A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

Functional analysis of the sea urchin-derived arylsulfatase (Ars)-element in mammalian cells.

PubMed

Watanabe, Satoshi; Watanabe, Sachiko; Sakamoto, Naoaki; Sato, Masahiro; Akasaka, Koji

2006-09-01

An insulator is a DNA sequence that has both enhancer-blocking activity, through its ability to modify the influence of neighboring cis-acting elements, and a barrier function that protects a transgene from being silenced by surrounding chromatin. Previously, we isolated and characterized a 582-bp-long element from the sea urchin arylsulfatase gene (Ars). This Ars-element was effective in sea urchin and Drosophila embryos and in plant cells. To investigate Ars-element activity in mammalian cells, we placed the element between the cytomegalovirus enhancer and a luciferase (luc) expression cassette. In contrast to controls lacking the Ars-element, NIH3T3 and 293T cells transfected with the element-containing construct displayed reduced luciferase activities. The Ars-element therefore acts as an enhancer-blocking element in mammalian cells. We assessed the barrier activity of the Ars-element using vectors in which a luc expression cassette was placed between two elements. Transfection experiments demonstrated that luc activity in these vectors was approximately ten-fold higher than in vectors lacking elements. Luc activities were well maintained even after 12 weeks in culture. Our observations demonstrate that the Ars-element has also a barrier activity. These results indicated that the Ars-element act as an insulator in mammalian cells.

Baculovirus GP64-mediated entry into mammalian cells.

PubMed

Kataoka, Chikako; Kaname, Yuuki; Taguwa, Shuhei; Abe, Takayuki; Fukuhara, Takasuke; Tani, Hideki; Moriishi, Kohji; Matsuura, Yoshiharu

2012-03-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) serves as an efficient viral vector, not only for abundant gene expression in insect cells, but also for gene delivery into mammalian cells. Lentivirus vectors pseudotyped with the baculovirus envelope glycoprotein GP64 have been shown to acquire more potent gene transduction than those with vesicular stomatitis virus (VSV) envelope glycoprotein G. However, there are conflicting hypotheses about the molecular mechanisms of the entry of AcMNPV. Moreover, the mechanisms of the entry of pseudotyped viruses bearing GP64 into mammalian cells are not well characterized. Determination of the entry mechanisms of AcMNPV and the pseudotyped viruses bearing GP64 is important for future development of viral vectors that can deliver genes into mammalian cells with greater efficiency and specificity. In this study, we generated three pseudotyped VSVs, NPVpv, VSVpv, and MLVpv, bearing envelope proteins of AcMNPV, VSV, and murine leukemia virus, respectively. Depletion of membrane cholesterol by treatment with methyl-β-cyclodextrin, which removes cholesterol from cellular membranes, inhibited GP64-mediated internalization in a dose-dependent manner but did not inhibit attachment to the cell surface. Treatment of cells with inhibitors or the expression of dominant-negative mutants for dynamin- and clathrin-mediated endocytosis abrogated the internalization of AcMNPV and NPVpv into mammalian cells, whereas inhibition of caveolin-mediated endocytosis did not. Furthermore, inhibition of macropinocytosis reduced GP64-mediated internalization. These results suggest that cholesterol in the plasma membrane, dynamin- and clathrin-dependent endocytosis, and macropinocytosis play crucial roles in the entry of viruses bearing baculovirus GP64 into mammalian cells.

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

PubMed

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Targeted systemic gene therapy and molecular imaging of cancer contribution of the vascular-targeted AAVP vector.

PubMed

Hajitou, Amin

2010-01-01

Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Green fluorescent protein as a reporter of gene expression and protein localization.

PubMed

Kain, S R; Adams, M; Kondepudi, A; Yang, T T; Ward, W W; Kitts, P

1995-10-01

The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is rapidly becoming an important reporter molecule for monitoring gene expression and protein localization in vivo, in situ and in real time. GFP emits bright green light (lambda max = 509 nm) when excited with UV or blue light (lambda max = 395 nm, minor peak at 470 nm). The fluorescence excitation and emission spectra of GFP are similar to those of fluorescein, and the conditions used to visualize this fluorophore are also suitable for GFP. Unlike other bioluminescent reporters, the chromophore in GFP is intrinsic to the primary structure of the protein, and GFP fluorescence does not require a substrate or cofactor. GFP fluorescence is stable, species-independent and can be monitored non-invasively in living cells and, in the case of transparent organisms, whole animals. Here we demonstrate GFP fluorescence in bacterial and mammalian cells and introduce our Living Colors line of GFP reporter vectors, GFP protein and anti-GFP antiserum. The reporter vectors for GFP include a promoterless GFP vector for monitoring the expression of cloned promoters/enhancers in mammalian cells and a series of six vectors for creating fusion protein to either the N or C terminus of GFP.

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

Mammalian cytochrome CYP2E1 triggered differential gene regulation in response to trichloroethylene (TCE) in a transgenic poplar.

PubMed

Kang, Jun Won; Wilkerson, Hui-Wen; Farin, Federico M; Bammler, Theo K; Beyer, Richard P; Strand, Stuart E; Doty, Sharon L

2010-08-01

Trichloroethylene (TCE) is an important environmental contaminant of soil, groundwater, and air. Studies of the metabolism of TCE by poplar trees suggest that cytochrome P450 enzymes are involved. Using poplar genome microarrays, we report a number of putative genes that are differentially expressed in response to TCE. In a previous study, transgenic hybrid poplar plants expressing mammalian cytochrome P450 2E1 (CYP2E1) had increased metabolism of TCE. In the vector control plants for this construct, 24 h following TCE exposure, 517 genes were upregulated and 650 genes were downregulated over 2-fold when compared with the non-exposed vector control plants. However, in the transgenic CYP2E1 plant, line 78, 1,601 genes were upregulated and 1,705 genes were downregulated over 2-fold when compared with the non-exposed transgenic CYP2E1 plant. It appeared that the CYP2E1 transgenic hybrid poplar plants overexpressing mammalian CYP2E1 showed a larger number of differentially expressed transcripts, suggesting a metabolic pathway for TCE to metabolites had been initiated by activity of CYP2E1 on TCE. These results suggest that either the over-expression of the CYP2E1 gene or the abundance of TCE metabolites from CYP450 2E1 activity triggered a strong genetic response to TCE. Particularly, cytochrome p450s, glutathione S-transferases, glucosyltransferases, and ABC transporters in the CYP2E1 transgenic hybrid poplar plants were highly expressed compared with in vector controls.

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.

PubMed

Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo

2018-03-20

DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Identification of Adeno-Associated Viral Vectors That Target Neonatal and Adult Mammalian Inner Ear Cell Subtypes

PubMed Central

Shu, Yilai; Tao, Yong; Wang, Zhengmin; Tang, Yong; Li, Huawei; Dai, Pu; Gao, Guangping; Chen, Zheng-Yi

2016-01-01

The mammalian inner ear consists of diverse cell types with important functions. Gene mutations in these diverse cell types have been found to underlie different forms of genetic hearing loss. Targeting these mutations for gene therapy development represents a future therapeutic strategy to treat hearing loss. Adeno-associated viral (AAV) vectors have become the vector of choice for gene delivery in animal models in vivo. To identify AAV vectors that target inner ear cell subtypes, we systemically screened 12 AAV vectors with different serotypes (AAV1, 2, 5, 6, 6.2, 7, 8, 9, rh.8, rh.10, rh.39, and rh.43) that carry a reporter gene GFP in neonatal and adult mice by microinjection in vivo. We found that most AAVs infect both neonatal and adult inner ear, with different specificities and expression levels. The inner ear cochlear sensory epithelial region, which includes auditory hair cells and supporting cells, is most frequently targeted for gene delivery. Expression of the transgene is sustained, and neonatal inner ear delivery does not adversely affect hearing. Adult inner ear injection of AAV has a similar infection pattern as the younger inner ear, with the exception that outer hair cell death caused by the injection procedure can lead to hearing loss. In the adult, more so than in the neonatal mice, cell types infected and efficiency of infection are correlated with the site of injection. Most infected cells survive in neonatal and adult inner ears. The study adds to the list of AAV vectors that transduce the mammalian inner ear efficiently, providing the tools that are important to study inner ear gene function and for the development of gene therapy to treat hearing loss. PMID:27342665

De novo formed satellite DNA-based mammalian artificial chromosomes and their possible applications.

PubMed

Katona, Robert L

2015-02-01

Mammalian artificial chromosomes (MACs) are non-integrating, autonomously replicating natural chromosome-based vectors that may carry a vast amount of genetic material, which in turn enable potentially prolonged, safe, and regulated therapeutic transgene expression and render MACs as attractive genetic vectors for "gene replacement" or for controlling differentiation pathways in target cells. Satellite-DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian and plant species. These artificially generated accessory chromosomes are composed of predictable DNA sequences, and they contain defined genetic information. SATACs have already passed a number of obstacles crucial to their further development as gene therapy vectors, including large-scale purification, transfer of purified artificial chromosomes into different cells and embryos, generation of transgenic animals and germline transmission with purified SATACs, and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals. SATACs could be used in cell therapy protocols. For these methods, the most versatile target cell would be one that was pluripotent and self-renewing to address multiple disease target cell types, thus making multilineage stem cells, such as adult derived early progenitor cells and embryonic stem cells, as attractive universal host cells.

Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

DOEpatents

Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

2007-02-27

The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

Identification of amino acid residues of mammalian mitochondrial phosphate carrier important for its functional expression in yeast cells, as achieved by PCR-mediated random mutation and gap-repair cloning.

PubMed

Yamagoshi, Ryohei; Yamamoto, Takenori; Hashimoto, Mitsuru; Sugahara, Ryohei; Shiotsuki, Takahiro; Miyoshi, Hideto; Terada, Hiroshi; Shinohara, Yasuo

2017-01-01

The mitochondrial phosphate carrier (PiC) of mammals, but not the yeast one, is synthesized with a presequence. The deletion of this presequence of the mammalian PiC was reported to facilitate the import of the carrier into yeast mitochondria, but the question as to whether or not mammalian PiC could be functionally expressed in yeast mitochondria was not addressed. In the present study, we first examined whether the defective growth on a glycerol plate of yeast cells lacking the yeast PiC gene could be reversed by the introduction of expression vectors of rat PiCs. The introduction of expression vectors encoding full-length rat PiC (rPiC) or rPiC lacking the presequence (ΔNrPiC) was ineffective in restoring growth on the glycerol plates. When we examined the expression levels of individual rPiCs in yeast mitochondria, ΔNrPiC was expressed at a level similar to that of yeast PiC, but that of rPiC was very low. These results indicated that ΔNrPiC expressed in yeast mitochondria is inert. Next, we sought to isolate "revertants" viable on the glycerol plate by expressing randomly mutated ΔNrPiC, and obtained two clones. These clones carried either of two mutations, F267S or F282S; and these mutations restored the transport function of ΔNrPiC in yeast mitochondria. These two Phe residues were conserved in human carrier (hPiC), and the transport function of ΔNhPiC expressed in yeast mitochondria was also markedly improved by their substitutions. Thus, substitution of F267S or F282S was concluded to be important for functional expression of mammalian PiCs in yeast mitochondria. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

Construction of siRNA/miRNA expression vectors based on a one-step PCR process

PubMed Central

Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

2009-01-01

Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells.

PubMed

Nagahashi, Kotomi; Umemura, Kazuo; Kanayama, Naohiro; Iwaki, Takayuki

2017-04-01

Mammalian gamma-glutamyl carboxylase and reduced vitamin K are indispensable for synthesis of mature mammalian vitamin K dependent proteins including some of blood coagulation factors (factors II, VII, IX, and X). It was well known that Drosophila melanogaster expressed gamma-glutamyl carboxylase and possessed a vit.K cycle although native substrates for them have not been identified yet. Despite the potential capability of gamma carboxylation in D. melanogaster derived cells such as S2 cells, Drosophila gamma-glutamyl carboxylase failed to gamma carboxylate a peptide fused to the human coagulation factor IX propeptide. Thus, it had been believed that the Drosophila system was not adequate to synthesize mammalian vit.K dependent proteins. Indeed, we previously attempted to synthesize biologically active factor VII in S2 cells although we were not able to obtain it. However, recently, a successful transient expression of biologically active human factor IX from S2 cells was reported. In the present study, several expression vectors which enable expressing mammalian GGCX, VKORC1, and/or PDIA2 along with F7 were developed. S2 cells transfected with pMKA85, pMAK86, and pMAK219 successfully synthesized active FVII. Thus, mammalian GGCX was indispensable to synthesize active FVII while mammalian VKORC1 and PDIA2 were not critical but supportive factors for S2 cells.

Rational design of aptazyme riboswitches for efficient control of gene expression in mammalian cells

PubMed Central

Zhong, Guocai; Wang, Haimin; Bailey, Charles C; Gao, Guangping; Farzan, Michael

2016-01-01

Efforts to control mammalian gene expression with ligand-responsive riboswitches have been hindered by lack of a general method for generating efficient switches in mammalian systems. Here we describe a rational-design approach that enables rapid development of efficient cis-acting aptazyme riboswitches. We identified communication-module characteristics associated with aptazyme functionality through analysis of a 32-aptazyme test panel. We then developed a scoring system that predicts an aptazymes’s activity by integrating three characteristics of communication-module bases: hydrogen bonding, base stacking, and distance to the enzymatic core. We validated the power and generality of this approach by designing aptazymes responsive to three distinct ligands, each with markedly wider dynamic ranges than any previously reported. These aptayzmes efficiently regulated adeno-associated virus (AAV)-vectored transgene expression in cultured mammalian cells and mice, highlighting one application of these broadly usable regulatory switches. Our approach enables efficient, protein-independent control of gene expression by a range of small molecules. DOI: http://dx.doi.org/10.7554/eLife.18858.001 PMID:27805569

Generation of a new Gateway-compatible inducible lentiviral vector platform allowing easy derivation of co-transduced cells.

PubMed

De Groote, Philippe; Grootjans, Sasker; Lippens, Saskia; Eichperger, Chantal; Leurs, Kirsten; Kahr, Irene; Tanghe, Giel; Bruggeman, Inge; De Schamphelaire, Wouter; Urwyler, Corinne; Vandenabeele, Peter; Haustraete, Jurgen; Declercq, Wim

2016-01-01

In contrast to most common gene delivery techniques, lentiviral vectors allow targeting of almost any mammalian cell type, even non-dividing cells, and they stably integrate in the genome. Therefore, these vectors are a very powerful tool for biomedical research. Here we report the generation of a versatile new set of 22 lentiviral vectors with broad applicability in multiple research areas. In contrast to previous systems, our platform provides a choice between constitutive and/or conditional expression and six different C-terminal fusions. Furthermore, two compatible selection markers enable the easy derivation of stable cell lines co-expressing differently tagged transgenes in a constitutive or inducible manner. We show that all of the vector features are functional and that they contribute to transgene overexpression in proof-of-principle experiments.

Genetically modified pigs produced with a nonviral episomal vector

PubMed Central

Manzini, Stefano; Vargiolu, Alessia; Stehle, Isa M; Bacci, Maria Laura; Cerrito, Maria Grazia; Giovannoni, Roberto; Zannoni, Augusta; Bianco, Maria Rosaria; Forni, Monica; Donini, Pierluigi; Papa, Michele; Lipps, Hans J; Lavitrano, Marialuisa

2006-01-01

Genetic modification of cells and animals is an invaluable tool for biotechnology and biomedicine. Currently, integrating vectors are used for this purpose. These vectors, however, may lead to insertional mutagenesis and variable transgene expression and can undergo silencing. Scaffold/matrix attachment region-based vectors are nonviral expression systems that replicate autonomously in mammalian cells, thereby making possible safe and reliable genetic modification of higher eukaryotic cells and organisms. In this study, genetically modified pig fetuses were produced with the scaffold/matrix attachment region-based vector pEPI, delivered to embryos by the sperm-mediated gene transfer method. The pEPI vector was detected in 12 of 18 fetuses in the different tissues analyzed and was shown to be retained as an episome. The reporter gene encoded by the pEPI vector was expressed in 9 of 12 genetically modified fetuses. In positive animals, all tissues analyzed expressed the reporter gene; moreover in these tissues, the positive cells were on the average 79%. The high percentage of EGFP-expressing cells and the absence of mosaicism have important implications for biotechnological and biomedical applications. These results are an important step forward in animal transgenesis and can provide the basis for the future development of germ-line gene therapy. PMID:17101993

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

PubMed

Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

2016-09-01

Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

A surface transporter family conveys the trypanosome differentiation signal.

PubMed

Dean, Samuel; Marchetti, Rosa; Kirk, Kiaran; Matthews, Keith R

2009-05-14

Microbial pathogens use environmental cues to trigger the developmental events needed to infect mammalian hosts or transmit to disease vectors. The parasites causing African sleeping sickness respond to citrate or cis-aconitate (CCA) to initiate life-cycle development when transmitted to their tsetse fly vector. This requires hypersensitization of the parasites to CCA by exposure to low temperature, conditions encountered after tsetse fly feeding at dusk or dawn. Here we identify a carboxylate-transporter family, PAD (proteins associated with differentiation), required for perception of this differentiation signal. Consistent with predictions for the response of trypanosomes to CCA, PAD proteins are expressed on the surface of the transmission-competent 'stumpy-form' parasites in the bloodstream, and at least one member is thermoregulated, showing elevated expression and surface access at low temperature. Moreover, RNA-interference-mediated ablation of PAD expression diminishes CCA-induced differentiation and eliminates CCA hypersensitivity under cold-shock conditions. As well as being molecular transducers of the differentiation signal in these parasites, PAD proteins provide the first example of a surface marker able to discriminate the transmission stage of trypanosomes in their mammalian host.

A herpes simplex viral vector expressing green fluorescent protein can be used to visualize morphological changes in high-density neuronal culture

PubMed Central

Falk, Torsten; Strazdas, Lori A.; Borders, Rebecca S.; Kilani, Ramsey K.; Yool, Andrea J.

2010-01-01

High-density cultures of mammalian neurons offer a model system for studies of brain development, but the morphological features of individual neurons is difficult to ascertain. We show that a herpes virus vector expressing a bioluminescent protein allows detailed morphometric analyses of living neurons in complex culture environments. Expression of enhanced green fluorescent protein (eGFP) was constitutively driven in neurons using the herpes simplex virus amplicon system. This system allowed us to make novel observations regarding development in high-density cultures from rat hippocampus and cerebellum. After the phase of initial neurite outgrowth, maturing neurons continue to show rapid remodeling of the neurite branches (0.79 ± 0.11 μm/h per neurite; mean ± SEM, n=8), and displacement of the soma within the neurite arbor (1.35 ± 0.74 μm/h). These results demonstrate that a substantial capacity for morphological plasticity persists in maturing mammalian CNS neurons after cessation of net neurite outgrowth in early development. PMID:20811504

[Sendai virus vector: vector development and its application to health care and biotechnology].

PubMed

Iida, Akihiro

2007-06-01

Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

[Overexpression of four fatty acid synthase genes elevated the efficiency of long-chain polyunsaturated fatty acids biosynthesis in mammalian cells].

PubMed

Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie

2014-09-01

Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.

An integrated vector system for cellular studies of phage display-derived peptides.

PubMed

Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

2002-09-15

Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

Infection studies of nontarget mammalian cell lines with Bombyx mori macula-like virus.

PubMed

Innami, Katsuhisa; Aizawa, Takahiro; Tsukui, Toshihiro; Katsuma, Susumu; Imanishi, Shigeo; Kawasaki, Hideki; Iwanaga, Masashi

2016-03-01

Bombyx mori-derived cell lines are generally used for Bombyx mori nucleopolyhedrovirus (BmNPV)-based baculovirus expression vector system (BEVS). However, almost all of the B. mori-derived cell lines are persistently infected with Bombyx mori macula-like virus (BmMLV). In this study, nontarget mammalian cell lines were exposed to BmMLV, and their susceptibility was investigated. Real-time PCR showed that viral RNA in virus-inoculated nine mammalian cell lines decreased sharply at 7 days postinfection. Also, there was no significant effect on cell viability of mammalian cells after inoculation with BmMLV. These findings indicate that mammalian cell lines used in this study are not permissive to BmMLV, and BmMLV contamination might not affect the safety aspect of BmNPV-based BEVS. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of retroviral infectivity and superinfection resistance during retrovirus-mediated transduction of mammalian cells.

PubMed

Liao, J; Wei, Q; Fan, J; Zou, Y; Song, D; Liu, J; Liu, F; Ma, C; Hu, X; Li, L; Yu, Y; Qu, X; Chen, L; Yu, X; Zhang, Z; Zhao, C; Zeng, Z; Zhang, R; Yan, S; Wu, T; Wu, X; Shu, Y; Lei, J; Li, Y; Zhang, W; Wang, J; Reid, R R; Lee, M J; Huang, W; Wolf, J M; He, T-C; Wang, J

2017-06-01

Retroviral vectors including lentiviral vectors are commonly used tools to stably express transgenes or RNA molecules in mammalian cells. Their utilities are roughly divided into two categories, stable overexpression of transgenes and RNA molecules, which requires maximal transduction efficiency, or functional selection with retrovirus (RV)-based libraries, which takes advantage of retroviral superinfection resistance. However, the dynamic features of RV-mediated transduction are not well characterized. Here, we engineered two murine stem cell virus-based retroviral vectors expressing dual fluorescence proteins and antibiotic markers, and analyzed virion production efficiency and virion stability, dynamic infectivity and superinfection resistance in different cell types, and strategies to improve transduction efficiency. We found that the highest virion production occurred between 60 and 72 h after transfection. The stability of the collected virion supernatant decreased by >60% after 3 days in storage. We found that RV infectivity varied drastically in the tested human cancer lines, while low transduction efficiency was partially overcome with increased virus titer, prolonged infection duration and/or repeated infections. Furthermore, we demonstrated that RV receptors PIT1 and PIT2 were lowly expressed in the analyzed cells, and that PIT1 and/or PIT2 overexpression significantly improved transduction efficiency in certain cell lines. Thus, our findings provide resourceful information for the optimal conditions of retroviral-mediated gene delivery.

Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.

PubMed

Wei, Y; Wang, S; Wang, X

2014-01-01

Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

DNA modification and functional delivery into human cells using Escherichia coli DH10B

PubMed Central

Narayanan, Kumaran; Warburton, Peter E.

2003-01-01

The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ∼200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies. PMID:12711696

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

PubMed

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-03-06

Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

PubMed Central

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-01-01

Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.

PubMed

Kowarz, Eric; Löscher, Denise; Marschalek, Rolf

2015-04-01

Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents

PubMed Central

Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

2015-01-01

The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications. PMID:26670247

Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents.

PubMed

Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

2015-12-08

The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications.

Overexpression of the DNA mismatch repair factor, PMS2, confers hypermutability and DNA damage tolerance.

PubMed

Gibson, Shannon L; Narayanan, Latha; Hegan, Denise Campisi; Buermeyer, Andrew B; Liskay, R Michael; Glazer, Peter M

2006-12-08

Inherited defects in genes associated with DNA mismatch repair (MMR) have been linked to familial colorectal cancer. Cells deficient in MMR are genetically unstable and demonstrate a tolerance phenotype in response to certain classes of DNA damage. Some sporadic human cancers also show abnormalities in MMR gene function, typically due to diminished expression of one of the MutL homologs, MLH1. Here, we report that overexpression of the MutL homolog, human PMS2, can also cause a disruption of the MMR pathway in mammalian cells, resulting in hypermutability and DNA damage tolerance. A mouse fibroblast cell line carrying a recoverable lambda phage shuttle vector for mutation detection was transfected with either a vector designed to express hPMS2 or with an empty vector control. Cells overexpressing hPMS2 were found to have elevated spontaneous mutation frequencies at the cII reporter gene locus. They also showed an increase in the level of mutations induced by the alkylating agent, methynitrosourea (MNU). Clonogenic survival assays demonstrated increased survival of the PMS2-overexpressing cells following exposure to MNU, consistent with the induction of a damage tolerance phenotype. Similar results were seen in cells expressing a mutant PMS2 gene, containing a premature stop codon at position 134 and representing a variant found in an individual with familial colon cancer. These results show that dysregulation of PMS2 gene expression can disrupt MMR function in mammalian cells and establish an additional carcinogenic mechanism by which cells can develop genetic instability and acquire resistance to cytotoxic cancer therapies.

Expression of Anaplasma marginale ankyrin repeat-containing proteins during infection of the mammalian host and tick vector

USDA-ARS?s Scientific Manuscript database

Using searches of the NCBI conserved domain database and SMART genomic architecture analysis, we identified three ankyrin repeat-containing genes in Anaplasma marginale: AM705, AM926 and AM638. Recombinant protein was used to immunize mice and generate fusion hybridomas secreting protein-specific mo...

Genetically Engineered Poxviruses for Recombinant Gene Expression, Vaccination, and Safety

NASA Astrophysics Data System (ADS)

Moss, Bernard

1996-10-01

Vaccinia virus, no longer required for immunization against smallpox, now serves as a unique vector for expressing genes within the cytoplasm of mammalian cells. As a research tool, recombinant vaccinia viruses are used to synthesize and analyze the structure--function relationships of proteins, determine the targets of humoral and cell-mediated immunity, and investigate the types of immune response needed for protection against specific infectious diseases and cancer. The vaccine potential of recombinant vaccinia virus has been realized in the form of an effective oral wild-life rabies vaccine, although no product for humans has been licensed. A genetically altered vaccinia virus that is unable to replicate in mammalian cells and produces diminished cytopathic effects retains the capacity for high-level gene expression and immunogenicity while promising exceptional safety for laboratory workers and potential vaccine recipients.

The Use of Transcription Terminators to Generate Transgenic Lines of Chinese Hamster Ovary Cells (CHO) with Stable and High Level of Reporter Gene Expression.

PubMed

Gasanov, N B; Toshchakov, S V; Georgiev, P G; Maksimenko, O G

2015-01-01

Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production.

An efficient strategy for cell-based antibody library selection using an integrated vector system.

PubMed

Yoon, Hyerim; Song, Jin Myung; Ryu, Chun Jeih; Kim, Yeon-Gu; Lee, Eun Kyo; Kang, Sunghyun; Kim, Sang Jick

2012-09-18

Cell panning of phage-displayed antibody library is a powerful tool for the development of therapeutic and imaging agents since disease-related cell surface proteins in native complex conformation can be directly targeted. Here, we employed a strategy taking advantage of an integrated vector system which allows rapid conversion of scFv-displaying phage into scFv-Fc format for efficient cell-based scFv library selection on a tetraspanin protein, CD9. A mouse scFv library constructed by using a phagemid vector, pDR-D1 was subjected to cell panning against stable CD9 transfectant, and the scFv repertoire from the enriched phage pool was directly transferred to a mammalian cassette vector, pDR-OriP-Fc1. The resulting constructs enabled transient expression of enough amounts of scFv-Fcs in HEK293E cells, and flow cytometric screening of binders for CD9 transfectant could be performed simply by using the culture supernatants. All three clones selected from the screening showed correct CD9-specificity. They could immunoprecipitate CD9 molecules out of the transfectant cell lysate and correctly stain endogenous CD9 expression on cancer cell membrane. Furthermore, competition assay with a known anti-CD9 monoclonal antibody (mAb) suggested that the binding epitopes of some of them overlap with that of the mAb which resides within the large extracellular loop of CD9. This study demonstrates that scFv-Fc from mammalian transient expression can be chosen as a reliable format for rapid screening and validation in cell-based scFv library selection, and the strategy described here will be applicable to efficient discovery of antibodies to diverse cell-surface targets.

Characterization of recombinant Raccoonpox Vaccine Vectors in Chickens

USGS Publications Warehouse

Hwa, S.-H.; Iams, Keith P.; Hall, Jeffrey S.; Kingstad, B.A.; Osorio, Jorge E.

2010-01-01

Raccoonpox virus (RCN) has been used as a recombinant vector against several mammalian pathogens but has not been tested in birds. The replication of RCN in chick embryo fibroblasts (CEFs) and chickens was studied with the use of highly pathogenic avian influenza virus H5N1 hemagglutinin (HA) as a model antigen and luciferase (luc) as a reporter gene. Although RCN replicated to low levels in CEFs, it efficiently expressed recombinant proteins and, in vivo, elicited anti-HA immunoglobulin yolk (IgY) antibody responses comparable to inactivated influenza virus. Biophotonic in vivo imaging of 1-wk-old chicks with RCN-luc showed strong expression of the luc reporter gene lasting up to 3 days postinfection. These studies demonstrate the potential of RCN as a vaccine vector for avian influenza and other poultry pathogens. ?? American Association of Avian Pathologists 2010.

Insect cells as factories for biomanufacturing.

PubMed

Drugmand, Jean-Christophe; Schneider, Yves-Jacques; Agathos, Spiros N

2012-01-01

Insect cells (IC) and particularly lepidopteran cells are an attractive alternative to mammalian cells for biomanufacturing. Insect cell culture, coupled with the lytic expression capacity of baculovirus expression vector systems (BEVS), constitutes a powerful platform, IC-BEVS, for the abundant and versatile formation of heterologous gene products, including proteins, vaccines and vectors for gene therapy. Such products can be manufactured on a large scale thanks to the development of efficient and scaleable production processes involving the integration of a cell growth stage and a stage of cell infection with the recombinant baculovirus vector. Insect cells can produce multimeric proteins functionally equivalent to the natural ones and engineered vectors can be used for efficient expression. Insect cells can be cultivated easily in serum- and protein-free media. A growing number of companies are currently developing an interest in producing therapeutics using IC-BEVS, and many products are today in clinical trials and on the market for veterinary and human applications. This review summarizes current knowledge on insect cell metabolism, culture conditions and applications. Copyright © 2011 Elsevier Inc. All rights reserved.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Prion extraction methods: comparison of bead beating, ultrasonic disruption and repeated freeze-thaw methodologies for the recovery of functional renilla-prion fusion protein from bacteria

USDA-ARS?s Scientific Manuscript database

Molecular DNA technology allows for production of mammalian proteins in bacteria at sufficient quantities for downstream use and analysis. Variation in design and engineering of DNA expression vectors imparts selective alterations resulting in the generation of fusion proteins with intrinsic report...

The babesia bovis hap2 gene is not required for blood stage replication, but expressed upon in vitro sexual stage induction

USDA-ARS?s Scientific Manuscript database

Babesia bovis, is a tick borne apicomplexan parasite responsible for important cattle losses globally. Babesia parasites have a complex life cycle including asexual replication in the mammalian host and sexual reproduction in the tick vector. Novel control strategies aimed at limiting transmission o...

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Bordetella bronchiseptica exploits the complex life cycle of Dictyostelium discoideum as an amplifying transmission vector

PubMed Central

Linz, Bodo; Rivera, Israel; Ryman, Valerie E.; Dewan, Kalyan K.; Wagner, Shannon M.; Wilson, Emily F.; Hilburger, Lindsay J.; Cuff, Laura E.; West, Christopher M.; Harvill, Eric T.

2017-01-01

Multiple lines of evidence suggest that Bordetella species have a significant life stage outside of the mammalian respiratory tract that has yet to be defined. The Bordetella virulence gene (BvgAS) two-component system, a paradigm for a global virulence regulon, controls the expression of many “virulence factors” expressed in the Bvg positive (Bvg+) phase that are necessary for successful respiratory tract infection. A similarly large set of highly conserved genes are expressed under Bvg negative (Bvg-) phase growth conditions; however, these appear to be primarily expressed outside of the host and are thus hypothesized to be important in an undefined extrahost reservoir. Here, we show that Bvg- phase genes are involved in the ability of Bordetella bronchiseptica to grow and disseminate via the complex life cycle of the amoeba Dictyostelium discoideum. Unlike bacteria that serve as an amoeba food source, B. bronchiseptica evades amoeba predation, survives within the amoeba for extended periods of time, incorporates itself into the amoeba sori, and disseminates along with the amoeba. Remarkably, B. bronchiseptica continues to be transferred with the amoeba for months, through multiple life cycles of amoebae grown on the lawns of other bacteria, thus demonstrating a stable relationship that allows B. bronchiseptica to expand and disperse geographically via the D. discoideum life cycle. Furthermore, B. bronchiseptica within the sori can efficiently infect mice, indicating that amoebae may represent an environmental vector within which pathogenic bordetellae expand and disseminate to encounter new mammalian hosts. These data identify amoebae as potential environmental reservoirs as well as amplifying and disseminating vectors for B. bronchiseptica and reveal an important role for the Bvg- phase in these interactions. PMID:28403138

Novel approaches to models of Alzheimer's disease pathology for drug screening and development.

PubMed

Shaughnessy, Laura; Chamblin, Beth; McMahon, Lori; Nair, Ayyappan; Thomas, Mary Beth; Wakefield, John; Koentgen, Frank; Ramabhadran, Ram

2004-01-01

Development of therapeutics for Alzheimer's disease (AD) requires appropriate cell culture models that reflect the errant biochemical pathways and animal models that reflect the pathological hallmarks of the disease as well as the clinical manifestations. In the past two decades AD research has benefited significantly from the use of genetically engineered cell lines expressing components of the amyloid-generating pathway, as well as from the study of transgenic mice that develop the pathological hallmarks of the disease, mainly neuritic plaques. The choice of certain cell types and the choice of mouse as the model organism have been mandated by the feasibility of introduction and expression of foreign genes into these model systems. We describe a universal and efficient gene-delivery system, using lentiviral vectors, that permits the development of relevant cell biological systems using neuronal cells, including primary neurons and animal models in mammalian species best suited for the study of AD. In addition, lentiviral gene delivery provides avenues for creation of novel models by direct and prolonged expression of genes in the brain in any vertebrate animal. TranzVector is a lentiviral vector optimized for efficiency and safety that delivers genes to cells in culture, in tissue explants, and in live animals regardless of the dividing or differentiated status of the cells. Genes can also be delivered efficiently to fertilized single-cell-stage embryos of a wide range of mammalian species, broadening the range of the model organism (from rats to nonhuman primates) for the study of disease mechanism as well as for development of therapeutics. Copyright 2004 Humana Press Inc.

A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

PubMed Central

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

PubMed

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

Screening and large-scale expression of membrane proteins in mammalian cells for structural studies

PubMed Central

Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H.; Michel, Jennifer Carlisle; Claxton, Derek P.; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K. Christopher; Gouaux, Eric

2014-01-01

Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in over-expression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol we show how to use small-scale transient transfection and fluorescence-detection, size-exclusion chromatography (FSEC) experiments using a GFP-His8 tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI− (N-acetylglucosaminyltransferase I-negative) cells in suspension culture, and over-express the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl), for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks. PMID:25299155

Expression from cloned DNA of biologically active glycoprotein C of herpes simplex virus type 1 in mammalian cells.

PubMed

Ghosh-Choudhury, N; Butcher, M; Ghosh, H P

1990-03-01

A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.

Cloning and Characterization of a Cell Senescence Gene for Breast Cancer Cells

DTIC Science & Technology

2004-07-01

have already established the inducible expression system in a retroviral vector for these studies. F. References 1. Hayflick , L. (1965). The limited ...CLASSIFICATION 18. SECURITY CLASSIFICATION 19. SECURITY CLASSIFICATION 20. LIMITATION OF ABSTRACT OF REPORT OF THIS PAGE OFABSTRACT Unclassified...13-14 Annual report A. Introduction Normal diploid mammalian cells display a limited proliferative life span in culture (1-3

Development of Defective and Persistent Sendai Virus Vector

PubMed Central

Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

2011-01-01

The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

TelAP1 links telomere complexes with developmental expression site silencing in African trypanosomes

PubMed Central

Reis, Helena; Schwebs, Marie; Dietz, Sabrina; Janzen, Christian J; Butter, Falk

2018-01-01

Abstract During its life cycle, Trypanosoma brucei shuttles between a mammalian host and the tsetse fly vector. In the mammalian host, immune evasion of T. brucei bloodstream form (BSF) cells relies on antigenic variation, which includes monoallelic expression and periodic switching of variant surface glycoprotein (VSG) genes. The active VSG is transcribed from only 1 of the 15 subtelomeric expression sites (ESs). During differentiation from BSF to the insect-resident procyclic form (PCF), the active ES is transcriptionally silenced. We used mass spectrometry-based interactomics to determine the composition of telomere protein complexes in T. brucei BSF and PCF stages to learn more about the structure and functions of telomeres in trypanosomes. Our data suggest a different telomere complex composition in the two forms of the parasite. One of the novel telomere-associated proteins, TelAP1, forms a complex with telomeric proteins TbTRF, TbRAP1 and TbTIF2 and influences ES silencing kinetics during developmental differentiation. PMID:29385523

[Expression of Dengue virus type 2 nonstructural protein 3 and isolation of host proteins interacting with it].

PubMed

Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen

2015-12-01

To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.

A quick and efficient method to generate mammalian stable cell lines based on a novel inducible alphavirus DNA/RNA layered system.

PubMed

Aranda, Alejandro; Bezunartea, Jaione; Casales, Erkuden; Rodriguez-Madoz, Juan R; Larrea, Esther; Prieto, Jesus; Smerdou, Cristian

2014-12-01

We report a new method to generate high-expressing mammalian cell lines in a quick and efficient way. For that purpose, we developed a master cell line (MCL) containing an inducible alphavirus vector expressing GFP integrated into the genome. In the MCL, recombinant RNA levels increased >4,600-fold after induction, due to a doxycycline-dependent RNA amplification loop. The MCL maintained inducibility and expression during 50 passages, being more efficient for protein expression than a conventional cell line. To generate new cell lines, mutant LoxP sites were inserted into the MCL, allowing transgene and selection gene exchange by Cre-directed recombination, leading to quick generation of inducible cell lines expressing proteins of therapeutic interest, like human cardiotrophin-1 and oncostatin-M at several mg/l/24 h. These proteins contained posttranslational modifications, showed bioactivity, and were efficiently purified. Remarkably, this system allowed production of toxic proteins, like oncostatin-M, since cells able to express it could be grown to the desired amount before induction. These cell lines were easily adapted to growth in suspension, making this methodology very attractive for therapeutic protein production.

Screening and large-scale expression of membrane proteins in mammalian cells for structural studies.

PubMed

Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H; Michel, Jennifer Carlisle; Claxton, Derek P; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K Christopher; Gouaux, Eric

2014-11-01

Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in overexpression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol, we show how to use small-scale transient transfection and fluorescence-detection size-exclusion chromatography (FSEC) experiments using a GFP-His8-tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI(-) (N-acetylglucosaminyltransferase I-negative) cells in suspension culture and overexpress the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl) for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks.

[Transient expression and characterization of intracellular single chain Fv against the nucleocapsid protein of Hantavirus].

PubMed

Bai, Wen-tao; Xu, Zhi-kai; Zhang, Fang-lin; Luo, Wen; Liu, Yong; Wu, Xing-an; Yan, Yan

2004-11-01

To transiently express an intracellular single chain Fv of monoclonal antibody 1A8 against nucleocapsid protein of Hantavirus and characterize the immunological activities of the expressed products. COS-7 cells were transfected with mammalian expression vector 1A8-scFv-Ckappa/pCI-neo via lipofectin. The expressed product was identified by indirect immunofluorescence and immunoprecipitation. A diffuse pattern fluorescence was observed in less than 1% cytoplasm of transfected COS-7 cells. The binding of intracellular antibody fragments to NP antigen was confirmed by immunoprecipitation analysis. Transiently expressed single chain intrabodies can effectively target NP antigen in the cytoplasm. The present study may provide a new approach for treatment of Hantavirus.

Polycation-induced Cell Membrane Permeability Does Not Enhance Cellular Uptake or Expression Efficiency of Delivered DNA

PubMed Central

Prevette, Lisa E.; Mullen, Douglas G.; Banaszak Holl, Mark M.

2010-01-01

Polycationic materials commonly used to delivery DNA to cells are known to induce cell membrane porosity in a charge-density dependent manner. It has been suggested that these pores may provide a mode of entry of the polymer-DNA complexes (polyplexes) into cells. To examine the correlation between membrane permeability and biological activity, we used two-color flow cytometry on two mammalian cell lines to simultaneously measure gene expression of a plasmid DNA delivered with four common nonviral vectors and cellular uptake of normally excluded fluorescent dye molecules of two different sizes, 668 Da and 2 MDa. We also followed gene expression in cells sorted based on the retention of endogenous fluorescein. We have found that cell membrane porosity caused by polycationic vectors does not enhance internalization or gene expression. Based on this single-cell study, membrane permeability is found to be an unwanted side effect that limits transfection efficiency, possibly through leakage of the delivered nucleic acid through the pores prior to transcription and translation and/or activation of cell defense mechanisms that restrict transgene expression. PMID:20349965

Proteomic Characterization of Yersinia pestis Virulence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chromy, B; Murphy, G; Gonzales, A

2005-01-05

Yersinia pestis, the etiological agent of plague, functions via the Type III secretion mechanism whereby virulence factors are induced upon interactions with a mammalian host. Here, the Y. pestis proteome was studied by two-dimensional differential gel electrophoresis (2-D DIGE) under physiologically relevant growth conditions mimicking the calcium concentrations and temperatures that the pathogen would encounter in the flea vector and upon interaction with the mammalian host. Over 4100 individual protein spots were detected of which hundreds were differentially expressed in the entire comparative experiment. A total of 43 proteins that were differentially expressed between the vector and host growth conditionsmore » were identified by mass spectrometry. Expected differences in expression were observed for several known virulence factors including catalase-peroxidase (KatY), murine toxin (Ymt), plasminogen activator (Pla), and F1 capsule antigen (Caf1), as well as putative virulence factors. Chaperone proteins and signaling molecules hypothesized to be involved in virulence due to their role in Type III secretion were also identified. Other differentially expressed proteins not previously reported to contribute to virulence are candidates for more detailed mechanistic studies, representing potential new virulence determinants. For example, several sugar metabolism proteins were differentially regulated in response to lower calcium and higher temperature, suggesting these proteins, while not directly connected to virulence, either represent a metabolic switch for survival in the host environment or may facilitate production of virulence factors. Results presented here contribute to a more thorough understanding of the virulence mechanism of Y. pestis through proteomic characterization of the pathogen under induced virulence.« less

Safe and stable noninvasive focal gene delivery to the mammalian brain following focused ultrasound.

PubMed

Stavarache, Mihaela A; Petersen, Nicholas; Jurgens, Eric M; Milstein, Elizabeth R; Rosenfeld, Zachary B; Ballon, Douglas J; Kaplitt, Michael G

2018-04-27

OBJECTIVE Surgical infusion of gene therapy vectors has provided opportunities for biological manipulation of specific brain circuits in both animal models and human patients. Transient focal opening of the blood-brain barrier (BBB) by MR-guided focused ultrasound (MRgFUS) raises the possibility of noninvasive CNS gene therapy to target precise brain regions. However, variable efficiency and short follow-up of studies to date, along with recent suggestions of the potential for immune reactions following MRgFUS BBB disruption, all raise questions regarding the viability of this approach for clinical translation. The objective of the current study was to evaluate the efficiency, safety, and long-term stability of MRgFUS-mediated noninvasive gene therapy in the mammalian brain. METHODS Focused ultrasound under the control of MRI, in combination with microbubbles consisting of albumin-coated gas microspheres, was applied to rat striatum, followed by intravenous infusion of an adeno-associated virus serotype 1/2 (AAV1/2) vector expressing green fluorescent protein (GFP) as a marker. Following recovery, animals were followed from several hours up to 15 months. Immunostaining for GFP quantified transduction efficiency and stability of expression. Quantification of neuronal markers was used to determine histological safety over time, while inflammatory markers were examined for evidence of immune responses. RESULTS Transitory disruption of the BBB by MRgFUS resulted in efficient delivery of the AAV1/2 vector to the targeted rodent striatum, with 50%-75% of striatal neurons transduced on average. GFP transgene expression appeared to be stable over extended periods of time, from 2 weeks to 6 months, with evidence of ongoing stable expression as long as 16 months in a smaller cohort of animals. No evidence of substantial toxicity, tissue injury, or neuronal loss was observed. While transient inflammation from BBB disruption alone was noted for the first few days, consistent with prior observations, no evidence of brain inflammation was observed from 2 weeks to 6 months following MRgFUS BBB opening, despite delivery of a virus and expression of a foreign protein in target neurons. CONCLUSIONS This study demonstrates that transitory BBB disruption using MRgFUS can be a safe and efficient method for site-specific delivery of viral vectors to the brain, raising the potential for noninvasive focal human gene therapy for neurological disorders.

Does the arthropod microbiota impact the establishment of vector-borne diseases in mammalian hosts?

PubMed

Finney, Constance A M; Kamhawi, Shaden; Wasmuth, James D

2015-04-01

The impact of the microbiota on the immune status of its host is a source of intense research and publicity. In comparison, the effect of arthropod microbiota on vector-borne infectious diseases has received little attention. A better understanding of the vector microbiota in relation to mammalian host immune responses is vital, as it can lead to strategies that affect transmission and improve vaccine design in a field of research where few vaccines exist and effective treatment is rare. Recent demonstrations of how microbiota decrease pathogen development in arthropods, and thus alter vector permissiveness to vector-borne diseases (VBDs), have led to renewed interest. However, hypotheses on the interactions between the arthropod-derived microbiota and the mammalian hosts have yet to be addressed. Advances in DNA sequencing technology, increased yield and falling costs, mean that these studies are now feasible for many microbiologists and entomologists. Here, we distill current knowledge and put forward key questions and experimental designs to shed light on this burgeoning research topic.

Does the Arthropod Microbiota Impact the Establishment of Vector-Borne Diseases in Mammalian Hosts?

PubMed Central

Finney, Constance A. M.; Kamhawi, Shaden; Wasmuth, James D.

2015-01-01

The impact of the microbiota on the immune status of its host is a source of intense research and publicity. In comparison, the effect of arthropod microbiota on vector-borne infectious diseases has received little attention. A better understanding of the vector microbiota in relation to mammalian host immune responses is vital, as it can lead to strategies that affect transmission and improve vaccine design in a field of research where few vaccines exist and effective treatment is rare. Recent demonstrations of how microbiota decrease pathogen development in arthropods, and thus alter vector permissiveness to vector-borne diseases (VBDs), have led to renewed interest. However, hypotheses on the interactions between the arthropod-derived microbiota and the mammalian hosts have yet to be addressed. Advances in DNA sequencing technology, increased yield and falling costs, mean that these studies are now feasible for many microbiologists and entomologists. Here, we distill current knowledge and put forward key questions and experimental designs to shed light on this burgeoning research topic. PMID:25856431

A versatile modular vector system for rapid combinatorial mammalian genetics.

PubMed

Albers, Joachim; Danzer, Claudia; Rechsteiner, Markus; Lehmann, Holger; Brandt, Laura P; Hejhal, Tomas; Catalano, Antonella; Busenhart, Philipp; Gonçalves, Ana Filipa; Brandt, Simone; Bode, Peter K; Bode-Lesniewska, Beata; Wild, Peter J; Frew, Ian J

2015-04-01

Here, we describe the multiple lentiviral expression (MuLE) system that allows multiple genetic alterations to be introduced simultaneously into mammalian cells. We created a toolbox of MuLE vectors that constitute a flexible, modular system for the rapid engineering of complex polycistronic lentiviruses, allowing combinatorial gene overexpression, gene knockdown, Cre-mediated gene deletion, or CRISPR/Cas9-mediated (where CRISPR indicates clustered regularly interspaced short palindromic repeats) gene mutation, together with expression of fluorescent or enzymatic reporters for cellular assays and animal imaging. Examples of tumor engineering were used to illustrate the speed and versatility of performing combinatorial genetics using the MuLE system. By transducing cultured primary mouse cells with single MuLE lentiviruses, we engineered tumors containing up to 5 different genetic alterations, identified genetic dependencies of molecularly defined tumors, conducted genetic interaction screens, and induced the simultaneous CRISPR/Cas9-mediated knockout of 3 tumor-suppressor genes. Intramuscular injection of MuLE viruses expressing oncogenic H-RasG12V together with combinations of knockdowns of the tumor suppressors cyclin-dependent kinase inhibitor 2A (Cdkn2a), transformation-related protein 53 (Trp53), and phosphatase and tensin homolog (Pten) allowed the generation of 3 murine sarcoma models, demonstrating that genetically defined autochthonous tumors can be rapidly generated and quantitatively monitored via direct injection of polycistronic MuLE lentiviruses into mouse tissues. Together, our results demonstrate that the MuLE system provides genetic power for the systematic investigation of the molecular mechanisms that underlie human diseases.

pLR: a lentiviral backbone series to stable transduction of bicistronic genes and exchange of promoters.

PubMed

Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés

2012-11-01

Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.

Rapid production of functionalized recombinant proteins: marrying ligation independent cloning and in vitro protein ligation.

PubMed

Kushnir, Susanna; Marsac, Yoann; Breitling, Reinhard; Granovsky, Igor; Brok-Volchanskaya, Vera; Goody, Roger S; Becker, Christian F W; Alexandrov, Kirill

2006-01-01

Functional genomics and proteomics have been very active fields since the sequencing of several genomes was completed. To assign a physiological role to the newly discovered coding genes with unknown function, new generic methods for protein production, purification, and targeted functionalization are needed. This work presents a new vector, pCYSLIC, that allows rapid generation of Escherichia coli expression constructs via ligation-independent cloning (LIC). The vector is designed to facilitate protein purification by either Ni-NTA or GSH affinity chromatography. Subsequent proteolytic removal of affinity tags liberates an N-terminal cysteine residue that is then used for covalent modification of the target protein with different biophysical probes via protein ligation. The described system has been tested on 36 mammalian Rab GTPases, and it was demonstrated that recombinant GTPases produced with pCYSLIC could be efficiently modified with fluorescein or biotin in vitro. Finally, LIC was compared with the recently developed In-Fusion cloning method, and it was demonstrated that In-Fusion provides superior flexibility in choice of expression vector. By the application of In-Fusion cloning Cys-Rab6A GTPase with an N-terminal cysteine residue was generated employing unmodified pET30a vector and TVMV protease.

Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

PubMed Central

Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

2011-01-01

Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

Two Distinct Mechanisms Govern RpoS-Mediated Repression of Tick-Phase Genes during Mammalian Host Adaptation by Borrelia burgdorferi, the Lyme Disease Spirochete.

PubMed

Grove, Arianna P; Liveris, Dionysios; Iyer, Radha; Petzke, Mary; Rudman, Joseph; Caimano, Melissa J; Radolf, Justin D; Schwartz, Ira

2017-08-22

The alternative sigma factor RpoS plays a key role modulating gene expression in Borrelia burgdorferi , the Lyme disease spirochete, by transcribing mammalian host-phase genes and repressing σ 70 -dependent genes required within the arthropod vector. To identify cis regulatory elements involved in RpoS-dependent repression, we analyzed green fluorescent protein (GFP) transcriptional reporters containing portions of the upstream regions of the prototypical tick-phase genes ospAB , the glp operon, and bba74 As RpoS-mediated repression occurs only following mammalian host adaptation, strains containing the reporters were grown in dialysis membrane chambers (DMCs) implanted into the peritoneal cavities of rats. Wild-type spirochetes harboring ospAB - and glp-gfp constructs containing only the minimal (-35/-10) σ 70 promoter elements had significantly lower expression in DMCs relative to growth in vitro at 37°C; no reduction in expression occurred in a DMC-cultivated RpoS mutant harboring these constructs. In contrast, RpoS-mediated repression of bba74 required a stretch of DNA located between -165 and -82 relative to its transcriptional start site. Electrophoretic mobility shift assays employing extracts of DMC-cultivated B. burgdorferi produced a gel shift, whereas extracts from RpoS mutant spirochetes did not. Collectively, these data demonstrate that RpoS-mediated repression of tick-phase borrelial genes occurs by at least two distinct mechanisms. One (e.g., ospAB and the glp operon) involves primarily sequence elements near the core promoter, while the other (e.g., bba74 ) involves an RpoS-induced transacting repressor. Our results provide a genetic framework for further dissection of the essential "gatekeeper" role of RpoS throughout the B. burgdorferi enzootic cycle. IMPORTANCE Borrelia burgdorferi , the Lyme disease spirochete, modulates gene expression to adapt to the distinctive environments of its mammalian host and arthropod vector during its enzootic cycle. The alternative sigma factor RpoS has been referred to as a "gatekeeper" due to its central role in regulating the reciprocal expression of mammalian host- and tick-phase genes. While RpoS-dependent transcription has been studied extensively, little is known regarding the mechanism(s) of RpoS-mediated repression. We employed a combination of green fluorescent protein transcriptional reporters along with an in vivo model to define cis regulatory sequences responsible for RpoS-mediated repression of prototypical tick-phase genes. Repression of ospAB and the glp operon requires only sequences near their core promoters, whereas modulation of bba74 expression involves a putative RpoS-dependent repressor that binds upstream of the core promoter. Thus, Lyme disease spirochetes employ at least two different RpoS-dependent mechanisms to repress tick-phase genes within the mammal. Copyright © 2017 Grove et al.

Approaches to utilize mesenchymal progenitor cells as cellular vehicles.

PubMed

Pereboeva, L; Komarova, S; Mikheeva, G; Krasnykh, V; Curiel, D T

2003-01-01

Mammalian cells represent a novel vector approach for gene delivery that overcomes major drawbacks of viral and nonviral vectors and couples cell therapy with gene delivery. A variety of cell types have been tested in this regard, confirming that the ideal cellular vector system for ex vivo gene therapy has to comply with stringent criteria and is yet to be found. Several properties of mesenchymal progenitor cells (MPCs), such as easy access and simple isolation and propagation procedures, make these cells attractive candidates as cellular vehicles. In the current work, we evaluated the potential utility of MPCs as cellular vectors with the intent to use them in the cancer therapy context. When conventional adenoviral (Ad) vectors were used for MPC transduction, the highest transduction efficiency of MPCs was 40%. We demonstrated that Ad primary-binding receptors were poorly expressed on MPCs, while the secondary Ad receptors and integrins presented in sufficient amounts. By employing Ad vectors with incorporated integrin-binding motifs (Ad5lucRGD), MPC transduction was augmented tenfold, achieving efficient genetic loading of MPCs with reporter and anticancer genes. MPCs expressing thymidine kinase were able to exert a bystander killing effect on the cancer cell line SKOV3ip1 in vitro. In addition, we found that MPCs were able to support Ad replication, and thus can be used as cell vectors to deliver oncolytic viruses. Our results show that MPCs can foster expression of suicide genes or support replication of adenoviruses as potential anticancer therapeutic payloads. These findings are consistent with the concept that MPCs possess key properties that ensure their employment as cellular vehicles and can be used to deliver either therapeutic genes or viruses to tumor sites.

Mutagenesis of diploid mammalian genes by gene entrapment

PubMed Central

Lin, Qing; Donahue, Sarah L.; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B.; Ruley, H. Earl

2006-01-01

The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector–cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 × 10−5 to 1.2 × 10−4 per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells. PMID:17062627

Isolation of tumor antigen-specific single-chain variable fragments using a chimeric antigen receptor bicistronic retroviral vector in a Mammalian screening protocol.

PubMed

Lipowska-Bhalla, Grazyna; Gilham, David E; Hawkins, Robert E; Rothwell, Dominic G

2013-12-01

The clinical potential of chimeric antigen receptors in adoptive cellular therapy is beginning to be realized with several recent clinical trials targeting CD19 showing promising results in advanced B cell malignancies. This increased efficacy corresponds with improved engineering of the chimeric receptors with the latest-generation receptors eliciting greater signaling and proliferation potential. However, the antigen-binding single-chain variable fragment (scFv) domain of the receptors is critical in determining the activity of the chimeric receptor-expressing T cells, as this determines specificity and affinity to the tumor antigen. In this study, we describe a mammalian T cell line screening protocol employing a 2A-based bicistronic retroviral vector to isolate functional scFvs. This approach involves expression of the scFv library in a chimeric antigen receptor, and is based on selection of clones capable of stimulating CD69 upregulation in a T cell line and has a number of advantages over previously described methods in that the use of a 2A cassette ensures the exclusion of nonexpressing scFvs and the screening using a chimeric receptor in a mammalian T cell line ensures selection in the optimum context for therapeutic use. Proof-of-principle experiments show that the protocol was capable of a 10(5)-fold enrichment of positive clones after three rounds of selection. Furthermore, an antigen-specific clone was successfully isolated from a partially enriched scFv library, confirming the strength of the protocol. This approach has the potential to identify novel scFvs of use in adoptive T cell therapy and, potentially, wider antibody-based applications.

A platform for rapid prototyping of synthetic gene networks in mammalian cells

PubMed Central

Duportet, Xavier; Wroblewska, Liliana; Guye, Patrick; Li, Yinqing; Eyquem, Justin; Rieders, Julianne; Rimchala, Tharathorn; Batt, Gregory; Weiss, Ron

2014-01-01

Mammalian synthetic biology may provide novel therapeutic strategies, help decipher new paths for drug discovery and facilitate synthesis of valuable molecules. Yet, our capacity to genetically program cells is currently hampered by the lack of efficient approaches to streamline the design, construction and screening of synthetic gene networks. To address this problem, here we present a framework for modular and combinatorial assembly of functional (multi)gene expression vectors and their efficient and specific targeted integration into a well-defined chromosomal context in mammalian cells. We demonstrate the potential of this framework by assembling and integrating different functional mammalian regulatory networks including the largest gene circuit built and chromosomally integrated to date (6 transcription units, 27kb) encoding an inducible memory device. Using a library of 18 different circuits as a proof of concept, we also demonstrate that our method enables one-pot/single-flask chromosomal integration and screening of circuit libraries. This rapid and powerful prototyping platform is well suited for comparative studies of genetic regulatory elements, genes and multi-gene circuits as well as facile development of libraries of isogenic engineered cell lines. PMID:25378321

The tripartite leader sequence is required for ectopic expression of HAdV-B and HAdV-E E3 CR1 genes.

PubMed

Bair, Camden R; Kotha Lakshmi Narayan, Poornima; Kajon, Adriana E

2017-05-01

The unique repertoire of genes that characterizes the early region 3 (E3) of the different species of human adenovirus (HAdV) likely contributes to their distinct pathogenic traits. The function of many E3 CR1 proteins remains unknown possibly due to unidentified intrinsic properties that make them difficult to express ectopically. This study shows that the species HAdV-B- and HAdV-E-specific E3 CR1 genes can be expressed from vectors carrying the HAdV tripartite leader (TPL) sequence but not from traditional mammalian expression vectors. Insertion of the TPL sequence upstream of the HAdV-B and HAdV-E E3 CR1 open reading frames was sufficient to rescue protein expression from pCI-neo constructs in transfected 293T cells. The detection of higher levels of HAdV-B and HAdV-E E3 CR1 transcripts suggests that the TPL sequence may enhance gene expression at both the transcriptional and translational levels. Our findings will facilitate the characterization of additional AdV E3 proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

Gene transfer and gene mapping in mammalian cells in culture.

PubMed

Shows, T B; Sakaguchi, A Y

1980-01-01

The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.

Independent and interactive effect of plant- and mammalian- based odors on the response of the malaria vector, Anopheles gambiae.

PubMed

Jacob, Juliah W; Tchouassi, David P; Lagat, Zipporah O; Mathenge, Evan M; Mweresa, Collins K; Torto, Baldwyn

2018-04-27

Several studies have shown that odors of plant and animal origin can be developed into lures for use in surveillance of mosquito vectors of infectious diseases. However, the effect of combining plant- and mammalian-derived odors into an improved lure for monitoring both nectar- and blood-seeking mosquito populations in traps is yet to be explored. Here we used both laboratory dual choice olfactometer and field assays to investigate responses of the malaria vector, Anopheles gambiae, to plant- and mammalian-derived compounds and a combined blend derived from these two odor sources. Using subtractive bioassays in dual choice olfactometer we show that a 3-component terpenoid plant-derived blend comprising (E)-linalool oxide, β-pinene, β-ocimene was more attractive to females of An. gambiae than (E)-linalool oxide only (previously found attractive in field trials) and addition of limonene to this blend antagonized its attractiveness. Likewise, a mammalian-derived lure comprising the aldehydes heptanal, octanal, nonanal and decanal, was more preferred than (E)-linalool oxide. Surprisingly, combining the plant-derived 3-component blend with the mammalian derived 4-component blend attracted fewer females of An. gambiae than the individual blends in laboratory assays. However, this pattern was not replicated in field trials, where we observed a dose-dependent effect on trap catches while combining both blends with significantly improved trap catches at higher doses. The observed dose-dependent attractiveness for An. gambiae has practical implication in the design of vector control strategies involving kairomones from plant- and mammalian-based sources. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

PubMed

Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

2014-03-01

Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

Insulated piggyBac vectors for insect transgenesis

PubMed Central

Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J

2006-01-01

Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846

Safety and immunogenicity of mammalian cell derived and Modified Vaccinia Ankara vectored African swine fever subunit antigens in swine.

PubMed

Lopera-Madrid, Jaime; Osorio, Jorge E; He, Yongqun; Xiang, Zuoshuang; Adams, L Garry; Laughlin, Richard C; Mwangi, Waithaka; Subramanya, Sandesh; Neilan, John; Brake, David; Burrage, Thomas G; Brown, William Clay; Clavijo, Alfonso; Bounpheng, Mangkey A

2017-03-01

A reverse vaccinology system, Vaxign, was used to identify and select a subset of five African Swine Fever (ASF) antigens that were successfully purified from human embryonic kidney 293 (HEK) cells and produced in Modified vaccinia virus Ankara (MVA) viral vectors. Three HEK-purified antigens [B646L (p72), E183L (p54), and O61R (p12)], and three MVA-vectored antigens [B646L, EP153R, and EP402R (CD2v)] were evaluated using a prime-boost immunization regimen swine safety and immunogenicity study. Antibody responses were detected in pigs following prime-boost immunization four weeks apart with the HEK-293-purified p72, p54, and p12 antigens. Notably, sera from the vaccinees were positive by immunofluorescence on ASFV (Georgia 2007/1)-infected primary macrophages. Although MVA-vectored p72, CD2v, and EP153R failed to induce antibody responses, interferon-gamma (IFN-γ + ) spot forming cell responses against all three antigens were detected one week post-boost. The highest IFN-γ + spot forming cell responses were detected against p72 in pigs primed with MVA-p72 and boosted with the recombinant p72. Antigen-specific (p12, p72, CD2v, and EP153R) T-cell proliferative responses were also detected post-boost. Collectively, these results are the first demonstration that ASFV subunit antigens purified from mammalian cells or expressed in MVA vectors are safe and can induce ASFV-specific antibody and T-cell responses following a prime-boost immunization regimen in swine. Copyright © 2017 Elsevier B.V. All rights reserved.

Magnetic nanoparticles for efficient cell transduction with Semliki Forest virus.

PubMed

Kurena, Baiba; Vežāne, Aleksandra; Skrastiņa, Dace; Trofimova, Olga; Zajakina, Anna

2017-07-01

Semliki Forest virus (SFV) is a potential cancer gene therapy vector capable of providing high and transient expression of heterologous proteins in mammalian cells. However, SFV has shown suboptimal transduction levels in several cancer cell types as well as wide biodistribution of SFV has been observed after in vivo applications. Magnetic nanoparticles (MNPs) have been shown to increase cell transduction with several viral vectors in vitro under an external magnetic field and enhance magnetically guided viral vector delivery. Here, we examined a panel of MNPs for enhanced cancer cell transduction with SFV vector. Magneto-transduction using positively charged MNPs increased Semliki Forest virus transduction in TS/A mouse mammary carcinoma cells in vitro in the presence of fetal bovine serum. Positively charged MNPs efficiently captured SFV particles independently of capturing medium, and MNPs-SFV complexes were successfully separated from suspension by magnetic precipitation. These results reveal the potential application of MNPs for enhanced gene delivery by SFV vector as well as proposes magnetic precipitation for efficient concentration of SFV particles from different media. Copyright © 2017 Elsevier B.V. All rights reserved.

A fusion-protein approach enabling mammalian cell production of tumor targeting protein domains for therapeutic development.

PubMed

Hu, Jia; Chen, Xiang; Zhang, Xuhua; Yuan, Xiaopeng; Yang, Mingjuan; Dai, Hui; Yang, Wei; Zhou, Qinghua; Wen, Weihong; Wang, Qirui; Qin, Weijun; Zhao, Aizhi

2018-05-01

A single chain Fv fragment (scFv) is a fusion of the variable regions of heavy (V H ) and light (V L ) chains of immunoglobulins. They are important elements of chimeric antigen receptors for cancer therapy. We sought to produce a panel of 16 extracellular protein domains of tumor markers for use in scFv yeast library screenings. A series of vectors comprising various combinations of expression elements was made, but expression was unpredictable and more than half of the protein domains could not be produced using any of the constructs. Here we describe a novel fusion expression system based on mouse TEM7 (tumor endothelial marker 7), which could facilitate protein expression. With this approach we could produce all but one of the tumor marker domains that could not otherwise be expressed. In addition, we demonstrated that the tumor associated antigen hFZD10 produced as a fusion protein with mTEM7 could be used to enrich scFv antibodies from a yeast display library. Collectively our study demonstrates the potential of specific fusion proteins based on mTEM7 in enabling mammalian cell production of tumor targeting protein domains for therapeutic development. © 2018 The Protein Society.

A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

PubMed

Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

2016-05-01

Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Baculovirus vectors expressing F proteins in combination with virus-induced signaling adaptor (VISA) molecules confer protection against respiratory syncytial virus infection.

PubMed

Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu

2016-01-04

Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Mammalian Synthetic Biology: Time for Big MACs.

PubMed

Martella, Andrea; Pollard, Steven M; Dai, Junbiao; Cai, Yizhi

2016-10-21

The enabling technologies of synthetic biology are opening up new opportunities for engineering and enhancement of mammalian cells. This will stimulate diverse applications in many life science sectors such as regenerative medicine, development of biosensing cell lines, therapeutic protein production, and generation of new synthetic genetic regulatory circuits. Harnessing the full potential of these new engineering-based approaches requires the design and assembly of large DNA constructs-potentially up to chromosome scale-and the effective delivery of these large DNA payloads to the host cell. Random integration of large transgenes, encoding therapeutic proteins or genetic circuits into host chromosomes, has several drawbacks such as risks of insertional mutagenesis, lack of control over transgene copy-number and position-specific effects; these can compromise the intended functioning of genetic circuits. The development of a system orthogonal to the endogenous genome is therefore beneficial. Mammalian artificial chromosomes (MACs) are functional, add-on chromosomal elements, which behave as normal chromosomes-being replicating and portioned to daughter cells at each cell division. They are deployed as useful gene expression vectors as they remain independent from the host genome. MACs are maintained as a single-copy and can accommodate multiple gene expression cassettes of, in theory, unlimited DNA size (MACs up to 10 megabases have been constructed). MACs therefore enabled control over ectopic gene expression and represent an excellent platform to rapidly prototype and characterize novel synthetic gene circuits without recourse to engineering the host genome. This review describes the obstacles synthetic biologists face when working with mammalian systems and how the development of improved MACs can overcome these-particularly given the spectacular advances in DNA synthesis and assembly that are fuelling this research area.

YAP/TAZ enhance mammalian embryonic neural stem cell characteristics in a Tead-dependent manner

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Dasol; Byun, Sung-Hyun; Park, Soojeong

Mammalian brain development is regulated by multiple signaling pathways controlling cell proliferation, migration and differentiation. Here we show that YAP/TAZ enhance embryonic neural stem cell characteristics in a cell autonomous fashion using diverse experimental approaches. Introduction of retroviral vectors expressing YAP or TAZ into the mouse embryonic brain induced cell localization in the ventricular zone (VZ), which is the embryonic neural stem cell niche. This change in cell distribution in the cortical layer is due to the increased stemness of infected cells; YAP-expressing cells were colabeled with Sox2, a neural stem cell marker, and YAP/TAZ increased the frequency and sizemore » of neurospheres, indicating enhanced self-renewal- and proliferative ability of neural stem cells. These effects appear to be TEA domain family transcription factor (Tead)–dependent; a Tead binding-defective YAP mutant lost the ability to promote neural stem cell characteristics. Consistently, in utero gene transfer of a constitutively active form of Tead2 (Tead2-VP16) recapitulated all the features of YAP/TAZ overexpression, and dominant negative Tead2-EnR resulted in marked cell exit from the VZ toward outer cortical layers. Taken together, these results indicate that the Tead-dependent YAP/TAZ signaling pathway plays important roles in neural stem cell maintenance by enhancing stemness of neural stem cells during mammalian brain development. - Highlights: • Roles of YAP and Tead in vivo during mammalian brain development are clarified. • Expression of YAP promotes embryonic neural stem cell characteristics in vivo in a cell autonomous fashion. • Enhancement of neural stem cell characteristics by YAP depends on Tead. • Transcriptionally active form of Tead alone can recapitulate the effects of YAP. • Transcriptionally repressive form of Tead severely reduces stem cell characteristics.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubo, Yoshinao; Yoshii, Hiroaki; Kamiyama, Haruka

Ezrin, radixin, and moesin (ERM) proteins supply functional linkage between integral membrane proteins and cytoskeleton in mammalian cells to regulate membrane protein dynamisms and cytoskeleton rearrangement. To assess potential role of the ERM proteins in HIV-1 lifecycle, we examined if suppression of ERM function in human cells expressing HIV-1 infection receptors influences HIV-1 envelope (Env)-mediated HIV-1-vector transduction and cell-cell fusion. Expression of an ezrin dominant negative mutant or knockdown of ezrin, radixin, or moesin with siRNA uniformly decreased transduction titers of HIV-1 vectors having X4-tropic Env. In contrast, transduction titers of R5-tropic Env HIV-1 vectors were decreased only by radixinmore » knockdown: ezrin knockdown had no detectable effects and moesin knockdown rather increased transduction titer. Each of the ERM suppressions had no detectable effects on cell surface expression of CD4, CCR5, and CXCR4 or VSV-Env-mediated HIV-1 vector transductions. Finally, the individual knockdown of ERM mRNAs uniformly decreased efficiency of cell-cell fusion mediated by X4- or R5-tropic Env and HIV-1 infection receptors. These results suggest that (i) the ERM proteins function as positive regulators of infection by X4-tropic HIV-1, (ii) moesin additionally functions as a negative regulator of R5-tropic HIV-1 virus infection at the early step(s) after the membrane fusion, and (iii) receptor protein dynamisms are regulated differently in R5- and X4-tropic HIV-1 infections.« less

[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

PubMed

Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

2010-01-01

The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

An Efficient Method for High-Fidelity BAC/PAC Retrofitting with a Selectable Marker for Mammalian Cell Transfection

PubMed Central

Wang, Zunde; Engler, Peter; Longacre, Angelika; Storb, Ursula

2001-01-01

Large-scale genomic sequencing projects have provided DNA sequence information for many genes, but the biological functions for most of them will only be known through functional studies. Bacterial artificial chromosomes (BACs) and P1-derived artificial chromosomes (PACs) are large genomic clones stably maintained in bacteria and are very important in functional studies through transfection because of their large size and stability. Because most BAC or PAC vectors do not have a mammalian selection marker, transfecting mammalian cells with genes cloned in BACs or PACs requires the insertion into the BAC/PAC of a mammalian selectable marker. However, currently available procedures are not satisfactory in efficiency and fidelity. We describe a very simple and efficient procedure that allows one to retrofit dozens of BACs in a day with no detectable deletions or unwanted recombination. We use a BAC/PAC retrofitting vector that, on transformation into competent BAC or PAC strains, will catalyze the specific insertion of itself into BAC/PAC vectors through in vivo cre/loxP site-specific recombination. PMID:11156622

Imaging grafted cells with [18F]FHBG using an optimized HSV1-TK mammalian expression vector in a brain injury rodent model.

PubMed

Salabert, Anne-Sophie; Vaysse, Laurence; Beaurain, Marie; Alonso, Mathieu; Arribarat, Germain; Lotterie, Jean-Albert; Loubinoux, Isabelle; Tafani, Mathieu; Payoux, Pierre

2017-01-01

Cell transplantation is an innovative therapeutic approach after brain injury to compensate for tissue damage. To have real-time longitudinal monitoring of intracerebrally grafted cells, we explored the feasibility of a molecular imaging approach using thymidine kinase HSV1-TK gene encoding and [18F]FHBG as a reporter probe to image enzyme expression. A stable neuronal cell line expressing HSV1-TK was developed with an optimised mammalian expression vector to ensure long-term transgene expression. After [18F]FHBG incubation under defined parameters, calibration ranges from 1 X 104 to 3 X 106 Neuro2A-TK cells were analysed by gamma counter or by PET-camera. In parallel, grafting with different quantities of [18F]FHBG prelabelled Neuro2A-TK cells was carried out in a rat brain injury model induced by stereotaxic injection of malonate toxin. Image acquisition of the rats was then performed with PET/CT camera to study the [18F]FHBG signal of transplanted cells in vivo. Under the optimised incubation conditions, [18F]FHBG cell uptake rate was around 2.52%. In-vitro calibration range analysis shows a clear linear correlation between the number of cells and the signal intensity. The PET signal emitted into rat brain correlated well with the number of cells injected and the number of surviving grafted cells was recorded via the in-vitro calibration range. PET/CT acquisitions also allowed validation of the stereotaxic injection procedure. Technique sensitivity was evaluated under 5 X 104 grafted cells in vivo. No [18F]FHBG or [18F]metabolite release was observed showing a stable cell uptake even 2 h post-graft. The development of this kind of approach will allow grafting to be controlled and ensure longitudinal follow-up of cell viability and biodistribution after intracerebral injection.

Intracellular trehalose via transporter TRET1 as a method to cryoprotect CHO-K1 cells.

PubMed

Uchida, Tsutomu; Furukawa, Maho; Kikawada, Takahiro; Yamazaki, Kenji; Gohara, Kazutoshi

2017-08-01

Trehalose is a promising natural cryoprotectant, but its cryoprotective effect is limited due to difficulties in transmembrane transport. Thus, expressing the trehalose transporter TRET1 on various mammalian cells may yield more trehalose applications. In this study, we ran comparative cryopreservation experiments between the TRET1-expressing CHO-K1 cells (CHO-TRET1) and the CHO-K1 cells transfected with an empty vector (CHO-vector). The experiments involve freezing under various trehalose concentrations in an extracellular medium. The freeze-thawing viabilities of CHO-TRET1 cells are higher than those of CHO-vector cells for most freezing conditions. This result differs from control experiments with a transmembrane type cryoprotectant, dimethyl sulfoxide (Me 2 SO), which had similar viabilities in each condition for both cell types. We conclude that the trehalose loaded into the cells with TRET1 significantly improves the cryoprotective effect. The higher viabilities occurred when the extracellular trehalose concentration exceeded 200 mM, with 250-500 mM being optimal, and a cooling rate below 30 K/min, with 5-20 K/min being optimal. Copyright © 2017 Elsevier Inc. All rights reserved.

Leishmania HASP and SHERP Genes Are Required for In Vivo Differentiation, Parasite Transmission and Virulence Attenuation in the Host

PubMed Central

Doehl, Johannes S. P.; Sádlová, Jovana; Aslan, Hamide; Pružinová, Kateřina; Votýpka, Jan; Kamhawi, Shaden; Volf, Petr

2017-01-01

Differentiation of extracellular Leishmania promastigotes within their sand fly vector, termed metacyclogenesis, is considered to be essential for parasites to regain mammalian host infectivity. Metacyclogenesis is accompanied by changes in the local parasite environment, including secretion of complex glycoconjugates within the promastigote secretory gel and colonization and degradation of the sand fly stomodeal valve. Deletion of the stage-regulated HASP and SHERP genes on chromosome 23 of Leishmania major is known to stall metacyclogenesis in the sand fly but not in in vitro culture. Here, parasite mutants deficient in specific genes within the HASP/SHERP chromosomal region have been used to investigate their role in metacyclogenesis, parasite transmission and establishment of infection. Metacyclogenesis was stalled in HASP/SHERP mutants in vivo and, although still capable of osmotaxis, these mutants failed to secrete promastigote secretory gel, correlating with a lack of parasite accumulation in the thoracic midgut and failure to colonise the stomodeal valve. These defects prevented parasite transmission to a new mammalian host. Sand fly midgut homogenates modulated parasite behaviour in vitro, suggesting a role for molecular interactions between parasite and vector in Leishmania development within the sand fly. For the first time, stage-regulated expression of the small HASPA proteins in Leishmania (Leishmania) has been demonstrated: HASPA2 is expressed only in extracellular promastigotes and HASPA1 only in intracellular amastigotes. Despite its lack of expression in amastigotes, replacement of HASPA2 into the null locus background delays onset of pathology in BALB/c mice. This HASPA2-dependent effect is reversed by HASPA1 gene addition, suggesting that the HASPAs may have a role in host immunomodulation. PMID:28095465

GSK3β, But Not GSK3α, Inhibits the Neuronal Differentiation of Neural Progenitor Cells As a Downstream Target of Mammalian Target of Rapamycin Complex1

PubMed Central

Ahn, Jyhyun; Jang, Jiwon; Choi, Jinyong; Lee, Junsub; Oh, Seo-Ho; Lee, Junghun; Yoon, Keejung

2014-01-01

Glycogen synthase kinase 3 (GSK3) acts as an important regulator during the proliferation and differentiation of neural progenitor cells (NPCs), but the roles of the isoforms of this molecule (GSK3α and GSK3β) have not been clearly defined. In this study, we investigated the functions of GSK3α and GSK3β in the context of neuronal differentiation of murine NPCs. Treatment of primary NPCs with a GSK3 inhibitor (SB216763) resulted in an increase in the percentage of TuJ1-positive immature neurons, suggesting an inhibitory role of GSK3 in embryonic neurogenesis. Downregulation of GSK3β expression increased the percentage of TuJ1-positive cells, while knock-down of GSK3α seemed to have no effect. When primary NPCs were engineered to stably express either isoform of GSK3 using retroviral vectors, GSK3β, but not GSK3α, inhibited neuronal differentiation and helped the cells to maintain the characteristics of NPCs. Mutant GSK3β (Y216F) failed to suppress neuronal differentiation, indicating that the kinase activity of GSK3β is important for this regulatory function. Similar results were obtained in vivo when a retroviral vector expressing GSK3β was delivered to E9.5 mouse brains using the ultrasound image-guided gene delivery technique. In addition, SB216763 was found to block the rapamycin-mediated inhibition of neuronal differentiation of NPCs. Taken together, our results demonstrate that GSK3β, but not GSK3α, negatively controls the neuronal differentiation of progenitor cells and that GSK3β may act downstream of the mammalian target of rapamycin complex1 signaling pathway. PMID:24397546

Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

2011-07-01

Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Highly stable maintenance of a mouse artificial chromosome in human cells and mice.

PubMed

Kazuki, Kanako; Takehara, Shoko; Uno, Narumi; Imaoka, Natsuko; Abe, Satoshi; Takiguchi, Masato; Hiramatsu, Kei; Oshimura, Mitsuo; Kazuki, Yasuhiro

2013-12-06

Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements. Previously, we showed that a MAC vector developed from a natural mouse chromosome by chromosome engineering was more stably maintained in adult tissues and hematopoietic cells in mice than HAC vectors. In this study, to expand the utility for a gene delivery vector in human cells and mice, we investigated the long-term stability of the MACs in cultured human cells and transchromosomic mice. We also investigated the chromosomal copy number-dependent expression of genes on the MACs in mice. The MAC was stably maintained in human HT1080 cells in vitro during long-term culture. The MAC was stably maintained at least to the F8 and F4 generations in ICR and C57BL/6 backgrounds, respectively. The MAC was also stably maintained in hematopoietic cells and tissues derived from old mice. Transchromosomic mice containing two or four copies of the MAC were generated by breeding. The DNA contents were comparable to the copy number of the MACs in each tissue examined, and the expression of the EGFP gene on the MAC was dependent on the chromosomal copy number. Therefore, the MAC vector may be useful not only for gene delivery in mammalian cells but also for animal transgenesis. Copyright © 2013 Elsevier Inc. All rights reserved.

Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

PubMed Central

Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

2011-01-01

Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

[Development of viral vectors and the application for viral entry mechanisms].

PubMed

Tani, Hideki

2011-06-01

Virus is identified as one of the obligate intracellular parasites, which only amplify in cells of specific living things. Viral vectors, which are developed by utilizing these properties, are available in the various fields such as basic research of medical biology or application of gene therapy. Our research group has studied development of viral vectors using properties of baculovirus or vesicular stomatitis virus (VSV). Due to the development of new baculoviral vectors for mammalian cells, it is possible to be more efficient transduction of foreign gene in mammalian cells and animals. Furthermore, pseudotype or recombinant VSV possessing the envelope proteins of hepatitis C virus, Japanese encephalitis virus or baculovirus were constructed, and characteristics of the envelope proteins or entry mechanisms of these viruses were analyzed.

Viral vectors for production of recombinant proteins in plants.

PubMed

Lico, Chiara; Chen, Qiang; Santi, Luca

2008-08-01

Global demand for recombinant proteins has steadily accelerated for the last 20 years. These recombinant proteins have a wide range of important applications, including vaccines and therapeutics for human and animal health, industrial enzymes, new materials and components of novel nano-particles for various applications. The majority of recombinant proteins are produced by traditional biological "factories," that is, predominantly mammalian and microbial cell cultures along with yeast and insect cells. However, these traditional technologies cannot satisfy the increasing market demand due to prohibitive capital investment requirements. During the last two decades, plants have been under intensive investigation to provide an alternative system for cost-effective, highly scalable, and safe production of recombinant proteins. Although the genetic engineering of plant viral vectors for heterologous gene expression can be dated back to the early 1980s, recent understanding of plant virology and technical progress in molecular biology have allowed for significant improvements and fine tuning of these vectors. These breakthroughs enable the flourishing of a variety of new viral-based expression systems and their wide application by academic and industry groups. In this review, we describe the principal plant viral-based production strategies and the latest plant viral expression systems, with a particular focus on the variety of proteins produced and their applications. We will summarize the recent progress in the downstream processing of plant materials for efficient extraction and purification of recombinant proteins. (c) 2008 Wiley-Liss, Inc.

Adeno-associated virus vector-mediated transduction in the cat brain.

PubMed

Vite, Charles H; Passini, Marco A; Haskins, Mark E; Wolfe, John H

2003-10-01

Adeno-associated virus (AAV) vectors are capable of delivering a therapeutic gene to the mouse brain that can result in long-term and widespread protein production. However, the human infant brain is more than 1000 times larger than the mouse brain, which will make the treatment of global neurometabolic disorders in children more difficult. In this study, we evaluated the ability of three AAV serotypes (1,2, and 5) to transduce cells in the cat brain as a model of a large mammalian brain. The human lysosomal enzyme beta-glucuronidase (GUSB) was used as a reporter gene, because it can be distinguished from feline GUSB by heat stability. The vectors were injected into the cerebral cortex, caudate nucleus, thalamus, corona radiata, internal capsule, and centrum semiovale of 8-week-old cats. The brains were evaluated for gene expression using in situ hybridization and enzyme histochemistry 10 weeks after surgery. The AAV2 vector was capable of transducing cells in the gray matter, while the AAV1 vector resulted in greater transduction of the gray matter than AAV2 as well as transduction of the white matter. AAV5 did not result in detectable transduction in the cat brain.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Virally mediated gene manipulation in the adult CNS

PubMed Central

Edry, Efrat; Lamprecht, Raphael; Wagner, Shlomo; Rosenblum, Kobi

2011-01-01

Understanding how the CNS functions poses one of the greatest challenges in modern life science and medicine. Studying the brain is especially challenging because of its complexity, the heterogeneity of its cellular composition, and the substantial changes it undergoes throughout its life-span. The complexity of adult brain neural networks results also from the diversity of properties and functions of neuronal cells, governed, inter alia, by temporally and spatially differential expression of proteins in mammalian brain cell populations. Hence, research into the biology of CNS activity and its implications to human and animal behavior must use novel scientific tools. One source of such tools is the field of molecular genetics—recently utilized more and more frequently in neuroscience research. Transgenic approaches in general, and gene targeting in rodents have become fundamental tools for elucidating gene function in the CNS. Although spectacular progress has been achieved over recent decades by using these approaches, it is important to note that they face a number of restrictions. One of the main challenges is presented by the temporal and spatial regulation of introduced genetic manipulations. Viral vectors provide an alternative approach to temporally regulated, localized delivery of genetic modifications into neurons. In this review we describe available technologies for gene transfer into the adult mammalian CNS that use both viral and non-viral tools. We discuss viral vectors frequently used in neuroscience, with emphasis on lentiviral vector (LV) systems. We consider adverse effects of LVs, and the use of LVs for temporally and spatially controllable manipulations. Especially, we highlight the significance of viral vector-mediated genetic manipulations in studying learning and memory processes, and how they may be effectively used to separate out the various phases of learning: acquisition, consolidation, retrieval, and maintenance. PMID:22207836

Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs.

PubMed

Zucchelli, Silvia; Patrucco, Laura; Persichetti, Francesca; Gustincich, Stefano; Cotella, Diego

2016-01-01

Mammalian cells are an indispensable tool for the production of recombinant proteins in contexts where function depends on post-translational modifications. Among them, Chinese Hamster Ovary (CHO) cells are the primary factories for the production of therapeutic proteins, including monoclonal antibodies (MAbs). To improve expression and stability, several methodologies have been adopted, including methods based on media formulation, selective pressure and cell- or vector engineering. This review presents current approaches aimed at improving mammalian cell factories that are based on the enhancement of translation. Among well-established techniques (codon optimization and improvement of mRNA secondary structure), we describe SINEUPs, a family of antisense long non-coding RNAs that are able to increase translation of partially overlapping protein-coding mRNAs. By exploiting their modular structure, SINEUP molecules can be designed to target virtually any mRNA of interest, and thus to increase the production of secreted proteins. Thus, synthetic SINEUPs represent a new versatile tool to improve the production of secreted proteins in biomanufacturing processes.

Advances in recombinant protein expression for use in pharmaceutical research.

PubMed

Assenberg, Rene; Wan, Paul T; Geisse, Sabine; Mayr, Lorenz M

2013-06-01

Protein production for structural and biophysical studies, functional assays, biomarkers, mechanistic studies in vitro and in vivo, but also for therapeutic applications in pharma, biotech and academia has evolved into a mature discipline in recent years. Due to the increased emphasis on biopharmaceuticals, the growing demand for proteins used for structural and biophysical studies, the impact of genomics technologies on the analysis of large sets of structurally diverse proteins, and the increasing complexity of disease targets, the interest in innovative approaches for the expression, purification and characterisation of recombinant proteins has steadily increased over the years. In this review, we summarise recent developments in the field of recombinant protein expression for research use in pharma, biotech and academia. We focus mostly on the latest developments for protein expression in the most widely used expression systems: Escherichia coli (E. coli), insect cell expression using the Baculovirus Expression Vector System (BEVS) and, finally, transient and stable expression of recombinant proteins in mammalian cells. Copyright © 2013. Published by Elsevier Ltd.

Stent-based delivery of adeno-associated viral vectors with sustained vascular transduction and iNOS-mediated inhibition of in-stent restenosis

PubMed Central

Fishbein, Ilia; Guerrero, David T.; Alferiev, Ivan S.; Foster, Jonathan B.; Minutolo, Nicholas G.; Chorny, Michael; Mas Monteys, Alejandro; Driesbaugh, Kathryn H.; Nagaswami, Chandrasekaran; Levy, Robert J.

2017-01-01

In-stent restenosis remains an important clinical problem in the era of drug eluting stents. Development of clinical gene therapy protocols for the prevention and treatment of in-stent restenosis is hampered by the lack of adequate local delivery systems. Herein we describe a novel stent-based gene delivery platform capable of providing local arterial gene transfer with adeno-associated viral (AAV) vectors. This system exploits the natural affinity of protein G (PrG) to bind to the Fc region of mammalian IgG, making PrG a universal adaptor for surface immobilization of vector-capturing antibodies (Ab). Our results: 1) demonstrate the feasibility of reversible immobilization of AAV2 vectors using vector tethering by AAV2-specific Ab appended to the stent surface through covalently attached PrG, 2) show sustained release kinetics of PrG/Ab-immobilized AAV2 vector particles into simulated physiological medium in vitro and site-specific transduction of cultured cells, 3) provide evidence of long-term (12 weeks) arterial expression of luciferase with PrG/Ab-tethered AAV2Luc, and 4) show anti-proliferative activity and anti-restenotic efficacy of stent-immobilized AAV2iNOS in the rat carotid artery model of stent angioplasty. PMID:28832561

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Efficiency of introns from various origins in fish cells.

PubMed

Bétancourt, O H; Attal, J; Théron, M C; Puissant, C; Houdebine, L M

1993-06-01

Several vectors containing (1) regulatory regions from Rous sarcoma virus (RSV), human cytomegalovirus (CMV), and herpes simplex thymidine kinase (TK); (2) introns from early or late SV40 genes and from trout growth hormone gene (tGH); (3) chloramphenicol acetyltransferase gene (CAT); and (4) transcription terminators from SV40 were transfected into carp EPC cells, salmon CHSE cells, tilapia TO2 cells, quail QT6 cells, and hamster CHO cells. CAT activity was measured in extracts from several cell lines 3 days after transfection and in the fish EPC stable clones. The CMV and RSV promoters were the most potent in all cell types. The intron from late SV40 genes (VP1 intron) worked properly in QT6 and CHO cells but not in EPC and very weakly in TO2 cells. The tGH intron was efficient in all cell types but preferentially in fish cells. The small t intron from SV40 was processed in all cell types. The small t and, to a lesser extent, the tGH introns amplified expression of cat gene in stable clones, in comparison to the transiently transfected cells. These results indicate that elements from mammalian genes may not be properly recognized by the fish cellular machinery and in an unpredictable manner. This finding suggests that vectors prepared to express foreign genes in transfected cultured fish cells and transgenic fish should preferably contain DNA sequences from fish genes or, alternatively, those sequences from mammalian genes that have been previously proved to be compatible with the fish cellular machinery.

DyNAvectors: dynamic constitutional vectors for adaptive DNA transfection.

PubMed

Clima, Lilia; Peptanariu, Dragos; Pinteala, Mariana; Salic, Adrian; Barboiu, Mihail

2015-12-25

Dynamic constitutional frameworks, based on squalene, PEG and PEI components, reversibly connected to core centers, allow the efficient identification of adaptive vectors for good DNA transfection efficiency and are well tolerated by mammalian cells.

Use of in vivo Expression Technology for the Identification of Putative Host Adaptation Factors of the Lyme Disease Spirochete.

PubMed

Casselli, Timothy; Bankhead, Troy

2015-01-01

The causative agent of Lyme disease, Borrelia burgdorferi, is an obligate parasite that requires either a tick vector or a mammalian host for survival. Identification of the bacterial genes that are specifically expressed during infection of the mammalian host could provide targets for novel therapeutics and vaccines. In vivo expression technology (IVET) is a reporter-based promoter trap system that utilizes selectable markers to identify promoters of bacterial host-specific genes. Using previously characterized genes for in vivo and in vitro selection, this study utilized an IVET system that allows for selection of B. burgdorferi sequences that act as active promoters only during murine infection. This promoter trap system was able to successfully distinguish active promoter sequences both in vivo and in vitro from control sequences and a library of cloned B. burgdorferi genomic fragments. However, a bottleneck effect during the experimental mouse infection limited the utility for genome-wide promoter screening. Overall, IVET was demonstrated as a tool for the identification of in vivo-induced promoter elements of B. burgdorferi, and the observed infection bottleneck apparent using a polyclonal infection pool provides insight into the dynamics of experimental infection with B. burgdorferi. © 2015 S. Karger AG, Basel.

Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA

PubMed Central

Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi

2012-01-01

Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184

Tissue plasminogen activator (tPA) as a reporter gene in transient gene expression.

PubMed

Cheng, S M; Lee, S G; Kalyan, N K; McCloud, S; Levner, M; Hung, P P

1987-01-01

Using the gene coding for tissue plasminogen activator (tPA) as a reporter gene, a transient gene expression system has been established. Vectors containing the full-length cDNA of tPA with its signal sequences were introduced into mammalian recipient cells by a modified gene transfer procedure. Thirty hours after transfection, the secreted tPA was found in serum-free medium and measured by a fibrin-agarose plate assay (FAPA). In this assay, tPA converts plasminogen into plasmin which then degrades high-Mr fibrin to produce cleared zones. The sizes of these zones correspond to quantities of tPA. The combination of transient tPA expression system and the FAPA provides a quick, sensitive, quantitative and non-destructive method to examine the strength of eukaryotic regulatory elements in tissue-culture cells.

Visualizing Inhibition of Nucleosome Mobility and Transcription by Cisplatin-DNA Interstrand Crosslinks in Live Mammalian Cells

PubMed Central

Zhu, Guangyu; Song, Lina; Lippard, Stephen J.

2013-01-01

Cisplatin is a widely used anticancer drug that acts by binding DNA and causing the formation of intrastrand and interstrand (ICL) cross-links, but the precise downstream effects of the latter damage are not well understood. In this study, we investigated the influence of cisplatin ICLs on synthetic nucleosomes that were platinated in a site-specific manner in vitro and on gene transcription in live mammalian cells. Nucleosome core particles (NCPs) that we constructed contained site-specific cisplatin 5′-d(G*pC)/5′-d(G*pC) ICLs, where the asterisk denotes the platinated nucleoside, to examine the influence of platinum lesions on the dynamic behavior of nucleosomes in solution. A cisplatin ICL, but not a 1,2-d(GpG) cross-link, significantly inhibited ATP-independent histone octamer-DNA sliding. We also used a novel linearization-recircularization strategy described here to synthesize mammalian expression vectors containing site-specific cisplatin ICLs. Plasmid vectors were tested in live mammalian cellsto study the transcription inhibition effects of cisplatin ICLs in the context of two different repair backgrounds. Cisplatin ICLs inhibit transcription as effectively as 1,2-d(GpG) cross-links. We determined that nucleotide excision repair plays a key role in the removal of cisplatin ICLs, acting in a replication-independent fashion. We also found that loss of mismatch repair function dramatically attenuatesthe transcription inhibition effects by cisplatin ICLs but not 1,2-d(GpG) intrastrand cross-links. Our results revealed the unique properties of cisplatin ICLs on nucleosome mobility and on transcription, and they defined how these adducts act in a manner completely different from that used for cisplatin 1,2-d(GpG) cross-links. These new findings provide direct support for a role of ICLs in the pharmacological activities of cisplatin, despite the lower frequency of their formation. PMID:23695549

Adeno-associated Virus as a Mammalian DNA Vector

PubMed Central

SALGANIK, MAX; HIRSCH, MATTHEW L.; SAMULSKI, RICHARD JUDE

2015-01-01

In the nearly five decades since its accidental discovery, adeno-associated virus (AAV) has emerged as a highly versatile vector system for both research and clinical applications. A broad range of natural serotypes, as well as an increasing number of capsid variants, has combined to produce a repertoire of vectors with different tissue tropisms, immunogenic profiles and transduction efficiencies. The story of AAV is one of continued progress and surprising discoveries in a viral system that, at first glance, is deceptively simple. This apparent simplicity has enabled the advancement of AAV into the clinic, where despite some challenges it has provided hope for patients and a promising new tool for physicians. Although a great deal of work remains to be done, both in studying the basic biology of AAV and in optimizing its clinical application, AAV vectors are currently the safest and most efficient platform for gene transfer in mammalian cells. PMID:26350320

Expression of human choline kinase in NIH 3T3 fibroblasts increases the mitogenic potential of insulin and insulin-like growth factor I.

PubMed

Chung, T; Huang, J S; Mukherjee, J J; Crilly, K S; Kiss, Z

2000-05-01

In mammalian cells, growth factors, oncogenes, and carcinogens stimulate phosphocholine (PCho) synthesis by choline kinase (CK), suggesting that PCho may regulate cell growth. To validate the role of PCho in mitogenesis, we determined the effects of insulin, insulin-like growth factor I (IGF-I), and other growth factors on DNA synthesis in NIH 3T3 fibroblast sublines highly expressing human choline kinase (CK) without increasing phosphatidylcholine synthesis. In serum-starved CK expressor cells, insulin and IGF-I stimulated DNA synthesis, p70 S6 kinase (p70 S6K) activity, phosphatidylinositol 3-kinase (PI3K) activity, and activating phosphorylation of p42/p44 mitogen-activated protein kinases (MAPK) to greater extents than in the corresponding vector control cells. Furthermore, the CK inhibitor hemicholinium-3 (HC-3) inhibited insulin- and IGF-I-induced DNA synthesis in the CK overexpressors, but not in the vector control cells. The results indicate that high cellular levels of PCho potentiate insulin- and IGF-I-induced DNA synthesis by MAPK- and p70 S6K-regulated mechanisms.

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

PubMed

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

[Construction of dengue virus-specific full-length fully human antibody libraries by mammalian display technology].

PubMed

Wen, Yangming; Lan, Kaijian; Wang, Junjie; Yu, Jingyi; Qu, Yarong; Zhao, Wei; Zhang, Fuchun; Tan, Wanlong; Cao, Hong; Zhou, Chen

2013-06-01

To construct dengue virus-specific full-length fully human antibody libraries using mammalian cell surface display technique. Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) from convalescent patients with dengue fever. The reservoirs of the light chain and heavy chain variable regions (LCκ and VH) of the antibody genes were amplified by RT-PCR and inserted into the vector pDGB-HC-TM separately to construct the light chain and heavy chain libraries. The library DNAs were transfected into CHO cells and the expression of full-length fully human antibodies on the surface of CHO cells was analyzed by flow cytometry. Using 1.2 µg of the total RNA isolated from the PBMCs as the template, the LCκ and VH were amplified and the full-length fully human antibody mammalian display libraries were constructed. The kappa light chain gene library had a size of 1.45×10(4) and the heavy chain gene library had a size of 1.8×10(5). Sequence analysis showed that 8 out of the 10 light chain clones and 7 out of the 10 heavy chain clones randomly picked up from the constructed libraries contained correct open reading frames. FACS analysis demonstrated that all the 15 clones with correct open reading frames expressed full-length antibodies, which could be detected on CHO cell surfaces. After co-transfection of the heavy chain and light chain gene libraries into CHO cells, the expression of full-length antibodies on CHO cell surfaces could be detected by FACS analysis with an expressible diversity of the antibody library reaching 1.46×10(9) [(1.45×10(4)×80%)×(1.8×10(5)×70%)]. Using 1.2 µg of total RNA as template, the LCκ and VH full-length fully human antibody libraries against dengue virus have been successfully constructed with an expressible diversity of 10(9).

Molecular Characterization, Expression and in vivo Analysis of LmexCht1: the Chitinase of the Human Pathogen, Leishmania mexicana

PubMed Central

Joshi, Manju B.; Rogers, Matthew E.; Shakarian, Alison M.; Yamage, Mat; Al-Harthi, Saeed A.; Bates, Paul A.; Dwyer, Dennis M.

2010-01-01

SUMMARY Chitinases have been implicated to be of importance in the life cycle development and transmission of a variety of parasitic organisms. Using a molecular approach, we identified and characterized the structure of a single copy LmexCht1-chitinase gene from the primitive trypanosomatid pathogen of humans, Leishmania mexicana. The LmexCht1 encodes an ~50 kDa protein, with well-conserved substrate-binding and catalytic domains characteristic of members of the Chitinase-18 protein family. Further, we showed that LmexCht1 mRNA is constitutively expressed by both the insect vector (i.e. promastigote) and mammalian (i.e. amastigote) life cycle developmental forms of this protozoan parasite. Interestingly, however, amastigotes were found to secrete/release ~ >2-4 fold higher levels of chitinase activity during their growth in vitro than promastigotes. Moreover, a homologous episomal-expression system was devised and used to express an epitope–tagged LmexCht1 chimeric construct in these parasites. Expression of the LmexCht1 chimera was verified in these transfectants by RT-PCR, Western blots and indirect immunofluorescence analyses. Further, results of coupled-immunoprecipitation/ enzyme activity experiments demonstrated that the LmexCht1 chimeric protein was secreted/released by these transfected L. mexicana parasites and that it possessed functional chitinase enzyme activity. Such transfectants were also evaluated for their infectivity both in human macrophages in vitro and in two different strains of mice. Results of those experiments demonstrated that the LmexCht1 transfectants survived significantly better in human macrophages and also produced significantly larger lesions in mice than control parasites. Taken together, our results indicate that the LmexCht1-chimera afforded a definitive survival advantage to the parasite within these mammalian hosts. Thus, the LmexCht1 could potentially represent a new virulence determinant in the mammalian phase of this important human pathogen PMID:15561707

Lentiviral vectors and cardiovascular diseases: a genetic tool for manipulating cardiomyocyte differentiation and function.

PubMed

Di Pasquale, E; Latronico, M V G; Jotti, G S; Condorelli, G

2012-06-01

Engineered recombinant viral vectors are a powerful tool for vehiculating genetic information into mammalian cells. Because of their ability to infect both dividing and non-dividing cells with high efficiency, lentiviral vectors have gained particular interest for basic research and preclinical studies in the cardiovascular field. We review here the major applications for lentiviral-vector technology in the cardiovascular field: we will discuss their use in trailing gene expression during the induction of differentiation, in protocols for the isolation of cardiac cells and in the tracking of cardiac cells after transplantation in vivo; we will also describe lentivirally-mediated gene delivery uses, such as the induction of a phenotype of interest in a target cell or the treatment of cardiovascular diseases. In addition, a section of the review will be dedicated to reprogramming approaches, focusing attention on the generation of pluripotent stem cells and on transdifferentiation, two emerging strategies for the production of cardiac myocytes from human cells and for the investigation of human diseases. Finally, in order to give a perspective on their future clinical use we will critically discuss advantages and disadvantages of lentivirus-based strategies for the treatment of cardiovascular diseases.

Mechanical remodeling of normally sized mammalian cells under a gravity vector.

PubMed

Zhang, Chen; Zhou, Lüwen; Zhang, Fan; Lü, Dongyuan; Li, Ning; Zheng, Lu; Xu, Yanhong; Li, Zhan; Sun, Shujin; Long, Mian

2017-02-01

Translocation of the dense nucleus along a gravity vector initiates mechanical remodeling of a cell, but the underlying mechanisms of cytoskeletal network and focal adhesion complex (FAC) reorganization in a mammalian cell remain unclear. We quantified the remodeling of an MC3T3-E1 cell placed in upward-, downward-, or edge-on-orientated substrate. Nucleus longitudinal translocation presents a high value in downward orientation at 24 h or in edge-on orientation at 72 h, which is consistent with orientation-dependent distribution of perinuclear actin stress fibers and vimentin cords. Redistribution of total FAC area and fractionized super mature adhesion number coordinates this dependence at short duration. This orientation-dependent remodeling is associated with nucleus flattering and lamin A/C phosphorylation. Actin depolymerization or Rho-associated protein kinase signaling inhibition abolishes the orientation dependence of nucleus translocation, whereas tubulin polymerization inhibition or vimentin disruption reserves the dependence. A biomechanical model is therefore proposed for integrating the mechanosensing of nucleus translocation with cytoskeletal remodeling and FAC reorganization induced by a gravity vector.-Zhang, C., Zhou, L., Zhang, F., Lü, D., Li, N., Zheng, L., Xu, Y., Li, Z., Sun, S., Long, M. Mechanical remodeling of normally sized mammalian cells under a gravity vector. © FASEB.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Kun; Sun, Guoxun; Lv, Zhiyuan

Research highlights: {yields} Invertebrates, for example amphioxus, do express uncoupling proteins. {yields} Both the sequence and the uncoupling activity of amphioxus UCP resemble UCP2. {yields} UCP1 is the only UCP that can form dimer on yeast mitochondria. -- Abstract: The present study describes the molecular cloning of a novel cDNA fragment from amphioxus (Branchiostoma belcheri) encoding a 343-amino acid protein that is highly homologous to human uncoupling proteins (UCP), this protein is therefore named amphioxus UCP. This amphioxus UCP shares more homology with and is phylogenetically more related to mammalian UCP2 as compared with UCP1. To further assess the functionalmore » similarity of amphioxus UCP to mammalian UCP1 and -2, the amphioxus UCP, rat UCP1, and human UCP2 were separately expressed in Saccharomyces cerevisiae, and the recombinant yeast mitochondria were isolated and assayed for the state 4 respiration rate and proton leak, using pYES2 empty vector as the control. UCP1 increased the state 4 respiration rate by 2.8-fold, and the uncoupling activity was strongly inhibited by GDP, while UCP2 and amphioxus UCP only increased the state 4 respiration rate by 1.5-fold and 1.7-fold in a GDP-insensitive manner, moreover, the proton leak kinetics of amphioxus UCP was very similar to UCP2, but much different from UCP1. In conclusion, the amphioxus UCP has a mild, unregulated uncoupling activity in the yeast system, which resembles mammalian UCP2, but not UCP1.« less

Prokaryotic arsenate reductase enhances arsenate resistance in Mammalian cells.

PubMed

Wu, Dan; Tao, Xuanyu; Wu, Gaofeng; Li, Xiangkai; Liu, Pu

2014-01-01

Arsenic is a well-known heavy metal toxicant in the environment. Bioremediation of heavy metals has been proposed as a low-cost and eco-friendly method. This article described some of recent patents on transgenic plants with enhanced heavy metal resistance. Further, to test whether genetic modification of mammalian cells could render higher arsenic resistance, a prokaryotic arsenic reductase gene arsC was transfected into human liver cancer cell HepG2. In the stably transfected cells, the expression level of arsC gene was determined by quantitative real-time PCR. Results showed that arsC was expressed in HepG2 cells and the expression was upregulated by 3 folds upon arsenate induction. To further test whether arsC has function in HepG2 cells, the viability of HepG2-pCI-ArsC cells exposed to arsenite or arsenate was compared to that of HepG2-pCI cells without arsC gene. The results indicated that arsC increased the viability of HepG2 cells by 25% in arsenate, but not in arsenite. And the test of reducing ability of stably transfected cells revealed that the concentration of accumulated trivalent arsenic increased by 25% in HepG2-pCI-ArsC cells. To determine the intracellular localization of ArsC, a fusion vector with fluorescent marker pEGFP-N1-ArsC was constructed and transfected into.HepG2. Laser confocal microscopy showed that EGFP-ArsC fusion protein was distributed throughout the cells. Taken together, these results demonstrated that prokaryotic arsenic resistant gene arsC integrated successfully into HepG2 genome and enhanced arsenate resistance of HepG2, which brought new insights of arsenic detoxification in mammalian cells.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Genetic engineering of stem cells for enhanced therapy.

PubMed

Nowakowski, Adam; Andrzejewska, Anna; Janowski, Miroslaw; Walczak, Piotr; Lukomska, Barbara

2013-01-01

Stem cell therapy is a promising strategy for overcoming the limitations of current treatment methods. The modification of stem cell properties may be necessary to fully exploit their potential. Genetic engineering, with an abundance of methodology to induce gene expression in a precise and well-controllable manner, is particularly attractive for this purpose. There are virus-based and non-viral methods of genetic manipulation. Genome-integrating viral vectors are usually characterized by highly efficient and long-term transgene expression, at a cost of safety. Non-integrating viruses are also highly efficient in transduction, and, while safer, offer only a limited duration of transgene expression. There is a great diversity of transfectable forms of nucleic acids; however, for efficient shuttling across cell membranes, additional manipulation is required. Both physical and chemical methods have been employed for this purpose. Stem cell engineering for clinical applications is still in its infancy and requires further research. There are two main strategies for inducing transgene expression in therapeutic cells: transient and permanent expression. In many cases, including stem cell trafficking and using cell therapy for the treatment of rapid-onset disease with a short healing process, transient transgene expression may be a sufficient and optimal approach. For that purpose, mRNA-based methods seem ideally suited, as they are characterized by a rapid, highly efficient transfection, with outstanding safety. Permanent transgene expression is primarily based on the application of viral vectors, and, due to safety concerns, these methods are more challenging. There is active, ongoing research toward the development of non-viral methods that would induce permanent expression, such as transposons and mammalian artificial chromosomes.

Retrofitting BACs with G418 resistance, luciferase, and oriP and EBNA-1 – new vectors for in vitro and in vivo delivery

PubMed Central

Magin-Lachmann, Christine; Kotzamanis, George; D'Aiuto, Leonardo; Wagner, Ernst; Huxley, Clare

2003-01-01

Background Bacterial artificial chromosomes (BACs) have been used extensively for sequencing the human and mouse genomes and are thus readily available for most genes. The large size of BACs means that they can generally carry intact genes with all the long range controlling elements that drive full levels of tissue-specific expression. For gene expression studies and gene therapy applications it is useful to be able to retrofit the BACs with selectable genes such as G418 resistance, reporter genes such as luciferase, and oriP/EBNA-1 from Epstein Barr virus which allows long term episomal maintenance in mammalian cells. Results We describe a series of retrofitting plasmids and a protocol for in vivo loxP/Cre recombination. The vector pRetroNeo carries a G418 resistance cassette, pRetroNeoLuc carries G418 resistance and a luciferase expression cassette, pRetroNeoLucOE carries G418 resistance, luciferase and an oriP/EBNA-1 cassette and pRetroNeoOE carries G418 resistance and oriP/EBNA-1. These vectors can be efficiently retrofitted onto BACs without rearrangement of the BAC clone. The luciferase cassette is expressed efficiently from the retrofitting plasmids and from retrofitted BACs after transient transfection of B16F10 cells in tissue culture and after electroporation into muscles of BALB/c mice in vivo. We also show that a BAC carrying GFP, oriP and EBNA-1 can be transfected into B16F10 cells with Lipofectamine 2000 and can be rescued intact after 5 weeks. Conclusion The pRetro vectors allow efficient retrofitting of BACs with G418 resistance, luciferase and/or oriP/EBNA-1 using in vivo expression of Cre. The luciferase reporter gene is expressed after transient transfection of retrofitted BACs into cells in tissue culture and after electroporation into mouse muscle in vivo. OriP/EBNA-1 allows stable maintenance of a 150-kb BAC without rearrangement for at least 5 weeks. PMID:12609052

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus.

PubMed

Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud

2008-03-25

A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

Genes involved in host-parasite interactions can be revealed by their correlated expression.

PubMed

Reid, Adam James; Berriman, Matthew

2013-02-01

Molecular interactions between a parasite and its host are key to the ability of the parasite to enter the host and persist. Our understanding of the genes and proteins involved in these interactions is limited. To better understand these processes it would be advantageous to have a range of methods to predict pairs of genes involved in such interactions. Correlated gene expression profiles can be used to identify molecular interactions within a species. Here we have extended the concept to different species, showing that genes with correlated expression are more likely to encode proteins, which directly or indirectly participate in host-parasite interaction. We go on to examine our predictions of molecular interactions between the malaria parasite and both its mammalian host and insect vector. Our approach could be applied to study any interaction between species, for example, between a host and its parasites or pathogens, but also symbiotic and commensal pairings.

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

Superinfection exclusion of the ruminant pathogen anaplasma marginale in the tick vector is dependent on time between exposures to the strains

USDA-ARS?s Scientific Manuscript database

The remarkable genetic diversity of vector-borne pathogens allows for the establishment of superinfection in the mammalian host. To have a long-term impact on population strain structure, the introduced strains must also be transmitted by a vector population that has been exposed to the existing pri...

Yeast Genetics and Biotechnological Applications

NASA Astrophysics Data System (ADS)

Mishra, Saroj; Baranwal, Richa

Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

[Novel bidirectional promoter from human genome].

PubMed

Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

2011-01-01

In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

PubMed

Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

2018-01-01

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells.

PubMed

Jose, Joyce; Taylor, Aaron B; Kuhn, Richard J

2017-02-14

Sindbis virus (SINV [genus Alphavirus , family Togaviridae ]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels. IMPORTANCE Reemerging mosquito-borne alphaviruses cause serious human epidemics worldwide. Several structural and imaging studies have helped to define the life cycle of alphaviruses in mammalian cells, but the mode of virus replication and assembly in the invertebrate vector and mechanisms producing two disease outcomes in two types of cells are yet to be identified. Using transmission electron microscopy and live-cell imaging with dual fluorescent protein-tagged SINV, we show that while insect and mammalian cells display similarities in entry and exit, they present distinct spatial and temporal organizations in virus replication and assembly. By characterizing acutely and persistently infected cells, we provide new insights into alphavirus replication and assembly in two distinct hosts, resulting in high-titer virus production in mammalian cells and continuous virus production at reduced levels in mosquito cells-presumably a prerequisite for alphavirus maintenance in nature. Copyright © 2017 Jose et al.

Role of mammalian immune responses in vector-enhanced orbiviral transmission

USDA-ARS?s Scientific Manuscript database

Culicoides sonorensis biting midges are vectors of several emerging and re-emerging orbiviruses including bluetongue, epizootic hemorrhagic disease, and African horse sickness viruses. They feed primarily on domestic sheep and cattle, but opportunistically feed on a variety of wildlife and on humans...

Hybrid Nanomaterial Complexes for Advanced Phage-guided Gene Delivery

PubMed Central

Yata, Teerapong; Lee, Koon-Yang; Dharakul, Tararaj; Songsivilai, Sirirurg; Bismarck, Alexander; Mintz, Paul J; Hajitou, Amin

2014-01-01

Developing nanomaterials that are effective, safe, and selective for gene transfer applications is challenging. Bacteriophages (phage), viruses that infect bacteria only, have shown promise for targeted gene transfer applications. Unfortunately, limited progress has been achieved in improving their potential to overcome mammalian cellular barriers. We hypothesized that chemical modification of the bacteriophage capsid could be applied to improve targeted gene delivery by phage vectors into mammalian cells. Here, we introduce a novel hybrid system consisting of two classes of nanomaterial systems, cationic polymers and M13 bacteriophage virus particles genetically engineered to display a tumor-targeting ligand and carry a transgene cassette. We demonstrate that the phage complex with cationic polymers generates positively charged phage and large aggregates that show enhanced cell surface attachment, buffering capacity, and improved transgene expression while retaining cell type specificity. Moreover, phage/polymer complexes carrying a therapeutic gene achieve greater cancer cell killing than phage alone. This new class of hybrid nanomaterial platform can advance targeted gene delivery applications by bacteriophage. PMID:25118171

In silico design, construction and cloning of Trastuzumab humanized monoclonal antibody: A possible biosimilar for Herceptin

PubMed Central

Akbarzadeh-Sharbaf, Soudabeh; Yakhchali, Bagher; Minuchehr, Zarrin; Shokrgozar, Mohammad Ali; Zeinali, Sirous

2012-01-01

Background: There is a novel hypothesis in that antibodies may have specificity for two distinct antigens that have been named “dual specificity”. This hypothesis was evaluated for some defined therapeutic monoclonal antibodies (mAbs) such as Trastuzumab, Pertuzumab, Bevacizumab, and Cetuximab. In silico design and construction of expression vectors for trastuzumab monoclonal antibody also in this work were performed. Materials and Methods: First, in bioinformatics studies the 3D structures of concerned mAbs were obtained from the Protein Data Bank (PDB). Three-dimensional structural alignments were performed with SIM and MUSTANG softwares. AutoDock4.2 software also was used for the docking analysis. Second, the suitable genes for trastuzumab heavy and light chains were designed, synthesized, and cloned in the prokaryotic vector. These fragments individually were PCR amplified and cloned into pcDNA™ 3.3-TOPO® and pOptiVEC™ TOPO® shuttle vectors, using standard methods. Results: First, many bioinformatics tools and softwares were applied but we did not meet any new dual specificity in the selected antibodies. In the following step, the suitable expression cascade for the heavy and light chains of Trastuzumab therapeutic mAb were designed and constructed. Gene cloning was successfully performed and created constructs were confirmed using gene mapping and sequencing. Conclusions: This study was based on a recently developed technology for mAb expression in mammalian cells. The obtained constructs could be successfully used for biosimilar recombinant mAb production in CHO DG44 dihydrofolate reductase (DHFR) gene deficient cell line in the suspension culture medium. PMID:23210080

Recombinase-Mediated Cassette Exchange Using Adenoviral Vectors.

PubMed

Kolb, Andreas F; Knowles, Christopher; Pultinevicius, Patrikas; Harbottle, Jennifer A; Petrie, Linda; Robinson, Claire; Sorrell, David A

2017-01-01

Site-specific recombinases are important tools for the modification of mammalian genomes. In conjunction with viral vectors, they can be utilized to mediate site-specific gene insertions in animals and in cell lines which are difficult to transfect. Here we describe a method for the generation and analysis of an adenovirus vector supporting a recombinase-mediated cassette exchange reaction and discuss the advantages and limitations of this approach.

Baculovirus-mediated expression of GPCRs in insect cells.

PubMed

Saarenpää, Tuulia; Jaakola, Veli-Pekka; Goldman, Adrian

2015-01-01

G-protein-coupled receptors (GPCRs) are a large family of seven transmembrane proteins that influence a considerable number of cellular events. For this reason, they are one of the most studied receptor types for their pharmacological and structural properties. Solving the structure of several GPCR receptor types has been possible using almost all expression systems, including Escherichia coli, yeast, mammalian, and insect cells. So far, however, most of the GPCR structures solved have been done using the baculovirus insect cell expression system. The reason for this is mainly due to cost-effectiveness, posttranslational modification efficiency, and overall effortless maintenance. The system has evolved so much that variables starting from vector type, purification tags, cell line, and growth conditions can be varied and optimized countless ways to suit the needs of new constructs. Here, we present the array of techniques that enable the rapid and efficient optimization of expression steps for maximal protein quality and quantity, including our emendations. © 2015 Elsevier Inc. All rights reserved.

Methods and materials relating to IMPDH and GMP production

DOEpatents

Collart, Frank R.; Huberman, Eliezer

1997-01-01

Disclosed are purified and isolated DNA sequences encoding eukaryotic proteins possessing biological properties of inosine 5'-monophosphate dehydrogenase ("IMPDH"). Illustratively, mammalian (e.g., human) IMPDH-encoding DNA sequences are useful in transformation or transfection of host cells for the large scale recombinant production of the enzymatically active expression products and/or products (e.g., GMP) resulting from IMPDH catalyzed synthesis in cells. Vectors including IMPDH-encoding DNA sequences are useful in gene amplification procedures. Recombinant proteins and synthetic peptides provided by the invention are useful as immunological reagents and in the preparation of antibodies (including polyclonal and monoclonal antibodies) for quantitative detection of IMPDH.

Signal Peptide and Denaturing Temperature are Critical Factors for Efficient Mammalian Expression and Immunoblotting of Cannabinoid Receptors*

PubMed Central

WANG, Chenyun; WANG, Yingying; WANG, Miao; CHEN, Jiankui; YU, Nong; SONG, Shiping; KAMINSKI, Norbert E.; ZHANG, Wei

2013-01-01

Summary Many researchers employed mammalian expression system to artificially express cannabinoid receptors, but immunoblot data that directly prove efficient protein expression can hardly be seen in related research reports. In present study, we demonstrated cannabinoid receptor protein was not able to be properly expressed with routine mammalian expression system. This inefficient expression was rescued by endowing an exogenous signal peptide ahead of cannabinoid receptor peptide. In addition, the artificially synthesized cannabinoid receptor was found to aggregate under routine sample denaturing temperatures (i.e., ≥95°C), forming a large molecular weight band when analyzed by immunoblotting. Only denaturing temperatures ≤75°C yielded a clear band at the predicted molecular weight. Collectively, we showed that efficient mammalian expression of cannabinoid receptors need a signal peptide sequence, and described the requirement for a low sample denaturing temperature in immunoblot analysis. These findings provide very useful information for efficient mammalian expression and immunoblotting of membrane receptors. PMID:22528237

Temporal characterization of the organ-specific Rhipicephalus microplus transcriptional response to Anaplasma marginale infection

USDA-ARS?s Scientific Manuscript database

Arthropods transmit a variety of important infectious diseases of humans and animals. Importantly, replication and development of pathogen infectivity is tightly linked to vector feeding on the mammalian host; thus analysis of the transcriptomes of both vector and pathogen during feeding is fundamen...

Escherichia coli cell-free protein synthesis and isotope labeling of mammalian proteins.

PubMed

Terada, Takaho; Yokoyama, Shigeyuki

2015-01-01

This chapter describes the cell-free protein synthesis method, using an Escherichia coli cell extract. This is a cost-effective method for milligram-scale protein production and is particularly useful for the production of mammalian proteins, protein complexes, and membrane proteins that are difficult to synthesize by recombinant expression methods, using E. coli and eukaryotic cells. By adjusting the conditions of the cell-free method, zinc-binding proteins, disulfide-bonded proteins, ligand-bound proteins, etc., may also be produced. Stable isotope labeling of proteins can be accomplished by the cell-free method, simply by using stable isotope-labeled amino acid(s) in the cell-free reaction. Moreover, the cell-free protein synthesis method facilitates the avoidance of stable isotope scrambling and dilution over the recombinant expression methods and is therefore advantageous for amino acid-selective stable isotope labeling. Site-specific stable isotope labeling is also possible with a tRNA molecule specific to the UAG codon. By the cell-free protein synthesis method, coupled transcription-translation is performed from a plasmid vector or a PCR-amplified DNA fragment encoding the protein. A milligram quantity of protein can be produced with a milliliter-scale reaction solution in the dialysis mode. More than a thousand solution structures have been determined by NMR spectroscopy for uniformly labeled samples of human and mouse functional domain proteins, produced by the cell-free method. Here, we describe the practical aspects of mammalian protein production by the cell-free method for NMR spectroscopy. © 2015 Elsevier Inc. All rights reserved.

Development of Serologic Assays for the Diagnosis of New World Leishmaniasis

DTIC Science & Technology

1986-02-20

the skin by the bite of the phlebotomine sandfly vector , and is maintained by subsequent parasite invasion of and multiplication within cells of the...distribution within the lipid bilayer may play a significant role in the behavior of the parasite within the insect vector and the mammalian host...by the phlebotomine sandfly vector . Promastigotes are then phagocytized by dermal macrophages, where they differentiate into the intracellular, or

Molecular characterization and expression of the M6 gene of grass carp hemorrhage virus (GCHV), an aquareovirus.

PubMed

Qiu, T; Lu, R H; Zhang, J; Zhu, Z Y

2001-07-01

The complete nucleotide sequence of M6 gene of grass carp hemorrhage virus (GCHV) was determined. It is 2039 nucleotides in length and contains a single large open reading frame that could encode a protein of 648 amino acids with predicted molecular mass of 68.7 kDa. Amino acid sequence comparison revealed that the protein encoded by GCHV M6 is closely related to the protein mu1 of mammalian reovirus. The M6 gene, encoding the major outer-capsid protein, was expressed using the pET fusion protein vector in Escherichia coli and detected by Western blotting using chicken anti-GCHV immunoglobulin (IgY). The result indicates that the protein encoded by M6 may share a putative Asn-42-Pro-43 proteolytic cleavage site with mu1.

Generating mammalian stable cell lines by electroporation.

PubMed

A Longo, Patti; Kavran, Jennifer M; Kim, Min-Sung; Leahy, Daniel J

2013-01-01

Expression of functional, recombinant mammalian proteins often requires expression in mammalian cells (see Single Cell Cloning of a Stable Mammalian Cell Line). If the expressed protein needs to be made frequently, it can be best to generate a stable cell line instead of performing repeated transient transfections into mammalian cells. Here, we describe a method to generate stable cell lines via electroporation followed by selection steps. This protocol will be limited to the CHO dhfr-Urlaub et al. (1983) and LEC1 cell lines, which in our experience perform the best with this method. Copyright © 2013 Elsevier Inc. All rights reserved.

Early mammalian development under conditions of reorientation relative to the gravity vector

NASA Technical Reports Server (NTRS)

Wolgemuth, D. J.; Grills, G. S.

1985-01-01

A clinostat was used to assess the effects of reorientation relative to the gravity vector on mammalian germ cells cultured in vitro. Previous studies using this system revealed an inhibition of meiotic maturation of mouse oocytes. In the present study, the effects of clinostat rotation on in vitro fertilization were examined. The frequency of fertilization of experimental cultures did not vary from that of the clinostat vertical control cultures at either of the rotation rates examined. Importantly, no abnormalities of fertilization, such as parthenogenetic activation, fragmentation, or polyspermy were seen. It is concluded that the initial events of fertilization were unaffected by this treatment, although the developmental potential of these embryos remains to be assessed.

Avipoxviruses: infection biology and their use as vaccine vectors.

PubMed

Weli, Simon C; Tryland, Morten

2011-02-03

Avipoxviruses (APVs) belong to the Chordopoxvirinae subfamily of the Poxviridae family. APVs are distributed worldwide and cause disease in domestic, pet and wild birds of many species. APVs are transmitted by aerosols and biting insects, particularly mosquitoes and arthropods and are usually named after the bird species from which they were originally isolated. The virus species Fowlpox virus (FWPV) causes disease in poultry and associated mortality is usually low, but in flocks under stress (other diseases, high production) mortality can reach up to 50%. APVs are also major players in viral vaccine vector development for diseases in human and veterinary medicine. Abortive infection in mammalian cells (no production of progeny viruses) and their ability to accommodate multiple gene inserts are some of the characteristics that make APVs promising vaccine vectors. Although abortive infection in mammalian cells conceivably represents a major vaccine bio-safety advantage, molecular mechanisms restricting APVs to certain hosts are not yet fully understood. This review summarizes the current knowledge relating to APVs, including classification, morphogenesis, host-virus interactions, diagnostics and disease, and also highlights the use of APVs as recombinant vaccine vectors.

Novel method to load multiple genes onto a mammalian artificial chromosome.

PubMed

Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L

2014-01-01

Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

La Crosse bunyavirus nonstructural protein NSs serves to suppress the type I interferon system of mammalian hosts.

PubMed

Blakqori, Gjon; Delhaye, Sophie; Habjan, Matthias; Blair, Carol D; Sánchez-Vargas, Irma; Olson, Ken E; Attarzadeh-Yazdi, Ghassem; Fragkoudis, Rennos; Kohl, Alain; Kalinke, Ulrich; Weiss, Siegfried; Michiels, Thomas; Staeheli, Peter; Weber, Friedemann

2007-05-01

La Crosse virus (LACV) is a mosquito-transmitted member of the Bunyaviridae family that causes severe encephalitis in children. For the LACV nonstructural protein NSs, previous overexpression studies with mammalian cells had suggested two different functions, namely induction of apoptosis and inhibition of RNA interference (RNAi). Here, we demonstrate that mosquito cells persistently infected with LACV do not undergo apoptosis and mount a specific RNAi response. Recombinant viruses that either express (rLACV) or lack (rLACVdelNSs) the NSs gene similarly persisted and were prone to the RNAi-mediated resistance to superinfection. Furthermore, in mosquito cells overexpressed LACV NSs was unable to inhibit RNAi against Semliki Forest virus. In mammalian cells, however, the rLACVdelNSs mutant virus strongly activated the antiviral type I interferon (IFN) system, whereas rLACV as well as overexpressed NSs suppressed IFN induction. Consequently, rLACVdelNSs was attenuated in IFN-competent mouse embryo fibroblasts and animals but not in systems lacking the type I IFN receptor. In situ analyses of mouse brains demonstrated that wild-type and mutant LACV mainly infect neuronal cells and that NSs is able to suppress IFN induction in the central nervous system. Thus, our data suggest little relevance of the NSs-induced apoptosis or RNAi inhibition for growth or pathogenesis of LACV in the mammalian host and indicate that NSs has no function in the insect vector. Since deletion of the viral NSs gene can be fully complemented by inactivation of the host's IFN system, we propose that the major biological function of NSs is suppression of the mammalian innate immune response.

Enduring high-efficiency in vivo transfection of neurons with non-viral magnetoparticles in the rat visual cortex for optogenetic applications.

PubMed

Soto-Sánchez, Cristina; Martínez-Navarrete, Gema; Humphreys, Lawrence; Puras, Gustavo; Zarate, Jon; Pedraz, José Luis; Fernández, Eduardo

2015-05-01

This work demonstrates the successful long-term transfection in vivo of a DNA plasmid vector in rat visual cortex neurons using the magnetofection technique. The transfection rates reached values of up to 97% of the neurons after 30days, comparable to those achieved by viral vectors. Immunohistochemical treatment with anti-EGFP antibodies enhanced the detection of the EYFP-channelrhodopsin expression throughout the dendritic trees and cell bodies. These results show that magnetic nanoparticles offer highly efficient and enduring in vivo high-rate transfection in identified neurons of an adult mammalian brain and suggest that the magnetotechnique facilitates the introduction of large functional genetic material like channelrhodopsin with safe non-viral vectors using minimally invasive approaches. Gene therapy may be one of the treatment modalities for neurological diseases in the future. The use of viral transfection remains a concern due to restrictions to the size limit of the genetic material able to be packed, as well as safety issues. In this work, the authors evaluated magnetoplexes as an alternative vehicle. The results showed very promising data in that these nanoparticles could offer high transfection efficiency. Copyright © 2015 Elsevier Inc. All rights reserved.

Protective Efficacy of Newcastle Disease Virus Expressing Soluble Trimeric Hemagglutinin against Highly Pathogenic H5N1 Influenza in Chickens and Mice

PubMed Central

Cornelissen, Lisette A. H. M.; de Leeuw, Olav S.; Tacken, Mirriam G.; Klos, Heleen C.; de Vries, Robert P.; de Boer-Luijtze, Els A.; van Zoelen-Bos, Diana J.; Rigter, Alan; Rottier, Peter J. M.; Moormann, Rob J. M.; de Haan, Cornelis A. M.

2012-01-01

Background Highly pathogenic avian influenza virus (HPAIV) causes a highly contagious often fatal disease in poultry, resulting in significant economic losses in the poultry industry. HPAIV H5N1 also poses a major public health threat as it can be transmitted directly from infected poultry to humans. One effective way to combat avian influenza with pandemic potential is through the vaccination of poultry. Several live vaccines based on attenuated Newcastle disease virus (NDV) that express influenza hemagglutinin (HA) have been developed to protect chickens or mammalian species against HPAIV. However, the zoonotic potential of NDV raises safety concerns regarding the use of live NDV recombinants, as the incorporation of a heterologous attachment protein may result in the generation of NDV with altered tropism and/or pathogenicity. Methodology/Principal Findings In the present study we generated recombinant NDVs expressing either full length, membrane-anchored HA of the H5 subtype (NDV-H5) or a soluble trimeric form thereof (NDV-sH53). A single intramuscular immunization with NDV-sH53 or NDV-H5 fully protected chickens against disease after a lethal challenge with H5N1 and reduced levels of virus shedding in tracheal and cloacal swabs. NDV-sH53 was less protective than NDV-H5 (50% vs 80% protection) when administered via the respiratory tract. The NDV-sH53 was ineffective in mice, regardless of whether administered oculonasally or intramuscularly. In this species, NDV-H5 induced protective immunity against HPAIV H5N1, but only after oculonasal administration, despite the poor H5-specific serum antibody response it elicited. Conclusions/Significance Although NDV expressing membrane anchored H5 in general provided better protection than its counterpart expressing soluble H5, chickens could be fully protected against a lethal challenge with H5N1 by using the latter NDV vector. This study thus provides proof of concept for the use of recombinant vector vaccines expressing a soluble form of a heterologous viral membrane protein. Such vectors may be advantageous as they preclude the incorporation of heterologous membrane proteins into the viral vector particles. PMID:22952980

Integrated Method for Purification and Single-Particle Characterization of Lentiviral Vector Systems by Size Exclusion Chromatography and Tunable Resistive Pulse Sensing.

PubMed

Heider, Susanne; Muzard, Julien; Zaruba, Marianne; Metzner, Christoph

2017-07-01

Elements derived from lentiviral particles such as viral vectors or virus-like particles are commonly used for biotechnological and biomedical applications, for example in mammalian protein expression, gene delivery or therapy, and vaccine development. Preparations of high purity are necessary in most cases, especially for clinical applications. For purification, a wide range of methods are available, from density gradient centrifugation to affinity chromatography. In this study we have employed size exclusion columns specifically designed for the easy purification of extracellular vesicles including exosomes. In addition to viral marker protein and total protein analysis, a well-established single-particle characterization technology, termed tunable resistive pulse sensing, was employed to analyze fractions of highest particle load and purity and characterize the preparations by size and surface charge/electrophoretic mobility. With this study, we propose an integrated platform combining size exclusion chromatography and tunable resistive pulse sensing for monitoring production and purification of viral particles.

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Newcastle disease virus-vectored rabies vaccine is safe, highly immunogenic, and provides long-lasting protection in dogs and cats.

PubMed

Ge, Jinying; Wang, Xijun; Tao, Lihong; Wen, Zhiyuan; Feng, Na; Yang, Songtao; Xia, Xianzhu; Yang, Chinglai; Chen, Hualan; Bu, Zhigao

2011-08-01

Effective, safe, and affordable rabies vaccines are still being sought. Newcastle disease virus (NDV), an avian paramyxovirus, has shown promise as a vaccine vector for mammals. Here, we generated a recombinant avirulent NDV La Sota strain expressing the rabies virus glycoprotein (RVG) and evaluated its potential to serve as a vaccine against rabies. The recombinant virus, rL-RVG, retained its high-growth property in chicken eggs, with titers of up to 10⁹·⁸ 50% egg infective doses (EID₅₀)/ml of allantoic fluid. RVG expression enabled rL-RVG to spread from cell to cell in a rabies virus-like manner, and RVG was incorporated on the surface of the rL-RVG viral particle. RVG incorporation did not alter the trypsin-dependent infectivity of the NDV vector in mammalian cells. rL-RVG and La Sota NDV showed similar levels of sensitivity to a neutralization antibody against NDV and similar levels of resistance to a neutralization antibody against rabies virus. Animal studies demonstrated that rL-RVG is safe in several species, including cats and dogs, when administered as multiple high doses of recombinant vaccine. Intramuscular vaccination with rL-RVG induced a substantial rabies virus neutralization antibody response and provided complete protection from challenge with circulating rabies virus strains. Most importantly, rL-RVG induced strong and long-lasting protective neutralization antibody responses to rabies virus in dogs and cats. A low vaccine dose of 10⁸·³ EID₅₀ completely protected dogs from challenge with a circulating strain of rabies virus for more than a year. This is the first study to demonstrate that immunization with an NDV-vectored vaccine can induce long-lasting, systemic protective immunity against rabies.

Protein and genome evolution in Mammalian cells for biotechnology applications.

PubMed

Majors, Brian S; Chiang, Gisela G; Betenbaugh, Michael J

2009-06-01

Mutation and selection are the essential steps of evolution. Researchers have long used in vitro mutagenesis, expression, and selection techniques in laboratory bacteria and yeast cultures to evolve proteins with new properties, termed directed evolution. Unfortunately, the nature of mammalian cells makes applying these mutagenesis and whole-organism evolution techniques to mammalian protein expression systems laborious and time consuming. Mammalian evolution systems would be useful to test unique mammalian cell proteins and protein characteristics, such as complex glycosylation. Protein evolution in mammalian cells would allow for generation of novel diagnostic tools and designer polypeptides that can only be tested in a mammalian expression system. Recent advances have shown that mammalian cells of the immune system can be utilized to evolve transgenes during their natural mutagenesis processes, thus creating proteins with unique properties, such as fluorescence. On a more global level, researchers have shown that mutation systems that affect the entire genome of a mammalian cell can give rise to cells with unique phenotypes suitable for commercial processes. This review examines the advances in mammalian cell and protein evolution and the application of this work toward advances in commercial mammalian cell biotechnology.

Transformation of NIH3T3 Cells with Synthetic c‐Ha‐ras Genes

PubMed Central

Kamiya, Hiroyuki; Miura, Kazunobu; Ohtomo, Noriko; Koda, Toshiaki; Kakinuma, Mitsuaki; Nishimura, Susumu

1989-01-01

Synthetic human c‐Ha‐ras genes in which amino acid codons were altered to those which are frequently used in highly expressed Escherichia coli genes were ligated to the 3′‐end of Rous sarcoma virus long terminal repeat. When NIH3T3 cells were transfected with the plasmids having those genes with valine at codon 12, leucine at codon 61 or arginine at codon 61, transformants were efficiently produced. These results indicated that the synthetic c‐Ha‐ras genes are expressed in a mammalian system even though their codon usage is altered to correspond with that of E. colt. This expression vector system should he useful for studies on the structure‐function relationships of c‐Ha‐ras, since the synthetic gene can be easily modified to have multiple base alterations, and can also be used simultaneously for the production of large amounts of p21 in E. coli for biochemical and biophysical studies. PMID:2542206

Roles of silkworm endoplasmic reticulum chaperones in the secretion of recombinant proteins expressed by baculovirus system.

PubMed

Imai, Saki; Kusakabe, Takahiro; Xu, Jian; Li, Zhiqing; Shirai, Shintaro; Mon, Hiroaki; Morokuma, Daisuke; Lee, Jae Man

2015-11-01

Baculovirus expression vector system (BEVS) is widely used for production of recombinant eukaryotic proteins in insect larvae or cultured cells. BEVS has advantages over bacterial expression system in producing post-translationally modified secreted proteins. However, for some unknown reason, it is very difficult for insects to secrete sufficiently for certain proteins of interest. To understand the reasons why insect cells fail to secrete some kinds of recombinant proteins, we here employed three mammalian proteins as targets, EPO, HGF, and Wnt3A, with different secretion levels in BEVS and investigated their mRNA transcriptions from the viral genome, subcellular localizations, and interactions with silkworm ER chaperones. Moreover, we observed that no significantly influence on the secretion amounts of all three proteins when depleting or overexpressing most endogenous ER chaperone genes in cultured silkworm cells. However, among all detected ER chaperones, the depletion of BiP severely decreased the recombinant protein secretion in BEVS, indicating the possible central role of Bip in silkworm secretion pathway.

The Web-Based DNA Vaccine Database DNAVaxDB and Its Usage for Rational DNA Vaccine Design.

PubMed

Racz, Rebecca; He, Yongqun

2016-01-01

A DNA vaccine is a vaccine that uses a mammalian expression vector to express one or more protein antigens and is administered in vivo to induce an adaptive immune response. Since the 1990s, a significant amount of research has been performed on DNA vaccines and the mechanisms behind them. To meet the needs of the DNA vaccine research community, we created DNAVaxDB ( http://www.violinet.org/dnavaxdb ), the first Web-based database and analysis resource of experimentally verified DNA vaccines. All the data in DNAVaxDB, which includes plasmids, antigens, vaccines, and sources, is manually curated and experimentally verified. This chapter goes over the detail of DNAVaxDB system and shows how the DNA vaccine database, combined with the Vaxign vaccine design tool, can be used for rational design of a DNA vaccine against a pathogen, such as Mycobacterium bovis.

Identification of a functional nuclear export signal in the green fluorescent protein asFP499

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mustafa, Huseyin; Strasser, Bernd; Rauth, Sabine

2006-04-21

The green fluorescent protein (GFP) asFP499 from Anemonia sulcata is a distant homologue of the GFP from Aequorea victoria. We cloned the asFP499 gene into a mammalian expression vector and showed that this protein was expressed in the human lymphoblast cell line Ramos RA1 and in the embryonic kidney 293T cell line (HEK 293T). In HEK 293T cells, asFP499 was localized mainly in the cytoplasm, suggesting that the protein was excluded from the nucleus. We identified {sub 194}LRMEKLNI{sub 201} as a candidate nuclear export signal in asFP499 and mutated the isoleucine at position 201 to an alanine. Unlike the wildtypemore » form, the mutant protein was distributed throughout the cytoplasm and nucleus. This is First report of a GFP that contains a functional NES.« less

Transformation of the rodent malaria parasite Plasmodium chabaudi.

PubMed

Spence, Philip J; Cunningham, Deirdre; Jarra, William; Lawton, Jennifer; Langhorne, Jean; Thompson, Joanne

2011-04-01

The rodent malaria parasite Plasmodium chabaudi chabaudi shares many features with human malaria species, including P. falciparum, and is the in vivo model of choice for many aspects of malaria research in the mammalian host, from sequestration of parasitized erythrocytes, to antigenic variation and host immunity and immunopathology. This protocol describes an optimized method for the transformation of mature blood-stage P.c. chabaudi and a description of a vector that targets efficient, single crossover integration into the P.c. chabaudi genome. Transformed lines are reproducibly generated and selected within 14-20 d, and show stable long-term protein expression even in the absence of drug selection. This protocol, therefore, provides the scientific community with a robust and reproducible method to generate transformed P.c. chabaudi parasites expressing fluorescent, bioluminescent and model antigens that can be used in vivo to dissect many of the fundamental principles of malaria infection.

Transformation of the rodent malaria parasite Plasmodium chabaudi

PubMed Central

Spence, Philip J; Cunningham, Deirdre; Jarra, William; Lawton, Jennifer

2014-01-01

The rodent malaria parasite Plasmodium chabaudi chabaudi shares many features with human malaria species, including P. falciparum, and is the in vivo model of choice for many aspects of malaria research in the mammalian host, from sequestration of parasitized erythrocytes, to antigenic variation and host immunity and immunopathology. this protocol describes an optimized method for the transformation of mature blood-stage P.c. chabaudi and a description of a vector that targets efficient, single crossover integration into the P.c. chabaudi genome. Transformed lines are reproducibly generated and selected within 4–20 d, and show stable long-term protein expression even in the absence of drug selection. this protocol, therefore, provides the scientific community with a robust and reproducible method to generate transformed P.c. chabaudi parasites expressing fluorescent, bioluminescent and model antigens that can be used in vivo to dissect many of the fundamental principles of malaria infection. PMID:21455190

Mechano-sensitization of mammalian neuronal networks through expression of the bacterial large-conductance mechanosensitive ion channel

PubMed Central

Contestabile, Andrea; Moroni, Monica; Hallinan, Grace I.; Palazzolo, Gemma; Chad, John; Deinhardt, Katrin; Carugo, Dario

2018-01-01

ABSTRACT Development of remote stimulation techniques for neuronal tissues represents a challenging goal. Among the potential methods, mechanical stimuli are the most promising vectors to convey information non-invasively into intact brain tissue. In this context, selective mechano-sensitization of neuronal circuits would pave the way to develop a new cell-type-specific stimulation approach. We report here, for the first time, the development and characterization of mechano-sensitized neuronal networks through the heterologous expression of an engineered bacterial large-conductance mechanosensitive ion channel (MscL). The neuronal functional expression of the MscL was validated through patch-clamp recordings upon application of calibrated suction pressures. Moreover, we verified the effective development of in-vitro neuronal networks expressing the engineered MscL in terms of cell survival, number of synaptic puncta and spontaneous network activity. The pure mechanosensitivity of the engineered MscL, with its wide genetic modification library, may represent a versatile tool to further develop a mechano-genetic approach. This article has an associated First Person interview with the first author of the paper. PMID:29361543

Genome profiling of sterol synthesis shows convergent evolution in parasites and guides chemotherapeutic attack.

PubMed

Fügi, Matthias A; Gunasekera, Kapila; Ochsenreiter, Torsten; Guan, Xueli; Wenk, Markus R; Mäser, Pascal

2014-05-01

Sterols are an essential class of lipids in eukaryotes, where they serve as structural components of membranes and play important roles as signaling molecules. Sterols are also of high pharmacological significance: cholesterol-lowering drugs are blockbusters in human health, and inhibitors of ergosterol biosynthesis are widely used as antifungals. Inhibitors of ergosterol synthesis are also being developed for Chagas's disease, caused by Trypanosoma cruzi. Here we develop an in silico pipeline to globally evaluate sterol metabolism and perform comparative genomics. We generate a library of hidden Markov model-based profiles for 42 sterol biosynthetic enzymes, which allows expressing the genomic makeup of a given species as a numerical vector. Hierarchical clustering of these vectors functionally groups eukaryote proteomes and reveals convergent evolution, in particular metabolic reduction in obligate endoparasites. We experimentally explore sterol metabolism by testing a set of sterol biosynthesis inhibitors against trypanosomatids, Plasmodium falciparum, Giardia, and mammalian cells, and by quantifying the expression levels of sterol biosynthetic genes during the different life stages of T. cruzi and Trypanosoma brucei. The phenotypic data correlate with genomic makeup for simvastatin, which showed activity against trypanosomatids. Other findings, such as the activity of terbinafine against Giardia, are not in agreement with the genotypic profile.

Genome profiling of sterol synthesis shows convergent evolution in parasites and guides chemotherapeutic attack

PubMed Central

Fügi, Matthias A.; Gunasekera, Kapila; Ochsenreiter, Torsten; Guan, Xueli; Wenk, Markus R.; Mäser, Pascal

2014-01-01

Sterols are an essential class of lipids in eukaryotes, where they serve as structural components of membranes and play important roles as signaling molecules. Sterols are also of high pharmacological significance: cholesterol-lowering drugs are blockbusters in human health, and inhibitors of ergosterol biosynthesis are widely used as antifungals. Inhibitors of ergosterol synthesis are also being developed for Chagas’s disease, caused by Trypanosoma cruzi. Here we develop an in silico pipeline to globally evaluate sterol metabolism and perform comparative genomics. We generate a library of hidden Markov model-based profiles for 42 sterol biosynthetic enzymes, which allows expressing the genomic makeup of a given species as a numerical vector. Hierarchical clustering of these vectors functionally groups eukaryote proteomes and reveals convergent evolution, in particular metabolic reduction in obligate endoparasites. We experimentally explore sterol metabolism by testing a set of sterol biosynthesis inhibitors against trypanosomatids, Plasmodium falciparum, Giardia, and mammalian cells, and by quantifying the expression levels of sterol biosynthetic genes during the different life stages of T. cruzi and Trypanosoma brucei. The phenotypic data correlate with genomic makeup for simvastatin, which showed activity against trypanosomatids. Other findings, such as the activity of terbinafine against Giardia, are not in agreement with the genotypic profile. PMID:24627128

Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

PubMed

Marín-López, Alejandro; Ortego, Javier

2016-01-01

Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

Adeno-associated-virus-mediated transduction of the mammary gland enables sustained production of recombinant proteins in milk

PubMed Central

Wagner, Stefan; Thresher, Rosemary; Bland, Ross; Laible, Götz

2015-01-01

Biopharming for the production of recombinant pharmaceutical proteins in the mammary gland of transgenic animals is an attractive but laborious alternative compared to mammalian cell fermentation. The disadvantage of the lengthy process of genetically modifying an entire animal could be circumvented with somatic transduction of only the mammary epithelium with recombinant, replication-defective viruses. While other viral vectors offer very limited scope for this approach, vectors based on adeno-associated virus (AAV) appear to be ideal candidates because AAV is helper-dependent, does not induce a strong immune response and has no association with disease. Here, we sought to test the suitability of recombinant AAV (rAAV) for biopharming. Using reporter genes, we showed that injected rAAV efficiently transduced mouse mammary cells. When rAAV encoding human myelin basic protein (hMBP) was injected into the mammary glands of mice and rabbits, this resulted in the expression of readily detectable protein levels of up to 0.5 g/L in the milk. Furthermore we demonstrated that production of hMBP persisted over extended periods and that protein expression could be renewed in a subsequent lactation by re-injection of rAAV into a previously injected mouse gland. PMID:26463440

Reverse Genetics for Mammalian Orthoreovirus.

PubMed

Stuart, Johnasha D; Phillips, Matthew B; Boehme, Karl W

2017-01-01

Reverse genetics allows introduction of specific alterations into a viral genome. Studies performed with mutant viruses generated using reverse genetics approaches have contributed immeasurably to our understanding of viral replication and pathogenesis, and also have led to development of novel vaccines and virus-based vectors. Here, we describe the reverse genetics system that allows for production and recovery of mammalian orthoreovirus, a double-stranded (ds) RNA virus, from plasmids that encode the viral genome.

Binding and condensation of plasmid DNA onto functionalized carbon nanotubes: toward the construction of nanotube-based gene delivery vectors.

PubMed

Singh, Ravi; Pantarotto, Davide; McCarthy, David; Chaloin, Olivier; Hoebeke, Johan; Partidos, Charalambos D; Briand, Jean-Paul; Prato, Maurizio; Bianco, Alberto; Kostarelos, Kostas

2005-03-30

Carbon nanotubes (CNTs) constitute a class of nanomaterials that possess characteristics suitable for a variety of possible applications. Their compatibility with aqueous environments has been made possible by the chemical functionalization of their surface, allowing for exploration of their interactions with biological components including mammalian cells. Functionalized CNTs (f-CNTs) are being intensively explored in advanced biotechnological applications ranging from molecular biosensors to cellular growth substrates. We have been exploring the potential of f-CNTs as delivery vehicles of biologically active molecules in view of possible biomedical applications, including vaccination and gene delivery. Recently we reported the capability of ammonium-functionalized single-walled CNTs to penetrate human and murine cells and facilitate the delivery of plasmid DNA leading to expression of marker genes. To optimize f-CNTs as gene delivery vehicles, it is essential to characterize their interactions with DNA. In the present report, we study the interactions of three types of f-CNTs, ammonium-functionalized single-walled and multiwalled carbon nanotubes (SWNT-NH3+; MWNT-NH3+), and lysine-functionalized single-walled carbon nanotubes (SWNT-Lys-NH3+), with plasmid DNA. Nanotube-DNA complexes were analyzed by scanning electron microscopy, surface plasmon resonance, PicoGreen dye exclusion, and agarose gel shift assay. The results indicate that all three types of cationic carbon nanotubes are able to condense DNA to varying degrees, indicating that both nanotube surface area and charge density are critical parameters that determine the interaction and electrostatic complex formation between f-CNTs with DNA. All three different f-CNT types in this study exhibited upregulation of marker gene expression over naked DNA using a mammalian (human) cell line. Differences in the levels of gene expression were correlated with the structural and biophysical data obtained for the f-CNT:DNA complexes to suggest that large surface area leading to very efficient DNA condensation is not necessary for effective gene transfer. However, it will require further investigation to determine whether the degree of binding and tight association between DNA and nanotubes is a desirable trait to increase gene expression efficiency in vitro or in vivo. This study constitutes the first thorough investigation into the physicochemical interactions between cationic functionalized carbon nanotubes and DNA toward construction of carbon nanotube-based gene transfer vector systems.

RpA, an extracellular protease similar to the metalloprotease of serralysin family, is required for pathogenicity of Ralstonia pickettii.

PubMed

Chen, C-M; Liu, J-J; Chou, C-W; Lai, C-H; Wu, L-T

2015-10-01

To investigate the biochemical and functional properties of an extracellular protease, RpA, in Ralstonia pickettii WP1 isolated from water supply systems. An extracellular protease was identified and characterized from R. pickettii WP1. A mutant strain WP1M2 was created from strain WP1 by mini-Tn5 transposition. The culture filtrates from WP1M2 had a lower cytotoxic effect than the parental WP1 on several mammalian cell lines. Cloning and sequence analysis revealed the Tn5 transposon inserted at a protease gene (rpA) which is 81% homologous to prtA and aprX genes of Pseudomonas fluorescens. The rpA gene encodes a 482-residue protein showing sequence similarity to metalloproteases of the serralysin family. The RpA protein was expressed in Escherichia coli using a pET expression vector and purified as a 55 kDa molecular weight protein. Furthermore, the protease activity of RpA was inhibited by protease inhibitor and heat treatment. The in vitro cytotoxic activity of R. pickettii culture filtrates was attributed to RpA protease. An extracellular protease, RpA, was identified from R. pickettii WP1 isolated from water supply system. The RpA metalloproteases is required for the pathogenicity of R. pickettii to mammalian cell lines. © 2015 The Society for Applied Microbiology.

Intracellular localization of adeno-associated viral proteins expressed in insect cells.

PubMed

Gallo-Ramírez, Lilí E; Ramírez, Octavio T; Palomares, Laura A

2011-01-01

Production of vectors derived from adeno-associated virus (AAVv) in insect cells represents a feasible option for large-scale applications. However, transducing particles yields obtained in this system are low compared with total capsid yields, suggesting the presence of genome encapsidation bottlenecks. Three components are required for AAVv production: viral capsid proteins (VP), the recombinant AAV genome, and Rep proteins for AAV genome replication and encapsidation. Little is known about the interaction between the three components in insect cells, which have intracellular conditions different to those in mammalian cells. In this work, the localization of AAV proteins in insect cells was assessed for the first time with the purpose of finding potential limiting factors. Unassembled VP were located either in the cytoplasm or in the nucleus. Their transport into the nucleus was dependent on protein concentration. Empty capsids were located in defined subnuclear compartments. Rep proteins expressed individually were efficiently translocated into the nucleus. Their intranuclear distribution was not uniform and differed from VP distribution. While Rep52 distribution and expression levels were not affected by AAV genomes or VP, Rep78 distribution and stability changed during coexpression. Expression of all AAV components modified capsid intranuclear distribution, and assembled VP were found in vesicles located in the nuclear periphery. Such vesicles were related to baculovirus infection, highlighting its role in AAVv production in insect cells. The results obtained in this work suggest that the intracellular distribution of AAV proteins allows their interaction and does not limit vector production in insect cells. Copyright © 2011 American Institute of Chemical Engineers (AIChE).

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study

PubMed Central

Day, Chi-Ping; Carter, John; Bonomi, Carrie; Esposito, Dominic; Crise, Bruce; Ortiz-Conde, Betty; Hollingshead, Melinda; Merlino, Glenn

2009-01-01

SUMMARY Lentiviral vectors (LVs) are capable of labeling a broad spectrum of cell types, achieving stable expression of transgenes. However, for in vivo studies, the duration of marker gene expression has been highly variable. We have developed a series of LVs harboring different promoters for expressing reporter gene in mouse cells. Long-term culture and colony formation of several LV-labeled mouse melanoma cells showed that promoters derived from mammalian house-keeping genes, especially those encoding RNA polymerase II (Pol2) and ferritin (FerH), provided the highest consistency for reporter expression. For in vivo studies, primary B16BL6 mouse melanoma were infected with LVs whose luciferase-GFP fusion gene (Luc/GFP) was driven by either Pol2 or FerH promoters. When transplanted into syngeneic C57BL/6 mice, Luc/GFP-labeled B16BL6 mouse melanoma cells can be monitored by bioluminescence imaging in vivo, and GFP-positive cells can be isolated from the tumors by FACS. Pol2-Luc/GFP labeling, while lower in activity, was more sustainable than FerH-Luc/GFP labeling in B16BL6 over consecutive passages into mice. We conclude that Pol-2-Luc/GFP labeling allows long-term in vivo monitoring and tumor cell isolation in immunocompetent mouse melanoma models. SIGNIFICANCE In this study we have developed and identified lentiviral vectors that allow labeled mouse melanoma cells to maintain long-term and consistent expression of a bifunctional luciferase-GFP marker gene, even in syngeneic mice with an intact immune function. This cell-labeling system can be used to build immunocompetent mouse melanoma models that permit both tumor monitoring and FACS-based tumor cell isolation from tissues, greatly facilitating the in vivo study of melanoma. PMID:19175523

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

PubMed

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Satellite DNA-based artificial chromosomes for use in gene therapy.

PubMed

Hadlaczky, G

2001-04-01

Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

Molecular genetic basis for fluoroquinolone-induced retinal degeneration in cats.

PubMed

Ramirez, Christina J; Minch, Jonathan D; Gay, John M; Lahmers, Sunshine M; Guerra, Dan J; Haldorson, Gary J; Schneider, Terri; Mealey, Katrina L

2011-02-01

Distribution of fluoroquinolones to the retina is normally restricted by ABCG2 at the blood-retinal barrier. As the cat develops a species-specific adverse reaction to photoreactive fluoroquinolones, our goal was to investigate ABCG2 as a candidate gene for fluoroquinolone-induced retinal degeneration and blindness in cats. Feline ABCG2 was sequenced and the consensus amino acid sequence was compared with that of 10 other mammalian species. Expression of ABCG2 in feline retina was assessed by immunoblot. cDNA constructs for feline and human ABCG2 were constructed in a pcDNA3 expression vector and expressed in HEK-293 cells, and ABCG2 expression was analyzed by western blot and immunofluorescence. Mitoxantrone and BODIPY-prazosin efflux measured by flow cytometry and a phototoxicity assay were used to assess feline and human ABCG2 function. Four feline-specific (compared with 10 other mammalian species) amino acid changes in conserved regions of ABCG2 were identified. Expression of ABCG2 on plasma membranes was confirmed in feline retina and in cells transfected with human and feline ABCG2, although some intracellular expression of feline ABCG2 was detected by immunofluorescence. Function of feline ABCG2, compared with human ABCG2, was found to be deficient as determined by flow cytometric measurement of mitoxantrone and BODIPY-prazosin efflux and enrofloxacin-induced phototoxicity assays. Feline-specific amino acid changes in ABCG2 cause a functional defect of the transport protein in cats. This functional defect may be owing, in part, to defective cellular localization of feline ABCG2. Regardless, dysfunction of ABCG2 at the blood-retinal barrier likely results in accumulation of photoreactive fluoroquinolones in feline retina. Exposure of the retina to light would then generate reactive oxygen species that would cause the characteristic retinal degeneration and blindness documented in some cats receiving high doses of some fluoroquinolones. Pharmacological inhibition of ABCG2 in other species might result in retinal damage if fluoroquinolones are concurrently administered.

Gene Delivery into Plant Cells for Recombinant Protein Production

PubMed Central

Chen, Qiang

2015-01-01

Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications. PMID:26075275

A cross-species bi-clustering approach to identifying conserved co-regulated genes.

PubMed

Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

2016-06-15

A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

Clathrin-mediated Endocytosis and Subsequent Endo-Lysosomal Trafficking of Adeno-associated Virus/Phage*

PubMed Central

Stoneham, Charlotte A.; Hollinshead, Michael; Hajitou, Amin

2012-01-01

Adeno-associated virus/phage (AAVP) is a gene delivery vector constructed as a hybrid between adeno-associated virus and filamentous phage. Tumor targeting following systemic administration has previously been demonstrated in several in vivo cancer models, with tumor specificity achieved through display of an αv integrin-targeting ligand on the capsid. However, high titers of AAVP are required for transduction of large numbers of mammalian cells. This study is the first to investigate the mechanisms involved in entry and intracellular trafficking of AAVP. Using a combination of flow cytometry, confocal, and electron microscopy techniques, together with pharmacological agents, RNAi and dominant negative mutants, we have demonstrated that targeted AAVP endocytosis is both dynamin and clathrin-dependent. Following entry, the majority of AAVP particles are sequestered by the endosomal-lysosomal degradative pathway. Finally, we have demonstrated that disruption of this pathway leads to improved transgene expression by AAVP, thus demonstrating that escape from the late endosomes/lysosomes is a critical step for improving gene delivery by AAVP. These findings have important implications for the rational design of improved AAVP and RGD-targeted vectors. PMID:22915587

Relevance of Assembly-Activating Protein for Adeno-associated Virus Vector Production and Capsid Protein Stability in Mammalian and Insect Cells.

PubMed

Grosse, Stefanie; Penaud-Budloo, Magalie; Herrmann, Anne-Kathrin; Börner, Kathleen; Fakhiri, Julia; Laketa, Vibor; Krämer, Chiara; Wiedtke, Ellen; Gunkel, Manuel; Ménard, Lucie; Ayuso, Eduard; Grimm, Dirk

2017-10-15

The discovery that adeno-associated virus 2 (AAV2) encodes an eighth protein, called assembly-activating protein (AAP), transformed our understanding of wild-type AAV biology. Concurrently, it raised questions about the role of AAP during production of recombinant vectors based on natural or molecularly engineered AAV capsids. Here, we show that AAP is indeed essential for generation of functional recombinant AAV2 vectors in both mammalian and insect cell-based vector production systems. Surprisingly, we observed that AAV2 capsid proteins VP1 to -3 are unstable in the absence of AAP2, likely due to rapid proteasomal degradation. Inhibition of the proteasome led to an increase of intracellular VP1 to -3 but neither triggered assembly of functional capsids nor promoted nuclear localization of the capsid proteins. Together, this underscores the crucial and unique role of AAP in the AAV life cycle, where it rapidly chaperones capsid assembly, thus preventing degradation of free capsid proteins. An expanded analysis comprising nine alternative AAV serotypes (1, 3 to 9, and rh10) showed that vector production always depends on the presence of AAP, with the exceptions of AAV4 and AAV5, which exhibited AAP-independent, albeit low-level, particle assembly. Interestingly, AAPs from all 10 serotypes could cross-complement AAP-depleted helper plasmids during vector production, despite there being distinct intracellular AAP localization patterns. These were most pronounced for AAP4 and AAP5, congruent with their inability to rescue an AAV2/AAP2 knockout. We conclude that AAP is key for assembly of genuine capsids from at least 10 different AAV serotypes, which has implications for vectors derived from wild-type or synthetic AAV capsids. IMPORTANCE Assembly of adeno-associated virus 2 (AAV2) is regulated by the assembly-activating protein (AAP), whose open reading frame overlaps with that of the viral capsid proteins. As the majority of evidence was obtained using virus-like particles composed solely of the major capsid protein VP3, AAP's role in and relevance for assembly of genuine AAV capsids have remained largely unclear. Thus, we established a trans -complementation assay permitting assessment of AAP functionality during production of recombinant vectors based on complete AAV capsids and derived from any serotype. We find that AAP is indeed a critical factor not only for AAV2, but also for generation of vectors derived from nine other AAV serotypes. Moreover, we identify a new role of AAP in maintaining capsid protein stability in mammalian and insect cells. Thereby, our study expands our current understanding of AAV/AAP biology, and it concomitantly provides insights into the importance of AAP for AAV vector production. Copyright © 2017 American Society for Microbiology.

Relevance of Assembly-Activating Protein for Adeno-associated Virus Vector Production and Capsid Protein Stability in Mammalian and Insect Cells

PubMed Central

Grosse, Stefanie; Penaud-Budloo, Magalie; Herrmann, Anne-Kathrin; Börner, Kathleen; Fakhiri, Julia; Laketa, Vibor; Krämer, Chiara; Wiedtke, Ellen; Gunkel, Manuel; Ménard, Lucie; Ayuso, Eduard

2017-01-01

ABSTRACT The discovery that adeno-associated virus 2 (AAV2) encodes an eighth protein, called assembly-activating protein (AAP), transformed our understanding of wild-type AAV biology. Concurrently, it raised questions about the role of AAP during production of recombinant vectors based on natural or molecularly engineered AAV capsids. Here, we show that AAP is indeed essential for generation of functional recombinant AAV2 vectors in both mammalian and insect cell-based vector production systems. Surprisingly, we observed that AAV2 capsid proteins VP1 to -3 are unstable in the absence of AAP2, likely due to rapid proteasomal degradation. Inhibition of the proteasome led to an increase of intracellular VP1 to -3 but neither triggered assembly of functional capsids nor promoted nuclear localization of the capsid proteins. Together, this underscores the crucial and unique role of AAP in the AAV life cycle, where it rapidly chaperones capsid assembly, thus preventing degradation of free capsid proteins. An expanded analysis comprising nine alternative AAV serotypes (1, 3 to 9, and rh10) showed that vector production always depends on the presence of AAP, with the exceptions of AAV4 and AAV5, which exhibited AAP-independent, albeit low-level, particle assembly. Interestingly, AAPs from all 10 serotypes could cross-complement AAP-depleted helper plasmids during vector production, despite there being distinct intracellular AAP localization patterns. These were most pronounced for AAP4 and AAP5, congruent with their inability to rescue an AAV2/AAP2 knockout. We conclude that AAP is key for assembly of genuine capsids from at least 10 different AAV serotypes, which has implications for vectors derived from wild-type or synthetic AAV capsids. IMPORTANCE Assembly of adeno-associated virus 2 (AAV2) is regulated by the assembly-activating protein (AAP), whose open reading frame overlaps with that of the viral capsid proteins. As the majority of evidence was obtained using virus-like particles composed solely of the major capsid protein VP3, AAP's role in and relevance for assembly of genuine AAV capsids have remained largely unclear. Thus, we established a trans-complementation assay permitting assessment of AAP functionality during production of recombinant vectors based on complete AAV capsids and derived from any serotype. We find that AAP is indeed a critical factor not only for AAV2, but also for generation of vectors derived from nine other AAV serotypes. Moreover, we identify a new role of AAP in maintaining capsid protein stability in mammalian and insect cells. Thereby, our study expands our current understanding of AAV/AAP biology, and it concomitantly provides insights into the importance of AAP for AAV vector production. PMID:28768875

Characterization of L1 ORF1p self-interaction and cellular localization using a mammalian two-hybrid system.

PubMed

Sokolowski, Mark; deHaro, Dawn; Christian, Claiborne M; Kines, Kristine J; Belancio, Victoria P

2013-01-01

Long INterspersed Element-1 (LINE-1, L1) is an active retrotransposon that mobilizes using a ribonucleoprotein particle (RNP) intermediate composed of the full-length bicistronic L1 mRNA and the two proteins (ORF1p and ORF2p) encoded by that mRNA. ORF1p and ORF2p demonstrate cis-preference for their encoding mRNA. Previous studies of ORF1p, purified from bacterial and insect cells demonstrated that this protein forms trimers in vitro. While valuable for understanding ORF1p function, these in vitro approaches do not provide any information on ORF1p self-interaction in the context of mammalian cells. We used a mammalian two-hybrid (M2H) system in order to study L1 ORF1p self-interaction in human and mouse cells. We demonstrate that the M2H system successfully detects human and mouse ORF1p self-interactions in transiently transfected mammalian cells. We also generated mouse and human ORF1p-specific antibodies to characterize the expression of ORF1p fusion proteins used in the M2H system. Using these antibodies, we demonstrate that ORF1p interaction in trans leads to the formation of heterodimers that are expected to produce a positive signal in the M2H system. Although the role for L1 ORF1p cis-preference in L1 mobilization is established, the impact of ability of ORF1pto interact in trans on the L1 replication cycle is not known. Furthermore, western blot analysis of ORF1p generated by a full-length L1, wild type ORF1, or a codon-optimized ORF1 expression vector is detected in the nucleus. In contrast, the addition of a tag to the N-terminus of the mouse and human ORF1 proteins can significantly alter the subcellular localization in a tag-specific manner. These data support that nuclear localization of ORF1p may contribute to L1 (and potentially the SINE Alu) RNP nuclear access in the host cell.

A Dual-Intein Autoprocessing Domain that Directs Synchronized Protein Co-Expression in Both Prokaryotes and Eukaryotes

PubMed Central

Zhang, Bei; Rapolu, Madhusudhan; Liang, Zhibin; Han, Zhenlin; Williams, Philip G.; Su, Wei Wen

2015-01-01

Being able to coordinate co-expression of multiple proteins is necessary for a variety of important applications such as assembly of protein complexes, trait stacking, and metabolic engineering. Currently only few options are available for multiple recombinant protein co-expression, and most of them are not applicable to both prokaryotic and eukaryotic hosts. Here, we report a new polyprotein vector system that is based on a pair of self-excising mini-inteins fused in tandem, termed the dual-intein (DI) domain, to achieve synchronized co-expression of multiple proteins. The DI domain comprises an Ssp DnaE mini-intein N159A mutant and an Ssp DnaB mini-intein C1A mutant connected in tandem by a peptide linker to mediate efficient release of the flanking proteins via autocatalytic cleavage. Essentially complete release of constituent proteins, GFP and RFP (mCherry), from a polyprotein precursor, in bacterial, mammalian, and plant hosts was demonstrated. In addition, successful co-expression of GFP with chloramphenicol acetyltransferase, and thioredoxin with RFP, respectively, further substantiates the general applicability of the DI polyprotein system. Collectively, our results demonstrate the DI-based polyprotein technology as a highly valuable addition to the molecular toolbox for multi-protein co-expression which finds vast applications in biotechnology, biosciences, and biomedicine. PMID:25712612

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

The CB₁ cannabinoid receptor signals striatal neuroprotection via a PI3K/Akt/mTORC1/BDNF pathway.

PubMed

Blázquez, C; Chiarlone, A; Bellocchio, L; Resel, E; Pruunsild, P; García-Rincón, D; Sendtner, M; Timmusk, T; Lutz, B; Galve-Roperh, I; Guzmán, M

2015-10-01

The CB1 cannabinoid receptor, the main molecular target of endocannabinoids and cannabis active components, is the most abundant G protein-coupled receptor in the mammalian brain. In particular, the CB1 receptor is highly expressed in the basal ganglia, mostly on terminals of medium-sized spiny neurons, where it plays a key neuromodulatory function. The CB1 receptor also confers neuroprotection in various experimental models of striatal damage. However, the assessment of the physiological relevance and therapeutic potential of the CB1 receptor in basal ganglia-related diseases is hampered, at least in part, by the lack of knowledge of the precise mechanism of CB1 receptor neuroprotective activity. Here, by using an array of pharmacological, genetic and pharmacogenetic (designer receptor exclusively activated by designer drug) approaches, we show that (1) CB1 receptor engagement protects striatal cells from excitotoxic death via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin complex 1 pathway, which, in turn, (2) induces brain-derived neurotrophic factor (BDNF) expression through the selective activation of BDNF gene promoter IV, an effect that is mediated by multiple transcription factors. To assess the possible functional impact of the CB1/BDNF axis in a neurodegenerative-disease context in vivo, we conducted experiments in the R6/2 mouse, a well-established model of Huntington's disease, in which the CB1 receptor and BDNF are known to be severely downregulated in the dorsolateral striatum. Adeno-associated viral vector-enforced re-expression of the CB1 receptor in the dorsolateral striatum of R6/2 mice allowed the re-expression of BDNF and the concerted rescue of the neuropathological deficits in these animals. Collectively, these findings unravel a molecular link between CB1 receptor activation and BDNF expression, and support the relevance of the CB1/BDNF axis in promoting striatal neuron survival.

A Green-Light-Responsive System for the Control of Transgene Expression in Mammalian and Plant Cells.

PubMed

Chatelle, Claire; Ochoa-Fernandez, Rocio; Engesser, Raphael; Schneider, Nils; Beyer, Hannes M; Jones, Alex R; Timmer, Jens; Zurbriggen, Matias D; Weber, Wilfried

2018-05-18

The ever-increasing complexity of synthetic gene networks and applications of synthetic biology requires precise and orthogonal gene expression systems. Of particular interest are systems responsive to light as they enable the control of gene expression dynamics with unprecedented resolution in space and time. While broadly used in mammalian backgrounds, however, optogenetic approaches in plant cells are still limited due to interference of the activating light with endogenous photoreceptors. Here, we describe the development of the first synthetic light-responsive system for the targeted control of gene expression in mammalian and plant cells that responds to the green range of the light spectrum in which plant photoreceptors have minimal activity. We first engineered a system based on the light-sensitive bacterial transcription factor CarH and its cognate DNA operator sequence CarO from Thermus thermophilus to control gene expression in mammalian cells. The system was functional in various mammalian cell lines, showing high induction (up to 350-fold) along with low leakiness, as well as high reversibility. We quantitatively described the systems characteristics by the development and experimental validation of a mathematical model. Finally, we transferred the system into A. thaliana protoplasts and demonstrated gene repression in response to green light. We expect that this system will provide new opportunities in applications based on synthetic gene networks and will open up perspectives for optogenetic studies in mammalian and plant cells.

cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

PubMed

Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

2005-04-01

A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

Use of Protein Biotinylation In Vivo for Immunoelectron Microscopic Localization of a Specific Protein Isoform

PubMed Central

Viens, Antoine; Harper, Francis; Pichard, Evelyne; Comisso, Martine; Pierron, Gérard; Ogryzko, Vasily

2008-01-01

Tagging of proteins in vivo by covalent attachment of a biotin moiety has emerged as a new prospective tool for protein detection and purification. Previously, we established a strategy for expression of in vivo biotinylated proteins in mammalian cells. It is based on coexpression of the protein of interest fused to a short biotin acceptor peptide and biotin ligase BirA cloned in the same vector. We show here that the in vivo biotinylation can be used for immunogold postembedding labeling in immunoelectron microscopy experiments. We show that immunoelectron microscopy with biotinylated nuclear proteins is compatible with a wide range of postembedding methods, facilitating combination of morphological and localization studies in a single experiment. We also show that the method works in both transient transfection and stable cell line expression protocols and can be used for colocalization studies. This manuscript contains online supplemental material at http://www.jhc.org. Please visit this article online to view these materials. (J Histochem Cytochem 56:911–919, 2008) PMID:18574249

The influence of GAP-43 on orientation of cell division through G proteins.

PubMed

Huang, Rui; Zhao, Junpeng; Ju, Lili; Wen, Yujun; Xu, Qunyuan

2015-12-01

Recent studies have shown that GAP-43 is highly expressed in horizontally dividing neural progenitor cells, and G protein complex are required for proper mitotic-spindle orientation of those progenitors in the mammalian developing cortex. In order to verify the hypothesis that GAP-43 may influence the orientation of cell division through interacting with G proteins during neurogenesis, the GAP-43 RNA from adult C57 mouse was cloned into the pEGFP-N1 vector, which was then transfected into Madin-Darby Canine Kidney (MDCK) cells cultured in a three-dimensional (3D) cell culture system. The interaction of GAP-43 with Gαi was detected by co-immunoprecipitation (co-IP), while cystogenesis of 3D morphogenesis of MDCK cells and expression of GAP-43 and Gαi were determined by immunofluorescence and Western blotting. The results showed are as follows: After being transfected by pEGFP-N1-GAP-43, GAP-43 was localized on the cell membrane and co-localized with Gαi, and this dramatically induced a defective cystogenesis in 3D morphogenesis of MDCK cells. The functional interaction between GAP-43 and Gαi proteins was proven by the co-IP assay. It can be considered from the results that the GAP-43 is involved in the orientation of cell division by interacting with Gαi and this should be an important mechanism for neurogenesis in the mammalian brain. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and characterization of beluga whale (Delphinapterus leucas) interleukin-1beta and tumor necrosis factor-alpha.

PubMed Central

Denis, F; Archambault, D

2001-01-01

Interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha) are cytokines produced primarily by monocytes and macrophages with regulatory effects in inflammation and multiple aspects of the immune response. As yet, no molecular data have been reported for IL-1beta and TNF-alpha of the beluga whale. In this study, we cloned and determined the entire cDNA sequence encoding beluga whale IL-1beta and TNF-alpha. The genetic relationship of the cytokine sequences was then analyzed with those from several mammalian species, including the human and the pig. The homology of beluga whale IL-1beta nucleic acid and deduced amino acid sequences with those from these mammalian species ranged from 74.6 to 86.0% and 62.7 to 77.1%, respectively, whereas that of TNF-alpha varied from 79.3 to 90.8% and 75.3 to 87.7%, respectively. Phylogenetic analyses based on deduced amino acid sequences showed that the beluga whale IL-1beta and TNF-alpha were most closely related to those of the ruminant species (cattle, sheep, and deer). The beluga whale IL-1beta- and TNF-alpha-encoding sequences were thereafter successfully expressed in Escherichia coli as fusion proteins by using procaryotic expression vectors. The fusion proteins were used to produce beluga whale IL-1beta- and TNF-alpha-specific rabbit antisera. Images Figure 3. Figure 4. Figure 5. PMID:11768130

I-SceI-Induced Gene Replacement at a Natural Locus in Embryonic Stem Cells

PubMed Central

Cohen-Tannoudji, Michel; Robine, Sylvie; Choulika, André; Pinto, Daniel; El Marjou, Fatima; Babinet, Charles; Louvard, Daniel; Jaisser, Frédéric

1998-01-01

Gene targeting is a very powerful tool for studying mammalian development and physiology and for creating models of human diseases. In many instances, however, it is desirable to study different modifications of a target gene, but this is limited by the generally low frequency of homologous recombination in mammalian cells. We have developed a novel gene-targeting strategy in mouse embryonic stem cells that is based on the induction of endogenous gap repair processes at a defined location within the genome by induction of a double-strand break (DSB) in the gene to be mutated. This strategy was used to knock in an NH2-ezrin mutant in the villin gene, which encodes an actin-binding protein expressed in the brush border of the intestine and the kidney. To induce the DSB, an I-SceI yeast meganuclease restriction site was first introduced by gene targeting to the villin gene, followed by transient expression of I-SceI. The repair of the ensuing DSB was achieved with high efficiency (6 × 10−6) by a repair shuttle vector sharing only a 2.8-kb region of homology with the villin gene and no negative selection marker. Compared to conventional gene-targeting experiments at the villin locus, this represents a 100-fold stimulation of gene-targeting frequency, notwithstanding a much lower length of homology. This strategy will be very helpful in facilitating the targeted introduction of several types of mutations within a gene of interest. PMID:9488460

Contactin‑associated protein‑like 2 expression in SH‑SY5Y cells is upregulated by a FOXP2 mutant with a shortened poly‑glutamine tract.

PubMed

Zhao, Yunjing; Liu, Xiaoliang; Sun, Hongwei; Wang, Yueping; Yang, Wenzhu; Ma, Hongwei

2015-12-01

The forkhead box protein P2 (FOXP2) gene encodes an important transcription factor that contains a polyglutamine (poly‑Q) tract and a forkhead DNA binding domain. It has been observed that FOXP2 is associated with speech sound disorder (SSD), and mutations that decrease the length of the poly‑Q tract were identified in the FOXP2 gene of SSD patients. However, the exact role of poly‑Q reduction is not well understood. In the present study, constructs expressing wild‑type and poly‑Q reduction mutants of FOXP2 were generated by polymerase chain reaction (PCR) using lentiviral vectors and transfected into the SH‑SY5Y neuronal cell line. Quantitative reverse transcription (qRT)‑PCR and western blotting indicated that infected cells stably expressed high levels of FOXP2. Using this cell model, the impact of FOXP2 on the expression of contactin‑associated protein‑like 2 (CNTNAP2) were investigated, and CNTNAP2 mRNA expression levels were observed to be significantly higher in cells expressing poly‑Q‑reduced FOXP2. In addition, the expression level of CASPR2, a mammalian homolog of Drosophila Neurexin IV, was increased in cells expressing the FOXP2 mutant. Demonstration of regulation by FOXP2 indicates that CNTNAP2 may also be involved in SSD.

Mechanisms of double-strand-break repair during gene targeting in mammalian cells.

PubMed Central

Ng, P; Baker, M D

1999-01-01

In the present study, the mechanism of double-strand-break (DSB) repair during gene targeting at the chromosomal immunoglobulin mu-locus in a murine hybridoma was examined. The gene-targeting assay utilized specially designed insertion vectors genetically marked in the region of homology to the chromosomal mu-locus by six diagnostic restriction enzyme site markers. The restriction enzyme markers permitted the contribution of vector-borne and chromosomal mu-sequences in the recombinant product to be determined. The use of the insertion vectors in conjunction with a plating procedure in which individual integrative homologous recombination events were retained for analysis revealed several important features about the mammalian DSB repair process:The presence of the markers within the region of shared homology did not affect the efficiency of gene targeting.In the majority of recombinants, the vector-borne marker proximal to the DSB was absent, being replaced with the corresponding chromosomal restriction enzyme site. This result is consistent with either formation and repair of a vector-borne gap or an "end" bias in mismatch repair of heteroduplex DNA (hDNA) that favored the chromosomal sequence. Formation of hDNA was frequently associated with gene targeting and, in most cases, began approximately 645 bp from the DSB and could encompass a distance of at least 1469 bp.The hDNA was efficiently repaired prior to DNA replication.The repair of adjacent mismatches in hDNA occurred predominantly on the same strand, suggesting the involvement of a long-patch repair mechanism. PMID:10049929

Vertebrate Development in Space: Gravity Is a Drag (and Has Been for Eons and Eons)

NASA Technical Reports Server (NTRS)

Keefe, J. R.

1985-01-01

Brief sketches of developmental biology studies during spaceflight presented are intended to be complete in scope and to provide the reader with an overview of the present status of such studies. Means of evaluating both the direct role of gravity on all processes of mammalian reproduction and development as well as defining the means of assessing indirect transplacemental aspects are considered. The potential present in the development of a spaceflight system/program specifically designed to provide chronic exposure of a representative variety of mammalian species with periodic sampling for multiple generations to fully assess the potential impact of an altered gravitational vector on general mammalian development is also considered.

The food additive vanillic acid controls transgene expression in mammalian cells and mice.

PubMed

Gitzinger, Marc; Kemmer, Christian; Fluri, David A; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

2012-03-01

Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

PubMed

Inouye, Satoshi; Suzuki, Takahiro

2016-12-01

The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

The effect of glycosylation on cytotoxicity of Ibaraki virus nonstructural protein NS3

PubMed Central

URATA, Maho; WATANABE, Rie; IWATA, Hiroyuki

2015-01-01

The cytotoxicity of Ibaraki virus nonstructural protein NS3 was confirmed, and the contribution of glycosylation to this activity was examined by using glycosylation mutants of NS3 generated by site-directed mutagenesis. The expression of NS3 resulted in leakage of lactate dehydrogenase to the culture supernatant, suggesting the cytotoxicity of this protein. The lack of glycosylation impaired the transport of NS3 to the plasma membrane and resulted in reduced cytotoxicity. Combined with the previous observation that NS3 glycosylation was specifically observed in mammalian cells (Urata et al., Virus Research 2014), it was suggested that the alteration of NS3 cytotoxicity through modulating glycosylation is one of the strategies to achieve host specific pathogenisity of Ibaraki virus between mammals and vector arthropods. PMID:26178820

Establishment of expanded and streamlined pipeline of PITCh knock-in – a web-based design tool for MMEJ-mediated gene knock-in, PITCh designer, and the variations of PITCh, PITCh-TG and PITCh-KIKO

PubMed Central

Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi

2017-01-01

ABSTRACT The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer (http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively. PMID:28453368

Establishment of expanded and streamlined pipeline of PITCh knock-in - a web-based design tool for MMEJ-mediated gene knock-in, PITCh designer, and the variations of PITCh, PITCh-TG and PITCh-KIKO.

PubMed

Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Nakade, Shota; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi

2017-05-04

The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer ( http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html ), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively.

Emergence of mammalian cell-adapted vesicular stomatitis virus from persistent infections of insect vector cells.

PubMed

Novella, Isabel S; Ebendick-Corpus, Bonnie E; Zárate, Selene; Miller, Eric L

2007-06-01

Arboviruses (arthropod-borne viruses) represent quintessential generalists, with the ability to infect and perform well in multiple hosts. However, antagonistic pleiotropy imposed a cost during the adaptation to persistent replication of vesicular stomatitis virus in sand fly cells and resulted in strains that initially replicated poorly in hamster cells, even when the virus was allowed to replicate periodically in the latter. Once a debilitated strain started replicating continuously in mammalian cells, fitness increased significantly. Fitness recovery did not entail back mutations or compensatory mutations, but instead, we observed the replacement of persistence-adapted genomes by mammalian cell-adapted strains with a full set of new, unrelated sequence changes. These mammalian cell-adapted genomes were present at low frequencies in the populations with a history of persistence for up to a year and quickly became dominant during mammalian infection, but coexistence was not stable in the long term. Periodic acute replication in mammalian cells likely contributed to extending the survival of minority genomes, but these genomes were also found in strictly persistent populations.

BacMam virus-based surface display of the infectious bronchitis virus (IBV) S1 glycoprotein confers strong protection against virulent IBV challenge in chickens.

PubMed

Zhang, Jie; Chen, Xiao-Wei; Tong, Tie-Zhu; Ye, Yu; Liao, Ming; Fan, Hui-Ying

2014-02-03

Avian infectious bronchitis virus (IBV) is associated with production inefficiencies in domestic fowl, and causes massive economic losses to the poultry industry worldwide. Progress has been made in designing novel and efficient candidate vaccines to control IBV infection. BacMam virus, a modified baculovirus mediating transgene expression under the control of a mammalian promoter, has emerged as a versatile and safe vector during vaccine development. In previous work, we generated the BacMam virus Ac-CMV-S1, which expressed the S1 glycoprotein of IBV-M41. We showed that Ac-CMV-S1 induced excellent cellular immunity, but did not confer adequate protection in chickens compared with the conventional inactivated vaccine. In the current study, we generated an improved BacMam virus, BV-Dual-S1. This virus displayed the S1 glycoprotein on the baculovirus envelope, and was capable of expressing it in mammalian cells. BV-Dual-S1 elicited stronger humoral and cell-mediated immune responses, and showed greater capacity for induction of cytotoxic T lymphocyte responses, compared with Ac-CMV-S1 in specific pathogen-free chickens. A significant difference was not observed for protection rates between chickens immunized with BV-Dual-S1 (83%) or inactivated vaccine (89%) following challenge with virulent IBV-M41. Our findings show that the protective efficacy of BV-Dual-S1 could be significantly enhanced by baculovirus display technology. BacMam virus-based surface display strategies could serve as effective tools in designing vaccines against IB and other infectious diseases. Copyright © 2013. Published by Elsevier Ltd.

Purification and properties of insulin receptor ectodomain from large-scale mammalian cell culture.

PubMed

Cosgrove, L; Lovrecz, G O; Verkuylen, A; Cavaleri, L; Black, L A; Bentley, J D; Howlett, G J; Gray, P P; Ward, C W; McKern, N M

1995-12-01

Ectodomain of the exon 11+ form of the human insulin receptor (hIR) was expressed in the mammalian cell secretion vector pEE6.HCMV-GS, containing the glutamine synthetase gene. Following transfection of the hIR ectodomain gene into Chinese hamster ovary (CHO-K1) cells, clones were isolated by selecting for glutamine synthetase expression with methionine sulphoximine. The expression levels of ectodomain were subsequently increased by gene amplification. Production was scaled up using a 40-liter airlift fermenter in which the transfected CHO-K1 cells were cultured on microcarrier beads, initially in medium containing 10% fetal calf serum (FCS). By continuous perfusion of serum-free medium into the bioreactor, cell viability was maintained during reduction of FCS, which enabled soluble hIR ectodomain to be harvested for at least 22 days. Harvests were concentrated 20-fold by anion-exchange chromatography. Optimal recovery of ectodomain from early harvests containing large quantities of serum proteins was achieved by insulin-affinity chromatography, whereas in later harvests purification was achieved by multistep chromatography. Analysis of the purified hIR ectodomain showed that it had a molecular weight by sedimentation equilibrium analysis of 269,500. Amino-terminal amino acid sequence analysis showed that the ectodomain was correctly processed to alpha and beta chains and that glycosylation characteristics were similar to those of native hIR. The integrity of the ectodomain was demonstrated by the recognition of conformation-dependent anti-hIR antibodies and by its binding of insulin (Kd approximately 2 x 10(-9) M). These results demonstrate the successful production and purification of hIR ectodomain by processes amenable to scale-up and in a form appropriate for structure/function studies of the ligand-binding domain of the receptor.

Current Good Manufacturing Practice Production of an Oncolytic Recombinant Vesicular Stomatitis Viral Vector for Cancer Treatment

PubMed Central

Meseck, M.; Derecho, I.; Lopez, P.; Knoblauch, C.; McMahon, R.; Anderson, J.; Dunphy, N.; Quezada, V.; Khan, R.; Huang, P.; Dang, W.; Luo, M.; Hsu, D.; Woo, S.L.C.; Couture, L.

2011-01-01

Abstract Vesicular stomatitis virus (VSV) is an oncolytic virus currently being investigated as a promising tool to treat cancer because of its ability to selectively replicate in cancer cells. To enhance the oncolytic property of the nonpathologic laboratory strain of VSV, we generated a recombinant vector [rVSV(MΔ51)-M3] expressing murine gammaherpesvirus M3, a secreted viral chemokine-binding protein that binds to a broad range of mammalian chemokines with high affinity. As previously reported, when rVSV(MΔ51)-M3 was used in an orthotopic model of hepatocellular carcinoma (HCC) in rats, it suppressed inflammatory cell migration to the virus-infected tumor site, which allowed for enhanced intratumoral virus replication leading to increased tumor necrosis and substantially prolonged survival. These encouraging results led to the development of this vector for clinical translation in patients with HCC. However, a scalable current Good Manufacturing Practice (cGMP)-compliant manufacturing process has not been described for this vector. To produce the quantities of high-titer virus required for clinical trials, a process that is amenable to GMP manufacturing and scale-up was developed. We describe here a large-scale (50-liter) vector production process capable of achieving crude titers on the order of 109 plaque-forming units (PFU)/ml under cGMP. This process was used to generate a master virus seed stock and a clinical lot of the clinical trial agent under cGMP with an infectious viral titer of approximately 2 × 1010 PFU/ml (total yield, 1 × 1013 PFU). The lot has passed all U.S. Food and Drug Administration-mandated release testing and will be used in a phase 1 clinical translational trial in patients with advanced HCC. PMID:21083425

Current good manufacturing practice production of an oncolytic recombinant vesicular stomatitis viral vector for cancer treatment.

PubMed

Ausubel, L J; Meseck, M; Derecho, I; Lopez, P; Knoblauch, C; McMahon, R; Anderson, J; Dunphy, N; Quezada, V; Khan, R; Huang, P; Dang, W; Luo, M; Hsu, D; Woo, S L C; Couture, L

2011-04-01

Vesicular stomatitis virus (VSV) is an oncolytic virus currently being investigated as a promising tool to treat cancer because of its ability to selectively replicate in cancer cells. To enhance the oncolytic property of the nonpathologic laboratory strain of VSV, we generated a recombinant vector [rVSV(MΔ51)-M3] expressing murine gammaherpesvirus M3, a secreted viral chemokine-binding protein that binds to a broad range of mammalian chemokines with high affinity. As previously reported, when rVSV(MΔ51)-M3 was used in an orthotopic model of hepatocellular carcinoma (HCC) in rats, it suppressed inflammatory cell migration to the virus-infected tumor site, which allowed for enhanced intratumoral virus replication leading to increased tumor necrosis and substantially prolonged survival. These encouraging results led to the development of this vector for clinical translation in patients with HCC. However, a scalable current Good Manufacturing Practice (cGMP)-compliant manufacturing process has not been described for this vector. To produce the quantities of high-titer virus required for clinical trials, a process that is amenable to GMP manufacturing and scale-up was developed. We describe here a large-scale (50-liter) vector production process capable of achieving crude titers on the order of 10(9) plaque-forming units (PFU)/ml under cGMP. This process was used to generate a master virus seed stock and a clinical lot of the clinical trial agent under cGMP with an infectious viral titer of approximately 2 × 10(10) PFU/ml (total yield, 1 × 10(13) PFU). The lot has passed all U.S. Food and Drug Administration-mandated release testing and will be used in a phase 1 clinical translational trial in patients with advanced HCC.

Stable 293 T and CHO cell lines expressing cleaved, stable HIV-1 envelope glycoprotein trimers for structural and vaccine studies.

PubMed

Chung, Nancy P Y; Matthews, Katie; Kim, Helen J; Ketas, Thomas J; Golabek, Michael; de Los Reyes, Kevin; Korzun, Jacob; Yasmeen, Anila; Sanders, Rogier W; Klasse, Per Johan; Wilson, Ian A; Ward, Andrew B; Marozsan, Andre J; Moore, John P; Cupo, Albert

2014-04-25

Recombinant soluble, cleaved HIV-1 envelope glycoprotein SOSIP.664 gp140 trimers based on the subtype A BG505 sequence are being studied structurally and tested as immunogens in animals. For these trimers to become a vaccine candidate for human trials, they would need to be made in appropriate amounts at an acceptable quality. Accomplishing such tasks by transient transfection is likely to be challenging. The traditional way to express recombinant proteins in large amounts is via a permanent cell line, usually of mammalian origin. Making cell lines that produce BG505 SOSIP.664 trimers requires the co-expression of the Furin protease to ensure that the cleavage site between the gp120 and gp41 subunits is fully utilized. We designed a vector capable of expressing Env and Furin, and used it to create Stable 293 T and CHO Flp-In™ cell lines through site-specific recombination. Both lines produce high quality, cleaved trimers at yields of up to 12-15 mg per 1 × 109 cells. Trimer expression at such levels was maintained for up to 30 days (10 passages) after initial seeding and was consistently superior to what could be achieved by transient transfection. Electron microscopy studies confirm that the purified trimers have the same native-like appearance as those derived by transient transfection and used to generate high-resolution structures. They also have appropriate antigenic properties, including the presentation of the quaternary epitope for the broadly neutralizing antibody PGT145. The BG505 SOSIP.664 trimer-expressing cell lines yield proteins of an appropriate quality for structural studies and animal immunogenicity experiments. The methodology is suitable for making similar lines under Good Manufacturing Practice conditions, to produce trimers for human clinical trials. Moreover, any env gene can be incorporated into this vector system, allowing the manufacture of SOSIP trimers from multiple genotypes, either by transient transfection or from stable cell lines.

Innate Immune Control of West Nile Virus Infection

PubMed Central

Arjona, Alvaro; Wang, Penghua; Montgomery, Ruth R.; Fikrig, Erol

2011-01-01

West Nile virus (WNV), from the Flaviviridae family, is a re-emerging zoonotic pathogen of medical importance. In humans, WNV infection may cause life-threatening meningoencephalitis or long-term neurologic sequelae. WNV is transmitted by Culex spp mosquitoes and both the arthropod vector and the mammalian host are equipped with antiviral innate immune mechanisms sharing a common phylogeny. As far as the current evidence is able to demonstrate, mosquitoes primarily rely on RNA interference, Toll, Imd and JAK-STAT signaling pathways for limiting viral infection, while mammals are provided with these and other more complex antiviral mechanisms involving antiviral effectors, inflammatory mediators, and cellular responses triggered by highly specialized pathogen detection mechanisms that often resemble their invertebrate ancestry. This mini-review summarizes our current understanding of how the innate immune systems of the vector and the mammalian host react to WNV infection and shape its pathogenesis. PMID:21790942

Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.

PubMed

Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu

2012-03-09

In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. Copyright © 2012 Elsevier Inc. All rights reserved.

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

Membrane penetrating peptides greatly enhance baculovirus transduction efficiency into mammalian cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Hong-Zhang; Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan, ROC; Wu, Carol P.

2011-02-11

Research highlights: {yields} Ligation of CTP with GP64 enhances baculovirus transduction into mammalian cells. {yields} Fusion of PTD with VP39 enhances baculovirus transduction into mammalian cells. {yields} CTP and PTD-carrying viruses improve the transduction of co-transduced baculoviruses. {yields} Virus entry and gene expression can be separate events in different cell types. -- Abstract: The baculovirus group of insect viruses is widely used for foreign gene introduction into mammalian cells for gene expression and protein production; however, the efficiency of baculovirus entry into mammalian cells is in general still low. In this study, two recombinant baculoviruses were engineered and their abilitymore » to improve viral entry was examined: (1) cytoplasmic transduction peptide (CTP) was fused with baculovirus envelope protein, GP64, to produce a cytoplasmic membrane penetrating baculovirus (vE-CTP); and (2) the protein transduction domain (PTD) of HIV TAT protein was fused with the baculovirus capsid protein VP39 to form a nuclear membrane penetrating baculovirus (vE-PTD). Transduction experiments showed that both viruses had better transduction efficiency than vE, a control virus that only expresses EGFP in mammalian cells. Interestingly, vE-CTP and vE-PTD were also able to improve the transduction efficiency of a co-transduced baculovirus, resulting in higher levels of gene expression. Our results have described new routes to further enhance the development of baculovirus as a tool for gene delivery into mammalian cells.« less

Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.

PubMed

Aricescu, A Radu; Owens, Raymond J

2013-06-01

Mammalian cells are rapidly becoming the system of choice for the production of recombinant glycoproteins for structural biology applications. Their use has enabled the structural investigation of a whole new set of targets including large, multi-domain and highly glycosylated eukaryotic cell surface receptors and their supra-molecular assemblies. We summarize the technical advances that have been made in mammalian expression technology and highlight some of the structural insights that have been obtained using these methods. Looking forward, it is clear that mammalian cell expression will provide exciting and unique opportunities for an integrative approach to the structural study of proteins, especially of human origin and medically relevant, by bridging the gap between the purified state and the cellular context. Copyright © 2013 Elsevier Ltd. All rights reserved.

Single-Vector, Single-Injection Recombinant Vesicular Stomatitis Virus Vaccines Against High-Containment Viruses.

PubMed

Whitt, Michael A; Geisbert, Thomas W; Mire, Chad E

2016-01-01

There are many avenues for making an effective vaccine against viruses. Depending on the virus these can include one of the following: inactivation of whole virions; attenuation of viruses; recombinant viral proteins; non-replication-competent virus particles; or surrogate virus vector systems such as vesicular stomatitis virus (VSV). VSV is a prototypic enveloped animal virus that has been used for over four decades to study virus replication, entry, and assembly due to its ability to replicate to high titers in a wide variety of mammalian and insect cells. The use of reverse genetics to recover infectious and single-cycle replicating VSV from plasmid DNA transfected in cell culture began a revolution in the study of recombinant VSV (rVSV). This platform can be manipulated to study the viral genetic sequences and proteins important in the virus life cycle. Additionally, foreign genes can be inserted between naturally occurring or generated start/stop signals and polyadenylation sites within the VSV genome. VSV has a tolerance for foreign gene expression which has led to numerous rVSVs reported in the literature. Of particular interest are the very effective single-dose rVSV vaccine vectors against high-containment viruses such as filoviruses, henipaviruses, and arenaviruses. Herein we describe the methods for selecting foreign antigenic genes, selecting the location within the VSV genome for insertion, generation of rVSV using reverse genetics, and proper vaccine study designs.

Structure and expression of canary myc family genes.

PubMed Central

Collum, R G; Clayton, D F; Alt, F W

1991-01-01

We found that the canary N-myc gene is highly related to mammalian N-myc genes in both the protein-coding region and the long 3' untranslated region. Examined coding regions of the canary c-myc gene were also highly related to their mammalian counterparts, but in contrast to N-myc, the canary and mammalian c-myc genes were quite divergent in their 3' untranslated regions. We readily detected N-myc and c-myc expression in the adult canary brain and found N-myc expression both at sites of proliferating neuronal precursors and in mature neurons. Images PMID:1996121

Cdc6 is regulated by E2F and is essential for DNA replication in mammalian cells.

PubMed

Yan, Z; DeGregori, J; Shohet, R; Leone, G; Stillman, B; Nevins, J R; Williams, R S

1998-03-31

Cdc6 has a critical regulatory role in the initiation of DNA replication in yeasts, but its function in mammalian cells has not been characterized. We show here that Cdc6 is expressed selectively in proliferating but not quiescent mammalian cells, both in culture and within tissues of intact animals. During the transition from a growth-arrested to a proliferative state, transcription of mammalian Cdc6 is regulated by E2F proteins, as revealed by a functional analysis of the human Cdc6 promoter and by the ability of exogenously expressed E2F proteins to stimulate the endogenous Cdc6 gene. Immunodepletion of Cdc6 by microinjection of anti-Cdc6 antibody blocks initiation of DNA replication in a human tumor cell line. We conclude that expression of human Cdc6 is regulated in response to mitogenic signals though transcriptional control mechanisms involving E2F proteins, and that Cdc6 is required for initiation of DNA replication in mammalian cells.

Comparative expression of the four enamel matrix protein genes, amelogenin, ameloblastin, enamelin and amelotin during amelogenesis in the lizard Anolis carolinensis.

PubMed

Gasse, Barbara; Sire, Jean-Yves

2015-01-01

In a recent study, we have demonstrated that amelotin (AMTN) gene structure and its expression during amelogenesis have changed during tetrapod evolution. Indeed, this gene is expressed throughout enamel matrix deposition and maturation in non-mammalian tetrapods, while in mammals its expression is restricted to the transition and maturation stages of amelogenesis. Previous studies of amelogenin (AMEL) gene expression in a lizard and a salamander have shown similar expression pattern to that in mammals, but to our knowledge there are no data regarding ameloblastin (AMBN) and enamelin (ENAM) expression in non-mammalian tetrapods. The present study aims to look at, and compare, the structure and expression of four enamel matrix protein genes, AMEL, AMBN, ENAM and AMTN during amelogenesis in the lizard Anolis carolinensis. We provide the full-length cDNA sequence of A. carolinensis AMEL and AMBN, and show for the first time the expression of ENAM and AMBN in a non-mammalian species. During amelogenesis in A. carolinensis, AMEL, AMBN and ENAM expression in ameloblasts is similar to that described in mammals. It is noteworthy that AMEL and AMBN expression is also found in odontoblasts. Our findings indicate that AMTN is the only enamel matrix protein gene that is differentially expressed in ameloblasts between mammals and sauropsids. Changes in AMTN structure and expression could be the key to explain the structural differences between mammalian and reptilian enamel, i.e. prismatic versus non-prismatic.

Molecular Detection of Bartonella Species in Blood-Feeding Bat Flies from Mexico.

PubMed

Moskaluk, Alexandra E; Stuckey, Matthew J; Jaffe, David A; Kasten, Rickie W; Aguilar-Setién, Alvaro; Olave-Leyva, José Ignacio; Galvez-Romero, Guillermo; Obregón-Morales, Cirani; Salas-Rojas, Mónica; García-Flores, María Martha; Aréchiga-Ceballos, Nidia; García-Baltazar, Anahí; Chomel, Bruno B

2018-05-01

Bartonellae are emerging blood-borne bacteria that have been recovered from a wide range of mammalian species and arthropod vectors around the world. Bats are now recognized as a potential wildlife reservoir for a diverse number of Bartonella species, including the zoonotic Candidatus B. mayotimonensis. These bat-borne Bartonella species have also been detected in the obligate ectoparasites of bats, such as blood-feeding flies, which could transmit these bacteria within bat populations. To better understand this potential for transmission, we investigated the relatedness between Bartonella detected or isolated from bat hosts sampled in Mexico and their ectoparasites. Bartonella spp. were identified in bat flies collected on two bat species, with the highest prevalence in Trichobius parasiticus and Strebla wiedemanni collected from common vampire bats (Desmodus rotundus). When comparing Bartonella sequences from a fragment of the citrate synthase gene (gltA), vector-associated strains were diverse and generally close to, but distinct from, those recovered from their bacteremic bat hosts in Mexico. Complete Bartonella sequence concordance was observed in only one bat-vector pair. The diversity of Bartonella strains in bat flies reflects the frequent host switch by bat flies, as they usually do not live permanently on their bat host. It may also suggest a possible endosymbiotic relationship with these vectors for some of the Bartonella species carried by bat flies, whereas others could have a mammalian host.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Vector-Host Interactions of Culiseta melanura in a Focus of Eastern Equine Encephalitis Virus Activity in Southeastern Virginia.

PubMed

Molaei, Goudarz; Armstrong, Philip M; Abadam, Charles F; Akaratovic, Karen I; Kiser, Jay P; Andreadis, Theodore G

2015-01-01

Eastern equine encephalitis virus (EEEV) causes a highly pathogenic mosquito-borne zoonosis that is responsible for sporadic outbreaks of severe illness in humans and equines in the eastern USA. Culiseta (Cs.) melanura is the primary vector of EEEV in most geographic regions but its feeding patterns on specific avian and mammalian hosts are largely unknown in the mid-Atlantic region. The objectives of our study were to: 1) identify avian hosts of Cs. melanura and evaluate their potential role in enzootic amplification of EEEV, 2) assess spatial and temporal patterns of virus activity during a season of intense virus transmission, and 3) investigate the potential role of Cs. melanura in epidemic/epizootic transmission of EEEV to humans and equines. Accordingly, we collected mosquitoes at 55 sites in Suffolk, Virginia in 2013, and identified the source of blood meals in engorged mosquitoes by nucleotide sequencing PCR products of the mitochondrial cytochrome b gene. We also examined field-collected mosquitoes for evidence of infection with EEEV using Vector Test, cell culture, and PCR. Analysis of 188 engorged Cs. melanura sampled from April through October 2013 indicated that 95.2%, 4.3%, and 0.5% obtained blood meals from avian, mammalian, and reptilian hosts, respectively. American Robin was the most frequently identified host for Cs. melanura (42.6% of blood meals) followed by Northern Cardinal (16.0%), European Starling (11.2%), Carolina Wren (4.3%), and Common Grackle (4.3%). EEEV was detected in 106 mosquito pools of Cs. melanura, and the number of virus positive pools peaked in late July with 22 positive pools and a Maximum Likelihood Estimation (MLE) infection rate of 4.46 per 1,000 mosquitoes. Our findings highlight the importance of Cs. melanura as a regional EEEV vector based on frequent feeding on virus-competent bird species. A small proportion of blood meals acquired from mammalian hosts suggests the possibility that this species may occasionally contribute to epidemic/epizootic transmission of EEEV.

TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

PubMed

Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

2014-01-24

Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Dedifferentiated adenoid cystic carcinoma of the trachea: a case report with respect to the immunohistochemical analyses of mammalian target of rapamycin pathway proteins.

PubMed

Ishida, Mitsuaki; Okabe, Hidetoshi

2013-08-01

Dedifferentiated adenoid cystic carcinoma is an extremely rare and highly aggressive tumor. We describe the first reported case of dedifferentiated adenoid cystic carcinoma of the trachea and analyze the expression profiles of mammalian target of rapamycin pathway proteins. A 66-year-old Japanese man was incidentally found to have stenosis of the trachea, and a bronchial biopsy revealed low-grade adenoid cystic carcinoma. The resected specimen revealed dedifferentiated adenoid cystic carcinoma, which was composed of conventional low-grade adenoid cystic carcinoma with tubular and cribriform patterns, and a dedifferentiated carcinoma component (poorly differentiated adenocarcinoma). Immunohistochemical study showed that mammalian target of rapamycin and 4E-BP1 were expressed in both components; however, phosphorylated 4E-BP1 was expressed only in the dedifferentiated carcinoma component. This report clearly demonstrates that mammalian target of rapamycin pathway proteins were activated in dedifferentiated carcinoma. Mammalian target of rapamycin is a central protein involved in carcinogenesis, and administration of its inhibitors prolonged survival in some types of carcinoma. Therefore, mammalian target of rapamycin inhibitors may be a potential candidate for treatment of this highly aggressive carcinoma. Copyright © 2013 Elsevier Inc. All rights reserved.

Stability of Lentiviral Vector-Mediated Transgene Expression in the Brain in the Presence of Systemic Antivector Immune Responses

PubMed Central

ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.

2009-01-01

Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605

Innate Mammalian Immune Response to Culicoides Feeding

USDA-ARS?s Scientific Manuscript database

Hematophagous Culicoides spp. biting midges are of great agricultural importance as livestock and wildlife pests and as vectors of orbiviruses such as bluetongue, epizootic hemorrhagic disease, and African horse sickness viruses, as well as vesicular stomatitis, bovine ephemeral fever and Schmallenb...

Gene therapy in the inner ear using adenovirus vectors.

PubMed

Husseman, Jacob; Raphael, Yehoash

2009-01-01

Therapies for the protection and regeneration of auditory hair cells are of great interest given the significant monetary and lifestyle impact of hearing loss. The past decade has seen tremendous advances in the use of adenoviral vectors to achieve these aims. Preliminary data demonstrated the functional capacity of this technique as adenoviral-induced expression of neurotrophic and growth factors protected hair cells and spiral ganglion neurons from ototoxic insults. Subsequent efforts confirmed the feasibility of adenoviral transfection of cells in the auditory neuroepithelium via cochleostomy into the scala media. Most recently, efforts have focused on regeneration of depleted hair cells. Mammalian hearing loss is generally considered a permanent insult as the auditory epithelium lacks a basal layer capable of producing new hair cells. Recently, the transcription factor Atoh1 has been found to play a critical role in hair cell differentiation. Adenoviral-mediated overexpression of Atoh1 in culture and in vivo have shown the ability to regenerate auditory and vestibular hair cells by causing transdifferentiation of neighboring epithelial-supporting cells. Functional recovery of both the auditory and vestibular systems has been documented following adenoviral induced Atoh1 overexpression. Copyright (c) 2009 S. Karger AG, Basel.

Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

PubMed Central

Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.

1999-01-01

The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005

Display of HIV-1 Envelope Protein on Lambda Phage Scaffold as a Vaccine Platform.

PubMed

Mattiacio, Jonelle L; Brewer, Matt; Dewhurst, Stephen

2017-01-01

The generation of a strong antibody response to target antigens is a major goal for vaccine development. Here we describe the display of the human immunodeficiency virus (HIV) envelope spike protein (Env) on a virus-like scaffold provided by the lambda phage capsid. Phage vectors, in general, have advantages over mammalian virus vectors due to their genetic tractability, inexpensive production, suitability for scale-up, as well as their physical stability, making them an attractive vaccine platform.

More than just trash bins? Potential roles for extracellular vesicles in the vertical and horizontal transmission of yeast prions.

PubMed

Kabani, Mehdi; Melki, Ronald

2016-05-01

In the yeast Saccharomyces cerevisiae, an ensemble of structurally and functionally diverse cytoplasmic proteins has the ability to form self-perpetuating protein aggregates (e.g. prions) which are the vectors of heritable non-Mendelian phenotypic traits. Whether harboring these prions is deleterious-akin to mammalian degenerative disorders-or beneficial-as epigenetic modifiers of gene expression-for yeasts has been intensely debated and strong arguments were made in support of both views. We recently reported that the yeast prion protein Sup35p is exported via extracellular vesicles (EV), both in its soluble and aggregated infectious states. Herein, we discuss the possible implications of this observation and propose several hypotheses regarding the roles of EV in both vertical and horizontal propagation of 'good' and 'bad' yeast prions.

Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

PubMed

Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

2015-04-01

Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

Significant differences in genotoxicity induced by retrovirus integration in human T cells and induced pluripotent stem cells.

PubMed

Zheng, Weiyan; Wang, Yingjia; Chang, Tammy; Huang, He; Yee, Jiing-Kuan

2013-04-25

Retrovirus is frequently used in the genetic modification of mammalian cells and the establishment of induced pluripotent stem cells (iPSCs) via cell reprogramming. Vector-induced genotoxicity could induce profound effect on the physiology and function of these stem cells and their differentiated progeny. We analyzed retrovirus-induced genotoxicity in somatic cell Jurkat and two iPSC lines. In Jurkat cells, retrovirus frequently activated host gene expression and gene activation was not dependent on the distance between the integration site and the transcription start site of the host gene. In contrast, retrovirus frequently down-regulated host gene expression in iPSCs, possibly due to the action of chromatin silencing that spreads from the provirus to the nearby host gene promoter. Our data raises the issue that some of the phenotypic variability observed among iPSC clones derived from the same parental cell line may be caused by retrovirus-induced gene expression changes rather than by the reprogramming process itself. It also underscores the importance of characterizing retrovirus integration and carrying out risk assessment of iPSCs before they can be applied in basic research and clinics. Copyright © 2013 Elsevier B.V. All rights reserved.

Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

MicroRNA let-7b regulates neural stem cell proliferation and differentiation by targeting nuclear receptor TLX signaling

PubMed Central

Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Lang, Ming-Fei; Yang, Su; Li, Wendong; Shi, Yanhong

2010-01-01

Neural stem cell self-renewal and differentiation is orchestrated by precise control of gene expression involving nuclear receptor TLX. Let-7b, a member of the let-7 microRNA family, is expressed in mammalian brains and exhibits increased expression during neural differentiation. However, the role of let-7b in neural stem cell proliferation and differentiation remains unknown. Here we show that let-7b regulates neural stem cell proliferation and differentiation by targeting the stem cell regulator TLX and the cell cycle regulator cyclin D1. Overexpression of let-7b led to reduced neural stem cell proliferation and increased neural differentiation, whereas antisense knockdown of let-7b resulted in enhanced proliferation of neural stem cells. Moreover, in utero electroporation of let-7b to embryonic mouse brains led to reduced cell cycle progression in neural stem cells. Introducing an expression vector of Tlx or cyclin D1 that lacks the let-7b recognition site rescued let-7b-induced proliferation deficiency, suggesting that both TLX and cyclin D1 are important targets for let-7b-mediated regulation of neural stem cell proliferation. Let-7b, by targeting TLX and cyclin D1, establishes an efficient strategy to control neural stem cell proliferation and differentiation. PMID:20133835

MicroRNA let-7b regulates neural stem cell proliferation and differentiation by targeting nuclear receptor TLX signaling.

PubMed

Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Lang, Ming-Fei; Yang, Su; Li, Wendong; Shi, Yanhong

2010-02-02

Neural stem cell self-renewal and differentiation is orchestrated by precise control of gene expression involving nuclear receptor TLX. Let-7b, a member of the let-7 microRNA family, is expressed in mammalian brains and exhibits increased expression during neural differentiation. However, the role of let-7b in neural stem cell proliferation and differentiation remains unknown. Here we show that let-7b regulates neural stem cell proliferation and differentiation by targeting the stem cell regulator TLX and the cell cycle regulator cyclin D1. Overexpression of let-7b led to reduced neural stem cell proliferation and increased neural differentiation, whereas antisense knockdown of let-7b resulted in enhanced proliferation of neural stem cells. Moreover, in utero electroporation of let-7b to embryonic mouse brains led to reduced cell cycle progression in neural stem cells. Introducing an expression vector of Tlx or cyclin D1 that lacks the let-7b recognition site rescued let-7b-induced proliferation deficiency, suggesting that both TLX and cyclin D1 are important targets for let-7b-mediated regulation of neural stem cell proliferation. Let-7b, by targeting TLX and cyclin D1, establishes an efficient strategy to control neural stem cell proliferation and differentiation.

Response of the flat cochlear epithelium to forced expression of Atoh1.

PubMed

Izumikawa, Masahiko; Batts, Shelley A; Miyazawa, Toru; Swiderski, Donald L; Raphael, Yehoash

2008-06-01

Following hair cell elimination in severely traumatized cochleae, differentiated supporting cells are often replaced by a simple epithelium with cuboidal or flat appearance. Atoh1 (previously Math1) is a basic helix-loop-helix transcription factor critical to hair cell differentiation during mammalian embryogenesis. Forced expression of Atoh1 in the differentiated supporting cell population can induce transdifferentiation leading to hair cell regeneration. Here, we examined the outcome of adenovirus mediated over-expression of Atoh1 in the non-sensory cells of the flat epithelium. We determined that seven days after unilateral elimination of hair cells with neomycin, differentiated supporting cells are absent, replaced by a flat epithelium. Nerve processes were also missing from the auditory epithelium, with the exception of infrequent looping nerve processes above the habenula perforata. We then inoculated an adenovirus vector with Atoh1 insert into the scala media of the deafened cochlea. The inoculation resulted in upregulation of Atoh1 in the flat epithelium. However, two months after the inoculation, Atoh1-treated ears did not exhibit clear signs of hair cell regeneration. Combined with previous data on induction of supporting cell to hair cell transdifferentiation by forced expression of Atoh1, these results suggest that the presence of differentiated supporting cells in the organ of Corti is necessary for transdifferentiation to occur.

Expression, purification and characterisation of recombinant Escherichia coli derived chicken interleukin-12.

PubMed

Thomas, Jesse D; Morris, Kirsten R; Godfrey, Dale I; Lowenthal, John W; Bean, Andrew G D

2008-12-15

Zoonotic viruses, such as H5N1 Avian Influenza, pose major threats to both animals and humans, and with this in mind there is a need for the development of new anti-viral strategies. The cytokine interleukin-12 (IL-12) is known to play a pivotal regulatory role in the anti-viral response due to its role in the induction of the key anti-viral cytokine IFN-gamma. Therefore, strategies which provide a means for the production of therapeutic quantities of IL-12 may be of major benefit. Here we describe the development of biologically active Escherichia coli (E. coli) derived chicken IL-12 (ChIL-12). The single chain ChIL-12 gene was cloned into the pET32b expression vector, transformed into the BL-21 E. coli strain and expression induced with IPTG. Over expressed protein was solubilised with zwittergent detergent and isolated utilising Nickel ion affinity chromatography. Biological activity was determined as ChIL-12 stimulated proliferation of pre-treated T-cells in vitro. This study is the first example of a biologically active E. coli derived IL-12 from a non-mammalian vertebrate subsequently providing a means for testing the anti-viral therapeutic potential of ChIL-12 in an in vivo model.

Bivalent monoclonal IgY antibody formats by conversion of recombinant antibody fragments.

PubMed

Greunke, Kerstin; Spillner, Edzard; Braren, Ingke; Seismann, Henning; Kainz, Sabine; Hahn, Ulrich; Grunwald, Thomas; Bredehorst, Reinhard

2006-07-13

Monoclonal IgY have the potential to become unique tools for diagnostic research and therapeutic purposes since avian antibodies provide several advantages due to their phylogenetic difference when compared to mammalian antibodies. The mechanism of avian immunoglobulin gene diversification renders chicken an excellent source for the generation of recombinant scFv as well as Fab antibody libraries of high diversity. One major limitation of these antibody fragments, however, is their monovalent format, impairing the functional affinity of the molecules and, thereby, their applicability in prevalent laboratory methods. In this study, we generated vectors for conversion of avian recombinant antibody fragments into different types of bivalent IgY antibody formats. To combine the properties of established mammalian monoclonal antibodies with those of IgY constant domains, we additionally generated bivalent murine/avian chimeric antibody constructs. When expressed in HEK-293 cells, all constructs yielded bivalent disulfide-linked antibodies, which exhibit a glycosylation pattern similar to that of native IgY as assessed by lectin blot analysis. After purification by one step procedures, the chimeric and the entire avian bivalent antibody formats were analyzed for antigen binding and interaction with secondary reagents. The data demonstrate that all antibody formats provide comparable antigen binding characteristics and the well established properties of avian constant domains.

Evolutionary Patterns of RNA-Based Duplication in Non-Mammalian Chordates

PubMed Central

Li, Xin; Vibranovski, Maria D.; Gan, Xiaoni; Wang, Dengqiang; Wang, Wen; Long, Manyuan; He, Shunping

2011-01-01

The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes. PMID:21779328

Global repression of host-associated genes of the Lyme disease spirochete through post-transcriptional modulation of the alternative sigma factor RpoS.

PubMed

Dulebohn, Daniel P; Hayes, Beth M; Rosa, Patricia A

2014-01-01

Borrelia burgdorferi, the agent of Lyme disease, is a vector-borne pathogen that transits between Ixodes ticks and vertebrate hosts. During the natural infectious cycle, spirochetes must globally adjust their transcriptome to survive in these dissimilar environments. One way B. burgdorferi accomplishes this is through the use of alternative sigma factors to direct transcription of specific genes. RpoS, one of only three sigma factors in B. burgdorferi, controls expression of genes required during tick-transmission and infection of the mammalian host. How spirochetes switch between different sigma factors during the infectious cycle has remained elusive. Here we establish a role for a novel protein, BBD18, in the regulation of the virulence-associated sigma factor RpoS. Constitutive expression of BBD18 repressed transcription of RpoS-dependent genes to levels equivalent to those observed in an rpoS mutant. Consistent with the global loss of RpoS-dependent transcripts, we were unable to detect RpoS protein. However, constitutive expression of BBD18 did not diminish the amount of rpoS transcript, indicating post-transcriptional regulation of RpoS by BBD18. Interestingly, BBD18-mediated repression of RpoS is independent of both the rpoS promoter and the 5' untranslated region, suggesting a mechanism of protein destabilization rather than translational control. We propose that BBD18 is a novel regulator of RpoS and its activity likely represents a first step in the transition from an RpoS-ON to an RpoS-OFF state, when spirochetes transition from the host to the tick vector.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasek, Marta; Boeggeman, Elizabeth; Ramakrishnan, Boopathy

The expression of recombinant proteins in Escherichia coli often leads to inactive aggregated proteins known as the inclusion bodies. To date, the best available tool has been the use of fusion tags, including the carbohydrate-binding protein; e.g., the maltose-binding protein (MBP) that enhances the solubility of recombinant proteins. However, none of these fusion tags work universally with every partner protein. We hypothesized that galectins, which are also carbohydrate-binding proteins, may help as fusion partners in folding the mammalian proteins in E. coli. Here we show for the first time that a small soluble lectin, human galectin-1, one member of amore » large galectin family, can function as a fusion partner to produce soluble folded recombinant human glycosyltransferase, {beta}-1,4-galactosyltransferase-7 ({beta}4Gal-T7), in E. coli. The enzyme {beta}4Gal-T7 transfers galactose to xylose during the synthesis of the tetrasaccharide linker sequence attached to a Ser residue of proteoglycans. Without a fusion partner, {beta}4Gal-T7 is expressed in E. coli as inclusion bodies. We have designed a new vector construct, pLgals1, from pET-23a that includes the sequence for human galectin-1, followed by the Tev protease cleavage site, a 6x His-coding sequence, and a multi-cloning site where a cloned gene is inserted. After lactose affinity column purification of galectin-1-{beta}4Gal-T7 fusion protein, the unique protease cleavage site allows the protein {beta}4Gal-T7 to be cleaved from galectin-1 that binds and elutes from UDP-agarose column. The eluted protein is enzymatically active, and shows CD spectra comparable to the folded {beta}4Gal-T1. The engineered galectin-1 vector could prove to be a valuable tool for expressing other proteins in E. coli.« less

Agent-based mathematical modeling as a tool for estimating Trypanosoma cruzi vector-host contact rates.

PubMed

Yong, Kamuela E; Mubayi, Anuj; Kribs, Christopher M

2015-11-01

The parasite Trypanosoma cruzi, spread by triatomine vectors, affects over 100 mammalian species throughout the Americas, including humans, in whom it causes Chagas' disease. In the U.S., only a few autochthonous cases have been documented in humans, but prevalence is high in sylvatic hosts (primarily raccoons in the southeast and woodrats in Texas). The sylvatic transmission of T. cruzi is spread by the vector species Triatoma sanguisuga and Triatoma gerstaeckeri biting their preferred hosts and thus creating multiple interacting vector-host cycles. The goal of this study is to quantify the rate of contacts between different host and vector species native to Texas using an agent-based model framework. The contact rates, which represent bites, are required to estimate transmission coefficients, which can be applied to models of infection dynamics. In addition to quantitative estimates, results confirm host irritability (in conjunction with host density) and vector starvation thresholds and dispersal as determining factors for vector density as well as host-vector contact rates. Copyright © 2015 Elsevier B.V. All rights reserved.

Curing genetic disease with gene therapy.

PubMed

Williams, David A

2014-01-01

Development of viral vectors that allow high efficiency gene transfer into mammalian cells in the early 1980s foresaw the treatment of severe monogenic diseases in humans. The application of gene transfer using viral vectors has been successful in diseases of the blood and immune systems, albeit with several curative studies also showing serious adverse events (SAEs). In children with X-linked severe combined immunodeficiency (SCID-X1), chronic granulomatous disease, and Wiskott-Aldrich syndrome, these SAEs were caused by inappropriate activation of oncogenes. Subsequent studies have defined the vector sequences responsible for these transforming events. Members of the Transatlantic Gene Therapy Consortium [TAGTC] have collaboratively developed new vectors that have proven safer in preclinical studies and used these vectors in new clinical trials in SCID-X1. These trials have shown evidence of early efficacy and preliminary integration analysis data from the SCID-X1 trial suggest an improved safety profile.

Curing Genetic Disease with Gene Therapy

PubMed Central

Williams, David A.

2014-01-01

Development of viral vectors that allow high efficiency gene transfer into mammalian cells in the early 1980s foresaw the treatment of severe monogenic diseases in humans. The application of gene transfer using viral vectors has been successful in diseases of the blood and immune systems, albeit with several curative studies also showing serious adverse events (SAEs). In children with X-linked severe combined immunodeficiency (SCID-X1), chronic granulomatous disease, and Wiskott-Aldrich syndrome, these SAEs were caused by inappropriate activation of oncogenes. Subsequent studies have defined the vector sequences responsible for these transforming events. Members of the Transatlantic Gene Therapy Consortium [TAGTC] have collaboratively developed new vectors that have proven safer in preclinical studies and used these vectors in new clinical trials in SCID-X1. These trials have shown evidence of early efficacy and preliminary integration analysis data from the SCID-X1 trial suggest an improved safety profile. PMID:25125725

Effects of Simulated Weightlessness on Mammalian Development. Part 2: Meiotic Maturation of Mouse Oocytes During Clinostat Rotation

NASA Technical Reports Server (NTRS)

Wolgemuth, D. J.; Grills, G. S.

1985-01-01

In order to understand the role of gravity in basic cellular processes that are important during development, the effects of a simulated microgravity environment on mammalian gametes and early embryos cultured in vitro are examined. A microgravity environment is simulated by use of a clinostat, which essentially reorients cells relative to the gravity vector. Initial studies have focused on assessing the effects of clinostat rotation on the meiotic progression of mouse oocytes. Modifications centered on providing the unique in vitro culture of the clinostat requirements of mammalian oocytes and embryos: 37 C temperature, constant humidity, and a 5% CO2 in air environment. The oocytes are observed under the dissecting microscope for polar body formation and gross morphological appearance. They are then processed for cytogenetic analysis.

Vaccinia-related kinase 3 (VRK3) sets the circadian period and amplitude by affecting the subcellular localization of clock proteins in mammalian cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Nayoung; Department of Brain Science, Ajou University School of Medicine, 164 Worldcup-ro, Yeongtong-gu, Suwon, Kyunggi-do, 16499; Song, Jieun

In the eukaryotic circadian clock machinery, negative feedback repression of CLOCK (CLK) and BMAL1 transcriptional activity by PERIOD (PER) and CRYPTOCHROME (CRY) underlies the basis for 24 h rhythmic gene expression. Thus, precise regulation of the time-dependent nuclear entry of circadian repressors is crucial to generating normal circadian rhythms. Here, we sought to identify novel kinase(s) that regulate nuclear entry of mammalian CRY1 (mCRY1) with an unbiased screening using red fluorescent protein (RFP)-tagged human kinome expression plasmids in mammalian cells. Transient expression of human vaccinia-related kinase 3 (hVRK3) reduced the nuclear presence of mCRY1. hVRK3 expression also induced alterations in themore » subcellular localization of other core clock proteins, including mCRY2, mPER2, and BMAL1. In contrast, the subcellular localization of mCLK was not changed. Given that singly expressed mCLK mostly resides in the cytoplasm and that nuclear localization sequence (NLS) mutation of hVRK3 attenuated the effect of hVRK3 co-expression on subcellular localization, ectopically expressed hVRK3 presumably reduces the retention of proteins in the nucleus. Finally, downregulation of hvrk3 using siRNA reduced the amplitude and lengthened the period of the cellular bioluminescence rhythm. Taken together, these data suggest that VRK3 plays a role in setting the amplitude and period length of circadian rhythms in mammalian cells. - Highlights: • Screening was performed to identify kinases that regulate CRY1 subcellular localization. • VRK3 alters the subcellular localization of CRY1, CRY2, PER2, and BMAL1. • VRK3 knock-down alters the circadian bioluminescence rhythm in mammalian cells.« less

Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells.

PubMed

Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y

2016-05-20

Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning 2 orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality.

Reversion of multidrug resistance in the P-glycoprotein-positive human pancreatic cell line (EPP85-181RDB) by introduction of a hammerhead ribozyme.

PubMed Central

Holm, P. S.; Scanlon, K. J.; Dietel, M.

1994-01-01

A major problem in cytostatic treatment of many tumours is the development of multidrug resistance (MDR4). This is most often accompanied by the overexpression of a membrane transport protein, P-glycoprotein, and its encoding mRNA. In order to reverse the resistant phenotype in cell cultures, we constructed a specific hammerhead ribozyme possessing catalytic activity that cleaves the 3'-end of the GUC sequence in codon 880 of the mdr1 mRNA. We demonstrated that the constructed ribozyme is able to cleave a reduced substrate mdr1 mRNA at the GUC position under physiological conditions in a cell-free system. A DNA sequence encoding the ribozyme gene was then incorporated into a mammalian expression vector (pH beta APr-1 neo) and transfected into the human pancreatic carcinoma cell line EPP85-181RDB, which is resistant to daunorubicin and expresses the MDR phenotype. The expressed ribozyme decreased the level of mdr1 mRNA expression, inhibited the formation of P-glycoprotein and reduced the cell's resistance to daunorubicin dramatically; this means that the resistant cells were 1,600-fold more resistant than the parental cell line (EPP85-181P), whereas those cell clones that showed ribozyme expression were only 5.3-fold more resistant than the parental cell line. Images Figure 1 Figure 3 Figure 2 PMID:7914421

Construction of an Expression System for Bioactive IL-18 and Generation of Recombinant Canine Distemper Virus Expressing IL-18

PubMed Central

LIU, Yuxiu; SATO, Hiroki; HAMANA, Masahiro; MOONAN, Navita Anisia; YONEDA, Misako; XIA, Xianzhu; KAI, Chieko

2014-01-01

ABSTRACT Interleukin 18 (IL-18) plays an important role in the T-helper-cell type 1 immune response against intracellular parasites, bacteria and viral infections. It has been widely used as an adjuvant for vaccines and as an anticancer agent. However, IL-18 protein lacks a typical signal sequence and requires cleavage into its mature active form by caspase 1. In this study, we constructed mammalian expression vectors carrying cDNA encoding mature canine IL-18 (cIL-18) or mouse IL-18 (mIL-18) fused to the human IL-2 (hIL-2) signal sequence. The expressed proIL-18 proteins were processed to their mature forms in the cells. The supernatants of cells transfected with these plasmids induced high interferon-γ production in canine peripheral blood mononuclear cells or mouse splenocytes, respectively, indicating the secretion of bioactive IL-18. Using reverse genetics, we also generated a recombinant canine distemper virus that expresses cIL-18 or mIL-18 fused to the hIL-2 signal sequence. As expected, both recombinant viruses produced mature IL-18 in the infected cells, which secreted bioactive IL-18. These results indicate that the signal sequence from hIL-2 is suitable for the secretion of mature IL-18. These recombinant viruses can also potentially be used as immunoadjuvants and agents for anticancer therapies in vivo. PMID:24898077

Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

PubMed

Vassella, Erik; Probst, Matthias; Schneider, André; Studer, Erwin; Renggli, Christina Kunz; Roditi, Isabel

2004-09-01

In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

Construction of an expression system for bioactive IL-18 and generation of recombinant canine distemper virus expressing IL-18.

PubMed

Liu, Yuxiu; Sato, Hiroki; Hamana, Masahiro; Moonan, Navita Anisia; Yoneda, Misako; Xia, Xianzhu; Kai, Chieko

2014-09-01

Interleukin 18 (IL-18) plays an important role in the T-helper-cell type 1 immune response against intracellular parasites, bacteria and viral infections. It has been widely used as an adjuvant for vaccines and as an anticancer agent. However, IL-18 protein lacks a typical signal sequence and requires cleavage into its mature active form by caspase 1. In this study, we constructed mammalian expression vectors carrying cDNA encoding mature canine IL-18 (cIL-18) or mouse IL-18 (mIL-18) fused to the human IL-2 (hIL-2) signal sequence. The expressed proIL-18 proteins were processed to their mature forms in the cells. The supernatants of cells transfected with these plasmids induced high interferon-γ production in canine peripheral blood mononuclear cells or mouse splenocytes, respectively, indicating the secretion of bioactive IL-18. Using reverse genetics, we also generated a recombinant canine distemper virus that expresses cIL-18 or mIL-18 fused to the hIL-2 signal sequence. As expected, both recombinant viruses produced mature IL-18 in the infected cells, which secreted bioactive IL-18. These results indicate that the signal sequence from hIL-2 is suitable for the secretion of mature IL-18. These recombinant viruses can also potentially be used as immunoadjuvants and agents for anticancer therapies in vivo.

Optoporation of impermeable molecules and genes for visualization and activation of cells

NASA Astrophysics Data System (ADS)

Dhakal, Kamal; Batbyal, Subrata; Kim, Young-Tae; Mohanty, Samarendra

2015-03-01

Visualization, activation, and detection of the cell(s) and their electrical activity require delivery of exogenous impermeable molecules and targeted expression of genes encoding labeling proteins, ion-channels and voltage indicators. While genes can be delivered by viral vector to cells, delivery of other impermeable molecules into the cytoplasm of targeted cells requires microinjection by mechanical needle or microelectrodes, which pose significant challenge to the viability of the cells. Further, it will be useful to localize the expression of the targeted molecules not only in specific cell types, but to specific cells in restricted spatial regions. Here, we report use of focused near-infrared (NIR) femtosecond laser beam to transiently perforate targeted cell membrane to insert genes encoding blue light activatable channelrhodopsin-2 (ChR2) and red-shifted opsin (ReachR). Optoporation of nanomolar concentrations of rhodamine phalloidin (an impermeable dye molecule for staining filamentous actin) into targeted living mammalian cells (both HEK and primary cortical neurons) is also achieved allowing imaging of dynamics and intact morphology of cellular structures without requiring fixation.

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

Mapping analysis of scaffold/matrix attachment regions (s/MARs) from two different mammalian cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pilus, Nur Shazwani Mohd; Ahmad, Azrin; Yusof, Nurul Yuziana Mohd

Scaffold/matrix attachment regions (S/MARs) are potential element that can be integrated into expression vector to increase expression of recombinant protein. Many studies on S/MAR have been done but none has revealed the distribution of S/MAR in a genome. In this study, we have isolated S/MAR sequences from HEK293 and Chinese hamster ovary cell lines (CHO DG44) using two different methods utilizing 2 M NaCl and lithium-3,5-diiodosalicylate (LIS). The isolated S/MARs were sequenced using Next Generation Sequencing (NGS) platform. Based on reference mapping analysis against human genome database, a total of 8,994,856 and 8,412,672 contigs of S/MAR sequences were retrieved frommore » 2M NaCl and LIS extraction of HEK293 respectively. On the other hand, reference mapping analysis of S/MAR derived from CHO DG44 against our own CHO DG44 database have generated a total of 7,204,348 and 4,672,913 contigs from 2 M NaCl and LIS extraction method respectively.« less

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Progress and prospects: foamy virus vectors enter a new age.

PubMed

Erlwein, O; McClure, M O

2010-12-01

Foamy viruses, distantly related to the major subfamily of Retroviruses, Orthoretroviruses that include oncoviruses (for example, murine leukemia virus (MLV)) and lentiviruses (human immunodeficiency virus (HIV)), are endemic in mammalian species, but not in human populations. Humans infected by accidental or occupational exposure remain well. The virus is not transmitted to others, nor is it associated with any disease. These features added to its broad host range, efficient transduction of progenitor cells and an integration profile less likely to induce insertional mutagenesis, make these viruses attractive as vectors. Long-term reversal of disease phenotype in dogs with the genetic defect, leukocyte adhesion deficiency, by foamy virus vector therapy strengthens the case for their clinical exploitation.

A new theory of phylogeny inference through construction of multidimensional vector space.

PubMed

Kitazoe, Y; Kurihara, Y; Narita, Y; Okuhara, Y; Tominaga, A; Suzuki, T

2001-05-01

Here, a new theory of molecular phylogeny is developed in a multidimensional vector space (MVS). The molecular evolution is represented as a successive splitting of branch vectors in the MVS. The end points of these vectors are the extant species and indicate the specific directions reflected by their individual histories of evolution in the past. This representation makes it possible to infer the phylogeny (evolutionary histories) from the spatial positions of the end points. Search vectors are introduced to draw out the groups of species distributed around them. These groups are classified according to the nearby order of branches with them. A law of physics is applied to determine the species positions in the MVS. The species are regarded as the particles moving in time according to the equation of motion, finally falling into the lowest-energy state in spite of their randomly distributed initial condition. This falling into the ground state results in the construction of an MVS in which the relative distances between two particles are equal to the substitution distances. The species positions are obtained prior to the phylogeny inference. Therefore, as the number of species increases, the species vectors can be more specific in an MVS of a larger size, such that the vector analysis gives a more stable and reliable topology. The efficacy of the present method was examined by using computer simulations of molecular evolution in which all the branch- and end-point sequences of the trees are known in advance. In the phylogeny inference from the end points with 100 multiple data sets, the present method consistently reconstructed the correct topologies, in contrast to standard methods. In applications to 185 vertebrates in the alpha-hemoglobin, the vector analysis drew out the two lineage groups of birds and mammals. A core member of the mammalian radiation appeared at the base of the mammalian lineage. Squamates were isolated from the bird lineage to compose the outgroup, while the other living reptilians were directly coupled with birds without forming any sister groups. This result is in contrast to the morphological phylogeny and is also different from those of recent molecular analyses.

Production of recombinant adeno-associated vectors using two bioreactor configurations at different scales

PubMed Central

Negrete, Alejandro; Kotin, Robert M.

2007-01-01

The conventional methods for producing recombinant adeno-associated virus (rAAV) rely on transient transfection of adherent mammalian cells. To gain acceptance and achieve current good manufacturing process (cGMP) compliance, clinical grade rAAV production process should have the following qualities: simplicity, consistency, cost effectiveness, and scalability. Currently, the only viable method for producing rAAV in large-scale, e.g.≥1016 particles per production run, utilizes Baculovirus Expression Vectors (BEVs) and insect cells suspension cultures. The previously described rAAV production in 40 L culture using a stirred tank bioreactor requires special conditions for implementation and operation not available in all laboratories. Alternatives to producing rAAV in stirred-tank bioreactors are single-use, disposable bioreactors, e.g. Wave™. The disposable bags are purchased pre-sterilized thereby eliminating the need for end-user sterilization and also avoiding cleaning steps between production runs thus facilitating the production process. In this study, rAAV production in stirred tank and Wave™ bioreactors was compared. The working volumes were 10 L and 40 L for the stirred tank bioreactors and 5 L and 20 L for the Wave™ bioreactors. Comparable yields of rAAV, ~2e+13 particles per liter of cell culture were obtained in all volumes and configurations. These results demonstrate that producing rAAV in large scale using BEVs is reproducible, scalable, and independent of the bioreactor configuration. Keywords: adeno-associated vectors; large-scale production; stirred tank bioreactor; wave bioreactor; gene therapy. PMID:17606302

Hemi-nested PCR and RFLP methodologies for identifying blood meals of the Chagas disease vector, Triatoma infestans.

PubMed

Roellig, Dawn M; Gomez-Puerta, Luis A; Mead, Daniel G; Pinto, Jesus; Ancca-Juarez, Jenny; Calderon, Maritza; Bern, Caryn; Gilman, Robert H; Cama, Vitaliano A

2013-01-01

Trypanosoma cruzi, the etiologic agent of Chagas disease, is transmitted by hematophagous reduviid bugs within the subfamily Triatominae. These vectors take blood meals from a wide range of hosts, and their feeding behaviors have been used to investigate the ecology and epidemiology of T. cruzi. In this study we describe two PCR-based methodologies that amplify a fragment of the 16S mitochondrial rDNA, aimed to improve the identification of blood meal sources for Triatoma infestans: a.--Sequence analyses of two heminested PCRs that allow the identification of mammalian and avian species, and b.--restriction fragment length polymorphism (RFLP) analysis from the mammalian PCR to identify and differentiate multi-host blood meals. Findings from both methodologies indicate that host DNA could be detected and the host species identified in samples from laboratory reared and field collected triatomines. The implications of this study are two-fold. First, these methods can be used in areas where the fauna diversity and feeding behavior of the triatomines are unknown. Secondly, the RFLP method led to the identification of multi-host DNA from T. infestans gut contents, enhancing the information provided by this assay. These tools are important contributions for ecological and epidemiological studies of vector-borne diseases.

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Immunogenic Salivary Proteins of Triatoma infestans: Development of a Recombinant Antigen for the Detection of Low-Level Infestation of Triatomines

PubMed Central

Schwarz, Alexandra; Helling, Stefan; Collin, Nicolas; Teixeira, Clarissa R.; Medrano-Mercado, Nora; Hume, Jen C. C.; Assumpção, Teresa C.; Marcus, Katrin; Stephan, Christian; Meyer, Helmut E.; Ribeiro, José M. C.; Billingsley, Peter F.; Valenzuela, Jesus G.; Sternberg, Jeremy M.; Schaub, Günter A.

2009-01-01

Background Triatomines are vectors of Trypanosoma cruzi, the etiological agent of Chagas disease in Latin America. The most effective vector, Triatoma infestans, has been controlled successfully in much of Latin America using insecticide spraying. Though rarely undertaken, surveillance programs are necessary in order to identify new infestations and estimate the intensity of triatomine bug infestations in domestic and peridomestic habitats. Since hosts exposed to triatomines develop immune responses to salivary antigens, these responses can be evaluated for their usefulness as epidemiological markers to detect infestations of T. infestans. Methodology/Principal Findings T. infestans salivary proteins were separated by 2D-gel electrophoresis and tested for their immunogenicity by Western blotting using sera from chickens and guinea pigs experimentally exposed to T. infestans. From five highly immunogenic protein spots, eight salivary proteins were identified by nano liquid chromatography-electrospray ionization-tandem mass spectrometry (nanoLC-ESI-MS/MS) and comparison to the protein sequences of the National Center for Biotechnology Information (NCBI) database and expressed sequence tags of a unidirectionally cloned salivary gland cDNA library from T. infestans combined with the NCBI yeast protein sub-database. The 14.6 kDa salivary protein [gi|149689094] was produced as recombinant protein (rTiSP14.6) in a mammalian cell expression system and recognized by all animal sera. The specificity of rTiSP14.6 was confirmed by the lack of reactivity to anti-mosquito and anti-sand fly saliva antibodies. However, rTiSP14.6 was recognized by sera from chickens exposed to four other triatomine species, Triatoma brasiliensis, T. sordida, Rhodnius prolixus, and Panstrongylus megistus and by sera of chickens from an endemic area of T. infestans and Chagas disease in Bolivia. Conclusions/Significance The recombinant rTiSP14.6 is a suitable and promising epidemiological marker for detecting the presence of small numbers of different species of triatomines and could be developed for use as a new tool in surveillance programs, especially to corroborate vector elimination in Chagas disease vector control campaigns. PMID:19841746

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Improved distribution of small molecules and viral vectors in the murine brain using a hollow fiber catheter

PubMed Central

Seunguk, Oh; Odland, Rick; Wilson, Scott R.; Kroeger, Kurt M.; Liu, Chunyan; Lowenstein, Pedro R.; Castro, Maria G.; Hall, Walter A.; Ohlfest, John R.

2008-01-01

Object A hollow fiber catheter was developed to improve the distribution of drugs administered via direct infusion into the central nervous system (CNS). It is a porous catheter that significantly increases the surface area of brain tissue into which a drug is infused. Methods Dye was infused into the mouse brain through convection-enhanced delivery (CED) using a 28-gauge needle compared with a 3-mm-long hollow fiber catheter. To determine whether a hollow fiber catheter could increase the distribution of gene therapy vectors, a recombinant adenovirus expressing the firefly luciferase reporter was injected into the mouse striatum. Gene expression was monitored using in vivo bioluminescent imaging. To assess the distribution of gene transfer, an adenovirus expressing green fluorescent protein was injected into the striatum using a hollow fiber catheter or a needle. Results Hollow fiber catheter—mediated infusion increased the volume of brain tissue labeled with dye by 2.7 times relative to needle-mediated infusion. In vivo imaging revealed that catheter-mediated infusion of adenovirus resulted in gene expression that was 10 times greater than that mediated by a needle. The catheter appreciably increased the area of brain transduced with adenovirus relative to a needle, affecting a significant portion of the injected hemisphere. Conclusions The miniature hollow fiber catheter used in this study significantly increased the distribution of dye and adenoviral-mediated gene transfer in the mouse brain compared with the levels reached using a 28-gauge needle. Compared with standard single-port clinical catheters, the hollow fiber catheter has the advantage of millions of nanoscale pores to increase surface area and bulk flow in the CNS. Extending the scale of the hollow fiber catheter for the large mammalian brain shows promise in increasing the distribution and efficacy of gene therapy and drug therapy using CED. PMID:17886557

BarTeL, a Genetically Versatile, Bioluminescent and Granule Neuron Precursor-Targeted Mouse Model for Medulloblastoma

PubMed Central

Mahdi, Min Y.; Gonzalez-Gomez, Ignacio; Asgharzadeh, Shahab; D’Apuzzo, Massimo; Erdreich-Epstein, Anat; Moats, Rex A.

2016-01-01

Medulloblastomas are the most common malignant pediatric brain tumor and have been divided into four major molecular subgroups. Animal models that mimic the principal molecular aberrations of these subgroups will be important tools for preclinical studies and allow greater understanding of medulloblastoma biology. We report a new transgenic model of medulloblastoma that possesses a unique combination of desirable characteristics including, among others, the ability to incorporate multiple and variable genes of choice and to produce bioluminescent tumors from a limited number of somatic cells within a normal cellular environment. This model, termed BarTeL, utilizes a Barhl1 homeobox gene promoter to target expression of a bicistronic transgene encoding both the avian retroviral receptor TVA and an eGFP-Luciferase fusion protein to neonatal cerebellar granule neuron precursor (cGNP) cells, which are cells of origin for the sonic hedgehog (SHH) subgroup of human medulloblastomas. The Barhl1 promoter-driven transgene is expressed strongly in mammalian cGNPs and weakly or not at all in mature granule neurons. We efficiently induced bioluminescent medulloblastomas expressing eGFP-luciferase in BarTeL mice by infection of a limited number of somatic cGNPs with avian retroviral vectors encoding the active N-terminal fragment of SHH and a stabilized MYCN mutant. Detection and quantification of the increasing bioluminescence of growing tumors in young BarTeL mice was facilitated by the declining bioluminescence of their uninfected maturing cGNPs. Inclusion of eGFP in the transgene allowed enriched sorting of cGNPs from neonatal cerebella. Use of a single bicistronic avian vector simultaneously expressing both Shh and Mycn oncogenes increased the medulloblastoma incidence and aggressiveness compared to mixed virus infections. Bioluminescent tumors could also be produced by ex vivo transduction of neonatal BarTeL cerebellar cells by avian retroviruses and subsequent implantation into nontransgenic cerebella. Thus, BarTeL mice provide a versatile model with opportunities for use in medulloblastoma biology and therapeutics. PMID:27310018

Temperature-dependent sRNA transcriptome of the Lyme disease spirochete.

PubMed

Popitsch, Niko; Bilusic, Ivana; Rescheneder, Philipp; Schroeder, Renée; Lybecker, Meghan

2017-01-05

Transmission of Borrelia burgdorferi from its tick vector to a vertebrate host requires extensive reprogramming of gene expression. Small regulatory RNAs (sRNA) have emerged in the last decade as important regulators of bacterial gene expression. Despite the widespread observation of sRNA-mediated gene regulation, only one sRNA has been characterized in the Lyme disease spirochete B. burgdorferi. We employed an sRNA-specific deep-sequencing approach to identify the small RNA transcriptome of B. burgdorferi at both 23 °C and 37 °C, which mimics in vitro the transmission from the tick vector to the mammalian host. We identified over 1000 sRNAs in B. burgdorferi revealing large amounts of antisense and intragenic sRNAs, as well as characteristic intergenic and 5' UTR-associated sRNAs. A large fraction of the novel sRNAs (43%) are temperature-dependent and differentially expressed at the two temperatures, suggesting a role in gene regulation for adaptation during transmission. In addition, many genes important for maintenance of Borrelia during its enzootic cycle are associated with antisense RNAs or 5' UTR sRNAs. RNA-seq data were validated for twenty-two of the sRNAs via Northern blot analyses. Our study demonstrates that sRNAs are abundant and differentially expressed by environmental conditions suggesting that gene regulation via sRNAs is a common mechanism utilized in B. burgdorferi. In addition, the identification of antisense and intragenic sRNAs impacts the broadly used loss-of-function genetic approach used to study gene function and increases the coding potential of a small genome. To facilitate access to the analyzed RNA-seq data we have set-up a website at http://www.cibiv.at/~niko/bbdb/ that includes a UCSC browser track hub. By clicking on the respective link, researchers can interactively inspect the data in the UCSC genome browser (Kent et al., Genome Res 12:996-1006, 2002).

Combining epidemiology with basic biology of sand flies, parasites, and hosts to inform leishmaniasis transmission dynamics and control.

PubMed

Courtenay, Orin; Peters, Nathan C; Rogers, Matthew E; Bern, Caryn

2017-10-01

Quantitation of the nonlinear heterogeneities in Leishmania parasites, sand fly vectors, and mammalian host relationships provides insights to better understand leishmanial transmission epidemiology towards improving its control. The parasite manipulates the sand fly via production of promastigote secretory gel (PSG), leading to the "blocked sand fly" phenotype, persistent feeding attempts, and feeding on multiple hosts. PSG is injected into the mammalian host with the parasite and promotes the establishment of infection. Animal models demonstrate that sand flies with the highest parasite loads and percent metacyclic promastigotes transmit more parasites with greater frequency, resulting in higher load infections that are more likely to be both symptomatic and efficient reservoirs. The existence of mammalian and sand fly "super-spreaders" provides a biological basis for the spatial and temporal clustering of clinical leishmanial disease. Sand fly blood-feeding behavior will determine the efficacies of indoor residual spraying, topical insecticides, and bed nets. Interventions need to have sufficient coverage to include transmission hot spots, especially in the absence of field tools to assess infectiousness. Interventions that reduce sand fly densities in the absence of elimination could have negative consequences, for example, by interfering with partial immunity conferred by exposure to sand fly saliva. A deeper understanding of both sand fly and host biology and behavior is essential to ensuring effectiveness of vector interventions.

Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

PubMed

Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

2017-04-01

Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

PubMed Central

Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

2012-01-01

Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

Definition of Contravariant Velocity Components

NASA Technical Reports Server (NTRS)

Hung, Ching-moa; Kwak, Dochan (Technical Monitor)

2002-01-01

In this paper we have reviewed the basics of tensor analysis in an attempt to clarify some misconceptions regarding contravariant and covariant vector components as used in fluid dynamics. We have indicated that contravariant components are components of a given vector expressed as a unique combination of the covariant base vector system and, vice versa, that the covariant components are components of a vector expressed with the contravariant base vector system. Mathematically, expressing a vector with a combination of base vector is a decomposition process for a specific base vector system. Hence, the contravariant velocity components are decomposed components of velocity vector along the directions of coordinate lines, with respect to the covariant base vector system. However, the contravariant (and covariant) components are not physical quantities. Their magnitudes and dimensions are controlled by their corresponding covariant (and contravariant) base vectors.

Geno- and phenotypic characteristics of a transfected babesia bovis 6-Cys-E knockout clonal line

USDA-ARS?s Scientific Manuscript database

Babesia bovis is an intra-erythrocytic tick transmitted apicomplexan protozoan parasite. It has a complex life style including asexual replication in the mammalian host and sexual replication occurring in the midgut of host tick vector, typically, Rhipicephalus microplus. Previous evidence showed th...

Requirement of siderophore biosynthesis for plant colonization by Salmonella enterica

USDA-ARS?s Scientific Manuscript database

Contaminated fresh produce has become the number one vector of non-typhoidal salmonellosis to humans. However, Salmonella enterica genes essential for the life cycle of this organism outside the mammalian host are for the most part unknown. Screening deletion mutants led to the discovery that an aro...

Role oh human-associated compounds in host-finding by Culex mosquitoes

USDA-ARS?s Scientific Manuscript database

Culex mosquitoes are important vectors of West Nile virus and other encephalitides in North America. Mosquitoes in this genera, however, vary in their propensity for feeding on mammalian hosts and this is reflected in the difficulty in trapping some of these species using conventional traps and lur...

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Evaluation of four microbial Class II fructose 1,6-bisphosphate aldolase enzymes for use as biocatalysts.

PubMed

Labbé, Geneviève; de Groot, Sarah; Rasmusson, Timothy; Milojevic, Gorica; Dmitrienko, Gary I; Guillemette, J Guy

2011-12-01

Fructose 1,6-bisphosphate (FBP) aldolase has been used as biocatalyst in the synthesis of several pharmaceutical compounds such as monosaccharides and analogs. Is has been suggested that microbial metal-dependant Class II aldolases could be better industrial catalysts than mammalian Class I enzyme because of their greater stability. The Class II aldolases from four microbes were subcloned into the Escherichia coli vector pT7-7, expressed and purified to near homogeneity. The kinetic parameters, temperature stability, pH profile, and tolerance to organic solvents of the Class II enzymes were determined, and compared with the properties of the Class I aldolase from rabbit muscle. Contrary to results obtained previously with the E. coli Class II aldolase, which was reported to be more stable than the mammalian enzyme, other recombinant Class II aldolases were found to be generally less stable than the Class I enzyme, especially in the presence of organic solvents. Class II aldolase from Bacillus cereus showed higher temperature stability than the other enzymes tested, but only the Mycobacterium tuberculosis Class II aldolase had a stability comparable to the Class I mammalian enzyme under assay conditions. The turnover number of the recombinant M. tuberculosis and Magnaporthe grisea Class II type A aldolases was comparable or higher than that of the Class I enzyme. The recombinant B. cereus and Pseudomonas aeruginosa Class II type B aldolases had very low turnover numbers and low metal content, indicating that the E. coli overexpression system may not be suitable for the Class II type B aldolases from these microorganisms. Copyright © 2011 Elsevier Inc. All rights reserved.

Influence of the Microenvironment in the Transcriptome of Leishmania infantum Promastigotes: Sand Fly versus Culture

PubMed Central

Alcolea, Pedro J.; Alonso, Ana; Domínguez, Mercedes; Parro, Víctor; Jiménez, Maribel; Molina, Ricardo; Larraga, Vicente

2016-01-01

Zoonotic visceral leishmaniasis is a vector-borne disease caused by Leishmania infantum in the Mediterranean Basin, where domestic dogs and wild canids are the main reservoirs. The promastigote stage replicates and develops within the gut of blood-sucking phlebotomine sand flies. Mature promastigotes are injected in the dermis of the mammalian host and differentiate into the amastigote stage within parasitophorous vacuoles of phagocytic cells. The major vector of L. infantum in Spain is Phlebotomus perniciosus. Promastigotes are routinely axenized and cultured to mimic in vitro the conditions inside the insect gut, which allows for most molecular, cellular, immunological and therapeutical studies otherwise inviable. Culture passages are known to decrease infectivity, which is restored by passage through laboratory animals. The most appropriate source of promastigotes is the gut of the vector host but isolation of the parasite is technically challenging. In fact, this option is not viable unless small samples are sufficient for downstream applications like promastigote cultures and nucleic acid amplification. In this study, in vitro infectivity and differential gene expression have been studied in cultured promastigotes at the stationary phase and in promastigotes isolated from the stomodeal valve of the sand fly P. perniciosus. About 20 ng RNA per sample could be isolated. Each sample contained L. infantum promastigotes from 20 sand flies. RNA was successfully amplified and processed for shotgun genome microarray hybridization analysis. Most differentially regulated genes are involved in regulation of gene expression, intracellular signaling, amino acid metabolism and biosynthesis of surface molecules. Interestingly, meta-analysis by hierarchical clustering supports that up-regulation of 22.4% of the differentially regulated genes is specifically enhanced by the microenvironment (i.e. sand fly gut or culture). The correlation between cultured and naturally developed promastigotes is strong but not very high (Pearson coefficient R2 = 0.727). Therefore, the influence of promastigote culturing should be evaluated case-by-case in experimentation. PMID:27163123

Influence of the Microenvironment in the Transcriptome of Leishmania infantum Promastigotes: Sand Fly versus Culture.

PubMed

Alcolea, Pedro J; Alonso, Ana; Domínguez, Mercedes; Parro, Víctor; Jiménez, Maribel; Molina, Ricardo; Larraga, Vicente

2016-05-01

Zoonotic visceral leishmaniasis is a vector-borne disease caused by Leishmania infantum in the Mediterranean Basin, where domestic dogs and wild canids are the main reservoirs. The promastigote stage replicates and develops within the gut of blood-sucking phlebotomine sand flies. Mature promastigotes are injected in the dermis of the mammalian host and differentiate into the amastigote stage within parasitophorous vacuoles of phagocytic cells. The major vector of L. infantum in Spain is Phlebotomus perniciosus. Promastigotes are routinely axenized and cultured to mimic in vitro the conditions inside the insect gut, which allows for most molecular, cellular, immunological and therapeutical studies otherwise inviable. Culture passages are known to decrease infectivity, which is restored by passage through laboratory animals. The most appropriate source of promastigotes is the gut of the vector host but isolation of the parasite is technically challenging. In fact, this option is not viable unless small samples are sufficient for downstream applications like promastigote cultures and nucleic acid amplification. In this study, in vitro infectivity and differential gene expression have been studied in cultured promastigotes at the stationary phase and in promastigotes isolated from the stomodeal valve of the sand fly P. perniciosus. About 20 ng RNA per sample could be isolated. Each sample contained L. infantum promastigotes from 20 sand flies. RNA was successfully amplified and processed for shotgun genome microarray hybridization analysis. Most differentially regulated genes are involved in regulation of gene expression, intracellular signaling, amino acid metabolism and biosynthesis of surface molecules. Interestingly, meta-analysis by hierarchical clustering supports that up-regulation of 22.4% of the differentially regulated genes is specifically enhanced by the microenvironment (i.e. sand fly gut or culture). The correlation between cultured and naturally developed promastigotes is strong but not very high (Pearson coefficient R2 = 0.727). Therefore, the influence of promastigote culturing should be evaluated case-by-case in experimentation.

Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

PubMed

Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

2017-06-06

Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

TMV-Gate vectors: Gateway compatible tobacco mosaic virus based expression vectors for functional analysis of proteins

PubMed Central

Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin

2012-01-01

Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

The flounder organic anion transporter fOat has sequence, function, and substrate specificity similarity to both mammalian Oat1 and Oat3

PubMed Central

Aslamkhan, Amy G.; Thompson, Deborah M.; Perry, Jennifer L.; Bleasby, Kelly; Wolff, Natascha A.; Barros, Scott; Miller, David S.; Pritchard, John B.

2007-01-01

The flounder renal organic anion transporter (fOat) has substantial sequence homology to mammalian basolateral organic anion transporter orthologs (OAT1/Oat1 and OAT3/Oat3), suggesting that fOat may have functional properties of both mammalian forms. We therefore compared uptake of various substrates by rat Oat1 and Oat3 and human OAT1 and OAT3 with the fOat clone expressed in Xenopus oocytes. These data confirm that estrone sulfate is an excellent substrate for mammalian OAT3/Oat3 transporters but not for OAT1/Oat1 transporters. In contrast, 2,4-dichlorophenoxyacetic acid and adefovir are better transported by mammalian OAT1/Oat1 than by the OAT3/Oat3 clones. All three substrates were well transported by fOat-expressing Xenopus oocytes. fOat Km values were comparable to those obtained for mammalian OAT/Oat1/3 clones. We also characterized the ability of these substrates to inhibit uptake of the fluorescent substrate fluorescein in intact teleost proximal tubules isolated from the winter flounder (Pseudopleuronectes americanus) and killifish (Fundulus heteroclitus). The rank order of the IC50 values for inhibition of cellular fluorescein accumulation was similar to that for the Km values obtained in fOat-expressing oocytes, suggesting that fOat may be the primary teleost renal basolateral Oat. Assessment of the zebrafish (Danio rerio) genome indicated the presence of a single Oat (zfOat) with similarity to both mammalian OAT1/Oat1 and OAT3/Oat3. The puffer fish (Takifugu rubripes) also has an Oat (pfOat) similar to mammalian OAT1/Oat1 and OAT3/Oat3 members. Furthermore, phylogenetic analyses argue that the teleost Oat1/3-like genes diverged from a common ancestral gene in advance of the divergence of the mammalian OAT1/Oat1, OAT3/Oat3, and, possibly, Oat6 genes. PMID:16857889

Novel Membrane-Bound eIF2α Kinase in the Flagellar Pocket of Trypanosoma brucei▿

PubMed Central

Moraes, Maria Carolina S.; Jesus, Teresa C. L.; Hashimoto, Nilce N.; Dey, Madhusudan; Schwartz, Kevin J.; Alves, Viviane S.; Avila, Carla C.; Bangs, James D.; Dever, Thomas E.; Schenkman, Sergio; Castilho, Beatriz A.

2007-01-01

Translational control mediated by phosphorylation of the alpha subunit of the eukaryotic initiation factor 2 (eIF2α) is central to stress-induced programs of gene expression. Trypanosomatids, important human pathogens, display differentiation processes elicited by contact with the distinct physiological milieu found in their insect vectors and mammalian hosts, likely representing stress situations. Trypanosoma brucei, the agent of African trypanosomiasis, encodes three potential eIF2α kinases (TbeIF2K1 to -K3). We show here that TbeIF2K2 is a transmembrane glycoprotein expressed both in procyclic and in bloodstream forms. The catalytic domain of TbeIF2K2 phosphorylates yeast and mammalian eIF2α at Ser51. It also phosphorylates the highly unusual form of eIF2α found in trypanosomatids specifically at residue Thr169 that corresponds to Ser51 in other eukaryotes. T. brucei eIF2α, however, is not a substrate for GCN2 or PKR in vitro. The putative regulatory domain of TbeIF2K2 does not share any sequence similarity with known eIF2α kinases. In both procyclic and bloodstream forms TbeIF2K2 is mainly localized in the membrane of the flagellar pocket, an organelle that is the exclusive site of exo- and endocytosis in these parasites. It can also be detected in endocytic compartments but not in lysosomes, suggesting that it is recycled between endosomes and the flagellar pocket. TbeIF2K2 location suggests a relevance in sensing protein or nutrient transport in T. brucei, an organism that relies heavily on posttranscriptional regulatory mechanisms to control gene expression in different environmental conditions. This is the first membrane-associated eIF2α kinase described in unicellular eukaryotes. PMID:17873083

Demonstration of GTG as an alternative initiation codon for the serpin endopin 2B-2.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill L; Hook, Vivian Y H

2005-02-18

This study demonstrates GTG as a novel, alternative initiation codon for translation of bovine endopin 2B-2, a serpin protease inhibitor. Molecular cDNA cloning revealed the endopin 2B-1 and endopin 2B-2 isoforms that are predicted to inhibit papain and elastase. Notably, GTG was demonstrated as the initiation codon for endopin 2B-2, whereas endopin 2B-1 possesses ATG as its initiation codon. GTG mediated in vitro translation of 46kDa endopin 2B-2. GTG also mediated translation of EGFP by in vitro translation and by expression in mammalian cells. Notably, mutagenesis of GTG to GTC resulted in the absence of EGFP expression in cells. GTG produced a lower level of protein expression compared to ATG. The use of GTG as an initiation codon to direct translation of endopin 2B, as well as the heterologous protein EGFP, demonstrates the role of GTG in the regulation of mRNA translation in mammalian cells. Significantly, further analyses of mammalian genomes based on GTG as an alternative initiation codon may predict new candidate gene products expressed by mammalian and human genomes.

The Yersinia pseudotuberculosis and Yersinia pestis toxin complex is active against cultured mammalian cells.

PubMed

Hares, Michelle C; Hinchliffe, Stewart J; Strong, Philippa C R; Eleftherianos, Ioannis; Dowling, Andrea J; ffrench-Constant, Richard H; Waterfield, Nick

2008-11-01

The toxin complex (Tc) genes were first identified in the insect pathogen Photorhabdus luminescens and encode approximately 1 MDa protein complexes which are toxic to insect pests. Subsequent genome sequencing projects have revealed the presence of tc orthologues in a range of bacterial pathogens known to be associated with insects. Interestingly, members of the mammalian-pathogenic yersiniae have also been shown to encode Tc orthologues. Studies in Yersinia enterocolitica have shown that divergent tc loci either encode insect-active toxins or play a role in colonization of the gut in gastroenteritis models of rats. So far little is known about the activity of the Tc proteins in the other mammalian-pathogenic yersiniae. Here we present work to suggest that Tc proteins in Yersinia pseudotuberculosis and Yersinia pestis are not insecticidal toxins but have evolved for mammalian pathogenicity. We show that Tc is secreted by Y. pseudotuberculosis strain IP32953 during growth in media at 28 degrees C and 37 degrees C. We also demonstrate that oral toxicity of strain IP32953 to Manduca sexta larvae is not due to Tc expression and that lysates of Escherichia coli BL21 expressing the Yersinia Tc proteins are not toxic to Sf9 insect cells but are toxic to cultured mammalian cell lines. Cell lysates of E. coli BL21 expressing the Y. pseudotuberculosis Tc proteins caused actin ruffles, vacuoles and multi-nucleation in cultured human gut cells (Caco-2); similar morphology was observed after application of a lysate of E. coli BL21 expressing the Y. pestis Tc proteins to mouse fibroblast NIH3T3 cells, but not Caco-2 cells. Finally, transient expression of the individual Tc proteins in Caco-2 and NIH3T3 cell lines reproduced the actin and nuclear rearrangement observed with the topical applications. Together these results add weight to the growing hypothesis that the Tc proteins in Y. pseudotuberculosis and Y. pestis have been adapted for mammalian pathogenicity. We further conclude that Tc proteins from Y. pseudotuberculosis and Y. pestis display differential mammalian cell specificity in their toxicity.

The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion.

PubMed

Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W; Kulozik, Andreas E

2016-09-01

Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells. © 2016 Hollerer et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Optimization of gene delivery methods in Xenopus laevis kidney (A6) and Chinese hamster ovary (CHO) cell lines for heterologous expression of Xenopus inner ear genes

PubMed Central

Ramirez-Gordillo, Daniel; Trujillo-Provencio, Casilda; Knight, V. Bleu; Serrano, Elba E.

2014-01-01

The Xenopus inner ear provides a useful model for studies of hearing and balance because it shares features with the mammalian inner ear, and because amphibians are capable of regenerating damaged mechanosensory hair cells. The structure and function of many proteins necessary for inner ear function have yet to be elucidated and require methods for analysis. To this end, we seek to characterize Xenopus inner ear genes outside of the animal model through heterologous expression in cell lines. As part of this effort, we aimed to optimize physical (electroporation), chemical (lipid-mediated; Lipofectamine™ 2000, Metafectene® Pro), and biological (viral-mediated; BacMam virus Cellular Lights™ Tubulin-RFP) gene delivery methods in amphibian (Xenopus; A6) cells and mammalian (Chinese hamster ovary (CHO)) cells. We successfully introduced the commercially available pEGFP-N3, pmCherry-N1, pEYFP-Tubulin, and Cellular Lights™ Tubulin-RFP fluorescent constructs to cells and evaluated their transfection or transduction efficiencies using the three gene delivery methods. In addition, we analyzed the transfection efficiency of a novel construct synthesized in our laboratory by cloning the Xenopus inner ear calcium-activated potassium channel β1 subunit, then subcloning the subunit into the pmCherry-N1 vector. Every gene delivery method was significantly more effective in CHO cells. Although results for the A6 cell line were not statistically significant, both cell lines illustrate a trend towards more efficient gene delivery using viral-mediated methods; however the cost of viral transduction is also much higher. Our findings demonstrate the need to improve gene delivery methods for amphibian cells and underscore the necessity for a greater understanding of amphibian cell biology. PMID:21959846

Inhibition of apoptosis by p26: implications for small heat shock protein function during Artemia development.

PubMed

Villeneuve, Tania S; Ma, Xiaocui; Sun, Yu; Oulton, Mindy M; Oliver, Ann E; MacRae, Thomas H

2006-01-01

p26, an abundantly expressed small heat shock protein, is thought to establish stress resistance in oviparously developing embryos of the crustacean Artemia franciscana by preventing irreversible protein denaturation, but it might also promote survival by inhibiting apoptosis. To test this possibility, stably transfected mammalian cells producing p26 were generated and their ability to resist apoptosis induction determined. Examination of immunofluorescently stained transfected 293H cells by confocal microscopy demonstrated p26 is diffusely distributed in the cytoplasm with a minor amount of the protein in nuclei. As shown by immunoprobing of Western blots, p26 constituted approximately 0.6% of soluble cell protein. p26 localization and quantity were unchanged during prolonged culture, and the protein had no apparent ill effects on transfected cells. Molecular sieve chromatography in Sepharose 6B revealed p26 oligomers of about 20 monomers, with a second fraction occurring as larger aggregates. A similar pattern was observed in sucrose gradients, but overall oligomer size was smaller. Mammalian cells containing p26 were more thermotolerant than cells transfected with the expression vector only, and as measured by annexin V labeling, Hoescht 33342 nuclear staining and procaspase-3 activation, transfected cells effectively resisted apoptosis induction by heat and staurosporine. The ability to confer thermotolerance and limit heat-induced apoptosis is important because Artemia embryos are frequently exposed to high temperature in their natural habitat. p26 also blocked apoptosis in transfected cells during drying and rehydration, findings with direct relevance to Artemia life history characteristics because desiccation terminates cyst diapause. Thus, in addition to functioning as a molecular chaperone, p26 inhibits apoptosis, an activity shared by other small heat shock proteins and with the potential to play an important role during Artemia embryo development.

TimesVector: a vectorized clustering approach to the analysis of time series transcriptome data from multiple phenotypes.

PubMed

Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun

2017-12-01

Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

The distribution of potential West Nile virus vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culicidae), in Mexico City

PubMed Central

2011-01-01

Background Culex spp. mosquitoes are considered to be the most important vectors of West Nile virus (WNV) detected in at least 34 species of mosquitoes in the United States. In North America, Culex pipiens pipiens, Culex pipiens quinquefasciatus, and Culex tarsalis are all competent vectors of WNV, which is considered to be enzootic in the United States and has also been detected in equines and birds in many states of Mexico and in humans in Nuevo Leon. There is potential for WNV to be introduced into Mexico City by various means including infected mosquitoes on airplanes, migrating birds, ground transportation and infected humans. Little is known of the geographic distribution of Culex pipiens complex mosquitoes and hybrids in Mexico City. Culex pipiens pipiens preferentially feed on avian hosts; Culex pipiens quinquefasciatus have historically been considered to prefer mammalian hosts; and hybrids of these two species could theoretically serve as bridge vectors to transmit WNV from avian hosts to humans and other mammalian hosts. In order to address the potential of WNV being introduced into Mexico City, we have determined the identity and spatial distribution of Culex pipiens complex mosquitoes and their hybrids. Results Mosquito larvae collected from 103 sites throughout Mexico City during 2004-2005 were identified as Culex, Culiseta or Ochlerotatus by morphological analysis. Within the genus Culex, specimens were further identified as Culex tarsalis or as belonging to the Culex pipiens complex. Members of the Culex pipiens complex were separated by measuring the ratio of the dorsal and ventral arms (DV/D ratio) of the male genitalia and also by using diagnostic primers designed for the Ace.2 gene. Culex pipiens quinquefasciatus was the most abundant form collected. Conclusions Important WNV vectors species, Cx. p. pipiens, Cx. p. quinquefasciatus and Cx. tarsalis, are all present in Mexico City. Hybrids of Cx. p. pipiens and Cx. p. quinquefasciatus were also collected and identified. The presence and abundance of these WNV competent vectors is a cause for concern. Understanding the distribution of these vectors can help improve viral surveillance activities and mosquito control efforts in Mexico City. PMID:21554725

The distribution of potential West Nile virus vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culicidae), in Mexico City.

PubMed

Diaz-Badillo, Alvaro; Bolling, Bethany G; Perez-Ramirez, Gerardo; Moore, Chester G; Martinez-Munoz, Jorge P; Padilla-Viveros, America A; Camacho-Nuez, Minerva; Diaz-Perez, Alfonso; Beaty, Barry J; Munoz, Maria de Lourdes

2011-05-09

Culex spp. mosquitoes are considered to be the most important vectors of West Nile virus (WNV) detected in at least 34 species of mosquitoes in the United States. In North America, Culex pipiens pipiens, Culex pipiens quinquefasciatus, and Culex tarsalis are all competent vectors of WNV, which is considered to be enzootic in the United States and has also been detected in equines and birds in many states of Mexico and in humans in Nuevo Leon. There is potential for WNV to be introduced into Mexico City by various means including infected mosquitoes on airplanes, migrating birds, ground transportation and infected humans. Little is known of the geographic distribution of Culex pipiens complex mosquitoes and hybrids in Mexico City. Culex pipiens pipiens preferentially feed on avian hosts; Culex pipiens quinquefasciatus have historically been considered to prefer mammalian hosts; and hybrids of these two species could theoretically serve as bridge vectors to transmit WNV from avian hosts to humans and other mammalian hosts. In order to address the potential of WNV being introduced into Mexico City, we have determined the identity and spatial distribution of Culex pipiens complex mosquitoes and their hybrids. Mosquito larvae collected from 103 sites throughout Mexico City during 2004-2005 were identified as Culex, Culiseta or Ochlerotatus by morphological analysis. Within the genus Culex, specimens were further identified as Culex tarsalis or as belonging to the Culex pipiens complex. Members of the Culex pipiens complex were separated by measuring the ratio of the dorsal and ventral arms (DV/D ratio) of the male genitalia and also by using diagnostic primers designed for the Ace.2 gene. Culex pipiens quinquefasciatus was the most abundant form collected. Important WNV vectors species, Cx. p. pipiens, Cx. p. quinquefasciatus and Cx. tarsalis, are all present in Mexico City. Hybrids of Cx. p. pipiens and Cx. p. quinquefasciatus were also collected and identified. The presence and abundance of these WNV competent vectors is a cause for concern. Understanding the distribution of these vectors can help improve viral surveillance activities and mosquito control efforts in Mexico City.

Development of an Improved Mammalian Overexpression Method for Human CD62L

PubMed Central

Brown, Haley A.; Roth, Gwynne; Holzapfel, Genevieve; Shen, Sarek; Rahbari, Kate; Ireland, Joanna; Zou, Zhongcheng; Sun, Peter D.

2014-01-01

We have previously developed a glutamine synthetase (GS)-based mammalian recombinant protein expression system that is capable of producing 5 to 30 mg/L recombinant proteins. The over expression is based on multiple rounds of target gene amplification driven by methionine sulfoximine (MSX), an inhibitor of glutamine synthetase. However, like other stable mammalian over expression systems, a major shortcoming of the GS-based expression system is its lengthy turn-around time, typically taking 4–6 months to produce. To shorten the construction time, we replaced the muti-round target gene amplifications with single-round in situ amplifications, thereby shortening the cell line construction to 2 months. The single-round in situ amplification method resulted in highest recombinant CD62L expressing CHO cell lines producing ~5mg/L soluble CD62L, similar to those derived from the multi-round amplification and selection method. In addition, we developed a MSX resistance assay as an alternative to utilizing ELISA for evaluating the expression level of stable recombinant CHO cell lines. PMID:25286402

An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells

PubMed Central

Chicaybam, Leonardo; Barcelos, Camila; Peixoto, Barbara; Carneiro, Mayra; Limia, Cintia Gomez; Redondo, Patrícia; Lira, Carla; Paraguassú-Braga, Flávio; Vasconcelos, Zilton Farias Meira De; Barros, Luciana; Bonamino, Martin Hernán

2017-01-01

Genetic modification of cell lines and primary cells is an expensive and cumbersome approach, often involving the use of viral vectors. Electroporation using square-wave generating devices, like Lonza’s Nucleofector, is a widely used option, but the costs associated with the acquisition of electroporation kits and the transient transgene expression might hamper the utility of this methodology. In the present work, we show that our in-house developed buffers, termed Chicabuffers, can be efficiently used to electroporate cell lines and primary cells from murine and human origin. Using the Nucleofector II device, we electroporated 14 different cell lines and also primary cells, like mesenchymal stem cells and cord blood CD34+, providing optimized protocols for each of them. Moreover, when combined with sleeping beauty-based transposon system, long-term transgene expression could be achieved in all types of cells tested. Transgene expression was stable and did not interfere with CD34+ differentiation to committed progenitors. We also show that these buffers can be used in CRISPR-mediated editing of PDCD1 gene locus in 293T and human peripheral blood mononuclear cells. The optimized protocols reported in this study provide a suitable and cost-effective platform for the genetic modification of cells, facilitating the widespread adoption of this technology. PMID:28168187

Arctigenin from Fructus Arctii is a novel suppressor of heat shock response in mammalian cells

PubMed Central

Ishihara, Keiichi; Yamagishi, Nobuyuki; Saito, Youhei; Takasaki, Midori; Konoshima, Takao; Hatayama, Takumi

2006-01-01

Because heat shock proteins (Hsps) are involved in protecting cells and in the pathophysiology of diseases such as inflammation, cancer, and neurodegenerative disorders, the use of regulators of the expression of Hsps in mammalian cells seems to be useful as a potential therapeutic modality. To identify compounds that modulate the response to heat shock, we analyzed several natural products using a mammalian cell line containing an hsp promoter-regulated reporter gene. In this study, we found that an extract from Fructus Arctii markedly suppressed the expression of Hsp induced by heat shock. A component of the extract arctigenin, but not the component arctiin, suppressed the response at the level of the activation of heat shock transcription factor, the induction of mRNA, and the synthesis and accumulation of Hsp. Furthermore, arctigenin inhibited the acquisition of thermotolerance in mammalian cells, including cancer cells. Thus, arctigenin seemed to be a new suppressive regulator of heat shock response in mammalian cells, and may be useful for hyperthermia cancer therapy. PMID:16817321

The boundary vector cell model of place cell firing and spatial memory

PubMed Central

Barry, Caswell; Lever, Colin; Hayman, Robin; Hartley, Tom; Burton, Stephen; O'Keefe, John; Jeffery, Kate; Burgess, Neil

2009-01-01

We review evidence for the boundary vector cell model of the environmental determinants of the firing of hippocampal place cells. Preliminary experimental results are presented concerning the effects of addition or removal of environmental boundaries on place cell firing and evidence that boundary vector cells may exist in the subiculum. We review and update computational simulations predicting the location of human search within a virtual environment of variable geometry, assuming that boundary vector cells provide one of the input representations of location used in mammalian spatial memory. Finally, we extend the model to include experience-dependent modification of connection strengths through a BCM-like learning rule, and compare the effects to experimental data on the firing of place cells under geometrical manipulations to their environment. The relationship between neurophysiological results in rats and spatial behaviour in humans is discussed. PMID:16703944

A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

PubMed

Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

2012-09-01

Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

miR-31 Regulates Spermatogonial Stem Cells Meiosis via Targeting Stra8.

PubMed

Wang, Yingjie; Zuo, Qisheng; Bi, Yulin; Zhang, Wenhui; Jin, Jing; Zhang, Liangliang; Zhang, Ya-Ni; Li, Bichun

2017-12-01

Stra8 (stimulated by retinoic acid gene 8) is a specific gene that is expressed in mammalian germ cells during transition from mitosis to meiosis and plays a key role in the initiation of meiosis in mammals and birds. So, the evaluation of the Stra8 pathway in cSSCs may provide a deeper insight into mammalian spermatogenesis. miRNA was also an important regulating factor for meiosis of SSCs. However, there is currently no data indicating that miRNA regulate the meiosis of SSCs via Stra8. Here, we predicted the prospective miRNA targeting to Stra8 using the online Bioinformatics database-Targetscan, and performed an analysis of the dual-luciferase recombinant vector, pGL3-CMV-LUC-MCS-Stra8-3'UTR. miR-31 mimics (miR-31m), miR-31 inhibitors (miR-31i), Control (NC, scrambled oligonucleotides transfection) were transfected into cSSCs; Stra8 and miRNA were analyzed by RT-qPCR, immunofluorescence, and Western blot. The detection of haploid was conducted by flow cytometry. The results showed that miR-31 regulates meiosis of cSSCs via targeting Stra8 in vitro and in vivo. Our study identifies a new regulatory pathway that miR-31 targets Stra8 and inhibits spermatogenesis. J. Cell. Biochem. 118: 4844-4853, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Possible involvement of SINEs in mammalian-specific brain formation

PubMed Central

Sasaki, Takeshi; Nishihara, Hidenori; Hirakawa, Mika; Fujimura, Koji; Tanaka, Mikiko; Kokubo, Nobuhiro; Kimura-Yoshida, Chiharu; Matsuo, Isao; Sumiyama, Kenta; Saitou, Naruya; Shimogori, Tomomi; Okada, Norihiro

2008-01-01

Retroposons, such as short interspersed elements (SINEs) and long interspersed elements (LINEs), are the major constituents of higher vertebrate genomes. Although there are many examples of retroposons' acquiring function, none has been implicated in the morphological innovations specific to a certain taxonomic group. We previously characterized a SINE family, AmnSINE1, members of which constitute a part of conserved noncoding elements (CNEs) in mammalian genomes. We proposed that this family acquired genomic functionality or was exapted after retropositioning in a mammalian ancestor. Here we identified 53 new AmnSINE1 loci and refined 124 total loci, two of which were further analyzed. Using a mouse enhancer assay, we demonstrate that one SINE locus, AS071, 178 kbp from the gene FGF8 (fibroblast growth factor 8), is an enhancer that recapitulates FGF8 expression in two regions of the developing forebrain, namely the diencephalon and the hypothalamus. Our gain-of-function analysis revealed that FGF8 expression in the diencephalon controls patterning of thalamic nuclei, which act as a relay center of the neocortex, suggesting a role for FGF8 in mammalian-specific forebrain patterning. Furthermore, we demonstrated that the locus, AS021, 392 kbp from the gene SATB2, controls gene expression in the lateral telencephalon, which is thought to be a signaling center during development. These results suggest important roles for SINEs in the development of the mammalian neuronal network, a part of which was initiated with the exaptation of AmnSINE1 in a common mammalian ancestor. PMID:18334644

Possible involvement of SINEs in mammalian-specific brain formation.

PubMed

Sasaki, Takeshi; Nishihara, Hidenori; Hirakawa, Mika; Fujimura, Koji; Tanaka, Mikiko; Kokubo, Nobuhiro; Kimura-Yoshida, Chiharu; Matsuo, Isao; Sumiyama, Kenta; Saitou, Naruya; Shimogori, Tomomi; Okada, Norihiro

2008-03-18

Retroposons, such as short interspersed elements (SINEs) and long interspersed elements (LINEs), are the major constituents of higher vertebrate genomes. Although there are many examples of retroposons' acquiring function, none has been implicated in the morphological innovations specific to a certain taxonomic group. We previously characterized a SINE family, AmnSINE1, members of which constitute a part of conserved noncoding elements (CNEs) in mammalian genomes. We proposed that this family acquired genomic functionality or was exapted after retropositioning in a mammalian ancestor. Here we identified 53 new AmnSINE1 loci and refined 124 total loci, two of which were further analyzed. Using a mouse enhancer assay, we demonstrate that one SINE locus, AS071, 178 kbp from the gene FGF8 (fibroblast growth factor 8), is an enhancer that recapitulates FGF8 expression in two regions of the developing forebrain, namely the diencephalon and the hypothalamus. Our gain-of-function analysis revealed that FGF8 expression in the diencephalon controls patterning of thalamic nuclei, which act as a relay center of the neocortex, suggesting a role for FGF8 in mammalian-specific forebrain patterning. Furthermore, we demonstrated that the locus, AS021, 392 kbp from the gene SATB2, controls gene expression in the lateral telencephalon, which is thought to be a signaling center during development. These results suggest important roles for SINEs in the development of the mammalian neuronal network, a part of which was initiated with the exaptation of AmnSINE1 in a common mammalian ancestor.

Quantitative Differences in Salivary Pathogen Load during Tick Transmission Underlie Strain-Specific Variation in Transmission Efficiency of Anaplasma marginale

USDA-ARS?s Scientific Manuscript database

The relative fitness of arthropod-borne pathogens within the vector can be a major determinant of pathogen prevalence within the mammalian host population. Strains of the tick-borne rickettsia Anaplasma marginale differ markedly in transmission efficiency with consequent impact on pathogen strain st...

Molecular detection and characterization of theileria spp infecting cattle in Sennar State, Sudan

USDA-ARS?s Scientific Manuscript database

Theileriosis is a serious animal disease transmitted by tick vectors. The agents of theileriosis are obligate intracellular parasites that cause mild to severe disease in the mammalian host. Tropical theileriosis has been recognized as a burden to the development of the dairy industry in Sudan and c...

Characterization of the human oncogene SCL/TAL1 interrupting locus (Stil) mediated Sonic hedgehog (Shh) signaling transduction in proliferating mammalian dopaminergic neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Lei; Department of Physiology, Nankai University School of Medicine, Tianjin 300071; Carr, Aprell L.

2014-07-11

Highlights: • Stil is a human oncogene that is conserved in vertebrate species. • Stil functions in the Shh pathway in mammalian cells. • The expression of Stil is required for mammalian dopaminergic cell proliferation. - Abstract: The human oncogene SCL/TAL1 interrupting locus (Stil) is highly conserved in all vertebrate species. In humans, the expression of Stil is involved in cancer cell survival, apoptosis and proliferation. In this research, we investigated the roles of Stil expression in cell proliferation of mammalian dopaminergic (DA) PC12 cells. Stil functions through the Sonic hedgehog (Shh) signal transduction pathway. Co-immunoprecipitation tests revealed that STILmore » interacts with Shh downstream components, which include SUFU and GLI1. By examining the expression of Stil, Gli1, CyclinD2 (cell-cycle marker) and PCNA (proliferating cell nuclear antigen), we found that up-regulation of Stil expression (transfection with overexpression plasmids) increased Shh signaling transduction and PC12 cell proliferation, whereas down-regulation of Stil expression (by shRNA) inhibited Shh signaling transduction, and thereby decreased PC12 cell proliferation. Transient transfection of PC12 cells with Stil knockdown or overexpression plasmids did not affect PC12 cell neural differentiation, further indicating the specific roles of Stil in cell proliferation. The results from this research suggest that Stil may serve as a bio-marker for neurological diseases involved in DA neurons, such as Parkinson’s disease.« less

A review of gene delivery and stem cell based therapies for regenerating inner ear hair cells.

PubMed

Devarajan, Keerthana; Staecker, Hinrich; Detamore, Michael S

2011-09-13

Sensory neural hearing loss and vestibular dysfunction have become the most common forms of sensory defects, affecting millions of people worldwide. Developing effective therapies to restore hearing loss is challenging, owing to the limited regenerative capacity of the inner ear hair cells. With recent advances in understanding the developmental biology of mammalian and non-mammalian hair cells a variety of strategies have emerged to restore lost hair cells are being developed. Two predominant strategies have developed to restore hair cells: transfer of genes responsible for hair cell genesis and replacement of missing cells via transfer of stem cells. In this review article, we evaluate the use of several genes involved in hair cell regeneration, the advantages and disadvantages of the different viral vectors employed in inner ear gene delivery and the insights gained from the use of embryonic, adult and induced pluripotent stem cells in generating inner ear hair cells. Understanding the role of genes, vectors and stem cells in therapeutic strategies led us to explore potential solutions to overcome the limitations associated with their use in hair cell regeneration.

Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

PubMed

Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

2013-01-01

We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

Human HLA-Ev (147) Expression in Transgenic Animals.

PubMed

Matsuura, R; Maeda, A; Sakai, R; Eguchi, H; Lo, P-C; Hasuwa, H; Ikawa, M; Nakahata, K; Zenitani, M; Yamamichi, T; Umeda, S; Deguchi, K; Okuyama, H; Miyagawa, S

2016-05-01

In our previous study, we reported on the development of substituting S147C for HLA-E as a useful gene tool for xenotransplantation. In this study we exchanged the codon of HLA-Ev (147), checked its function, and established a line of transgenic mice. A new construct, a codon exchanging human HLA-Ev (147) + IRES + human beta 2-microgloblin, was established. The construct was subcloned into pCXN2 (the chick beta-actin promoter and cytomegalovirus enhancer) vector. Natural killer cell- and macrophage-mediated cytotoxicities were performed using the established the pig endothelial cell (PEC) line with the new gene. Transgenic mice with it were next produced using a micro-injection method. The expression of the molecule on PECs was confirmed by the transfection of the plasmid. The established molecules on PECs functioned well in regulating natural killer cell-mediated cytotoxicity and macrophage-mediated cytotoxicity. We have also successfully generated several lines of transgenic mice with this plasmid. The expression of HLA-Ev (147) in each mouse organ was confirmed by assessing the mRNA. The chick beta-actin promoter and cytomegalovirus enhancer resulted in a relatively broad expression of the gene in each organ, and a strong expression in the cases of the heart and lung. A synthetic HLA-Ev (147) gene with a codon usage optimized to a mammalian system represents a critical factor in the development of transgenic animals for xenotransplantation. Copyright © 2016 Elsevier Inc. All rights reserved.

Statins induce apoptosis through inhibition of Ras signaling pathways and enhancement of Bim and p27 expression in human hematopoietic tumor cells.

PubMed

Fujiwara, Daichiro; Tsubaki, Masanobu; Takeda, Tomoya; Tomonari, Yoshika; Koumoto, Yu-Ichi; Sakaguchi, Katsuhiko; Nishida, Shozo

2017-10-01

Recently, statins have been demonstrated to improve cancer-related mortality or prognosis in patients of various cancers. However, the details of the apoptosis-inducing mechanisms remain unknown. This study showed that the induction of apoptosis by statins in hematopoietic tumor cells is mediated by mitochondrial apoptotic signaling pathways, which are activated by the suppression of mevalonate or geranylgeranyl pyrophosphate biosynthesis. In addition, statins decreased the levels of phosphorylated extracellular signal-regulated kinase 1/2 and mammalian target of rapamycin through suppressing Ras prenylation. Furthermore, inhibition of extracellular signal-regulated kinase 1/2 and mammalian target of rapamycin by statins induced Bim expression via inhibition of Bim phosphorylation and ubiquitination and cell-cycle arrest at G1 phase via enhancement of p27 expression. Moreover, combined treatment of U0126, a mitogen-activated protein kinase kinase 1/2 inhibitor, and rapamycin, a mammalian target of rapamycin inhibitor, induced Bim and p27 expressions. The present results suggested that statins induce apoptosis by decreasing the mitochondrial transmembrane potential, increasing the activation of caspase-9 and caspase-3, enhancing Bim expression, and inducing cell-cycle arrest at G1 phase through inhibition of Ras/extracellular signal-regulated kinase and Ras/mammalian target of rapamycin pathways. Therefore, our findings support the use of statins as potential anticancer agents or concomitant drugs of adjuvant therapy.

A fine-tuned vector-parasite dialogue in tsetse's cardia determines peritrophic matrix integrity and trypanosome transmission success

PubMed Central

Aksoy, Emre; Weiss, Brian L.; Zhao, Xin; Awuoche, Erick O.; Wu, Yineng; Aksoy, Serap

2018-01-01

Arthropod vectors have multiple physical and immunological barriers that impede the development and transmission of parasites to new vertebrate hosts. These barriers include the peritrophic matrix (PM), a chitinous barrier that separates the blood bolus from the midgut epithelia and modulates vector-pathogens interactions. In tsetse flies, a sleeve-like PM is continuously produced by the cardia organ located at the fore- and midgut junction. African trypanosomes, Trypanosoma brucei, must bypass the PM twice; first to colonize the midgut and secondly to reach the salivary glands (SG), to complete their transmission cycle in tsetse. However, not all flies with midgut infections develop mammalian transmissible SG infections—the reasons for which are unclear. Here, we used transcriptomics, microscopy and functional genomics analyses to understand the factors that regulate parasite migration from midgut to SG. In flies with midgut infections only, parasites fail to cross the PM as they are eliminated from the cardia by reactive oxygen intermediates (ROIs)—albeit at the expense of collateral cytotoxic damage to the cardia. In flies with midgut and SG infections, expression of genes encoding components of the PM is reduced in the cardia, and structural integrity of the PM barrier is compromised. Under these circumstances trypanosomes traverse through the newly secreted and compromised PM. The process of PM attrition that enables the parasites to re-enter into the midgut lumen is apparently mediated by components of the parasites residing in the cardia. Thus, a fine-tuned dialogue between tsetse and trypanosomes at the cardia determines the outcome of PM integrity and trypanosome transmission success. PMID:29614112

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

Construction of two vectors for gene expression in Trichoderma reesei.

PubMed

Lv, Dandan; Wang, Wei; Wei, Dongzhi

2012-01-01

We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

Configurations of a two-tiered amplified gene expression system in adenoviral vectors designed to improve the specificity of in vivo prostate cancer imaging

PubMed Central

Sato, M; Figueiredo, ML; Burton, JB; Johnson, M; Chen, M; Powell, R; Gambhir, SS; Carey, M; Wu, L

2009-01-01

Effective treatment for recurrent, disseminated prostate cancer is notably limited. We have developed adenoviral vectors with a prostate-specific two-step transcriptional amplification (TSTA) system that would express therapeutic genes at a robust level to target metastatic disease. The TSTA system employs the prostate-specific antigen (PSA) promoter/enhancer to drive a potent synthetic activator, which in turn activates the expression of the therapeutic gene. In this study, we explored different configurations of this bipartite system and discovered that physical separation of the two TSTA components into E1 and E3 regions of adenovirus was able to enhance androgen regulation and cell-discriminatory expression. The TSTA vectors that express imaging reporter genes were assessed by noninvasive imaging technologies in animal models. The improved selectivity of the E1E3 configured vector was reflected in silenced ectopic expression in the lung. Significantly, the enhanced specificity of the E1E3 vector enabled the detection of lung metastasis of prostate cancer. An E1E3 TSTA vector that expresses the herpes simplex virus thymidine kinase gene can effectively direct positron emission tomography (PET) imaging of the tumor. The prostate-targeted gene delivery vectors with robust and cell-specific expression capability will advance the development of safe and effective imaging guided therapy for recurrent metastatic stages of prostate cancer. PMID:18305574

Role of the Polarity Determinant Crumbs in Suppressing Mammalian Epithelial Tumor Progression

PubMed Central

Karp, Cristina M.; Tan, Ting Ting; Mathew, Robin; Nelson, Deidre; Mukherjee, Chandreyee; Degenhardt, Kurt; Karantza-Wadsworth, Vassiliki; White, Eileen

2009-01-01

Most tumors are epithelial-derived, and although disruption of polarity and aberrant cellular junction formation is a poor prognosticator in human cancer, the role of polarity determinants in oncogenesis is poorly understood. Using in vivo selection, we identified a mammalian orthologue of the Drosophila polarity regulator crumbs as a gene whose loss of expression promotes tumor progression. Immortal baby mouse kidney epithelial (iBMK) cells selected in vivo to acquire tumorigenicity displayed dramatic repression of crumbs3 (crb3) expression associated with disruption of tight junction formation, apicobasal polarity, and contact-inhibited growth. Restoration of crb3 expression restored junctions, polarity and contact inhibition, while suppressing migration and metastasis. These findings suggest a role for mammalian polarity determinants in suppressing tumorigenesis that may be analogous to the well-studied polarity tumor suppressor mechanisms in Drosophila. PMID:18519669

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

PubMed

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design

PubMed Central

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065

Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

PubMed Central

Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

2012-01-01

Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

InXy and SeXy, compact heterologous reporter proteins for mammalian cells.

PubMed

Fluri, David A; Kelm, Jens M; Lesage, Guillaume; Baba, Marie Daoud-El; Fussenegger, Martin

2007-10-15

Mammalian reporter proteins are essential for gene-function analysis, drugscreening initiatives and as model product proteins for biopharmaceutical manufacturing. Bacillus subtilis can maintain its metabolism by secreting Xylanase A (XynA), which converts xylan into shorter xylose oligosaccharides. XynA is a family 11 xylanase monospecific for D-xylose containing substrates. Mammalian cells transgenic for constitutive expression of wild-type xynA showed substantial secretion of this prokaryotic enzyme. Deletion analysis confirmed that a prokaryotic signal sequence encoded within the first 81 nucleotides was compatible with the secretory pathway of mammalian cells. Codon optimization combined with elimination of the prokaryotic signal sequence resulted in an exclusively intracellular mammalian Xylanase A variant (InXy) while replacement by an immunoglobulin-derived secretion signal created an optimal secreted Xylanase A derivative (SeXy). A variety of chromogenic and fluorescence-based assays adapted for use with mammalian cells detected InXy and SeXy with high sensitivity and showed that both reporter proteins resisted repeated freeze/thaw cycles, remained active over wide temperature and pH ranges, were extremely stable in human serum stored at room temperature and could independently be quantified in samples also containing other prominent reporter proteins such as the human placental alkaline phosphatase (SEAP) and the Bacillus stearothermophilus-derived secreted alpha-amylase (SAMY). Glycoprofiling revealed that SeXy produced in mammalian cells was N- glycosylated at four different sites, mutation of which resulted in impaired secretion. SeXy was successfully expressed in a variety of mammalian cell lines and primary cells following transient transfection and transduction with adeno-associated virus particles (AAV) engineered for constitutive SeXy expression. Intramuscular injection of transgenic AAVs into mice showed significant SeXy levels in the bloodstream. InXy and SeXy are highly sensitive, compact and robust reporter proteins, fully compatible with pre-existing marker genes and can be assayed in high-throughput formats using very small sample volumes. Copyright 2007 Wiley Periodicals, Inc.

Elabela-apelin receptor signaling pathway is functional in mammalian systems.

PubMed

Wang, Zhi; Yu, Daozhan; Wang, Mengqiao; Wang, Qilong; Kouznetsova, Jennifer; Yang, Rongze; Qian, Kun; Wu, Wenjun; Shuldiner, Alan; Sztalryd, Carole; Zou, Minghui; Zheng, Wei; Gong, Da-Wei

2015-02-02

Elabela (ELA) or Toddler is a recently discovered hormone which is required for normal development of heart and vasculature through activation of apelin receptor (APJ), a G protein-coupled receptor (GPCR), in zebrafish. The present study explores whether the ELA-APJ signaling pathway is functional in the mammalian system. Using reverse-transcription PCR, we found that ELA is restrictedly expressed in human pluripotent stem cells and adult kidney whereas APJ is more widely expressed. We next studied ELA-APJ signaling pathway in reconstituted mammalian cell systems. Addition of ELA to HEK293 cells over-expressing GFP-AJP fusion protein resulted in rapid internalization of the fusion receptor. In Chinese hamster ovarian (CHO) cells over-expressing human APJ, ELA suppresses cAMP production with EC50 of 11.1 nM, stimulates ERK1/2 phosphorylation with EC50 of 14.3 nM and weakly induces intracellular calcium mobilization. Finally, we tested ELA biological function in human umbilical vascular endothelial cells and showed that ELA induces angiogenesis and relaxes mouse aortic blood vessel in a dose-dependent manner through a mechanism different from apelin. Collectively, we demonstrate that the ELA-AJP signaling pathways are functional in mammalian systems, indicating that ELA likely serves as a hormone regulating the circulation system in adulthood as well as in embryonic development.

Robust expression of a bioactive mammalian protein in chlamydomonas chloroplast

DOEpatents

Mayfield, Stephen P.

2010-03-16

Methods and compositions are disclosed to engineer chloroplast comprising heterologous mammalian genes via a direct replacement of chloroplast Photosystem II (PSII) reaction center protein coding regions to achieve expression of recombinant protein above 5% of total protein. When algae is used, algal expressed protein is produced predominantly as a soluble protein where the functional activity of the peptide is intact. As the host algae is edible, production of biologics in this organism for oral delivery or proteins/peptides, especially gut active proteins, without purification is disclosed.

Robust expression of a bioactive mammalian protein in Chlamydomonas chloroplast

DOEpatents

Mayfield, Stephen P

2015-01-13

Methods and compositions are disclosed to engineer chloroplast comprising heterologous mammalian genes via a direct replacement of chloroplast Photosystem II (PSII) reaction center protein coding regions to achieve expression of recombinant protein above 5% of total protein. When algae is used, algal expressed protein is produced predominantly as a soluble protein where the functional activity of the peptide is intact. As the host algae is edible, production of biologics in this organism for oral delivery of proteins/peptides, especially gut active proteins, without purification is disclosed.

Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

PubMed

Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

2008-12-01

With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

Database construction for PromoterCAD: synthetic promoter design for mammals and plants.

PubMed

Nishikata, Koro; Cox, Robert Sidney; Shimoyama, Sayoko; Yoshida, Yuko; Matsui, Minami; Makita, Yuko; Toyoda, Tetsuro

2014-03-21

Synthetic promoters can control a gene's timing, location, and expression level. The PromoterCAD web server ( http://promotercad.org ) allows the design of synthetic promoters to control plant gene expression, by novel arrangement of cis-regulatory elements. Recently, we have expanded PromoterCAD's scope with additional plant and animal data: (1) PLACE (Plant Cis-acting Regulatory DNA Elements), including various sized sequence motifs; (2) PEDB (Mammalian Promoter/Enhancer Database), including gene expression data for mammalian tissues. The plant PromoterCAD data now contains 22 000 Arabidopsis thaliana genes, 2 200 000 microarray measurements in 20 growth conditions and 79 tissue organs and developmental stages, while the new mammalian PromoterCAD data contains 679 Mus musculus genes and 65 000 microarray measurements in 96 tissue organs and cell types ( http://promotercad.org/mammal/ ). This work presents step-by-step instructions for adding both regulatory motif and gene expression data to PromoterCAD, to illustrate how users can expand PromoterCAD functionality for their own applications and organisms.

The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo

PubMed Central

Meerbrey, Kristen L.; Hu, Guang; Kessler, Jessica D.; Roarty, Kevin; Fang, Justin E.; Herschkowitz, Jason I.; Burrows, Anna E.; Ciccia, Alberto; Sun, Tingting; Schmitt, Earlene M.; Bernardi, Ronald J.; Fu, Xiaoyong; Bland, Christopher S.; Cooper, Thomas A.; Schiff, Rachel; Rosen, Jeffrey M.; Westbrook, Thomas F.; Elledge, Stephen J.

2011-01-01

The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems. However, significant challenges still remain to fully exploit RNAi for mammalian genetics. For instance, genetic screens and in vivo studies could be broadly improved by methods that allow inducible and uniform gene expression control. To achieve this, we built the lentiviral pINDUCER series of expression vehicles for inducible RNAi in vivo. Using a multicistronic design, pINDUCER vehicles enable tracking of viral transduction and shRNA or cDNA induction in a broad spectrum of mammalian cell types in vivo. They achieve this uniform temporal, dose-dependent, and reversible control of gene expression across heterogenous cell populations via fluorescence-based quantification of reverse tet-transactivator expression. This feature allows isolation of cell populations that exhibit a potent, inducible target knockdown in vitro and in vivo that can be used in human xenotransplantation models to examine cancer drug targets. PMID:21307310

Transport characteristics of mammalian Rh and Rh glycoproteins expressed in heterologous systems.

PubMed

Westhoff, C M; Wylie, D E

2006-01-01

The development and use of heterologous expression systems is critical for deciphering the function of mammalian Rh and Rh-glycoproteins. The studies here use Xenopus oocytes, well known for their ability to readily traffic and express difficult membrane proteins, and S. cerevisiae wild-type strains and mutants that are defective in ammonium transport. Data obtained in both of these expression systems revealed that mammalian Rh-glycoprotein-mediated transport (RhAG, RhBG, and RhCG) is an electroneutral process that is driven by the NH4+ concentration and the transmembrane H+ gradient, effectively exchanging NH4+ for H+ in a process that results in transport of net NH3. Homology modeling and functional studies suggest that the more recently evolved erythrocyte blood group proteins, RhCE and RhD, may not function directly in ammonia transport and may be evolving a new function in the RBC membrane. The relationship of Rh and Rh-glycoproteins to the Amt/Mep ammonium transporters is substantiated with functional transport data and structural modeling.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Expression of Rous sarcoma virus-derived retroviral vectors in the avian blastoderm: Potential as stable genetic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, S.T.; Stoker, A.W.; Bissell, M.J.

1991-12-01

Retroviruses are valuable tools in studies of embryonic development, both as gene expression vectors and as cell lineage markers. In this study early chicken blastoderm cells are shown to be permissive for infection by Rous sarcoma virus and derivative replication-defective by Rous sarcoma virus and derivative replication-defective vectors, and, in contrast to previously published data, these cells will readily express viral genes. In cultured blastoderm cells, Rous sarcoma virus stably integrates and is transcribed efficiently, producing infectious virus particles. Using replication-defective vectors encoding the bacterial lacZ gene, the authors further show that blastoderms can be infected in culture and inmore » ovo. In ovo, lacZ expression is seen within 24 hours of virus inoculation, and by 96 hours stably expressing clones of cells are observed in diverse tissues throughout the embryo, including epidermis, somites, and heart, as well as in extraembryonic membranes. Given the rapid onset of vector expression and the broad range of permissive cell types, it should be feasible to use Rous sarcoma virus-derived retroviruses as early lineage markers and expression vectors beginning at the blastoderm stage of avian embryogenesis.« less

Holocarboxylase Synthetase: A Moonlighting Transcriptional Coregulator of Gene Expression and a Cytosolic Regulator of Biotin Utilization.

PubMed

León-Del-Río, Alfonso; Valadez-Graham, Viviana; Gravel, Roy A

2017-08-21

The vitamin biotin is an essential nutrient for the metabolism and survival of all organisms owing to its function as a cofactor of enzymes collectively known as biotin-dependent carboxylases. These enzymes use covalently attached biotin as a vector to transfer a carboxyl group between donor and acceptor molecules during carboxylation reactions. In human cells, biotin-dependent carboxylases catalyze key reactions in gluconeogenesis, fatty acid synthesis, and amino acid catabolism. Biotin is attached to apocarboxylases by a biotin ligase: holocarboxylase synthetase (HCS) in mammalian cells and BirA in microbes. Despite their evolutionary distance, these proteins share structural and sequence similarities, underscoring their importance across all life forms. However, beyond its role in metabolism, HCS participates in the regulation of biotin utilization and acts as a nuclear transcriptional coregulator of gene expression. In this review, we discuss the function of HCS and biotin in metabolism and human disease, a putative role for the enzyme in histone biotinylation, and its participation as a nuclear factor in chromatin dynamics. We suggest that HCS be classified as a moonlighting protein, with two biotin-dependent cytosolic metabolic roles and a distinct biotin-independent nuclear coregulatory function.

Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery.

PubMed

Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P

2006-08-01

Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.

Germline Transgenic Pigs by Sleeping Beauty Transposition in Porcine Zygotes and Targeted Integration in the Pig Genome

PubMed Central

Garrels, Wiebke; Mátés, Lajos; Holler, Stephanie; Dalda, Anna; Taylor, Ulrike; Petersen, Björn; Niemann, Heiner; Izsvák, Zsuzsanna; Ivics, Zoltán; Kues, Wilfried A.

2011-01-01

Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X) transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases. PMID:21897845

Repurposing CRISPR/Cas9 for in situ functional assays.

PubMed

Malina, Abba; Mills, John R; Cencic, Regina; Yan, Yifei; Fraser, James; Schippers, Laura M; Paquet, Marilène; Dostie, Josée; Pelletier, Jerry

2013-12-01

RNAi combined with next-generation sequencing has proven to be a powerful and cost-effective genetic screening platform in mammalian cells. Still, this technology has its limitations and is incompatible with in situ mutagenesis screens on a genome-wide scale. Using p53 as a proof-of-principle target, we readapted the CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR associated 9) genome-editing system to demonstrate the feasibility of this methodology for targeted gene disruption positive selection assays. By using novel "all-in-one" lentiviral and retroviral delivery vectors heterologously expressing both a codon-optimized Cas9 and its synthetic guide RNA (sgRNA), we show robust selection for the CRISPR-modified Trp53 locus following drug treatment. Furthermore, by linking Cas9 expression to GFP fluorescence, we use an "all-in-one" system to track disrupted Trp53 in chemoresistant lymphomas in the Eμ-myc mouse model. Deep sequencing analysis of the tumor-derived endogenous Cas9-modified Trp53 locus revealed a wide spectrum of mutants that were enriched with seemingly limited off-target effects. Taken together, these results establish Cas9 genome editing as a powerful and practical approach for positive in situ genetic screens.

Repurposing CRISPR/Cas9 for in situ functional assays

PubMed Central

Malina, Abba; Mills, John R.; Cencic, Regina; Yan, Yifei; Fraser, James; Schippers, Laura M.; Paquet, Marilène; Dostie, Josée; Pelletier, Jerry

2013-01-01

RNAi combined with next-generation sequencing has proven to be a powerful and cost-effective genetic screening platform in mammalian cells. Still, this technology has its limitations and is incompatible with in situ mutagenesis screens on a genome-wide scale. Using p53 as a proof-of-principle target, we readapted the CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR associated 9) genome-editing system to demonstrate the feasibility of this methodology for targeted gene disruption positive selection assays. By using novel “all-in-one” lentiviral and retroviral delivery vectors heterologously expressing both a codon-optimized Cas9 and its synthetic guide RNA (sgRNA), we show robust selection for the CRISPR-modified Trp53 locus following drug treatment. Furthermore, by linking Cas9 expression to GFP fluorescence, we use an “all-in-one” system to track disrupted Trp53 in chemoresistant lymphomas in the Eμ-myc mouse model. Deep sequencing analysis of the tumor-derived endogenous Cas9-modified Trp53 locus revealed a wide spectrum of mutants that were enriched with seemingly limited off-target effects. Taken together, these results establish Cas9 genome editing as a powerful and practical approach for positive in situ genetic screens. PMID:24298059

Adenoviral vector tethering to metal surfaces via hydrolysable cross-linkers for the modulation of vector release and transduction

PubMed Central

Fishbein, Ilia; Forbes, Scott P.; Chorny, Michael; Connolly, Jeanne M.; Adamo, Richard F.; Corrales, Ricardo; Alferiev, Ivan S.; Levy, Robert J.

2013-01-01

The use of arterial stents and other medical implants as a delivery platform for surface immobilized gene vectors allows for safe and efficient localized expression of therapeutic transgenes. In this study we investigate the use of hydrolysable cross-linkers with distinct kinetics of hydrolysis for delivery of gene vectors from polyallylamine bisphosphonate-modified metal surfaces. Three cross-linkers with the estimated t1/2 of ester bonds hydrolysis of 5, 12 and 50 days demonstrated a cumulative 20%, 39% and 45% vector release, respectively, after 30 days exposure to physiological buffer at 37°C. Transgene expression in endothelial and smooth muscles cells transduced with substrate immobilized adenovirus resulted in significantly different expression profiles for each individual cross-linker. Furthermore, immobilization of adenoviral vectors effectively extended their transduction effectiveness beyond the initial phase of release. Transgene expression driven by adenovirus-tethered stents in rat carotid arteries demonstrated that a faster rate of cross-linker hydrolysis resulted in higher expression levels at day 1, which declined by day 8 after stent implantation, while inversely, slower hydrolysis was associated with increased arterial expression at day 8 in comparison with day 1. In conclusion, adjustable release of transduction-competent adenoviral vectors from metallic surfaces can be achieved, both in vitro and in vivo, through surface immobilization of adenoviral vectors using hydrolysable cross-linkers with structure-specific release kinetics. PMID:23777912

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

Novel Protective Antigens Expressed by Trypanosoma cruzi Amastigotes Provide Immunity to Mice Highly Susceptible to Chagas' Disease▿

PubMed Central

Silveira, Eduardo L. V.; Claser, Carla; Haolla, Filipe A. B.; Zanella, Luiz G.; Rodrigues, Mauricio M.

2008-01-01

Earlier studies have demonstrated in A/Sn mice highly susceptible to Chagas' disease protective immunity against lethal Trypanosoma cruzi infection elicited by vaccination with an open reading frame (ORF) expressed by amastigotes. In our experiments, we used this mouse model to search for other amastigote-expressed ORFs with a similar property. Fourteen ORFs previously determined to be expressed in this developmental stage were individually inserted into a eukaryotic expression vector containing a nucleotide sequence that encoded a mammalian secretory signal peptide. Immunization with 13 of the 14 ORFs induced specific antibodies which recognized the amastigotes. Three of those immune sera also reacted with trypomastigotes and epimastigotes. After a lethal challenge with Y strain trypomastigotes, the vast majority of plasmid-injected mice succumbed to infection. In some cases, a significant delay in mortality was observed. Only two of these ORFs provided protective immunity against the otherwise lethal infection caused by trypomastigotes of the Y or Colombia strain. These ORFs encode members of the trans-sialidase family of surface antigens related to the previously described protective antigen amastigote surface protein 2 (ASP-2). Nevertheless, at the level of antibody recognition, no cross-reactivity was observed between the ORFs and the previously described ASP-2 from the Y strain. In immunofluorescence analyses, we observed the presence of epitopes related to both proteins expressed by amastigotes of seven different strains. In conclusion, our approach allowed us to successfully identify two novel protective ORFs which we consider interesting for future studies on the immune response to Chagas' disease. PMID:18579696

Novel protective antigens expressed by Trypanosoma cruzi amastigotes provide immunity to mice highly susceptible to Chagas' disease.

PubMed

Silveira, Eduardo L V; Claser, Carla; Haolla, Filipe A B; Zanella, Luiz G; Rodrigues, Mauricio M

2008-08-01

Earlier studies have demonstrated in A/Sn mice highly susceptible to Chagas' disease protective immunity against lethal Trypanosoma cruzi infection elicited by vaccination with an open reading frame (ORF) expressed by amastigotes. In our experiments, we used this mouse model to search for other amastigote-expressed ORFs with a similar property. Fourteen ORFs previously determined to be expressed in this developmental stage were individually inserted into a eukaryotic expression vector containing a nucleotide sequence that encoded a mammalian secretory signal peptide. Immunization with 13 of the 14 ORFs induced specific antibodies which recognized the amastigotes. Three of those immune sera also reacted with trypomastigotes and epimastigotes. After a lethal challenge with Y strain trypomastigotes, the vast majority of plasmid-injected mice succumbed to infection. In some cases, a significant delay in mortality was observed. Only two of these ORFs provided protective immunity against the otherwise lethal infection caused by trypomastigotes of the Y or Colombia strain. These ORFs encode members of the trans-sialidase family of surface antigens related to the previously described protective antigen amastigote surface protein 2 (ASP-2). Nevertheless, at the level of antibody recognition, no cross-reactivity was observed between the ORFs and the previously described ASP-2 from the Y strain. In immunofluorescence analyses, we observed the presence of epitopes related to both proteins expressed by amastigotes of seven different strains. In conclusion, our approach allowed us to successfully identify two novel protective ORFs which we consider interesting for future studies on the immune response to Chagas' disease.

PPARalpha-dependent modulation of hepatic CYP1A by clofibric acid in rats.

PubMed

Shaban, Zein; El-Shazly, Samir; Ishizuka, Mayumi; Kimura, Kazuhiro; Kazusaka, Akio; Fujita, Shoichi

2004-09-01

Fibrates, hypolipidemic drugs, have been reported to suppress the metabolic activities of cytochrome P450 1A1 and 1A2 in rats but the mechanism has not been elucidated. In the present study we tested the hypothesis that the inhibitory effect of fibrates on arylhydrocarbon receptor (AhR) function may be due to their stimulatory effects on PPARalpha. Sudan III (S.III) treatment induced CYP 1A1 and CYP 1A2 protein expression, mRNA and their metabolic activities, methoxyresorufin-O-demethylase (MROD) and ethoxyresorufin-O-deethylase (EROD), in Wistar rats higher than those in the control. Co-treatment of rats with S.III and clofibric acid (CA) caused a 40-50% decrease in the induced levels of CYP1A1 and CYP1A2 protein, mRNA expression and their metabolic activities and reduced AhR protein expression. When we treated HepG2 cells with S.III and/or CA, no suppressive effect on S.III-induced CYP1A1 protein expression due to CA was found. HepG2 cells were transiently transfected with increasing concentrations of PPARalpha mammalian expression vector and exposed to the same treatment. CA co-treatment with S.III decreased AhR protein and S.III-induced CYP1A1 protein expression with increasing dose of PPARalpha transfected into HepG2 cells. Our results demonstrate that the suppressive effect of fibrates on CYP1A is PPARalpha-dependent and suggest that PPARalpha has an inhibitory effect on AhR function.

Kinematic sensitivity of robot manipulators

NASA Technical Reports Server (NTRS)

Vuskovic, Marko I.

1989-01-01

Kinematic sensitivity vectors and matrices for open-loop, n degrees-of-freedom manipulators are derived. First-order sensitivity vectors are defined as partial derivatives of the manipulator's position and orientation with respect to its geometrical parameters. The four-parameter kinematic model is considered, as well as the five-parameter model in case of nominally parallel joint axes. Sensitivity vectors are expressed in terms of coordinate axes of manipulator frames. Second-order sensitivity vectors, the partial derivatives of first-order sensitivity vectors, are also considered. It is shown that second-order sensitivity vectors can be expressed as vector products of the first-order sensitivity vectors.

Comparative ultrastructural characterization of African horse sickness virus-infected mammalian and insect cells reveals a novel potential virus release mechanism from insect cells.

PubMed

Venter, E; van der Merwe, C F; Buys, A V; Huismans, H; van Staden, V

2014-03-01

African horse sickness virus (AHSV) is an arbovirus capable of successfully replicating in both its mammalian host and insect vector. Where mammalian cells show a severe cytopathic effect (CPE) following AHSV infection, insect cells display no CPE. These differences in cell death could be linked to the method of viral release, i.e. lytic or non-lytic, that predominates in a specific cell type. Active release of AHSV, or any related orbivirus, has, however, not yet been documented from insect cells. We applied an integrated microscopy approach to compare the nanomechanical and morphological response of mammalian and insect cells to AHSV infection. Atomic force microscopy revealed plasma membrane destabilization, integrity loss and structural deformation of the entire surface of infected mammalian cells. Infected insect cells, in contrast, showed no morphological differences from mock-infected cells other than an increased incidence of circular cavities present on the cell surface. Transmission electron microscopy imaging identified a novel large vesicle-like compartment within infected insect cells, not present in mammalian cells, containing viral proteins and virus particles. Extracellular clusters of aggregated virus particles were visualized adjacent to infected insect cells with intact plasma membranes. We propose that foreign material is accumulated within these vesicles and that their subsequent fusion with the cell membrane releases entrapped viruses, thereby facilitating a non-lytic virus release mechanism different from the budding previously observed in mammalian cells. This insect cell-specific defence mechanism contributes to the lack of cell damage observed in AHSV-infected insect cells.

Human REV3 DNA Polymerase Zeta Localizes to Mitochondria and Protects the Mitochondrial Genome.

PubMed

Singh, Bhupendra; Li, Xiurong; Owens, Kjerstin M; Vanniarajan, Ayyasamy; Liang, Ping; Singh, Keshav K

2015-01-01

To date, mitochondrial DNA polymerase γ (POLG) is the only polymerase known to be present in mammalian mitochondria. A dogma in the mitochondria field is that there is no other polymerase present in the mitochondria of mammalian cells. Here we demonstrate localization of REV3 DNA polymerase in the mammalian mitochondria. We demonstrate localization of REV3 in the mitochondria of mammalian tissue as well as cell lines. REV3 associates with POLG and mitochondrial DNA and protects the mitochondrial genome from DNA damage. Inactivation of Rev3 leads to reduced mitochondrial membrane potential, reduced OXPHOS activity, and increased glucose consumption. Conversely, inhibition of the OXPHOS increases expression of Rev3. Rev3 expression is increased in human primary breast tumors and breast cancer cell lines. Inactivation of Rev3 decreases cell migration and invasion, and localization of Rev3 in mitochondria increases survival and the invasive potential of cancer cells. Taken together, we demonstrate that REV3 functions in mammalian mitochondria and that mitochondrial REV3 is associated with the tumorigenic potential of cells.

Engineering zucchini yellow mosaic potyvirus as a non-pathogenic vector for expression of heterologous proteins in cucurbits.

PubMed

Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A

2001-04-27

Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.

Engineering Escherichia coli into a protein delivery system for mammalian cells.

PubMed

Reeves, Analise Z; Spears, William E; Du, Juan; Tan, Kah Yong; Wagers, Amy J; Lesser, Cammie F

2015-05-15

Many Gram-negative pathogens encode type 3 secretion systems, sophisticated nanomachines that deliver proteins directly into the cytoplasm of mammalian cells. These systems present attractive opportunities for therapeutic protein delivery applications; however, their utility has been limited by their inherent pathogenicity. Here, we report the reengineering of a laboratory strain of Escherichia coli with a tunable type 3 secretion system that can efficiently deliver heterologous proteins into mammalian cells, thereby circumventing the need for virulence attenuation. We first introduced a 31 kB region of Shigella flexneri DNA that encodes all of the information needed to form the secretion nanomachine onto a plasmid that can be directly propagated within E. coli or integrated into the E. coli chromosome. To provide flexible control over type 3 secretion and protein delivery, we generated plasmids expressing master regulators of the type 3 system from either constitutive or inducible promoters. We then constructed a Gateway-compatible plasmid library of type 3 secretion sequences to enable rapid screening and identification of sequences that do not perturb function when fused to heterologous protein substrates and optimized their delivery into mammalian cells. Combining these elements, we found that coordinated expression of the type 3 secretion system and modified target protein substrates produces a nonpathogenic strain that expresses, secretes, and delivers heterologous proteins into mammalian cells. This reengineered system thus provides a highly flexible protein delivery platform with potential for future therapeutic applications.

Functional Similarities between Pigeon ‘Milk’ and Mammalian Milk: Induction of Immune Gene Expression and Modification of the Microbiota

PubMed Central

Gillespie, Meagan J.; Stanley, Dragana; Chen, Honglei; Donald, John A.; Nicholas, Kevin R.; Moore, Robert J.; Crowley, Tamsyn M.

2012-01-01

Pigeon ‘milk’ and mammalian milk have functional similarities in terms of nutritional benefit and delivery of immunoglobulins to the young. Mammalian milk has been clearly shown to aid in the development of the immune system and microbiota of the young, but similar effects have not yet been attributed to pigeon ‘milk’. Therefore, using a chicken model, we investigated the effect of pigeon ‘milk’ on immune gene expression in the Gut Associated Lymphoid Tissue (GALT) and on the composition of the caecal microbiota. Chickens fed pigeon ‘milk’ had a faster rate of growth and a better feed conversion ratio than control chickens. There was significantly enhanced expression of immune-related gene pathways and interferon-stimulated genes in the GALT of pigeon ‘milk’-fed chickens. These pathways include the innate immune response, regulation of cytokine production and regulation of B cell activation and proliferation. The caecal microbiota of pigeon ‘milk’-fed chickens was significantly more diverse than control chickens, and appears to be affected by prebiotics in pigeon ‘milk’, as well as being directly seeded by bacteria present in pigeon ‘milk’. Our results demonstrate that pigeon ‘milk’ has further modes of action which make it functionally similar to mammalian milk. We hypothesise that pigeon ‘lactation’ and mammalian lactation evolved independently but resulted in similarly functional products. PMID:23110233

Immunolocalization of ciliary neurotrophic factor receptor alpha (CNTFRalpha) in mammalian photoreceptor cells.

PubMed

Beltran, William A; Rohrer, Hermann; Aguirre, Gustavo D

2005-04-01

To characterize the site of expression of the alpha subunit of the receptor for ciliary neurotrophic factor (CNTFRalpha) in the retina of a variety of mammalian species, and determine whether CNTFRalpha is localized to photoreceptor cells. The cellular distribution of CNTFRalpha(protein) was examined by immunocytochemistry in the adult retinas of several mammalian species that included mouse, rat, dog, cat, sheep, pig, horse, monkey, and human. Developing retinas from 3-day-old and 6-day-old rats were also included in this study. The molecular weight of CNTFRalpha in rat, dog, cat, pig, and human retinas was determined by immunoblotting. CNTFRalpha immunolabeling was present in the retina of all species. A common pattern was observed in all species, and represented labeling of the nerve fiber layer (NFL), ganglion cell layer (GCL), inner plexiform layer (IPL), inner nuclear layer (INL), and outer plexiform layer (OPL). CNTFRalpha did not immunolocalize to photoreceptor cells in both adult and developing rodent retinas, but was consistently observed in both rods and cones of non-rodent species. The molecular weight of CNTFRalpha in mammalian retinas was approximately 61-64 kDa. These findings highlight a significant difference in the expression of CNTFRalpha in the retina of rodent and non-rodent mammalian species. The expression of CNTFRalpha by rods and cones in non-rodent species may suggest a direct mechanism of action if CNTF administration results in photoreceptor rescue.

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

The nucleolar protein SURF-6 is essential for viability in mouse NIH/3T3 cells.

PubMed

Polzikov, Mikhail; Magoulas, Charalambos; Zatsepina, Olga

2007-09-01

SURF-6 is a bona fide nucleolar protein comprising an evolutionary conserved family that extends from human to yeast. The expression of the mammalian SURF-6 has been recently found to be regulated during the cell cycle. In order to determine the importance of SURF-6 in mammalian cells, we applied the Tet-On system to regulate conditionally, in response to tetracycline, the expression of an antisense RNA (asRNA) that targets Surf-6 mRNA in mouse NIH/3T3 cells. Induced Surf-6 asRNA caused an effective depletion of SURF-6 protein resulted in cell death and in an apparent arrest in the G1 phase of the cell cycle. These results provide for the first time evidence that expression of SURF-6 is essential for mammalian cell viability, and suggest that SURF-6 might participate in the progression of cell cycle.

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

Alpharetroviral Self-inactivating Vectors: Long-term Transgene Expression in Murine Hematopoietic Cells and Low Genotoxicity

PubMed Central

Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel

2012-01-01

Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016

“Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

PubMed Central

Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

2001-01-01

Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

PubMed

Crosby, Catherine M; Barry, Michael A

2017-02-18

Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

Genetic engineering with endothelial nitric oxide synthase improves functional properties of endothelial progenitor cells from patients with coronary artery disease: an in vitro study.

PubMed

Kaur, Savneet; Kumar, T R Santhosh; Uruno, Akira; Sugawara, Akira; Jayakumar, Karunakaran; Kartha, Chandrasekharan Cheranellore

2009-11-01

Recent studies have reported a marked impairment in the number and functions of endothelial progenitor cells (EPCs) in patients with coronary artery disease (CAD). In view of an important role of eNOS in angiogenesis, in the present study, we evaluated the effects of eNOS gene transfer in ex vivo expanded EPCs isolated from patients with CAD. The expanded EPCs were transfected with mammalian expression vector pcDNA3.1-eNOS containing the full-length human eNOS gene using lipofectamine. About 35-40% of the eNOS-EPCs had higher expression of eNOS as compared to untransfected EPCs. EPCs transfected with pcDNA3.0-EGFP, the plasmid vector expressing green fluorescent protein (GFP) were used as control. The untransfected, GFP-transfected and eNOS-transfected EPCs were compared in terms of important functional attributes of angiogenesis such as proliferation, migration, differentiation and adhesion/integration into tube-like structures in vitro. Functional studies revealed that in the presence of defined growth conditions, compared to the untransfected and GFP-transfected cells, eNOS-EPCs from patients with CAD have a significant increase in [3H] thymidine-labeled DNA (P < 0.01), migration (14.6 +/- 1.8 and 16.5 +/- 1.9 vs. 23.5 +/- 3.4 cells/field, P < 0.01), ability to differentiate into endothelial-like spindle-shaped cells (46 +/- 4.5 and 56.5 +/- 2.1 vs. 93.2 +/- 6.6 cells/field, P < 0.001) and also incorporation into tube-like structures on the matrigel (GFP-EPCs: 21.25 +/- 2.9 vs. GFP-eNOS-EPCs: 34.5 +/- 5.5 cells/field, P < 0.05). We conclude that eNOS gene transfection is a valuable approach to augment angiogenic properties of ex vivo expanded EPCs and eNOS-modified EPCs may offer significant advantages than EPCs alone in terms of their clinical use in patients with myocardial ischemia.

The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.

PubMed

Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M

1992-02-01

The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs. The presence in shark liver of an FABP which differs substantially in primary structure from mammalian liver FABP, while being closely related to the FABP expressed in mammalian heart muscle, peripheral nerve myelin and adipocytes, opens a further dimension regarding the question of the existence of structure-dependent and tissue-specific specialization of FABP function in lipid metabolism.

The Combinational Use of CRISPR/Cas9 and Targeted Toxin Technology Enables Efficient Isolation of Bi-Allelic Knockout Non-Human Mammalian Clones.

PubMed

Watanabe, Satoshi; Sakurai, Takayuki; Nakamura, Shingo; Miyoshi, Kazuchika; Sato, Masahiro

2018-04-04

Recent advances in genome editing systems such as clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease (CRISPR/Cas9) have facilitated genomic modification in mammalian cells. However, most systems employ transient treatment with selective drugs such as puromycin to obtain the desired genome-edited cells, which often allows some untransfected cells to survive and decreases the efficiency of generating genome-edited cells. Here, we developed a novel targeted toxin-based drug-free selection system for the enrichment of genome-edited cells. Cells were transfected with three expression vectors, each of which carries a guide RNA (gRNA), humanized Cas9 ( hCas9 ) gene, or Clostridium perfringens -derived endo-β-galactosidase C ( EndoGalC ) gene. Once EndoGalC is expressed in a cell, it digests the cell-surface α-Gal epitope, which is specifically recognized by BS-I-B₄ lectin (IB4). Three days after transfection, these cells were treated with cytotoxin saporin-conjugated IB4 (IB4SAP) for 30 min at 37 °C prior to cultivation in a normal medium. Untransfected cells and those weakly expressing EndoGalC will die due to the internalization of saporin. Cells transiently expressing EndoGalC strongly survive, and some of these surviving clones are expected to be genome-edited bi-allelic knockout (KO) clones due to their strong co-expression of gRNA and hCas9. When porcine α-1,3-galactosyltransferase gene, which can synthesize the α-Gal epitope, was attempted to be knocked out, 16.7% and 36.7% of the surviving clones were bi-allelic and mono-allelic knockout (KO) cells, respectively, which was in contrast to the isolation of clones in the absence of IB4SAP treatment. Namely, 0% and 13.3% of the resulting clones were bi-allelic and mono-allelic KO cells, respectively. A similar tendency was seen when other target genes such as DiGeorge syndrome critical region gene 2 and transforming growth factor-β receptor type 1 gene were targeted to be knocked out. Our results indicate that a combination of the CRISPR/Cas9 system and targeted toxin technology using IB4SAP allows efficient enrichment of genome-edited clones, particularly bi-allelic KO clones.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

Development and characterization of a Rift Valley fever virus cell-cell fusion assay using alphavirus replicon vectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filone, Claire Marie; Heise, Mark; Doms, Robert W.

2006-12-20

Rift Valley fever virus (RVFV), a member of the Phlebovirus genus in the Bunyaviridae family, is transmitted by mosquitoes and infects both humans and domestic animals, particularly cattle and sheep. Since primary RVFV strains must be handled in BSL-3+ or BSL-4 facilities, a RVFV cell-cell fusion assay will facilitate the investigation of RVFV glycoprotein function under BSL-2 conditions. As for other members of the Bunyaviridae family, RVFV glycoproteins are targeted to the Golgi, where the virus buds, and are not efficiently delivered to the cell surface. However, overexpression of RVFV glycoproteins using an alphavirus replicon vector resulted in the expressionmore » of the glycoproteins on the surface of multiple cell types. Brief treatment of RVFV glycoprotein expressing cells with mildly acidic media (pH 6.2 and below) resulted in rapid and efficient syncytia formation, which we quantified by {beta}-galactosidase {alpha}-complementation. Fusion was observed with several cell types, suggesting that the receptor(s) for RVFV is widely expressed or that this acid-dependent virus does not require a specific receptor to mediate cell-cell fusion. Fusion occurred over a broad temperature range, as expected for a virus with both mosquito and mammalian hosts. In contrast to cell fusion mediated by the VSV-G glycoprotein, RVFV glycoprotein-dependent cell fusion could be prevented by treating target cells with trypsin, indicating that one or more proteins (or protein-associated carbohydrate) on the host cell surface are needed to support membrane fusion. The cell-cell fusion assay reported here will make it possible to study the membrane fusion activity of RVFV glycoproteins in a high-throughput format and to screen small molecule inhibitors for the ability to block virus-specific membrane fusion.« less

Involvement of H-ras in erythroid differentiation of TF1 and human umbilical cord blood CD34 cells.

PubMed

Ge, Y; Li, Z H; Marshall, M S; Broxmeyer, H E; Lu, L

1998-06-01

To investigate the role of the ras gene in erythroid differentiation, a human erythroleukemic cell line, TF1, was transduced with a selectable retroviral vector carrying a mammalian wild type H-ras gene or a cytoplasmic dominant negative RAS1 gene. Transduction of TF1 cells with the wild type H-ras gene resulted in changes of cell types and up-regulation of erythroid-specific gene expression similar to that seen in differentiating erythroid cells. The number of red blood cell containing colonies derived from TF1 cells transduced with wild type H-ras cDNA was significantly increased and the cells in the colonies were more hemoglobinized as estimated by a deeper red color compared to those colony cells from mock or dominant negative RAS1 gene transduced TF1 cells, suggesting increased erythroid differentiation of TF1 cells after transduction of wild type H-ras in vitro. The mRNA levels of beta- and gamma-, but not alpha-, globin genes were significantly higher in H-ras transduced TF1 cells than those in TF1 cells transduced with mock or dominant negative RAS1 gene. Moreover, a 4kb pre-mRNA of the Erythropoietin receptor (EpoR) was highly expressed only in H-ras transduced TF1 cells. Additionally, human umbilical cord blood (CB) CD34 cells which are highly enriched for hematopoietic stem/progenitor cells were transduced with the same retroviral vectors to evaluate in normal primary cells the activities of H-ras in erythroid differentiation. Increased numbers of erythroid cell containing colonies (BFU-E and CFU-GEMM) were observed in CD34 cells transduced with the H-ras cDNA, compared to that from mock transduced cells. These data suggest a possible role for ras in erythroid differentiation.

BacMam immunization partially protects pigs against sublethal challenge with African swine fever virus.

PubMed

Argilaguet, Jordi M; Pérez-Martín, Eva; López, Sergio; Goethe, Martin; Escribano, J M; Giesow, Katrin; Keil, Günther M; Rodríguez, Fernando

2013-04-01

Lack of vaccines and efficient control measures complicate the control and eradication of African swine fever (ASF). Limitations of conventional inactivated and attenuated virus-based vaccines against African swine fever virus (ASFV) highlight the need to use new technologies to develop efficient and safe vaccines against this virus. With this aim in mind, in this study we have constructed BacMam-sHAPQ, a baculovirus based vector for gene transfer into mammalian cells, expressing a fusion protein comprising three in tandem ASFV antigens: p54, p30 and the extracellular domain of the viral hemagglutinin (secretory hemagglutinin, sHA), under the control of the human cytomegalovirus immediate early promoter (CMVie). Confirming its correct in vitro expression, BacMam-sHAPQ induced specific T-cell responses directly after in vivo immunization. Conversely, no specific antibody responses were detectable prior to ASFV challenge. The protective potential of this recombinant vaccine candidate was tested by a homologous sublethal challenge with ASFV following immunization. Four out of six immunized pigs remained viremia-free after ASFV infection, while the other two pigs showed similar viremic titres to control animals. The protection afforded correlated with the presence of a large number of virus-specific IFNγ-secreting T-cells in blood at 17 days post-infection. In contrast, the specific antibody levels observed after ASFV challenge in sera from BacMam-sHAPQ immunized pigs were indistinguishable from those found in control pigs. These results highlight the importance of the cellular responses in protection against ASFV and point towards BacMam vectors as potential tools for future vaccine development. Copyright © 2013 Elsevier B.V. All rights reserved.

Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming.

PubMed

Schmitt, Christopher E; Morales, Blanca M; Schmitz, Ellen M H; Hawkins, John S; Lizama, Carlos O; Zape, Joan P; Hsiao, Edward C; Zovein, Ann C

2017-06-05

Non-integrating episomal vectors have become an important tool for induced pluripotent stem cell reprogramming. The episomal vectors carrying the "Yamanaka reprogramming factors" (Oct4, Klf, Sox2, and L-Myc + Lin28) are critical tools for non-integrating reprogramming of cells to a pluripotent state. However, the reprogramming process remains highly stochastic, and is hampered by an inability to easily identify clones that carry the episomal vectors. We modified the original set of vectors to express spectrally separable fluorescent proteins to allow for enrichment of transfected cells. The vectors were then tested against the standard original vectors for reprogramming efficiency and for the ability to enrich for stoichiometric ratios of factors. The reengineered vectors allow for cell sorting based on reprogramming factor expression. We show that these vectors can assist in tracking episomal expression in individual cells and can select the reprogramming factor dosage. Together, these modified vectors are a useful tool for understanding the reprogramming process and improving induced pluripotent stem cell isolation efficiency.

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

In situ reprogramming to transdifferentiate fibroblasts into cardiomyocytes using adenoviral vectors: Implications for clinical myocardial regeneration.

PubMed

Mathison, Megumi; Singh, Vivek P; Chiuchiolo, Maria J; Sanagasetti, Deepthi; Mao, Yun; Patel, Vivekkumar B; Yang, Jianchang; Kaminsky, Stephen M; Crystal, Ronald G; Rosengart, Todd K

2017-02-01

The reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells improves ventricular function in myocardial infarction models. Only integrating persistent expression vectors have thus far been used to induce reprogramming, potentially limiting its clinical applicability. We therefore tested the reprogramming potential of nonintegrating, acute expression adenoviral (Ad) vectors. Ad or lentivirus vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) were validated in vitro. Sprague-Dawley rats then underwent coronary ligation and Ad-mediated administration of vascular endothelial growth factor to generate infarct prevascularization. Three weeks later, animals received Ad or lentivirus encoding G, M, or T (AdGMT or LentiGMT) or an equivalent dose of a null vector (n = 11, 10, and 10, respectively). Outcomes were analyzed by echocardiography, magnetic resonance imaging, and histology. Ad and lentivirus vectors provided equivalent G, M, and T expression in vitro. AdGMT and LentiGMT both likewise induced expression of the cardiomyocyte marker cardiac troponin T in approximately 6% of cardiac fibroblasts versus <1% cardiac troponin T expression in AdNull (adenoviral vector that does not encode a transgene)-treated cells. Infarcted myocardium that had been treated with AdGMT likewise demonstrated greater density of cells expressing the cardiomyocyte marker beta myosin heavy chain 7 compared with AdNull-treated animals. Echocardiography demonstrated that AdGMT and LentiGMT both increased ejection fraction compared with AdNull (AdGMT: 21% ± 3%, LentiGMT: 14% ± 5%, AdNull: -0.4% ± 2%; P < .05). Ad vectors are at least as effective as lentiviral vectors in inducing cardiac fibroblast transdifferentiation into induced cardiomyocyte-like cells and improving cardiac function in postinfarct rat hearts. Short-term expression Ad vectors may represent an important means to induce cardiac cellular reprogramming in humans. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

FRET sensor-based quantification of intracellular trehalose in mammalian cells.

PubMed

Kikuta, Shingo; Hou, Bi-Huei; Sato, Ryoichi; Frommer, Wolf B; Kikawada, Takahiro

2016-01-01

Trehalose acts as a stress protectant and an autophagy inducer in mammalian cells. The molecular mechanisms of action remain obscure because intracellular trehalose at micromolar level is difficult to quantitate. Here, we show a novel trehalose monitoring technology based on FRET. FLIP-suc90μ∆1Venus sensor expressed in mammalian cells enables to quickly and non-destructively detect an infinitesimal amount of intracellular trehalose.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Overcoming the Refractory Expression of Secreted Recombinant Proteins in Mammalian Cells through Modification of the Signal Peptide and Adjacent Amino Acids.

PubMed

Güler-Gane, Gülin; Kidd, Sara; Sridharan, Sudharsan; Vaughan, Tristan J; Wilkinson, Trevor C I; Tigue, Natalie J

2016-01-01

The expression and subsequent purification of mammalian recombinant proteins is of critical importance to many areas of biological science. To maintain the appropriate tertiary structure and post-translational modifications of such proteins, transient mammalian expression systems are often adopted. The successful utilisation of these systems is, however, not always forthcoming and some recombinant proteins prove refractory to expression in mammalian hosts. In this study we focussed on the role of different N-terminal signal peptides and residues immediately downstream, in influencing the level of secreted recombinant protein obtained from suspension HEK293 cells. Using secreted alkaline phosphatase (SEAP) as a model protein, we identified that the +1/+2 downstream residues flanking a heterologous signal peptide significantly affect secreted levels. By incorporating these findings we conducted a comparison of different signal peptide sequences and identified the most productive as secrecon, a computationally-designed sequence. Importantly, in the context of the secrecon signal peptide and SEAP, we also demonstrated a clear preference for specific amino acid residues at the +1 position (e.g. alanine), and a detrimental effect of others (cysteine, proline, tyrosine and glutamine). When proteins that naturally contain these "undesirable" residues at the +1 position were expressed with their native signal peptide, the heterologous secrecon signal peptide, or secrecon with an additional alanine at the +1 or +1 and +2 position, the level of expression differed significantly and in an unpredictable manner. For each protein, however, at least one of the panel of signal peptide/adjacent amino acid combinations enabled successful recombinant expression. In this study, we highlight the important interplay between a signal peptide and its adjacent amino acids in enabling protein expression, and we describe a strategy that could enable recombinant proteins that have so far proved refractory to expression in HEK293 cells, to be produced in sufficient quantities to answer important biological questions.

[Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

PubMed

Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

2015-07-01

To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Retrovirus-based vectors for transient and permanent cell modification.

PubMed

Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

2015-10-01

Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of nonhuman adenoviruses as vaccine vectors

PubMed Central

Bangari, Dinesh S.; Mittal, Suresh K.

2006-01-01

Human adenoviral (HAd) vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system. However, clinical use of adenoviral vectors for vaccine purposes is anticipated to be limited by vector immunity that is either preexisting or develops rapidly following the first inoculation with adenoviral vectors. Vector immunity inactivates the vector particles and rapidly removes the transduced cells, thereby limiting the duration of transgene expression. Due to strong vector immunity, subsequent use of the same vector is usually less efficient. In order to circumvent this limitation, nonhuman adenoviral vectors have been proposed as alternative vectors. In addition to eluding HAd immunity, these vectors possess most of the attractive features of HAd vectors. Several replication-competent or replication-defective nonhuman adenoviral vectors have been developed and investigated for their potential as vaccine delivery vectors. Here, we review recent advances in the design and characterization of various nonhuman adenoviral vectors, and discuss their potential applications for human and animal vaccination. PMID:16297508

Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, Edward M.; Cullen, Bryan R., E-mail: bryan.cullen@duke.edu

CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called singlemore » guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA genomes might be destroyed. In conclusion, we believe that the continued rapid evolution of CRISPR/Cas technology will soon have a major, possibly revolutionary, impact on the field of virology. - Highlights: • Bacterial CRISPR/Cas systems can edit specific DNA sequences in mammalian cells. • CRISPR/Cas systems could eliminate latent or persistent DNA viruses in vivo. • CRISPR/Cas could also be used to screen for viral co-factors or restriction factors.« less

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-09-01

Human immunodeficiency virus (HIV)-associated sensory neuropathy is a common neurological complication of HIV infection affecting up to 30% of HIV-positive individuals. However, the exact neuropathological mechanisms remain unknown, which hinders our ability to develop effective treatments for HIV-related neuropathic pain (NP). In this study, we tested the hypothesis that inhibition of proinflammatory factors with overexpression of interleukin (IL)-10 reduces HIV-related NP in a rat model. NP was induced by the application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve. The hindpaws of rats were inoculated with nonreplicating herpes simplex virus (HSV) vectors expressing anti-inflammatory cytokine IL-10 or control vector. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The mechanical threshold response was assessed over time using the area under curves. The expression of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 in both the lumbar spinal cord and the L4/5 dorsal root ganglia (DRG), was examined at 14 and 28 days after vector inoculation using Western blots. We found that in the gp120-induced NP model, IL-10 overexpression mediated by the HSV vector resulted in a significant elevation of the mechanical threshold that was apparent on day 3 after vector inoculation compared with the control vector (P < 0.001). The antiallodynic effect of the single HSV vector inoculation expressing IL-10 lasted >28 days. The area under curve in the HSV vector expressing IL-10 was increased compared with that in the control vector (P < 0.0001). HSV vectors expressing IL-10 reversed the upregulation of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 expression at 14 and/or 28 days in the DRG and/or the spinal dorsal horn. Our studies demonstrate that blocking the signaling of these proinflammatory molecules in the DRG and/or the spinal cord using the HSV vector expressing IL-10 is able to reduce HIV-related NP. These results provide new insights on the potential mechanisms of HIV-associated NP and a proof of concept for treating painful HIV sensory neuropathy with this type of gene therapy.

Elabela-Apelin Receptor Signaling Pathway is Functional in Mammalian Systems

PubMed Central

Wang, Zhi; Yu, Daozhan; Wang, Mengqiao; Wang, Qilong; Kouznetsova, Jennifer; Yang, Rongze; Qian, Kun; Wu, Wenjun; Shuldiner, Alan; Sztalryd, Carole; Zou, Minghui; Zheng, Wei; Gong, Da-Wei

2015-01-01

Elabela (ELA) or Toddler is a recently discovered hormone which is required for normal development of heart and vasculature through activation of apelin receptor (APJ), a G protein-coupled receptor (GPCR), in zebrafish. The present study explores whether the ELA-APJ signaling pathway is functional in the mammalian system. Using reverse-transcription PCR, we found that ELA is restrictedly expressed in human pluripotent stem cells and adult kidney whereas APJ is more widely expressed. We next studied ELA-APJ signaling pathway in reconstituted mammalian cell systems. Addition of ELA to HEK293 cells over-expressing GFP-AJP fusion protein resulted in rapid internalization of the fusion receptor. In Chinese hamster ovarian (CHO) cells over-expressing human APJ, ELA suppresses cAMP production with EC50 of 11.1 nM, stimulates ERK1/2 phosphorylation with EC50 of 14.3 nM and weakly induces intracellular calcium mobilization. Finally, we tested ELA biological function in human umbilical vascular endothelial cells and showed that ELA induces angiogenesis and relaxes mouse aortic blood vessel in a dose-dependent manner through a mechanism different from apelin. Collectively, we demonstrate that the ELA-AJP signaling pathways are functional in mammalian systems, indicating that ELA likely serves as a hormone regulating the circulation system in adulthood as well as in embryonic development. PMID:25639753

Antagonistic control of a dual-input mammalian gene switch by food additives.

PubMed

Xie, Mingqi; Ye, Haifeng; Hamri, Ghislaine Charpin-El; Fussenegger, Martin

2014-08-01

Synthetic biology has significantly advanced the design of mammalian trigger-inducible transgene-control devices that are able to programme complex cellular behaviour. Fruit-based benzoate derivatives licensed as food additives, such as flavours (e.g. vanillate) and preservatives (e.g. benzoate), are a particularly attractive class of trigger compounds for orthogonal mammalian transgene control devices because of their innocuousness, physiological compatibility and simple oral administration. Capitalizing on the genetic componentry of the soil bacterium Comamonas testosteroni, which has evolved to catabolize a variety of aromatic compounds, we have designed different mammalian gene expression systems that could be induced and repressed by the food additives benzoate and vanillate. When implanting designer cells engineered for gene switch-driven expression of the human placental secreted alkaline phosphatase (SEAP) into mice, blood SEAP levels of treated animals directly correlated with a benzoate-enriched drinking programme. Additionally, the benzoate-/vanillate-responsive device was compatible with other transgene control systems and could be assembled into higher-order control networks providing expression dynamics reminiscent of a lap-timing stopwatch. Designer gene switches using licensed food additives as trigger compounds to achieve antagonistic dual-input expression profiles and provide novel control topologies and regulation dynamics may advance future gene- and cell-based therapies. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors

PubMed Central

Giritch, Anatoli; Marillonnet, Sylvestre; Engler, Carola; van Eldik, Gerben; Botterman, Johan; Klimyuk, Victor; Gleba, Yuri

2006-01-01

Plant viral vectors allow expression of heterologous proteins at high yields, but so far, they have been unable to express heterooligomeric proteins efficiently. We describe here a rapid and indefinitely scalable process for high-level expression of functional full-size mAbs of the IgG class in plants. The process relies on synchronous coinfection and coreplication of two viral vectors, each expressing a separate antibody chain. The two vectors are derived from two different plant viruses that were found to be noncompeting. Unlike vectors derived from the same virus, noncompeting vectors effectively coexpress the heavy and light chains in the same cell throughout the plant body, resulting in yields of up to 0.5 g of assembled mAbs per kg of fresh-leaf biomass. This technology allows production of gram quantities of mAbs for research purposes in just several days, and the same protocol can be used on an industrial scale in situations requiring rapid response, such as pandemic or terrorism events. PMID:16973752

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

[Zoonotic diseases caused by bacteria of the genus Bartonella genus: new reservoirs ? New vectors?].

PubMed

Chomel, Bruno B; Boulouis, Henri-Jean

2005-03-01

Domestic animals and wildlife represent a large reservoir for bartonellae, at least eight species or subspecies of which have been reported to cause zoonotic infections. In addition, numerous orphan clinical syndromes are now being attributed to Bartonella henselae infection. Many mammalian species, including cats, dogs, rodents and ruminants are the main bartonellae reservoirs. Cats are the main reservoir for B. henselae. It appears that domestic dogs, at least in non tropical regions, are more likely to be accidental hosts than reservoirs, and constitute excellent sentinels for human infections. Bartonellae are vector-borne bacteria. The mode of B. henselae transmission by cat fleas is now better understood, but new potential vectors have recently been identified, including ticks and biting flies. This articles summarizes current knowledge of the etiology, new clinical features and epidemiological characteristics of these emerging zoonoses.

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

Baculovirus-vectored multistage Plasmodium vivax vaccine induces both protective and transmission-blocking immunities against transgenic rodent malaria parasites.

PubMed

Mizutani, Masanori; Iyori, Mitsuhiro; Blagborough, Andrew M; Fukumoto, Shinya; Funatsu, Tomohiro; Sinden, Robert E; Yoshida, Shigeto

2014-10-01

A multistage malaria vaccine targeting the pre-erythrocytic and sexual stages of Plasmodium could effectively protect individuals against infection from mosquito bites and provide transmission-blocking (TB) activity against the sexual stages of the parasite, respectively. This strategy could help prevent malaria infections in individuals and, on a larger scale, prevent malaria transmission in communities of endemicity. Here, we describe the development of a multistage Plasmodium vivax vaccine which simultaneously expresses P. vivax circumsporozoite protein (PvCSP) and P25 (Pvs25) protein of this species as a fusion protein, thereby acting as a pre-erythrocytic vaccine and a TB vaccine, respectively. A new-concept vaccine platform based on the baculovirus dual-expression system (BDES) was evaluated. The BDES-Pvs25-PvCSP vaccine displayed correct folding of the Pvs25-PvCSP fusion protein on the viral envelope and was highly expressed upon transduction of mammalian cells in vitro. This vaccine induced high levels of antibodies to Pvs25 and PvCSP and elicited protective (43%) and TB (82%) efficacies against transgenic P. berghei parasites expressing the corresponding P. vivax antigens in mice. Our data indicate that our BDES, which functions as both a subunit and DNA vaccine, can offer a promising multistage vaccine capable of delivering a potent antimalarial pre-erythrocytic and TB response via a single immunization regimen. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Equus caballus Major Histocompatibility Complex Class I Is an Entry Receptor for Equine Herpesvirus Type 1▿

PubMed Central

Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.

2010-01-01

In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Transmission of cutaneous leishmaniasis by sand flies is enhanced by regurgitation of fPPG.

PubMed

Rogers, Matthew E; Ilg, Thomas; Nikolaev, Andrei V; Ferguson, Michael A J; Bates, Paul A

2004-07-22

Sand flies are the exclusive vectors of the protozoan parasite Leishmania, but the mechanism of transmission by fly bite has not been determined nor incorporated into experimental models of infection. In sand flies with mature Leishmania infections the anterior midgut is blocked by a gel of parasite origin, the promastigote secretory gel. Here we analyse the inocula from Leishmania mexicana-infected Lutzomyia longipalpis sand flies. Analysis revealed the size of the infectious dose, the underlying mechanism of parasite delivery by regurgitation, and the novel contribution made to infection by filamentous proteophosphoglycan (fPPG), a component of promastigote secretory gel found to accompany the parasites during transmission. Collectively these results have important implications for understanding the relationship between the parasite and its vector, the pathology of cutaneous leishmaniasis in humans and also the development of effective vaccines and drugs. These findings emphasize that to fully understand transmission of vector-borne diseases the interaction between the parasite, its vector and the mammalian host must be considered together.

Efficient Single Tobamoviral Vector-Based Bioproduction of Broadly Neutralizing Anti-HIV-1 Monoclonal Antibody VRC01 in Nicotiana benthamiana Plants and Utility of VRC01 in Combination Microbicides

PubMed Central

Hamorsky, Krystal Teasley; Grooms-Williams, Tiffany W.; Husk, Adam S.; Bennett, Lauren J.; Palmer, Kenneth E.

2013-01-01

Broadly neutralizing monoclonal antibodies (bnMAbs) may offer powerful tools for HIV-1 preexposure prophylaxis, such as topical microbicides. However, this option is hampered due to expensive MAb biomanufacturing based on mammalian cell culture. To address this issue, we developed a new production system for bnMAb VRC01 in Nicotiana benthamiana plants using a tobamovirus replicon vector. Unlike conventional two-vector-based expression, this system was designed to overexpress full-length IgG1 from a single polypeptide by means of kex2p-like enzyme recognition sites introduced between the heavy and light chains. An enzyme-linked immunosorbent assay (ELISA) revealed that gp120-binding VRC01 IgG1 was maximally accumulated on 5 to 7 days following vector inoculation, yielding ∼150 mg of the bnMAb per kg of fresh leaf material. The plant-made VRC01 (VRC01p) was efficiently purified by protein A affinity followed by hydrophobic-interaction chromatography. ELISA, surface plasmon resonance, and an HIV-1 neutralization assay demonstrated that VRC01p has gp120-binding affinity and HIV-1-neutralization capacity virtually identical to the human-cell-produced counterpart. To advance VRC01p's use in topical microbicides, we analyzed combinations of the bnMAb with other microbicide candidates holding distinct antiviral mechanisms in an HIV-1 neutralization assay. VRC01p exhibited clear synergy with the antiviral lectin griffithsin, the CCR5 antagonist maraviroc, and the reverse transcriptase inhibitor tenofovir in multiple CCR5-tropic HIV-1 strains from clades A, B, and C. In summary, VRC01p is amenable to robust, rapid, and large-scale production and may be developed as an active component in combination microbicides with other anti-HIV agents such as antiviral lectins, CCR5 antagonists, and reverse transcriptase inhibitors. PMID:23403432

Viral vectors for gene modification of plants as chem/bio sensors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manginell, Monica; Harper, Jason C.; Arango, Dulce C.

2006-11-01

Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport.more » We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing platforms. Detection of the chem/bio agent reporter (GFP) can be detected only at a specific wavelength.« less

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

PubMed Central

Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

2012-01-01

Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

Host structural carbohydrate induces vector transmission of a bacterial plant pathogen.

PubMed

Killiny, Nabil; Almeida, Rodrigo P P

2009-12-29

Many insect-borne pathogens have complex life histories because they must colonize both hosts and vectors for successful dissemination. In addition, the transition from host to vector environments may require changes in gene expression before the pathogen's departure from the host. Xylella fastidiosa is a xylem-limited plant-pathogenic bacterium transmitted by leafhopper vectors that causes diseases in a number of economically important plants. We hypothesized that factors of host origin, such as plant structural polysaccharides, are important in regulating X. fastidiosa gene expression and mediating vector transmission of this pathogen. The addition of pectin and glucan to a simple defined medium resulted in dramatic changes in X. fastidiosa's phenotype and gene-expression profile. Cells grown in the presence of pectin became more adhesive than in other media tested. In addition, the presence of pectin and glucan in media resulted in significant changes in the expression of several genes previously identified as important for X. fastidiosa's pathogenicity in plants. Furthermore, vector transmission of X. fastidiosa was induced in the presence of both polysaccharides. Our data show that host structural polysaccharides mediate gene regulation in X. fastidiosa, which results in phenotypic changes required for vector transmission. A better understanding of how vector-borne pathogens transition from host to vector, and vice versa, may lead to previously undiscovered disease-control strategies.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

A Cell Line Producing Recombinant Nerve Growth Factor Evokes Growth Responses in Intrinsic and Grafted Central Cholinergic Neurons

NASA Astrophysics Data System (ADS)

Ernfors, Patrik; Ebendal, Ted; Olson, Lars; Mouton, Peter; Stromberg, Ingrid; Persson, Hakan

1989-06-01

The rat β nerve growth factor (NGF) gene was inserted into a mammalian expression vector and cotransfected with a plasmid conferring resistance to neomycin into mouse 3T3 fibroblasts. From this transfection a stable cell line was selected that contains several hundred copies of the rat NGF gene and produces excess levels of recombinant NGF. Such genetically modified cells were implanted into the rat brain as a probe for in vivo effects of NGF on central nervous system neurons. In a model of the cortical cholinergic deficits in Alzheimer disease, we demonstrate a marked increase in the survival of, and fiber outgrowth from, grafts of fetal basal forebrain cholinergic neurons, as well as stimulation of fiber formation by intact adult intrinsic cholinergic circuits in the cerebral cortex. Adult cholinergic interneurons in intact striatum also sprout vigorously toward implanted fibroblasts. Our results suggest that this model has implications for future treatment of neurodegenerative diseases.

All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins

PubMed Central

Hochbaum, Daniel R.; Zhao, Yongxin; Farhi, Samouil L.; Klapoetke, Nathan; Werley, Christopher A.; Kapoor, Vikrant; Zou, Peng; Kralj, Joel M.; Maclaurin, Dougal; Smedemark-Margulies, Niklas; Saulnier, Jessica L.; Boulting, Gabriella L.; Straub, Christoph; Cho, Yong Ku; Melkonian, Michael; Wong, Gane Ka-Shu; Harrison, D. Jed; Murthy, Venkatesh N.; Sabatini, Bernardo; Boyden, Edward S.; Campbell, Robert E.; Cohen, Adam E.

2014-01-01

All-optical electrophysiology—spatially resolved simultaneous optical perturbation and measurement of membrane voltage—would open new vistas in neuroscience research. We evolved two archaerhodopsin-based voltage indicators, QuasAr1 and 2, which show improved brightness and voltage sensitivity, microsecond response times, and produce no photocurrent. We engineered a novel channelrhodopsin actuator, CheRiff, which shows improved light sensitivity and kinetics, and spectral orthogonality to the QuasArs. A co-expression vector, Optopatch, enabled crosstalk-free genetically targeted all-optical electrophysiology. In cultured neurons, we combined Optopatch with patterned optical excitation to probe back-propagating action potentials in dendritic spines, synaptic transmission, sub-cellular microsecond-timescale details of action potential propagation, and simultaneous firing of many neurons in a network. Optopatch measurements revealed homeostatic tuning of intrinsic excitability in human stem cell-derived neurons. In brain slice, Optopatch induced and reported action potentials and subthreshold events, with high signal-to-noise ratios. The Optopatch platform enables high-throughput, spatially resolved electrophysiology without use of conventional electrodes. PMID:24952910

Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

PubMed

Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

2012-10-01

A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

Protein Expression in Insect and Mammalian Cells Using Baculoviruses in Wave Bioreactors.

PubMed

Kadwell, Sue H; Overton, Laurie K

2016-01-01

Many types of disposable bioreactors for protein expression in insect and mammalian cells are now available. They differ in design, capacity, and sensor options, with many selections available for either rocking platform, orbitally shaken, pneumatically mixed, or stirred-tank bioreactors lined with an integral disposable bag (Shukla and Gottschalk, Trends Biotechnol 31(3):147-154, 2013). WAVE Bioreactors™ were among the first disposable systems to be developed (Singh, Cytotechnology 30:149-158, 1999). Since their commercialization in 1999, Wave Bioreactors have become routinely used in many laboratories due to their ease of operation, limited utility requirements, and protein expression levels comparability to traditional stirred-tank bioreactors. Wave Bioreactors are designed to use a presterilized Cellbag™, which is attached to a rocking platform and inflated with filtered air provided by the bioreactor unit. The Cellbag can be filled with medium and cells and maintained at a set temperature. The rocking motion, which is adjusted through angle and rock speed settings, provides mixing of oxygen (and CO2, which is used to control pH in mammalian cell cultures) from the headspace created in the inflated Cellbag with the cell culture medium and cells. This rocking motion can be adjusted to prevent cell shear damage. Dissolved oxygen and pH can be monitored during scale-up, and samples can be easily removed to monitor other parameters. Insect and mammalian cells grow very well in Wave Bioreactors (Shukla and Gottschalk, Trends Biotechnol 31(3):147-154, 2013). Combining Wave Bioreactor cell growth capabilities with recombinant baculoviruses engineered for insect or mammalian cell expression has proven to be a powerful tool for rapid production of a wide range of proteins.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Anxiety-like behavior in transgenic mice with brain expression of neuropeptide Y.

PubMed

Inui, A; Okita, M; Nakajima, M; Momose, K; Ueno, N; Teranishi, A; Miura, M; Hirosue, Y; Sano, K; Sato, M; Watanabe, M; Sakai, T; Watanabe, T; Ishida, K; Silver, J; Baba, S; Kasuga, M

1998-01-01

Neuropeptide Y (NPY), one of the most abundant peptide transmitters in the mammalian brain, is assumed to play an important role in behavior and its disorders. To understand the long-term modulation of neuronal functions by NPY, we raised transgenic mice created with a novel central nervous system (CNS) neuron-specific expression vector of human Thy- gene fragment linked to mouse NPY cDNA. In situ hybridization analysis demonstrated transgene-derived NPY expression in neurons (e.g., in the hippocampus, cerebral cortex, and the arcuate nucleus of the hypothalamus) in the transgenic mice. The modest increase of NPY protein in the brain was demonstrated by semiquantitative immunohistochemical analysis and by radioreceptor assay (115% in transgenic mice compared to control littermates). Double-staining experiments indicated colocalization of the transgene-derived NPY message and NPY protein in the same neurons, such as in the arcuate nucleus. The transgenic mice displayed behavioral signs of anxiety and hypertrophy of adrenal zona fasciculata cells, but no change in food intake was observed. The anxiety-like behavior of transgenic mice was reversed, at least in part, by administration of corticotropin-releasing factor (CRF) antagonists, alpha-helical CRF9-41, into the third cerebral ventricle. These results suggest that NPY has a role in anxiety and behavioral responses to stress partly via the CRF neuronal system. This genetic model may provide a unique opportunity to study human anxiety and emotional disorders.

Non-invasive activation of optogenetic actuators

NASA Astrophysics Data System (ADS)

Birkner, Elisabeth; Berglund, Ken; Klein, Marguerita E.; Augustine, George J.; Hochgeschwender, Ute

2014-03-01

The manipulation of genetically targeted neurons with light (optogenetics) continues to provide unprecedented avenues into studying the function of the mammalian brain. However, potential translation into the clinical arena faces a number of significant hurdles, foremost among them the need for insertion of optical fibers into the brain to deliver light to opsins expressed on neuronal membranes. In order to overcome these hardware-related problems, we have developed an alternative strategy for delivering light to opsins which does not involve fiber implants. Rather, the light is produced by a protein, luciferase, which oxidizes intravenously applied substrate, thereby emitting bioluminescence. In proof-ofprinciple studies employing a fusion protein of a light-generating luciferase to a light-sensing opsin (luminopsin), we showed that light emitted by Gaussia luciferase is indeed able to activate channelrhodopsin, allowing modulation of neuronal activity when expressed in cultured neurons. Here we assessed applicability of the concept in vivo in mice expressing luminopsins from viral vectors and from genetically engineered transgenes. The experiments demonstrate that intravenously applied substrate reaches neurons in the brain, causing the luciferase to produce bioluminescence which can be imaged in vivo, and that activation of channelrhodopsin by bioluminescence is sufficient to affect behavior. Further developments of such technology based on combining optogenetics with bioluminescence - i.e. combining lightsensing molecules with biologically produced light through luciferases - should bring optogenetics closer to clinical applications.

Lack of Humoral Immune Response to the Tetracycline (Tet) Activator in Rats Injected Intracranially with Tet-off rAAV Vectors

PubMed Central

Han, Ye; Chang, Qin A.; Virag, Tamas; West, Neva C.; George, David; Castro, Maria G.; Bohn, Martha C.

2010-01-01

The ability to safely control transgene expression from viral vectors is a long-term goal in the gene therapy field. We have previously reported tight regulation of GFP expression in rat brain using a self-regulating tet-off rAAV vector. The immune responses against tet regulatory elements observed by other groups in nonhuman primates after intramuscular injection of tet-on encoding vectors raise concerns about the clinical value of tet-regulated vectors. However, previous studies have not examined immune responses following injection of AAV vectors into brain. Therefore, rat striatum was injected with tet-off rAAV harboring a therapeutic gene for Parkinson's disease, either hAADC or hGDNF. The expression of each gene was tightly controlled by the tet-off regulatory system. Using an ELISA developed with purified GST-tTA protein, no detectable immunogenicity against tTA was observed in sera of rats that received an intrastriatal injection of either vector. In contrast, sera from rats intradermally injected with an adenovirus containing either tTA or rtTA, as positive controls, had readily detectable antibodies. These observations suggest that tet-off rAAV vectors do not elicit an immune response when injected into rat brain and that these may offer safer vectors for Parkinson's disease than vectors with constitutive expression. PMID:20164859

Modified Newcastle Disease virus as an improved vaccine vector against Simian Immunodeficiency virus.

PubMed

Manoharan, Vinoth K; Khattar, Sunil K; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

2018-06-12

SIV infection in macaques is a relevant animal model for HIV pathogenesis and vaccine study in humans. To design a safe and effective vaccine against HIV, we evaluated the suitability of naturally-occurring avirulent Newcastle disease virus (NDV) strains and several modified versions of NDV as vectors for the expression and immunogenicity of SIV envelope protein gp160. All the NDV vectors expressed gp160 protein in infected cells. The gp160 expressed by these vectors formed oligomers and was incorporated into the NDV envelope. All the NDV vectors expressing gp160 were attenuated in chickens. Intranasal immunization of guinea pigs with modified NDV vectors such as rNDV-APMV-2CS/gp160 and rNDV-APMV-8CS/gp160 (NDV strain LaSota containing the cleavage site sequences of F protein of avian paramyxovirus (APMV) serotype 2 and 8, respectively), and rNDV-BC-F-HN/gp160 (NDV strain BC containing LaSota F cleavage site and LaSota F and HN genes) elicited improved SIV-specific humoral and mucosal immune responses compared to other NDV vectors. These modified vectors were also efficient in inducing neutralizing antibody responses to tier 1 A SIVmac251.6 and tier 1B SIVmac251/M766 strains. This study suggests that our novel modified NDV vectors are safe and immunogenic and can be used as vaccine vector to control HIV.

Gene Transfer of Glutamic Acid Decarboxylase 67 by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats.

PubMed

Kanao, Megumi; Kanda, Hirotsugu; Huang, Wan; Liu, Shue; Yi, Hyun; Candiotti, Keith A; Lubarsky, David A; Levitt, Roy C; Hao, Shuanglin

2015-06-01

Human immunodeficiency virus (HIV)-related painful sensory neuropathies primarily consist of the HIV infection-related distal sensory polyneuropathy and antiretroviral toxic neuropathies. Pharmacotherapy provides only partial relief of pain in patients with HIV/acquired immune deficiency syndrome because little is known about the exact neuropathological mechanisms for HIV-associated neuropathic pain (NP). Hypofunction of γ-aminobutyric acid (GABA) GABAergic inhibitory mechanisms has been reported after peripheral nerve injury. In this study, we tested the hypothesis that HIV gp120 combined with antiretroviral therapy reduces spinal GABAergic inhibitory tone and that restoration of GABAergic inhibitory tone will reduce HIV-related NP in a rat model. The application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve plus systemic ddC (one antiretroviral drug) induced mechanical allodynia. The hind paws of rats were inoculated with replication-defective herpes simplex virus (HSV) vectors genetically encoding gad1 gene to express glutamic acid decarboxylase 67 (GAD67), an enzyme that catalyzes the decarboxylation of glutamate to GABA. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The expression of GAD67 in both the lumbar spinal cord and the L4-5 dorsal root ganglia was examined using western blots. The expression of mitochondrial superoxide in the spinal dorsal horn was examined using MitoSox imaging. The immunoreactivity of spinal GABA, pCREB, and pC/EBPβ was tested using immunohistochemistry. In the gp120 with ddC-induced neuropathic pain model, GAD67 expression mediated by the HSV vector caused an elevation of mechanical threshold that was apparent on day 3 after vector inoculation. The antiallodynic effect of the single HSV vector inoculation expressing GAD67 lasted >28 days. The area under the time-effect curves in the HSV vector expressing GAD67 was increased compared with that in the control vectors (P = 0.0005). Intrathecal GABA-A/B agonists elevated mechanical threshold in the pain model. The HSV vectors expressing GAD67 reversed the lowered GABA immunoreactivity in the spinal dorsal horn in the neuropathic rats. HSV vectors expressing GAD67 in the neuropathic rats reversed the increased signals of mitochondrial superoxide in the spinal dorsal horn. The vectors expressing GAD67 reversed the upregulated immunoreactivity expression of pCREB and pC/EBPβ in the spinal dorsal horn in rats exhibiting NP. Based on our results, we suggest that GAD67 mediated by HSV vectors acting through the suppression of mitochondrial reactive oxygen species and transcriptional factors in the spinal cord decreases pain in the HIV-related neuropathic pain model, providing preclinical evidence for gene therapy applications in patients with HIV-related pain states.

Modification and identification of a vector for making a large phage antibody library.

PubMed

Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing

2007-11-20

The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.

In Vitro and In Vivo Gene Delivery by Recombinant Baculoviruses

PubMed Central

Tani, Hideki; Limn, Chang Kwang; Yap, Chan Choo; Onishi, Masayoshi; Nozaki, Masami; Nishimune, Yoshitake; Okahashi, Nobuo; Kitagawa, Yoshinori; Watanabe, Rie; Mochizuki, Rika; Moriishi, Kohji; Matsuura, Yoshiharu

2003-01-01

Although recombinant baculovirus vectors can be an efficient tool for gene transfer into mammalian cells in vitro, gene transduction in vivo has been hampered by the inactivation of baculoviruses by serum complement. Recombinant baculoviruses possessing excess envelope protein gp64 or other viral envelope proteins on the virion surface deliver foreign genes into a variety of mammalian cell lines more efficiently than the unmodified baculovirus. In this study, we examined the efficiency of gene transfer both in vitro and in vivo by recombinant baculoviruses possessing envelope proteins derived from either vesicular stomatitis virus (VSVG) or rabies virus. These recombinant viruses efficiently transferred reporter genes into neural cell lines, primary rat neural cells, and primary mouse osteal cells in vitro. The VSVG-modified baculovirus exhibited greater resistance to inactivation by animal sera than the unmodified baculovirus. A synthetic inhibitor of the complement activation pathway circumvented the serum inactivation of the unmodified baculovirus. Furthermore, the VSVG-modified baculovirus could transduce a reporter gene into the cerebral cortex and testis of mice by direct inoculation in vivo. These results suggest the possible use of the recombinant baculovirus vectors in combination with the administration of complement inhibitors for in vivo gene therapy. PMID:12941888

miR-544 Regulates Dairy Goat Male Germline Stem Cell Self-Renewal via Targeting PLZF.

PubMed

Song, Wencong; Mu, Hailong; Wu, Jiang; Liao, Mingzhi; Zhu, Haijing; Zheng, Liming; He, Xin; Niu, Bowen; Zhai, Yuanxin; Bai, Chunling; Lei, Anmin; Li, Guangpeng; Hua, Jinlian

2015-10-01

The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the self-renewal of mGSCs, so, evaluation of the PLZF pathway in mGSCs may provide a deeper insight into mammalian spermatogenesis. miRNA was also an important regulating factor for the self-renewal and differentiation of mGSCs; however, there is currently no data indicating that which miRNA regulate the self-renewal and differentiation of mGSCs via PLZF. Here, we predicted the prospective miRNA targeting to PLZF using the online Bioinformatics database-Targetscan, and performed an analysis of the dual-luciferase recombinant vector, psiCHCEKTM-2-PLZF-3'UTR. miR-544 mimics (miR-544m), miR-544 inhibitors (miR-544i), Control (NC, scrambled oligonucleotides transfection), pPLZF-IRES2-EGFP or PLZF siRNA were transfected into mGSCs; the cells proliferation was evaluated by BRDU incorporation assay and flow cytometry, and the mGSC marker, GFRa1, PLZF, KIT, DAZL, and VASA expression were analyzed by RT-qPCR, immunofluorescence and Western blot. The results showed that miR-544 regulates dairy goat male germline stem cell self-renewal via targeting PLZF. Our study identifies a new regulatory pathway for PLZF and expands upon the PLZF regulatory network in mGSCs. © 2015 Wiley Periodicals, Inc.

Analyses of expression and localization of two mammalian-type transglutaminases in Physarum polycephalum, an acellular slime mold.

PubMed

Wada, Fumitaka; Ogawa, Atsuko; Hanai, Yuko; Nakamura, Akio; Maki, Masatoshi; Hitomi, Kiyotaka

2004-11-01

Transglutaminase (TGase) is an enzyme that modifies proteins by crosslinking or polyamination. Physarum polycephalum, an acellular slime mold, is the evolutionally lowest organism that has a mammalian-type transglutaminase. We have cloned a cDNA for Physarum polycephalum TGase (PpTGB), homologous to a previously identified TGase (PpTGA), whose sequence is similar to that of mammalian TGases. PpTGB encodes a primary sequence identical to that of PpTGA except for 11 amino acid residues at the N-terminus. Reverse transcription-PCR and Western blotting analyses showed that both PpTGA and PpTGB are expressed in microplasmodia and macroplasmodia during their life cycle, except for in sporangia. For biochemical characterization, we carried out the ectopical expressions of PpTGA and PpTGB in Dictyostelium discoideum. Subcellular fractionation of these Dictyostelium cells showed that the expressed PpTGA, but not PpTGB, localizes to the membrane fraction. Furthermore, in Physarum, subcellular fractionation and immunostaining indicated specific localization at the plasma membrane in macroplasmodia, while the localization was entirely cytoplasmic in microplasmodia.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

Transcriptome-wide comparison of the impact of Atoh1 and miR-183 family on pluripotent stem cells and multipotent otic progenitor cells.

PubMed

Ebeid, Michael; Sripal, Prashanth; Pecka, Jason; Beisel, Kirk W; Kwan, Kelvin; Soukup, Garrett A

2017-01-01

Over 5% of the global population suffers from disabling hearing loss caused by multiple factors including aging, noise exposure, genetic predisposition, or use of ototoxic drugs. Sensorineural hearing loss is often caused by the loss of sensory hair cells (HCs) of the inner ear. A barrier to hearing restoration after HC loss is the limited ability of mammalian auditory HCs to spontaneously regenerate. Understanding the molecular mechanisms orchestrating HC development is expected to facilitate cell replacement therapies. Multiple events are known to be essential for proper HC development including the expression of Atoh1 transcription factor and the miR-183 family. We have developed a series of vectors expressing the miR-183 family and/or Atoh1 that was used to transfect two different developmental cell models: pluripotent mouse embryonic stem cells (mESCs) and immortalized multipotent otic progenitor (iMOP) cells representing an advanced developmental stage. Transcriptome profiling of transfected cells show that the impact of Atoh1 is contextually dependent with more HC-specific effects on iMOP cells. miR-183 family expression in combination with Atoh1 not only appears to fine tune gene expression in favor of HC fate, but is also required for the expression of some HC-specific genes. Overall, the work provides novel insight into the combined role of Atoh1 and the miR-183 family during HC development that may ultimately inform strategies to promote HC regeneration or maintenance.

Expression in mammalian cells of the Escherichia coli O6 alkylguanine-DNA-alkyltransferase gene ogt reduces the toxicity of alkylnitrosoureas.

PubMed Central

Harris, L. C.; Margison, G. P.

1993-01-01

V79 Chinese hamster cells expressing either the O6-alkylguanine-DNA-alkyltransferase (ATase) encoded by the E. coli ogt gene or a truncated version of the E. coli ada gene have been exposed to various alkylnitrosoureas to investigate the contribution of ATase repairable lesions to the toxicity of these compounds. Both ATases are able to repair O6-alkylguanine (O6-AlkG) and O4-alkylthymine (O4-AlkT) but the ogt ATase is more efficient in the repair of O4-methylthymine (O4-MeT) and higher alkyl derivatives of O6-AlkG than is the ada ATase. Expression of the ogt ATase provided greater protection against the toxic effects of the alkylating agents then the ada ATase particularly with N-ethyl-N-nitrosourea (ENU) and N-butyl-N-nitrosourea (BNU) to which the ada ATase expressing cells were as sensitive as parent vector transfected cells. Although ogt was expressed at slightly higher levels than the truncated ada in the transfected cells, this could not account for the differential protection observed. For-N-methyl-N-nitrosourea (MNU) the increased protection in ogt-transfected cells is consistent with O4-MeT acting as a toxic lesion. For the longer chain alkylating agents and chloroethylating agents, the protection afforded by the ogt protein may be a consequence of the more efficient repair of O6-AlkG, O4-AlkT or both of these lesions in comparison with the ada-encoded ATase. Images Figure 2 Figure 3 PMID:8512805

Adeno-Associated Viral Vector Serotype DJ-Mediated Overexpression of N171-82Q-Mutant Huntingtin in the Striatum of Juvenile Mice Is a New Model for Huntington's Disease.

PubMed

Jang, Minhee; Lee, Seung Eun; Cho, Ik-Hyun

2018-01-01

Huntington's disease (HD) is an autosomal-dominant inherited neurodegenerative disorder characterized by motor, psychiatric and cognitive symptoms. HD is caused by an expansion of CAG repeats in the huntingtin ( HTT ) gene in various areas of the brain including striatum. There are few suitable animal models to study the pathogenesis of HD and validate therapeutic strategies. Recombinant adeno-associated viral (AAV) vectors successfully transfer foreign genes to the brain of adult mammalians. In this article, we report a novel mouse model of HD generated by bilateral intrastriatal injection of AAV vector serotype DJ (AAV-DJ) containing N171-82Q mutant HTT (82Q) and N171-18Q wild type HTT (18Q; sham). The AAV-DJ-82Q model displayed motor dysfunctions in pole and rotarod tests beginning 4 weeks after viral infection in juvenile mice (8 weeks after birth). They showed behaviors reflecting neurodegeneration. They also showed increased apoptosis, robust glial activation and upregulated representative inflammatory cytokines (tumor necrosis factor-alpha (TNF-α) and interleukin (IL)-6), mediators (cyclooxygenase-2 and inducible nitric oxide synthase) and signaling pathways (nuclear factor kappa B and signal transducer and activator of transcription 3 (STAT3)) in the striatum at 10 weeks after viral infection (14 weeks after birth) via successful transfection of mutant HTT into neurons, microglia, and astrocytes in the striatum. However, little evidence of any of these events was found in mice infected with the AAV-DJ-18Q expressing construct. Intrastriatal injection of AAV-DJ-82Q might be useful as a novel in vivo model to investigate the biology of truncated N-terminal fragment (N171) in the striatum and to explore the efficacy of therapeutic strategies for HD.

Applications of lentiviral vectors in molecular imaging.

PubMed

Chatterjee, Sushmita; De, Abhijit

2014-06-01

Molecular imaging provides the ability of simultaneous visual and quantitative estimation of long term gene expression directly from living organisms. To reveal the kinetics of gene expression by imaging method, often sustained expression of the transgene is required. Lentiviral vectors have been extensively used over last fifteen years for delivery of a transgene in a wide variety of cell types. Lentiviral vectors have the well known advantages such as sustained transgene delivery through stable integration into the host genome, the capability of infecting non-dividing and dividing cells, broad tissue tropism, a reasonably large carrying capacity for delivering therapeutic and reporter gene combinations. Additionally, they do not express viral proteins during transduction, have a potentially safe integration site profile, and a relatively easy system for vector manipulation and infective viral particle production. As a result, lentiviral vector mediated therapeutic and imaging reporter gene delivery to various target organs holds promise for the future treatment. In this review, we have conducted a brief survey of important lentiviral vector developments in diverse biomedical fields including reproductive biology.

mTOR Complexes Repress Hypertrophic Agonist-Stimulated Expression of Connective Tissue Growth Factor in Adult Cardiac Muscle Cells.

PubMed

Sundararaj, Kamala; Pleasant, Dorea L; Moschella, Phillip C; Panneerselvam, Kavin; Balasubramanian, Sundaravadivel; Kuppuswamy, Dhandapani

2016-02-01

Connective tissue growth factor (CTGF) is a fibrogenic cytokine that promotes fibrosis in various organs. In the heart, both cardiomyocytes (CM) and cardiac fibroblasts have been reported as a source of CTGF expression, aiding cardiac fibrosis. Although the mammalian target of rapamycin (mTOR) forms 2 distinct complexes, mTORC1 and mTORC2, and plays a central role in integrating biochemical signals for protein synthesis and cellular homeostasis, we explored its role in CTGF expression in adult feline CM. CM were stimulated with 10 μM phenylephrine (PE), 200 nM angiotensin (Ang), or 100 nM insulin for 24 hours. PE and Ang, but not insulin, caused an increase in CTGF mRNA expression with the highest expression observed with PE. Inhibition of mTOR with torin1 but not rapamycin significantly enhanced PE-stimulated CTGF expression. Furthermore, silencing of raptor and rictor using shRNA adenoviral vectors to suppress mTORC1 and mTORC2, respectively, or blocking phosphatidylinositol 3-kinase (PI3K) signaling with LY294002 (LY) or Akt signaling by dominant-negative Akt expression caused a substantial increase in PE-stimulated CTGF expression as measured by both mRNA and secreted protein levels. However, studies with dominant-negative delta isoform of protein kinase C demonstrate that delta isoform of protein kinase C is required for both agonist-induced CTGF expression and mTORC2/Akt-mediated CTGF suppression. Finally, PE-stimulated CTGF expression was accompanied with a corresponding increase in Smad3 phosphorylation and pretreatment of cells with SIS3, a Smad3 specific inhibitor, partially blocked the PE-stimulated CTGF expression. Therefore, a PI3K/mTOR/Akt axis plays a suppressive role on agonist-stimulated CTGF expression where the loss of this mechanism could be a contributing factor for the onset of cardiac fibrosis in the hypertrophying myocardium.

An interaction study in mammalian cells demonstrates weak binding of HSPB2 to BAG3, which is regulated by HSPB3 and abrogated by HSPB8.

PubMed

Morelli, Federica F; Mediani, Laura; Heldens, Lonneke; Bertacchini, Jessika; Bigi, Ilaria; Carrà, Arianna Dorotea; Vinet, Jonathan; Carra, Serena

2017-07-01

The ten mammalian small heat shock proteins (sHSPs/HSPBs) show a different expression profile, although the majority of them are abundant in skeletal and cardiac muscles. HSPBs form hetero-oligomers and homo-oligomers by interacting together and complexes containing, e.g., HSPB2/HSPB3 or HSPB1/HSPB5 have been documented in mammalian cells and muscles. Moreover, HSPB8 associates with the Hsc70/Hsp70 co-chaperone BAG3, in mammalian, skeletal, and cardiac muscle cells. Interaction of HSPB8 with BAG3 regulates its stability and function. Weak association of HSPB5 and HSPB6 with BAG3 has been also reported upon overexpression in cells, supporting the idea that BAG3 might indirectly modulate the function of several HSPBs. However, it is yet unknown whether other HSPBs highly expressed in muscles such as HSPB2 and HSPB3 also bind to BAG3. Here, we report that in mammalian cells, upon overexpression, HSPB2 binds to BAG3 with an affinity weaker than HSPB8. HSPB2 competes with HSPB8 for binding to BAG3. In contrast, HSPB3 negatively regulates HSPB2 association with BAG3. In human myoblasts that express HSPB2, HSPB3, HSPB8, and BAG3, the latter interacts selectively with HSPB8. Combining these data, it supports the interpretation that HSPB8-BAG3 is the preferred interaction.

Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

PubMed Central

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

2015-01-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

Reflections on the early development of poxvirus vectors.

PubMed

Moss, Bernard

2013-09-06

Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

2006-10-06

We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

PubMed

Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

2016-08-01

Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

[Expression and identification of eukaryotic expression vectors of Brucella melitensis lipoprotein OMP19].

PubMed

He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao

2016-04-01

To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Adenovirus vector expressing keratinocyte growth factor using CAG promoter impairs pulmonary function of mice with elastase-induced emphysema.

PubMed

Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu

2017-07-01

Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Mammalian cell display technology coupling with AID induced SHM in vitro: an ideal approach to the production of therapeutic antibodies.

PubMed

Qin, Chang-Fei; Li, Guan-Cheng

2014-12-01

Traditional antibody production technology within non-mammalian cell expression systems has shown many unsatisfactory properties for the development of therapeutic antibodies. Nevertheless, mammalian cell display technology reaps the benefits of producing full-length all human antibodies. Together with the developed cytidine deaminase induced in vitro somatic hypermutation technology, mammalian cell display technology provides the opportunity to produce high affinity antibodies that might be ideal for therapeutic application. This review was concentrated on the development of the mammalian cell display technology as well as the activation-induced cytidine deaminase induced in vitro somatic hypermutation technology and their applications for the production of therapeutic antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

Anti-inflammatory Effects of Cardamonin in Ovarian Cancer Cells Are Mediated via mTOR Suppression.

PubMed

Chen, Huajiao; Shi, Daohua; Niu, Peiguang; Zhu, Yanting; Zhou, Jintuo

2018-05-17

Cardamonin exhibits a variety of pharmacological activities including anti-inflammatory and antitumor, which are correlated with the inhibition of nuclear factor-kappaB and the mammalian target of rapamycin, respectively. However, whether the anti-inflammatory effects of cardamonin are mediated by the mammalian target of rapamycin remains unknown. In this study, ovarian cancer SKOV3 cells were cultured with lipopolysaccharide to induce inflammation, and the inhibitory effects and underlying molecular mechanisms of cardamonin were investigated using specific inhibitors of the mammalian target of rapamycin and the nuclear factor-kappaB pathway (rapamycin and pyrrolidine dithiocarbamate, respectively). Our results indicated that cardamonin inhibited the viability of normal and lipopolysaccharide-pretreated SKOV3 cells in a concentration-dependent manner. In accordance with rapamycin, the activation of the mammalian target of rapamycin and its downstream target, ribosomal protein S6 kinase 1, was inhibited by cardamonin, while pyrrolidine dithiocarbamate substantially blocked nuclear factor-kappaB activation and mildly inhibited the phosphorylation of the mammalian target of rapamycin and ribosomal protein S6 kinase 1. Pretreated with pyrrolidine dithiocarbamate, the effect of cardamonin on the mammalian target of rapamycin signalling was not affected, but the expression of inflammatory factors was further reduced. In cells pretreated with rapamycin, the inhibitory effects of cardamonin were completely suppressed with regards to the phosphorylation of the mammalian target of rapamycin, ribosomal protein S6 kinase 1, TNF- α , and interleukin-6, and nuclear factor-kappaB p65 protein expression was decreased. In conclusion, our findings indicate that the anti-inflammatory effects of cardamonin are correlated with mammalian target of rapamycin inhibition. Georg Thieme Verlag KG Stuttgart · New York.

Hypergravity signal transduction and gene expression in cultured mammalian cells

NASA Technical Reports Server (NTRS)

Kumei, Y.; Whitson, P. A.

1994-01-01

A number of studies have been conducted during space flight and with clinostats and centrifuges, suggesting that gravity effects the proliferation and differentiation of mammalian cells in vitro. However, little is known about the mechanisms by which mammalian cells respond to changes in gravitational stress. This paper summarizes studies designed to clarify the effects of hypergravity on the cultured human HeLa cells and to investigate the mechanism of hypergravity signal transduction in these cells.

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Generation of 2A-linked multicistronic cassettes by recombinant PCR.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.

Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

PubMed

Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

2007-08-01

Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

Temporal and Spatial Expression of CCN Genes in Zebrafish

PubMed Central

Fernando, Carol A; Conrad, Patricia A; Bartels, Cynthia F; Marques, Tomas; To, Michael; Balow, Stephanie A; Nakamura, Yukio; Warman, Matthew L

2010-01-01

The six mammalian CCN genes (Cyr61, CTGF, Nov, WISP1, WISP2, WISP3) encode a family of secreted, cysteine-rich, multimodular proteins having roles in cell proliferation, adhesion, migration, and differentiation during embryogenesis, wound healing, and angiogenesis. We used bioinformatics to identify 9 CCN genes in zebrafish (zCCNs), 6 of which have not been previously described. When compared with mammalian CCN family members, 3 were paralogs of Cyr61, 2 of CTGF, 2 of WISP1, 1 of WISP2, and 1 of WISP3. No paralog of Nov was found. In situ hybridization was performed to characterize the sites of expression of the zCCNs during early zebrafish development. zCCNs demonstrated both unique and overlapping patterns of expression, suggesting potential division of labor between orthologous genes and providing an alternate approach to gene function studies that will complement studies in mammalian models. Developmental Dynamics 239:1755–1767, 2010. © 2010 Wiley-Liss, Inc. PMID:20503371

Role of H1 Linker Histones in Mammalian Development and Stem Cell Differentiation

PubMed Central

Pan, Chenyi; Fan, Yuhong

2016-01-01

H1 linker histones are key chromatin architectural proteins facilitating the formation of higher order chromatin structures. The H1 family constitutes the most heterogeneous group of histone proteins, with eleven non-allelic H1 variants in mammals. H1 variants differ in their biochemical properties and exhibit significant sequence divergence from one another, yet most of them are highly conserved during evolution from mouse to human. H1 variants are differentially regulated during development and their cellular compositions undergo dramatic changes in embryogenesis, gametogenesis, tissue maturation and cellular differentiation. As a group, H1 histones are essential for mouse development and proper stem cell differentiation. Here we summarize our current knowledge on the expression and functions of H1 variants in mammalian development and stem cell differentiation. Their diversity, sequence conservation, complex expression and distinct functions suggest that H1s mediate chromatin reprogramming and contribute to the large variations and complexity of chromatin structure and gene expression in the mammalian genome. PMID:26689747

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Cloning, characterization and tissue specific expression of Amur tiger (Panthera tigris altaica) IGF-I.

PubMed

Hu, Xi-Lian; Zhu, Mu-Yuan; Zhang, Zhi-He; Hou, Rong; Shen, Fu-Jun; Li, Fu-Zhen; Zhang, An-Ju

2006-08-01

Insulin-like growth factor I (IGF-I) plays an important role in regulating gonad function, which is essential for normal reproduction in animals, especially in sexual receptivity and reproductive behavior. In this study, a cDNA encoding Amur tiger (Panthera tigris altaica) IGF-I was isolated from liver total RNA using RT-PCR. The IGF-I cDNA of Amur tiger (ATIGF-I) was highly homologous to that of other animals, 84.8% to rat, 93.7% to human and horse. Alignment analysis showed that the cysteine residues and many amino acid residues of putative mature ATIGF-I are highly conserved in mammalian species, confirming the high sequence homology observed in other species. DNA encoding the mature ATIGF-I peptide was ligated with pET-DsbA expression vector and highly expressed in Escherichia coli BL21 with IPTG induction. The recombinant proteins expressed existed mostly in the soluble protein fraction, and were purified with metal affinity resins. Western blotting confirmed that the recombinant proteins reacted with antibodies against IGF-I. The results obtained here should be useful for large-scale production of biological active ATIGF-I protein, as well as for further research on growth, development, and reproduction in the Amur tiger. Tissue specific expression of ATIGF-I mRNA in the Amur tiger was examined by reverse transcription-polymerase chain reaction (RT-PCR), The major ATIGF-I mRNA expression tissue was the liver, while medium signals were found in the uterus, ovary, and pituitary, and minor signals were detected in various tissues including the heart, spleen, pancreas, and kidney. The results indicate that IGF-I might play an important role in the reproductive system and in cub development in the Amur tiger.

Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

PubMed Central

Nakanishi, Mahito; Otsu, Makoto

2012-01-01

Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

PubMed

Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

2017-08-01

Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

NASA Astrophysics Data System (ADS)

Roizman, Bernard

1996-10-01

Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

A Novel Terminator Primer and Enhancer Reagents for Direct Expression of PCR-Amplified Genes in Mammalian Cells.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji

2015-08-01

Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.

Detectable reporter gene expression following transduction of adenovirus and adeno-associated virus serotype 2 vectors within full-thickness osteoarthritic and unaffected canine cartilage in vitro and unaffected guinea pig cartilage in vivo.

PubMed

Santangelo, Kelly S; Baker, Sarah A; Nuovo, Gerard; Dyce, Jonathan; Bartlett, Jeffrey S; Bertone, Alicia L

2010-02-01

This study quantified and compared the transduction efficiencies of adenoviral (Ad), Arg-Gly-Asp (RGD)-modified Ad, adeno-associated viral serotype 2 (AAV2), and self-complementary AAV2 (scAAV2) vectors within full-thickness osteoarthritic (OA) and unaffected canine cartilage explants in vitro. Intraarticular administration of Ad and scAAV2 vectors was performed to determine the ability of these vectors to transduce unaffected guinea pig cartilage in vivo. Following explant exposure to vector treatment or control, the onset and surface distribution of reporter gene expression was monitored daily with fluorescent microscopy. At termination, explants were divided: one half was digested for analysis using flow cytometry; the remaining portion was used for histology and immunohistochemistry (IHC). Intact articular joints were collected for real-time RT-PCR and IHC to detect reporter gene expression following injection of selected vectors. Ad vector transduced focal areas along the perimeters of explants; the remaining vectors transduced chondrocytes across 100% of the surface. Greater mean transduction efficiencies were found with both AAV2 vectors as compared to the Ad vector (p < or = 0.026). Ad and Ad-RGD vectors transduced only superficial chondrocytes of OA and unaffected cartilage. Uniform reporter gene expression from AAV2 and scAAV2 was detected in the tangential and transitional zones of OA cartilage, but not deeper zones. AAV2 and scAAV2 vectors achieved partial and full-thickness transduction of unaffected cartilage. In vivo work revealed that scAAV2 vector, but not Ad vector, transduced deeper zones of cartilage and menisci. This study demonstrates that AAV2 and scAAV2 are reliable vectors for use in cartilage in vitro and in vivo. (c) 2009 Orthopaedic Research Society.

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

Tissue Distribution of the Ehrlichia muris-Like Agent in a Tick Vector

PubMed Central

Lynn, Geoffrey E.; Oliver, Jonathan D.; Nelson, Curtis M.; Felsheim, Roderick F.; Kurtti, Timothy J.; Munderloh, Ulrike G.

2015-01-01

Human pathogens transmitted by ticks undergo complex life cycles alternating between the arthropod vector and a mammalian host. While the latter has been investigated to a greater extent, examination of the biological interactions between microbes and the ticks that carry them presents an equally important opportunity for disruption of the disease cycle. In this study, we used in situ hybridization to demonstrate infection by the Ehrlichia muris-like organism, a newly recognized human pathogen, of Ixodes scapularis ticks, a primary vector for several important human disease agents. This allowed us to assess whole sectioned ticks for the patterns of tissue invasion, and demonstrate generalized dissemination of ehrlichiae in a variety of cell types and organs within ticks infected naturally via blood feeding. Electron microscopy was used to confirm these results. Here we describe a strong ehrlichial affinity for epithelial cells, neuronal cells of the synganglion, salivary glands, and male accessory glands. PMID:25781930

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

Viral Vectors for in Vivo Gene Transfer

NASA Astrophysics Data System (ADS)

Thévenot, E.; Dufour, N.; Déglon, N.

The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ.

PubMed

Aida, Tomomi; Nakade, Shota; Sakuma, Tetsushi; Izu, Yayoi; Oishi, Ayu; Mochida, Keiji; Ishikubo, Harumi; Usami, Takako; Aizawa, Hidenori; Yamamoto, Takashi; Tanaka, Kohichi

2016-11-28

Although CRISPR/Cas enables one-step gene cassette knock-in, assembling targeting vectors containing long homology arms is a laborious process for high-throughput knock-in. We recently developed the CRISPR/Cas-based precise integration into the target chromosome (PITCh) system for a gene cassette knock-in without long homology arms mediated by microhomology-mediated end-joining. Here, we identified exonuclease 1 (Exo1) as an enhancer for PITCh in human cells. By combining the Exo1 and PITCh-directed donor vectors, we achieved convenient one-step knock-in of gene cassettes and floxed allele both in human cells and mouse zygotes. Our results provide a technical platform for high-throughput knock-in.

The bovine lactation genome: Insights into the evolution of mammalian milk

USDA-ARS?s Scientific Manuscript database

The newly assembled Bos Taurus genome sequence enables the linkage of bovine milk and lactation data with other mammalian genomes. Using publicly available milk proteome data and mammary expressed sequence tags, 197 milk protein genes and over 6,000 mammary genes were identified in the bovine genome...

MERP1: a mammalian ependymin-related protein gene differentially expressed in hematopoietic cells.

PubMed

Gregorio-King, Claudia C; McLeod, Janet L; Collier, Fiona McL; Collier, Gregory R; Bolton, Karyn A; Van Der Meer, Gavin J; Apostolopoulos, Jim; Kirkland, Mark A

2002-03-20

We have utilized differential display polymerase chain reaction to investigate the gene expression of hematopoietic progenitor cells from adult bone marrow and umbilical cord blood. A differentially expressed gene was identified in CD34+ hematopoietic progenitor cells, with low expression in CD34- cells. We have obtained the full coding sequence of this gene which we designated human mammalian ependymin-related protein 1 (MERP1). Expression of MERP1 was found in a variety of normal human tissues, and is 4- and 10-fold higher in adult bone marrow and umbilical cord blood CD34+ cells, respectively, compared to CD34- cells. Additionally, MERP1 expression in a hematopoietic stem cell enriched population was down-regulated with proliferation and differentiation. Conceptual translation of the MERP1 open reading frame reveals significant homology to two families of glycoprotein calcium-dependant cell adhesion molecules: ependymins and protocadherins.

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

PubMed Central

Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

2015-01-01

Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

PubMed

Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

2015-01-01

Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Interaction theory of mammalian mitochondria.

PubMed

Nakada, K; Inoue, K; Hayashi, J

2001-11-09

We generated mice with deletion mutant mtDNA by its introduction from somatic cells into mouse zygotes. Expressions of disease phenotypes are limited to tissues expressing mitochondrial dysfunction. Considering that all these mice share the same nuclear background, these observations suggest that accumulation of the mutant mtDNA and resultant expressions of mitochondrial dysfunction are responsible for expression of disease phenotypes. On the other hand, mitochondrial dysfunction and expression of clinical abnormalities were not observed until the mutant mtDNA accumulated predominantly. This protection is due to the presence of extensive and continuous interaction between exogenous mitochondria from cybrids and recipient mitochondria from embryos. Thus, we would like to propose a new hypothesis on mitochondrial biogenesis, interaction theory of mitochondria: mammalian mitochondria exchange genetic contents, and thus lost the individuality and function as a single dynamic cellular unit. Copyright 2001 Academic Press.

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

Baculovirus IE2 Stimulates the Expression of Heat Shock Proteins in Insect and Mammalian Cells to Facilitate Its Proper Functioning.

PubMed

Tung, Hsuan; Wei, Sung-Chan; Lo, Huei-Ru; Chao, Yu-Chan

2016-01-01

Baculoviruses have gained popularity as pest control agents and for protein production in insect systems. These viruses are also becoming popular for gene expression, tissue engineering and gene therapy in mammalian systems. Baculovirus infection triggers a heat shock response, and this response is crucial for its successful infection of host insect cells. However, the viral protein(s) or factor(s) that trigger this response are not yet clear. Previously, we revealed that IE2-an early gene product of the baculovirus-could form unique nuclear bodies for the strong trans-activation of various promoters in mammalian cells. Here, we purified IE2 nuclear bodies from Vero E6 cells and investigated the associated proteins by using mass spectrometry. Heat shock proteins (HSPs) were found to be one of the major IE2-associated proteins. Our experiments show that HSPs are greatly induced by IE2 and are crucial for the trans-activation function of IE2. Interestingly, blocking both heat shock protein expression and the proteasome pathway preserved the IE2 protein and its nuclear body structure, and revived its function. These observations reveal that HSPs do not function directly to assist the formation of the nuclear body structure, but may rather protect IE2 from proteasome degradation. Aside from functional studies in mammalian cells, we also show that HSPs were stimulated and required to determine IE2 protein levels, in insect cells infected with baculovirus. Upon inhibiting the expression of heat shock proteins, baculovirus IE2 was substantially suppressed, resulting in a significantly suppressed viral titer. Thus, we demonstrate a unique feature in that IE2 can function in both insect and non-host mammalian cells to stimulate HSPs, which may be associated with IE2 stabilization and lead to the protection of the its strong gene activation function in mammalian cells. On the other hand, during viral infection in insect cells, IE2 could also strongly stimulate HSPs and ultimately affect viral replication.

Gene transfer to the cerebellum.

PubMed

Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

2010-12-01

There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

Design and construction of 2A peptide-linked multicistronic vectors.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. This article describes the design and construction of 2A peptide-linked multicistronic vectors, which can be used to express multiple proteins from a single open reading frame (ORF). The small 2A peptide sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector.

Construction of two Lactococcus lactis expression vectors combining the Gateway and the NIsin Controlled Expression systems.

PubMed

Douillard, François P; Mahony, Jennifer; Campanacci, Valérie; Cambillau, Christian; van Sinderen, Douwe

2011-09-01

Over the last 10 years, the NIsin Controlled Expression (NICE) system has been extensively used in the food-grade bacterium Lactococcus lactis subsp. cremoris to produce homologous and heterologous proteins for academic and biotechnological purposes. Although various L. lactis molecular tools have been developed, no expression vectors harboring the popular Gateway recombination system are currently available for this widely used cloning host. In this study, we constructed two expression vectors that combine the NICE and the Gateway recombination systems and we tested their applicability by recombining and over-expressing genes encoding structural proteins of lactococcal phages Tuc2009 and TP901-1. Over-expressed phage proteins were analyzed by immunoblotting and purified by His-tag affinity chromatography with protein productions yielding 2.8-3.7 mg/l of culture. This therefore is the first description of L. lactis NICE expression vectors which integrate the Gateway cloning technology and which are suitable for the production of sufficient amounts of proteins to facilitate subsequent structural and functional analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

Biologically active recombinant human erythropoietin expressed in hairy root cultures and regenerated plantlets of Nicotiana tabacum L.

PubMed Central

Schäfer, Holger; Ramamoorthy, Siva; Wink, Michael

2017-01-01

Hairy root culture is a potential alternative to conventional mammalian cell culture to produce recombinant proteins due to its ease in protein recovery, low costs and absence of potentially human pathogenic contaminants. The current study focussed to develop a new platform of a hairy root culture system from Nicotiana tabacum for the production of recombinant human EPO (rhEPO), which is regularly produced in mammalian cells. The human EPO construct was amplified with C-terminal hexahistidine tag from a cDNA of Caco-2 cells. Two versions of rhEPO clones, with or without the N-terminal calreticulin (cal) fusion sequence, were produced by cloning the amplified construct into gateway binary vector pK7WG2D. Following Agrobacterium rhizogenes mediated transformation of tobacco explants; integration and expression of constructs in hairy roots were confirmed by several tests at DNA, RNA and protein levels. The amount of intracellular rhEPO from hairy root cultures with cal signal peptide was measured up to 66.75 ng g-1 of total soluble protein. The presence of the ER signal peptide (cal) was essential for the secretion of rhEPO into the spent medium; no protein was detected from hairy root cultures without ER signal peptide. The addition of polyvinylpyrrolidone enhanced the stabilization of secreted rhEPO leading to a 5.6 fold increase to a maximum concentration of 185.48 pg rhEPOHR g-1 FW hairy root cultures. The rhizo-secreted rhEPO was separated by HPLC and its biological activity was confirmed by testing distinct parameters for proliferation and survival in retinal pigment epithelial cells (ARPE). In addition, the rhEPO was detected to an amount 14.8 ng g-1 of total soluble leaf protein in transgenic T0 generation plantlets regenerated from hairy root cultures with cal signal peptide. PMID:28800637

Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin.

PubMed

Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

2009-06-30

Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida-mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies.

Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin

PubMed Central

Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

2009-01-01

Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida–mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies. PMID:19549857

Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

PubMed

Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

2015-06-30

Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Immunogenicity of Newcastle disease virus vectors expressing Norwalk virus capsid protein in the presence or absence of VP2 protein.

PubMed

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y; Samal, Siba K

2015-10-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirus-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

Follistatin-mediated skeletal muscle hypertrophy is regulated by Smad3 and mTOR independently of myostatin

PubMed Central

Winbanks, Catherine E.; Weeks, Kate L.; Thomson, Rachel E.; Sepulveda, Patricio V.; Beyer, Claudia; Qian, Hongwei; Chen, Justin L.; Allen, James M.; Lancaster, Graeme I.; Febbraio, Mark A.; Harrison, Craig A.; McMullen, Julie R.; Chamberlain, Jeffrey S.

2012-01-01

Follistatin is essential for skeletal muscle development and growth, but the intracellular signaling networks that regulate follistatin-mediated effects are not well defined. We show here that the administration of an adeno-associated viral vector expressing follistatin-288aa (rAAV6:Fst-288) markedly increased muscle mass and force-producing capacity concomitant with increased protein synthesis and mammalian target of rapamycin (mTOR) activation. These effects were attenuated by inhibition of mTOR or deletion of S6K1/2. Furthermore, we identify Smad3 as the critical intracellular link that mediates the effects of follistatin on mTOR signaling. Expression of constitutively active Smad3 not only markedly prevented skeletal muscle growth induced by follistatin but also potently suppressed follistatin-induced Akt/mTOR/S6K signaling. Importantly, the regulation of Smad3- and mTOR-dependent events by follistatin occurred independently of overexpression or knockout of myostatin, a key repressor of muscle development that can regulate Smad3 and mTOR signaling and that is itself inhibited by follistatin. These findings identify a critical role of Smad3/Akt/mTOR/S6K/S6RP signaling in follistatin-mediated muscle growth that operates independently of myostatin-driven mechanisms. PMID:22711699

Response to Blood Meal in the Fat Body of Anopheles stephensi Using Quantitative Proteomics: Toward New Vector Control Strategies Against Malaria.

PubMed

Kumar, Manish; Mohanty, Ajeet Kumar; Sreenivasamurthy, Sreelakshmi K; Dey, Gourav; Advani, Jayshree; Pinto, Sneha M; Kumar, Ashwani; Prasad, Thottethodi Subrahmanya Keshava

2017-09-01

Malaria remains a grand challenge for disruptive innovation in global health therapeutics and diagnostics. Anopheles stephensi is one of the major vectors of malaria in Asia. Vector and transmission control are key focus areas in the fight against malaria, a field of postgenomics research where proteomics can play a substantive role. Moreover, to identify novel strategies to control the vector population, it is necessary to understand the vector life processes at a global and molecular scale. In this context, fat body is a vital organ required for vitellogenesis, vector immunity, vector physiology, and vector-parasite interaction. Given its central role in energy metabolism, vitellogenesis, and immune function, the proteome profile of the fat body and the impact of blood meal (BM) ingestion on the protein abundances of this vital organ have not been investigated so far. Therefore, using a proteomics approach, we identified the proteins expressed in the fat body of An. stephensi and their differential expression in response to BM ingestion. In all, we identified 3,218 proteins in the fat body using high-resolution mass spectrometry, of which 483 were found to be differentially expressed in response to the BM ingestion. Bioinformatics analysis of these proteins underscored their role in amino acid metabolism, vitellogenesis, lipid transport, signal peptide processing, mosquito immunity, and oxidation-reduction processes. Interestingly, we identified five novel genes, which were found to be differentially expressed upon BM ingestion. Proteins that exhibited altered expression in the present study are potential targets for vector control strategies and development of transmission blocking vaccines in the fight against malaria.

An efficient Foxtail mosaic virus vector system with reduced environmental risk

PubMed Central

2010-01-01

Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

PubMed

Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

2000-02-01

Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

Cell stress and translational inhibitors transiently increase the abundance of mammalian SINE transcripts.

PubMed Central

Liu, W M; Chu, W M; Choudary, P V; Schmid, C W

1995-01-01

The abundance of Alu RNA is transiently increased by heat shock in human cell lines. This effect is specific to Alu repeats among Pol III transcribed genes, since the abundance of 7SL, 7SK, 5S and U6 RNAs is essentially unaffected by heat shock. The rapid induction of Alu expression precedes the heat shock induction of mRNAs for the ubiquitin and HSP 70 heat shock genes. Heat shock mimetics also transiently induce Alu expression indicating that increased Alu expression is a general cell-stress response. Cycloheximide treatment rapidly and transiently increases the abundance of Alu RNA. Again, compared with other genes transcribed by Pol III, this increase is specific to Alu. However, as distinguished from the cell stress response, cycloheximide does not induce expression of HSP 70 and ubiquitin mRNAs. Puromycin also increases Alu expression, suggesting that this response is generally caused by translational inhibition. The response of mammalian SINEs to cell stress and translational inhibition is not limited to SINEs which are Alu homologues. Heat shock and cycloheximide each transiently induce Pol III directed expression of B1 and B2 RNAs in mouse cells and C-element RNA in rabbit cells. Together, these three species exemplify the known SINE composition of placental mammals, suggesting that mammalian SINEs are similarly regulated and may serve a common function. Images PMID:7784180

Novel hypophysiotropic AgRP2 neurons and pineal cells revealed by BAC transgenesis in zebrafish.

PubMed

Shainer, Inbal; Buchshtab, Adi; Hawkins, Thomas A; Wilson, Stephen W; Cone, Roger D; Gothilf, Yoav

2017-03-20

The neuropeptide agouti-related protein (AgRP) is expressed in the arcuate nucleus of the mammalian hypothalamus and plays a key role in regulating food consumption and energy homeostasis. Fish express two agrp genes in the brain: agrp1, considered functionally homologous with the mammalian AgRP, and agrp2. The role of agrp2 and its relationship to agrp1 are not fully understood. Utilizing BAC transgenesis, we generated transgenic zebrafish in which agrp1- and agrp2-expressing cells can be visualized and manipulated. By characterizing these transgenic lines, we showed that agrp1-expressing neurons are located in the ventral periventricular hypothalamus (the equivalent of the mammalian arcuate nucleus), projecting throughout the hypothalamus and towards the preoptic area. The agrp2 gene was expressed in the pineal gland in a previously uncharacterized subgroup of cells. Additionally, agrp2 was expressed in a small group of neurons in the preoptic area that project directly towards the pituitary and form an interface with the pituitary vasculature, suggesting that preoptic AgRP2 neurons are hypophysiotropic. We showed that direct synaptic connection can exist between AgRP1 and AgRP2 neurons in the hypothalamus, suggesting communication and coordination between AgRP1 and AgRP2 neurons and, therefore, probably also between the processes they regulate.

Chitinase mRNA Levels Determined by QPCR in Crab-Eating Monkey (Macaca fascicularis) Tissues: Species-Specific Expression of Acidic Mammalian Chitinase and Chitotriosidase.

PubMed

Uehara, Maiko; Tabata, Eri; Ishii, Kazuhiro; Sawa, Akira; Ohno, Misa; Sakaguchi, Masayoshi; Matoska, Vaclav; Bauer, Peter O; Oyama, Fumitaka

2018-05-09

Mice and humans express two active chitinases: acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Both chitinases are thought to play important roles in specific pathophysiological conditions. The crab-eating monkey ( Macaca fascicularis ) is one of the most frequently used nonhuman primate models in basic and applied biomedical research. Here, we performed gene expression analysis of two chitinases in normal crab-eating monkey tissues by way of quantitative real-time polymerase chain reaction (qPCR) using a single standard DNA molecule. Levels of AMCase and CHIT1 messenger RNAs (mRNAs) were highest in the stomach and the lung, respectively, when compared to other tissues. Comparative gene expression analysis of mouse, monkey, and human using monkey⁻mouse⁻human hybrid standard DNA showed that the AMCase mRNA levels were exceptionally high in mouse and monkey stomachs while very low in the human stomach. As for the CHIT1 mRNA, we detected higher levels in the monkey lung when compared with those of mouse and human. The differences of mRNA expression between the species in the stomach tissues were basically reflecting the levels of the chitinolytic activities. These results indicate that gene expression of AMCase and CHIT1 differs between mammalian species and requiring special attention in handling data in chitinase-related studies in particular organisms.

[Development of a mouse cell line containing stably integrated copies of pMCLacI/Neo plasmid: a model for studying mutations in vitro].

PubMed

Lu, Y; Li, H; Fu, J

2000-04-01

To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.