  13. Staphylococcus aureus Manipulates Innate Immunity through Own and Host-Expressed Proteases

    PubMed Central

    Pietrocola, Giampiero; Nobile, Giulia; Rindi, Simonetta; Speziale, Pietro

    2017-01-01

    Neutrophils, complement system and skin collectively represent the main elements of the innate immune system, the first line of defense of the host against many common microorganisms. Bacterial pathogens have evolved strategies to counteract all these defense activities. Specifically, Staphylococcus aureus, a major human pathogen, secretes a variety of immune evasion molecules including proteases, which cleave components of the innate immune system or disrupt the integrity of extracellular matrix and intercellular connections of tissues. Additionally, S. aureus secretes proteins that can activate host zymogens which, in turn, target specific defense components. Secreted proteins can also inhibit the anti-bacterial function of neutrophils or complement system proteases, potentiating S. aureus chances of survival. Here, we review the current understanding of these proteases and modulators of host proteases in the functioning of innate immunity and describe the importance of these mechanisms in the pathology of staphylococcal diseases. PMID:28529927

  14. Chloroplast Proteases: Updates on Proteolysis within and across Suborganellar Compartments.

    PubMed

    Nishimura, Kenji; Kato, Yusuke; Sakamoto, Wataru

    2016-08-01

    Chloroplasts originated from the endosymbiosis of ancestral cyanobacteria and maintain transcription and translation machineries for around 100 proteins. Most endosymbiont genes, however, have been transferred to the host nucleus, and the majority of the chloroplast proteome is composed of nucleus-encoded proteins that are biosynthesized in the cytosol and then imported into chloroplasts. How chloroplasts and the nucleus communicate to control the plastid proteome remains an important question. Protein-degrading machineries play key roles in chloroplast proteome biogenesis, remodeling, and maintenance. Research in the past few decades has revealed more than 20 chloroplast proteases, which are localized to specific suborganellar locations. In particular, two energy-dependent processive proteases of bacterial origin, Clp and FtsH, are central to protein homeostasis. Processing endopeptidases such as stromal processing peptidase and thylakoidal processing peptidase are involved in the maturation of precursor proteins imported into chloroplasts by cleaving off the amino-terminal transit peptides. Presequence peptidases and organellar oligopeptidase subsequently degrade the cleaved targeting peptides. Recent findings have indicated that not only intraplastidic but also extraplastidic processive protein-degrading systems participate in the regulation and quality control of protein translocation across the envelopes. In this review, we summarize current knowledge of the major chloroplast proteases in terms of type, suborganellar localization, and diversification. We present details of these degradation processes as case studies according to suborganellar compartment (envelope, stroma, and thylakoids). Key questions and future directions in this field are discussed. © 2016 American Society of Plant Biologists. All Rights Reserved.

  15. Tissue Dissociation Enzyme Neutral Protease Assessment

    PubMed Central

    Breite, A.G.; Dwulet, F.E.; McCarthy, R.C.

    2010-01-01

    Neutral proteases, essential components of purified tissue dissociation enzymes required for successful human islet isolation, show variable activities and effects of substrate on their activities. Initially we used a spectrophotometric endpoint assay with azocasein substrate to measure neutral protease activity. After critical review of the results, we observed these data to be inconsistent and not correlating expected differences in specific activities between thermolysin and Bacillus polymyxa proteases. This observation led to the development of a fluorescent microplate assay using fluorescein isothyocyanate–conjugated bovine serum albumin (FITC-BSA) as the substrate. This simpler, more flexible method offered a homogeneous, kinetic enzyme assay allowing determination of steady state reaction rates of sample replicates at various dilutions. The assay had a linear range of 4- to 8-fold and interassay coefficients of variation for B polymyxa protease and thermolysin of <9% and <15%, respectively, which were lower than those using the spectrophotometric endpoint assay, namely, 54% and 36%, respectively. This format allowed for incorporation of enzyme inhibitors, as illustrated by addition of sulfhydryl protease inhibitors, which, consistent with earlier reports, strongly indicated that the main contaminant in purified collagenase preparations was clostripain. Determination of the specific activities for several purified neutral proteases showed that the B polymyxa and Clostridium histolyticum proteases had approximately 40% and 15% specific activities, respectively, of those obtained with purified thermolysin, indicating the different characteristics of neutral protease enzymes for cell isolation procedures. PMID:20692405

  16. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  17. Function, therapeutic potential and cell biology of BACE proteases: current status and future prospects.

    PubMed

    Vassar, Robert; Kuhn, Peer-Hendrik; Haass, Christian; Kennedy, Matthew E; Rajendran, Lawrence; Wong, Philip C; Lichtenthaler, Stefan F

    2014-07-01

    The β-site APP cleaving enzymes 1 and 2 (BACE1 and BACE2) were initially identified as transmembrane aspartyl proteases cleaving the amyloid precursor protein (APP). BACE1 is a major drug target for Alzheimer's disease because BACE1-mediated cleavage of APP is the first step in the generation of the pathogenic amyloid-β peptides. BACE1, which is highly expressed in the nervous system, is also required for myelination by cleaving neuregulin 1. Several recent proteomic and in vivo studies using BACE1- and BACE2-deficient mice demonstrate a much wider range of physiological substrates and functions for both proteases within and outside of the nervous system. For BACE1 this includes axon guidance, neurogenesis, muscle spindle formation, and neuronal network functions, whereas BACE2 was shown to be involved in pigmentation and pancreatic β-cell function. This review highlights the recent progress in understanding cell biology, substrates, and functions of BACE proteases and discusses the therapeutic options and potential mechanism-based liabilities, in particular for BACE inhibitors in Alzheimer's disease. The protease BACE1 is a major drug target in Alzheimer disease. Together with its homolog BACE2, both proteases have an increasing number of functions within and outside of the nervous system. This review highlights recent progress in understanding cell biology, substrates, and functions of BACE proteases and discusses the therapeutic options and potential mechanism-based liabilities, in particular for BACE inhibitors in Alzheimer disease.

  18. Cysteine Proteases Inhibitors with immunoglobulin-like fold in protozoan parasites and their role in pathogenesis.

    PubMed

    Jimenez-Sandoval, Pedro; Lopez-Castillo, Laura Margarita; Trasviña-Arenas, Carlos H; Brieba, Luis G

    2016-08-13

    The number of protein folds in nature is limited, thus is not surprising that proteins with the same fold are able to exert different functions. The cysteine protease inhibitors that adopt an immunoglobulin-like fold (Ig-ICPs) are inhibitors encoded in bacteria and protozoan parasites. Structural studies indicate that these inhibitors resemble the structure of archetypical proteins with an Ig fold, like antibodies, cadherins or cell receptors. The structure of Ig-ICPs from four different protozoan parasites clearly shows the presence of three loops that form part of a protein-ligand interaction surface that resembles the antigen binding sites of antibodies. Thus, Ig-ICPs bind to different cysteine proteases using a tripartite mechanism in which their BC, DE and FG loops are responsible for the main interactions with the target cysteine protease. Ig-ICPs from different protozoan parasites regulate the enzymatic activity of host or parasite&#039;s proteases and thus regulate virulence and pathogenesis.

  19. Membrane vesicles released by Actinobacillus pleuropneumoniae contain proteases and Apx toxins.

    PubMed

    Negrete-Abascal, E; García, R M; Reyes, M E; Godínez, D; de la Garza, M

    2000-10-01

    Actinobacillus pleuropneumoniae serotype 1 releases vesicles containing proteases and Apx toxins into the culture medium. Vesicles were concentrated by ultracentrifugation and analyzed by electron microscopy and electrophoresis; their size ranged from 20 to 200 nm. A polyclonal antiserum raised against a purified high molecular mass secreted protease of serotype 1 recognized this protease on the surface of the vesicles by immunogold electron microscopy. Higher molecular mass polypeptides from vesicle extracts were recognized by the antiserum by Western immunoblot, indicating that the protease could form oligomers. However, these oligomers were not active against gelatin until secreted. Additionally, Apx toxins were also present in vesicles, and were recognized by Western immunoblot by an anti-serotype 1 toxins polyclonal serum. A. pleuropneumoniae antigens in vesicles were recognized by convalescent-phase pig sera from animals infected with serotype 1 or 5. The release of vesicles containing virulence factors could be a tissue damage mechanism in swine pleuropneumonia.

  20. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  1. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  2. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  3. A fungal protease allergen provokes airway hyperresponsiveness in asthma

    PubMed Central

    Balenga, Nariman A.; Klichinsky, Michael; Xie, Zhihui; Chan, Eunice C.; Zhao, Ming; Jude, Joseph; Laviolette, Michel; Panettieri, Reynold A.; Druey, Kirk M.

    2015-01-01

    Asthma, a common disorder that affects more than 250 million people worldwide, is defined by exaggerated bronchoconstriction to inflammatory mediators including acetylcholine, bradykinin, and histamine—also termed airway hyper-responsiveness Nearly 10% of people with asthma have severe, treatment-resistant disease, which is frequently associated with IgE sensitization to ubiquitous fungi, typically Aspergillus fumigatus. Here we show that a major Aspergillus fumigatus allergen, Asp f13, which is a serine protease, alkaline protease 1 (Alp 1), promotes airway hyper-responsiveness by infiltrating the bronchial submucosa and disrupting airway smooth muscle cell-extracellular matrix interactions. Alp 1-mediated extracellular matrix degradation evokes pathophysiological RhoA-dependent Ca2+ sensitivity and bronchoconstriction. These findings support a pathogenic mechanism in asthma and other lung diseases associated with epithelial barrier impairment, whereby airway smooth muscle cells respond directly to inhaled environmental allergens to generate airway hyper-responsiveness. PMID:25865874

  4. Dynamic redistribution of major platelet surface receptors after contact-induced platelet activation and spreading. An immunoelectron microscopy study.

    PubMed Central

    Kieffer, N.; Guichard, J.; Breton-Gorius, J.

    1992-01-01

    The authors used an immunogold labeling procedure to investigate the redistribution of platelet receptors and their ligands on the surface of contact-activated adherent platelets before and after thrombin stimulation. During the initial stage of platelet adhesion, a typical segregation of receptors occurred. Gold particles identifying glycoprotein (GP) Ib (CD42b) and GPIIb-IIIa (CD41a) remained distributed over the entire platelet surface, whereas gold particles identifying GPIa-IIa (CDw 49b) and GPIV (CD36) were found essentially overlying the granulomere; p24 (CD9) was present at the peripheral platelet rim and over the cell body. An increased labeling of GPIIb-IIIa, GPIV and p24 was also observed on pseudopods, with GPIIb-IIIa and GPIV concentrated at the enlarged extremities and at sites of contact between two platelets, whereas GPIb was absent from pseudopods. After thrombin stimulation of adherent platelets, GPIb underwent a relocation to the cell center, in contrast to GPIIb-IIIa which still remained randomly distributed over the cell body. To investigate whether ligand distribution paralleled this receptor segregation, platelet released von Willebrand factor (vWF), fibrinogen (Fg) and thrombospondin (TSP) were visualized. During the early stages of platelet activation, surface labeling for all three adhesive proteins was minimal and almost undetectable. Occasionally, intragranular Fg and vWF was accessible to gold-coupled antibodies, with vWF exhibiting the typical eccentric alpha-granular localization. At later stages of activation and especially after thrombin stimulation, no surface labeling for vWF was observed, whereas immunogold particles identifying vWF were still present inside enlarged clear vacuoles. In contrast, labeling of Fg and TSP was increased over the granulomere and extended to the cell periphery and the pseudopods, but was absent from the hyalomere, despite the presence of GPIIb-IIIa molecules. Double labeling experiments showed

  5. A novel and rapid assay for HIV-1 protease detection using magnetic bead mediation.

    PubMed

    Esseghaier, Chiheb; Ng, Andy; Zourob, Mohammed

    2013-03-15

    A simple sensing assay was established for label-free detection of HIV-1 protease. HIV-1 protease peptide substrate conjugated to magnetic beads via its N-terminus is directly fixed onto the sensor gold surface through the sulphur atom of cysteine. Surface plasmon resonance (SPR) was used to study the peptide substrate cleavage efficiency of the protease with magnetic beads of different sizes (1 μm and 30 nm). Cyclic voltammetry and faradic impedance spectroscopy were employed in order to characterize the functionalized gold electrode. It was found that the nano-sized beads are a more efficient sensing probe for the protease. Electrochemical biosensing showed a gradual decrease in charge transfer resistance after injection of the HIV-1 protease. The experimental data established a detection limit of 10 pg/ml, as well as demonstrated a drug screening assay. This HIV-1 protease biosensor represents a new detection approach which will lead to low-cost point-of-care devices for sensitive HIV-1 diagnosis, as well as high-throughput drug screening platforms.

  6. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  7. Role of an extracellular neutral protease in infection against nematodes by Brevibacillus laterosporus strain G4.

    PubMed

    Tian, Baoyu; Yang, Jinkui; Lian, Lihui; Wang, Chunyan; Li, Ning; Zhang, Ke-Qin

    2007-02-01

    Proteases have been proposed as virulence factors in microbial pathogenicity against nematodes. However, what kinds of extracellular proteases from these pathogens and how they contribute to the pathogenesis of infections against nematode in vivo remain largely unknown. A previous analysis using a strain with a deletion in an extracellular alkaline protease BLG4 gene from Brevibacillus laterosporus demonstrated that BLG4 was responsible for the majority of nematicidal activity by destroying host's cuticle. In recent studies, a neutral protease NPE-4, purified from the mutant BLG4-6, was found to be responsible for the majority of the remaining EDTA-inhibited protease activity. However, the purified NPE-4 and recombinant NPE-4 in a related species Bacillus subtilis showed little nematicidal activity in vitro and were unable to degrade the intact cuticle of the host. It is interesting to note that the addition of NPE-4 improved the pathogenicity of crude enzyme extract from wild-type B. laterosporus but had no effect on the BLG4-deficient mutant. This result suggests that NPE-4 functions in the presence of protease BLG4. Moreover, NPE-4 could degrade proteins from the inner layer of purified cuticles from nematode Panagrellus redivivus in vitro. These results indicated that the two different bacterial extracellular proteases might play differential roles at different stages of infection or a synthetic role in penetration of nematode cuticle in B. laterosporus. This is among the first reports to systematically evaluate and define the roles of different bacterial extracellular proteases in infection against nematodes.

  8. Electrochemical CO2 reduction on Au surfaces: mechanistic aspects regarding the formation of major and minor products

    DOE PAGES

    Cave, Etosha R.; Montoya, Joseph H.; Kuhl, Kendra P.; ...

    2017-01-06

    In the future, industrial CO2 electroreduction using renewable energy sources could be a sustainable means to convert CO2 and water into commodity chemicals at room temperature and atmospheric pressure. This study focuses on the electrocatalytic reduction of CO2 on polycrystalline Au surfaces, which have high activity and selectivity for CO evolution. Here, we explore the catalytic behavior of polycrystalline Au surfaces by coupling potentiostatic CO2 electrolysis experiments in an aqueous bicarbonate solution with high sensitivity product detection methods. We observed the production of methanol, in addition to detecting the known products of CO2 electroreduction on Au: CO, H2 and formate.more » We suggest a mechanism that explains Au's evolution of methanol. Specifically, the Au surface does not favor C-O scission, and thus is more selective towards methanol than methane. These insights could aid in the design of electrocatalysts that are selective for CO2 electroreduction to oxygenates over hydrocarbons.« less

  9. Wet-surface–enhanced ellipsometric contrast microscopy identifies slime as a major adhesion factor during bacterial surface motility

    PubMed Central

    Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier

    2012-01-01

    In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces. PMID:22665761

  10. Plasmodium subtilisin-like protease 1 (SUB1): Insights into the active-site structure, specificity and function of a pan-malaria drug target

    PubMed Central

    Withers-Martinez, Chrislaine; Suarez, Catherine; Fulle, Simone; Kher, Samir; Penzo, Maria; Ebejer, Jean-Paul; Koussis, Kostas; Hackett, Fiona; Jirgensons, Aigars; Finn, Paul; Blackman, Michael J.

    2012-01-01

    Release of the malaria merozoite from its host erythrocyte (egress) and invasion of a fresh cell are crucial steps in the life cycle of the malaria pathogen. Subtilisin-like protease 1 (SUB1) is a parasite serine protease implicated in both processes. In the most dangerous human malarial species, Plasmodium falciparum, SUB1 has previously been shown to have several parasite-derived substrates, proteolytic cleavage of which is important both for egress and maturation of the merozoite surface to enable invasion. Here we have used molecular modelling, existing knowledge of SUB1 substrates, and recombinant expression and characterisation of additional Plasmodium SUB1 orthologues, to examine the active site architecture and substrate specificity of P. falciparum SUB1 and its orthologues from the two other major human malaria pathogens Plasmodium vivax and Plasmodium knowlesi, as well as from the rodent malaria species, Plasmodium berghei. Our results reveal a number of unusual features of the SUB1 substrate binding cleft, including a requirement to interact with both prime and non-prime side residues of the substrate recognition motif. Cleavage of conserved parasite substrates is mediated by SUB1 in all parasite species examined, and the importance of this is supported by evidence for species-specific co-evolution of protease and substrates. Two peptidyl alpha-ketoamides based on an authentic PfSUB1 substrate inhibit all SUB1 orthologues examined, with inhibitory potency enhanced by the presence of a carboxyl moiety designed to introduce prime side interactions with the protease. Our findings demonstrate that it should be possible to develop ‘pan-reactive’ drug-like compounds that inhibit SUB1 in all three major human malaria pathogens, enabling production of broad-spectrum antimalarial drugs targeting SUB1. PMID:22543039

  11. [A preliminary study on the chemical properties of precipitation, throughfall, stemflow and surface run-off in major forest types at Dinghushan under acid deposition].

    PubMed

    Liu, Juxiu; Zhang, Deqiang; Zhou, Guoyi; Wen, Dazhi; Zhang, Qianmei

    2003-08-01

    Studies on the chemical properties of precipitation, throughfall, stemflow and surface run-off in major forest types at Dinghushan under acid deposition showed that the pH value of precipitation was about 4.90, and the frequency of acid rain was over 62%. In broad-leaved forest, the pH value of precipitation was lower than that of throughfall, but higher than that of stemflow and especially the surface run-off, indicating that the soil was naturally acidified. In mixed forest, both throughfall and surface run-off had a higher pH value, but stemflow had a lower pH value than precipitation. The throughfall and stemflow were more acidified than precipitation in coniferous pine forest, but the surface run-off had a higher pH value than precipitation. These results suggested that among the three major forest types at Dinghushan, the canopy of broad-leaved forest had the highest buffering ability, whereas for the soil, the coniferous forest had the highest soil buffering capacity. The concentrations of nutrient elements, such as P, K, Ca, Na and Mg in the throughfall, stemflow and surface run-off were higher than those in bulk precipitation in all forests at Dinghushan, some even 10 times higher, indicating that a large amount of nutrients were leached from the canopy. The concentrations of nutrient elements in stemflow were higher than those in throughfall in all forests, and the concentration of nutrient elements in surface water was higher than those in atmospheric rainfall. Coniferous forest had a higher concentration of nutrients in the throughfall and stemflow and a lower nutrient concentration in the surface run-off than other forest types, which implied that nutrient loss was more serious in broad-leaved and mixed forests than in coniferous forests.

  12. Molecular and functional characterisation of a stress responsive cysteine protease, EhCP6 from Entamoeba histolytica.

    PubMed

    Ghosh, Anupama; Raha, Sanghamitra

    2015-05-01

    Entamoeba histolytica cysteine protease 6 (EhCP6) is a stress responsive cysteine protease that is upregulated in response to heat shock and during pathogen invasion of the host tissue. In the present study an attempt has been made to express and purify recombinant EhCP6 in order to gain insights into its biochemical properties. The recombinant and refolded protein has been shown to undergo autoproteolysis in the presence of DTT and SDS to give rise to ∼25kDa mature form. The mature form of the protein was found to exhibit a protease activity that is sensitive to E-64, a specific cysteine protease inhibitor. In silico homology modelling of EhCP6 revealed that the protein exhibits conservation of almost all the major structural features of cathepsin-L like cysteine proteases. Further in vivo studies are needed to decipher the function of the protein in response to different stressed conditions.

  13. Direct Visualization of Peptide/MHC Complexes at the Surface and in the Intracellular Compartments of Cells Infected In Vivo by Leishmania major

    PubMed Central

    Cazareth, Julie; Hoebeke, Johan; Lippuner, Christoph; Davalos-Misslitz, Ana; Aebischer, Toni; Muller, Sylviane; Glaichenhaus, Nicolas; Mougneau, Evelyne

    2010-01-01

    Protozoa and bacteria infect various types of phagocytic cells including macrophages, monocytes, dendritic cells and eosinophils. However, it is not clear which of these cells process and present microbial antigens in vivo and in which cellular compartments parasite peptides are loaded onto Major Histocompatibility Complex molecules. To address these issues, we have infected susceptible BALB/c (H-2d) mice with a recombinant Leishmania major parasite expressing a fluorescent tracer. To directly visualize the antigen presenting cells that present parasite-derived peptides to CD4+ T cells, we have generated a monoclonal antibody that reacts to an antigenic peptide derived from the parasite LACK antigen bound to I-Ad Major Histocompatibility Complex class II molecule. Immunogold electron microscopic analysis of in vivo infected cells showed that intracellular I-Ad/LACK complexes were present in the membrane of amastigote-containing phagosomes in dendritic cells, eosinophils and macrophages/monocytes. In both dendritic cells and macrophages, these complexes were also present in smaller vesicles that did not contain amastigote. The presence of I-Ad/LACK complexes at the surface of dendritic cells, but neither on the plasma membrane of macrophages nor eosinophils was independently confirmed by flow cytometry and by incubating sorted phagocytes with highly sensitive LACK-specific hybridomas. Altogether, our results suggest that peptides derived from Leishmania proteins are loaded onto Major Histocompatibility Complex class II molecules in the phagosomes of infected phagocytes. Although these complexes are transported to the cell surface in dendritic cells, therefore allowing the stimulation of parasite-specific CD4+ T cells, this does not occur in other phagocytic cells. To our knowledge, this is the first study in which Major Histocompatibility Complex class II molecules bound to peptides derived from a parasite protein have been visualized within and at the surface of

  14. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  15. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  16. Concentrations and patterns of perfluoroalkyl acids in Georgia, USA surface waters near and distant to a major use source

    USGS Publications Warehouse

    Konwick, B.J.; Tomy, G.T.; Ismail, N.; Peterson, J.T.; Fauver, R.J.; Higginbotham, D.; Fisk, A.T.

    2008-01-01

    Perfluoroalkyl acids (PFAAs) are widespread contaminants emanating from, among other sources, the production/degradation of fluorinated chemicals used in surface repellant applications, such as carpet manufacturing. The goal of the present study was to assess the concentrations of PFAAs, including perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), perfluorodecanoic acid (PFDA), perfluoroundecanoic acid (PFUA), and perfluorooctane sulfonamide (PFOSA), in surface waters both near a wastewater land application system (LAS) in Dalton (GA, USA), home to North America's largest carpet manufacturing site, and distant to this location (Altamaha River, GA, USA) to understand the fate of PFAAs in freshwater. Levels of PFAAs were high in the Conasauga River (GA, USA) downstream of the LAS (PFOA, 253-1,150 ng/L; PFOS, 192-318 ng/L; PFNA, 202-369 ng/L; PFDA, 30.1-113 ng/L; PFUA, 58.0-99.2 ng/L; PFOSA, 162-283 ng/L) and in streams and ponds in Dalton (PFOA, 49.9-299 ng/L; PFOS, 15.8-120 ng/L), and were among the highest measured at a nonspill or directrelease location. Perfluoroalkyl acids in the Altamaha River were much lower (PFOA, 3.0-3.1 ng/L; PFOS, 2.6-2.7 ng/L), but were a source of PFAAs to Georgia's estuaries. A preliminary hazard assessment indicated that concentrations of PFOS at two sites in the Conasauga River exceeded the threshold effect predicted for birds consuming aquatic organisms that are exposed continuously to the PFOS levels at these sites. Assuming that toxicity for all PFAAs quantified is equal to that of PFOS, the sum total PFAAs at two sites within the Conasauga River exceeded PFOS thresholds for aquatic and avian species, warranting additional research. ?? 2008 SETAC Printed in the USA.

  17. Role of host cellular proteases in the pathogenesis of influenza and influenza-induced multiple organ failure.

    PubMed

    Kido, Hiroshi; Okumura, Yuushi; Takahashi, Etsuhisa; Pan, Hai-Yan; Wang, Siye; Yao, Dengbing; Yao, Min; Chida, Junji; Yano, Mihiro

    2012-01-01

    Influenza A virus (IAV) is one of the most common infectious pathogens in humans. Since the IVA genome does not have the processing protease for the viral hemagglutinin (HA) envelope glycoprotein precursors, entry of this virus into cells and infectious organ tropism of IAV are primarily determined by host cellular trypsin-type HA processing proteases. Several secretion-type HA processing proteases for seasonal IAV in the airway, and ubiquitously expressed furin and pro-protein convertases for highly pathogenic avian influenza (HPAI) virus, have been reported. Recently, other HA-processing proteases for seasonal IAV and HPAI have been identified in the membrane fraction. These proteases proteolytically activate viral multiplication at the time of viral entry and budding. In addition to the role of host cellular proteases in IAV pathogenicity, IAV infection results in marked upregulation of cellular trypsins and matrix metalloproteinase-9 in various organs and cells, particularly endothelial cells, through induced pro-inflammatory cytokines. These host cellular factors interact with each other as the influenza virus-cytokine-protease cycle, which is the major mechanism that induces vascular hyperpermeability and multiorgan failure in severe influenza. This mini-review discusses the roles of cellular proteases in the pathogenesis of IAV and highlights the molecular mechanisms of upregulation of trypsins as effective targets for the control of IAV infection. This article is part of a Special Issue entitled: Proteolysis 50 years after the discovery of lysosome. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Statistical optimization of medium components for extracellular protease production by an extreme haloarchaeon, Halobacterium sp. SP1(1).

    PubMed

    Akolkar, A; Bharambe, N; Trivedi, S; Desai, A

    2009-01-01

    Optimization of medium components for extracellular protease production by Halobacterium sp. SP1(1) using statistical approach. The significant factors influencing the protease production as screened by Plackett-Burman method were identified as soybean flour and FeCl(3). Response surface methodology such as central composite design was applied for further optimization studies. The concentrations of medium components for higher protease production as optimized using this approach were (g l(-1)): NaCl, 250; KCl, 2; MgSO(4), 10; tri-Na-citrate, 1.5; soybean flour, 10 and FeCl(3), 0.16. This statistical optimization approach led to production of 69.44 +/- 0.811 U ml(-1) of protease. Soybean flour and FeCl(3) were identified as important factors controlling the production of extracellular protease by Halobacterium sp. SP1(1). The statistical approach was found to be very effective in optimizing the medium components in manageable number of experimental runs with overall 3.9-fold increase in extracellular protease production. The present study is the first report on statistical optimization of medium components for production of haloarchaeal protease. The study also explored the possibility of using extracellular protease produced by Halobacterium sp. SP1(1) for various applications like antifouling coatings and fish sauce preparation using cheaper raw material.

  19. Identification of potential transmembrane protease serine 4 inhibitors as anti-cancer agents by integrated computational approach.

    PubMed

    Ilamathi, M; Hemanth, R; Nishanth, S; Sivaramakrishnan, V

    2016-01-21

    Transmembrane protease serine 4 is a well known cell surface protease facilitating the extracellular matrix degradation and epithelial mesenchymal transition in hepatocellular carcinoma. Henceforth targeting transmembrane protease serine 4 is strongly believed to provide therapeutic intervention against hepatocellular carcinoma. Owing to lack of crystal structure for human transmembrane protease serine 4, we predicted its three dimensional structure for the first time in this study. Experimentally proven inhibitor-Tyroserleutide (TSL) against hepatocellular carcinoma via transmembrane protease serine 4 was used as a benchmark to identify structurally similar candidates from PubChem database to create the TSL library. Virtual screening of TSL library against modeled transmembrane protease serine 4 revealed the top four potential inhibitors. Further binding free energy (ΔGbind) analysis of the potential inhibitors revealed the best potential lead compound against transmembrane protease serine 4. Drug likeliness nature of the top four potential hits were additionally analyzed in comparison to TSL to confirm on the best potential lead compound with the highest % of human oral absorption. Consequently, e-pharmacophore mapping of the best potential lead compound yielded a six point feature. It was observed to contain four hydrogen bond donor sites (D), one positively ionizable site (P) and one aromatic ring (R). Such e-pharmacophore insight obtained from structural determinants by integrated computational analysis could serve as a framework for further advancement of drug discovery process of new anti-cancer agents with less toxicity and high specificity targeting transmembrane protease serine 4 and hepatocellular carcinoma.

  20. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  1. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  2. Mobility of major and trace elements in a coupled groundwater-surface water system: Merced River, CA

    NASA Astrophysics Data System (ADS)

    Wildman, R. A.; Domagalski, J. L.; Hering, J. G.

    2004-12-01

    Trace element transport in coupled surface water/groundwater systems is controlled not only by advective flow, but also by redox reactions that affect the partitioning of various elements between mobile and immobile phases. These processes have been examined in the context of a field project conducted by the U.S. Geological Survey (USGS) as part of the National Water-Quality Assessment (NAWQA) program. The Merced River flows out of Yosemite National Park and the Sierra Nevada foothills and into California's Central Valley, where it joins the San Joaquin River. Our field site is approximately twenty river kilometers from the confluence with the San Joaquin River. This deep alluvial plain has minimal topography. Agricultural development characterizes the land surrounding this reach of river; consequently, the hydrology is heavily influenced by irrigation. Riverbed groundwater samples were collected from ten wells aligned in two transects across the river located approximately 100 m apart. The wells were sampled from depths of 0.5 m, 1 m, and 3 m below the sediment-water interface. Groundwater flowpath samples were taken from wells positioned on a path perpendicular to the river and located 100 m, 500 m, and 1000 m from the river. The saturated groundwater system exists from 7 to 40 m below the surface and is confined below by a clay layer. Each well location samples from 3-5 depths in this surface aquifer. Samples were collected in December 2003, March-April, June-July, and October 2004. This served to provide an evenly-spaced sampling frequency over the course of a year, and also to allow observation of trends coinciding with the onset of winter, the spring runoff, and early and late summer irrigation. An initial survey of the elements in the riverbed samples was conducted using Inductively-Coupled Plasma Mass Spectrometry (ICP-MS). Elements for further study were selected based on variability in this survey, either with respect to depth or location, as well as to

  3. Structures of HIV Protease Guide Inhibitor Design to Overcome Drug Resistance

    SciTech Connect

    Weber, Irene T.; Kovalevsky, Andrey Y.; Harrison, Robert W.

    2008-06-03

    The HIV/AIDS infection continues to be a major epidemic worldwide despite the initial promise of antiviral drugs. Current therapy includes a combination of drugs that inhibit two of the virally-encoded enzymes, the reverse transcriptase and the protease. The first generation of HIV protease inhibitors that have been in clinical use for treatment of AIDS since 1995 was developed with the aid of structural analysis of protease-inhibitor complexes. These drugs were successful in improving the life span of HIV-infected people. Subsequently, the rapid emergence of drug resistance has necessitated the design of new inhibitors that target mutant proteases. This second generation of antiviral protease inhibitors has been developed with the aid of data from medicinal chemistry, kinetics, and X-ray crystallographic analysis. Traditional computational methods such as molecular mechanics and dynamics can be supplemented with intelligent data mining approaches. One approach, based on similarities to the protease interactions with substrates, is to incorporate additional interactions with main chain atoms that cannot easily be eliminated by mutations. Our structural and inhibition data for darunavir have helped to understand its antiviral activity and effectiveness on drug resistant HIV and demonstrate the success of this approach.

  4. Protease Inhibitors from Marine Venomous Animals and Their Counterparts in Terrestrial Venomous Animals

    PubMed Central

    Mourão, Caroline B.F.; Schwartz, Elisabeth F.

    2013-01-01

    The Kunitz-type protease inhibitors are the best-characterized family of serine protease inhibitors, probably due to their abundance in several organisms. These inhibitors consist of a chain of ~60 amino acid residues stabilized by three disulfide bridges, and was first observed in the bovine pancreatic trypsin inhibitor (BPTI)-like protease inhibitors, which strongly inhibit trypsin and chymotrypsin. In this review we present the protease inhibitors (PIs) described to date from marine venomous animals, such as from sea anemone extracts and Conus venom, as well as their counterparts in terrestrial venomous animals, such as snakes, scorpions, spiders, Anurans, and Hymenopterans. More emphasis was given to the Kunitz-type inhibitors, once they are found in all these organisms. Their biological sources, specificity against different proteases, and other molecular blanks (being also K+ channel blockers) are presented, followed by their molecular diversity. Whereas sea anemone, snakes and other venomous animals present mainly Kunitz-type inhibitors, PIs from Anurans present the major variety in structure length and number of Cys residues, with at least six distinguishable classes. A representative alignment of PIs from these venomous animals shows that, despite eventual differences in Cys assignment, the key-residues for the protease inhibitory activity in all of them occupy similar positions in primary sequence. The key-residues for the K+ channel blocking activity was also compared. PMID:23771044

  5. Functional proteomics-aided selection of protease inhibitors for herbivore insect control

    PubMed Central

    Rasoolizadeh, Asieh; Munger, Aurélie; Goulet, Marie-Claire; Sainsbury, Frank; Cloutier, Conrad; Michaud, Dominique

    2016-01-01

    Studies have reported the potential of protease inhibitors to engineer insect resistance in transgenic plants but the general usefulness of this approach in crop protection still remains to be established. Insects have evolved strategies to cope with dietary protease inhibitors, such as the use of proteases recalcitrant to inhibition, that often make the selection of effective inhibitors very challenging. Here, we used a functional proteomics approach for the ‘capture’ of Cys protease targets in crude protein extracts as a tool to identify promising cystatins for plant improvement. Two cystatins found to differ in their efficiency to capture Cys proteases of the coleopteran pest Leptinotarsa decemlineata also differed in their usefulness to produce transgenic potato lines resistant to this insect. Plants expressing the most potent cystatin at high level had a strong repressing effect on larval growth and leaf intake, while plants expressing the weakest cystatin showed no effect on both two parameters compared to untransformed parental line used for genetic transformation. Our data underline the relevance of considering the whole range of possible protease targets when selecting an inhibitor for plant pest control. They also confirm the feasibility of developing cystatin-expressing transgenics resistant to a major pest of potato. PMID:27958307

  6. Development and binding characteristics of phosphonate inhibitors of SplA protease from Staphylococcus aureus

    PubMed Central

    Burchacka, Ewa; Zdzalik, Michal; Niemczyk, Justyna-Stec; Pustelny, Katarzyna; Popowicz, Grzegorz; Wladyka, Benedykt; Dubin, Adam; Potempa, Jan; Sienczyk, Marcin; Dubin, Grzegorz; Oleksyszyn, Jozef

    2014-01-01

    Staphylococcus aureus is responsible for a variety of human infections, including life-threatening, systemic conditions. Secreted proteome, including a range of proteases, constitutes the major virulence factor of the bacterium. However, the functions of individual enzymes, in particular SplA protease, remain poorly characterized. Here, we report development of specific inhibitors of SplA protease. The design, synthesis, and activity of a series of α-aminoalkylphosphonate diaryl esters and their peptidyl derivatives are described. Potent inhibitors of SplA are reported, which may facilitate future investigation of physiological function of the protease. The binding modes of the high-affinity compounds Cbz-PheP-(OC6H4−4-SO2CH3)2 and Suc-Val-Pro-PheP-(OC6H5)2 are revealed by high-resolution crystal structures of complexes with the protease. Surprisingly, the binding mode of both compounds deviates from previously characterized canonical interaction of α-aminoalkylphosphonate peptidyl derivatives and family S1 serine proteases. PMID:24375505

  7. Major factors influencing the elemental composition of surface estuarine sediments: the case of 15 estuaries in Portugal.

    PubMed

    Mil-Homens, M; Vale, C; Raimundo, J; Pereira, P; Brito, P; Caetano, M

    2014-07-15

    Upper sediments (0-5 cm) were sampled in 94 sites of water bodies of the fifteen Portuguese estuaries characterized by distinct settings of climate, topography and lithology, and marked by diverse anthropogenic pressures. Confined areas recognized as highly anthropogenic impacted, as well as areas dominated by erosion or frequently dredged were not sampled. Grain size, organic carbon (Corg), Al and trace elements (As, Cd, Co, Cr, Cu, Hg, Ni, Pb and Zn) were determined. Normalisation of trace element concentrations to Al and Corg, correlations between elements and Principal Component Analysis (PCA) allowed identifying elemental associations and the relevance of grain-size, lithology and anthropogenic inputs on sediment chemical composition. Whereas grain-size is the dominant effect for the majority of the studied estuaries, the southern estuaries Mira, Arade and Guadiana are dominated by specific lithologies of their river basins, and anthropogenic effects are identified in Ave, Leça, Tagus and Sado. This study emphasizes how baseline values of trace elements in sediments may vary within and among estuarine systems. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  9. Local Protease Signaling Contributes to Neural Tube Closure in the Mouse Embryo

    PubMed Central

    Camerer, Eric; Barker, Adrian; Duong, Daniel N.; Ganesan, Rajkumar; Kataoka, Hiroshi; Cornelissen, Ivo; Darragh, Molly R.; Hussain, Arif; Zheng, Yao-Wu; Srinivasan, Yoga; Brown, Christopher; Xu, Shan-Mei; Regard, Jean B.; Lin, Chen-Yong; Craik, Charles S.; Kirchhofer, Daniel; Coughlin, Shaun R.

    2009-01-01

    Summary We report an unexpected role for protease signaling in neural tube closure and formation of the central nervous system. Mouse embryos lacking protease-activated receptor 1 and 2 showed defective hindbrain and posterior neuropore closure and developed exencephaly and spina bifida, important human congenital anomalies. Par1 and Par2 were expressed in surface ectoderm, Par2 selectively along the line of closure. Ablation of Gi/z and Rac1 function in these Par2-expressing cells disrupted neural tube closure, further implicating G protein-coupled receptors and identifying a likely effector pathway. Cluster analysis of protease and Par2 expression patterns revealed a group of membrane-tethered proteases often co-expressed with Par2. Among these, matriptase activated Par2 with picomolar potency, and hepsin and prostasin activated matriptase. Together, our results suggest a role for protease-activated receptor signaling in neural tube closure and identify a local protease network that may trigger Par2 signaling and monitor and regulate epithelial integrity in this context. PMID:20152175

  10. Protease specificity determination by using cellular libraries of peptide substrates (CLiPS).

    PubMed

    Boulware, Kevin T; Daugherty, Patrick S

    2006-05-16

    We report a general combinatorial approach to identify optimal substrates of a given protease by using quantitative kinetic screening of cellular libraries of peptide substrates (CLiPS). A whole-cell protease activity assay was developed by displaying fluorescent reporter substrates on the surface of Escherichia coli as N-terminal fusions. This approach enabled generation of substrate libraries of arbitrary amino acid composition and length that are self-renewing. Substrate hydrolysis by a target protease was measured quantitatively via changes in whole-cell fluorescence by using FACS. FACS enabled efficient screening to identify optimal substrates for a given protease and characterize their cleavage kinetics. The utility of CLiPS was demonstrated by determining the substrate specificity of two unrelated proteases, caspase-3 and enteropeptidase (or enterokinase). CLiPS unambiguously identified the caspase-3 consensus cleavage sequence DXVDG. Enteropeptidase was unexpectedly promiscuous, but exhibited a preference for substrates with the motif (D/E)RM, which were cleaved substantially faster than the canonical DDDDK recognition sequence, widely used for protein purification. CLiPS provides a straightforward and versatile approach to determine protease specificity and discover optimal substrates on the basis of cleavage kinetics.

  11. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  12. Ginkgolic acid inhibits HIV protease activity and HIV infection in vitro

    PubMed Central

    Lü, Jian-Ming; Yan, Shaoyu; Jamaluddin, Saha; Weakley, Sarah M.; Liang, Zhengdong; Siwak, Edward B.; Yao, Qizhi; Chen, Changyi

    2012-01-01

    Summary Background Several HIV protease mutations, which are resistant to clinical HIV protease inhibitors (PIs), have been identified. There is a great need for second-generation PIs with different chemical structures and/or with an alternative mode of inhibition. Ginkgolic acid is a natural herbal substance and a major component of the lipid fraction in the nutshells of the Ginkgo biloba tree. The objective of this study was to determine whether ginkgolic acid could inhibit HIV protease activity in a cell free system and HIV infection in human cells. Material/Methods Purified ginkgolic acid and recombinant HIV-1 HXB2 KIIA protease were used for the HIV protease activity assay. Human peripheral blood mononuclear cells (PBMCs) were used for HIV infection (HIV-1SF162 virus), determined by a p24gag ELISA. Cytotoxicity was also determined. Results Ginkgolic acid (31.2 μg/ml) inhibited HIV protease activity by 60%, compared with the negative control, and the effect was concentration-dependent. In addition, ginkgolic acid treatment (50 and 100 μg/ml) effectively inhibited the HIV infection at day 7 in a concentration-dependent manner. Ginkgolic acid at a concentration of up to 150 μg/ml demonstrated very limited cytotoxicity. Conclusions Ginkgolic acid effectively inhibits HIV protease activity in a cell free system and HIV infection in PBMCs without significant cytotoxicity. Ginkgolic acid may inhibit HIV protease through different mechanisms than current FDA-approved HIV PI drugs. These properties of ginkgolic acid make it a promising therapy for HIV infection, especially as the clinical problem of viral resistance to HIV PIs continues to grow. PMID:22847190

  13. Alternate phase variation in expression of two major surface membrane proteins (MBA and UU376) of Ureaplasma parvum serovar 3.

    PubMed

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Rosengarten, Renate; Spergser, Joachim

    2009-03-01

    Ureaplasma urealyticum and Ureaplasma parvum are commensals and pathogens of the human urogenital tract and of newborn infants. There are four distinct U. parvum serovars and 10 distinct U. urealyticum serovars. Both species possess a distinct immunodominant variable surface protein, the multiple banded antigen (MBA), which shows size variability among isolates as a result of changes in the number of C-terminal repeating units. Adjacent to the MBA gene (UU375) lies UU376, which was annotated as 'Ureaplasma-specific conserved hypothetical gene'. In four different strains of U. parvum serovar 3, we demonstrated expression of UU376 by Western blot analysis and phase variation between UU376, here designated Upvmp376 (Ureaplasma phase-variable membrane protein 376), and MBA after application of selective pressure with hyperimmune antisera directed against either protein. By Southern blot analysis, we found that the switch between MBA and Upvmp376 expression is associated with a DNA inversion event in which the nonrepetitive region of the MBA gene and its putative promoter region are opposed to either the repetitive region of MBA or UU376. We propose that in U. parvum serovar 3, and presumably in all U. parvum and U. urealyticum, an inversion event at specific sites effects an alternate ON/OFF switching of the genes UU375 and UU376.

  14. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  15. The membrane-anchored serine protease, TMPRSS2, activates PAR-2 in prostate cancer cells

    PubMed Central

    2004-01-01

    TMPRSS2 is a type II transmembrane-bound serine protease that has gained interest owing to its highly localized expression in the prostate and its overexpression in neoplastic prostate epithelium. Once activated, the serine protease domain of TMPRSS2 is released from the cell surface into the extracellular space. PAR (protease-activated receptor)-2 belongs to a family of G-protein-coupled receptors (PAR-1–4) that are activated by specific serine proteases, which are expressed in many normal and malignant cell types. Previous in vitro studies on prostate cancer cells suggest a role for PAR-2 in prostate cancer metastasis. A polyclonal anti-human TMPRSS2 antibody was generated against the TMPRSS2 serine protease domain. The antibody showed specific reactivity with recombinant expressed TMPRSS2, and so was used to extract and purify the cleaved active TMPRSS2 protease from prostate cancer cells. Reverse transcriptase PCR and Western blot analysis were used to show the expression of both TMPRSS2 and PAR-2 in the androgen-dependent LNCaP prostate cancer cell line. Treatment of LNCaP cells with the cellular immunopurified TMPRSS2 protease induced a transient increase in intracellular calcium, which is indicative of G-protein-coupled-receptor activation. This calcium mobilization was inhibited by cellular pre-treatment with a specific PAR-2 antagonist, but not with a PAR-1 antagonist; inhibition of the protease activity also failed to mobilize calcium, suggesting that TMPRSS2 is capable of cleaving and thereby activating the PAR-2 receptor. The calcium mobilization was also inhibited by cellular pre-treatment with suramin or 2-APB (2-aminoethoxydiphenyl borate), indicating that a G-protein pathway is involved and that subsequent calcium release is mainly from intracellular stores. The present study describes how TMPRSS2 may contribute to prostate tumour metastasis via the activation of PAR-2. PMID:15537383

  16. The membrane-anchored serine protease, TMPRSS2, activates PAR-2 in prostate cancer cells.

    PubMed

    Wilson, Susan; Greer, Brett; Hooper, John; Zijlstra, Andries; Walker, Brian; Quigley, James; Hawthorne, Susan

    2005-06-15

    TMPRSS2 is a type II transmembrane-bound serine protease that has gained interest owing to its highly localized expression in the prostate and its overexpression in neoplastic prostate epithelium. Once activated, the serine protease domain of TMPRSS2 is released from the cell surface into the extracellular space. PAR (protease-activated receptor)-2 belongs to a family of G-protein-coupled receptors (PAR-1-4) that are activated by specific serine proteases, which are expressed in many normal and malignant cell types. Previous in vitro studies on prostate cancer cells suggest a role for PAR-2 in prostate cancer metastasis. A polyclonal anti-human TMPRSS2 antibody was generated against the TMPRSS2 serine protease domain. The antibody showed specific reactivity with recombinant expressed TMPRSS2, and so was used to extract and purify the cleaved active TMPRSS2 protease from prostate cancer cells. Reverse transcriptase PCR and Western blot analysis were used to show the expression of both TMPRSS2 and PAR-2 in the androgen-dependent LNCaP prostate cancer cell line. Treatment of LNCaP cells with the cellular immunopurified TMPRSS2 protease induced a transient increase in intracellular calcium, which is indicative of G-protein-coupled-receptor activation. This calcium mobilization was inhibited by cellular pre-treatment with a specific PAR-2 antagonist, but not with a PAR-1 antagonist; inhibition of the protease activity also failed to mobilize calcium, suggesting that TMPRSS2 is capable of cleaving and thereby activating the PAR-2 receptor. The calcium mobilization was also inhibited by cellular pre-treatment with suramin or 2-APB (2-aminoethoxydiphenyl borate), indicating that a G-protein pathway is involved and that subsequent calcium release is mainly from intracellular stores. The present study describes how TMPRSS2 may contribute to prostate tumour metastasis via the activation of PAR-2.

  17. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  18. Genome-wide analysis of regulatory proteases sequences identified through bioinformatics data mining in Taenia solium.

    PubMed

    Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng

    2014-06-04

    Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases

  19. Variability and resistance mutations in the hepatitis C virus NS3 protease in patients not treated with protease inhibitors.

    PubMed

    Zeminian, Luciana Bonome; Padovani, Juliana Lara; Corvino, Sílvia Maria; Silva, Giovanni Faria; Pardini, Maria Inês de Moura Campos; Grotto, Rejane Maria Tommasini

    2013-02-01

    The goal of treatment of chronic hepatitis C is to achieve a sustained virological response, which is defined as exhibiting undetectable hepatitis C virus (HCV) RNA levels in serum following therapy for at least six months. However, the current treatment is only effective in 50% of patients infected with HCV genotype 1, the most prevalent genotype in Brazil. Inhibitors of the serine protease non-structural protein 3 (NS3) have therefore been developed to improve the responses of HCV-infected patients. However, the emergence of drug-resistant variants has been the major obstacle to therapeutic success. The goal of this study was to evaluate the presence of resistance mutations and genetic polymorphisms in the NS3 genomic region of HCV from 37 patients infected with HCV genotype 1 had not been treated with protease inhibitors. Plasma viral RNA was used to amplify and sequence the HCV NS3 gene. The results indicate that the catalytic triad is conserved. A large number of substitutions were observed in codons 153, 40 and 91; the resistant variants T54A, T54S, V55A, R155K and A156T were also detected. This study shows that resistance mutations and genetic polymorphisms are present in the NS3 region of HCV in patients who have not been treated with protease inhibitors, data that are important in determining the efficiency of this new class of drugs in Brazil.

  20. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  1. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine.

    PubMed

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R; Ketterman, Albert J

    2015-11-24

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target.

  2. Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine

    PubMed Central

    Saisawang, Chonticha; Saitornuang, Sawanan; Sillapee, Pornpan; Ubol, Sukathida; Smith, Duncan R.; Ketterman, Albert J.

    2015-01-01

    Chikungunya virus is the pathogenic alphavirus that causes chikungunya fever in humans. In the last decade millions of cases have been reported around the world from Africa to Asia to the Americas. The alphavirus nsP2 protein is multifunctional and is considered to be pivotal to viral replication, as the nsP2 protease activity is critical for proteolytic processing of the viral polyprotein during replication. Classically the alphavirus nsP2 protease is thought to be papain-like with the enzyme reaction proceeding through a cysteine/histidine catalytic dyad. We performed structure-function studies on the chikungunya nsP2 protease and show that the enzyme is not papain-like. Characterization of the catalytic dyad cysteine residue enabled us to identify a nearby serine that is catalytically interchangeable with the dyad cysteine residue. The enzyme retains activity upon alanine replacement of either residue but a replacement of both cysteine and serine residues results in no detectable activity. Protein dynamics appears to allow the use of either the cysteine or the serine residue in catalysis. This switchable dyad residue has not been previously reported for alphavirus nsP2 proteases and would have a major impact on the nsP2 protease as an anti-viral target. PMID:26597768

  3. Equine herpesvirus type 4 UL56 and UL49.5 proteins downregulate cell surface major histocompatibility complex class I expression independently of each other.

    PubMed

    Said, Abdelrahman; Azab, Walid; Damiani, Armando; Osterrieder, Nikolaus

    2012-08-01

    Major histocompatibility complex class I (MHC-I) molecules are critically important in the host defense against various pathogens through presentation of viral peptides to cytotoxic T lymphocytes (CTLs), a process resulting in the destruction of virus-infected cells. Herpesviruses interfere with CTL-mediated elimination of infected cells by various mechanisms, including inhibition of peptide transport and loading, perturbation of MHC-I trafficking, and rerouting and proteolysis of cell surface MHC-I. In this study, we show that equine herpesvirus type 4 (EHV-4) modulates MHC-I cell surface expression through two different mechanisms. First, EHV-4 can lead to a significant downregulation of MHC-I expression at the cell surface through the product of ORF1, a protein expressed with early kinetics from a gene that is homologous to herpes simplex virus 1 UL56. The EHV-4 UL56 protein reduces cell surface MHC-I as early as 4 h after infection. Second, EHV-4 can interfere with MHC-I antigen presentation, starting at 6 h after infection, by inhibition of the transporter associated with antigen processing (TAP) through its UL49.5 protein. Although pUL49.5 has no immediate effect on overall surface MHC-I levels in infected cells, it blocks the supply of antigenic peptides to the endoplasmic reticulum (ER) and transport of peptide-loaded MHC-I to the cell surface. Taken together, our results show that EHV-4 encodes at least two viral immune evasion proteins: pUL56 reduces MHC-I molecules on the cell surface at early times after infection, and pUL49.5 interferes with MHC-I antigen presentation by blocking peptide transport in the ER.

  4. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

  5. The Taenia saginata homologue of the major surface antigen of Echinococcus spp. is immunogenic and 97% identical to its Taenia solium homologue.

    PubMed

    González, Luis Miguel; Ferrer, Elizabeth; Spickett, Andrea; Michael, Lynne M; Vatta, Adriano F; Gárate, Teresa; Harrison, Leslie J S; Parkhouse, R Michael E

    2007-11-01

    The TEG-Tsag gene of Taenia saginata is homologous to the genes expressing the two major surface antigens of Echinococcus spp. (EM10 and EG10). Surface antigens of parasites are logical candidates for vaccines, and in this paper we demonstrate that cattle vaccinated with the recombinant TEG-Tsag protein, either used singly or in conjunction with the recombinant HP6-Tsag protein, the major 18 kDa surface/secreted antigen of T. saginata oncospheres, produce excellent antibody responses to both these recombinant proteins. Thus TEG-Tsag may have utility as a vaccine and also as a diagnostic tool for bovine cysticercosis. In addition, as we now demonstrate a 97% homology between TEG-Tsag and its Taenia solium homologue, TEG-Tsol, this latter molecule may have similar potential in the control of human and porcine cysticercosis. The TEG molecule is characterized by an N-terminal FERM domain and a C-terminal ERM domain which are found in a number of cytoskeletal-associated proteins located at the interface between the plasma membrane and the cytoskeleton and in proteins that interact with lipid membranes. The FERM domain is also postulated to bind to adhesion proteins, in a PIP2-regulated fashion, providing a link between cytoskeletal signals and membrane dynamics. Thus TEG protein may play a role in tegument function and interaction with the host.

  6. Functional analysis of rhomboid proteases during Toxoplasma invasion.

    PubMed

    Shen, Bang; Buguliskis, Jeffrey S; Lee, Tobie D; Sibley, L David

    2014-10-21

    Host cell invasion by Toxoplasma gondii and other apicomplexan parasites requires transmembrane adhesins that mediate binding to receptors on the substrate and host cell to facilitate motility and invasion. Rhomboid proteases (ROMs) are thought to cleave adhesins within their transmembrane segments, thus allowing the parasite to disengage from receptors and completely enter the host cell. To examine the specific roles of individual ROMs during invasion, we generated single, double, and triple knockouts for the three ROMs expressed in T. gondii tachyzoites. Analysis of these mutants demonstrated that ROM4 is the primary protease involved in adhesin processing and host cell invasion, whereas ROM1 or ROM5 plays negligible roles in these processes. Deletion of ROM4 blocked the shedding of adhesins such as MIC2 (microneme protein 2), causing them to accumulate on the surface of extracellular parasites. Increased surface adhesins led to nonproductive attachment, altered gliding motility, impaired moving junction formation, and reduced invasion efficiency. Despite the importance of ROM4 for efficient invasion, mutants lacking all three ROMs were viable and MIC2 was still efficiently removed from the surface of invaded mutant parasites, implying the existence of ROM-independent mechanisms for adhesin removal during invasion. Collectively, these results suggest that although ROM processing of adhesins is not absolutely essential, it is important for efficient host cell invasion by T. gondii. Importance: Apicomplexan parasites such as Toxoplasma gondii express surface proteins that bind host cell receptors to aid invasion. Many of these adhesins are subject to cleavage by rhomboid proteases (ROMs) within their transmembrane segments during invasion. Previous studies have demonstrated the importance of adhesin cleavage for parasite invasion and proposed that the ROMs responsible for processing would be essential for parasite survival. In T. gondii, ROM5 was thought to be the

  7. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  8. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 1 May 2002) The Science This image is from the region of Syrtis Major, which is dominated by a low-relief shield volcano. This area is believed to be an area of vigorous aeolian activity with strong winds in the east-west direction. The effects of these winds are observed as relatively bright streaks across the image, extending from topographic features such as craters. The brighter surface material probably indicates a smaller relative particle size in these areas, as finer particles have a higher albedo. The bright streaks seen off of craters are believed to have formed during dust storms. A raised crater rim can cause a reduction in the wind velocity directly behind it, which results in finer particles being preferentially deposited in this location. In the top half of the image, there is a large bright streak that crosses the entire image. There is no obvious topographic obstacle, therefore it is unclear whether it was formed in the same manner as described above. This image is located northwest of Nili Patera, a large caldera in Syrtis Major. Different flows from the caldera eruptions can be recognized as raised ridges, representing the edge of a flow lobe. The Story In the 17th century, Holland was in its Golden Age, a time of cultural greatness and immense political and economic influence in the world. In that time, lived a inquisitive person named Christian Huygens. As a boy, he loved to draw and to figure out problems in mathematics. As a man, he used these talents to make the first detailed drawings of the Martian surface - - only 50 years or so after Galileo first turned his telescope on Mars. Mars suddenly became something other than a small red dot in the sky. One of the drawings Huygens made was of a dark marking on the red planet's surface named Syrtis Major. Almost 350 years later, here we are with an orbiter that can show us this place in detail. Exploration lives! It's great we can study this area up close. In earlier periods of history

  9. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 1 May 2002) The Science This image is from the region of Syrtis Major, which is dominated by a low-relief shield volcano. This area is believed to be an area of vigorous aeolian activity with strong winds in the east-west direction. The effects of these winds are observed as relatively bright streaks across the image, extending from topographic features such as craters. The brighter surface material probably indicates a smaller relative particle size in these areas, as finer particles have a higher albedo. The bright streaks seen off of craters are believed to have formed during dust storms. A raised crater rim can cause a reduction in the wind velocity directly behind it, which results in finer particles being preferentially deposited in this location. In the top half of the image, there is a large bright streak that crosses the entire image. There is no obvious topographic obstacle, therefore it is unclear whether it was formed in the same manner as described above. This image is located northwest of Nili Patera, a large caldera in Syrtis Major. Different flows from the caldera eruptions can be recognized as raised ridges, representing the edge of a flow lobe. The Story In the 17th century, Holland was in its Golden Age, a time of cultural greatness and immense political and economic influence in the world. In that time, lived a inquisitive person named Christian Huygens. As a boy, he loved to draw and to figure out problems in mathematics. As a man, he used these talents to make the first detailed drawings of the Martian surface - - only 50 years or so after Galileo first turned his telescope on Mars. Mars suddenly became something other than a small red dot in the sky. One of the drawings Huygens made was of a dark marking on the red planet's surface named Syrtis Major. Almost 350 years later, here we are with an orbiter that can show us this place in detail. Exploration lives! It's great we can study this area up close. In earlier periods of history

  10. Aspartic acid protease from Botrytis cinerea removes haze-forming proteins during white winemaking.

    PubMed

    Van Sluyter, Steven C; Warnock, Nicholas I; Schmidt, Simon; Anderson, Peter; van Kan, Jan A L; Bacic, Antony; Waters, Elizabeth J

    2013-10-09

    White wines suffer from heat-induced protein hazes during transport and storage unless the proteins are removed prior to bottling. Bentonite fining is by far the most commonly used method, but it is inefficient and creates several other process challenges. An alternative to bentonite is the enzymatic removal of haze-forming grape pathogenesis-related proteins using added proteases. The major problem with this approach is that grape pathogenesis-related proteins are highly protease resistant unless they are heat denatured in combination with enzymatic treatment. This paper demonstrates that the protease BcAP8, from the grape fungal pathogen Botrytis cinerea , is capable of degrading chitinase, a major class of haze-forming proteins, without heat denaturation. Because BcAP8 effectively removes haze-forming proteins under normal winemaking conditions, it could potentially benefit winemakers by reducing bentonite requirements.

  11. Presence and partial characterization of internal acid protease of Aspergillus oryzae.

    PubMed Central

    Tsujita, Y; Endo, A

    1978-01-01

    The presence and partial characterization of the internal acid protease (EC 2.4.23.6) of Aspergillus oryzae has been investigated. Although the majority of the acid protease is external and present in the culture filtrate, a significant amount of the active enzyme is firmly bound to the cells; it is not released by repeated extraction of cells with 0.9% sodium chloride but is liberated into the soluble fraction during disruption of cells. The internal acid protease, as well as the external one, was separated into two major molecular forms (F1 and F2) with molecular weights of 60,000 and 42,000, respectively, by chromatography on Sephadex G-100 and on CM-Sephadex C-50. The partially purified internal enzymes had the same catalytic and immunological properties, as did the external enzyme. Images PMID:29561

  12. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  13. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 6 June 2002) The Science This image, located near the equator and 288W (72E), is near the southern edge of a low, broad volcanic feature called Syrtis Major. A close look at this image reveals a wrinkly texture that indicates a very rough surface that is associated with the lava flows that cover this region. On a larger scale, there are numerous bright streaks that trail topographic features such as craters. These bright streaks are in the wind shadows of the craters where dust that settles onto the surface is not as easily scoured away. It is important to note that these streaks are only bright in a relative sense to the surrounding image. Syrtis Major is one of the darkest regions on Mars and it is as dark as fresh basalt flows or dunes are on Earth. The Story Cool! It almost looks as if nature has 'painted' comets on the surface of Mars, using craters as comet cores and dust as streaky tails. Of course, that's just an illusion. As in many areas of Mars, the wind is behind the creation of such fantastic landforms. The natural phenomenon seen here gives this particular surface of Mars a very dynamic, fast-moving, almost luminous 'cosmic personality.' The bright, powdery-looking streaks of dust are in the 'wind shadows' of craters, where dust that settles onto the surface is not as easily scoured away. That's because the wind moves across the land in a particular direction, and a raised surface like the rim of a crater 'protects' dust from being completely blown away on the other side. The raised landforms basically act as a buffer. From the streaks seen above, you can tell the wind was blowing in a northeast to southwest direction. Why are the streaks so bright? Because they contrast with the really dark underlying terrain in this volcanic area of Mars. Syrtis Major is one of the darkest regions on Mars because it is made of basalt. Basalt is typically dark gray or black, and forms when a certain type of molten lava cools. The meaning of the word basalt

  14. How proteases regulate bone morphogenesis.

    PubMed

    Ortega, Nathalie; Behonick, Danielle; Stickens, Dominique; Werb, Zena

    2003-05-01

    Matrix metalloproteinases (MMPs) degrade most components of the extracellular matrix (ECM), as well as many non-ECM molecules. MMPs participate in (1). degradation of ECM to allow cell migration; (2). alteration of the ECM microenvironment resulting in alteration in cellular behavior; (3). modulation of biologically active molecules by direct cleavage or release from ECM stores; (4). regulation of the activity of other proteases; and (5). cell attachment, proliferation, differentiation, and apoptosis. We have sought to understand the role of MMPs during development and tissue repair in transgenic mice. Endochondral bone formation presents a particularly interesting developmental challenge. During this process, an avascular tissue (cartilage) is converted into one of the most highly vascularized tissues (bone) in the vertebrate body. Ossification begins with invasion of the calcified hypertrophic cartilage by capillaries. Apoptosis of the terminal hypertrophic chondrocytes, degradation of the cartilage matrix, and deposition of bone matrix by osteoblasts accompanies neovascularization of the growth plate. Remodeling of ECM results in a cavity filled with vascular channels containing hematopoietic cells. Our results reveal that MMP9, MMP13, and vascular endothelial growth factor are key regulators for the remodeling of the skeletal tissues. They coordinate not only matrix degradation, but also the recruitment and differentiation of endothelial cells, osteoclasts, chondroclasts, and osteoprogenitors.

  15. The Effect of Clade-Specific Sequence Polymorphisms on HIV-1 Protease Activity and Inhibitor Resistance Pathways

    SciTech Connect

    Bandaranayake, Rajintha M.; Kolli, Madhavi; King, Nancy M.; Nalivaika, Ellen A.; Heroux, Annie; Kakizawa, Junko; Sugiura, Wataru; Schiffer, Celia A.

    2010-09-08

    The majority of HIV-1 infections around the world result from non-B clade HIV-1 strains. The CRF01{_}AE (AE) strain is seen principally in Southeast Asia. AE protease differs by {approx}10% in amino acid sequence from clade B protease and carries several naturally occurring polymorphisms that are associated with drug resistance in clade B. AE protease has been observed to develop resistance through a nonactive-site N88S mutation in response to nelfinavir (NFV) therapy, whereas clade B protease develops both the active-site mutation D30N and the nonactive-site mutation N88D. Structural and biochemical studies were carried out with wild-type and NFV-resistant clade B and AE protease variants. The relationship between clade-specific sequence variations and pathways to inhibitor resistance was also assessed. AE protease has a lower catalytic turnover rate than clade B protease, and it also has weaker affinity for both NFV and darunavir (DRV). This weaker affinity may lead to the nonactive-site N88S variant in AE, which exhibits significantly decreased affinity for both NFV and DRV. The D30N/N88D mutations in clade B resulted in a significant loss of affinity for NFV and, to a lesser extent, for DRV. A comparison of crystal structures of AE protease shows significant structural rearrangement in the flap hinge region compared with those of clade B protease and suggests insights into the alternative pathways to NFV resistance. In combination, our studies show that sequence polymorphisms within clades can alter protease activity and inhibitor binding and are capable of altering the pathway to inhibitor resistance.

  16. The effect of limited proteolysis by different proteases on the formation of whey protein fibrils.

    PubMed

    Gao, Yu-Zhe; Xu, Hong-Hua; Ju, Ting-Ting; Zhao, Xin-Huai

    2013-01-01

    Four proteases: trypsin, protease A, pepsin, and protease M were selected to modify whey protein concentrate (WPC) at a low degree of hydrolysis (0.1, 0.2, and 0.3%) before adjusting to pH 2.0 and heating at 90°C to gain insight into the influence of proteolysis on fibril formation. The kinetics of fibril formation were performed on native and modified WPC using the fluorescent dye thioflavin T in conjunction with transmission electron microscopy and far-UV circular dichroism spectroscopy for the morphological and secondary structural analyses. The change in surface hydrophobicity and content of free sulfhydryl groups were also observed during the formation of fibrils for the native and modified WPC. The content of aggregation and thioflavin T kinetic data indicated that the ability of fibril formation was apparently different for WPC modified by the 4 proteases. Whey protein concentrate modified by trypsin aggregated more during heating and the fibril formation rate was faster than that of the native WPC. Whey protein concentrate modified by the other proteases showed slower aggregation with worse amyloid fibril morphology. Compared with the native WPC, the structure of WPC changed differently after being modified by proteases. The state of α-helix structure for modified WPC played the most important role in the formation of fibrils. Under the mild conditions used in this work, the α-helix structure of WPC modified by trypsin caused little destruction and resulted in fibrils with good morphology; the content of α-helices for WPC modified by other proteases decreased to 36.19 to 50.94%; thus, fibril formation was inhibited. In addition, it was beneficial for the modified WPC to form fibrils such that the surface hydrophobicity increased and the content of free sulfhydryl groups slightly decreased during heating.

  17. Biochemical and biophysical characterization of the major outer surface protein, OSP-A from North American and European isolates of Borrelia burgdorferi

    SciTech Connect

    McGrath, B.C.; Dunn, J.J.; France, L.L.; Jaing, W.; Polin, D.; Gorgone, G.; Luft, B.; Dykhuizen, D.

    1995-12-31

    Lyme borreliosis, caused by the spirochete Borrelia burgdorferi, is the most common vector-borne disease in North America and Western Europe. As the major delayed immune response in humans, a better understanding of the major outer surface lipoproteins OspA and OspB are of much interest. These proteins have been shown to exhibit three distinct phylogenetic genotypes based on their DNA sequences. This paper describes the cloning of genomic DNA for each variant and amplification of PCR. DNA sequence data was used to derive computer driven phylogenetic analysis and deduced amino acid sequences. Overproduction of variant OspAs was carried out in E. coli using a T7-based expression system. Circular dichroism and fluorescence studies was carried out on the recombinant B31 PspA yielding evidence supporting a B31 protein containing 11% alpha-helix, 34% antiparallel beta-sheet, 12% parallel beta sheet.

  18. Targeting dynamic pockets of HIV-1 protease by structure-based computational screening for allosteric inhibitors.

    PubMed

    Kunze, Jens; Todoroff, Nickolay; Schneider, Petra; Rodrigues, Tiago; Geppert, Tim; Reisen, Felix; Schreuder, Herman; Saas, Joachim; Hessler, Gerhard; Baringhaus, Karl-Heinz; Schneider, Gisbert

    2014-03-24

    We present the discovery of low molecular weight inhibitors of human immunodeficiency virus 1 (HIV-1) protease subtype B that were identified by structure-based virtual screening as ligands of an allosteric surface cavity. For pocket identification and prioritization, we performed a molecular dynamics simulation and observed several flexible, partially transient surface cavities. For one of these presumable ligand-binding pockets that are located in the so-called "hinge region" of the identical protease chains, we computed a receptor-derived pharmacophore model, with which we retrieved fragment-like inhibitors from a screening compound pool. The most potent hit inhibited protease activity in vitro in a noncompetitive mode of action. Although attempts failed to crystallize this ligand bound to the enzyme, the study provides proof-of-concept for identifying innovative tool compounds for chemical biology by addressing flexible protein models with receptor pocket-derived pharmacophore screening.

  19. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  20. On the methane paradox: Transport from shallow water zones rather than in situ methanogenesis is the major source of CH4 in the open surface water of lakes

    NASA Astrophysics Data System (ADS)

    Encinas Fernández, Jorge; Peeters, Frank; Hofmann, Hilmar

    2016-10-01

    Estimates of global methane (CH4) emissions from lakes and the contributions of different pathways are currently under debate. In situ methanogenesis linked to algae growth was recently suggested to be the major source of CH4 fluxes from aquatic systems. However, based on our very large data set on CH4 distributions within lakes, we demonstrate here that methane-enriched water from shallow water zones is the most likely source of the basin-wide mean CH4 concentrations in the surface water of lakes. Consistently, the mean surface CH4 concentrations are significantly correlated with the ratio between the surface area of the shallow water zone and the entire lake, fA,s/t, but not with the total surface area. The categorization of CH4 fluxes according to fA,s/t may therefore improve global estimates of CH4 emissions from lakes. Furthermore, CH4 concentrations increase substantially with water temperature, indicating that seasonally resolved data are required to accurately estimate annual CH4 emissions.

  1. Three-Dimensional Molecular Modeling of a Diverse Range of SC Clan Serine Proteases

    PubMed Central

    Laskar, Aparna; Chatterjee, Aniruddha; Chatterjee, Somnath; Rodger, Euan J.

    2012-01-01

    Serine proteases are involved in a variety of biological processes and are classified into clans sharing structural homology. Although various three-dimensional structures of SC clan proteases have been experimentally determined, they are mostly bacterial and animal proteases, with some from archaea, plants, and fungi, and as yet no structures have been determined for protozoa. To bridge this gap, we have used molecular modeling techniques to investigate the structural properties of different SC clan serine proteases from a diverse range of taxa. Either SWISS-MODEL was used for homology-based structure prediction or the LOOPP server was used for threading-based structure prediction. The predicted models were refined using Insight II and SCRWL and validated against experimental structures. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. The structural geometry of the catalytic core shows clear deviations between taxa, but the relative positions of the catalytic triad residues were conserved. Evolutionary divergence was also exhibited by large variation in secondary structure features outside the core, differences in overall amino acid distribution, and unique surface electrostatic potential patterns between species. Encompassing a wide range of taxa, our structural analysis provides an evolutionary perspective on SC clan serine proteases. PMID:23213528

  2. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    USDA-ARS?s Scientific Manuscript database

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  3. Evaluating a space-based indicator of surface ozone sensitivity to emissions of NOx vs. NMVOC over major northern mid-latitude source regions

    NASA Astrophysics Data System (ADS)

    Jin, X.; Fiore, A. M.; Murray, L. T.; Valin, L.

    2016-12-01

    Determining the most effective strategy for mitigating local surface ozone pollution requires knowledge of the relative ambient concentration of NOx to VOCs in the air. Satellite observations of the tropospheric column ratio of HCHO (a marker of VOCs) to NO2 (a marker of NOx) have been used as an indicator to identify areas which would benefit from reducing NOx emissions (NOx-sensitive, HCHO:NO2 > 2), and areas where reducing VOC emission leads to lower ozone (VOC-sensitive or NOx-saturated, HCHO:NO2 < 1). We evaluate the quantitative utility of the indicator ratio HCHO:NO2 observed from the Ozone Monitoring Instrument (OMI) to inform surface ozone formation regimes over three major northern mid-latitude source regions: North America, East Asia and Europe. Satellite-derived ozone sensitivity differs from that diagnosed with two emission perturbation simulations in GEOS-Chem that reduce NOx and VOC emissions by 20%. We examine three possible causes of the satellite-model discrepancy: 1) correlations between ozone sensitivity and indicator may shift under different photochemical conditions; 2) column-based ratios may not represent the near-surface air; 3) uncertainties in the satellite retrieval. We find that surface HCHO:NO2 in the model is a robust predictor of near-surface ozone production regime with constant transitional values. However, because HCHO and NO2 differ in their column-to-surface relationships, the column-to-surface conversion factor of the indicator varies in space and time. As a result, column-based HCHO:NO2 ratios show variations in the regime-defining threshold values across regions and time. We compare four combinations of two OMI HCHO products (BIRA, SAO) and OMI NO2 (DOMINO, SP) products with GEOS-Chem simulations. The spatiotemporal correlation between the modeled and observed indicator ratio is mainly influenced by the choice of NO2 product, while the mean bias depends on the choice of HCHO product. Applying a regime classification method

  4. Identification of Major Risk Sources for Surface Water Pollution by Risk Indexes (RI) in the Multi-Provincial Boundary Region of the Taihu Basin, China.

    PubMed

    Yao, Hong; Li, Weixin; Qian, Xin

    2015-08-21

    Environmental safety in multi-district boundary regions has been one of the focuses in China and is mentioned many times in the Environmental Protection Act of 2014. Five types were categorized concerning the risk sources for surface water pollution in the multi-provincial boundary region of the Taihu basin: production enterprises, waste disposal sites, chemical storage sites, agricultural non-point sources and waterway transportations. Considering the hazard of risk sources, the purification property of environmental medium and the vulnerability of risk receptors, 52 specific attributes on the risk levels of each type of risk source were screened out. Continuous piecewise linear function model, expert consultation method and fuzzy integral model were used to calculate the integrated risk indexes (RI) to characterize the risk levels of pollution sources. In the studied area, 2716 pollution sources were characterized by RI values. There were 56 high-risk sources screened out as major risk sources, accounting for about 2% of the total. The numbers of sources with high-moderate, moderate, moderate-low and low pollution risk were 376, 1059, 101 and 1124, respectively, accounting for 14%, 38%, 5% and 41% of the total. The procedure proposed could be included in the integrated risk management systems of the multi-district boundary region of the Taihu basin. It could help decision makers to identify major risk sources in the risk prevention and reduction of surface water pollution.

  5. Identification of Major Risk Sources for Surface Water Pollution by Risk Indexes (RI) in the Multi-Provincial Boundary Region of the Taihu Basin, China

    PubMed Central

    Yao, Hong; Li, Weixin; Qian, Xin

    2015-01-01

    Environmental safety in multi-district boundary regions has been one of the focuses in China and is mentioned many times in the Environmental Protection Act of 2014. Five types were categorized concerning the risk sources for surface water pollution in the multi-provincial boundary region of the Taihu basin: production enterprises, waste disposal sites, chemical storage sites, agricultural non-point sources and waterway transportations. Considering the hazard of risk sources, the purification property of environmental medium and the vulnerability of risk receptors, 52 specific attributes on the risk levels of each type of risk source were screened out. Continuous piecewise linear function model, expert consultation method and fuzzy integral model were used to calculate the integrated risk indexes (RI) to characterize the risk levels of pollution sources. In the studied area, 2716 pollution sources were characterized by RI values. There were 56 high-risk sources screened out as major risk sources, accounting for about 2% of the total. The numbers of sources with high-moderate, moderate, moderate-low and low pollution risk were 376, 1059, 101 and 1124, respectively, accounting for 14%, 38%, 5% and 41% of the total. The procedure proposed could be included in the integrated risk management systems of the multi-district boundary region of the Taihu basin. It could help decision makers to identify major risk sources in the risk prevention and reduction of surface water pollution. PMID:26308032

  6. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  7. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.

    PubMed

    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  8. A multifaceted analysis of HIV-1 protease multidrug resistance phenotypes

    PubMed Central

    2011-01-01

    Background Great strides have been made in the effective treatment of HIV-1 with the development of second-generation protease inhibitors (PIs) that are effective against historically multi-PI-resistant HIV-1 variants. Nevertheless, mutation patterns that confer decreasing susceptibility to available PIs continue to arise within the population. Understanding the phenotypic and genotypic patterns responsible for multi-PI resistance is necessary for developing PIs that are active against clinically-relevant PI-resistant HIV-1 variants. Results In this work, we use globally optimal integer programming-based clustering techniques to elucidate multi-PI phenotypic resistance patterns using a data set of 398 HIV-1 protease sequences that have each been phenotyped for susceptibility toward the nine clinically-approved HIV-1 PIs. We validate the information content of the clusters by evaluating their ability to predict the level of decreased susceptibility to each of the available PIs using a cross validation procedure. We demonstrate the finding that as a result of phenotypic cross resistance, the considered clinical HIV-1 protease isolates are confined to ~6% or less of the clinically-relevant phenotypic space. Clustering and feature selection methods are used to find representative sequences and mutations for major resistance phenotypes to elucidate their genotypic signatures. We show that phenotypic similarity does not imply genotypic similarity, that different PI-resistance mutation patterns can give rise to HIV-1 isolates with similar phenotypic profiles. Conclusion Rather than characterizing HIV-1 susceptibility toward each PI individually, our study offers a unique perspective on the phenomenon of PI class resistance by uncovering major multidrug-resistant phenotypic patterns and their often diverse genotypic determinants, providing a methodology that can be applied to understand clinically-relevant phenotypic patterns to aid in the design of novel inhibitors that

  9. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    PubMed

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study

  10. Organohalogen pollutants in surface particulates from workshop floors of four major e-waste recycling sites in China and implications for emission lists.

    PubMed

    Zeng, Yan-Hong; Tang, Bin; Luo, Xiao-Jun; Zheng, Xiao-Bo; Peng, Ping-An; Mai, Bi-Xian

    2016-11-01

    To examine the environmental pollution associated with e-waste recycling activities, the concentrations of organohologenated pollutants (OHPs), i.e., short- and medium-chain chlorinated paraffins (SCCPs and MCCPs), polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), and several other halogenated flame retardants (OHFRs), were investigated in surface particulates from the workshop floors of four major e-waste recycling sites (Taizhou, Guiyu, Dali and Qingyuan) in China. The mean levels of SCCPs, MCCPs, PCBs, PBDEs and OHFRs in surface particulates ranged from 30,000-61,000, 170,000-890,000, 2700-27,000, 52,000-240,000, and 62,000-140,000ng/g dry weight (dw), respectively. OHFRs, including decabromodiphenyl ethane, dechlorane plus, 1,2-bis(2,4,6-tribromophenoxy)ethane, tetrabromobisphenol A, hexabromocyclododecanes, polybrominated biphenyls, hexabromobenzene, pentabromotoluene, and pentabromoethylbenzene, were frequently (>50% detection frequency) detected in surface particulates with mean concentration ranges of 39,000-63,000, 310-2700, 98-16,000, 21,000-56,000, 55-5700, 1700-27,000, 42-1600, 3.2-220, and 5.8-12ng/g dw, respectively. The composition of OHPs varied depend on the e-waste items processing in different regions. Guiyu and Dali were typical sites contaminated by halogenated flame retardants (HFRs) and CPs, respectively, while Qingyuan, and Taizhou were representative PCB-polluted regions. The evidence produced by this preliminary study indicated that electronic devices and plastics may account for the high content of HFRs and the metal products are likely the major source of CPs in these e-waste sites.

  11. Cowpea bruchid Callosobruchus maculatus uses a three-component strategy to overcome a plant defensive cysteine protease inhibitor.

    PubMed

    Zhu-Salzman, K; Koiwa, H; Salzman, R A; Shade, R E; Ahn, J-E

    2003-04-01

    The soybean cysteine protease inhibitor, soyacystatin N (scN), negatively impacts growth and development of the cowpea bruchid, Callosobruchus maculatus[Koiwa et al. (1998) Plant J 14: 371-379]. However, the developmental delay and feeding inhibition caused by dietary scN occurred only during the early developmental stages (the 1st, 2nd and 3rd instars) of the cowpea bruchid. The 4th instar larvae reared on scN diet (adapted) exhibited rates of feeding and development which were comparable to those feeding on an scN-free diet (unadapted) prior to pupation. Total gut proteolytic capacity at this larval stage significantly increased in the scN-adapted insects. The elevated enzymatic activity was attributed to a differential expression of insect gut cysteine proteases (representing the major digestive enzymes), and of aspartic proteases. scN degradation by the gut extract was observed only in adapted bruchids, and this activity appeared to be a combined effect of scN-induced cysteine and aspartic proteases. Thirty cDNAs encoding cathepsin L-like cysteine proteases were isolated from insect guts, and they were differentially regulated by dietary scN. Our results suggest that the cowpea bruchid adapts to the challenge of scN by qualitative and quantitative remodelling of its digestive protease complement, and by activating scN-degrading protease activity.

  12. An 11-kDa form of human immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic activity.

    PubMed Central

    Graves, M C; Lim, J J; Heimer, E P; Kramer, R A

    1988-01-01

    In order to define the protease domain of human immunodeficiency virus 1, various regions of the pol open reading frame were cloned and expressed in Escherichia coli. Antiserum directed against the conserved retroviral protease active site was used to identify pol precursor and processed species containing the presumed protease domain. The smallest product that accumulates is about 11 kDa as measured by NaDodSO4/PAGE. This size agrees with that predicted from the presence in this region of two Phe-Pro sequences, which is one of the cleavage sites recognized by HIV protease. DNA encoding only the predicted 11-kDa protein was cloned, bypassing the need for autoprocessing, and the protein was expressed to a high level in E. coli. This form is active as demonstrated by its ability to specifically cleave protease-deficient pol protein in vivo in E. coli. Extracts of E. coli containing the 11-kDa protease also process human immunodeficiency virus gag substrates in vitro. These results demonstrate that the 11-kDa protease is sufficient for enzymatic activity and are consistent with a major role for this form in virus maturation. Images PMID:3282230

  13. Lazarus and Group Psychotherapy: AIDS in the Era of Protease Inhibitors

    ERIC Educational Resources Information Center

    Gushue, George V.; Brazaitis, Sarah J.

    2003-01-01

    A new class of medications, protease inhibitors, has dramatically improved the health of many people with Human Immunodeficiency Virus (HIV) and Acquired Immune Deficiency Syndrome (AIDS). This development has had a major impact on the lives of those affected by HIV/AIDS. This article considers how a group is affected by the larger systems of…

  14. Lazarus and Group Psychotherapy: AIDS in the Era of Protease Inhibitors

    ERIC Educational Resources Information Center

    Gushue, George V.; Brazaitis, Sarah J.

    2003-01-01

    A new class of medications, protease inhibitors, has dramatically improved the health of many people with Human Immunodeficiency Virus (HIV) and Acquired Immune Deficiency Syndrome (AIDS). This development has had a major impact on the lives of those affected by HIV/AIDS. This article considers how a group is affected by the larger systems of…

  15. Assessment of spatial variability of major-ion concentrations and del oxygen-18 values in surface snow, Upper Fremont Glacier, Wyoming, USA

    USGS Publications Warehouse

    Naftz, D.L.; Schuster, P.F.; Reddy, M.M.

    1994-01-01

    One hundred samples were collected from the surface of the Upper Fremont Glacier at equally spaced intervals defined by an 8100m2 snow grid to asesss the significance of lateral variability in major-ion concentrations and del oxygen-18 values. Comparison of the observed variability of each chemical constituent to the variability expected by measurement error indicated substantial lateral variability with the surface-snow layer. Results of the nested ANOVA indicate most of the variance for every constituent is in the values grouped at the two smaller geographic scales (between 506m2 and within 506m2 sections). The variance data from the snow grid were used to develop equations to evaluate the significance of both positive and negative concentration/value peaks of nitrate and del oxygen-18 with depth, in a 160m ice core. Values of del oxygen-18 in the section from 110-150m below the surface consistently vary outside the expected limits and possibly represents cooler temperatures during the Little Ice Age from about 1810 to 1725 A.D. -from Authors

  16. Decreased expression of protease inhibitor 9, a granzyme B inhibitor, in celiac disease: a potential mechanism in enterocyte destruction and villous atrophy.

    PubMed

    Pohjanen, V-M; Kokkonen, T S; Arvonen, M; Augustin, M A; Patankar, M; Turunen, S; Vähäsalo, P; Karttunen, T J

    2013-01-01

    The objective of this study was to assess the expression of protease inhibitor 9, a granzyme B inhibitor, in human small intestine, and to evaluate its cytoprotective role in the celiac disease of children. Twelve subjects with untreated celiac disease and thirteen healthy controls were examined by endoscopy. The expression of protease inhibitor 9 was analyzed immunohistochemically from duodenal biopsies and compared to granzyme B expression, apoptosis rate, number of intraepithelial lymphocytes and villus and crypt height data from the biopsies. We discovered that protease inhibitor 9 is expressed in the cytoplasm of the duodenal epithelial cells in the majority of cases. The enterocyte expression of protease inhibitor 9 was lower in celiac disease patients than in controls. Protease inhibitor 9 expression also showed a negative correlation with the number of apoptotic cells, overall density of granzyme B expressing intraepithelial lymphocytes, the height of the crypts and the severity of villous atrophy in duodenum. Therefore, we conclude that the protease inhibitor 9 is constantly expressed in the enterocytes of normal duodenum and the expression is decreased in celiac disease. These findings suggest that protease inhibitor 9 has a role in duodenal homeostasis and in the protection of enterocytes from misdirected granzyme B. Indeed, observed associations of lowered protease inhibitor 9 expression together with increased granzyme B expression, apoptosis rate and severity of villous atrophy suggest that impaired balance between granzyme B mediated cytotoxicity and its inhibition by protease inhibitor 9 forms an important factor in the pathogenesis of villous atrophy in celiac disease.

  17. Purification and biochemical characterization of a novel alkaline protease produced by Penicillium nalgiovense.

    PubMed

    Papagianni, M; Sergelidis, D

    2014-04-01

    Penicillium nalgiovense PNA9 produces an extracellular protease during fermentation with characteristics of growth-associated product. Enzyme purification involved ammonium sulfate precipitation, dialysis, and ultrafiltration, resulting in 12.1-fold increase of specific activity (19.5 U/mg). The protein was isolated through a series of BN-PAGE and native PAGE runs. ESI-MS analysis confirmed the molecular mass of 45.2 kDa. N-Terminal sequencing (MGFLKLLKGSLATLAVVNAGKLLTANDGDE) revealed 93 % similarity to a Penicillium chrysogenum protease, identified as major allergen. The protease exhibits simple Michaelis-Menten kinetics and K m (1.152 mg/ml), V max (0.827 mg/ml/min), and k cat (3.2 × 10(2)) (1/s) values against azocasein show that it possesses high substrate affinity and catalytic efficiency. The protease is active within 10-45 °C, pH 4.0-10.0, and 0-3 M NaCl, while maximum activity was observed at 35 °C, pH 8.0, and 0.25 M NaCl. It is active against the muscle proteins actin and myosin and inactive against myoglobin. It is highly stable in the presence of non-ionic surfactants, hydrogen peroxide, BTNB, and EDTA. Activity was inhibited by SDS, Mn(2+) and Zn(2+), and by the serine protease inhibitor PMSF, indicating the serine protease nature of the enzyme. These properties make the novel protease a suitable candidate enzyme in meat ripening and other biotechnological applications.

  18. Cysteine and Aspartyl Proteases Contribute to Protein Digestion in the Gut of Freshwater Planaria.

    PubMed

    Goupil, Louise S; Ivry, Sam L; Hsieh, Ivy; Suzuki, Brian M; Craik, Charles S; O'Donoghue, Anthony J; McKerrow, James H

    2016-08-01

    Proteases perform numerous vital functions in flatworms, many of which are likely to be conserved throughout the phylum Platyhelminthes. Within this phylum are several parasitic worms that are often poorly characterized due to their complex life-cycles and lack of responsiveness to genetic manipulation. The flatworm Schmidtea mediterranea, or planaria, is an ideal model organism to study the complex role of protein digestion due to its simple life cycle and amenability to techniques like RNA interference (RNAi). In this study, we were interested in deconvoluting the digestive protease system that exists in the planarian gut. To do this, we developed an alcohol-induced regurgitation technique to enrich for the gut enzymes in S. mediterranea. Using a panel of fluorescent substrates, we show that this treatment produces a sharp increase in proteolytic activity. These enzymes have broad yet diverse substrate specificity profiles. Proteomic analysis of the gut contents revealed the presence of cysteine and metallo-proteases. However, treatment with class-specific inhibitors showed that aspartyl and cysteine proteases are responsible for the majority of protein digestion. Specific RNAi knockdown of the cathepsin B-like cysteine protease (SmedCB) reduced protein degradation in vivo. Immunohistochemistry and whole-mount in situ hybridization (WISH) confirmed that the full-length and active forms of SmedCB are found in secretory cells surrounding the planaria intestinal lumen. Finally, we show that the knockdown of SmedCB reduces the speed of tissue regeneration. Defining the roles of proteases in planaria can provide insight to functions of conserved proteases in parasitic flatworms, potentially uncovering drug targets in parasites.

  19. Dimerization and protease resistance: new insight into the function of PR-1.

    PubMed

    Lu, Shunwen; Faris, Justin D; Sherwood, Robert; Edwards, Michael C

    2013-01-01

    The group 1 pathogenesis-related (PR-1) proteins have long been considered hallmarks of hypersensitive response/defense pathways in plants, but their biochemical functions are still obscure despite resolution of the NMR/X-ray structures of several PR-1-like proteins, including P14a (the prototype PR-1). We report here the characterization of two basic PR-1 proteins (PR-1-1 and PR-1-5) recently identified from hexaploid wheat (Triticum aestivum). Both proteins were expressed in Pichia pastoris as a single major species of ∼15 kDa. Sequence identity of the expressed PR-1 proteins was verified by MALDI-TOF/TOF analysis. Accumulation of the native PR-1-5 protein in pathogen-challenged wheat was confirmed by protein gel blot analysis. Low-temperature SDS-PAGE and yeast two-hybrid assays revealed that PR-1-1 exists primarily as a monomer whereas PR-1-5 forms homodimers. Both PR-1 proteins are resistant to proteases compared to bovine serum albumin, but PR-1-1 shows resistance mainly to subtilisin and protease K (serine proteases) whereas PR-1-5 shows resistance to subtilisin, protease K and papain (a cysteine protease). Site-specific mutations at the five putative active sites in the PR-1 domain all affected dimerization, with the mutations at Glu-72 and Glu-102 (in the PR-1-5 numeration) also diminishing protease resistance. Sequence analysis revealed that the Glu-72 and Glu-102 residues are located in motif-like sequences that are conserved in both PR-1 and the human apoptosis-related caspase proteins. These findings prompt us to examine the function of PR-1 for a role in protease-mediated programmed cell death pathways in plants. Copyright © 2012 Elsevier GmbH. All rights reserved.

  20. Differential expression of conserved protease genes in crucifer-attacking pathovars of Xanthomonas campestris.

    PubMed

    Dow, J M; Fan, M J; Newman, M A; Daniels, M J

    1993-12-01

    Strains of Xanthomonas campestris pathovars armoraciae and raphani, which cause leaf spotting diseases in brassicas, produce a major extracellular protease in liquid culture which was partially purified. The protease (PRT 3) was a zinc-requiring metalloenzyme and was readily distinguishable from the two previously characterized proteases (PRT 1 and PRT 2) of X. campestris pv. campestris by the pattern of degradation of beta-casein and sensitivity to inhibitors. PRT 3 was produced at a low level in the vascular brassica pathogen X. campestris pv. campestris (five strains tested), in which PRT 1 and PRT 2 predominate. In contrast, expression of PRT 1, a serine protease, could not be detected in the six tested strains of the leaf spotting mesophyll pathogens. However, all these strains had DNA fragments which hybridized to a prtA probe and which probably carry a functional prtA (the structural gene for PRT 1). The structural gene for PRT 3 (prtC) was cloned by screening a genomic library of X. campestris pv. raphani in a protease-deficient X. campestris pv. campestris strain. Subcloning and Tn5 mutagenesis located the structural gene to 1.2 kb of DNA. DNA fragments which hybridized to the structural gene were found in all strains of the crucifer-attacking X. campestris pathovars tested as well as in a number of other pathovars. Experiments in which the pattern of protease production of the pathovars was manipulated by introduction of cloned genes into heterologous pathovars suggested that no determinative relationship exists between the pattern of protease gene expression and the (vascular or mesophyllic) mode of pathogenesis.

  1. Cysteine and Aspartyl Proteases Contribute to Protein Digestion in the Gut of Freshwater Planaria

    PubMed Central

    Goupil, Louise S.; Ivry, Sam L.; Hsieh, Ivy; Suzuki, Brian M.; Craik, Charles S.; O’Donoghue, Anthony J.; McKerrow, James H.

    2016-01-01

    Proteases perform numerous vital functions in flatworms, many of which are likely to be conserved throughout the phylum Platyhelminthes. Within this phylum are several parasitic worms that are often poorly characterized due to their complex life-cycles and lack of responsiveness to genetic manipulation. The flatworm Schmidtea mediterranea, or planaria, is an ideal model organism to study the complex role of protein digestion due to its simple life cycle and amenability to techniques like RNA interference (RNAi). In this study, we were interested in deconvoluting the digestive protease system that exists in the planarian gut. To do this, we developed an alcohol-induced regurgitation technique to enrich for the gut enzymes in S. mediterranea. Using a panel of fluorescent substrates, we show that this treatment produces a sharp increase in proteolytic activity. These enzymes have broad yet diverse substrate specificity profiles. Proteomic analysis of the gut contents revealed the presence of cysteine and metallo-proteases. However, treatment with class-specific inhibitors showed that aspartyl and cysteine proteases are responsible for the majority of protein digestion. Specific RNAi knockdown of the cathepsin B-like cysteine protease (SmedCB) reduced protein degradation in vivo. Immunohistochemistry and whole-mount in situ hybridization (WISH) confirmed that the full-length and active forms of SmedCB are found in secretory cells surrounding the planaria intestinal lumen. Finally, we show that the knockdown of SmedCB reduces the speed of tissue regeneration. Defining the roles of proteases in planaria can provide insight to functions of conserved proteases in parasitic flatworms, potentially uncovering drug targets in parasites. PMID:27501047

  2. An Alkaline Protease from Bacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive

    PubMed Central

    Baweja, Mehak; Tiwari, Rameshwar; Singh, Puneet K.; Nain, Lata; Shukla, Pratyoosh

    2016-01-01

    A proteolytic strain of Bacillus pumilus MP 27 was isolated from water samples of Southern ocean produced alkaline protease. Since protease production need expensive ingredients, an economically viable process was developed by using low cost carbon source, wheat straw, supplemented with peptone. This protease was active within temperature ranges 10–70°C at pH 9. This process was optimized by response surface methodology using a Box Bekhman design by Design Expert 7.0 software that increased the protease activity to 776.5 U/ml. Moreover, the enzyme was extremely stable at a broad range of temperature and pH retaining 69% of its activity at 50°C and 70% at pH 11. The enzyme exhibited excellent compatibility with surfactants and commercial detergents, showing 87% stability with triton X-100 and 100% stability with Tide commercial detergent. The results of the wash performance analysis demonstrated considerably good de-staining at 50 and 4°C with low supplementation (109 U/ml). Molecular modeling of the protease revealed the presence of serine proteases, subtilase family and serine active site and further docking supported the association of catalytic site with the various substrates. Certainly, such protease can be considered as a good detergent additive in detergent industry with a possibility to remove the stains effectively even in a cold wash. PMID:27536284

  3. Isolation and characterization of two serine proteases from metagenomic libraries of the Gobi and Death Valley deserts.

    PubMed

    Neveu, Julie; Regeard, Christophe; DuBow, Michael S

    2011-08-01

    The screening of environmental DNA metagenome libraries for functional activities can provide an important source of new molecules and enzymes. In this study, we identified 17 potential protease-producing clones from two metagenomic libraries derived from samples of surface sand from the Gobi and Death Valley deserts. Two of the proteases, DV1 and M30, were purified and biochemically examined. These two proteases displayed a molecular mass of 41.5 kDa and 45.7 kDa, respectively, on SDS polyacrylamide gels. Alignments with known protease sequences showed less than 55% amino acid sequence identity. These two serine proteases appear to belong to the subtilisin (S8A) family and displayed several unique biochemical properties. Protease DV1 had an optimum pH of 8 and an optimal activity at 55°C, while protease M30 had an optimum pH >11 and optimal activity at 40°C. The properties of these enzymes make them potentially useful for biotechnological applications and again demonstrate that metagenomic approaches can be useful, especially when coupled with the study of novel environments such as deserts.

  4. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  5. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  6. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  7. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  8. Structure of the Autocatalytic Cysteine Protease Domain of Potyvirus Helper-component Proteinase*

    PubMed Central

    Guo, Bihong; Lin, Jinzhong; Ye, Keqiong

    2011-01-01

    The helper-component proteinase (HC-Pro) of potyvirus is involved in polyprotein processing, aphid transmission, and suppression of antiviral RNA silencing. There is no high resolution structure reported for any part of HC-Pro, hindering mechanistic understanding of its multiple functions. We have determined the crystal structure of the cysteine protease domain of HC-Pro from turnip mosaic virus at 2.0 Å resolution. As a protease, HC-Pro only cleaves a Gly-Gly dipeptide at its own C terminus. The structure represents a postcleavage state in which the cleaved C terminus remains tightly bound at the active site cleft to prevent trans activity. The structure adopts a compact α/β-fold, which differ