Mapping photothermally induced gene expression in living cells and tissues by nanorod-locked nucleic acid complexes.

PubMed

Riahi, Reza; Wang, Shue; Long, Min; Li, Na; Chiou, Pei-Yu; Zhang, Donna D; Wong, Pak Kin

2014-04-22

The photothermal effect of plasmonic nanostructures has numerous applications, such as cancer therapy, photonic gene circuit, large cargo delivery, and nanostructure-enhanced laser tweezers. The photothermal operation can also induce unwanted physical and biochemical effects, which potentially alter the cell behaviors. However, there is a lack of techniques for characterizing the dynamic cell responses near the site of photothermal operation with high spatiotemporal resolution. In this work, we show that the incorporation of locked nucleic acid probes with gold nanorods allows photothermal manipulation and real-time monitoring of gene expression near the area of irradiation in living cells and animal tissues. The multimodal gold nanorod serves as an endocytic delivery reagent to transport the probes into the cells, a fluorescence quencher and a binding competitor to detect intracellular mRNA, and a plasmonic photothermal transducer to induce cell ablation. We demonstrate the ability of the gold nanorod-locked nucleic acid complex for detecting the spatiotemporal gene expression in viable cells and tissues and inducing photothermal ablation of single cells. Using the gold nanorod-locked nucleic acid complex, we systematically characterize the dynamic cellular heat shock responses near the site of photothermal operation. The gold nanorod-locked nucleic acid complex enables mapping of intracellular gene expressions and analyzes the photothermal effects of nanostructures toward various biomedical applications.

Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

PubMed

Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

2014-11-01

Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

A 3,000-loci transcription map of chromosome 3B unravels the structural and functional features of gene islands in hexaploid wheat.

PubMed

Rustenholz, Camille; Choulet, Frédéric; Laugier, Christel; Safár, Jan; Simková, Hana; Dolezel, Jaroslav; Magni, Federica; Scalabrin, Simone; Cattonaro, Federica; Vautrin, Sonia; Bellec, Arnaud; Bergès, Hélène; Feuillet, Catherine; Paux, Etienne

2011-12-01

To improve our understanding of the organization and regulation of the wheat (Triticum aestivum) gene space, we established a transcription map of a wheat chromosome (3B) by hybridizing a newly developed wheat expression microarray with bacterial artificial chromosome pools from a new version of the 3B physical map as well as with cDNA probes derived from 15 RNA samples. Mapping data for almost 3,000 genes showed that the gene space spans the whole chromosome 3B with a 2-fold increase of gene density toward the telomeres due to an increase in the number of genes in islands. Comparative analyses with rice (Oryza sativa) and Brachypodium distachyon revealed that these gene islands are composed mainly of genes likely originating from interchromosomal gene duplications. Gene Ontology and expression profile analyses for the 3,000 genes located along the chromosome revealed that the gene islands are enriched significantly in genes sharing the same function or expression profile, thereby suggesting that genes in islands acquired shared regulation during evolution. Only a small fraction of these clusters of cofunctional and coexpressed genes was conserved with rice and B. distachyon, indicating a recent origin. Finally, genes with the same expression profiles in remote islands (coregulation islands) were identified suggesting long-distance regulation of gene expression along the chromosomes in wheat.

Prolonged, brain-wide expression of nuclear-localized GCaMP3 for functional circuit mapping

PubMed Central

Kim, Christina K.; Miri, Andrew; Leung, Louis C.; Berndt, Andre; Mourrain, Philippe; Tank, David W.; Burdine, Rebecca D.

2014-01-01

Larval zebrafish offer the potential for large-scale optical imaging of neural activity throughout the central nervous system; however, several barriers challenge their utility. First, ~panneuronal probe expression has to date only been demonstrated at early larval stages up to 7 days post-fertilization (dpf), precluding imaging at later time points when circuits are more mature. Second, nuclear exclusion of genetically-encoded calcium indicators (GECIs) limits the resolution of functional fluorescence signals collected during imaging. Here, we report the creation of transgenic zebrafish strains exhibiting robust, nuclearly targeted expression of GCaMP3 across the brain up to at least 14 dpf utilizing a previously described optimized Gal4-UAS system. We confirmed both nuclear targeting and functionality of the modified probe in vitro and measured its kinetics in response to action potentials (APs). We then demonstrated in vivo functionality of nuclear-localized GCaMP3 in transgenic zebrafish strains by identifying eye position-sensitive fluorescence fluctuations in caudal hindbrain neurons during spontaneous eye movements. Our methodological approach will facilitate studies of larval zebrafish circuitry by both improving resolution of functional Ca2+ signals and by allowing brain-wide expression of improved GECIs, or potentially any probe, further into development. PMID:25505384

Issues in the analysis of oligonucleotide tiling microarrays for transcript mapping

NASA Technical Reports Server (NTRS)

Royce, Thomas E.; Rozowsky, Joel S.; Bertone, Paul; Samanta, Manoj; Stolc, Viktor; Weissman, Sherman; Snyder, Michael; Gerstein, Mark

2005-01-01

Traditional microarrays use probes complementary to known genes to quantitate the differential gene expression between two or more conditions. Genomic tiling microarray experiments differ in that probes that span a genomic region at regular intervals are used to detect the presence or absence of transcription. This difference means the same sets of biases and the methods for addressing them are unlikely to be relevant to both types of experiment. We introduce the informatics challenges arising in the analysis of tiling microarray experiments as open problems to the scientific community and present initial approaches for the analysis of this nascent technology.

Development of an Expressed Sequence Tag (EST) Resource for Wheat (Triticum aestivum L.)

PubMed Central

Lazo, G. R.; Chao, S.; Hummel, D. D.; Edwards, H.; Crossman, C. C.; Lui, N.; Matthews, D. E.; Carollo, V. L.; Hane, D. L.; You, F. M.; Butler, G. E.; Miller, R. E.; Close, T. J.; Peng, J. H.; Lapitan, N. L. V.; Gustafson, J. P.; Qi, L. L.; Echalier, B.; Gill, B. S.; Dilbirligi, M.; Randhawa, H. S.; Gill, K. S.; Greene, R. A.; Sorrells, M. E.; Akhunov, E. D.; Dvořák, J.; Linkiewicz, A. M.; Dubcovsky, J.; Hossain, K. G.; Kalavacharla, V.; Kianian, S. F.; Mahmoud, A. A.; Miftahudin; Ma, X.-F.; Conley, E. J.; Anderson, J. A.; Pathan, M. S.; Nguyen, H. T.; McGuire, P. E.; Qualset, C. O.; Anderson, O. D.

2004-01-01

This report describes the rationale, approaches, organization, and resource development leading to a large-scale deletion bin map of the hexaploid (2n = 6x = 42) wheat genome (Triticum aestivum L.). Accompanying reports in this issue detail results from chromosome bin-mapping of expressed sequence tags (ESTs) representing genes onto the seven homoeologous chromosome groups and a global analysis of the entire mapped wheat EST data set. Among the resources developed were the first extensive public wheat EST collection (113,220 ESTs). Described are protocols for sequencing, sequence processing, EST nomenclature, and the assembly of ESTs into contigs. These contigs plus singletons (unassembled ESTs) were used for selection of distinct sequence motif unigenes. Selected ESTs were rearrayed, validated by 5′ and 3′ sequencing, and amplified for probing a series of wheat aneuploid and deletion stocks. Images and data for all Southern hybridizations were deposited in databases and were used by the coordinators for each of the seven homoeologous chromosome groups to validate the mapping results. Results from this project have established the foundation for future developments in wheat genomics. PMID:15514037

Effectiveness of Simultaneous Prompting in Small Group: The Opportunity of Acquiring Non-Target Skills through Observational Learning and Instructive Feedback

ERIC Educational Resources Information Center

Gursel, Oguz; Tekin-Iftar, Elif; Bozkurt, Funda

2006-01-01

A multiple probe study across behaviors, replicated across students, assessed the effectiveness of simultaneous prompting (SP) in a small group teaching arrangement on teaching (a) to show the provinces, rivers, and border countries of Turkey on a map and (b) to expressively identify the names of the symbols which are usually used in math.…

Characterizing the performance of eddy current probes using photoinductive field-mapping

NASA Astrophysics Data System (ADS)

Moulder, John C.; Nakagawa, Norio

1992-12-01

We present a new method for characterizing the performance of eddy current probes by mapping their electromagnetic fields. The technique is based on the photoinductive effect, the change in the impedance of an eddy current probe induced by laser heating of the material under the probe. The instrument we developed maps a probe's electric field distribution by scanning an infrared laser beam over a thin film of gold lying underneath the probe. Measurements of both photoinductive signals and flaw signals for a series of similar probes demonstrates that the impedance change caused by an electrical-discharge-machined notch or a fatigue crack is proportional to the strength of the photoinductive signal. Thus, photoinductive measurements can supplant the use of artifact standards to calibrate eddy current probes.

Automated cell-type classification in intact tissues by single-cell molecular profiling

PubMed Central

2018-01-01

A major challenge in biology is identifying distinct cell classes and mapping their interactions in vivo. Tissue-dissociative technologies enable deep single cell molecular profiling but do not provide spatial information. We developed a proximity ligation in situ hybridization technology (PLISH) with exceptional signal strength, specificity, and sensitivity in tissue. Multiplexed data sets can be acquired using barcoded probes and rapid label-image-erase cycles, with automated calculation of single cell profiles, enabling clustering and anatomical re-mapping of cells. We apply PLISH to expression profile ~2900 cells in intact mouse lung, which identifies and localizes known cell types, including rare ones. Unsupervised classification of the cells indicates differential expression of ‘housekeeping’ genes between cell types, and re-mapping of two sub-classes of Club cells highlights their segregated spatial domains in terminal airways. By enabling single cell profiling of various RNA species in situ, PLISH can impact many areas of basic and medical research. PMID:29319504

Expression quantitative trait loci and genetic regulatory network analysis reveals that Gabra2 is involved in stress responses in the mouse.

PubMed

Dai, Jiajuan; Wang, Xusheng; Chen, Ying; Wang, Xiaodong; Zhu, Jun; Lu, Lu

2009-11-01

Previous studies have revealed that the subunit alpha 2 (Gabra2) of the gamma-aminobutyric acid receptor plays a critical role in the stress response. However, little is known about the gentetic regulatory network for Gabra2 and the stress response. We combined gene expression microarray analysis and quantitative trait loci (QTL) mapping to characterize the genetic regulatory network for Gabra2 expression in the hippocampus of BXD recombinant inbred (RI) mice. Our analysis found that the expression level of Gabra2 exhibited much variation in the hippocampus across the BXD RI strains and between the parental strains, C57BL/6J, and DBA/2J. Expression QTL (eQTL) mapping showed three microarray probe sets of Gabra2 to have highly significant linkage likelihood ratio statistic (LRS) scores. Gene co-regulatory network analysis showed that 10 genes, including Gria3, Chka, Drd3, Homer1, Grik2, Odz4, Prkag2, Grm5, Gabrb1, and Nlgn1 are directly or indirectly associated with stress responses. Eleven genes were implicated as Gabra2 downstream genes through mapping joint modulation. The genetical genomics approach demonstrates the importance and the potential power of the eQTL studies in identifying genetic regulatory networks that contribute to complex traits, such as stress responses.

Mapping MRI/MRS Parameters with Genetic Over-expression Profiles In Human Prostate Cancer: Demonstrating the Potential

PubMed Central

Lenkinski, Robert E.; Bloch, B. Nicholas; Liu, Fangbing; Frangioni, John V.; Perner, Sven; Rubin, Mark A.; Genega, Elizabeth; Rofsky, Neil M.; Gaston, Sandra M.

2009-01-01

Magnetic resonance imaging (MRI) and MR spectroscopy can probe a variety of physiological (e.g. blood vessel permeability) and metabolic characteristics of prostate cancer. However, little is known about the changes in gene expression that underlie the spectral and imaging features observed in prostate cancer. Tumor induced changes in vascular permeability and angiogenesis are thought to contribute to patterns of dynamic contrast enhanced (DCE) MRI images of prostate cancer even though the genetic basis of tumor vasculogenesis is complex and the specific mechanisms underlying these DCEMRI features have not yet been determined. In order to identify the changes in gene expression that correspond to MRS and DCEMRI patterns in human prostate cancers, we have utilized tissue print micropeel techniques to generate “whole mount” molecular maps of radical prostatectomy specimens that correspond to pre-surgical MRI/MRS studies. These molecular maps include RNA expression profiles from both Affymetrix GeneChip microarrays and quantitative reverse transcriptase PCR (qrt-PCR) analysis, as well as immunohistochemical studies. Using these methods on patients with prostate cancer, we found robust over-expression of choline kinase a in the majority of primary tumors. We also observed overexpression of neuropeptide Y (NPY), a newly identified angiogenic factor, in a subset of DCEMRI positive prostate cancers. These studies set the stage for establishing MRI/MRS parameters as validated biomarkers for human prostate cancer. PMID:18752015

Finite element and analytical solutions for van der Pauw and four-point probe correction factors when multiple non-ideal measurement conditions coexist

NASA Astrophysics Data System (ADS)

Reveil, Mardochee; Sorg, Victoria C.; Cheng, Emily R.; Ezzyat, Taha; Clancy, Paulette; Thompson, Michael O.

2017-09-01

This paper presents an extensive collection of calculated correction factors that account for the combined effects of a wide range of non-ideal conditions often encountered in realistic four-point probe and van der Pauw experiments. In this context, "non-ideal conditions" refer to conditions that deviate from the assumptions on sample and probe characteristics made in the development of these two techniques. We examine the combined effects of contact size and sample thickness on van der Pauw measurements. In the four-point probe configuration, we examine the combined effects of varying the sample's lateral dimensions, probe placement, and sample thickness. We derive an analytical expression to calculate correction factors that account, simultaneously, for finite sample size and asymmetric probe placement in four-point probe experiments. We provide experimental validation of the analytical solution via four-point probe measurements on a thin film rectangular sample with arbitrary probe placement. The finite sample size effect is very significant in four-point probe measurements (especially for a narrow sample) and asymmetric probe placement only worsens such effects. The contribution of conduction in multilayer samples is also studied and found to be substantial; hence, we provide a map of the necessary correction factors. This library of correction factors will enable the design of resistivity measurements with improved accuracy and reproducibility over a wide range of experimental conditions.

Finite element and analytical solutions for van der Pauw and four-point probe correction factors when multiple non-ideal measurement conditions coexist.

PubMed

Reveil, Mardochee; Sorg, Victoria C; Cheng, Emily R; Ezzyat, Taha; Clancy, Paulette; Thompson, Michael O

2017-09-01

This paper presents an extensive collection of calculated correction factors that account for the combined effects of a wide range of non-ideal conditions often encountered in realistic four-point probe and van der Pauw experiments. In this context, "non-ideal conditions" refer to conditions that deviate from the assumptions on sample and probe characteristics made in the development of these two techniques. We examine the combined effects of contact size and sample thickness on van der Pauw measurements. In the four-point probe configuration, we examine the combined effects of varying the sample's lateral dimensions, probe placement, and sample thickness. We derive an analytical expression to calculate correction factors that account, simultaneously, for finite sample size and asymmetric probe placement in four-point probe experiments. We provide experimental validation of the analytical solution via four-point probe measurements on a thin film rectangular sample with arbitrary probe placement. The finite sample size effect is very significant in four-point probe measurements (especially for a narrow sample) and asymmetric probe placement only worsens such effects. The contribution of conduction in multilayer samples is also studied and found to be substantial; hence, we provide a map of the necessary correction factors. This library of correction factors will enable the design of resistivity measurements with improved accuracy and reproducibility over a wide range of experimental conditions.

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Treesearch

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

Cloning a balanced t(9;11)(p24;q23.1) chromosomal translocation breakpoint segregating with bipolar affective disorder in a small pedigree

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, D.J.; Baysal, B.E.; Gollin, S.M.

A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less

Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin.

PubMed

Troggio, Michela; Surbanovski, Nada; Bianco, Luca; Moretto, Marco; Giongo, Lara; Banchi, Elisa; Viola, Roberto; Fernández, Felicdad Fernández; Costa, Fabrizio; Velasco, Riccardo; Cestaro, Alessandro; Sargent, Daniel James

2013-01-01

High throughput arrays for the simultaneous genotyping of thousands of single-nucleotide polymorphisms (SNPs) have made the rapid genetic characterisation of plant genomes and the development of saturated linkage maps a realistic prospect for many plant species of agronomic importance. However, the correct calling of SNP genotypes in divergent polyploid genomes using array technology can be problematic due to paralogy, and to divergence in probe sequences causing changes in probe binding efficiencies. An Illumina Infinium II whole-genome genotyping array was recently developed for the cultivated apple and used to develop a molecular linkage map for an apple rootstock progeny (M432), but a large proportion of segregating SNPs were not mapped in the progeny, due to unexpected genotype clustering patterns. To investigate the causes of this unexpected clustering we performed BLAST analysis of all probe sequences against the 'Golden Delicious' genome sequence and discovered evidence for paralogous annealing sites and probe sequence divergence for a high proportion of probes contained on the array. Following visual re-evaluation of the genotyping data generated for 8,788 SNPs for the M432 progeny using the array, we manually re-scored genotypes at 818 loci and mapped a further 797 markers to the M432 linkage map. The newly mapped markers included the majority of those that could not be mapped previously, as well as loci that were previously scored as monomorphic, but which segregated due to divergence leading to heterozygosity in probe annealing sites. An evaluation of the 8,788 probes in a diverse collection of Malus germplasm showed that more than half the probes returned genotype clustering patterns that were difficult or impossible to interpret reliably, highlighting implications for the use of the array in genome-wide association studies.

Exploration at the Edge of the Solar System: The Pluto-Kuiper Express Mission (Invited)

NASA Astrophysics Data System (ADS)

Terrile, R. J.

1999-09-01

The Pluto-Kuiper Express mission is one component of the Outer Planets/Solar Probe Project which is part of the exploration strategy laid out in the Solar System Exploration Roadmap. The first three missions of this project are the Europa Orbiter, Pluto-Kuiper Express and the Solar Probe. All require challenging new technologies and the ability to operate in deep space and at Jupiter. Use of common management and design approaches, avionics, and mission software is planned to reduce the costs of the three missions. The Pluto-Kuiper Express mission is planned to launch in 2004 and is designed to provide the first reconnaissance of the Solar System's most distant planet, Pluto, and it, moon Charon. A gravity assist from Jupiter will allow an 8-year flight time to Pluto and the possibility of encountering one or more Edgeworth-Kuiper Belt objects after the Pluto encounter. The primary science objectives for the mission include characterizing the global geology and geomorphology of Pluto and Charon, mapping their surface composition and characterizing Pluto's neutral atmosphere and its escape rate. This mission is currently soliciting scientific investigations through a NASA Announcement of Opportunity.

The Oxford Probe: an open access five-hole probe for aerodynamic measurements

NASA Astrophysics Data System (ADS)

Hall, B. F.; Povey, T.

2017-03-01

The Oxford Probe is an open access five-hole probe designed for experimental aerodynamic measurements. The open access probe can be manufactured by the end user via additive manufacturing (metal or plastic). The probe geometry, drawings, calibration maps, and software are available under a creative commons license. The purpose is to widen access to aerodynamic measurement techniques in education and research environments. There are many situations in which the open access probe will allow results of comparable accuracy to a well-calibrated commercial probe. We discuss the applications and limitations of the probe, and compare the calibration maps for 16 probes manufactured in different materials and at different scales, but with the same geometrical design.

Molecular mapping of chromosomes 17 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1991-01-15

Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.« less

Molecular mapping of chromosomes 17 and X. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1991-01-15

Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping@ clones from a larger genome.« less

Inhibition of peroxisome proliferator-activated receptor γ: a potential link between chronic maternal hypoxia and impaired fetal growth

PubMed Central

Julian, Colleen G.; Yang, Ivana V.; Browne, Vaughn A.; Vargas, Enrique; Rodriguez, Carmelo; Pedersen, Brent S.; Moore, Lorna G.; Schwartz, David A.

2014-01-01

Chronic exposure to hypoxia raises the risk of pregnancy disorders characterized by maternal vascular dysfunction and diminished fetal growth. In an effort to identify novel pathways for these hypoxia-related effects, we assessed gene expression profiles of peripheral blood mononuclear cells (PBMCs) obtained from 43 female, high-altitude or sea-level residents in the nonpregnant state or during pregnancy (20 or 36 wk). Hypoxia-related fetal growth restriction becomes apparent between 25 and 29 wk of gestation and continues until delivery. Our sampling strategy was designed to capture changes occurring before (20 wk) and during (36 wk) the time frame of slowed fetal growth. PBMC gene expression profiles were generated using human gene expression microarrays and compared between altitudes. Biological pathways were identified using pathway analysis. Modest transcriptional differences were observed between altitudes in the nonpregnant state. Of the genes that were differentially expressed at high altitude vs. sea level during pregnancy (20 wk: 59 probes mapped to 41 genes; 36 wk: 985 probes mapped to 700 genes), several are of pathological relevance for fetal growth restriction. In particular, transcriptional changes were consistent with the negative regulation of peroxisome proliferator-activated receptor γ (PPARγ) at high altitude; such effects were accompanied by reduced birth weight (P <0.05) and head circumference (P <0.01) at high altitude vs. sea level. Our findings indicate that chronic exposure to hypoxia during pregnancy alters maternal gene expression patterns in general and, in particular, expression of key genes involved in metabolic homeostasis that have been proposed to play a role in the pathophysiology of fetal growth restriction.—Julian, C. G., Yang, I. V., Browne, V. A., Vargas, E., Rodriguez, C., Pedersen, B. S., Moore, L. G., Schwartz, D. A. Inhibition of peroxisome proliferator-activated receptor γ: a potential link between chronic maternal hypoxia and impaired fetal growth. PMID:24307415

A Filtering Method to Reveal Crystalline Patterns from Atom Probe Microscopy Desorption Maps

DTIC Science & Technology

2016-03-26

Gault, S.P. Ringer, J.M. Cairney, Atom probe crystallography : characterization of grain boundary orientation relationships in nanocrystalline...J.M. Cairney, Atom probe crystallography : atomic- scale 3-D orientation mapping, Scr. Mater. 66 (11) (2012) 907. L. Yao /MethodsX 3 (2016) 268–273 273

A Unique Procedure to Identify Cell Surface Markers Through a Spherical Self-Organizing Map Applied to DNA Microarray Analysis.

PubMed

Sugii, Yuh; Kasai, Tomonari; Ikeda, Masashi; Vaidyanath, Arun; Kumon, Kazuki; Mizutani, Akifumi; Seno, Akimasa; Tokutaka, Heizo; Kudoh, Takayuki; Seno, Masaharu

2016-01-01

To identify cell-specific markers, we designed a DNA microarray platform with oligonucleotide probes for human membrane-anchored proteins. Human glioma cell lines were analyzed using microarray and compared with normal and fetal brain tissues. For the microarray analysis, we employed a spherical self-organizing map, which is a clustering method suitable for the conversion of multidimensional data into two-dimensional data and displays the relationship on a spherical surface. Based on the gene expression profile, the cell surface characteristics were successfully mirrored onto the spherical surface, thereby distinguishing normal brain tissue from the disease model based on the strength of gene expression. The clustered glioma-specific genes were further analyzed by polymerase chain reaction procedure and immunocytochemical staining of glioma cells. Our platform and the following procedure were successfully demonstrated to categorize the genes coding for cell surface proteins that are specific to glioma cells. Our assessment demonstrates that a spherical self-organizing map is a valuable tool for distinguishing cell surface markers and can be employed in marker discovery studies for the treatment of cancer.

Mapping alternating current electroosmotic flow at the dielectrophoresis crossover frequency of a colloidal probe.

PubMed

Wang, Jingyu; Wei, Ming-Tzo; Cohen, Joel A; Ou-Yang, H Daniel

2013-07-01

AC electroosmotic (ACEO) flow above the gap between coplanar electrodes is mapped by the measurement of Stokes forces on an optically trapped polystyrene colloidal particle. E²-dependent forces on the probe particle are selected by amplitude modulation (AM) of the ACEO electric field (E) and lock-in detection at twice the AM frequency. E²-dependent DEP of the probe is eliminated by driving the ACEO at the probe's DEP crossover frequency. The location-independent DEP crossover frequency is determined, in a separate experiment, as the limiting frequency of zero horizontal force as the probe is moved toward the midpoint between the electrodes. The ACEO velocity field, uncoupled from probe DEP effects, was mapped in the region 1-9 μm above a 28 μm gap between the electrodes. By use of variously sized probes, each at its DEP crossover frequency, the frequency dependence of the ACEO flow was determined at a point 3 μm above the electrode gap and 4 μm from an electrode tip. At this location the ACEO flow was maximal at ∼117 kHz for a low salt solution. This optical trapping method, by eliminating DEP forces on the probe, provides unambiguous mapping of the ACEO velocity field. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin

PubMed Central

Troggio, Michela; Šurbanovski, Nada; Bianco, Luca; Moretto, Marco; Giongo, Lara; Banchi, Elisa; Viola, Roberto; Fernández, Felicdad Fernández; Costa, Fabrizio; Velasco, Riccardo; Cestaro, Alessandro; Sargent, Daniel James

2013-01-01

High throughput arrays for the simultaneous genotyping of thousands of single-nucleotide polymorphisms (SNPs) have made the rapid genetic characterisation of plant genomes and the development of saturated linkage maps a realistic prospect for many plant species of agronomic importance. However, the correct calling of SNP genotypes in divergent polyploid genomes using array technology can be problematic due to paralogy, and to divergence in probe sequences causing changes in probe binding efficiencies. An Illumina Infinium II whole-genome genotyping array was recently developed for the cultivated apple and used to develop a molecular linkage map for an apple rootstock progeny (M432), but a large proportion of segregating SNPs were not mapped in the progeny, due to unexpected genotype clustering patterns. To investigate the causes of this unexpected clustering we performed BLAST analysis of all probe sequences against the ‘Golden Delicious’ genome sequence and discovered evidence for paralogous annealing sites and probe sequence divergence for a high proportion of probes contained on the array. Following visual re-evaluation of the genotyping data generated for 8,788 SNPs for the M432 progeny using the array, we manually re-scored genotypes at 818 loci and mapped a further 797 markers to the M432 linkage map. The newly mapped markers included the majority of those that could not be mapped previously, as well as loci that were previously scored as monomorphic, but which segregated due to divergence leading to heterozygosity in probe annealing sites. An evaluation of the 8,788 probes in a diverse collection of Malus germplasm showed that more than half the probes returned genotype clustering patterns that were difficult or impossible to interpret reliably, highlighting implications for the use of the array in genome-wide association studies. PMID:23826289

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

A PCR-Based Method for RNA Probes and Applications in Neuroscience.

PubMed

Hua, Ruifang; Yu, Shanshan; Liu, Mugen; Li, Haohong

2018-01-01

In situ hybridization (ISH) is a powerful technique that is used to detect the localization of specific nucleic acid sequences for understanding the organization, regulation, and function of genes. However, in most cases, RNA probes are obtained by in vitro transcription from plasmids containing specific promoter elements and mRNA-specific cDNA. Probes originating from plasmid vectors are time-consuming and not suitable for the rapid gene mapping. Here, we introduce a simplified method to prepare digoxigenin (DIG)-labeled non-radioactive RNA probes based on polymerase chain reaction (PCR) amplification and applications in free-floating mouse brain sections. Employing a transgenic reporter line, we investigate the expression of the somatostatin (SST) mRNA in the adult mouse brain. The method can be applied to identify the colocalization of SST mRNA and proteins including corticotrophin-releasing hormone (CRH) and protein kinase C delta type (PKC-δ) using double immunofluorescence, which is useful for understanding the organization of complex brain nuclei. Moreover, the method can also be incorporated with retrograde tracing to visualize the functional connection in the neural circuitry. Briefly, the PCR-based method for non-radioactive RNA probes is a useful tool that can be substantially utilized in neuroscience studies.

Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

PubMed

Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

1998-01-01

Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

OxfordGrid: a web interface for pairwise comparative map views.

PubMed

Yang, Hongyu; Gingle, Alan R

2005-12-01

OxfordGrid is a web application and database schema for storing and interactively displaying genetic map data in a comparative, dot-plot, fashion. Its display is composed of a matrix of cells, each representing a pairwise comparison of mapped probe data for two linkage groups or chromosomes. These are arranged along the axes with one forming grid columns and the other grid rows with the degree and pattern of synteny/colinearity between the two linkage groups manifested in the cell's dot density and structure. A mouse click over the selected grid cell launches an image map-based display for the selected cell. Both individual and linear groups of mapped probes can be selected and displayed. Also, configurable links can be used to access other web resources for mapped probe information. OxfordGrid is implemented in C#/ASP.NET and the package, including MySQL schema creation scripts, is available at ftp://cggc.agtec.uga.edu/OxfordGrid/.

Theoretical analysis of a dual-probe scanning tunneling microscope setup on graphene.

PubMed

Settnes, Mikkel; Power, Stephen R; Petersen, Dirch H; Jauho, Antti-Pekka

2014-03-07

Experimental advances allow for the inclusion of multiple probes to measure the transport properties of a sample surface. We develop a theory of dual-probe scanning tunneling microscopy using a Green's function formalism, and apply it to graphene. Sampling the local conduction properties at finite length scales yields real space conductance maps which show anisotropy for pristine graphene systems and quantum interference effects in the presence of isolated impurities. Spectral signatures in the Fourier transforms of real space conductance maps include characteristics that can be related to different scattering processes. We compute the conductance maps of graphene systems with different edge geometries or height fluctuations to determine the effects of nonideal graphene samples on dual-probe measurements.

A new method for mapping the three-dimensional atomic distribution within nanoparticles by atom probe tomography (APT).

PubMed

Kim, Se-Ho; Kang, Phil Woong; Park, O Ok; Seol, Jae-Bok; Ahn, Jae-Pyoung; Lee, Ji Yeong; Choi, Pyuck-Pa

2018-07-01

We present a new method of preparing needle-shaped specimens for atom probe tomography from freestanding Pd and C-supported Pt nanoparticles. The method consists of two steps, namely electrophoresis of nanoparticles on a flat Cu substrate followed by electrodeposition of a Ni film acting as an embedding matrix for the nanoparticles. Atom probe specimen preparation can be subsequently carried out by means of focused-ion-beam milling. Using this approach, we have been able to perform correlative atom probe tomography and transmission electron microscopy analyses on both nanoparticle systems. Reliable mass spectra and three-dimensional atom maps could be obtained for Pd nanoparticle specimens. In contrast, atom probe samples prepared from C-supported Pt nanoparticles showed uneven field evaporation and hence artifacts in the reconstructed atom maps. Our developed method is a viable means of mapping the three-dimensional atomic distribution within nanoparticles and is expected to contribute to an improved understanding of the structure-composition-property relationships of various nanoparticle systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Multiplexed 3D FRET imaging in deep tissue of live embryos

PubMed Central

Zhao, Ming; Wan, Xiaoyang; Li, Yu; Zhou, Weibin; Peng, Leilei

2015-01-01

Current deep tissue microscopy techniques are mostly restricted to intensity mapping of fluorophores, which significantly limit their applications in investigating biochemical processes in vivo. We present a deep tissue multiplexed functional imaging method that probes multiple Förster resonant energy transfer (FRET) sensors in live embryos with high spatial resolution. The method simultaneously images fluorescence lifetimes in 3D with multiple excitation lasers. Through quantitative analysis of triple-channel intensity and lifetime images, we demonstrated that Ca2+ and cAMP levels of live embryos expressing dual FRET sensors can be monitored simultaneously at microscopic resolution. The method is compatible with a broad range of FRET sensors currently available for probing various cellular biochemical functions. It opens the door to imaging complex cellular circuitries in whole live organisms. PMID:26387920

Regulation of gene expression in the mammalian eye and its relevance to eye disease.

PubMed

Scheetz, Todd E; Kim, Kwang-Youn A; Swiderski, Ruth E; Philp, Alisdair R; Braun, Terry A; Knudtson, Kevin L; Dorrance, Anne M; DiBona, Gerald F; Huang, Jian; Casavant, Thomas L; Sheffield, Val C; Stone, Edwin M

2006-09-26

We used expression quantitative trait locus mapping in the laboratory rat (Rattus norvegicus) to gain a broad perspective of gene regulation in the mammalian eye and to identify genetic variation relevant to human eye disease. Of >31,000 gene probes represented on an Affymetrix expression microarray, 18,976 exhibited sufficient signal for reliable analysis and at least 2-fold variation in expression among 120 F(2) rats generated from an SR/JrHsd x SHRSP intercross. Genome-wide linkage analysis with 399 genetic markers revealed significant linkage with at least one marker for 1,300 probes (alpha = 0.001; estimated empirical false discovery rate = 2%). Both contiguous and noncontiguous loci were found to be important in regulating mammalian eye gene expression. We investigated one locus of each type in greater detail and identified putative transcription-altering variations in both cases. We found an inserted cREL binding sequence in the 5' flanking sequence of the Abca4 gene associated with an increased expression level of that gene, and we found a mutation of the gene encoding thyroid hormone receptor beta2 associated with a decreased expression level of the gene encoding short-wavelength sensitive opsin (Opn1sw). In addition to these positional studies, we performed a pairwise analysis of gene expression to identify genes that are regulated in a coordinated manner and used this approach to validate two previously undescribed genes involved in the human disease Bardet-Biedl syndrome. These data and analytical approaches can be used to facilitate the discovery of additional genes and regulatory elements involved in human eye disease.

In vivo Magnetic Resonance Imaging of Tumor Protease Activity

PubMed Central

Haris, Mohammad; Singh, Anup; Mohammed, Imran; Ittyerah, Ranjit; Nath, Kavindra; Nanga, Ravi Prakash Reddy; Debrosse, Catherine; Kogan, Feliks; Cai, Kejia; Poptani, Harish; Reddy, Damodar; Hariharan, Hari; Reddy, Ravinder

2014-01-01

Increased expression of cathepsins has diagnostic as well as prognostic value in several types of cancer. Here, we demonstrate a novel magnetic resonance imaging (MRI) method, which uses poly-L-glutamate (PLG) as an MRI probe to map cathepsin expression in vivo, in a rat brain tumor model. This noninvasive, high-resolution and non-radioactive method exploits the differences in the CEST signals of PLG in the native form and cathepsin mediated cleaved form. The method was validated in phantoms with known physiological concentrations, in tumor cells and in an animal model of brain tumor along with immunohistochemical analysis. Potential applications in tumor diagnosis and evaluation of therapeutic response are outlined. PMID:25124082

A Java-based tool for the design of classification microarrays.

PubMed

Meng, Da; Broschat, Shira L; Call, Douglas R

2008-08-04

Classification microarrays are used for purposes such as identifying strains of bacteria and determining genetic relationships to understand the epidemiology of an infectious disease. For these cases, mixed microarrays, which are composed of DNA from more than one organism, are more effective than conventional microarrays composed of DNA from a single organism. Selection of probes is a key factor in designing successful mixed microarrays because redundant sequences are inefficient and limited representation of diversity can restrict application of the microarray. We have developed a Java-based software tool, called PLASMID, for use in selecting the minimum set of probe sequences needed to classify different groups of plasmids or bacteria. The software program was successfully applied to several different sets of data. The utility of PLASMID was illustrated using existing mixed-plasmid microarray data as well as data from a virtual mixed-genome microarray constructed from different strains of Streptococcus. Moreover, use of data from expression microarray experiments demonstrated the generality of PLASMID. In this paper we describe a new software tool for selecting a set of probes for a classification microarray. While the tool was developed for the design of mixed microarrays-and mixed-plasmid microarrays in particular-it can also be used to design expression arrays. The user can choose from several clustering methods (including hierarchical, non-hierarchical, and a model-based genetic algorithm), several probe ranking methods, and several different display methods. A novel approach is used for probe redundancy reduction, and probe selection is accomplished via stepwise discriminant analysis. Data can be entered in different formats (including Excel and comma-delimited text), and dendrogram, heat map, and scatter plot images can be saved in several different formats (including jpeg and tiff). Weights generated using stepwise discriminant analysis can be stored for analysis of subsequent experimental data. Additionally, PLASMID can be used to construct virtual microarrays with genomes from public databases, which can then be used to identify an optimal set of probes.

Subatomic-scale force vector mapping above a Ge(001) dimer using bimodal atomic force microscopy

NASA Astrophysics Data System (ADS)

Naitoh, Yoshitaka; Turanský, Robert; Brndiar, Ján; Li, Yan Jun; Štich, Ivan; Sugawara, Yasuhiro

2017-07-01

Probing physical quantities on the nanoscale that have directionality, such as magnetic moments, electric dipoles, or the force response of a surface, is essential for characterizing functionalized materials for nanotechnological device applications. Currently, such physical quantities are usually experimentally obtained as scalars. To investigate the physical properties of a surface on the nanoscale in depth, these properties must be measured as vectors. Here we demonstrate a three-force-component detection method, based on multi-frequency atomic force microscopy on the subatomic scale and apply it to a Ge(001)-c(4 × 2) surface. We probed the surface-normal and surface-parallel force components above the surface and their direction-dependent anisotropy and expressed them as a three-dimensional force vector distribution. Access to the atomic-scale force distribution on the surface will enable better understanding of nanoscale surface morphologies, chemical composition and reactions, probing nanostructures via atomic or molecular manipulation, and provide insights into the behaviour of nano-machines on substrates.

An expression database for roots of the model legume Medicago truncatula under salt stress

PubMed Central

2009-01-01

Background Medicago truncatula is a model legume whose genome is currently being sequenced by an international consortium. Abiotic stresses such as salt stress limit plant growth and crop productivity, including those of legumes. We anticipate that studies on M. truncatula will shed light on other economically important legumes across the world. Here, we report the development of a database called MtED that contains gene expression profiles of the roots of M. truncatula based on time-course salt stress experiments using the Affymetrix Medicago GeneChip. Our hope is that MtED will provide information to assist in improving abiotic stress resistance in legumes. Description The results of our microarray experiment with roots of M. truncatula under 180 mM sodium chloride were deposited in the MtED database. Additionally, sequence and annotation information regarding microarray probe sets were included. MtED provides functional category analysis based on Gene and GeneBins Ontology, and other Web-based tools for querying and retrieving query results, browsing pathways and transcription factor families, showing metabolic maps, and comparing and visualizing expression profiles. Utilities like mapping probe sets to genome of M. truncatula and In-Silico PCR were implemented by BLAT software suite, which were also available through MtED database. Conclusion MtED was built in the PHP script language and as a MySQL relational database system on a Linux server. It has an integrated Web interface, which facilitates ready examination and interpretation of the results of microarray experiments. It is intended to help in selecting gene markers to improve abiotic stress resistance in legumes. MtED is available at http://bioinformatics.cau.edu.cn/MtED/. PMID:19906315

An expression database for roots of the model legume Medicago truncatula under salt stress.

PubMed

Li, Daofeng; Su, Zhen; Dong, Jiangli; Wang, Tao

2009-11-11

Medicago truncatula is a model legume whose genome is currently being sequenced by an international consortium. Abiotic stresses such as salt stress limit plant growth and crop productivity, including those of legumes. We anticipate that studies on M. truncatula will shed light on other economically important legumes across the world. Here, we report the development of a database called MtED that contains gene expression profiles of the roots of M. truncatula based on time-course salt stress experiments using the Affymetrix Medicago GeneChip. Our hope is that MtED will provide information to assist in improving abiotic stress resistance in legumes. The results of our microarray experiment with roots of M. truncatula under 180 mM sodium chloride were deposited in the MtED database. Additionally, sequence and annotation information regarding microarray probe sets were included. MtED provides functional category analysis based on Gene and GeneBins Ontology, and other Web-based tools for querying and retrieving query results, browsing pathways and transcription factor families, showing metabolic maps, and comparing and visualizing expression profiles. Utilities like mapping probe sets to genome of M. truncatula and In-Silico PCR were implemented by BLAT software suite, which were also available through MtED database. MtED was built in the PHP script language and as a MySQL relational database system on a Linux server. It has an integrated Web interface, which facilitates ready examination and interpretation of the results of microarray experiments. It is intended to help in selecting gene markers to improve abiotic stress resistance in legumes. MtED is available at http://bioinformatics.cau.edu.cn/MtED/.

Comparison of global brain gene expression profiles between inbred long-sleep and inbred short-sleep mice by high-density gene array hybridization.

PubMed

Xu, Y; Ehringer, M; Yang, F; Sikela, J M

2001-06-01

Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.

Treatment of cells with alkaline borate buffer extends the capability of interphase FISH mapping.

PubMed

Yokota, H; van den Engh, G; Mostert, M; Trask, B J

1995-01-20

Interphase fluorescence in situ hybridization (FISH) has been shown to be a means to map DNA sequences relative to each other in the 100 kb to 1-2 Mb genomic-separation range. At distances below 0.1 Mb, probe sites are infrequently resolved in interphase chromatin. In the 0.1- to 1-Mb range, interphase chromatin can be modeled as a freely flexible chain. The mean square interphase distance between two probes is proportional to the genomic separation between the probes on the linear DNA molecule. Above 1-2 Mb, the relationship between interphase distance and genomic separation changes abruptly and appears to level off. We have used alkaline-borate treatment to expand the capability of interphase FISH mapping. We show here that alkaline-borate treatment increases nuclear diameter, the interphase distance between probes on homologous chromosomes, and the distance between probes on the same chromosome. We also show that the mean square distance between hybridization sites in borate-treated nuclei is proportional to genomic separation up to 4 Mb. Thus, alkaline-borate treatment enhances the capability of interphase FISH mapping by increasing the absolute distance between probes and extending the range of the simple relationship between interphase distance and genomic separation.

Treatment of cells with alkaline borate buffer extends the capability of interphase FISH mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokota, H.; Van Den Engh, G.; Mostert, M.

1995-01-20

Interphase fluorescence in situ hybridization (FISH) has been shown to be a means to map DNA sequences relative to each other in the 100 kb to 1-2 Mb genomic-separation range. At distances below 0.1 Mb, probe sites are infrequently resolved in interphase chromatin. In the 0.1- to 1-Mb range, interphase chromatin can be modeled as a freely flexible chain. The mean square interphase distance between two probes is proportional to the genomic separation between the probes on the linear DNA molecule. Above 1-2 Mb, the relationship between interphase distance and genomic separation changes abruptly and appears to level off. Wemore » have used alkaline-borate treatment to expand the capability of interphase FISH mapping. We show here that alkaline-borate treatment increases nuclear diameter, the interphase distance between probes on homologous chromosomes, and the distance between probes on the same chromosome. We also show that the mean square distance between hybridization sites in borate-treated nuclei is proportional to genomic separation up to 4 Mb. Thus, alkaline-borate treatment enhances the capability of interphase FISH mapping by increasing the absolute distance between probes and extending the range of the simple relationship between interphase distance and genomic separation. 31 refs., 5 figs.« less

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Hall Probe Calibration System Design for the Mu2e Solenoid Field Mapping System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orozco, Charles; Elementi, Luciano; Feher, Sandor

The goal of the Mu2e experiment at Fermilab is to search for charged-lepton flavor violation by looking for neutrino-less muon to electron conversion in the field of the nucleus. The Mu2e experimental apparatus utilizes a complex magnetic field in the muon generation and momentum and charge selection process. Precise knowledge of the magnetic field is crucial. It is planned to map the solenoid field with calibrated 3D Hall probes up to 10 -5 accuracy. Here, this article describes a new design of a Hall probe calibration system that will be used to calibrate 3D Hall probes to better than 10more » -5 accuracy for the Mu2e Solenoid Field Mapping System.« less

Hall Probe Calibration System Design for the Mu2e Solenoid Field Mapping System

DOE PAGES

Orozco, Charles; Elementi, Luciano; Feher, Sandor; ...

2018-02-22

The goal of the Mu2e experiment at Fermilab is to search for charged-lepton flavor violation by looking for neutrino-less muon to electron conversion in the field of the nucleus. The Mu2e experimental apparatus utilizes a complex magnetic field in the muon generation and momentum and charge selection process. Precise knowledge of the magnetic field is crucial. It is planned to map the solenoid field with calibrated 3D Hall probes up to 10 -5 accuracy. Here, this article describes a new design of a Hall probe calibration system that will be used to calibrate 3D Hall probes to better than 10more » -5 accuracy for the Mu2e Solenoid Field Mapping System.« less

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

PubMed Central

2012-01-01

Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.).

PubMed

Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen

2012-05-14

High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Automated clustering of probe molecules from solvent mapping of protein surfaces: new algorithms applied to hot-spot mapping and structure-based drug design

NASA Astrophysics Data System (ADS)

Lerner, Michael G.; Meagher, Kristin L.; Carlson, Heather A.

2008-10-01

Use of solvent mapping, based on multiple-copy minimization (MCM) techniques, is common in structure-based drug discovery. The minima of small-molecule probes define locations for complementary interactions within a binding pocket. Here, we present improved methods for MCM. In particular, a Jarvis-Patrick (JP) method is outlined for grouping the final locations of minimized probes into physical clusters. This algorithm has been tested through a study of protein-protein interfaces, showing the process to be robust, deterministic, and fast in the mapping of protein "hot spots." Improvements in the initial placement of probe molecules are also described. A final application to HIV-1 protease shows how our automated technique can be used to partition data too complicated to analyze by hand. These new automated methods may be easily and quickly extended to other protein systems, and our clustering methodology may be readily incorporated into other clustering packages.

Analysis of Transcriptional Regulatory Pathways of Photoreceptor Genes by Expression Profiling of the Otx2-Deficient Retina

PubMed Central

Muranishi, Yuki; Chaya, Taro; Onishi, Akishi; Minami, Takashi; Fujikado, Takashi; Furukawa, Takahisa

2011-01-01

In the vertebrate retina, the Otx2 transcription factor plays a crucial role in the cell fate determination of both rod and cone photoreceptors. We previously reported that Otx2 conditional knockout (CKO) mice exhibited a total absence of rods and cones in the retina due to their cell fate conversion to amacrine-like cells. In order to investigate the entire transcriptome of the Otx2 CKO retina, we compared expression profile of Otx2 CKO and wild-type retinas at P1 and P12 using microarray. We observed that expression of 101- and 1049-probe sets significantly decreased in the Otx2 CKO retina at P1 and P12, respectively, whereas, expression of 3- and 4149-probe sets increased at P1 and P12, respectively. We found that expression of genes encoding transcription factors involved in photoreceptor development, including Crx, Nrl, Nr2e3, Esrrb, and NeuroD, was markedly down-regulated in the Otx2 CKO at both P1 and P12. Furthermore, we identified three human retinal disease loci mapped in close proximity to certain down-regulated genes in the Otx2 CKO retina including Ccdc126, Tnfsf13 and Pitpnm1, suggesting that these genes are possibly responsible for these diseases. These transcriptome data sets of the Otx2 CKO retina provide a resource on developing rods and cones to further understand the molecular mechanisms underlying photoreceptor development, function and disease. PMID:21602925

Analysis of transcriptional regulatory pathways of photoreceptor genes by expression profiling of the Otx2-deficient retina.

PubMed

Omori, Yoshihiro; Katoh, Kimiko; Sato, Shigeru; Muranishi, Yuki; Chaya, Taro; Onishi, Akishi; Minami, Takashi; Fujikado, Takashi; Furukawa, Takahisa

2011-01-01

In the vertebrate retina, the Otx2 transcription factor plays a crucial role in the cell fate determination of both rod and cone photoreceptors. We previously reported that Otx2 conditional knockout (CKO) mice exhibited a total absence of rods and cones in the retina due to their cell fate conversion to amacrine-like cells. In order to investigate the entire transcriptome of the Otx2 CKO retina, we compared expression profile of Otx2 CKO and wild-type retinas at P1 and P12 using microarray. We observed that expression of 101- and 1049-probe sets significantly decreased in the Otx2 CKO retina at P1 and P12, respectively, whereas, expression of 3- and 4149-probe sets increased at P1 and P12, respectively. We found that expression of genes encoding transcription factors involved in photoreceptor development, including Crx, Nrl, Nr2e3, Esrrb, and NeuroD, was markedly down-regulated in the Otx2 CKO at both P1 and P12. Furthermore, we identified three human retinal disease loci mapped in close proximity to certain down-regulated genes in the Otx2 CKO retina including Ccdc126, Tnfsf13 and Pitpnm1, suggesting that these genes are possibly responsible for these diseases. These transcriptome data sets of the Otx2 CKO retina provide a resource on developing rods and cones to further understand the molecular mechanisms underlying photoreceptor development, function and disease.

Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.

PubMed

Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W

2005-01-01

Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.

Regulation of gene expression in the mammalian eye and its relevance to eye disease

PubMed Central

Scheetz, Todd E.; Kim, Kwang-Youn A.; Swiderski, Ruth E.; Philp, Alisdair R.; Braun, Terry A.; Knudtson, Kevin L.; Dorrance, Anne M.; DiBona, Gerald F.; Huang, Jian; Casavant, Thomas L.; Sheffield, Val C.; Stone, Edwin M.

2006-01-01

We used expression quantitative trait locus mapping in the laboratory rat (Rattus norvegicus) to gain a broad perspective of gene regulation in the mammalian eye and to identify genetic variation relevant to human eye disease. Of >31,000 gene probes represented on an Affymetrix expression microarray, 18,976 exhibited sufficient signal for reliable analysis and at least 2-fold variation in expression among 120 F2 rats generated from an SR/JrHsd × SHRSP intercross. Genome-wide linkage analysis with 399 genetic markers revealed significant linkage with at least one marker for 1,300 probes (α = 0.001; estimated empirical false discovery rate = 2%). Both contiguous and noncontiguous loci were found to be important in regulating mammalian eye gene expression. We investigated one locus of each type in greater detail and identified putative transcription-altering variations in both cases. We found an inserted cREL binding sequence in the 5′ flanking sequence of the Abca4 gene associated with an increased expression level of that gene, and we found a mutation of the gene encoding thyroid hormone receptor β2 associated with a decreased expression level of the gene encoding short-wavelength sensitive opsin (Opn1sw). In addition to these positional studies, we performed a pairwise analysis of gene expression to identify genes that are regulated in a coordinated manner and used this approach to validate two previously undescribed genes involved in the human disease Bardet–Biedl syndrome. These data and analytical approaches can be used to facilitate the discovery of additional genes and regulatory elements involved in human eye disease. PMID:16983098

Isolation of a transcription factor expressed in neural crest from the region of 22q11 deleted in DiGeorge syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wadey, R.; Roberts, C.; Daw, S.

1994-09-01

Deletions within chromosome 22q11 cause a wide variety of birth defects including DiGeorge syndrome and Shprintzen syndrome. We have defined a commonly deleted region of over 2 Mb, and a critical region of 300 kb. A gene, TUPLE1, has been isolated from this critical region encoding a transcriptional regulator similar to the yeast HIR1 histone regulator gene. Since it has been suggested that DGS results from a defective neural crest, the expression of Tuple1 was examined in whole mouse and chick embryos, tissue sections and neural tube explants: Tuple1 is expressed in a dynamic pattern with high levels in regionsmore » containing migrating crest. Prior to crest migration Tuple1 is expressed in a rhombomere-specific expression pattern. Later Tuple1 is expressed in discrete domains within the developing neural tube. A remarkable feature of the experiments was the detection of a similar dynamic pattern with sense probe; i.e., there is an antisense Tuple1 transcript. This was confirmed using RPA. Tuple1 is being screened for mutations in non-deletion patients and constructs assembled for homologous recombination in ES cells. Tuple1 maps to MMU16 extending the homology of linkage with human chromosome 22. From these data we predict that the human homologue of the murine scid mutation maps to 22q11.« less

Transcriptome Analysis of Oryza sativa Calli Under Microgravity

NASA Astrophysics Data System (ADS)

Jin, Jing; Chen, Haiying; Cai, Weiming

2015-11-01

The transcriptome of Oryza sativacalli was analyzed on board the Chinese spaceship "Shenzhou 8" to study the effects of microgravity on plant signal transduction and secondary metabolism (as one of the experiments with SIMBOX on Shenzhou 8). Calli of Oryza sativa were pre-cultured for 4 days on ground and then loaded into the stationary platform or the rotating platform of a biological incubator, called SIMBOX, to grow in space under microgravity conditions or 1g-conditions, respectively. The calli were fixed by RNAlater after grew 324 h under microgravity. After 17 days, Shenzhou 8 returned to Earth carrying SIMBOX. Oryza sativa calli were recovered, and the RNA was extracted for transcriptome analysis. After comparing 1 gspaceflight controls-inflight controls with 1 g-ground controls, 157 probe sets with different expression levels (fold change ≥2, p<0.05) were identified. When comparing spaceflight controls to 1 g-ground controls and to 1 g-inflight controls, 678 probe sets with different expression levels (fold change ≥2, p<0.05) were identified. The fact that the same 678 probe sets were identified in these two comparisons suggests that transcription was affected under microgravity conditions. MapMan analysis was used to classify 627 microgravity responsive (MR) transcripts. The MR transcripts were mainly involved in cell wall structure, the TCA cycle, primary metabolism, transcription, protein modification and degradation, hormone metabolism, calcium regulation, receptor like kinase activity and transport.

Mapping the plasmon response of Ag nanoislands on graphite at 100 nm resolution with scanning probe energy loss spectroscopy

NASA Astrophysics Data System (ADS)

Murphy, Shane; Bauer, Karl; Sloan, Peter A.; Lawton, James J.; Tang, Lin; Palmer, Richard E.

2015-12-01

We demonstrate plasmon mapping of Ag nanostructures on graphite using scanning probe energy loss spectroscopy (SPELS) with a spatial resolution of 100 nm. In SPELS, an STM tip is used as a localized source of field-emitted electrons to probe the sample surface. The energy loss spectrum of the backscattered electrons is measured to provide a chemical signature of the surface under the tip. We acquire three images simultaneously with SPELS: i) constant-current field-emission images, which provide topographical information; ii) backscattered electron images, which display material contrast; and iii) SPELS images, where material-dependent features such as plasmons are mapped.

An exemplar-familiarity model predicts short-term and long-term probe recognition across diverse forms of memory search.

PubMed

Nosofsky, Robert M; Cox, Gregory E; Cao, Rui; Shiffrin, Richard M

2014-11-01

Experiments were conducted to test a modern exemplar-familiarity model on its ability to account for both short-term and long-term probe recognition within the same memory-search paradigm. Also, making connections to the literature on attention and visual search, the model was used to interpret differences in probe-recognition performance across diverse conditions that manipulated relations between targets and foils across trials. Subjects saw lists of from 1 to 16 items followed by a single item recognition probe. In a varied-mapping condition, targets and foils could switch roles across trials; in a consistent-mapping condition, targets and foils never switched roles; and in an all-new condition, on each trial a completely new set of items formed the memory set. In the varied-mapping and all-new conditions, mean correct response times (RTs) and error proportions were curvilinear increasing functions of memory set size, with the RT results closely resembling ones from hybrid visual-memory search experiments reported by Wolfe (2012). In the consistent-mapping condition, new-probe RTs were invariant with set size, whereas old-probe RTs increased slightly with increasing study-test lag. With appropriate choice of psychologically interpretable free parameters, the model accounted well for the complete set of results. The work provides support for the hypothesis that a common set of processes involving exemplar-based familiarity may govern long-term and short-term probe recognition across wide varieties of memory- search conditions. PsycINFO Database Record (c) 2014 APA, all rights reserved.

Focal overlap gating in velocity map imaging to achieve high signal-to-noise ratio in photo-ion pump-probe experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shivaram, Niranjan; Champenois, Elio G.; Cryan, James P.

We demonstrate a technique in velocity map imaging (VMI) that allows spatial gating of the laser focal overlap region in time resolved pump-probe experiments. This significantly enhances signal-to-noise ratio by eliminating background signal arising outside the region of spatial overlap of pump and probe beams. This enhancement is achieved by tilting the laser beams with respect to the surface of the VMI electrodes which creates a gradient in flight time for particles born at different points along the beam. By suitably pulsing our microchannel plate detector, we can select particles born only where the laser beams overlap. Furthermore, this spatialmore » gating in velocity map imaging can benefit nearly all photo-ion pump-probe VMI experiments especially when extreme-ultraviolet light or X-rays are involved which produce large background signals on their own.« less

Focal overlap gating in velocity map imaging to achieve high signal-to-noise ratio in photo-ion pump-probe experiments

DOE PAGES

Shivaram, Niranjan; Champenois, Elio G.; Cryan, James P.; ...

2016-12-19

We demonstrate a technique in velocity map imaging (VMI) that allows spatial gating of the laser focal overlap region in time resolved pump-probe experiments. This significantly enhances signal-to-noise ratio by eliminating background signal arising outside the region of spatial overlap of pump and probe beams. This enhancement is achieved by tilting the laser beams with respect to the surface of the VMI electrodes which creates a gradient in flight time for particles born at different points along the beam. By suitably pulsing our microchannel plate detector, we can select particles born only where the laser beams overlap. Furthermore, this spatialmore » gating in velocity map imaging can benefit nearly all photo-ion pump-probe VMI experiments especially when extreme-ultraviolet light or X-rays are involved which produce large background signals on their own.« less

Characteristics of genomic signatures derived using univariate methods and mechanistically anchored functional descriptors for predicting drug- and xenobiotic-induced nephrotoxicity.

PubMed

Shi, Weiwei; Bugrim, Andrej; Nikolsky, Yuri; Nikolskya, Tatiana; Brennan, Richard J

2008-01-01

ABSTRACT The ideal toxicity biomarker is composed of the properties of prediction (is detected prior to traditional pathological signs of injury), accuracy (high sensitivity and specificity), and mechanistic relationships to the endpoint measured (biological relevance). Gene expression-based toxicity biomarkers ("signatures") have shown good predictive power and accuracy, but are difficult to interpret biologically. We have compared different statistical methods of feature selection with knowledge-based approaches, using GeneGo's database of canonical pathway maps, to generate gene sets for the classification of renal tubule toxicity. The gene set selection algorithms include four univariate analyses: t-statistics, fold-change, B-statistics, and RankProd, and their combination and overlap for the identification of differentially expressed probes. Enrichment analysis following the results of the four univariate analyses, Hotelling T-square test, and, finally out-of-bag selection, a variant of cross-validation, were used to identify canonical pathway maps-sets of genes coordinately involved in key biological processes-with classification power. Differentially expressed genes identified by the different statistical univariate analyses all generated reasonably performing classifiers of tubule toxicity. Maps identified by enrichment analysis or Hotelling T-square had lower classification power, but highlighted perturbed lipid homeostasis as a common discriminator of nephrotoxic treatments. The out-of-bag method yielded the best functionally integrated classifier. The map "ephrins signaling" performed comparably to a classifier derived using sparse linear programming, a machine learning algorithm, and represents a signaling network specifically involved in renal tubule development and integrity. Such functional descriptors of toxicity promise to better integrate predictive toxicogenomics with mechanistic analysis, facilitating the interpretation and risk assessment of predictive genomic investigations.

A microarray-based genotyping and genetic mapping approach for highly heterozygous outcrossing species enables localization of a large fraction of the unassembled Populus trichocarpa genome sequence.

PubMed

Drost, Derek R; Novaes, Evandro; Boaventura-Novaes, Carolina; Benedict, Catherine I; Brown, Ryan S; Yin, Tongming; Tuskan, Gerald A; Kirst, Matias

2009-06-01

Microarrays have demonstrated significant power for genome-wide analyses of gene expression, and recently have also revolutionized the genetic analysis of segregating populations by genotyping thousands of loci in a single assay. Although microarray-based genotyping approaches have been successfully applied in yeast and several inbred plant species, their power has not been proven in an outcrossing species with extensive genetic diversity. Here we have developed methods for high-throughput microarray-based genotyping in such species using a pseudo-backcross progeny of 154 individuals of Populus trichocarpa and P. deltoides analyzed with long-oligonucleotide in situ-synthesized microarray probes. Our analysis resulted in high-confidence genotypes for 719 single-feature polymorphism (SFP) and 1014 gene expression marker (GEM) candidates. Using these genotypes and an established microsatellite (SSR) framework map, we produced a high-density genetic map comprising over 600 SFPs, GEMs and SSRs. The abundance of gene-based markers allowed us to localize over 35 million base pairs of previously unplaced whole-genome shotgun (WGS) scaffold sequence to putative locations in the genome of P. trichocarpa. A high proportion of sampled scaffolds could be verified for their placement with independently mapped SSRs, demonstrating the previously un-utilized power that high-density genotyping can provide in the context of map-based WGS sequence reassembly. Our results provide a substantial contribution to the continued improvement of the Populus genome assembly, while demonstrating the feasibility of microarray-based genotyping in a highly heterozygous population. The strategies presented are applicable to genetic mapping efforts in all plant species with similarly high levels of genetic diversity.

Molecular and cellular organization of taste neurons in adult Drosophila pharynx

PubMed Central

Chen, Yu-Chieh (David); Dahanukar, Anupama

2017-01-01

SUMMARY The Drosophila pharyngeal taste organs are poorly characterized despite their location at important sites for monitoring food quality. Functional analysis of pharyngeal neurons has been hindered by the paucity of molecular tools to manipulate them, as well as their relative inaccessibility for neurophysiological investigations. Here, we generate receptor-to-neuron maps of all three pharyngeal taste organs by performing a comprehensive chemoreceptor-GAL4/LexA expression analysis. The organization of pharyngeal neurons reveals similarities and distinctions in receptor repertoires and neuronal groupings compared to external taste neurons. We validate the mapping results by pinpointing a single pharyngeal neuron required for feeding avoidance of L-canavanine. Inducible activation of pharyngeal taste neurons reveals functional differences between external and internal taste neurons and functional subdivision within pharyngeal sweet neurons. Our results provide road maps of pharyngeal taste organs in an insect model system for probing the role of these understudied neurons in controlling feeding behaviors. PMID:29212040

Exact mapping between different dynamics of isotropically trapped quantum gases

NASA Astrophysics Data System (ADS)

Wamba, Etienne; Pelster, Axel; Anglin, James R.

2016-05-01

Experiments on trapped quantum gases can probe challenging regimes of quantum many-body dynamics, where strong interactions or non-equilibrium states prevent exact theoretical treatment. In this talk, we present a class of exact mappings between all the observables of different experiments, under the experimentally attainable conditions that the gas particles interact via a homogeneously scaling two-body potential which is in general time-dependent, and are confined in an isotropic harmonic trap. We express our result through an identity relating second-quantized field operators in the Heisenberg picture of quantum mechanics which makes it general. It applies to arbitrary measurements on possibly multi-component Bose or Fermi gases in arbitrary initial quantum states, no matter how highly excited or far from equilibrium. We use an example to show how the results of two different and currently feasible experiments can be mapped onto each other by our spacetime transformation. DAMOP sorting category: 6.11 Nonlinear dynamics and out-of-equilibrium trapped gases EW acknowledge the financial support from the Alexander von Humboldt foundation.

Highly sensitive mode mapping of whispering-gallery modes by scanning thermocouple-probe microscopy.

PubMed

Klein, Angela E; Schmidt, Carsten; Liebsch, Mattes; Janunts, Norik; Dobynde, Mikhail; Tünnermann, Andreas; Pertsch, Thomas

2014-03-01

We propose a method for mapping optical near-fields with the help of a thermocouple scanning-probe microscope tip. As the tip scans the sample surface, its apex is heated by light absorption, generating a thermovoltage. The thermovoltage map represents the intensity distribution of light at the sample surface. The measurement technique has been employed to map optical whispering-gallery modes in fused silica microdisk resonators operating at near-infrared wavelengths. The method could potentially be employed for near-field imaging of a variety of systems in the near-infrared and visible spectral range.

Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

NASA Astrophysics Data System (ADS)

Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

2014-11-01

The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

Advanced concentration analysis of atom probe tomography data: Local proximity histograms and pseudo-2D concentration maps.

PubMed

Felfer, Peter; Cairney, Julie

2018-06-01

Analysing the distribution of selected chemical elements with respect to interfaces is one of the most common tasks in data mining in atom probe tomography. This can be represented by 1D concentration profiles, 2D concentration maps or proximity histograms, which represent concentration, density etc. of selected species as a function of the distance from a reference surface/interface. These are some of the most useful tools for the analysis of solute distributions in atom probe data. In this paper, we present extensions to the proximity histogram in the form of 'local' proximity histograms, calculated for selected parts of a surface, and pseudo-2D concentration maps, which are 2D concentration maps calculated on non-flat surfaces. This way, local concentration changes at interfaces or and other structures can be assessed more effectively. Copyright © 2018 Elsevier B.V. All rights reserved.

KSC-01pp1057

NASA Image and Video Library

2001-05-31

KENNEDY SPACE CENTER, FLA. -- Scientists and other workers watch as the solar panels on the Microwave Anisotropy Probe (MAP) spacecraft are deployed in the Spacecraft Assembly and Encapsulation Facility 2. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1056

NASA Image and Video Library

2001-05-31

KENNEDY SPACE CENTER, FLA. -- Scientists and other workers watch as the solar panels on the Microwave Anisotropy Probe (MAP) spacecraft are deployed in the Spacecraft Assembly and Encapsulation Facility 2. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

Dual fiber microprobe for mapping elemental distributions in biological cells

DOEpatents

Martin, Rodger C [Powell, TN; Martin, Madhavi Z [Powell, TN

2007-07-31

Laser-induced breakdown spectroscopy (LIBS) is applied on a microscale for in situ elemental analysis and spatial mapping in biological cells. A high power laser beam is focused onto a cell surface using a dual branching optical fiber probe for optical excitation of the cell constituents. Dual spectrometers and ICCD detectors capture the emission spectra from the excited cell(s). Repeated probing or repositioning of the laser beam with respect to the cell can provide 2-D or 3-D mapping of the cell.

Microscopy and microanalysis 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bailey, G.W.; Corbett, J.M.; Dimlich, R.V.W.

1996-12-31

The Proceedings of this Annual Meeting contain paper of members from the three societies. These proceedings emphasizes the common research interests and attempts to eliminate some unwanted overlap. Topics covered are: microscopic analysis of animals with altered gene expression and in-situ gene and antibody localizations, high-resolution elemental mapping of nucleoprofein interactions, plant biology and pathology, quantitative HREM analysis of perfect and defected materials, computational methods for TEM image analysis, high-resolution FESM in materials research, frontiers in polymer microscopy and microanalysis, oxidation and corrosion, micro XRD and XRF, molecular microspectroscopy and spectral imaging, advances in confocal and multidimensional light microscopy, analyticalmore » electron microscopy in biology, correlative microscopy in biological sciences, grain-boundary microengineering, surfaces and interfaces, telepresence microscopy in education and research, MSA educational outreach, quantitative electron probe microanalysis, frontiers of analytical electron microscopy, critical issues in ceramic microstructures, dynamic organization of the cell, pathology, microbiology, high-resolution biological and cryo SEM, and scanning-probe microscopy.« less

The genetic map of finger millet, Eleusine coracana.

PubMed

Dida, Mathews M; Srinivasachary; Ramakrishnan, Sujatha; Bennetzen, Jeffrey L; Gale, Mike D; Devos, Katrien M

2007-01-01

Restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), expressed-sequenced tag (EST), and simple sequence repeat (SSR) markers were used to generate a genetic map of the tetraploid finger millet (Eleusine coracana subsp. coracana) genome (2n = 4x = 36). Because levels of variation in finger millet are low, the map was generated in an inter-subspecific F(2) population from a cross between E. coracana subsp. coracana cv. Okhale-1 and its wild progenitor E. coracana subsp. africana acc. MD-20. Duplicated loci were used to identify homoeologous groups. Assignment of linkage groups to the A and B genome was done by comparing the hybridization patterns of probes in Okhale-1, MD-20, and Eleusine indica acc. MD-36. E. indica is the A genome donor to E. coracana. The maps span 721 cM on the A genome and 787 cM on the B genome and cover all 18 finger millet chromosomes, at least partially. To facilitate the use of marker-assisted selection in finger millet, a first set of 82 SSR markers was developed. The SSRs were identified in small-insert genomic libraries generated using methylation-sensitive restriction enzymes. Thirty-one of the SSRs were mapped. Application of the maps and markers in hybridization-based breeding programs will expedite the improvement of finger millet.

The Development of Chromosome Microdissection and Microcloning Technique and its Applications in Genomic Research

PubMed Central

Zhou, Ruo-Nan; Hu, Zan-Min

2007-01-01

The technique of chromosome microdissection and microcloning has been developed for more than 20 years. As a bridge between cytogenetics and molecular genetics, it leads to a number of applications: chromosome painting probe isolation, genetic linkage map and physical map construction, and expressed sequence tags generation. During those 20 years, this technique has not only been benefited from other technological advances but also cross-fertilized with other techniques. Today, it becomes a practicality with extensive uses. The purpose of this article is to review the development of this technique and its application in the field of genomic research. Moreover, a new method of generating ESTs of specific chromosomes developed by our lab is introduced. By using this method, the technique of chromosome microdissection and microcloning would be more valuable in the advancement of genomic research. PMID:18645627

A radiation hybrid map of the distal short arm of human chromosome II, containing the Beckwith-Weidemann and associated embroyonal tumor disease loci

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, C.W. III; Berg, D.J.; Meeker, T.C.

1993-05-01

The authors describe a high-resolution radiation hybrid (RH) map of the distal short arm of human chromosome 11 containing the Beckwith-Weidemann gene and the associated embryonal tumor disease loci. Thirteen human 11p15 genes and 17 new anonymous probes were mapped by a statistical analysis of the cosegregation of markers in 102 rodent-human radiation hybrids retaining fragments of human chromosome 11. The 17 anonymous probes were generated from lambda phage containing human 11p15.5 inserts, by using ALU-PCR. A comprehensive map of all 30 loci and a framework map of nine clusters of loci ordered at odds of 1,000:1 were constructed bymore » a multipoint maximum-likelihood approach by using the computer program RHMAP. This RH map localizes one new gene to chromosome 11p15 (WEE1), provides more precise order information for several 11p15 genes (CTSD, H19, HPX,.ST5, RNH, and SMPD1), confirms previous map orders for other 11p15 genes (CALCA, PTH, HBBC, TH, HRAS, and DRD4), and maps 17 new anonymous probes within the 11p15.5 region. This RH map should prove useful in better defining the positions of the Beckwith-Weidemann and associated embryonal tumor disease-gene loci. 41 refs., 1 fig., 2 tabs.« less

A standard photomap of ovarian nurse cell chromosomes and inversion polymorphism in Anopheles beklemishevi.

PubMed

Artemov, Gleb N; Gordeev, Mikhail I; Kokhanenko, Alina A; Moskaev, Anton V; Velichevskaya, Alena I; Stegniy, Vladimir N; Sharakhov, Igor V; Sharakhova, Maria V

2018-03-27

Anopheles beklemishevi is a member of the Maculipennis group of malaria mosquitoes that has the most northern distribution among other members of the group. Although a cytogenetic map for the larval salivary gland chromosomes of this species has been developed, a high-quality standard cytogenetic photomap that enables genomics and population genetics studies of this mosquito at the adult stage is still lacking. In this study, a cytogenetic map for the polytene chromosomes of An. beklemishevi from ovarian nurse cells was developed using high-resolution digital imaging from field collected mosquitoes. PCR-amplified DNA probes for fluorescence in situ hybridization (FISH) were designed based on the genome of An. atroparvus. The DNA probe obtained by microdissection procedures from the breakpoint region was labelled in a DOP-PCR reaction. Population analysis was performed on 371 specimens collected in 18 locations. We report the development of a high-quality standard photomap for the polytene chromosomes from ovarian nurse cells of An. beklemishevi. To confirm the suitability of the map for physical mapping, several PCR-amplified probes were mapped to the chromosomes of An. beklemishevi using FISH. In addition, we identified and mapped DNA probes to flanking regions of the breakpoints of two inversions on chromosome X of this species. Inversion polymorphism was determined in 13 geographically distant populations of An. beklemishevi. Four polymorphic inversions were detected. The positions of common chromosomal inversions were indicated on the map. The study constructed a standard photomap for ovarian nurse cell chromosomes of An. beklemishevi and tested its suitability for physical genome mapping and population studies. Cytogenetic analysis determined inversion polymorphism in natural populations of An. beklemishevi related to this species' adaptation.

The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements

PubMed Central

2012-01-01

Over the last decade, the introduction of microarray technology has had a profound impact on gene expression research. The publication of studies with dissimilar or altogether contradictory results, obtained using different microarray platforms to analyze identical RNA samples, has raised concerns about the reliability of this technology. The MicroArray Quality Control (MAQC) project was initiated to address these concerns, as well as other performance and data analysis issues. Expression data on four titration pools from two distinct reference RNA samples were generated at multiple test sites using a variety of microarray-based and alternative technology platforms. Here we describe the experimental design and probe mapping efforts behind the MAQC project. We show intraplatform consistency across test sites as well as a high level of interplatform concordance in terms of genes identified as differentially expressed. This study provides a resource that represents an important first step toward establishing a framework for the use of microarrays in clinical and regulatory settings. PMID:16964229

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Design and Application of Hybrid Magnetic Field-Eddy Current Probe

NASA Technical Reports Server (NTRS)

Wincheski, Buzz; Wallace, Terryl; Newman, Andy; Leser, Paul; Simpson, John

2013-01-01

The incorporation of magnetic field sensors into eddy current probes can result in novel probe designs with unique performance characteristics. One such example is a recently developed electromagnetic probe consisting of a two-channel magnetoresistive sensor with an embedded single-strand eddy current inducer. Magnetic flux leakage maps of ferrous materials are generated from the DC sensor response while high-resolution eddy current imaging is simultaneously performed at frequencies up to 5 megahertz. In this work the design and optimization of this probe will be presented, along with an application toward analysis of sensory materials with embedded ferromagnetic shape-memory alloy (FSMA) particles. The sensory material is designed to produce a paramagnetic to ferromagnetic transition in the FSMA particles under strain. Mapping of the stray magnetic field and eddy current response of the sample with the hybrid probe can thereby image locations in the structure which have experienced an overstrain condition. Numerical modeling of the probe response is performed with good agreement with experimental results.

Scanning laser vibrometry and luminol photomicrography to map cavitational activity around ultrasonic scalers

NASA Astrophysics Data System (ADS)

Felver, Bernhard; King, David C.; Lea, Simon C.; Price, Gareth J.; Walmsley, A. Damien

2008-06-01

Ultrasonic dental scalers are clinically used to remove deposits from tooth surfaces. A metal probe, oscillating at ultrasonic frequencies, is used to chip away deposits from the teeth. To reduce frictional heating, water flows over the operated probe in which a bi-product, cavitation, may be generated. The aim of this study is characterise probe oscillations using scanning laser vibrometry and to relate the recorded data to the occurrence of cavitation that is mapped in the course of this research. Scanning laser vibrometry (Polytec models 300-F/S and 400-3D) was used to measure the movement of various designs of operating probes and to locate vibration nodes / anti-nodes at different generator power settings and contact loads (100g and 200g). Cavitation mapping was performed by photographing the emission from a luminol solution with a digital camera (Artemis ICX285). The scaler design influences the number and location of vibration node / anti-node points. For all ultrasonic probes, the highest displacement amplitude values were recorded at the tip. The highest amounts of cavitation around the probes were recorded at the second anti-node measured from the tip. Broad, beaver-tale shaped probes produced more cavitation than slim shaped ones. The design also influences the amount of inertial cavitation around the operated instrument. The clinical relevance is that broad, beaver-tale shaped probes are unlikely to reach subgingival areas of the tooth. Further research is required to design probes that will be clinically superior to cleaning this area of the tooth.

Random-breakage mapping method applied to human DNA sequences

NASA Technical Reports Server (NTRS)

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

PubMed

Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

2018-02-12

Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

The Maneuverable Atmospheric Probe (MAP), a Remotely Piloted Vehicle.

DTIC Science & Technology

1982-05-01

9 lb. MAP vehicle and major- components .................................... 10 2. Endevco Pitot tube airspeed indicator mounted below front...28 8. Cascaded PIXE impactors, housing cylinder and wing pod front end cup with aerosol inlet plastic tubing ........................... 30 9...turbulence sensors, a Pitot tube , two air temperature sensors, and a yaw gust probe. Located at each wing tip are sensors that contain encapsulated

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Feasibility of a GNSS-Probe for Creating Digital Maps of High Accuracy and Integrity

NASA Astrophysics Data System (ADS)

Vartziotis, Dimitris; Poulis, Alkis; Minogiannis, Alexandros; Siozos, Panayiotis; Goudas, Iraklis; Samson, Jaron; Tossaint, Michel

The “ROADSCANNER” project addresses the need for increased accuracy and integrity Digital Maps (DM) utilizing the latest developments in GNSS, in order to provide the required datasets for novel applications, such as navigation based Safety Applications, Advanced Driver Assistance Systems (ADAS) and Digital Automotive Simulations. The activity covered in the current paper is the feasibility study, preliminary tests, initial product design and development plan for an EGNOS enabled vehicle probe. The vehicle probe will be used for generating high accuracy, high integrity and ADAS compatible digital maps of roads, employing a multiple passes methodology supported by sophisticated refinement algorithms. Furthermore, the vehicle probe will be equipped with pavement scanning and other data fusion equipment, in order to produce 3D road surface models compatible with standards of road-tire simulation applications. The project was assigned to NIKI Ltd under the 1st Call for Ideas in the frame of the ESA - Greece Task Force.

Physical location of the carotenoid biosynthesis genes Psy and β-Lcy in Capsicum annuum (Solanaceae) using heterologous probes from Citrus sinensis (Rutaceae).

PubMed

Andrade-Souza, V; Costa, M G C; Chen, C X; Gmitter, F G; Costa, M A

2011-03-09

Carotenoids are responsible for a range of fruit colors in different hot pepper (Capsicum) varieties, from white to deep red. Color traits are genetically determined by three loci, Y, C1, and C2, which are associated with carotenogenic genes. Although such genes have been localized on genetic maps of Capsicum and anchored in Lycopersicon and Solanum, physical mapping in Capsicum has been restricted to only a few clusters of some multiple copy genes. Heterologous probes from single copy genes have been rarely used. Fluorescent in situ hybridization was performed in Capsicum annuum varieties with different fruit colors, using heterologous probes of Psy and β-Lcy genes obtained from a BAC library of the sweet orange (Citrus sinensis). The probes hybridized in the terminal portion of a chromosome pair, confirming the location of these genes in genetic maps. The hybridized segments showed variation in size in both chromosomes.

Real-Time Vision-Based Stiffness Mapping †.

PubMed

Faragasso, Angela; Bimbo, João; Stilli, Agostino; Wurdemann, Helge Arne; Althoefer, Kaspar; Asama, Hajime

2018-04-26

This paper presents new findings concerning a hand-held stiffness probe for the medical diagnosis of abnormalities during palpation of soft-tissue. Palpation is recognized by the medical community as an essential and low-cost method to detect and diagnose disease in soft-tissue. However, differences are often subtle and clinicians need to train for many years before they can conduct a reliable diagnosis. The probe presented here fills this gap providing a means to easily obtain stiffness values of soft tissue during a palpation procedure. Our stiffness sensor is equipped with a multi degree of freedom (DoF) Aurora magnetic tracker, allowing us to track and record the 3D position of the probe whilst examining a tissue area, and generate a 3D stiffness map in real-time. The stiffness probe was integrated in a robotic arm and tested in an artificial environment representing a good model of soft tissue organs; the results show that the sensor can accurately measure and map the stiffness of a silicon phantom embedded with areas of varying stiffness.

New approaches to probing Minkowski functionals

NASA Astrophysics Data System (ADS)

Munshi, D.; Smidt, J.; Cooray, A.; Renzi, A.; Heavens, A.; Coles, P.

2013-10-01

We generalize the concept of the ordinary skew-spectrum to probe the effect of non-Gaussianity on the morphology of cosmic microwave background (CMB) maps in several domains: in real space (where they are commonly known as cumulant-correlators), and in harmonic and needlet bases. The essential aim is to retain more information than normally contained in these statistics, in order to assist in determining the source of any measured non-Gaussianity, in the same spirit as Munshi & Heavens skew-spectra were used to identify foreground contaminants to the CMB bispectrum in Planck data. Using a perturbative series to construct the Minkowski functionals (MFs), we provide a pseudo-C_ℓ based approach in both harmonic and needlet representations to estimate these spectra in the presence of a mask and inhomogeneous noise. Assuming homogeneous noise, we present approximate expressions for error covariance for the purpose of joint estimation of these spectra. We present specific results for four different models of primordial non-Gaussianity local, equilateral, orthogonal and enfolded models, as well as non-Gaussianity caused by unsubtracted point sources. Closed form results of next-order corrections to MFs too are obtained in terms of a quadruplet of kurt-spectra. We also use the method of modal decomposition of the bispectrum and trispectrum to reconstruct the MFs as an alternative method of reconstruction of morphological properties of CMB maps. Finally, we introduce the odd-parity skew-spectra to probe the odd-parity bispectrum and its impact on the morphology of the CMB sky. Although developed for the CMB, the generic results obtained here can be useful in other areas of cosmology.

Pioneer Venus 1978

NASA Technical Reports Server (NTRS)

1976-01-01

An orbiter and a multiprobe spacecraft will be sent to Venus in 1978 to conduct a detailed examination of the planet's atmosphere and weather. The spin-stabilized multiprobe spacecraft consists of a bus, a large probe and three identical small probes, each carrying a complement of scientific instruments. The large probe will conduct a detailed sounding of the lower atmosphere, obtaining measurements of the clouds, atmospheric structure, wind speed, and atmospheric composition. Primary emphasis will be placed on the planet's energy balance and clouds. The three small probes will provide information on the circulation pattern of the lower atmosphere. The probe bus will provide data on the upper atmosphere and ionosphere down to an altitude of about 120 km. The orbiter is designed to globally map the atmosphere, ionosphere, and the solar wind/ionosphere interaction. In addition, it will utilize radar mapping techniques to study the surface.

First-generation physical map of the Culicoides variipennis (Diptera: Ceratopogonidae) genome.

PubMed

Nunamaker, R A; Brown, S E; McHolland, L E; Tabachnick, W J; Knudson, D L

1999-11-01

Recombinant cosmids labeled with biotin-11-dUTP or digoxigenin by nick translation were used as in situ hybridization probes to metaphase chromosomes of Culicoides variipennis (Coquillett). Paired fluorescent signals were detected on each arm of sister chromatids and were ordered along the 3 chromosomes. Thirty-three unique probes were mapped to the 3 chromosomes of C. variipennis (2n = 6): 7 to chromosome 1, 20 to chromosome 2, and 6 to chromosome 3. This work represents the first stage in generating a physical map of the genome of C. variipennis.

A Global Orientation Map in the Primary Visual Cortex (V1): Could a Self Organizing Model Reveal Its Hidden Bias?

PubMed Central

Philips, Ryan T.; Chakravarthy, V. Srinivasa

2017-01-01

A remarkable accomplishment of self organizing models is their ability to simulate the development of feature maps in the cortex. Additionally, these models have been trained to tease out the differential causes of multiple feature maps, mapped on to the same output space. Recently, a Laterally Interconnected Synergetically Self Organizing Map (LISSOM) model has been used to simulate the mapping of eccentricity and meridional angle onto orthogonal axes in the primary visual cortex (V1). This model is further probed to simulate the development of the radial bias in V1, using a training set that consists of both radial (rectangular bars of random size and orientation) as well as non-radial stimuli. The radial bias describes the preference of the visual system toward orientations that match the angular position (meridional angle) of that orientation with respect to the point of fixation. Recent fMRI results have shown that there exists a coarse scale orientation map in V1, which resembles the meridional angle map, thereby providing a plausible neural basis for the radial bias. The LISSOM model, trained for the development of the retinotopic map, on probing for orientation preference, exhibits a coarse scale orientation map, consistent with these experimental results, quantified using the circular cross correlation (rc). The rc between the orientation map developed on probing with a thin annular ring containing sinusoidal gratings with a spatial frequency of 0.5 cycles per degree (cpd) and the corresponding meridional map for the same annular ring, has a value of 0.8894. The results also suggest that the radial bias goes beyond the current understanding of a node to node correlation between the two maps. PMID:28111542

A Global Orientation Map in the Primary Visual Cortex (V1): Could a Self Organizing Model Reveal Its Hidden Bias?

PubMed

Philips, Ryan T; Chakravarthy, V Srinivasa

2016-01-01

A remarkable accomplishment of self organizing models is their ability to simulate the development of feature maps in the cortex. Additionally, these models have been trained to tease out the differential causes of multiple feature maps, mapped on to the same output space. Recently, a Laterally Interconnected Synergetically Self Organizing Map (LISSOM) model has been used to simulate the mapping of eccentricity and meridional angle onto orthogonal axes in the primary visual cortex (V1). This model is further probed to simulate the development of the radial bias in V1, using a training set that consists of both radial (rectangular bars of random size and orientation) as well as non-radial stimuli. The radial bias describes the preference of the visual system toward orientations that match the angular position (meridional angle) of that orientation with respect to the point of fixation. Recent fMRI results have shown that there exists a coarse scale orientation map in V1, which resembles the meridional angle map, thereby providing a plausible neural basis for the radial bias. The LISSOM model, trained for the development of the retinotopic map, on probing for orientation preference, exhibits a coarse scale orientation map, consistent with these experimental results, quantified using the circular cross correlation ( r c ). The r c between the orientation map developed on probing with a thin annular ring containing sinusoidal gratings with a spatial frequency of 0.5 cycles per degree (cpd) and the corresponding meridional map for the same annular ring, has a value of 0.8894. The results also suggest that the radial bias goes beyond the current understanding of a node to node correlation between the two maps.

Application of Monte-Carlo Analyses for the Microwave Anisotropy Probe (MAP) Mission

NASA Technical Reports Server (NTRS)

Mesarch, Michael A.; Rohrbaugh, David; Schiff, Conrad; Bauer, Frank H. (Technical Monitor)

2001-01-01

The Microwave Anisotropy Probe (MAP) is the third launch in the National Aeronautics and Space Administration's (NASA's) a Medium Class Explorers (MIDEX) program. MAP will measure, in greater detail, the cosmic microwave background radiation from an orbit about the Sun-Earth-Moon L2 Lagrangian point. Maneuvers will be required to transition MAP from it's initial highly elliptical orbit to a lunar encounter which will provide the remaining energy to send MAP out to a lissajous orbit about L2. Monte-Carlo analysis methods were used to evaluate the potential maneuver error sources and determine their effect of the fixed MAP propellant budget. This paper will discuss the results of the analyses on three separate phases of the MAP mission - recovering from launch vehicle errors, responding to phasing loop maneuver errors, and evaluating the effect of maneuver execution errors and orbit determination errors on stationkeeping maneuvers at L2.

Quantitatively Mapping Cellular Viscosity with Detailed Organelle Information via a Designed PET Fluorescent Probe

PubMed Central

Liu, Tianyu; Liu, Xiaogang; Spring, David R.; Qian, Xuhong; Cui, Jingnan; Xu, Zhaochao

2014-01-01

Viscosity is a fundamental physical parameter that influences diffusion in biological processes. The distribution of intracellular viscosity is highly heterogeneous, and it is challenging to obtain a full map of cellular viscosity with detailed organelle information. In this work, we report 1 as the first fluorescent viscosity probe which is able to quantitatively map cellular viscosity with detailed organelle information based on the PET mechanism. This probe exhibited a significant ratiometric fluorescence intensity enhancement as solvent viscosity increases. The emission intensity increase was attributed to combined effects of the inhibition of PET due to restricted conformational access (favorable for FRET, but not for PET), and the decreased PET efficiency caused by viscosity-dependent twisted intramolecular charge transfer (TICT). A full map of subcellular viscosity was successfully constructed via fluorescent ratiometric detection and fluorescence lifetime imaging; it was found that lysosomal regions in a cell possess the highest viscosity, followed by mitochondrial regions. PMID:24957323

KSC-01pp1058

NASA Image and Video Library

2001-05-31

At the gantry on Complex 17-A, Cape Canaveral Air Force Station, the fairing for the Microwave Anisotropy Probe (MAP) spacecraft is raised for its lift to the White Room. There it will wait for the arrival of the spacecraft. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1060

NASA Image and Video Library

2001-05-31

KENNEDY SPACE CENTER, FLA. -- At the gantry on Complex 17-A, Cape Canaveral Air Force Station, the fairing for the Microwave Anisotropy Probe (MAP) spacecraft arrives in the White Room. There it will wait for the arrival of the spacecraft. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

Cross-correlating 2D and 3D galaxy surveys

DOE PAGES

Passaglia, Samuel; Manzotti, Alessandro; Dodelson, Scott

2017-06-08

Galaxy surveys probe both structure formation and the expansion rate, making them promising avenues for understanding the dark universe. Photometric surveys accurately map the 2D distribution of galaxy positions and shapes in a given redshift range, while spectroscopic surveys provide sparser 3D maps of the galaxy distribution. We present a way to analyse overlapping 2D and 3D maps jointly and without loss of information. We represent 3D maps using spherical Fourier-Bessel (sFB) modes, which preserve radial coverage while accounting for the spherical sky geometry, and we decompose 2D maps in a spherical harmonic basis. In these bases, a simple expression exists for the cross-correlation of the two fields. One very powerful application is the ability to simultaneously constrain the redshift distribution of the photometric sample, the sample biases, and cosmological parameters. We use our framework to show that combined analysis of DESI and LSST can improve cosmological constraints by factors ofmore » $${\\sim}1.2$$ to $${\\sim}1.8$$ on the region where they overlap relative to identically sized disjoint regions. We also show that in the overlap of DES and SDSS-III in Stripe 82, cross-correlating improves photo-$z$ parameter constraints by factors of $${\\sim}2$$ to $${\\sim}12$$ over internal photo-$z$ reconstructions.« less

Cross-correlating 2D and 3D galaxy surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Passaglia, Samuel; Manzotti, Alessandro; Dodelson, Scott

Galaxy surveys probe both structure formation and the expansion rate, making them promising avenues for understanding the dark universe. Photometric surveys accurately map the 2D distribution of galaxy positions and shapes in a given redshift range, while spectroscopic surveys provide sparser 3D maps of the galaxy distribution. We present a way to analyse overlapping 2D and 3D maps jointly and without loss of information. We represent 3D maps using spherical Fourier-Bessel (sFB) modes, which preserve radial coverage while accounting for the spherical sky geometry, and we decompose 2D maps in a spherical harmonic basis. In these bases, a simple expression exists for the cross-correlation of the two fields. One very powerful application is the ability to simultaneously constrain the redshift distribution of the photometric sample, the sample biases, and cosmological parameters. We use our framework to show that combined analysis of DESI and LSST can improve cosmological constraints by factors ofmore » $${\\sim}1.2$$ to $${\\sim}1.8$$ on the region where they overlap relative to identically sized disjoint regions. We also show that in the overlap of DES and SDSS-III in Stripe 82, cross-correlating improves photo-$z$ parameter constraints by factors of $${\\sim}2$$ to $${\\sim}12$$ over internal photo-$z$ reconstructions.« less

Flow Field Mapping of Carbon Dioxide Nozzle Expansion into Vacuum

DTIC Science & Technology

1985-07-01

probe bow shock are adequately defined by the Rankine-Hugoniot relations. For flows that meet these requirements, the pitot probe is a simple and...nozzle lip [i.e. radial location 2.0 in. (5 cm)] could be attributable to the interaction of the probe bow shock with the nozzle lip. The similarity in...microbalance, free-molecule heat-transfer probe , free- m !olecule pressure probe , and a rotary pitot probe were used in this evaluation. (Cant)

A dual-modal magnetic nanoparticle probe for preoperative and intraoperative mapping of sentinel lymph nodes by magnetic resonance and near infrared fluorescence imaging

PubMed Central

Zhou, Zhengyang; Chen, Hongwei; Lipowska, Malgorzata; Wang, Liya; Yu, Qiqi; Yang, Xiaofeng; Tiwari, Diana; Yang, Lily; Mao, Hui

2016-01-01

The ability to reliably detect sentinel lymph nodes for sentinel lymph node biopsy and lymphadenectomy is important in clinical management of patients with metastatic cancers. However, the traditional sentinel lymph node mapping with visible dyes is limited by the penetration depth of light and fast clearance of the dyes. On the other hand, sentinel lymph node mapping with radionucleotide technique has intrinsically low spatial resolution and does not provide anatomic details in the sentinel lymph node mapping procedure. This work reports the development of a dual modality imaging probe with magnetic resonance and near infrared imaging capabilities for sentinel lymph node mapping using magnetic iron oxide nanoparticles (10 nm core size) conjugated with a near infrared molecule with emission at 830 nm. Accumulation of magnetic iron oxide nanoparticles in sentinel lymph nodes leads to strong T2 weighted magnetic resonance imaging contrast that can be potentially used for preoperative localization of sentinel lymph nodes, while conjugated near infrared molecules provide optical imaging tracking of lymph nodes with a high signal to background ratio. The new magnetic nanoparticle based dual imaging probe exhibits a significant longer lymph node retention time. Near infrared signals from nanoparticle conjugated near infrared dyes last up to 60 min in sentinel lymph node compared to that of 25 min for the free near infrared dyes in a mouse model. Furthermore, axillary lymph nodes, in addition to sentinel lymph nodes, can be also visualized with this probe, given its slow clearance and sufficient sensitivity. Therefore, this new dual modality imaging probe with the tissue penetration and sensitive detection of sentinel lymph nodes can be applied for preoperative survey of lymph nodes with magnetic resonance imaging and allows intraoperative sentinel lymph node mapping using near infrared optical devices. PMID:23812946

New developments in ground probing radar for Earth resource mapping and planetology

NASA Astrophysics Data System (ADS)

Cattermole, P. J.; Junkin, G.; Finkelstein, M. I.; Kingsley, S. P.

1992-07-01

Ground probing radar is a well established technique for locating buried objects and has found application in resource mapping. The development of this technology for the Mars exploration programme has lead to lightweight systems with potential applications for investigating shallow geological structures on Earth, Mars and Venus. Recent advances in ground probing radar technology for planetary exploration include the development of single-antenna systems with improved beam focussing into the ground and a move to lower frequencies which considerably extends the depth penetration in dry ground. These systems are designed for mobility and could form the basis of autonomous mapping systems for terrestrial exploration. Such systems would be particularly valuable for water resource surveying in arid and semi-arid regions, where there is a need to have lightweight instrumentation that can be moved into sometimes inhospitable terrain.

A new intracavitary probe for detecting the site of origin of ectopic ventricular beats during one cardiac cycle.

PubMed

Taccardi, B; Arisi, G; Macchi, E; Baruffi, S; Spaggiari, S

1987-01-01

An olive-shaped probe (25 X 12 mm) with 41 evenly distributed recording electrodes on its surface was introduced into the left ventricles of seven open-chest dogs via the left atrium. In two other dogs a cylindrical probe (40 X 3 mm) was used. Electrical stimuli were delivered at 66 endocardial, midwall, or epicardial sites in the left and right ventricular walls and the septum. Mechanical stimuli were also applied at various epicardial sites. On-line mapping of equipotential contour lines on the surface of the probe invariably revealed a clear-cut potential minimum on the electrode that faced the pacing site. Time of appearance of potential minimum was 3 to 5 msec after endocardial stimuli, 10 to 25 msec for midwall and epicardial pacing, and 30 msec or more for right ventricular stimulation. Simultaneous stimulation at two sites 1.2 cm apart gave rise to two separate minima on the maps. "Pseudoisochrones" derived from electrograms recorded by the new probe were slightly less accurate in indicating the site of origin of extrasystoles. We conclude that equipotential and "isochrone" contour maps recorded from an array of semidirect electrodes, regularly distributed on the surface of an intraventricular probe, provide information on the site of origin (location and intramural depth) of ectopic paced beats in a normal dog heart.

Using genic sequence capture in combination with a syntenic pseudo genome to map a deletion mutant in a wheat species.

PubMed

Gardiner, Laura-Jayne; Gawroński, Piotr; Olohan, Lisa; Schnurbusch, Thorsten; Hall, Neil; Hall, Anthony

2014-12-01

Mapping-by-sequencing analyses have largely required a complete reference sequence and employed whole genome re-sequencing. In species such as wheat, no finished genome reference sequence is available. Additionally, because of its large genome size (17 Gb), re-sequencing at sufficient depth of coverage is not practical. Here, we extend the utility of mapping by sequencing, developing a bespoke pipeline and algorithm to map an early-flowering locus in einkorn wheat (Triticum monococcum L.) that is closely related to the bread wheat genome A progenitor. We have developed a genomic enrichment approach using the gene-rich regions of hexaploid bread wheat to design a 110-Mbp NimbleGen SeqCap EZ in solution capture probe set, representing the majority of genes in wheat. Here, we use the capture probe set to enrich and sequence an F2 mapping population of the mutant. The mutant locus was identified in T. monococcum, which lacks a complete genome reference sequence, by mapping the enriched data set onto pseudo-chromosomes derived from the capture probe target sequence, with a long-range order of genes based on synteny of wheat with Brachypodium distachyon. Using this approach we are able to map the region and identify a set of deleted genes within the interval. © 2014 The Authors.The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

The Dynein Gene Family in Chlamydomonas Reinhardtii

PubMed Central

Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

1996-01-01

To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

Mapping the CMB with the Wilkinson Microwave Anisotropy Probe

NASA Technical Reports Server (NTRS)

Hinshaw, Gary

2007-01-01

The data from the Wilkinson Microwave Anisotropy Probe (WMAP) satellite provide detailed full-sky maps of the cosmic microwave background temperature anisotropy and new full-sky maps of the polarization. Together, the data provide a wealth of cosmological information, including the age of the universe, the epoch when the first stars formed, and the overall composition of baryonic matter, dark matter, and dark energy. The results also provide constraints on the period of inflationary expansion in the very first moments of time. These and other aspects of the mission results will be discussed and commented on.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Go Huygens!

NASA Image and Video Library

2005-01-11

This map illustrates the planned imaging coverage for the Descent Imager/Spectral Radiometer, onboard the European Space Agency's Huygens probe during the probe's descent toward Titan's surface on Jan. 14, 2005. The Descent Imager/Spectral Radiometer is one of two NASA instruments on the probe. The colored lines delineate regions that will be imaged at different resolutions as the probe descends. On each map, the site where Huygens is predicted to land is marked with a yellow dot. This area is in a boundary between dark and bright regions. This map was made from the images taken by the Cassini spacecraft cameras on Oct. 26, 2004, at image scales of 4 to 6 kilometers (2.5 to 3.7 miles) per pixel. The images were obtained using a narrow band filter centered at 938 nanometers -- a near-infrared wavelength (invisible to the human eye) at which light can penetrate Titan's atmosphere to reach the surface and return through the atmosphere to be detected by the camera. The images have been processed to enhance surface details. Only brightness variations on Titan's surface are seen; the illumination is such that there is no shading due to topographic variations. For about two hours, the probe will fall by parachute from an altitude of 160 kilometers (99 miles) to Titan's surface. During the descent the camera on the probe and five other science instruments will send data about the moon's atmosphere and surface back to the Cassini spacecraft for relay to Earth. The Descent Imager/Spectral Radiometer will take pictures as the probe slowly spins, and some these will be made into panoramic views of Titan's surface. This map shows the planned coverage by the medium- and high-resolution. PIA06173 shows expected coverage by the Descent Imager/Spectral Radiometer side-looking imager and two downward-looking imagers - one providing medium-resolution and the other high-resolution coverage. http://photojournal.jpl.nasa.gov/catalog/PIA06173

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

PubMed

Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

2010-06-18

The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

Genetics of Sputum Gene Expression in Chronic Obstructive Pulmonary Disease

PubMed Central

Qiu, Weiliang; Cho, Michael H.; Riley, John H.; Anderson, Wayne H.; Singh, Dave; Bakke, Per; Gulsvik, Amund; Litonjua, Augusto A.; Lomas, David A.; Crapo, James D.; Beaty, Terri H.; Celli, Bartolome R.; Rennard, Stephen; Tal-Singer, Ruth; Fox, Steven M.; Silverman, Edwin K.; Hersh, Craig P.

2011-01-01

Previous expression quantitative trait loci (eQTL) studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD) patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP) data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs). The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS) dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5), the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD) bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus. PMID:21949713

Real-Time Vision-Based Stiffness Mapping †

PubMed Central

Althoefer, Kaspar; Asama, Hajime

2018-01-01

This paper presents new findings concerning a hand-held stiffness probe for the medical diagnosis of abnormalities during palpation of soft-tissue. Palpation is recognized by the medical community as an essential and low-cost method to detect and diagnose disease in soft-tissue. However, differences are often subtle and clinicians need to train for many years before they can conduct a reliable diagnosis. The probe presented here fills this gap providing a means to easily obtain stiffness values of soft tissue during a palpation procedure. Our stiffness sensor is equipped with a multi degree of freedom (DoF) Aurora magnetic tracker, allowing us to track and record the 3D position of the probe whilst examining a tissue area, and generate a 3D stiffness map in real-time. The stiffness probe was integrated in a robotic arm and tested in an artificial environment representing a good model of soft tissue organs; the results show that the sensor can accurately measure and map the stiffness of a silicon phantom embedded with areas of varying stiffness. PMID:29701704

NHS-Esters As Versatile Reactivity-Based Probes for Mapping Proteome-Wide Ligandable Hotspots.

PubMed

Ward, Carl C; Kleinman, Jordan I; Nomura, Daniel K

2017-06-16

Most of the proteome is considered undruggable, oftentimes hindering translational efforts for drug discovery. Identifying previously unknown druggable hotspots in proteins would enable strategies for pharmacologically interrogating these sites with small molecules. Activity-based protein profiling (ABPP) has arisen as a powerful chemoproteomic strategy that uses reactivity-based chemical probes to map reactive, functional, and ligandable hotspots in complex proteomes, which has enabled inhibitor discovery against various therapeutic protein targets. Here, we report an alkyne-functionalized N-hydroxysuccinimide-ester (NHS-ester) as a versatile reactivity-based probe for mapping the reactivity of a wide range of nucleophilic ligandable hotspots, including lysines, serines, threonines, and tyrosines, encompassing active sites, allosteric sites, post-translational modification sites, protein interaction sites, and previously uncharacterized potential binding sites. Surprisingly, we also show that fragment-based NHS-ester ligands can be made to confer selectivity for specific lysine hotspots on specific targets including Dpyd, Aldh2, and Gstt1. We thus put forth NHS-esters as promising reactivity-based probes and chemical scaffolds for covalent ligand discovery.

Dimensionality of Data Matrices with Applications to Gene Expression Profiles

ERIC Educational Resources Information Center

Feng, Xingdong

2009-01-01

Probe-level microarray data are usually stored in matrices. Take a given probe set (gene), for example, each row of the matrix corresponds to an array, and each column corresponds to a probe. Often, people summarize each array by the gene expression level. Is one number sufficient to summarize a whole probe set for a specific gene in an array?…

Atom probe trajectory mapping using experimental tip shape measurements.

PubMed

Haley, D; Petersen, T; Ringer, S P; Smith, G D W

2011-11-01

Atom probe tomography is an accurate analytical and imaging technique which can reconstruct the complex structure and composition of a specimen in three dimensions. Despite providing locally high spatial resolution, atom probe tomography suffers from global distortions due to a complex projection function between the specimen and detector which is different for each experiment and can change during a single run. To aid characterization of this projection function, this work demonstrates a method for the reverse projection of ions from an arbitrary projection surface in 3D space back to an atom probe tomography specimen surface. Experimental data from transmission electron microscopy tilt tomography are combined with point cloud surface reconstruction algorithms and finite element modelling to generate a mapping back to the original tip surface in a physically and experimentally motivated manner. As a case study, aluminium tips are imaged using transmission electron microscopy before and after atom probe tomography, and the specimen profiles used as input in surface reconstruction methods. This reconstruction method is a general procedure that can be used to generate mappings between a selected surface and a known tip shape using numerical solutions to the electrostatic equation, with quantitative solutions to the projection problem readily achievable in tens of minutes on a contemporary workstation. © 2011 The Authors Journal of Microscopy © 2011 Royal Microscopical Society.

Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

NASA Astrophysics Data System (ADS)

van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

1992-09-01

The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

KSC-01pp1038

NASA Image and Video Library

2001-05-29

KENNEDY SPACE CENTER, FLA. -- On Launch Complex 17-B, Cape Canaveral Air Force Station, the second stage of a Boeing Delta 7425-10 rocket is lifted into position as preparations to launch NASA's Microwave Anisotropy Probe (MAP) on June 30 continue. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission.; The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1240

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- Wrapped in billows of smoke and steam, the Boeing Delta II rocket lifts off Launch Complex 17-A, Cape Canaveral Air Force Station, carrying the Microwave Anisotropy Probe (MAP) spacecraft. The successful launch occurred at 3:46:46 p.m. EDT. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1036

NASA Image and Video Library

2001-05-29

On Launch Complex 17-B, Cape Canaveral Air Force Station, the second stage of a Boeing Delta 7425-10 rocket is lifted into position as preparations to launch NASA's Microwave Anisotropy Probe (MAP) on June 30 continue. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission.; The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1037

NASA Image and Video Library

2001-05-29

On Launch Complex 17-B, Cape Canaveral Air Force Station, the second stage of a Boeing Delta 7425-10 rocket is lifted into position as preparations to launch NASA's Microwave Anisotropy Probe (MAP) on June 30 continue. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission.; The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

PubMed Central

2010-01-01

Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

Pheno2Geno - High-throughput generation of genetic markers and maps from molecular phenotypes for crosses between inbred strains.

PubMed

Zych, Konrad; Li, Yang; van der Velde, Joeri K; Joosen, Ronny V L; Ligterink, Wilco; Jansen, Ritsert C; Arends, Danny

2015-02-19

Genetic markers and maps are instrumental in quantitative trait locus (QTL) mapping in segregating populations. The resolution of QTL localization depends on the number of informative recombinations in the population and how well they are tagged by markers. Larger populations and denser marker maps are better for detecting and locating QTLs. Marker maps that are initially too sparse can be saturated or derived de novo from high-throughput omics data, (e.g. gene expression, protein or metabolite abundance). If these molecular phenotypes are affected by genetic variation due to a major QTL they will show a clear multimodal distribution. Using this information, phenotypes can be converted into genetic markers. The Pheno2Geno tool uses mixture modeling to select phenotypes and transform them into genetic markers suitable for construction and/or saturation of a genetic map. Pheno2Geno excludes candidate genetic markers that show evidence for multiple possibly epistatically interacting QTL and/or interaction with the environment, in order to provide a set of robust markers for follow-up QTL mapping. We demonstrate the use of Pheno2Geno on gene expression data of 370,000 probes in 148 A. thaliana recombinant inbred lines. Pheno2Geno is able to saturate the existing genetic map, decreasing the average distance between markers from 7.1 cM to 0.89 cM, close to the theoretical limit of 0.68 cM (with 148 individuals we expect a recombination every 100/148=0.68 cM); this pinpointed almost all of the informative recombinations in the population. The Pheno2Geno package makes use of genome-wide molecular profiling and provides a tool for high-throughput de novo map construction and saturation of existing genetic maps. Processing of the showcase dataset takes less than 30 minutes on an average desktop PC. Pheno2Geno improves QTL mapping results at no additional laboratory cost and with minimum computational effort. Its results are formatted for direct use in R/qtl, the leading R package for QTL studies. Pheno2Geno is freely available on CRAN under "GNU GPL v3". The Pheno2Geno package as well as the tutorial can also be found at: http://pheno2geno.nl .

Mapping cavitation activity around dental ultrasonic tips.

PubMed

Walmsley, A Damien; Lea, Simon C; Felver, Bernhard; King, David C; Price, Gareth J

2013-05-01

Cavitation arising within the water around the oscillating ultrasonic scaler tip is an area that may lead to advances in enhancing biofilm removal. The aim of this study is to map the occurrence of cavitation around scaler tips under loaded conditions. Two designs of piezoelectric ultrasonic scaling probes were evaluated with a scanning laser vibrometer and luminol dosimetric system under loaded (100 g/200 g) and unloaded conditions. Loads were applied to the probe tips via teeth mounted in a load-measuring apparatus. There was a positive correlation between probe displacement amplitude and cavitation production for ultrasonic probes. The position of cavitation at the tip of each probe was greater under loaded conditions than unloaded and for the longer P probe towards the tip. Whilst increasing vibration displacement amplitude of ultrasonic scalers increases the occurrence of cavitation, factors such as the length of the probe influence the amount of cavitation activity generated. The application of load affects the production of cavitation at the most clinically relevant area-the tip. Loading and the design of ultrasonic scalers lead to maximising the occurrence of the cavitation at the tip and enhance the cleaning efficiency of the scaler.

Identifier mapping performance for integrating transcriptomics and proteomics experimental results

PubMed Central

2011-01-01

Background Studies integrating transcriptomic data with proteomic data can illuminate the proteome more clearly than either separately. Integromic studies can deepen understanding of the dynamic complex regulatory relationship between the transcriptome and the proteome. Integrating these data dictates a reliable mapping between the identifier nomenclature resultant from the two high-throughput platforms. However, this kind of analysis is well known to be hampered by lack of standardization of identifier nomenclature among proteins, genes, and microarray probe sets. Therefore data integration may also play a role in critiquing the fallible gene identifications that both platforms emit. Results We compared three freely available internet-based identifier mapping resources for mapping UniProt accessions (ACCs) to Affymetrix probesets identifications (IDs): DAVID, EnVision, and NetAffx. Liquid chromatography-tandem mass spectrometry analyses of 91 endometrial cancer and 7 noncancer samples generated 11,879 distinct ACCs. For each ACC, we compared the retrieval sets of probeset IDs from each mapping resource. We confirmed a high level of discrepancy among the mapping resources. On the same samples, mRNA expression was available. Therefore, to evaluate the quality of each ACC-to-probeset match, we calculated proteome-transcriptome correlations, and compared the resources presuming that better mapping of identifiers should generate a higher proportion of mapped pairs with strong inter-platform correlations. A mixture model for the correlations fitted well and supported regression analysis, providing a window into the performance of the mapping resources. The resources have added and dropped matches over two years, but their overall performance has not changed. Conclusions The methods presented here serve to achieve concrete context-specific insight, to support well-informed decisions in choosing an ID mapping strategy for "omic" data merging. PMID:21619611

In vivo fluorescence lifetime tomography of a FRET probe expressed in mouse

PubMed Central

McGinty, James; Stuckey, Daniel W.; Soloviev, Vadim Y.; Laine, Romain; Wylezinska-Arridge, Marzena; Wells, Dominic J.; Arridge, Simon R.; French, Paul M. W.; Hajnal, Joseph V.; Sardini, Alessandro

2011-01-01

Förster resonance energy transfer (FRET) is a powerful biological tool for reading out cell signaling processes. In vivo use of FRET is challenging because of the scattering properties of bulk tissue. By combining diffuse fluorescence tomography with fluorescence lifetime imaging (FLIM), implemented using wide-field time-gated detection of fluorescence excited by ultrashort laser pulses in a tomographic imaging system and applying inverse scattering algorithms, we can reconstruct the three dimensional spatial localization of fluorescence quantum efficiency and lifetime. We demonstrate in vivo spatial mapping of FRET between genetically expressed fluorescent proteins in live mice read out using FLIM. Following transfection by electroporation, mouse hind leg muscles were imaged in vivo and the emission of free donor (eGFP) in the presence of free acceptor (mCherry) could be clearly distinguished from the fluorescence of the donor when directly linked to the acceptor in a tandem (eGFP-mCherry) FRET construct. PMID:21750768

KSC-01pp1198

NASA Image and Video Library

2001-06-26

KENNEDY SPACE CENTER, Fla. -- The fairing closes around the Microwave Anisotropy Probe (MAP) spacecraft at Launch Complex 17-B, Cape Canaveral Air Force Station. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft

KSC-01pp1195

NASA Image and Video Library

2001-06-26

KENNEDY SPACE CENTER, Fla. -- Workers at Launch Complex 17-B, Cape Canaveral Air Force Station, watch as fairing moves into position around the Microwave Anisotropy Probe (MAP) spacecraft. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft

KSC01pd1197

NASA Image and Video Library

2001-06-26

KENNEDY SPACE CENTER, Fla. -- Workers at Launch Complex 17-B, Cape Canaveral Air Force Station, oversee the fairing installation on the Microwave Anisotropy Probe (MAP) spacecraft. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft

KSC-01pp1194

NASA Image and Video Library

2001-06-26

KENNEDY SPACE CENTER, Fla. -- At Launch Complex 17-B, Cape Canaveral Air Force Station, the fairing is moved into position around the Microwave Anisotropy Probe (MAP) spacecraft. MAP is scheduled for launch on June 30 aboard a Boeing Delta II rocket. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft

A high-resolution cat radiation hybrid and integrated FISH mapping resource for phylogenomic studies across Felidae.

PubMed

Davis, Brian W; Raudsepp, Terje; Pearks Wilkerson, Alison J; Agarwala, Richa; Schäffer, Alejandro A; Houck, Marlys; Chowdhary, Bhanu P; Murphy, William J

2009-04-01

We describe the construction of a high-resolution radiation hybrid (RH) map of the domestic cat genome, which includes 2662 markers, translating to an estimated average intermarker distance of 939 kilobases (kb). Targeted marker selection utilized the recent feline 1.9x genome assembly, concentrating on regions of low marker density on feline autosomes and the X chromosome, in addition to regions flanking interspecies chromosomal breakpoints. Average gap (breakpoint) size between cat-human ordered conserved segments is less than 900 kb. The map was used for a fine-scale comparison of conserved syntenic blocks with the human and canine genomes. Corroborative fluorescence in situ hybridization (FISH) data were generated using 129 domestic cat BAC clones as probes, providing independent confirmation of the long-range correctness of the map. Cross-species hybridization of BAC probes on divergent felids from the genera Profelis (serval) and Panthera (snow leopard) provides further evidence for karyotypic conservation within felids, and demonstrates the utility of such probes for future studies of chromosome evolution within the cat family and in related carnivores. The integrated map constitutes a comprehensive framework for identifying genes controlling feline phenotypes of interest, and to aid in assembly of a higher coverage feline genome sequence.

A High-Resolution Cat Radiation Hybrid and Integrated FISH Mapping Resource for Phylogenomic Studies across Felidae

PubMed Central

Davis, Brian W.; Raudsepp, Terje; Wilkerson, Alison J. Pearks; Agarwala, Richa; Schäffer, Alejandro A.; Houck, Marlys; Ryder, Oliver A.; Chowdhdary, Bhanu P.; Murphy, William J.

2008-01-01

We describe the construction of a high-resolution radiation hybrid (RH) map of the domestic cat genome, which includes 2,662 markers, translating to an estimated average intermarker distance of 939 kilobases (Kb). Targeted marker selection utilized the recent feline 1.9x genome assembly, concentrating on regions of low marker density on feline autosomes and the X chromosome, in addition to regions flanking interspecies chromosomal breakpoints. Average gap (breakpoint) size between cat-human ordered conserved segments is less than 900 Kb. The map was used for a fine-scale comparison of conserved syntenic blocks with the human and canine genomes. Corroborative fluorescence in situ hybridization (FISH) data were generated using 129 domestic cat BAC-clones as probes, providing independent confirmation of the long-range correctness of the map. Cross-species hybridization of BAC probes on divergent felids from the genera Profelis (serval) and Panthera (snow leopard) provides further evidence for karyotypic conservation within felids, and demonstrates the utility of such probes for future studies of chromosome evolution within the cat family and in related carnivores. The integrated map constitutes a comprehensive framework for identifying genes controlling feline phenotypes of interest, and to aid in assembly of a higher coverage feline genome sequence. PMID:18951970

Correlation of physical and genetic maps of human chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-01-01

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Correlation of physical and genetic maps of human chromosome 16. Annual progress report, October 1, 1990--July 31, 1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-12-31

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Sprayable enzyme-activatable fluorescent probes: kinetic mapping using dynamic fluorescence imaging can help detecting tiny cancer foci (Conference Presentation)

NASA Astrophysics Data System (ADS)

Kobayashi, Hisataka

2017-02-01

Optical fluorescence-guided imaging is increasingly used to guide surgery and endoscopic procedures. Sprayable enzyme-activatable probes are particularly useful because of high target-to-background ratios that increase sensitivity for tiny cancer foci. However, green fluorescent activatable probes suffers from interference from autofluorescence found in biological tissue. Dynamic imaging followed by the kinetic analysis could be detected local enzyme activity and used to differentiate specific fluorescence arising from an activated probe in a tumor from autofluorescence in background tissues especially when low concentrations of the dye are applied to detect tiny cancer foci. Serial fluorescence imaging was performed using various concentrations of γ-glutamyl hydroxymethyl rhodamine green (gGlu-HMRG) which was sprayed on the peritoneal surface with tiny implants of SHIN3-dsRed ovarian cancer tumors. Temporal differences in signal between specific green fluorescence in cancer foci and non-specific autofluorescence in background tissue was measured and processed into three kinetic maps reflecting maximum fluorescence signal (MF), wash-in rate (WIR), and area under the curve (AUC), respectively. Especially at lower concentrations, kinetic maps derived from dynamic fluorescence imaging were clearly superior to unprocessed images for detection small cancer foci.

High-resolution measurements of the spatial and temporal evolution of megagauss magnetic fields created in intense short-pulse laser-plasma interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatterjee, Gourab, E-mail: gourab@tifr.res.in; Singh, Prashant Kumar; Adak, Amitava

A pump-probe polarimetric technique is demonstrated, which provides a complete, temporally and spatially resolved mapping of the megagauss magnetic fields generated in intense short-pulse laser-plasma interactions. A normally incident time-delayed probe pulse reflected from its critical surface undergoes a change in its ellipticity according to the magneto-optic Cotton-Mouton effect due to the azimuthal nature of the ambient self-generated megagauss magnetic fields. The temporal resolution of the magnetic field mapping is typically of the order of the pulsewidth, limited by the laser intensity contrast, whereas a spatial resolution of a few μm is achieved by this optical technique. High-harmonics of themore » probe can be employed to penetrate deeper into the plasma to even near-solid densities. The spatial and temporal evolution of the megagauss magnetic fields at the target front as well as at the target rear are presented. The μm-scale resolution of the magnetic field mapping provides valuable information on the filamentary instabilities at the target front, whereas probing the target rear mirrors the highly complex fast electron transport in intense laser-plasma interactions.« less

A Direct Method for Mapping the Center of Pressure Measured by an Insole Pressure Sensor System to the Shoe's Local Coordinate System.

PubMed

Weaver, Brian T; Braman, Jerrod E; Haut, Roger C

2016-06-01

A direct method to express the center of pressure (CoP) measured by an insole pressure sensor system (IPSS) into a known coordinate system measured by motion tracking equipment is presented. A custom probe was constructed with reflective markers to allow its tip to be precisely tracked with motion tracking equipment. This probe was utilized to activate individual sensors on an IPSS that was placed in a shoe fitted with reflective markers used to establish a local shoe coordinate system. When pressed onto the IPSS the location of the probe's tip was coincident with the CoP measured by the IPSS (IPSS-CoP). Two separate pushes (i.e., data points) were used to develop vectors in each respective coordinate system. Simple vector mathematics determined the rotational and translational components of the transformation matrix needed to express the IPSS-CoP into the local shoe coordinate system. Validation was performed by comparing IPSS-CoP with an embedded force plate measured CoP (FP-CoP) from data gathered during kinematic trials. Six male subjects stood on an embedded FP and performed anterior/posterior (AP) sway, internal rotation, and external rotation of the body relative to a firmly planted foot. The IPSS-CoP was highly correlated with the FP-CoP for all motions, root mean square errors (RMSRRs) were comparable to other research, and there were no statistical differences between the displacement of the IPSS-CoP and FP-CoP for both the AP and medial/lateral (ML) axes, respectively. The results demonstrated that this methodology could be utilized to determine the transformation variables need to express IPSS-CoP into a known coordinate system measured by motion tracking equipment and that these variables can be determined outside the laboratory anywhere motion tracking equipment is available.

3D "spectracoustic" system: a modular, tomographic, spectroscopic mapping imaging, non-invasive, diagnostic system for detection of small starting developing tumors like melanoma

NASA Astrophysics Data System (ADS)

Karagiannis, Georgios

2017-03-01

This work led to a new method named 3D spectracoustic tomographic mapping imaging. The current and the future work is related to the fabrication of a combined acoustic microscopy transducer and infrared illumination probe permitting the simultaneous acquisition of the spectroscopic and the tomographic information. This probe provides with the capability of high fidelity and precision registered information from the combined modalities named spectracoustic information.

Data Validation for Earth Probe-Total Ozone Mapping Spectrometer

NASA Technical Reports Server (NTRS)

Stanford, John L.

1995-01-01

This presentation represents the final report for the NASA grant project. The goal of this project was to provide scientific analysis to aid in validation fo data sets used in detection of long term global trends of total ozone. Ozone data from the Earth Probe Total Ozone Mapping Spectrometer instrument was compared for validation purposes with features in previous TOMS data. Atmospheric dynamic concepts were used in the analysis. The publications sponsored by the grant are listed along with abstracts.

Ultrasonic thickness measuring and imaging system and method

DOEpatents

Bylenok, Paul J.; Patmos, William M.; Wagner, Thomas A.; Martin, Francis H.

1992-08-04

An ultrasonic thickness measuring and imaging system uses an ultrasonic fsed beam probe for measuring thickness of an object, such as a wall of a tube, a computer for controlling movement of the probe in a scanning pattern within the tube and processing an analog signal produced by the probe which is proportional to the tube wall thickness in the scanning pattern, and a line scan recorder for producing a record of the tube wall thicknesses measured by the probe in the scanning pattern. The probe is moved in the scanning pattern to sequentially scan circumferentially the interior tube wall at spaced apart adjacent axial locations. The computer processes the analog signal by converting it to a digital signal and then quantifies the digital signal into a multiplicity of thickness points with each falling in one of a plurality of thickness ranges corresponding to one of a plurality of shades of grey. From the multiplicity of quantified thickness points, a line scan recorder connected to the computer generates a pictorial map of tube wall thicknesses with each quantified thickness point thus being obtained from a minute area, e.g. 0.010 inch by 0.010 inch, of tube wall and representing one pixel of the pictorial map. In the pictorial map of tube wall thicknesses, the pixels represent different wall thicknesses having different shades of grey.

Ultrasonic thickness measuring and imaging system and method

DOEpatents

Bylenok, Paul J.; Patmos, William M.; Wagner, Thomas A.; Martin, Francis H.

1992-01-01

An ultrasonic thickness measuring and imaging system uses an ultrasonic fsed beam probe for measuring thickness of an object, such as a wall of a tube, a computer for controlling movement of the probe in a scanning pattern within the tube and processing an analog signal produced by the probe which is proportional to the tube wall thickness in the scanning pattern, and a line scan recorder for producing a record of the tube wall thicknesses measured by the probe in the scanning pattern. The probe is moved in the scanning pattern to sequentially scan circumferentially the interior tube wall at spaced apart adjacent axial locations. The computer processes the analog signal by converting it to a digital signal and then quantifies the digital signal into a multiplicity of thickness points with each falling in one of a plurality of thickness ranges corresponding to one of a plurality of shades of grey. From the multiplicity of quantified thickness points, a line scan recorder connected to the computer generates a pictorial map of tube wall thicknesses with each quantified thickness point thus being obtained from a minute area, e.g. 0.010 inch by 0.010 inch, of tube wall and representing one pixel of the pictorial map. In the pictorial map of tube wall thicknesses, the pixels represent different wall thicknesses having different shades of grey.

Electron Tunneling, a Quantum Probe for the Quantum World of Nanotechnology

ERIC Educational Resources Information Center

Hipps, K. W.; Scudiero, L.

2005-01-01

A quantum-mechanical probe is essential to study the quantum world, which is provided by electron tunneling. A spectroscopic mapping to image the electron-transport pathways on a sub-molecular scale is used.

A Crosslinker Based on a Tethered Electrophile for Mapping Kinase-Substrate Networks

PubMed Central

Riel-Mehan, Megan M; Shokat, Kevan M

2014-01-01

SUMMARY Despite the continuing progress made towards mapping kinase signaling networks, there are still many phosphorylation events for which the responsible kinase has not yet been identified. We are interested in addressing this problem through forming covalent crosslinks between a peptide substrate and the corresponding phosphorylating kinase. Previously we reported a dialdehyde-based kinase binding probe capable of such a reaction with a peptide containing a cysteine substituted for the phosphorylatable ser/thr/tyr residue. Here, we examine the yield of a previously reported dialdehyde-based probe, and report that the dialdehyde based probes possesses a significant limitation in terms of crosslinked kinase-substrate product yield. To address this limitation, we develop a crosslinking scheme based on a kinase activity-based probe, and this new cross-linker provides an increase in efficiency and substrate specificity, including in the context of cell lysate. PMID:24746561

CEM-designer: design of custom expression microarrays in the post-ENCODE Era.

PubMed

Arnold, Christian; Externbrink, Fabian; Hackermüller, Jörg; Reiche, Kristin

2014-11-10

Microarrays are widely used in gene expression studies, and custom expression microarrays are popular to monitor expression changes of a customer-defined set of genes. However, the complexity of transcriptomes uncovered recently make custom expression microarray design a non-trivial task. Pervasive transcription and alternative processing of transcripts generate a wealth of interweaved transcripts that requires well-considered probe design strategies and is largely neglected in existing approaches. We developed the web server CEM-Designer that facilitates microarray platform independent design of custom expression microarrays for complex transcriptomes. CEM-Designer covers (i) the collection and generation of a set of unique target sequences from different sources and (ii) the selection of a set of sensitive and specific probes that optimally represents the target sequences. Probe design itself is left to third party software to ensure that probes meet provider-specific constraints. CEM-Designer is available at http://designpipeline.bioinf.uni-leipzig.de. Copyright © 2014 Elsevier B.V. All rights reserved.

Pump-probe Kelvin-probe force microscopy: Principle of operation and resolution limits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murawski, J.; Graupner, T.; Milde, P., E-mail: peter.milde@tu-dresden.de

Knowledge on surface potential dynamics is crucial for understanding the performance of modern-type nanoscale devices. We describe an electrical pump-probe approach in Kelvin-probe force microscopy that enables a quantitative measurement of dynamic surface potentials at nanosecond-time and nanometer-length scales. Also, we investigate the performance of pump-probe Kelvin-probe force microscopy with respect to the relevant experimental parameters. We exemplify a measurement on an organic field effect transistor that verifies the undisturbed functionality of our pump-probe approach in terms of simultaneous and quantitative mapping of topographic and electronic information at a high lateral and temporal resolution.

KSC-01pp1174

NASA Image and Video Library

2001-06-19

KENNEDY SPACE CENTER, Fla. -- At Launch Complex 17-B, Cape Canaveral Air Force Station, the canister is removed from the Microwave Anisotropy Probe (MAP). Launch of MAP via a Boeing Delta II rocket is scheduled for June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures

KSC01pd1176

NASA Image and Video Library

2001-06-19

KENNEDY SPACE CENTER, Fla. -- Workers at Launch Complex 17-B, Cape Canaveral Air Force Station, place protective covers around the Microwave Anisotropy Probe (MAP) spacecraft. Launch of MAP via a Boeing Delta II rocket is scheduled for June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures

A detailed transcript-level probe annotation reveals alternative splicing based microarray platform differences

PubMed Central

Lee, Joseph C; Stiles, David; Lu, Jun; Cam, Margaret C

2007-01-01

Background Microarrays are a popular tool used in experiments to measure gene expression levels. Improving the reproducibility of microarray results produced by different chips from various manufacturers is important to create comparable and combinable experimental results. Alternative splicing has been cited as a possible cause of differences in expression measurements across platforms, though no study to this point has been conducted to show its influence in cross-platform differences. Results Using probe sequence data, a new microarray probe/transcript annotation was created based on the AceView Aug05 release that allowed for the categorization of genes based on their expression measurements' susceptibility to alternative splicing differences across microarray platforms. Examining gene expression data from multiple platforms in light of the new categorization, genes unsusceptible to alternative splicing differences showed higher signal agreement than those genes most susceptible to alternative splicing differences. The analysis gave rise to a different probe-level visualization method that can highlight probe differences according to transcript specificity. Conclusion The results highlight the need for detailed probe annotation at the transcriptome level. The presence of alternative splicing within a given sample can affect gene expression measurements and is a contributing factor to overall technical differences across platforms. PMID:17708771

Electrical impedance map (EIM) for margin assessment during robot-assisted laparoscopic prostatectomy (RALP) using a microendoscopic probe

NASA Astrophysics Data System (ADS)

Mahara, Aditya; Khan, Shadab; Schned, Alan R.; Hyams, Elias S.; Halter, Ryan J.

2015-03-01

Positive surgical margins (PSMs) found following prostate cancer surgery are a significant risk factor for post-operative disease recurrence. Noxious adjuvant radiation and chemical-based therapies are typically offered to men with PSMs. Unfortunately, no real-time intraoperative technology is currently available to guide surgeons to regions of suspicion during the initial prostatectomy where immediate surgical excisions could be used to reduce the chance of PSMs. A microendoscopic electrical impedance sensing probe was developed with the intention of providing real-time feedback regarding margin status to surgeons during robot-assisted laparoscopic prostatectomy (RALP) procedures. A radially configured 17-electrode microendoscopic probe was designed, constructed, and initially evaluated through use of gelatin-based phantoms and an ex vivo human prostate specimen. Impedance measurements are recorded at 10 frequencies (10 kHz - 100 kHz) using a high-speed FPGA-based electrical impedance tomography (EIT) system. Tetrapolar impedances are recorded from a number of different electrode configurations strategically chosen to sense tissue in a pre-defined sector underlying the probe face. A circular electrical impedance map (EIM) with several color-coded pie-shaped sectors is created to represent the impedance values of the probed tissue. Gelatin phantom experiments show an obvious distinction in the impedance maps between high and low impedance regions. Similarly, the EIM generated from the ex vivo prostate case shows distinguishing features between cancerous and benign regions. Based on successful development of this probe and these promising initial results, EIMs of additional prostate specimens are being collected to further evaluate this approach for intraoperative surgical margin assessment during RALP procedures.

KSC-01pp1235

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- The morning sky is nearly clear over Launch Complex 17-A, Cape Canaveral Air Force Station, and the waiting Boeing/Delta II rocket. The Atlantic Ocean can be seen on the horizon. Topping the rocket is the payload, the Microwave Anisotropy Probe (MAP) spacecraft. Launch is scheduled at 3:46 p.m. EDT June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1236

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- The Delta II rocket, carrying the Microwave Anisotropy Probe (MAP) spacecraft, arcs through the cloud-washed blue sky while photographers try to capture the spectacle from the ground. The successful launch from Launch Complex 17-A, Cape Canaveral Air Force Station, occurred at 3:46:46 p.m. EDT. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC-01pp1239

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- Engineers in Hangar A&E, Cape Canaveral Air Force Station, wait to track the launch of the Boeing Delta II rocket carrying the Microwave Anisotropy Probe (MAP) spacecraft. The screens above the console show the rocket on the launch pad. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University. Launch is scheduled for 3:46 p.m. EDT

KSC-01pp1234

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- The Boeing Delta II rocket is poised for flight on Launch Complex 17-A, Cape Canaveral Air Force Station, after rollback of the Mobile Service Tower. Topping the rocket is the payload, the Microwave Anisotropy Probe (MAP) spacecraft. Launch is scheduled at 3:46 p.m. EDT June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

KSC01padig235

NASA Image and Video Library

2001-06-30

KENNEDY SPACE CENTER, Fla. -- The Boeing Delta II rocket is poised for flight on Launch Complex 17-A, Cape Canaveral Air Force Station, after rollback of the Mobile Service Tower (right). Topping the rocket is the payload, the Microwave Anisotropy Probe (MAP) spacecraft. Launch is scheduled at 3:46 p.m. EDT June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures. The MAP instrument will be continuously shaded from the Sun, Earth, and Moon by the spacecraft. The probe is a product of Goddard Space Flight Center in partnership with Princeton University

Homozygous deletions at 3p12 in breast and lung cancer.

PubMed

Sundaresan, V; Chung, G; Heppell-Parton, A; Xiong, J; Grundy, C; Roberts, I; James, L; Cahn, A; Bench, A; Douglas, J; Minna, J; Sekido, Y; Lerman, M; Latif, F; Bergh, J; Li, H; Lowe, N; Ogilvie, D; Rabbitts, P

1998-10-01

We have constructed a physical map of the region homozygously deleted in the U2020 cell line at 3p12, including the location of putative CpG islands. Adjacent to one of these islands, we have identified and cloned a new gene (DUTT1) and used probes from this gene to detect two other homozygous deletions occurring in lung and breast carcinomas: the smallest deletion is within the gene itself and would result in a truncated protein. The DUTT1 gene is a member of the neural cell adhesion molecule family, although its widespread expression suggests it plays a less specialized role compared to other members of the family.

Tactile mapping system: a novel imaging technology for surface topography and elasticity of tissues or organs.

PubMed

Oie, Tomonori; Suzuki, Hisato; Fukuda, Toru; Murayama, Yoshinobu; Omata, Sadao; Kanda, Keiichi; Nakayama, Yasuhide

2009-11-01

: We demonstrated that the tactile mapping system (TMS) has a high degree of spatial precision in the distribution mapping of surface elasticity of tissues or organs. : Samples used were a circumferential section of a small-caliber porcine artery (diameter: ∼3 mm) and an elasticity test pattern with a line and space configuration for the distribution mapping of elasticity, prepared by regional micropatterning of a 14-μm thick gelatin hydrogel coating on a polyurethane sheet. Surface topography and elasticity in normal saline were simultaneously investigated by TMS using a probe with a diameter of 5 or 12 μm, a spatial interval of 1 to 5 μm, and an indentation depth of 4 μm. : In the test pattern, a spatial resolution in TMS of <5 μm was acquired under water with a minimal probe diameter and spatial interval of the probe movement. TMS was used for the distribution mapping of surface elasticity in a flat, circumferential section (thickness: ∼0.5 mm) of a porcine artery, and the concentric layers of the vascular wall, including the collagen-rich and elastin-rich layers, could be clearly differentiated in terms of surface elasticity at the spatial resolution of <2 μm. : TMS is a simple and inexpensive technique for the distribution mapping of the surface elasticity in vascular tissues at the spatial resolution <2 μm. TMS has the ability to analyze a complex structure of the tissue samples under normal saline.

Identification of hypertension-related genes through an integrated genomic-transcriptomic approach.

PubMed

Yagil, Chana; Hubner, Norbert; Monti, Jan; Schulz, Herbert; Sapojnikov, Marina; Luft, Friedrich C; Ganten, Detlev; Yagil, Yoram

2005-04-01

In search for the genetic basis of hypertension, we applied an integrated genomic-transcriptomic approach to identify genes involved in the pathogenesis of hypertension in the Sabra rat model of salt-susceptibility. In the genomic arm of the project, we previously detected in male rats two salt-susceptibility QTLs on chromosome 1, SS1a (D1Mgh2-D1Mit11; span 43.1 cM) and SS1b (D1Mit11-D1Mit4; span 18 cM). In the transcriptomic arm, we studied differential gene expression in kidneys of SBH/y and SBN/y rats that had been fed regular diet or salt-loaded. We used the Affymetrix Rat Genome RAE230 GeneChip and probed >30,000 transcripts. The research algorithm called for an initial genome-wide screen for differentially expressed transcripts between the study groups. This step was followed by cluster analysis based on 2x2 ANOVA to identify transcripts that were of relevance specifically to salt-sensitivity and hypertension and to salt-resistance. The two arms of the project were integrated by identifying those differentially expressed transcripts that showed an allele-specific hypertensive effect on salt-loading and that mapped within the defined boundaries of the salt-susceptibility QTLs on chromosome 1. The differentially expressed transcripts were confirmed by RT-PCR. Of the 2933 genes annotated to rat chromosome 1, 1102 genes were identified within the boundaries of the two blood pressure QTLs. The microarray identified 2470 transcripts that were differentially expressed between the study groups. Cluster analysis identified genome-wide 192 genes that were relevant to salt-susceptibility and/or hypertension, 19 of which mapped to chromosome 1. Eight of these genes mapped within the boundaries of QTLs SS1a and SS1b. RT-PCR confirmed 7 genes, leaving TcTex1, Myadm, Lisch7, Axl-like, Fah, PRC1-like, and Serpinh1. None of these genes has been implicated in hypertension before. These genes become henceforth targets for our continuing search for the genetic basis of hypertension.

Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

PubMed

Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

2016-11-01

High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.

PubMed

Carabajal Paladino, Leonela Z; Nguyen, Petr; Síchová, Jindra; Marec, František

2014-01-01

We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms.

Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella

PubMed Central

2014-01-01

Background We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Results Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. Conclusions We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms. PMID:25471491

Electrical property heterogeneity at transparent conductive oxide/organic semiconductor interfaces: mapping contact ohmicity using conducting-tip atomic force microscopy.

PubMed

MacDonald, Gordon A; Veneman, P Alexander; Placencia, Diogenes; Armstrong, Neal R

2012-11-27

We demonstrate mapping of electrical properties of heterojunctions of a molecular semiconductor (copper phthalocyanine, CuPc) and a transparent conducting oxide (indium-tin oxide, ITO), on 20-500 nm length scales, using a conductive-probe atomic force microscopy technique, scanning current spectroscopy (SCS). SCS maps are generated for CuPc/ITO heterojunctions as a function of ITO activation procedures and modification with variable chain length alkyl-phosphonic acids (PAs). We correlate differences in small length scale electrical properties with the performance of organic photovoltaic cells (OPVs) based on CuPc/C(60) heterojunctions, built on these same ITO substrates. SCS maps the "ohmicity" of ITO/CuPc heterojunctions, creating arrays of spatially resolved current-voltage (J-V) curves. Each J-V curve is fit with modified Mott-Gurney expressions, mapping a fitted exponent (γ), where deviations from γ = 2.0 suggest nonohmic behavior. ITO/CuPc/C(60)/BCP/Al OPVs built on nonactivated ITO show mainly nonohmic SCS maps and dark J-V curves with increased series resistance (R(S)), lowered fill-factors (FF), and diminished device performance, especially near the open-circuit voltage. Nearly optimal behavior is seen for OPVs built on oxygen-plasma-treated ITO contacts, which showed SCS maps comparable to heterojunctions of CuPc on clean Au. For ITO electrodes modified with PAs there is a strong correlation between PA chain length and the degree of ohmicity and uniformity of electrical response in ITO/CuPc heterojunctions. ITO electrodes modified with 6-8 carbon alkyl-PAs show uniform and nearly ohmic SCS maps, coupled with acceptable CuPc/C(60)OPV performance. ITO modified with C14 and C18 alkyl-PAs shows dramatic decreases in FF, increases in R(S), and greatly enhanced recombination losses.

Simultaneous Nanoscale Surface Charge and Topographical Mapping.

PubMed

Perry, David; Al Botros, Rehab; Momotenko, Dmitry; Kinnear, Sophie L; Unwin, Patrick R

2015-07-28

Nanopipettes are playing an increasingly prominent role in nanoscience, for sizing, sequencing, delivery, detection, and mapping interfacial properties. Herein, the question of how to best resolve topography and surface charge effects when using a nanopipette as a probe for mapping in scanning ion conductance microscopy (SICM) is addressed. It is shown that, when a bias modulated (BM) SICM scheme is used, it is possible to map the topography faithfully, while also allowing surface charge to be estimated. This is achieved by applying zero net bias between the electrode in the SICM tip and the one in bulk solution for topographical mapping, with just a small harmonic perturbation of the potential to create an AC current for tip positioning. Then, a net bias is applied, whereupon the ion conductance current becomes sensitive to surface charge. Practically this is optimally implemented in a hopping-cyclic voltammetry mode where the probe is approached at zero net bias at a series of pixels across the surface to reach a defined separation, and then a triangular potential waveform is applied and the current response is recorded. Underpinned with theoretical analysis, including finite element modeling of the DC and AC components of the ionic current flowing through the nanopipette tip, the powerful capabilities of this approach are demonstrated with the probing of interfacial acid-base equilibria and high resolution imaging of surface charge heterogeneities, simultaneously with topography, on modified substrates.

Atomic resolution elemental mapping using energy-filtered imaging scanning transmission electron microscopy with chromatic aberration correction.

PubMed

Krause, F F; Rosenauer, A; Barthel, J; Mayer, J; Urban, K; Dunin-Borkowski, R E; Brown, H G; Forbes, B D; Allen, L J

2017-10-01

This paper addresses a novel approach to atomic resolution elemental mapping, demonstrating a method that produces elemental maps with a similar resolution to the established method of electron energy-loss spectroscopy in scanning transmission electron microscopy. Dubbed energy-filtered imaging scanning transmission electron microscopy (EFISTEM) this mode of imaging is, by the quantum mechanical principle of reciprocity, equivalent to tilting the probe in energy-filtered transmission electron microscopy (EFTEM) through a cone and incoherently averaging the results. In this paper we present a proof-of-principle EFISTEM experimental study on strontium titanate. The present approach, made possible by chromatic aberration correction, has the advantage that it provides elemental maps which are immune to spatial incoherence in the electron source, coherent aberrations in the probe-forming lens and probe jitter. The veracity of the experiment is supported by quantum mechanical image simulations, which provide an insight into the image-forming process. Elemental maps obtained in EFTEM suffer from the effect known as preservation of elastic contrast, which, for example, can lead to a given atomic species appearing to be in atomic columns where it is not to be found. EFISTEM very substantially reduces the preservation of elastic contrast and yields images which show stability of contrast with changing thickness. The experimental application is demonstrated in a proof-of-principle study on strontium titanate. Copyright © 2017 Elsevier B.V. All rights reserved.

Trajectory Design for the Microwave Anisotropy Probe (MAP)

NASA Technical Reports Server (NTRS)

Newman, Lauri Kraft; Rohrbaugh, David; Bauer, Frank H. (Technical Monitor)

2001-01-01

The Microwave Anisotropy, Probe (MAP) is a Medium Class Explorers (MIDEX) Mission produced in partnership between Goddard Space Flight Center (GSFC) and Princeton University. The goal of the MAP mission is to produce an accurate fill-sky, map of the cosmic microwave background temperature fluctuations (anisotropy). The mission orbit is a Lissajous orbit about the L(sub 2) Sun-Earth Lagrange point. The trajectory design for MAP is complex, having many requirements that must be met including shadow avoidance, sun angle constraints, Lissqjous size and shape characteristics, and limited Delta-V budget. In order to find a trajectory that met the design requirements for the entire 4-year mission lifetime goal, GSFC Flight Dynamics engineers performed many analyses, the results of which are presented herein. The paper discusses the preliminary trade-offs to establish a baseline trajectory, analysis to establish the nominal daily trajectory, and the launch window determination to widen the opportunity from instantaneous to several minutes for each launch date.

A hemicyanine based ratiometric fluorescence probe for mapping lysosomal pH during heat stroke in living cells.

PubMed

Wu, Luling; Wang, Yang; James, Tony D; Jia, Nengqin; Huang, Chusen

2018-05-29

Heat stroke is a lethal condition which can cause dysfunction in the central nervous system, multi-organ damage and even death. However, there is still limited knowledge of the detailed mechanism about the roles of lysosomes in heat stroke due to lack of effective tools. Herein, we introduce our previously developed hemicyanine with a large D-π-A structure as the key fluorophore to develop a new fluorescent probe (CPY) for ratiometric mapping of lysosomal pH changes in live cells under a heat shock stimulus.

Interstitial duplication 8q22-q24: Report of a case proven by FISH with mapped cosmid probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wakui, Keiko; Ohashi, Hirofumi; Yamagishi, Akira

We report on a 6-month-old malformed female infant with a de novo interstitial duplication of an 8q22-q24 segment. She had an excess dark-band on the 8q distal region by GTG-banded chromosome analysis, which was likely to be 8q23. We performed FISH analysis using cosmid probes mapped to 8q23 and proved that the patient had an 8q duplication including the 8q23 region. 20 refs., 2 figs., 1 tab.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

UniVIO: A Multiple Omics Database with Hormonome and Transcriptome Data from Rice

PubMed Central

Sakurai, Tetsuya; Sakakibara, Hitoshi

2013-01-01

Plant hormones play important roles as signaling molecules in the regulation of growth and development by controlling the expression of downstream genes. Since the hormone signaling system represents a complex network involving functional cross-talk through the mutual regulation of signaling and metabolism, a comprehensive and integrative analysis of plant hormone concentrations and gene expression is important for a deeper understanding of hormone actions. We have developed a database named Uniformed Viewer for Integrated Omics (UniVIO: http://univio.psc.riken.jp/), which displays hormone-metabolome (hormonome) and transcriptome data in a single formatted (uniformed) heat map. At the present time, hormonome and transcriptome data obtained from 14 organ parts of rice plants at the reproductive stage and seedling shoots of three gibberellin signaling mutants are included in the database. The hormone concentration and gene expression data can be searched by substance name, probe ID, gene locus ID or gene description. A correlation search function has been implemented to enable users to obtain information of correlated substance accumulation and gene expression. In the correlation search, calculation method, range of correlation coefficient and plant samples can be selected freely. PMID:23314752

Probing low-energy hyperbolic polaritons in van der Waals crystals with an electron microscope.

PubMed

Govyadinov, Alexander A; Konečná, Andrea; Chuvilin, Andrey; Vélez, Saül; Dolado, Irene; Nikitin, Alexey Y; Lopatin, Sergei; Casanova, Fèlix; Hueso, Luis E; Aizpurua, Javier; Hillenbrand, Rainer

2017-07-21

Van der Waals materials exhibit intriguing structural, electronic, and photonic properties. Electron energy loss spectroscopy within scanning transmission electron microscopy allows for nanoscale mapping of such properties. However, its detection is typically limited to energy losses in the eV range-too large for probing low-energy excitations such as phonons or mid-infrared plasmons. Here, we adapt a conventional instrument to probe energy loss down to 100 meV, and map phononic states in hexagonal boron nitride, a representative van der Waals material. The boron nitride spectra depend on the flake thickness and on the distance of the electron beam to the flake edges. To explain these observations, we developed a classical response theory that describes the interaction of fast electrons with (anisotropic) van der Waals slabs, revealing that the electron energy loss is dominated by excitation of hyperbolic phonon polaritons, and not of bulk phonons as often reported. Thus, our work is of fundamental importance for interpreting future low-energy loss spectra of van der Waals materials.Here the authors adapt a STEM-EELS system to probe energy loss down to 100 meV, and apply it to map phononic states in hexagonal boron nitride, revealing that the electron loss is dominated by hyperbolic phonon polaritons.

Molecular pathways associated with blood pressure and hexadecanedioate levels.

PubMed

Menni, Cristina; Metrustry, Sarah J; Ehret, Georg; Dominiczak, Anna F; Chowienczyk, Phil; Spector, Tim D; Padmanabhan, Sandosh; Valdes, Ana M

2017-01-01

The dicarboxylic acid hexadecanedioate is associated with increased blood pressure (BP) and mortality in humans and feeding it to rats raises BP. Here we aim to characterise the molecular pathways that influence levels of hexadecanedioate linked to BP regulation, using genetic and transcriptomic studies. The top associations for hexadecanedioate in a genome-wide association scan (GWAS) conducted on 6447 individuals from the TwinsUK and KORA cohorts were tested for association with BP and hypertension in the International Consortium for BP and in a GWAS of BP extremes. Transcriptomic analyses correlating hexadecanedioate with gene expression levels in adipose tissue in 740 TwinsUK participants were further performed. GWAS showed 242 SNPs mapping to two independent loci achieving genome-wide significance. In rs414056 in the SCLO1B1 gene (Beta(SE) = -0.088(0.006)P = 1.65 x 10-51, P < 1 x 10-51), the allele previously associated with increased risk of statin associated myopathy is associated with higher hexadecanedioate levels. However this SNP did not show association with BP or hypertension. The top SNP in the second locus rs6663731 mapped to the intronic region of CYP4Z2P on chromosome 1 (0.045(0.007), P = 5.49x10-11). Hexadecanedioate levels also correlate with adipose tissue gene-expression of the 3 out of 4 CYP4 probes (P<0.05) and of alcohol dehydrogenase probes (Beta(SE) = 0.12(0.02); P = 6.04x10-11). High circulating levels of hexadecanedioate determine a significant effect of alcohol intake on BP (SBP: 1.12(0.34), P = 0.001; DBP: 0.70(0.22), P = 0.002), while no effect is seen in the lower hexadecanedioate level group. In conclusion, levels in fat of ADH1A, ADH1B and CYP4 encoding enzymes in the omega oxidation pathway, are correlated with hexadecanedioate levels. Hexadecanedioate appears to regulate the effect of alcohol on BP.

KSC-01pp1173

NASA Image and Video Library

2001-06-19

KENNEDY SPACE CENTER, Fla. -- At Launch Complex 17-B, Cape Canaveral Air Force Station, workers keep watch while the Microwave Anisotropy Probe (MAP) is lowered into position on the Delta II rocket below. Launch of MAP via a Boeing Delta II rocket is scheduled for June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures

FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

PubMed

Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

2016-03-01

We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

Picking Cell Lines for High-Throughput Transcriptomic Toxicity ...

EPA Pesticide Factsheets

High throughput, whole genome transcriptomic profiling is a promising approach to comprehensively evaluate chemicals for potential biological effects. To be useful for in vitro toxicity screening, gene expression must be quantified in a set of representative cell types that captures the diversity of potential responses across chemicals. The ideal dataset to select these cell types would consist of hundreds of cell types treated with thousands of chemicals, but does not yet exist. However, basal gene expression data may be useful as a surrogate for representing the relevant biological space necessary for cell type selection. The goal of this study was to identify a small (< 20) number of cell types that capture a large, quantifiable fraction of basal gene expression diversity. Three publicly available collections of Affymetrix U133+2.0 cellular gene expression data were used: 1) 59 cell lines from the NCI60 set; 2) 303 primary cell types from the Mabbott et al (2013) expression atlas; and 3) 1036 cell lines from the Cancer Cell Line Encyclopedia. The data were RMA normalized, log-transformed, and the probe sets mapped to HUGO gene identifiers. The results showed that <20 cell lines capture only a small fraction of the total diversity in basal gene expression when evaluated using either the entire set of 20960 HUGO genes or a subset of druggable genes likely to be chemical targets. The fraction of the total gene expression variation explained was consistent when

Recent Progress in Nanoelectrical Characterizations of CdTe and Cu(In,Ga)Se2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Chun-Sheng; To, Bobby; Glynn, Stephen

2016-11-21

We report two recent nanoelectrical characterizations of CdTe and Cu(In, Ga)Se2 (CIGS) thin-film solar cells by developing atomic force microscopy-based nanoelectrical probes. Charges trapped at defects at the CdS/CdTe interface were probed by Kelvin probe force microscopy (KPFM) potential mapping and by ion-milling the CdTe superstrate device in a bevel glancing angle of ~0.5 degrees. The results show randomly distributed donor-like defects at the interface. The effect of K post-deposition treatment on the near-surface region of the CIGS film was studied by KPFM potential and scanning spreading resistance microscopy (SSRM) resistivity mapping, which shows passivation of grain-boundary potential and improvementmore » of resistivity uniformity by the K treatment.« less

Are X-rays the key to integrated computational materials engineering?

DOE PAGES

Ice, Gene E.

2015-11-01

The ultimate dream of materials science is to predict materials behavior from composition and processing history. Owing to the growing power of computers, this long-time dream has recently found expression through worldwide excitement in a number of computation-based thrusts: integrated computational materials engineering, materials by design, computational materials design, three-dimensional materials physics and mesoscale physics. However, real materials have important crystallographic structures at multiple length scales, which evolve during processing and in service. Moreover, real materials properties can depend on the extreme tails in their structural and chemical distributions. This makes it critical to map structural distributions with sufficient resolutionmore » to resolve small structures and with sufficient statistics to capture the tails of distributions. For two-dimensional materials, there are high-resolution nondestructive probes of surface and near-surface structures with atomic or near-atomic resolution that can provide detailed structural, chemical and functional distributions over important length scales. Furthermore, there are no nondestructive three-dimensional probes with atomic resolution over the multiple length scales needed to understand most materials.« less

A Bayesian Framework to Account for Complex Non-Genetic Factors in Gene Expression Levels Greatly Increases Power in eQTL Studies

PubMed Central

Durbin, Richard; Winn, John

2010-01-01

Gene expression measurements are influenced by a wide range of factors, such as the state of the cell, experimental conditions and variants in the sequence of regulatory regions. To understand the effect of a variable of interest, such as the genotype of a locus, it is important to account for variation that is due to confounding causes. Here, we present VBQTL, a probabilistic approach for mapping expression quantitative trait loci (eQTLs) that jointly models contributions from genotype as well as known and hidden confounding factors. VBQTL is implemented within an efficient and flexible inference framework, making it fast and tractable on large-scale problems. We compare the performance of VBQTL with alternative methods for dealing with confounding variability on eQTL mapping datasets from simulations, yeast, mouse, and human. Employing Bayesian complexity control and joint modelling is shown to result in more precise estimates of the contribution of different confounding factors resulting in additional associations to measured transcript levels compared to alternative approaches. We present a threefold larger collection of cis eQTLs than previously found in a whole-genome eQTL scan of an outbred human population. Altogether, 27% of the tested probes show a significant genetic association in cis, and we validate that the additional eQTLs are likely to be real by replicating them in different sets of individuals. Our method is the next step in the analysis of high-dimensional phenotype data, and its application has revealed insights into genetic regulation of gene expression by demonstrating more abundant cis-acting eQTLs in human than previously shown. Our software is freely available online at http://www.sanger.ac.uk/resources/software/peer/. PMID:20463871

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes.

PubMed

Mok, Calvin A; Au, Vinci; Thompson, Owen A; Edgley, Mark L; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G; Waterston, Robert H

2017-10-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C . elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2 We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. Copyright © 2017 by the Genetics Society of America.

MIP-MAP: High-Throughput Mapping of Caenorhabditis elegans Temperature-Sensitive Mutants via Molecular Inversion Probes

PubMed Central

Mok, Calvin A.; Au, Vinci; Thompson, Owen A.; Edgley, Mark L.; Gevirtzman, Louis; Yochem, John; Lowry, Joshua; Memar, Nadin; Wallenfang, Matthew R.; Rasoloson, Dominique; Bowerman, Bruce; Schnabel, Ralf; Seydoux, Geraldine; Moerman, Donald G.; Waterston, Robert H.

2017-01-01

Mutants remain a powerful means for dissecting gene function in model organisms such as Caenorhabditis elegans. Massively parallel sequencing has simplified the detection of variants after mutagenesis but determining precisely which change is responsible for phenotypic perturbation remains a key step. Genetic mapping paradigms in C. elegans rely on bulk segregant populations produced by crosses with the problematic Hawaiian wild isolate and an excess of redundant information from whole-genome sequencing (WGS). To increase the repertoire of available mutants and to simplify identification of the causal change, we performed WGS on 173 temperature-sensitive (TS) lethal mutants and devised a novel mapping method. The mapping method uses molecular inversion probes (MIP-MAP) in a targeted sequencing approach to genetic mapping, and replaces the Hawaiian strain with a Million Mutation Project strain with high genomic and phenotypic similarity to the laboratory wild-type strain N2. We validated MIP-MAP on a subset of the TS mutants using a competitive selection approach to produce TS candidate mapping intervals with a mean size < 3 Mb. MIP-MAP successfully uses a non-Hawaiian mapping strain and multiplexed libraries are sequenced at a fraction of the cost of WGS mapping approaches. Our mapping results suggest that the collection of TS mutants contains a diverse library of TS alleles for genes essential to development and reproduction. MIP-MAP is a robust method to genetically map mutations in both viable and essential genes and should be adaptable to other organisms. It may also simplify tracking of individual genotypes within population mixtures. PMID:28827289

Connecting CO intensity mapping to molecular gas and star formation in the epoch of galaxy assembly

DOE PAGES

Li, Tony Y.; Wechsler, Risa H.; Devaraj, Kiruthika; ...

2016-01-29

Intensity mapping, which images a single spectral line from unresolved galaxies across cosmological volumes, is a promising technique for probing the early universe. Here we present predictions for the intensity map and power spectrum of the CO(1–0) line from galaxies atmore » $$z\\sim 2.4$$–2.8, based on a parameterized model for the galaxy–halo connection, and demonstrate the extent to which properties of high-redshift galaxies can be directly inferred from such observations. We find that our fiducial prediction should be detectable by a realistic experiment. Motivated by significant modeling uncertainties, we demonstrate the effect on the power spectrum of varying each parameter in our model. Using simulated observations, we infer constraints on our model parameter space with an MCMC procedure, and show corresponding constraints on the $${L}_{\\mathrm{IR}}$$–$${L}_{\\mathrm{CO}}$$ relation and the CO luminosity function. These constraints would be complementary to current high-redshift galaxy observations, which can detect the brightest galaxies but not complete samples from the faint end of the luminosity function. Furthermore, by probing these populations in aggregate, CO intensity mapping could be a valuable tool for probing molecular gas and its relation to star formation in high-redshift galaxies.« less

L-Mapping Solar Energetic Particles from LEO to High Altitudes at High Latitudes

NASA Astrophysics Data System (ADS)

Young, S. L.; Wilson, G.

2017-12-01

The current solar energetic particle (SEP) hazard specification is focused on geosynchronous orbit with some capability at LEO, but there is no specification for the large region between these orbital regimes. The L-mapping technique, which attempts to fill this capability gap, assumes that there is a simple relationship between magnetic L-shells and SEP penetration boundaries that can be exploited. A previous study compared POES observations that had been mapped to the Van Allen Probes with local observations. It found that more than 90% of the mapped and local fluxes were within a factor of four of each other; this is thought to be sucient for operational purposes. One concern with the previous study was the limited number of SEP events that have occurred during the Van Allen Probes mission. The current study examines the L-mapping method's accuracy at higher latitudes. Observations from a satellite that was launched into a HEO orbit with a 63° inclination before the peak of solar cycle 24 are compared to L-mapped POES observations. The larger number of events provides better statistics and the 63° orbit inclination allows us to examine the difference between mapping from POES to the magnetic equator, as in the previous study, and mapping from POES to higher latitudes.

Gene signatures of postoperative atrial fibrillation in atrial tissue after coronary artery bypass grafting surgery in patients receiving β-blockers.

PubMed

Kertai, Miklos D; Qi, Wenjing; Li, Yi-Ju; Lombard, Frederick W; Liu, Yutao; Smith, Michael P; Stafford-Smith, Mark; Newman, Mark F; Milano, Carmelo A; Mathew, Joseph P; Podgoreanu, Mihai V

2016-03-01

Atrial tissue gene expression profiling may help to determine how differentially expressed genes in the human atrium before cardiopulmonary bypass (CPB) are related to subsequent biologic pathway activation patterns, and whether specific expression profiles are associated with an increased risk for postoperative atrial fibrillation (AF) or altered response to β-blocker (BB) therapy after coronary artery bypass grafting (CABG) surgery. Right atrial appendage (RAA) samples were collected from 45 patients who were receiving perioperative BB treatment, and underwent CABG surgery. The isolated RNA samples were used for microarray gene expression analysis, to identify probes that were expressed differently in patients with and without postoperative AF. Gene expression analysis was performed to identify probes that were expressed differently in patients with and without postoperative AF. Gene set enrichment analysis (GSEA) was performed to determine how sets of genes might be systematically altered in patients with postoperative AF. Of the 45 patients studied, genomic DNA from 42 patients was used for target sequencing of 66 candidate genes potentially associated with AF, and 2,144 single-nucleotide polymorphisms (SNPs) were identified. We then performed expression quantitative trait loci (eQTL) analysis to determine the correlation between SNPs identified in the genotyped patients, and RAA expression. Probes that met a false discovery rate<0.25 were selected for eQTL analysis. Of the 17,678 gene expression probes analyzed, 2 probes met our prespecified significance threshold of false discovery rate<0.25. The most significant probe corresponded to vesicular overexpressed in cancer - prosurvival protein 1 gene (VOPP1; 1.83 fold change; P=3.47×10(-7)), and was up-regulated in patients with postoperative AF, whereas the second most significant probe, which corresponded to the LOC389286 gene (0.49 fold change; P=1.54×10(-5)), was down-regulated in patients with postoperative AF. GSEA highlighted the role of VOPP1 in pathways with biologic relevance to myocardial homeostasis, and oxidative stress and redox modulation. Candidate gene eQTL showed a trans-acting association between variants of G protein-coupled receptor kinase 5 gene, previously linked to altered BB response, and high expression of VOPP1. In patients undergoing CABG surgery, RAA gene expression profiling, and pathway and eQTL analysis suggested that VOPP1 plays a novel etiological role in postoperative AF despite perioperative BB therapy. Copyright © 2016. Published by Elsevier Ltd.

Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

PubMed

Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

2016-09-01

Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

Molecular mapping within the mouse albino-deletion complex.

PubMed Central

Johnson, D K; Hand, R E; Rinchik, E M

1989-01-01

Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

Characterization of Three Maize Bacterial Artificial Chromosome Libraries toward Anchoring of the Physical Map to the Genetic Map Using High-Density Bacterial Artificial Chromosome Filter Hybridization1

PubMed Central

Yim, Young-Sun; Davis, Georgia L.; Duru, Ngozi A.; Musket, Theresa A.; Linton, Eric W.; Messing, Joachim W.; McMullen, Michael D.; Soderlund, Carol A.; Polacco, Mary L.; Gardiner, Jack M.; Coe, Edward H.

2002-01-01

Three maize (Zea mays) bacterial artificial chromosome (BAC) libraries were constructed from inbred line B73. High-density filter sets from all three libraries, made using different restriction enzymes (HindIII, EcoRI, and MboI, respectively), were evaluated with a set of complex probes including the185-bp knob repeat, ribosomal DNA, two telomere-associated repeat sequences, four centromere repeats, the mitochondrial genome, a multifragment chloroplast DNA probe, and bacteriophage λ. The results indicate that the libraries are of high quality with low contamination by organellar and λ-sequences. The use of libraries from multiple enzymes increased the chance of recovering each region of the genome. Ninety maize restriction fragment-length polymorphism core markers were hybridized to filters of the HindIII library, representing 6× coverage of the genome, to initiate development of a framework for anchoring BAC contigs to the intermated B73 × Mo17 genetic map and to mark the bin boundaries on the physical map. All of the clones used as hybridization probes detected at least three BACs. Twenty-two single-copy number core markers identified an average of 7.4 ± 3.3 positive clones, consistent with the expectation of six clones. This information is integrated into fingerprinting data generated by the Arizona Genomics Institute to assemble the BAC contigs using fingerprint contig and contributed to the process of physical map construction. PMID:12481051

The Atacama Cosmology Telescope: Calibration with the Wilkinson Microwave Anisotropy Probe Using Cross-Correlations

NASA Technical Reports Server (NTRS)

Hajian, Amir; Acquaviva, Viviana; Ade, Peter A. R.; Aguirre, Paula; Amiri, Mandana; Appel, John William; Barrientos, L. Felipe; Battistelli, Elia S.; Bond, John R.; Brown, Ben;

KSC-01pp1172

NASA Image and Video Library

2001-06-19

KENNEDY SPACE CENTER, Fla. -- The Microwave Anisotropy Probe (MAP) spacecraft is lifted up the gantry on Launch Complex 17-B, Cape Canaveral Air Force Station, where it will undergo final testing and installation of the payload fairing. Launch of MAP via a Boeing Delta II rocket is scheduled for June 30. The launch will place MAP into a lunar-assisted trajectory to the Sun-Earth for a 27-month mission. The probe will measure small fluctuations in the temperature of the cosmic microwave background radiation to an accuracy of one millionth of a degree. These measurements should reveal the size, matter content, age, geometry and fate of the universe. They will also reveal the primordial structure that grew to form galaxies and will test ideas about the origins of these primordial structures

Multispectral imaging probe

DOEpatents

Sandison, David R.; Platzbecker, Mark R.; Descour, Michael R.; Armour, David L.; Craig, Marcus J.; Richards-Kortum, Rebecca

1999-01-01

A multispectral imaging probe delivers a range of wavelengths of excitation light to a target and collects a range of expressed light wavelengths. The multispectral imaging probe is adapted for mobile use and use in confined spaces, and is sealed against the effects of hostile environments. The multispectral imaging probe comprises a housing that defines a sealed volume that is substantially sealed from the surrounding environment. A beam splitting device mounts within the sealed volume. Excitation light is directed to the beam splitting device, which directs the excitation light to a target. Expressed light from the target reaches the beam splitting device along a path coaxial with the path traveled by the excitation light from the beam splitting device to the target. The beam splitting device directs expressed light to a collection subsystem for delivery to a detector.

Multispectral imaging probe

DOEpatents

Sandison, D.R.; Platzbecker, M.R.; Descour, M.R.; Armour, D.L.; Craig, M.J.; Richards-Kortum, R.

1999-07-27

A multispectral imaging probe delivers a range of wavelengths of excitation light to a target and collects a range of expressed light wavelengths. The multispectral imaging probe is adapted for mobile use and use in confined spaces, and is sealed against the effects of hostile environments. The multispectral imaging probe comprises a housing that defines a sealed volume that is substantially sealed from the surrounding environment. A beam splitting device mounts within the sealed volume. Excitation light is directed to the beam splitting device, which directs the excitation light to a target. Expressed light from the target reaches the beam splitting device along a path coaxial with the path traveled by the excitation light from the beam splitting device to the target. The beam splitting device directs expressed light to a collection subsystem for delivery to a detector. 8 figs.

Euclid Mission: Mapping the Geometry of the Dark Universe. Mission and Consortium Status

NASA Technical Reports Server (NTRS)

Rhodes, Jason

2011-01-01

Euclid concept: (1) High-precision survey mission to map the geometry of the Dark Universe (2) Optimized for two complementary cosmological probes: (2a) Weak Gravitational Lensing (2b) Baryonic Acoustic Oscillations (2c) Additional probes: clusters, redshift space distortions, ISW (3) Full extragalactic sky survey with 1.2m telescope at L2: (3a) Imaging: (3a-1) High precision imaging at visible wavelengths (3a-2) Photometry/Imaging in the near-infrared (3b) Near Infrared Spectroscopy (4) Synergy with ground based surveys (5) Legacy science for a wide range of in astronomy

The Microwave Anisotropy Probe (MAP) Attitude Control System

NASA Technical Reports Server (NTRS)

Markley, F. Landis; Andrews, Stephen F.; ODonnell, James R., Jr.; Ward, David K.; Ericsson, Aprille J.; Bauer, Frank H. (Technical Monitor)

2002-01-01

The Microwave Anisotropy Probe mission is designed to produce a map of the cosmic microwave background radiation over the entire celestial sphere by executing a fast spin and a slow precession of its spin axis about the Sun line to obtain a highly interconnected set of measurements. The spacecraft attitude is sensed and controlled using an Inertial Reference Unit, two Autonomous Star Trackers, a Digital Sun Sensor, twelve Coarse Sun Sensors, three Reaction Wheel Assemblies, and a propulsion system. This paper describes the design of the attitude control system that carries out this mission and presents some early flight experience.

Stationkeeping Approach for the Microwave Anisotropy Probe (MAP)

NASA Technical Reports Server (NTRS)

Rohrbaugh, Dave; Schiff, Conrad

2002-01-01

The Microwave Anisotropy Probe was successfully launched on June 30, 2001 and placed into a Lissajous orbit about the L2 Sun-Earth-Moon libration point. However, the L2 libration point is unstable which necessitates occasional stationkeeping maneuvers in order to maintain the spacecraft s Lissajous orbit. Analyses were performed in order to develop a feasible L2 stationkeeping strategy for the MAP mission. The resulting strategy meets the allotted fuel budget, allowing for enough fuel to handle additional he1 taxes, while meeting the attitude requirements for the maneuvers. Results from the first two stationkeeping maneuvers are included.

The Microwave Anisotropy Probe (MAP) Mission

NASA Technical Reports Server (NTRS)

Markley, F. Landis; Andrews, Stephen F.; ODonnell, James R., Jr.; Ward, David K.; Bauer, Frank H. (Technical Monitor)

2002-01-01

The Microwave Anisotropy Probe mission is designed to produce a map of the cosmic microwave background radiation over the entire celestial sphere by executing a fast spin and a slow precession of its spin axis about the Sun line to obtain a highly interconnected set of measurements. The spacecraft attitude is sensed and controlled using an inertial reference unit, two star trackers, a digital sun sensor, twelve coarse sun sensors, three reaction wheel assemblies, and a propulsion system. This paper presents an overview of the design of the attitude control system to carry out this mission and presents some early flight experience.

The Microwave Anisotropy Probe (MAP) Mission

NASA Technical Reports Server (NTRS)

Markley, F. Landis; Andrews, Stephen F.; ODonnell, James R., Jr.; Ward, David K.; Ericsson, Aprille J.; Bauer, Frank H. (Technical Monitor)

2002-01-01

The Microwave Anisotropy Probe mission is designed to produce a map of the cosmic microwave background radiation over the entire celestial sphere by executing a fast spin and a slow precession of its spin axis about the Sun line to obtain a highly interconnected set of measurements. The spacecraft attitude is sensed and controlled using an Inertial Reference Unit, two Autonomous Star Trackers, a Digital Sun Sensor, twelve Coarse Sun Sensors, three Reaction Wheel Assemblies, and a propulsion system. This paper describes the design of the attitude control system that carries out this mission and presents some early flight experience.

Final report: Mapping Interactions in Hybrid Systems with Active Scanning Probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berezovsky, Jesse

2017-09-29

This project aimed to study and map interactions between components of hybrid nanodevices using a novel scanning probe approach. To enable this work, we initially constructed a flexible experimental apparatus allowing for simultaneous scanning probe and confocal optical microscopy measurements. This setup was first used for all-optical measurements of nanostructures, with the focus then shifting to hybrid devices in which single coherent electron spins are coupled to micron-scale ferromagnetic elements, which may prove useful for addressing single spins, enhanced sensing, or spin-wave-mediated coupling of spins for quantum information applications. A significant breakthrough was the realization that it is not necessarymore » to fabricate a magnetic structure on a scanning probe – instead a ferromagnetic vortex core can act as an integrated, solid state, scanning probe. The core of the vortex produces a very strong, localized fringe field which can be used analogously to an MFM tip. Unlike a traditional MFM tip, however, the vortex core is scanned within an integrated device (eliminating drift), and can be moved on vastly faster timescales. This approach allows the detailed investigation of interactions between single spins and complex driven ferromagnetic dynamics.« less

Probe measurements of the three-dimensional magnetic field structure in a rotating magnetic field sustained field-reversed configuration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Velas, K. M.; Milroy, R. D.

A translatable three-axis probe was constructed and installed on the translation, confinement, and sustainment upgrade (TCSU) experiment. With ninety windings, the probe can simultaneously measure B{sub r}, B{sub θ}, and B{sub z} at 30 radial positions, and can be placed at any desired axial position within the field reversed configuration (FRC) confinement chamber. Positioning the probe at multiple axial positions and taking multiple repeatable shots allows for a full r-z map of the magnetic field. Measurements were made for odd-parity rotating magnetic field (RMF) antennas and even-parity RMF. The steady state data from applying a 10 kHz low pass filter usedmore » in conjunction with data at the RMF frequency yields a map of the full 3D rotating field structure. Comparisons will be made to the 3D magnetic structure predicted by NIMROD simulations, with parameters adjusted to match that of the TCSU experiments. The probe provides sufficient data to utilize a Maxwell stress tensor approach to directly measure the torque applied to the FRC's electrons, which combined with a resistive torque model, yields an estimate of the average FRC resistivity.« less

Optimized Probe Masking for Comparative Transcriptomics of Closely Related Species

PubMed Central

Poeschl, Yvonne; Delker, Carolin; Trenner, Jana; Ullrich, Kristian Karsten; Quint, Marcel; Grosse, Ivo

2013-01-01

Microarrays are commonly applied to study the transcriptome of specific species. However, many available microarrays are restricted to model organisms, and the design of custom microarrays for other species is often not feasible. Hence, transcriptomics approaches of non-model organisms as well as comparative transcriptomics studies among two or more species often make use of cost-intensive RNAseq studies or, alternatively, by hybridizing transcripts of a query species to a microarray of a closely related species. When analyzing these cross-species microarray expression data, differences in the transcriptome of the query species can cause problems, such as the following: (i) lower hybridization accuracy of probes due to mismatches or deletions, (ii) probes binding multiple transcripts of different genes, and (iii) probes binding transcripts of non-orthologous genes. So far, methods for (i) exist, but these neglect (ii) and (iii). Here, we propose an approach for comparative transcriptomics addressing problems (i) to (iii), which retains only transcript-specific probes binding transcripts of orthologous genes. We apply this approach to an Arabidopsis lyrata expression data set measured on a microarray designed for Arabidopsis thaliana, and compare it to two alternative approaches, a sequence-based approach and a genomic DNA hybridization-based approach. We investigate the number of retained probe sets, and we validate the resulting expression responses by qRT-PCR. We find that the proposed approach combines the benefit of sequence-based stringency and accuracy while allowing the expression analysis of much more genes than the alternative sequence-based approach. As an added benefit, the proposed approach requires probes to detect transcripts of orthologous genes only, which provides a superior base for biological interpretation of the measured expression responses. PMID:24260119

Probe-level linear model fitting and mixture modeling results in high accuracy detection of differential gene expression.

PubMed

Lemieux, Sébastien

2006-08-25

The identification of differentially expressed genes (DEGs) from Affymetrix GeneChips arrays is currently done by first computing expression levels from the low-level probe intensities, then deriving significance by comparing these expression levels between conditions. The proposed PL-LM (Probe-Level Linear Model) method implements a linear model applied on the probe-level data to directly estimate the treatment effect. A finite mixture of Gaussian components is then used to identify DEGs using the coefficients estimated by the linear model. This approach can readily be applied to experimental design with or without replication. On a wholly defined dataset, the PL-LM method was able to identify 75% of the differentially expressed genes within 10% of false positives. This accuracy was achieved both using the three replicates per conditions available in the dataset and using only one replicate per condition. The method achieves, on this dataset, a higher accuracy than the best set of tools identified by the authors of the dataset, and does so using only one replicate per condition.

Signatures of combinatorial regulation in intrinsic biological noise

PubMed Central

Warmflash, Aryeh; Dinner, Aaron R.

2008-01-01

Gene expression is controlled by the action of transcription factors that bind to DNA and influence the rate at which a gene is transcribed. The quantitative mapping between the regulator concentrations and the output of the gene is known as the cis-regulatory input function (CRIF). Here, we show how the CRIF shapes the form of the joint probability distribution of molecular copy numbers of the regulators and the product of a gene. Namely, we derive a class of fluctuation-based relations that relate the moments of the distribution to the derivatives of the CRIF. These relations are useful because they enable statistics of naturally arising cell-to-cell variations in molecular copy numbers to substitute for traditional manipulations for probing regulatory mechanisms. We demonstrate that these relations can distinguish super- and subadditive gene regulatory scenarios (molecular analogs of AND and OR logic operations) in simulations that faithfully represent bacterial gene expression. Applications and extensions to other regulatory scenarios are discussed. PMID:18981421

Screening phage display libraries for organ-specific vascular immunotargeting in vivo

PubMed Central

Valadon, Philippe; Garnett, Jeff D.; Testa, Jacqueline E.; Bauerle, Marc; Oh, Phil; Schnitzer, Jan E.

2006-01-01

The molecular diversity of the luminal endothelial cell surface arising in vivo from local variations in genetic expression and tissue microenvironment may create opportunities for achieving targeted molecular imaging and therapies. Here, we describe a strategy to identify probes and their cognate antigens for targeting vascular endothelia of specific organs in vivo. We differentially screen phage libraries to select organ-targeting antibodies by using luminal endothelial cell plasma membranes isolated directly from tissue and highly enriched in natively expressed proteins exposed to the bloodstream. To obviate liver uptake of intravenously injected phage, we convert the phage-displayed antibodies into scFv-Fc fusion proteins, which then are able to rapidly target select organ(s) in vivo as visualized directly by γ-scintigraphic whole-body imaging. Mass spectrometry helps identify the antigen targets. This comprehensive strategy provides new promise for harnessing the power of phage display for mapping vascular endothelia natively in tissue and for achieving vascular targeting of specific tissues in vivo. PMID:16384919

The Role of the Immune Response in the Pathogenesis of Thyroid Eye Disease: A Reassessment

PubMed Central

Rosenbaum, James T.; Choi, Dongseok; Wong, Amanda; Wilson, David J.; Grossniklaus, Hans E.; Harrington, Christina A.; Dailey, Roger A.; Ng, John D.; Steele, Eric A.; Czyz, Craig N.; Foster, Jill A.; Tse, David; Alabiad, Chris; Dubovy, Sander; Parekh, Prashant K.; Harris, Gerald J.; Kazim, Michael; Patel, Payal J.; White, Valerie A.; Dolman, Peter J.; Edward, Deepak P.; Alkatan, Hind M.; al Hussain, Hailah; Selva, Dinesh; Yeatts, R. Patrick; Korn, Bobby S.; Kikkawa, Don O.; Stauffer, Patrick; Planck, Stephen R.

2015-01-01

Background Although thyroid eye disease is a common complication of Graves’ disease, the pathogenesis of the orbital disease is poorly understood. Most authorities implicate the immune response as an important causal factor. We sought to clarify pathogenesis by using gene expression microarray. Methods An international consortium of ocular pathologists and orbital surgeons contributed formalin fixed orbital biopsies. RNA was extracted from orbital tissue from 20 healthy controls, 25 patients with thyroid eye disease (TED), 25 patients with nonspecific orbital inflammation (NSOI), 7 patients with sarcoidosis and 6 patients with granulomatosis with polyangiitis (GPA). Tissue was divided into a discovery set and a validation set. Gene expression was quantified using Affymetrix U133 Plus 2.0 microarrays which include 54,000 probe sets. Results Principal component analysis showed that gene expression from tissue from patients with TED more closely resembled gene expression from healthy control tissue in comparison to gene expression characteristic of sarcoidosis, NSOI, or granulomatosis with polyangiitis. Unsupervised cluster dendrograms further indicated the similarity between TED and healthy controls. Heat maps based on gene expression for cytokines, chemokines, or their receptors showed that these inflammatory markers were associated with NSOI, sarcoidosis, or GPA much more frequently than with TED. Conclusion This is the first study to compare gene expression in TED to gene expression associated with other causes of exophthalmos. The juxtaposition shows that inflammatory markers are far less characteristic of TED relative to other orbital inflammatory diseases. PMID:26371757

Intraoperative Mapping of Expressive Language Cortex Using Passive Real-Time Electrocorticography

DTIC Science & Technology

2016-08-26

lsev ie r .com/ locate /ebcrCase ReportIntraoperative mapping of expressive language cortex using passive real-time electrocorticographyAmiLyn M...case report, we investigated the utility and practicality of passive intraoperative functional mapping of expressive language cortex using high...expressive lan- guage regions. In preparation of tumor resection, the patient underwent multiple functional language mapping procedures. We examined

A beam current density monitor for intense electron beams

NASA Astrophysics Data System (ADS)

Fiorito, R. B.; Raleigh, M.; Seltzer, S. M.

1983-12-01

The authors describe a new type of electric probe for mapping the radial current density profile of high-energy, high current electron beams. The idea of developing an electrically sensitive probe for these conditions was originally suggested to one of the authors during a year's visit to the Lawrence Livermore National Laboratory. The resulting probe is intended for use on the Experimental Test Accelerator (ETA) and the Advanced Test Accelerator at that laboratory. This report discusses in detail: the mechanical design, the electrical response, and temperature effects, as they pertain to the electric probe, and describe the first experimental results obtained using this probe on ETA.

The Anti-inflammatory Drug Indomethacin Alters Nanoclustering in Synthetic and Cell Plasma Membranes*

PubMed Central

Zhou, Yong; Plowman, Sarah J.; Lichtenberger, Lenard M.; Hancock, John F.

2010-01-01

The nonsteroidal anti-inflammatory drug indomethacin exhibits diverse biological effects, many of which have no clear molecular mechanism. Membrane-bound receptors and enzymes are sensitive to their phospholipid microenvironment. Amphipathic indomethacin could therefore potentially modulate cell signaling by changing membrane properties. Here we examined the effect of indomethacin on membrane lateral heterogeneity. Fluorescence lifetime imaging of cells expressing lipid-anchored probes revealed that treatment of BHK cells with therapeutic levels of indomethacin enhances cholesterol-dependent nanoclustering, but not cholesterol-independent nanoclustering. Immuno-electron microscopy and quantitative spatial mapping of intact plasma membrane sheets similarly showed a selective effect of indomethacin on promoting cholesterol-dependent, but not cholesterol-independent, nanoclustering. To further evaluate the biophysical effects of indomethacin, we measured fluorescence polarization of the phase-sensitive probe Laurdan and FRET between phase-partitioning probes in model bilayers. Therapeutic levels of indomethacin enhanced phase seperation in DPPC/DOPC/Chol (1:1:1) and DPPC/Chol membranes in a temperature-dependent manner, but had minimal effect on the phase behavior of pure DOPC at any temperature. Taken together, the imaging results on intact epithelial cells and the biophysical assays of model membranes suggest that indomethacin can enhance phase separation and stabilize cholesterol-dependent nanoclusters in biological membranes. These effects on membrane lateral heterogeneity may have significant consequences for cell signaling cascades that are assembled on the plasma membrane. PMID:20826816

Visual geography

USGS Publications Warehouse

,; ,; ,

1991-01-01

Maps are, among other things, a way of making geography visual. They are world views, ways of thinking, and ways of communicating. They depict our world and guide us through it. Visual Geography probes the essence of maps and mapmaking. It follows the story of cartography through the millennia, across the globe, and beyond the solar system. It includes some of the world's most beautiful and enduring maps, some of its most historic - a map in Columbus' hand, the map that was carried to the Moon, the first map to show America - and it examines the urge to map, to measure our world, and to record it graphically.

Dynamic mapping of spontaneously produced H2S in the entire cell space and in live animals using a rationally designed molecular switch.

PubMed

Yang, Linlin; Zhao, Jun; Yu, Xinling; Zhang, Ruilong; Han, Guangmei; Liu, Renyong; Liu, Zhengjie; Zhao, Tingting; Han, Ming-Yong; Zhang, Zhongping

2018-04-16

Hydrogen sulfide (H2S) is a key signaling molecule in the cytoprotection, vascular mediation and neurotransmission of living organisms. In-depth understanding of its production, trafficking, and transformation in cells is very important in the way H2S mediates cellular signal transductions and organism functions; it also motivates the development of H2S probes and imaging technologies. A fundamental challenge, however, is how to engineer probes with sensitivity and cellular penetrability that allow detection of spontaneous production of H2S in the entire cell space and live animals. Here, we report a rationally designed molecular switch capable of accessing all intracellular compartments, including the nucleus, lysosomes and mitochondria, for H2S detection. Our probe comprised three functional domains (H2S sensing, fluorescence, and biomembrane penetration), could enter almost all cell types readily, and exhibit a rapid and ultrasensitive response to H2S (≤120-fold fluorescence enhancement) for the dynamic mapping of spontaneously produced H2S as well as its distribution in the whole cell. In particular, the probe traversed blood/tissue/cell barriers to achieve mapping of endogenous H2S in metabolic organs of a live Danio rerio (zebrafish). These results open-up exciting opportunities to investigate H2S physiology and H2S-related diseases.

Physical mapping of complex genomes

DOEpatents

Evans, G.A.

1993-06-15

A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buehler, Marc; Tartaglia, Michael; Tompkins, John

The Mu2e experiment at Fermilab is designed to explore charged lepton flavor violation by searching for muon-to-electron conversion. The magnetic field generated by a system of solenoids is crucial for Mu2e and requires accurate characterization to detect any flaws and to produce a detailed field map. Stringent physics goals are driving magnetic field specifications for the Mu2e solenoids. A field mapper is being designed, which will produce detailed magnetic field maps. The uniform field region of the spectrometer volume requires the highest level of precision (1 Gauss per 1 Tesla). During commissioning, multiple magnetic field maps will be generated tomore » verify proper alignment of all magnet coils, and to create the final magnetic field map. In order to design and build a precise field mapping system consisting of Hall and NRM probes, tolerances and precision for such a system need to be evaluated. In this paper we present a design for the Mu2e field mapping hardware, and discuss results from OPERA-3D simulations to specify parameters for Hall and NMR probes. We also present a fitting procedure for the analytical treatment of our expected magnetic measurements.« less

X-ray Reverberation Mapping in Active Galactic Nuclei

NASA Astrophysics Data System (ADS)

Kara, Erin

2018-01-01

Active Galactic Nuclei can produce as much or more electromagnetic and kinetic luminosities than the combined stellar luminosity of an entire galaxy. The energy output from AGN comes from the gravitational potential energy of the infalling material and the rotational energy of the black hole, both of which are released very close to the black hole. Therefore, probing the relativistic region of the inner accretion flow is essential to understanding how AGN work and effect their environments. In this talk, I will present a new technique for probing these relativistic environments: X-ray reverberation mapping. Similar to Optical reverberation mapping, where time delays of days or weeks between the continuum and Broad Line Region lines map out centiparsec scales, X-ray reverberation reveals time delays of tens of seconds, which map out microparsec scales in the accretion flow—well beyond the spatial resolution power of any instrument. This technique has been discovered in the past decade, so I will give a brief overview of how the measurements are made, and highlight some recent discoveries, which allow us to map the gas falling on to the black hole and measure the effects of strongly curved spacetime close to the event horizon.

In Vivo Fiber-Optic Raman Mapping Of Metastases In Mouse Brains

NASA Astrophysics Data System (ADS)

Stelling, A.; Kirsch, M.; Steiner, G.; Krafft, C.; Schackert, G.; Salzer, R.

2010-08-01

Vibrational spectroscopy, in particular Raman spectroscopy, has potential applications in the field of in vivo diagnostics. Raman and FT-IR spectroscopy analyze the complete biochemical information at any given pixel within the visual field. Here we demonstrate the feasibility of performing Raman spectroscopic measurements on living mice brains using a fiber-optic probe with a nominal spatial resolution of 60 μm. The objectives of this study were to 1) evaluate preclinical models, namely murine brain slices containing experimental tumors, 2) optimize the preparation of pristine brain tissue to obtain reference information, to 3) optimize the conditions for introducing a fiber-optic probe to acquire Raman maps in vivo, and 4) to transfer results obtained from human brain tumors to an animal model. Disseminated brain metastases of malignant melanomas were induced by injecting tumor cells into the carotid artery of mice. The procedure mimicked hematogenous tumor spread in one brain hemisphere while the other hemisphere remained tumor free. Three series of sections were prepared consecutively from whole mouse brains: pristine, 2-mm thick sections for Raman mapping and dried, thin sections for FT-IR imaging, hematoxylin and eosin-stained thin sections for histopathological assessment. Raman maps were collected serially using a spectrometer coupled to a fiber-optic probe. FT-IR images were recorded using a spectrometer with a multi-channel detector. The FT-IR images and the Raman maps were evaluated by multivariate data analysis. The results obtained from the thin section studies were employed to guide measurements of murine brains in vivo. Raman maps with an acquisition time of over an hour could be performed on the living animals. No damage to the tissue was observed.

Molecular characterization of deletion breakpoints in adults with 22q11 deletion syndrome

PubMed Central

Stachon, Andrea C.; Squire, Jeremy A.; Moldovan, Laura; Bayani, Jane; Meyn, Stephen; Chow, Eva; Bassett, Anne S.

2011-01-01

22q11 Deletion syndrome (22q11DS) is a common microdeletion syndrome with variable expression, including congenital and later onset conditions such as schizophrenia. Most studies indicate that expression does not appear to be related to length of the deletion but there is limited information on the endpoints of even the common deletion breakpoint regions in adults. We used a real-time quantitative PCR (qPCR) approach to fine map 22q11.2 deletions in 44 adults with 22q11DS, 22 with schizophrenia (SZ; 12 M, 10 F; mean age 35.7 SD 8.0 years) and 22 with no history of psychosis (NP; 8 M, 14 F; mean age 27.1 SD 8.6 years). QPCR data were consistent with clinical FISH results using the TUPLE1 or N25 probes. Two subjects (one SZ, one NP) negative for clinical FISH had atypical 22q11.2 deletions confirmed by FISH using the RP11-138C22 probe. Most (n = 34; 18 SZ, 16 NP) subjects shared a common 3 Mb hemizygous 22q11.2 deletion. However, eight subjects showed breakpoint variability: a more telomeric proximal breakpoint (n = 2), or more centromeric (n = 3) or more telomeric distal breakpoint (n = 3). One NP subject had a proximal nested 1.4 Mb deletion. COMT and TBX1 were deleted in all 44 subjects, and PRODH in 40 subjects (19 SZ, 21 NP). The results delineate proximal and distal breakpoint variants in 22q11DS. Neither deletion extent nor PRODH haploinsufficiency appeared to explain the clinical expression of schizophrenia in the present study. Further studies are needed to elucidate the molecular basis of schizophrenia and clinical heterogeneity in 22q11DS. PMID:17028864

Development of TaqMan probes targeting the four major celiac disease epitopes found in α-gliadin sequences of spelt (Triticum aestivum ssp. spelta) and bread wheat (Triticum aestivum ssp. aestivum).

PubMed

Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique

2017-01-01

Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the Asian spelt accessions studied.

In Vivo Proton–Electron Double-Resonance Imaging of Extracellular Tumor pH Using an Advanced Nitroxide Probe

PubMed Central

Samouilov, Alexandre; Efimova, Olga V.; Bobko, Andrey A.; Sun, Ziqi; Petryakov, Sergey; Eubank, Timothy D.; Trofimov, Dmitrii G.; Kirilyuk, Igor A.; Grigor’ev, Igor A.; Takahashi, Wataru; Zweier, Jay L.; Khramtsov, Valery V.

2014-01-01

A variable radio frequency proton–electron double-resonance imaging (VRF PEDRI) approach for pH mapping of aqueous samples has been recently developed (Efimova et al. J. Magn. Reson. 2011, 209, 227–232). A pH map is extracted from two PEDRI acquisitions performed at electron paramagnetic resonance (EPR) frequencies of protonated and unprotonated forms of a pH-sensitive probe. To translate VRF PEDRI to an in vivo setting, an advanced pH probe was synthesized. Probe deuteration resulted in a narrow spectral line of 1.2 G compared to a nondeuterated analogue line width of 2.1 G allowing for an increase of Overhauser enhancements and reduction in rf power deposition. Binding of the probe to the cell-impermeable tripeptide, glutathione (GSH), allows for targeting to extracellular tissue space for monitoring extracellular tumor acidosis, a prognostic factor in tumor pathophysiology. The probe demonstrated pH sensitivity in the 5.8–7.8 range, optimum for measurement of acidic extracellular tumor pH (pHe). In vivo VRF PEDRI was performed on Met-1 tumor-bearing mice. Compared to normal mammary glands with a neutral mean pHe (7.1 ± 0.1), we observed broader pH distribution with acidic mean pHe (6.8 ± 0.1) in tumor tissue. In summary, VRF PEDRI in combination with a newly developed pH probe provides an analytical approach for spatially resolved noninvasive pHe monitoring, in vivo. PMID:24372284

A comparative study between an improved novel air-cushion sensor and a wheeled probe for minimally invasive surgery.

PubMed

Zbyszewski, Dinusha; Challacombe, Benjamin; Li, Jichun; Seneviratne, Lakmal; Althoefer, Kaspar; Dasgupta, Prokar; Murphy, Declan

2010-07-01

We describe a comparative study between an enhanced air-cushion tactile sensor and a wheeled indentation probe. These laparoscopic tools are designed to rapidly locate soft-tissue abnormalities during minimally invasive surgery (MIS). The air-cushion tactile sensor consists of an optically based sensor with a 7.8 mm sphere "floating" on a cushion of air at the tip of a shaft. The wheeled indentation probe is a 10 mm wide and 5 mm in diameter wheel mounted to a force/torque sensor. A continuous rolling indentation technique is used to pass the sensors over the soft-tissue surfaces. The variations in stiffness of the viscoelastic materials that are detected during the rolling indentations are illustrated by stiffness maps that can be used for tissue diagnosis. The probes were tested by having to detect four embedded nodules in a silicone phantom. Each probe was attached to a robotic manipulator and rolled over the silicone phantom in parallel paths. The readings of each probe collected during the process of rolling indentation were used to achieve the final results. The results show that both sensors reliably detected the areas of variable stiffness by accurately identifying the location of each nodule. These are illustrated in the form of two three-dimensional spatiomechanical maps. These probes have the potential to be used in MIS because they could provide surgeons with information on the mechanical properties of soft tissue, consequently enhancing the reduction in haptic feedback.

RNA-Seq Profiling Reveals Novel Hepatic Gene Expression Pattern in Aflatoxin B1 Treated Rats

PubMed Central

Merrick, B. Alex; Phadke, Dhiral P.; Auerbach, Scott S.; Mav, Deepak; Stiegelmeyer, Suzy M.; Shah, Ruchir R.; Tice, Raymond R.

2013-01-01

Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1’s carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT’s) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the rat transcriptome contains many previously unidentified, AFB1-responsive exons and transcripts supporting RNA-Seq’s capabilities to provide new insights into AFB1-mediated gene expression leading to hepatocellular carcinoma. PMID:23630614

RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.

PubMed

Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R

2013-01-01

Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the rat transcriptome contains many previously unidentified, AFB1-responsive exons and transcripts supporting RNA-Seq's capabilities to provide new insights into AFB1-mediated gene expression leading to hepatocellular carcinoma.

Evaluation of prognostic and predictive value of microtubule associated protein tau in two independent cohorts.

PubMed

Baquero, Maria T; Lostritto, Karen; Gustavson, Mark D; Bassi, Kimberly A; Appia, Franck; Camp, Robert L; Molinaro, Annette M; Harris, Lyndsay N; Rimm, David L

2011-11-02

Microtubule associated proteins (MAPs) endogenously regulate microtubule stabilization and have been reported as prognostic and predictive markers for taxane response. The microtubule stabilizer, MAP-tau, has shown conflicting results. We quantitatively assessed MAP-tau expression in two independent breast cancer cohorts to determine prognostic and predictive value of this biomarker. MAP-tau expression was evaluated in the retrospective Yale University breast cancer cohort (n = 651) using tissue microarrays and also in the TAX 307 cohort, a clinical trial randomized for TAC versus FAC chemotherapy (n = 140), using conventional whole tissue sections. Expression was measured using the AQUA method for quantitative immunofluorescence. Scores were correlated with clinicopathologic variables, survival, and response to therapy. Assessment of the Yale cohort using Cox univariate analysis indicated an improved overall survival (OS) in tumors with a positive correlation between high MAP-tau expression and overall survival (OS) (HR = 0.691, 95% CI = 0.489-0.974; P = 0.004). Kaplan Meier analysis showed 10-year survival for 65% of patients with high MAP-tau expression compared to 52% with low expression (P = .006). In TAX 307, high expression was associated with significantly longer median time to tumor progression (TTP) regardless of treatment arm (33.0 versus 23.4 months, P = 0.010) with mean TTP of 31.2 months. Response rates did not differ by MAP-tau expression (P = 0.518) or by treatment arm (P = 0.584). Quantitative measurement of MAP-tau expression has prognostic value in both cohorts, with high expression associated with longer TTP and OS. Differences by treatment arm or response rate in low versus high MAP-tau groups were not observed, indicating that MAP-tau is not associated with response to taxanes and is not a useful predictive marker for taxane-based chemotherapy.

Characterization of Electronic Materials HgZnSe and HgZnTe Using Innovative and Conventional Techniques

NASA Technical Reports Server (NTRS)

Tanton, George; Kesmodel, Roy; Burden, Judy; Su, Ching-Hua; Cobb, Sharon D.; Lehoczky, S. L.

2000-01-01

HgZnSe and HgZnTe are electronic materials of interest for potential IR detector and focal plane array applications due to their improved strength and compositional stability over HgCdTe, but they are difficult to grow on Earth and to fully characterize. Conventional contact methods of characterization, such as Hall and van der Paw, although adequate for many situations are typically labor intensive and not entirely suitable where only very small samples are available. To adequately characterize and compare properties of electronic materials grown in low earth orbit with those grown on Earth, innovative techniques are needed that complement existing methods. This paper describes the implementation and test results of a unique non-contact method of characterizing uniformity, mobility, and carrier concentration together with results from conventional methods applied to HgZnSe and HgZnTe. The innovative method has advantages over conventional contact methods since it circumvents problems of possible contamination from alloying electrical contacts to a sample and also has the capability to map a sample. Non- destructive mapping, the determination of the carrier concentration and mobility at each place on a sample, provides a means to quantitatively compare, at high spatial resolution, effects of microgravity on electronic properties and uniformity of electronic materials grown in low-Earth orbit with Earth grown materials. The mapping technique described here uses a 1mm diameter polarized beam of radiation to probe the sample. Activation of a magnetic field, in which the sample is placed, causes the plane of polarization of the probe beam to rotate. This Faraday rotation is a function of the free carrier concentration and the band parameters of the material. Maps of carrier concentration, mobility, and transmission generated from measurements of the Faraday rotation angles over the temperature range from 300K to 77K will be presented. New information on band parameters, obtained by combining results from conventional Hall measurements of the free carrier concentration with Faraday rotation measurements, will also be presented. One example of how this type of information was derived is illustrated in the following figure which shows Faraday rotation vs wavelength modeled for Hg(l-x)ZnxSe at a temperature of 300K and x=0.07. The plasma contribution, total Faraday rotation, and interband contribution to the Faraday rotation, are designated in the Figure as del(p), FR tot, and del(i) respectively. Experimentally measured values of FR tot, each indicated by + , agree acceptably well with the model at the probe wavelength of 10.6 microns. The model shows that at the probe wavelength, practically all the rotation is due to the plasma component, which can be expressed as delta(sub p)= 2pi(e(sup 3))NBL/c(sup 2)nm*(sup 2) omega(sup 2). In this equation, delta(sub p) is the rotation angle due to the free carrier plasma, N is the free carrier concentration, B the magnetic field strength, L the thickness of the sample, n the index of refraction, omega the probe radiation frequency, c the speed of light, e the electron charge, and m* the effective mass. A measurement of N by conventional techniques, combined with a measurement of the Faraday rotation angle allows m* to be accurately determined since it is an inverse square function.

KSC-01pp1169

NASA Image and Video Library

2001-06-18

KENNEDY SPACE CENTER, Fla. -- In KSC’s Spacecraft Assembly and Encapsulation Facility -2, workers lower a canister over the Microwave Anisotropy Probe (MAP) before transporting to Launch Complex 17, Cape Canaveral Air Force Station. Launch of MAP via a Boeing Delta II rocket is scheduled for June 30.

Nanoscale laminin coating modulates cortical scarring response around implanted silicon microelectrode arrays

NASA Astrophysics Data System (ADS)

He, Wei; McConnell, George C.; Bellamkonda, Ravi V.

2006-12-01

Neural electrodes could significantly enhance the quality of life for patients with sensory and/or motor deficits as well as improve our understanding of brain functions. However, long-term electrical connectivity between neural tissue and recording sites is compromised by the development of astroglial scar around the recording probes. In this study we investigate the effect of a nanoscale laminin (LN) coating on Si-based neural probes on chronic cortical tissue reaction in a rat model. Tissue reaction was evaluated after 1 day, 1 week, and 4 weeks post-implant for coated and uncoated probes using immunohistochemical techniques to evaluate activated microglia/macrophages (ED-1), astrocytes (GFAP) and neurons (NeuN). The coating did not have an observable effect on neuronal density or proximity to the electrode surface. However, the response of microglia/macrophages and astrocytes was altered by the coating. One day post-implant, we observed an ~60% increase in ED-1 expression near LN-coated probe sites compared with control uncoated probe sites. Four weeks post-implant, we observed an ~20% reduction in ED-1 expression along with an ~50% reduction in GFAP expression at coated relative to uncoated probe sites. These results suggest that LN has a stimulatory effect on early microglia activation, accelerating the phagocytic function of these cells. This hypothesis is further supported by the increased mRNA expression of several pro-inflammatory cytokines (TNF-α, IL-1 and IL-6) in cultured microglia on LN-bound Si substrates. LN immunostaining of coated probes immediately after insertion and retrieval demonstrates that the coating integrity is not compromised by the shear force during insertion. We speculate, based on these encouraging results, that LN coating of Si neural probes could potentially improve chronic neural recordings through dispersion of the astroglial scar.

Combining µXANES and µXRD mapping to analyse the heterogeneity in calcium carbonate granules excreted by the earthworm Lumbricus terrestris

PubMed Central

Brinza, Loredana; Schofield, Paul F.; Hodson, Mark E.; Weller, Sophie; Ignatyev, Konstantin; Geraki, Kalotina; Quinn, Paul D.; Mosselmans, J. Frederick W.

2014-01-01

The use of fluorescence full spectral micro-X-ray absorption near-edge structure (µXANES) mapping is becoming more widespread in the hard energy regime. This experimental method using the Ca K-edge combined with micro-X-ray diffraction (µXRD) mapping of the same sample has been enabled on beamline I18 at Diamond Light Source. This combined approach has been used to probe both long- and short-range order in calcium carbonate granules produced by the earthworm Lumbricus terrestris. In granules produced by earthworms cultured in a control artificial soil, calcite and vaterite are observed in the granules. However, granules produced by earthworms cultivated in the same artificial soil amended with 500 p.p.m. Mg also contain an aragonite. The two techniques, µXRD and µXANES, probe different sample volumes but there is good agreement in the phase maps produced. PMID:24365942

Towards the delineation of the ancestral eutherian genome organization: comparative genome maps of human and the African elephant (Loxodonta africana) generated by chromosome painting.

PubMed Central

Frönicke, Lutz; Wienberg, Johannes; Stone, Gary; Adams, Lisa; Stanyon, Roscoe

2003-01-01

This study presents a whole-genome comparison of human and a representative of the Afrotherian clade, the African elephant, generated by reciprocal Zoo-FISH. An analysis of Afrotheria genomes is of special interest, because recent DNA sequence comparisons identify them as the oldest placental mammalian clade. Complete sets of whole-chromosome specific painting probes for the African elephant and human were constructed by degenerate oligonucleotide-primed PCR amplification of flow-sorted chromosomes. Comparative genome maps are presented based on their hybridization patterns. These maps show that the elephant has a moderately rearranged chromosome complement when compared to humans. The human paint probes identified 53 evolutionary conserved segments on the 27 autosomal elephant chromosomes and the X chromosome. Reciprocal experiments with elephant probes delineated 68 conserved segments in the human genome. The comparison with a recent aardvark and elephant Zoo-FISH study delineates new chromosomal traits which link the two Afrotherian species phylogenetically. In the absence of any morphological evidence the chromosome painting data offer the first non-DNA sequence support for an Afrotherian clade. The comparative human and elephant genome maps provide new insights into the karyotype organization of the proto-afrotherian, the ancestor of extant placental mammals, which most probably consisted of 2n=46 chromosomes. PMID:12965023

Nanoscale Probing of Thermal, Stress, and Optical Fields under Near-Field Laser Heating

PubMed Central

Tang, Xiaoduan; Xu, Shen; Wang, Xinwei

2013-01-01

Micro/nanoparticle induced near-field laser ultra-focusing and heating has been widely used in laser-assisted nanopatterning and nanolithography to pattern nanoscale features on a large-area substrate. Knowledge of the temperature and stress in the nanoscale near-field heating region is critical for process control and optimization. At present, probing of the nanoscale temperature, stress, and optical fields remains a great challenge since the heating area is very small (∼100 nm or less) and not immediately accessible for sensing. In this work, we report the first experimental study on nanoscale mapping of particle-induced thermal, stress, and optical fields by using a single laser for both near-field excitation and Raman probing. The mapping results based on Raman intensity variation, wavenumber shift, and linewidth broadening all give consistent conjugated thermal, stress, and near-field focusing effects at a 20 nm resolution (<λ/26, λ = 32 nm). Nanoscale mapping of near-field effects of particles from 1210 down to 160 nm demonstrates the strong capacity of such a technique. By developing a new strategy for physical analysis, we have de-conjugated the effects of temperature, stress, and near-field focusing from the Raman mapping. The temperature rise and stress in the nanoscale heating region is evaluated at different energy levels. High-fidelity electromagnetic and temperature field simulation is conducted to accurately interpret the experimental results. PMID:23555566

Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

PubMed Central

O'Connor, Timothy R.; Bailey, Timothy L.

2014-01-01

Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

Contingency Planning for the Microwave Anisotropy Probe Mission

NASA Technical Reports Server (NTRS)

Mesarch, Michael A.; Rohrbaugh, David; Schiff, Conrad; Bauer, Frank (Technical Monitor)

2002-01-01

The Microwave Anisotropy Probe (MAP) utilized a phasing loop/lunar encounter strategy to achieve a small amplitude Lissajous orbit about the Sun-Earth/Moon L2 libration point. The use of phasing loops was key in minimizing MAP's overall deltaV needs while also providing ample opportunities for contingency resolution. This paper will discuss the different contingencies and responses studied for MAP. These contingencies included accommodating excessive launch vehicle errors (beyond 3 sigma), splitting perigee maneuvers to achieve ground station coverage through the Deep Space Network (DSN), delaying the start of a perigee maneuver, aborting a perigee maneuver in the middle of execution, missing a perigee maneuver altogether, and missing the lunar encounter (crucial to achieving the final Lissajous orbit). It is determined that using a phasing loop approach permits many opportunities to correct for a majority of these contingencies.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Conformational Dynamics inside Amino-Terminal Disease Hotspot of Ryanodine Receptor

PubMed Central

Zhong, Xiaowei; Liu, Ying; Zhu, Li; Meng, Xing; Wang, Ruiwu; Van Petegem, Filip; Wagenknecht, Terence; Wayne Chen, S. R.; Liu, Zheng

2013-01-01

Summary The N-terminal region of both skeletal and cardiac ryanodine receptor is a disease mutation hotspot. Recently, a crystal structure of the RyR1 fragment (residues 1-559) was solved. This N-terminal structure contains three separate domains, A, B, and C, and was docked into a central vestibule in a full-length RyR1 cryo-EM map. Here we reconstructed 3D cryo-EM structures of two GFP-tagged RyR2s with GFP inserted after residue Glu-310 and Ser-437, respectively. The structures of RyR2E310-GFP and RyR2S437-GFP displayed an extra mass on domain B and C, directly validating the predicted docking model. Next, we revealed domain movements in molecular dynamics flexible fitting models in both the closed and open state cryo-EM maps. To further probe the conformational changes, we generated FRET pairs by inserting CFP or YFP in two selected domains, FRET studies of three dual-insertion pairs and three co-expressed single-insertion pairs showed the dynamic structural changes within the N-terminal domains. PMID:24139989

Inheritance of RFLP loci in a loblolly pine three-generation pedigree

Treesearch

M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale

1991-01-01

A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...

Optimal stimulus scheduling for active estimation of evoked brain networks.

PubMed

Kafashan, MohammadMehdi; Ching, ShiNung

2015-12-01

We consider the problem of optimal probing to learn connections in an evoked dynamic network. Such a network, in which each edge measures an input-output relationship between sites in sensor/actuator-space, is relevant to emerging applications in neural mapping and neural connectivity estimation. We show that the problem of scheduling nodes to a probe (i.e., stimulate) amounts to a problem of optimal sensor scheduling. By formulating the evoked network in state-space, we show that the solution to the greedy probing strategy has a convenient form and, under certain conditions, is optimal over a finite horizon. We adopt an expectation maximization technique to update the state-space parameters in an online fashion and demonstrate the efficacy of the overall approach in a series of detailed numerical examples. The proposed method provides a principled means to actively probe time-varying connections in neuronal networks. The overall method can be implemented in real time and is particularly well-suited to applications in stimulation-based cortical mapping in which the underlying network dynamics are changing over time.

Optimal stimulus scheduling for active estimation of evoked brain networks

NASA Astrophysics Data System (ADS)

Kafashan, MohammadMehdi; Ching, ShiNung

2015-12-01

Objective. We consider the problem of optimal probing to learn connections in an evoked dynamic network. Such a network, in which each edge measures an input-output relationship between sites in sensor/actuator-space, is relevant to emerging applications in neural mapping and neural connectivity estimation. Approach. We show that the problem of scheduling nodes to a probe (i.e., stimulate) amounts to a problem of optimal sensor scheduling. Main results. By formulating the evoked network in state-space, we show that the solution to the greedy probing strategy has a convenient form and, under certain conditions, is optimal over a finite horizon. We adopt an expectation maximization technique to update the state-space parameters in an online fashion and demonstrate the efficacy of the overall approach in a series of detailed numerical examples. Significance. The proposed method provides a principled means to actively probe time-varying connections in neuronal networks. The overall method can be implemented in real time and is particularly well-suited to applications in stimulation-based cortical mapping in which the underlying network dynamics are changing over time.

Line Intensity Mapping during the Epoch of Reionization

NASA Astrophysics Data System (ADS)

Silva, Marta B.; Zaroubi, Saleem

2018-05-01

Characterizing the properties and the evolution of the first stars and galaxies is a challenging task for traditional galaxy surveys since they are sensitivity limited and can only detect the brightest light sources. Three-dimensional intensity mapping (IM) of transition lines can be a valuable alternative to study the high redshift Universe given that this technique avoids sensitivity limitation problems by measuring the overall emission of a line, with a low resolution, without resolving its sources. While 21cm line IM surveys probe neutral hydrogen gas and can, therefore, be used to probe the state of the IGM and the evolution of the ionization field during the Epoch of Reionization (EoR). IM surveys of other lines, such as CO, CII, Ly-alpha or H-alpha, can be used to probe the galaxies which emitted most of the ionizing radiation responsible for the EoR. These lines will trace the different ISM gas phases, the excitation state of this gas, its metallicity, etc. This study addresses IM of multiple transition lines and how it can be used to probe the EoR and to constrain the redshift evolution of galaxy properties.

An expanded genetic code for probing the role of electrostatics in enzyme catalysis by vibrational Stark spectroscopy.

PubMed

Völler, Jan-Stefan; Biava, Hernan; Hildebrandt, Peter; Budisa, Nediljko

2017-11-01

To find experimental validation for electrostatic interactions essential for catalytic reactions represents a challenge due to practical limitations in assessing electric fields within protein structures. This review examines the applications of non-canonical amino acids (ncAAs) as genetically encoded probes for studying the role of electrostatic interactions in enzyme catalysis. ncAAs constitute sensitive spectroscopic probes to detect local electric fields by exploiting the vibrational Stark effect (VSE) and thus have the potential to map the protein electrostatics. Mapping the electrostatics in proteins will improve our understanding of natural catalytic processes and, in beyond, will be helpful for biocatalyst engineering. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

Mapping out the Details: Supporting Struggling Writers' Written Expression with Concept Mapping

ERIC Educational Resources Information Center

Flanagan, Sara M.; Bouck, Emily C.

2015-01-01

Written expression is a key component of the secondary curriculum, but many students struggle to produce effective written expression passages. However, written expression can be supported through prewriting strategies such as concept mapping. Using a counterbalanced group design, 19 secondary students alternated between using paper- or…

Exon-Specific QTLs Skew the Inferred Distribution of Expression QTLs Detected Using Gene Expression Array Data

PubMed Central

Veyrieras, Jean-Baptiste; Gaffney, Daniel J.; Pickrell, Joseph K.; Gilad, Yoav; Stephens, Matthew; Pritchard, Jonathan K.

2012-01-01

Mapping of expression quantitative trait loci (eQTLs) is an important technique for studying how genetic variation affects gene regulation in natural populations. In a previous study using Illumina expression data from human lymphoblastoid cell lines, we reported that cis-eQTLs are especially enriched around transcription start sites (TSSs) and immediately upstream of transcription end sites (TESs). In this paper, we revisit the distribution of eQTLs using additional data from Affymetrix exon arrays and from RNA sequencing. We confirm that most eQTLs lie close to the target genes; that transcribed regions are generally enriched for eQTLs; that eQTLs are more abundant in exons than introns; and that the peak density of eQTLs occurs at the TSS. However, we find that the intriguing TES peak is greatly reduced or absent in the Affymetrix and RNA-seq data. Instead our data suggest that the TES peak observed in the Illumina data is mainly due to exon-specific QTLs that affect 3′ untranslated regions, where most of the Illumina probes are positioned. Nonetheless, we do observe an overall enrichment of eQTLs in exons versus introns in all three data sets, consistent with an important role for exonic sequences in gene regulation. PMID:22359548

Calibrating CHIME: a new radio interferometer to probe dark energy

NASA Astrophysics Data System (ADS)

Newburgh, Laura B.; Addison, Graeme E.; Amiri, Mandana; Bandura, Kevin; Bond, J. Richard; Connor, Liam; Cliche, Jean-François; Davis, Greg; Deng, Meiling; Denman, Nolan; Dobbs, Matt; Fandino, Mateus; Fong, Heather; Gibbs, Kenneth; Gilbert, Adam; Griffin, Elizabeth; Halpern, Mark; Hanna, David; Hincks, Adam D.; Hinshaw, Gary; Höfer, Carolin; Klages, Peter; Landecker, Tom; Masui, Kiyoshi; Parra, Juan Mena; Pen, Ue-Li; Peterson, Jeff; Recnik, Andre; Shaw, J. Richard; Sigurdson, Kris; Sitwell, Micheal; Smecher, Graeme; Smegal, Rick; Vanderlinde, Keith; Wiebe, Don

2014-07-01

The Canadian Hydrogen Intensity Mapping Experiment (CHIME) is a transit interferometer currently being built at the Dominion Radio Astrophysical Observatory (DRAO) in Penticton, BC, Canada. We will use CHIME to map neutral hydrogen in the frequency range 400 { 800MHz over half of the sky, producing a measurement of baryon acoustic oscillations (BAO) at redshifts between 0.8 { 2.5 to probe dark energy. We have deployed a pathfinder version of CHIME that will yield constraints on the BAO power spectrum and provide a test-bed for our calibration scheme. I will discuss the CHIME calibration requirements and describe instrumentation we are developing to meet these requirements.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Tony Y.; Wechsler, Risa H.; Devaraj, Kiruthika

Intensity mapping, which images a single spectral line from unresolved galaxies across cosmological volumes, is a promising technique for probing the early universe. Here we present predictions for the intensity map and power spectrum of the CO(1–0) line from galaxies atmore » $$z\\sim 2.4$$–2.8, based on a parameterized model for the galaxy–halo connection, and demonstrate the extent to which properties of high-redshift galaxies can be directly inferred from such observations. We find that our fiducial prediction should be detectable by a realistic experiment. Motivated by significant modeling uncertainties, we demonstrate the effect on the power spectrum of varying each parameter in our model. Using simulated observations, we infer constraints on our model parameter space with an MCMC procedure, and show corresponding constraints on the $${L}_{\\mathrm{IR}}$$–$${L}_{\\mathrm{CO}}$$ relation and the CO luminosity function. These constraints would be complementary to current high-redshift galaxy observations, which can detect the brightest galaxies but not complete samples from the faint end of the luminosity function. Furthermore, by probing these populations in aggregate, CO intensity mapping could be a valuable tool for probing molecular gas and its relation to star formation in high-redshift galaxies.« less

Detection of an electron beam in a high density plasma via an electrostatic probe

NASA Astrophysics Data System (ADS)

Majeski, Stephen; Yoo, Jongsoo; Zweben, Stewart; Yamada, Masaaki; Ji, Hantao

2017-10-01

The perturbation in floating potential by an electron beam is detected by a 1D floating potential probe array to evaluate the use of an electron beam for magnetic field line mapping in the Magnetic Reconnection Experiment (MRX) plasma. The MRX plasma is relatively high density (1013 cm-3) and low temperature (5 eV). Beam electrons are emitted from a tungsten filament and are accelerated by a 200 V potential across the sheath. They stream along the magnetic field lines towards the probe array. The spatial electron beam density profile is assumed to be a Gaussian along the radial axis of MRX and the effective beam width is determined from the radial profile of the floating potential. The magnitude of the perturbation is in agreement with theoretical predictions and the location of the perturbation is also in agreement with field line mapping. In addition, no significant broadening of the electron beam is observed after propagation for tens of centimeters through the high density plasma. These results demonstrate that this method of field line mapping is, in principle, feasible in high density plasmas. This work is supported by the DOE Contract No. DE-AC0209CH11466.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray.

PubMed

Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén

2009-10-13

It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray

PubMed Central

2009-01-01

Background It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Results Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. Conclusion The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction. PMID:19825185

Extensive Conserved Synteny of Genes between the Karyotypes of Manduca sexta and Bombyx mori Revealed by BAC-FISH Mapping

PubMed Central

Tanaka-Okuyama, Makiko; Shibata, Fukashi; Yoshido, Atsuo; Marec, František; Wu, Chengcang; Zhang, Hongbin; Goldsmith, Marian R.

2009-01-01

Background Genome sequencing projects have been completed for several species representing four highly diverged holometabolous insect orders, Diptera, Hymenoptera, Coleoptera, and Lepidoptera. The striking evolutionary diversity of insects argues a need for efficient methods to apply genome information from such models to genetically uncharacterized species. Constructing conserved synteny maps plays a crucial role in this task. Here, we demonstrate the use of fluorescence in situ hybridization with bacterial artificial chromosome probes as a powerful tool for physical mapping of genes and comparative genome analysis in Lepidoptera, which have numerous and morphologically uniform holokinetic chromosomes. Methodology/Principal Findings We isolated 214 clones containing 159 orthologs of well conserved single-copy genes of a sequenced lepidopteran model, the silkworm, Bombyx mori, from a BAC library of a sphingid with an unexplored genome, the tobacco hornworm, Manduca sexta. We then constructed a BAC-FISH karyotype identifying all 28 chromosomes of M. sexta by mapping 124 loci using the corresponding BAC clones. BAC probes from three M. sexta chromosomes also generated clear signals on the corresponding chromosomes of the convolvulus hawk moth, Agrius convolvuli, which belongs to the same subfamily, Sphinginae, as M. sexta. Conclusions/Significance Comparison of the M. sexta BAC physical map with the linkage map and genome sequence of B. mori pointed to extensive conserved synteny including conserved gene order in most chromosomes. Only a few rearrangements, including three inversions, three translocations, and two fission/fusion events were estimated to have occurred after the divergence of Bombycidae and Sphingidae. These results add to accumulating evidence for the stability of lepidopteran genomes. Generating signals on A. convolvuli chromosomes using heterologous M. sexta probes demonstrated that BAC-FISH with orthologous sequences can be used for karyotyping a wide range of related and genetically uncharacterized species, significantly extending the ability to develop synteny maps for comparative and functional genomics. PMID:19829706

Expression analysis and in silico characterization of intronic long noncoding RNAs in renal cell carcinoma: emerging functional associations

PubMed Central

2013-01-01

Background Intronic and intergenic long noncoding RNAs (lncRNAs) are emerging gene expression regulators. The molecular pathogenesis of renal cell carcinoma (RCC) is still poorly understood, and in particular, limited studies are available for intronic lncRNAs expressed in RCC. Methods Microarray experiments were performed with custom-designed arrays enriched with probes for lncRNAs mapping to intronic genomic regions. Samples from 18 primary RCC tumors and 11 nontumor adjacent matched tissues were analyzed. Meta-analyses were performed with microarray expression data from three additional human tissues (normal liver, prostate tumor and kidney nontumor samples), and with large-scale public data for epigenetic regulatory marks and for evolutionarily conserved sequences. Results A signature of 29 intronic lncRNAs differentially expressed between RCC and nontumor samples was obtained (false discovery rate (FDR) <5%). A signature of 26 intronic lncRNAs significantly correlated with the RCC five-year patient survival outcome was identified (FDR <5%, p-value ≤0.01). We identified 4303 intronic antisense lncRNAs expressed in RCC, of which 22% were significantly (p <0.05) cis correlated with the expression of the mRNA in the same locus across RCC and three other human tissues. Gene Ontology (GO) analysis of those loci pointed to 'regulation of biological processes’ as the main enriched category. A module map analysis of the protein-coding genes significantly (p <0.05) trans correlated with the 20% most abundant lncRNAs, identified 51 enriched GO terms (p <0.05). We determined that 60% of the expressed lncRNAs are evolutionarily conserved. At the genomic loci containing the intronic RCC-expressed lncRNAs, a strong association (p <0.001) was found between their transcription start sites and genomic marks such as CpG islands, RNA Pol II binding and histones methylation and acetylation. Conclusion Intronic antisense lncRNAs are widely expressed in RCC tumors. Some of them are significantly altered in RCC in comparison with nontumor samples. The majority of these lncRNAs is evolutionarily conserved and possibly modulated by epigenetic modifications. Our data suggest that these RCC lncRNAs may contribute to the complex network of regulatory RNAs playing a role in renal cell malignant transformation. PMID:24238219

Capturing relativistic wakefield structures in plasmas using ultrashort high-energy electrons as a probe

DOE PAGES

Zhang, C. J.; Hua, J. F.; Xu, X. L.; ...

2016-07-11

A new method capable of capturing coherent electric field structures propagating at nearly the speed of light in plasma with a time resolution as small as a few femtoseconds is proposed. This method uses a few femtoseconds long relativistic electron bunch to probe the wake produced in a plasma by an intense laser pulse or an ultra-short relativistic charged particle beam. As the probe bunch traverses the wake, its momentum is modulated by the electric field of the wake, leading to a density variation of the probe after free-space propagation. This variation of probe density produces a snapshot of themore » wake that can directly give many useful information of the wake structure and its evolution. Furthermore, this snapshot allows detailed mapping of the longitudinal and transverse components of the wakefield. We develop a theoretical model for field reconstruction and verify it using 3-dimensional particle-in-cell (PIC) simulations. This model can accurately reconstruct the wakefield structure in the linear regime, and it can also qualitatively map the major features of nonlinear wakes. As a result, the capturing of the injection in a nonlinear wake is demonstrated through 3D PIC simulations as an example of the application of this new method.« less

PigGIS: Pig Genomic Informatics System

PubMed Central

Ruan, Jue; Guo, Yiran; Li, Heng; Hu, Yafeng; Song, Fei; Huang, Xin; Kristiensen, Karsten; Bolund, Lars; Wang, Jun

2007-01-01

Pig Genomic Information System (PigGIS) is a web-based depository of pig (Sus scrofa) genomic learning mainly engineered for biomedical research to locate pig genes from their human homologs and position single nucleotide polymorphisms (SNPs) in different pig populations. It utilizes a variety of sequence data, including whole genome shotgun (WGS) reads and expressed sequence tags (ESTs), and achieves a successful mapping solution to the low-coverage genome problem. With the data presently available, we have identified a total of 15 700 pig consensus sequences covering 18.5 Mb of the homologous human exons. We have also recovered 18 700 SNPs and 20 800 unique 60mer oligonucleotide probes for future pig genome analyses. PigGIS can be freely accessed via the web at and . PMID:17090590

Radical probing of spliceosome assembly.

PubMed

Grewal, Charnpal S; Kent, Oliver A; MacMillan, Andrew M

2017-08-01

Here we describe the synthesis and use of a directed hydroxyl radical probe, tethered to a pre-mRNA substrate, to map the structure of this substrate during the spliceosome assembly process. These studies indicate an early organization and proximation of conserved pre-mRNA sequences during spliceosome assembly. This methodology may be adapted to the synthesis of a wide variety of modified RNAs for use as probes of RNA structure and RNA-protein interaction. Copyright © 2017 Elsevier Inc. All rights reserved.

KSC-01pp1170

NASA Image and Video Library

2001-06-18

KENNEDY SPACE CENTER, Fla. -- In KSC’s Spacecraft Assembly and Encapsulation Facility -2, workers adjust the canister as it is lowered over the Microwave Anisotropy Probe (MAP). The spacecraft will be transported to Launch Complex 17, Cape Canaveral Air Force Station. Launch of MAP via a Boeing Delta II rocket is scheduled for June 30

Facilitating in vivo tumor localization by principal component analysis based on dynamic fluorescence molecular imaging

NASA Astrophysics Data System (ADS)

Gao, Yang; Chen, Maomao; Wu, Junyu; Zhou, Yuan; Cai, Chuangjian; Wang, Daliang; Luo, Jianwen

2017-09-01

Fluorescence molecular imaging has been used to target tumors in mice with xenograft tumors. However, tumor imaging is largely distorted by the aggregation of fluorescent probes in the liver. A principal component analysis (PCA)-based strategy was applied on the in vivo dynamic fluorescence imaging results of three mice with xenograft tumors to facilitate tumor imaging, with the help of a tumor-specific fluorescent probe. Tumor-relevant features were extracted from the original images by PCA and represented by the principal component (PC) maps. The second principal component (PC2) map represented the tumor-related features, and the first principal component (PC1) map retained the original pharmacokinetic profiles, especially of the liver. The distribution patterns of the PC2 map of the tumor-bearing mice were in good agreement with the actual tumor location. The tumor-to-liver ratio and contrast-to-noise ratio were significantly higher on the PC2 map than on the original images, thus distinguishing the tumor from its nearby fluorescence noise of liver. The results suggest that the PC2 map could serve as a bioimaging marker to facilitate in vivo tumor localization, and dynamic fluorescence molecular imaging with PCA could be a valuable tool for future studies of in vivo tumor metabolism and progression.

Elemental mapping of large samples by external ion beam analysis with sub-millimeter resolution and its applications

NASA Astrophysics Data System (ADS)

Silva, T. F.; Rodrigues, C. L.; Added, N.; Rizzutto, M. A.; Tabacniks, M. H.; Mangiarotti, A.; Curado, J. F.; Aguirre, F. R.; Aguero, N. F.; Allegro, P. R. P.; Campos, P. H. O. V.; Restrepo, J. M.; Trindade, G. F.; Antonio, M. R.; Assis, R. F.; Leite, A. R.

2018-05-01

The elemental mapping of large areas using ion beam techniques is a desired capability for several scientific communities, involved on topics ranging from geoscience to cultural heritage. Usually, the constraints for large-area mapping are not met in setups employing micro- and nano-probes implemented all over the world. A novel setup for mapping large sized samples in an external beam was recently built at the University of São Paulo employing a broad MeV-proton probe with sub-millimeter dimension, coupled to a high-precision large range XYZ robotic stage (60 cm range in all axis and precision of 5 μ m ensured by optical sensors). An important issue on large area mapping is how to deal with the irregularities of the sample's surface, that may introduce artifacts in the images due to the variation of the measuring conditions. In our setup, we implemented an automatic system based on machine vision to correct the position of the sample to compensate for its surface irregularities. As an additional benefit, a 3D digital reconstruction of the scanned surface can also be obtained. Using this new and unique setup, we have produced large-area elemental maps of ceramics, stones, fossils, and other sort of samples.

Disruption of AP3B1 by a chromosome 5 inversion: a new disease mechanism in Hermansky-Pudlak syndrome type 2.

PubMed

Jones, Matthew L; Murden, Sherina L; Brooks, Claire; Maloney, Viv; Manning, Richard A; Gilmour, Kimberly C; Bharadwaj, Vandana; de la Fuente, Josu; Chakravorty, Subarna; Mumford, Andrew D

2013-04-04

Hermansky-Pudlak syndrome 2 (HPS2; OMIM #608233) is a rare, autosomal recessive disorder caused by loss-of-function genetic variations affecting AP3B1, which encodes the β3A subunit of the adaptor-related protein complex 3 (AP3). Phenotypic characteristics include reduced pigmentation, absent platelet dense granule secretion, neutropenia and reduced cytotoxic T lymphocyte (CTL) and natural killer (NK) cell function. To date HPS2 has been associated with non-synonymous, stop-gain or deletion-insertion nucleotide variations within the coding region of AP3B1. We describe a consanguineous female infant with reduced pigmentation, neutropenia and recurrent infections. Platelets displayed reduced aggregation and absent ATP secretion in response to collagen and ADP, indicating a platelet dense granule defect. There was increased basal surface expression of CD107a (lysosome-associated membrane protein 1(LAMP-1)) on NK cells and CTLs from the study subject and a smaller increase in the percentage of CD107a positive cells after stimulation compared to most healthy controls. Immunoblotting of protein extracts from EBV-transformed lymphoblasts from the index case showed absent expression of full-length AP-3 β3A subunit protein, confirming a phenotypic diagnosis of HPS2.The index case displayed a homozygous pericentric inv(5)(p15.1q14.1), which was also detected as a heterozygous defect in both parents of the index case. No loss of genetic material was demonstrated by microarray comparative genome hybridisation at 60kb resolution. Fluorescence in-situ hybridisation using the 189.6kb probe RP11-422I12, which maps to 5q14.1, demonstrated dual hybridisation to both 5q14.1 and 5p15.1 regions of the inverted Chr5. The RP11-422I12 probe maps from intron 1 to intron 16 of AP3B1, thus localising the 5q inversion breakpoint to within AP3B1. The probe RP11-211K15, which corresponds to an intergenic region on 5p also showed dual hybridisation, enabling localisation of the 5p inversion breakpoint. This case report extends the phenotypic description of the very rare disorder HPS2. Our demonstration of a homozygous Chr5 inversion predicted to disrupt AP3B1 gene provides a novel pathogenic mechanism for this disorder.

Evaluation of prognostic and predictive value of microtubule associated protein tau in two independent cohorts

PubMed Central

2011-01-01

Introduction Microtubule associated proteins (MAPs) endogenously regulate microtubule stabilization and have been reported as prognostic and predictive markers for taxane response. The microtubule stabilizer, MAP-tau, has shown conflicting results. We quantitatively assessed MAP-tau expression in two independent breast cancer cohorts to determine prognostic and predictive value of this biomarker. Methods MAP-tau expression was evaluated in the retrospective Yale University breast cancer cohort (n = 651) using tissue microarrays and also in the TAX 307 cohort, a clinical trial randomized for TAC versus FAC chemotherapy (n = 140), using conventional whole tissue sections. Expression was measured using the AQUA method for quantitative immunofluorescence. Scores were correlated with clinicopathologic variables, survival, and response to therapy. Results Assessment of the Yale cohort using Cox univariate analysis indicated an improved overall survival (OS) in tumors with a positive correlation between high MAP-tau expression and overall survival (OS) (HR = 0.691, 95% CI = 0.489-0.974; P = 0.004). Kaplan Meier analysis showed 10-year survival for 65% of patients with high MAP-tau expression compared to 52% with low expression (P = .006). In TAX 307, high expression was associated with significantly longer median time to tumor progression (TTP) regardless of treatment arm (33.0 versus 23.4 months, P = 0.010) with mean TTP of 31.2 months. Response rates did not differ by MAP-tau expression (P = 0.518) or by treatment arm (P = 0.584). Conclusions Quantitative measurement of MAP-tau expression has prognostic value in both cohorts, with high expression associated with longer TTP and OS. Differences by treatment arm or response rate in low versus high MAP-tau groups were not observed, indicating that MAP-tau is not associated with response to taxanes and is not a useful predictive marker for taxane-based chemotherapy. PMID:21888627

Chromosomal rearrangements and karyotype evolution in carnivores revealed by chromosome painting

PubMed Central

Nie, W; Wang, J; Su, W; Wang, D; Tanomtong, A; Perelman, P L; Graphodatsky, A S; Yang, F

2012-01-01

Chromosomal evolution in carnivores has been revisited extensively using cross-species chromosome painting. Painting probes derived from flow-sorted chromosomes of the domestic dog, which has one of the most rearranged karyotypes in mammals and the highest dipoid number (2n=78) in carnivores, are a powerful tool in detecting both evolutionary intra- and inter-chromosomal rearrangements. However, only a few comparative maps have been established between dog and other non-Canidae species. Here, we extended cross-species painting with dog probes to seven more species representing six carnivore families: Eurasian lynx (Lynx lynx), the stone marten (Martes foina), the small Indian civet (Viverricula indica), the Asian palm civet (Paradoxurus hermaphrodites), Javan mongoose (Hepestes javanicas), the raccoon (Procyon lotor) and the giant panda (Ailuropoda melanoleuca). The numbers and positions of intra-chromosomal rearrangements were found to differ among these carnivore species. A comparative map between human and stone marten, and a map among the Yangtze finless porpoise (Neophocaena phocaenoides asiaeorientalis), stone marten and human were also established to facilitate outgroup comparison and to integrate comparative maps between stone marten and other carnivores with such maps between human and other species. These comparative maps give further insight into genome evolution and karyotype phylogenetic relationships among carnivores, and will facilitate the transfer of gene mapping data from human, domestic dog and cat to other species. PMID:22086079

Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

NASA Astrophysics Data System (ADS)

Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

2016-11-01

Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Digital detection of multiple minority mutants and expression levels of multiple colorectal cancer-related genes using digital-PCR coupled with bead-array.

PubMed

Huang, Huan; Li, Shuo; Sun, Lizhou; Zhou, Guohua

2015-01-01

To simultaneously analyze mutations and expression levels of multiple genes on one detection platform, we proposed a method termed "multiplex ligation-dependent probe amplification-digital amplification coupled with hydrogel bead-array" (MLPA-DABA) and applied it to diagnose colorectal cancer (CRC). CRC cells and tissues were sampled to extract nucleic acid, perform MLPA with sequence-tagged probes, perform digital emulsion polymerase chain reaction (PCR), and produce a hydrogel bead-array to immobilize beads and form a single bead layer on the array. After hybridization with fluorescent probes, the number of colored beads, which reflects the abundance of expressed genes and the mutation rate, was counted for diagnosis. Only red or green beads occurred on the chips in the mixed samples, indicating the success of single-molecule PCR. When a one-source sample was analyzed using mixed MLPA probes, beads of only one color occurred, suggesting the high specificity of the method in analyzing CRC mutation and gene expression. In gene expression analysis of a CRC tissue from one CRC patient, the mutant percentage was 3.1%, and the expression levels of CRC-related genes were much higher than those of normal tissue. The highly sensitive MLPA-DABA succeeds in the relative quantification of mutations and gene expressions of exfoliated cells in stool samples of CRC patients on the same chip platform. MLPA-DABA coupled with hydrogel bead-array is a promising method in the non-invasive diagnosis of CRC.

Human retinoblastoma susceptibility gene: genomic organization and analysis of heterozygous intragenic deletion mutants.

PubMed Central

Bookstein, R; Lee, E Y; To, H; Young, L J; Sery, T W; Hayes, R C; Friedmann, T; Lee, W H

1988-01-01

A gene in chromosome region 13q14 has been identified as the human retinoblastoma susceptibility (RB) gene on the basis of altered gene expression found in virtually all retinoblastomas. In order to further characterize the RB gene and its structural alterations, we examined genomic clones of the RB gene isolated from both a normal human genomic library and a library made from DNA of the retinoblastoma cell line Y79. First, a restriction and exon map of the RB gene was constructed by aligning overlapping genomic clones, yielding three contiguous regions ("contigs") of 150 kilobases total length separated by two gaps. At least 20 exons were identified in genomic clones, and these were provisionally numbered. Second, two overlapping genomic clones that demonstrated a DNA deletion of exons 2 through 6 from one RB allele were isolated from the Y79 library. To confirm and extend this result, a unique sequence probe from intron 1 was used to detect similar and possibly identical heterozygous deletions in genomic DNA from three retinoblastoma cell lines, thereby explaining the origins of their shortened RB mRNA transcripts. The same probe detected genomic rearrangements in fibroblasts from two hereditary retinoblastoma patients, indicating that intron 1 includes a frequent site for mutations conferring predisposition to retinoblastoma. Third, this probe also detected a polymorphic site for BamHI with allele frequencies near 0.5/0.5. Identification of commonly mutated regions will contribute significantly to genetic diagnosis in retinoblastoma patients and families. Images PMID:2895471

Constitutive expression of a grapevine polygalacturonase-inhibiting protein affects gene expression and cell wall properties in uninfected tobacco

PubMed Central

2011-01-01

Background Polygalacturonase-inhibiting proteins (PGIPs) directly limit the effective ingress of fungal pathogens by inhibiting cell wall-degrading endopolygalacturonases (ePGs). Transgenic tobacco plants over-expressing grapevine (Vitis vinifera) Vvpgip1 have previously been shown to be resistant to Botrytis infection. In this study we characterized two of these PGIP over-expressing lines with known resistance phenotypes by gene expression and hormone profiling in the absence of pathogen infection. Results Global gene expression was performed by a cross-species microarray approach using a potato cDNA microarray. The degree of potential cross-hybridization between probes was modeled by a novel computational workflow designed in-house. Probe annotations were updated by predicting probe-to-transcript hybridizations and combining information derived from other plant species. Comparing uninfected Vvpgip1-overexpressing lines to wild-type (WT), 318 probes showed significant change in expression. Functional groups of genes involved in metabolism and associated to the cell wall were identified and consequent cell wall analysis revealed increased lignin-levels in the transgenic lines, but no major differences in cell wall-derived polysaccharides. GO enrichment analysis also identified genes responsive to auxin, which was supported by elevated indole-acetic acid (IAA) levels in the transgenic lines. Finally, a down-regulation of xyloglucan endotransglycosylase/hydrolases (XTHs), which are important in cell wall remodeling, was linked to a decrease in total XTH activity. Conclusions This evaluation of PGIP over-expressing plants performed under pathogen-free conditions to exclude the classical PGIP-ePG inhibition interaction indicates additional roles for PGIPs beyond the inhibition of ePGs. PMID:22078230

Counting the Nouns: Simple Structural Cues to Verb Meaning

ERIC Educational Resources Information Center

Yuan, Sylvia; Fisher, Cynthia; Snedeker, Jesse

2012-01-01

Two-year-olds use the sentence structures verbs appear in--"subcategorization frames"--to guide verb learning. This is syntactic bootstrapping. This study probed the developmental origins of this ability. The structure-mapping account proposes that children begin with a bias toward one-to-one mapping between nouns in sentences and participant…

Characterization of a microdissection library from human chromosome region 3p14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bardenheuer, W.; Szymanski, S.; Lux, A.

1994-01-15

Structural alterations in human chromosome region 3p14-p23 resulting in the inactivation of one or more tumor suppressor genes are thought to play a pathogenic role in small cell lung cancer, renal cell carcinoma, and other human neoplasms. To identify putative tumor suppressor genes, 428 recombinant clones from a microdissection library specific for human chromosome region 3p14 were isolated and characterized. Ninety-six of these (22.5%) were human single-copy DNA sequences, 57 of which were unique sequence clones. Forty-four of these were mapped to the microdissected region using a cell hybrid mapping panel. Within this mapping panel, four probes detected two newmore » chromosome breakpoints that were previously indistinguishable from the translocation breakpoint t(3;8) in 3p14.2 in hereditary renal cell carcinoma. One probe maps to the homozygously deleted region of the small cell lung cancer cell line U2020. In addition, microdissection clones have been shown to be suitable for isolation of yeast artificial chromosomes. 52 refs., 3 figs., 2 tabs.« less

Scanning transmission X-ray, laser scanning, and transmission electron microscopy mapping of the exopolymeric matrix of microbial biofilms.

PubMed

Lawrence, J R; Swerhone, G D W; Leppard, G G; Araki, T; Zhang, X; West, M M; Hitchcock, A P

2003-09-01

Confocal laser scanning microscopy (CLSM), transmission electron microscopy (TEM), and soft X-ray scanning transmission X-ray microscopy (STXM) were used to map the distribution of macromolecular subcomponents (e.g., polysaccharides, proteins, lipids, and nucleic acids) of biofilm cells and matrix. The biofilms were developed from river water supplemented with methanol, and although they comprised a complex microbial community, the biofilms were dominated by heterotrophic bacteria. TEM provided the highest-resolution structural imaging, CLSM provided detailed compositional information when used in conjunction with molecular probes, and STXM provided compositional mapping of macromolecule distributions without the addition of probes. By examining exactly the same region of a sample with combinations of these techniques (STXM with CLSM and STXM with TEM), we demonstrate that this combination of multimicroscopy analysis can be used to create a detailed correlative map of biofilm structure and composition. We are using these correlative techniques to improve our understanding of the biochemical basis for biofilm organization and to assist studies intended to investigate and optimize biofilms for environmental remediation applications.

ICRF-Induced Changes in Floating Potential and Ion Saturation Current in the EAST Divertor

NASA Astrophysics Data System (ADS)

Perkins, Rory; Hosea, Joel; Taylor, Gary; Bertelli, Nicola; Kramer, Gerrit; Qin, Chengming; Wang, Liang; Yang, Jichan; Zhang, Xinjun

2017-10-01

Injection of waves in the ion cyclotron range of frequencies (ICRF) into a tokamak can potentially raise the plasma potential via RF rectification. Probes are affected both by changes in plasma potential and also by RF-averaging of the probe characteristic, with the latter tending to drop the floating potential. We present the effect of ICRF heating on divertor Langmuir probes in the EAST experiment. Over a scan of the outer gap, probes connected to the antennas have increases in floating potential with ICRF, but probes in between the outer-vessel strike point and flux surface tangent to the antenna have decreased floating potential. This behaviour is investigated using field-line mapping. Preliminary results show that mdiplane gas puffing can suppress the strong influence of ICRF on the probes' floating potential.

MAP3K8 (TPL2/COT) affects obesity-induced adipose tissue inflammation without systemic effects in humans and in mice.

PubMed

Ballak, Dov B; van Essen, Peter; van Diepen, Janna A; Jansen, Henry; Hijmans, Anneke; Matsuguchi, Tetsuya; Sparrer, Helmut; Tack, Cees J; Netea, Mihai G; Joosten, Leo A B; Stienstra, Rinke

2014-01-01

Chronic low-grade inflammation in adipose tissue often accompanies obesity, leading to insulin resistance and increasing the risk for metabolic diseases. MAP3K8 (TPL2/COT) is an important signal transductor and activator of pro-inflammatory pathways that has been linked to obesity-induced adipose tissue inflammation. We used human adipose tissue biopsies to study the relationship of MAP3K8 expression with markers of obesity and expression of pro-inflammatory cytokines (IL-1β, IL-6 and IL-8). Moreover, we evaluated obesity-induced adipose tissue inflammation and insulin resistance in mice lacking MAP3K8 and WT mice on a high-fat diet (HFD) for 16 weeks. Individuals with a BMI >30 displayed a higher mRNA expression of MAP3K8 in adipose tissue compared to individuals with a normal BMI. Additionally, high mRNA expression levels of IL-1β, IL-6 and IL-8, but not TNF -α, in human adipose tissue were associated with higher expression of MAP3K8. Moreover, high plasma SAA and CRP did not associate with increased MAP3K8 expression in adipose tissue. Similarly, no association was found for MAP3K8 expression with plasma insulin or glucose levels. Mice lacking MAP3K8 had similar bodyweight gain as WT mice, yet displayed lower mRNA expression levels of IL-1β, IL-6 and CXCL1 in adipose tissue in response to the HFD as compared to WT animals. However, MAP3K8 deficient mice were not protected against HFD-induced adipose tissue macrophage infiltration or the development of insulin resistance. Together, the data in both human and mouse show that MAP3K8 is involved in local adipose tissue inflammation, specifically for IL-1β and its responsive cytokines IL-6 and IL-8, but does not seem to have systemic effects on insulin resistance.

Quantitative trait locus mapping and functional genomics of an organophosphate resistance trait in the western corn rootworm, Diabrotica virgifera virgifera.

PubMed

Coates, B S; Alves, A P; Wang, H; Zhou, X; Nowatzki, T; Chen, H; Rangasamy, M; Robertson, H M; Whitfield, C W; Walden, K K; Kachman, S D; French, B W; Meinke, L J; Hawthorne, D; Abel, C A; Sappington, T W; Siegfried, B D; Miller, N J

2016-02-01

The western corn rootworm, Diabrotica virgifera virgifera, is an insect pest of corn and population suppression with chemical insecticides is an important management tool. Traits conferring organophosphate insecticide resistance have increased in frequency amongst D. v. virgifera populations, resulting in the reduced efficacy in many corn-growing regions of the USA. We used comparative functional genomic and quantitative trait locus (QTL) mapping approaches to investigate the genetic basis of D. v. virgifera resistance to the organophosphate methyl-parathion. RNA from adult methyl-parathion resistant and susceptible adults was hybridized to 8331 microarray probes. The results predicted that 11 transcripts were significantly up-regulated in resistant phenotypes, with the most significant (fold increases ≥ 2.43) being an α-esterase-like transcript. Differential expression was validated only for the α-esterase (ST020027A20C03), with 11- to 13-fold greater expression in methyl-parathion resistant adults (P < 0.05). Progeny with a segregating methyl-parathion resistance trait were obtained from a reciprocal backcross design. QTL analyses of high-throughput single nucleotide polymorphism genotype data predicted involvement of a single genome interval. These data suggest that a specific carboyxesterase may function in field-evolved corn rootworm resistance to organophosphates, even though direct linkage between the QTL and this locus could not be established. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

A Computer-Controlled Classroom Model of an Atomic Force Microscope

NASA Astrophysics Data System (ADS)

Engstrom, Tyler A.; Johnson, Matthew M.; Eklund, Peter C.; Russin, Timothy J.

2015-12-01

The concept of "seeing by feeling" as a way to circumvent limitations on sight is universal on the macroscopic scale—reading Braille, feeling one's way around a dark room, etc. The development of the atomic force microscope (AFM) in 1986 extended this concept to imaging in the nanoscale. While there are classroom demonstrations that use a tactile probe to map the topography or some other property of a sample, the rastering of the probe over the sample is manually controlled, which is both tedious and potentially inaccurate. Other groups have used simulation or tele-operation of an AFM probe. In this paper we describe a teaching AFM with complete computer control to map out topographic and magnetic properties of a "crystal" consisting of two-dimensional arrays of spherical marble "atoms." Our AFM is well suited for lessons on the "Big Ideas of Nanoscale" such as tools and instrumentation, as well as a pre-teaching activity for groups with remote access AFM or mobile AFM. The principle of operation of our classroom AFM is the same as that of a real AFM, excepting the nature of the force between sample and probe.

Codon optimisation to improve expression of a Mycobacterium avium ssp. paratuberculosis-specific membrane-associated antigen by Lactobacillus salivarius.

PubMed

Johnston, Christopher; Douarre, Pierre E; Soulimane, Tewfik; Pletzer, Daniel; Weingart, Helge; MacSharry, John; Coffey, Aidan; Sleator, Roy D; O'Mahony, Jim

2013-06-01

Subunit and DNA-based vaccines against Mycobacterium avium ssp. paratuberculosis (MAP) attempt to overcome inherent issues associated with whole-cell formulations. However, these vaccines can be hampered by poor expression of recombinant antigens from a number of disparate hosts. The high G+C content of MAP invariably leads to a codon bias throughout gene expression. To investigate if the codon bias affects recombinant MAP antigen expression, the open reading frame of a MAP-specific antigen MptD (MAP3733c) was codon optimised for expression against a Lactobacillus salivarius host. Of the total 209 codons which constitute MAP3733c, 172 were modified resulting in a reduced G+C content from 61% for the native gene to 32.7% for the modified form. Both genes were placed under the transcriptional control of the PnisA promoter; allowing controlled heterologous expression in L. salivarius. Expression was monitored using fluorescence microscopy and microplate fluorometry via GFP tags translationally fused to the C-termini of the two MptD genes. A > 37-fold increase in expression was observed for the codon-optimised MAP3733synth variant over the native gene. Due to the low cost and improved expression achieved, codon optimisation significantly improves the potential of L. salivarius as an oral vaccine stratagem against Johne's disease. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Power Control and Monitoring Requirements for Thermal Vacuum/Thermal Balance Testing of the MAP Observatory

NASA Technical Reports Server (NTRS)

Johnson, Chris; Hinkle, R. Kenneth (Technical Monitor)

2002-01-01

The specific heater control requirements for the thermal vacuum and thermal balance testing of the Microwave Anisotropy Probe (MAP) Observatory at the Goddard Space Flight Center (GSFC) in Greenbelt, Maryland are described. The testing was conducted in the 10m wide x 18.3m high Space Environment Simulator (SES) Thermal Vacuum Facility. The MAP thermal testing required accurate quantification of spacecraft and fixture power levels while minimizing heater electrical emissions. The special requirements of the MAP test necessitated construction of five (5) new heater racks.

An electrical impedance tomography (EIT) multi-electrode needle-probe device for local assessment of heterogeneous tissue impeditivity.

PubMed

Meroni, Davide; Maglioli, Camilla Carpano; Bovio, Dario; Greco, Francesco G; Aliverti, Andrea

2017-07-01

Electrical Impedance Tomography (EIT) is an image reconstruction technique applied in medicine for the electrical imaging of living tissues. In literature there is the evidence that a large resistivity variation related to the differences of the human tissues exists. As a result of this interest for the electrical characterization of the biological samples, recently the attention is also focused on the identification and characterization of the human tissue, by studying the homogeneity of its structure. An 8 electrodes needle-probe device has been developed with the intent of identifying the structural inhomogeneities under the surface layers. Ex-vivo impeditivity measurements, by placing the needle-probe in 5 different patterns of fat and lean porcine tissue, were performed, and impeditivity maps were obtained by EIDORS open source software for image reconstruction in electrical impedance. The values composing the maps have been analyzed, pointing out a good tissue discrimination, and the conformity with the real images. We conclude that this device is able to perform impeditivity maps matching to reality for position and orientation. In all the five patterns presented is possible to identify and replicate correctly the heterogeneous tissue under test. This new procedure can be helpful to the medical staff to completely characterize the biological sample, in different unclear situations.

Laser remote sensing of an algal bloom in a freshwater reservoir

NASA Astrophysics Data System (ADS)

Grishin, M. Ya; Lednev, V. N.; Pershin, S. M.; Bunkin, A. F.; Kobylyanskiy, V. V.; Ermakov, S. A.; Kapustin, I. A.; Molkov, A. A.

2016-12-01

Laser remote sensing of an algal bloom in a freshwater reservoir on the Volga River in central Russia was carried out. The compact Raman lidar was installed on a small ship to probe the properties of the surface water layer in different typical regions of Gorky Water Reservoir. Elastic and Raman scattering as well as chlorophyll fluorescence were quantified, mapped and compared with data acquired by a commercial salinity, temperature and depth probe (STD probe) equipped with a blue-green algae sensor. Good correlation between lidar and STD measurements was established.

LIFTING THE DUSTY VEIL WITH NEAR- AND MID-INFRARED PHOTOMETRY. III. TWO-DIMENSIONAL EXTINCTION MAPS OF THE GALACTIC MIDPLANE USING THE RAYLEIGH-JEANS COLOR EXCESS METHOD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nidever, David L.; Zasowski, Gail; Majewski, Steven R., E-mail: dln5q@virginia.edu, E-mail: gz2n@virginia.edu, E-mail: srm4n@virginia.edu

We provide new, high-resolution A(K{sub s} ) extinction maps of the heavily reddened Galactic midplane based on the Rayleigh-Jeans Color Excess ({sup R}JCE{sup )} method. RJCE determines star-by-star reddening based on a combination of near- and mid-infrared photometry. The new RJCE-generated maps have 2' Multiplication-Sign 2' pixels and span some of the most severely extinguished regions of the Galaxy-those covered with Spitzer/IRAC imaging by the GLIMPSE-I, -II, -3D, and Vela-Carina surveys, from 256 Degree-Sign < l < 65 Degree-Sign and, in general, for |b| {<=} 1 Degree-Sign -1.{sup 0}5 (extending up to |b| {<=} 4 Degree-Sign in the bulge). Usingmore » RJCE extinction measurements, we generate dereddened color-magnitude diagrams and, in turn, create maps based on main sequence, red clump, and red giant star tracers, each probing different distances and thereby providing coarse three-dimensional information on the relative placement of dust cloud structures. The maps generated from red giant stars, which reach to {approx}18-20 kpc, probe beyond most of the Milky Way extinction in most directions and provide close to a 'total Galactic extinction' map-at minimum they provide high angular resolution maps of lower limits on A(K{sub s} ). Because these maps are generated directly from measurements of reddening by the very dust being mapped, rather than inferred on the basis of some less direct means, they are likely the most accurate to date for charting in detail the highly patchy differential extinction in the Galactic midplane. We provide downloadable FITS files and an IDL tool for retrieving extinction values for any line of sight within our mapped regions.« less

A fast tumor-targeting near-infrared fluorescent probe based on bombesin analog for in vivo tumor imaging.

PubMed

Chen, Haiyan; Wan, Shunan; Zhu, Fenxia; Wang, Chuan; Cui, Sisi; Du, Changli; Ma, Yuxiang; Gu, Yueqing

2014-01-01

Bombesin (BBN), an analog of gastrin-releasing peptide (GRP), of which the receptors are over-expressed on various tumor cells, is able to bind to GRP receptor specifically. In this study, a near-infrared fluorescent dye (MPA) and polyethylene glycol (PEG) were conjugated to BBN analog to form BBN[7-14]-MPA and BBN[7-14]-SA-PEG-MPA. The successful synthesis of the two probes was proved by the characterization via sodium dodecylsulfate-polyacrylamide gel electrophoresis, infrared and optical spectra. Cellular uptakes studies indicated that BBN-based probes were mediated by gastrin-releasing peptide receptors (GRPR) on tumor cells and the PEG modified probe had higher affinity. The dynamic distribution and clearance investigations showed that the BBN-based probes were eliminated by the liver-kidney pathway. Furthermore, both of the BBN-based probes displayed tumor-targeting ability in GRPR over-expressed tumor-bearing mice. The PEG modified probe exhibited faster and higher tumor targeting capability than BBN[7-14]-MPA. The results implied that BBN[7-14]-SA-PEG-MPA could act as an effective fluorescence probe for tumor imaging. Copyright © 2014 John Wiley & Sons, Ltd.

A pollen-specific novel calmodulin-binding protein with tetratricopeptide repeats

NASA Technical Reports Server (NTRS)

Safadi, F.; Reddy, V. S.; Reddy, A. S.

2000-01-01

Calcium is essential for pollen germination and pollen tube growth. A large body of information has established a link between elevation of cytosolic Ca(2+) at the pollen tube tip and its growth. Since the action of Ca(2+) is primarily mediated by Ca(2+)-binding proteins such as calmodulin (CaM), identification of CaM-binding proteins in pollen should provide insights into the mechanisms by which Ca(2+) regulates pollen germination and tube growth. In this study, a CaM-binding protein from maize pollen (maize pollen calmodulin-binding protein, MPCBP) was isolated in a protein-protein interaction-based screening using (35)S-labeled CaM as a probe. MPCBP has a molecular mass of about 72 kDa and contains three tetratricopeptide repeats (TPR) suggesting that it is a member of the TPR family of proteins. MPCBP protein shares a high sequence identity with two hypothetical TPR-containing proteins from Arabidopsis. Using gel overlay assays and CaM-Sepharose binding, we show that the bacterially expressed MPCBP binds to bovine CaM and three CaM isoforms from Arabidopsis in a Ca(2+)-dependent manner. To map the CaM-binding domain several truncated versions of the MPCBP were expressed in bacteria and tested for their ability to bind CaM. Based on these studies, the CaM-binding domain was mapped to an 18-amino acid stretch between the first and second TPR regions. Gel and fluorescence shift assays performed with CaM and a CaM-binding synthetic peptide further confirmed MPCBP binding to CaM. Western, Northern, and reverse transcriptase-polymerase chain reaction analysis have shown that MPCBP expression is specific to pollen. MPCBP was detected in both soluble and microsomal proteins. Immunoblots showed the presence of MPCBP in mature and germinating pollen. Pollen-specific expression of MPCBP, its CaM-binding properties, and the presence of TPR motifs suggest a role for this protein in Ca(2+)-regulated events during pollen germination and growth.

The NASA Solar Probe mission - In situ determination of interplanetary out-of-the ecliptic and near-solar dust environments

NASA Technical Reports Server (NTRS)

Tsurutani, Bruce T.; Randolph, James E.

1991-01-01

The NASA Solar Probe mission will be one of the most exciting dust missions ever flown and will lead to a revolutionary advance in our understanding of dust within our solar system. Solar Probe will map the dust environment from the orbit of Jupiter (5 AU), to within 4 solar radii of the sun's center. The region between 0.3 AU and 4 Rs has never been visited before, so the ten days that the spacecraft spends during each (of the two) orbit is purely exploratory in nature. Solar Probe will also reach heliographic latitudes as high as about 15 to 28 deg above (below) the ecliptic on its trajectory inbound (outbound) to (from) the sun. This, in addition to the ESA/NASA Ulysses mission, will help determine the out-of-the-ecliptic dust environment. A post-perihelion burn will reduce the satellite orbital period to 2.5 years about the sun. A possible extended mission would allow data reception for two more revolutions, mapping out a complete solar cycle. Because the near-solar dust environment is not well understood (or is controversial at best), and it is very important to have better knowledge of the dust environment to protect Solar Probe from high velocity dust hits, we urgently request the scientific community to obtain further measurements of the nearsolar dust properties.

Detection of an electron beam in a high density plasma via an electrostatic probe

NASA Astrophysics Data System (ADS)

Majeski, Stephen; Yoo, Jongsoo; Zweben, Stewart; Yamada, Masaaki

2018-07-01

An electron beam is detected by a 1D floating potential probe array in a relatively high density (1012–1013 cm‑3) and low temperature (∼5 eV) plasma of the Magnetic Reconnection Experiment. Clear perturbations in the floating potential profile by the electron beam are observed. Based on the floating potential profile and a current balance equation to the probe array tips, the effective width of the electron beam is determined, from which we determine the radial and toroidal beam current density profiles. After the profile of the electron beam is specified from the measured beam current, we demonstrate the consistency of the current balance equation and the location of the perturbation is also in agreement with field line mapping. No significant broadening of the electron beam is observed after the beam propagates for tens of centimeters through the high density plasma. These results prove that the field line mapping is, in principle, possible in high density plasmas.

Detection of an electron beam in a high density plasma via an electrostatic probe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majeski, Stephen; Yoo, Jongsoo; Zweben, Stewart

Here, an electron beam is detected by a 1D floating potential probe array in a relatively high density (10 12–10 13 cm -3) and low temperature (~5 eV) plasma of the Magnetic Reconnection Experiment. Clear perturbations in the floating potential profile by the electron beam are observed. Based on the floating potential profile and a current balance equation to the probe array tips, the effective width of the electron beam is determined, from which we determine the radial and toroidal beam current density profiles. After the profile of the electron beam is specified from the measured beam current, we demonstratemore » the consistency of the current balance equation and the location of the perturbation is also in agreement with field line mapping. No significant broadening of the electron beam is observed after the beam propagates for tens of centimeters through the high density plasma. These results prove that the field line mapping is, in principle, possible in high density plasmas.« less

Detection of an electron beam in a high density plasma via an electrostatic probe

DOE PAGES

Majeski, Stephen; Yoo, Jongsoo; Zweben, Stewart; ...

2018-05-08

Here, an electron beam is detected by a 1D floating potential probe array in a relatively high density (10 12–10 13 cm -3) and low temperature (~5 eV) plasma of the Magnetic Reconnection Experiment. Clear perturbations in the floating potential profile by the electron beam are observed. Based on the floating potential profile and a current balance equation to the probe array tips, the effective width of the electron beam is determined, from which we determine the radial and toroidal beam current density profiles. After the profile of the electron beam is specified from the measured beam current, we demonstratemore » the consistency of the current balance equation and the location of the perturbation is also in agreement with field line mapping. No significant broadening of the electron beam is observed after the beam propagates for tens of centimeters through the high density plasma. These results prove that the field line mapping is, in principle, possible in high density plasmas.« less

Locus-specific oligonucleotide probes increase the usefulness of inter-Alu polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jarnik, M.; Tang, J.Q.; Korab-Laskowska, M.

1994-09-01

Most of the mapping approaches are based on single-locus codominant markers of known location. Their multiplex ratio, defined as the number of loci that can be simultaneously tested, is typically one. An increased multiplex ratio was obtained by typing anonymous polymorphisms using PCR primers anchored in ubiquitous Alu-repeats. These so called alumorphs are revealed by inter-Alu-PCR and seen as the presence or absence of an amplified band of a given length. We decided to map alumorphs and to develop locus-specific oligonucleotide (LSO) probes to facilitate their use and transfer among different laboratories. We studied the segregation of alumorphs in eightmore » CEPH families, using two distinct Alu-primers, both directing PCR between the repeats in a tail-to-tail orientation. The segregating bands were assigned to chromosomal locations by two-point linkage analysis with CEPH markers (V6.0). They were excised from dried gels, reamplified, cloned and sequenced. The resulting LSOs were used as hybridization probes (i) to confirm chromosomal assignments in a human/hamster somatic cell hybrid panel, and (ii) to group certain allelic length variants, originally coded as separate dominant markres, into more informative codominant loci. These codominants were then placed by multipoint analysis on a microsatellite Genethon map. Finally, the LSO probes were used as polymorphic STSs, to identify by hybridization the corresponding markers among products of inter-Alu-PCR. The use of LSOs converts alumorphs into a system of non-anonymous, often multiallelic codominant markes which can be simultaneously typed, thus achieving the goal of high multiplex ratio.« less

Chromosomal mapping of the human M6 genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olinsky, S.; Loop, B.T.; DeKosky, A.

1996-05-01

M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

PubMed Central

Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

2000-01-01

Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

SigReannot-mart: a query environment for expression microarray probe re-annotations.

PubMed

Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

2011-01-01

Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR.

PubMed

Ramiah, K; van Reenen, C A; Dicks, L M T

2007-05-30

Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA by Lactobacillus plantarum 423, grown in the presence of bile, pancreatin and at low pH, was studied by real-time PCR. Mub, MapA and EF-Tu were up-regulated in the presence of mucus, proportional to increasing concentrations. Expression of MapA was up-regulated in the presence of 3.0 g/l bile and 3.0 g/l pancreatin at pH 6.5. Similar results were recorded in the presence of 10.0 g/l bile and 10.0 g/l pancreatin at pH 6.5. Expression of Mub was down-regulated in the presence of bile and pancreatin, whilst the expression of EF-Tu and plaA remained unchanged. Expression of Mub and MapA remained unchanged at pH 4.0, whilst expression of EF-Tu and plaA were up-regulated. Expression of MapA was down-regulated in the presence of 1.0 g/l l-cysteine HCl, suggesting that the gene is regulated by transcription attenuation that involves cysteine.

Pulse Oximeter Derived Blood Pressure Measurement in Patients With a Continuous Flow Left Ventricular Assist Device.

PubMed

Hellman, Yaron; Malik, Adnan S; Lane, Kathleen A; Shen, Changyu; Wang, I-Wen; Wozniak, Thomas C; Hashmi, Zubair A; Munson, Sarah D; Pickrell, Jeanette; Caccamo, Marco A; Gradus-Pizlo, Irmina; Hadi, Azam

2017-05-01

Currently, blood pressure (BP) measurement is obtained noninvasively in patients with continuous flow left ventricular assist device (LVAD) by placing a Doppler probe over the brachial or radial artery with inflation and deflation of a manual BP cuff. We hypothesized that replacing the Doppler probe with a finger-based pulse oximeter can yield BP measurements similar to the Doppler derived mean arterial pressure (MAP). We conducted a prospective study consisting of patients with contemporary continuous flow LVADs. In a small pilot phase I inpatient study, we compared direct arterial line measurements with an automated blood pressure (ABP) cuff, Doppler and pulse oximeter derived MAP. Our main phase II study included LVAD outpatients with a comparison between Doppler, ABP, and pulse oximeter derived MAP. A total of five phase I and 36 phase II patients were recruited during February-June 2014. In phase I, the average MAP measured by pulse oximeter was closer to arterial line MAP rather than Doppler (P = 0.06) or ABP (P < 0.01). In phase II, pulse oximeter MAP (96.6 mm Hg) was significantly closer to Doppler MAP (96.5 mm Hg) when compared to ABP (82.1 mm Hg) (P = 0.0001). Pulse oximeter derived blood pressure measurement may be as reliable as Doppler in patients with continuous flow LVADs. © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagner, B.J.; Long, L.; Pettenati, M.J.

Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

Presence of intestinal Mycobacterium avium subspecies paratuberculosis (MAP) DNA is not associated with altered MMP expression in ulcerative colitis

PubMed Central

2011-01-01

Background Mycobacterium avium subspecies paratuberculosis (MAP) is suspected to be a causative agent in human Crohn's disease (CD). Recent evidence suggests that pathogenic mycobacteria and MAP can induce the expression of Matrix Metalloproteinases (MMP), which are the main proteases in the pathogenesis of mucosal ulcerations in inflammatory bowel disease (IBD). Within this study we assessed the prevalence of intestinal MAP specific DNA in patients with Crohn's disease, ulcerative colitis (UC), and healthy controls. We further analysed regulation patterns of MMPs in mucosal tissues of UC patients with and without intestinal MAP DNA detection. Methods Colonic biopsy samples were obtained from 63 Norwegian and German IBD patients and 21 healthy controls. RNA was quantified by quantitative real-time polymerase chain reaction (PCR) to study MMP gene expression in both pathological and healthy mucosal specimens. The presence of MAP DNA in colonic mucosa was examined using MAP specific PCR. Results MAP DNA was detected in 20% of UC patients and 33% of healthy controls but only in 7% of patients with CD. UC patients treated with corticosteroids exhibited a significantly increased frequency of intestinal MAP DNA compared to those not receiving corticosteroids. Expression of MMP-1, -2, -7, -9, -13, -19, -28 and TNF-α did not differ between UC patients with presence of intestinal MAP DNA compared to those without. MMP-2, MMP-9 and MMP-13 were significantly decreased in UC patients receiving corticosteroids. Conclusions The presence of intestinal MAP specific DNA is not associated with altered MMP expression in UC in vivo. Corticosteroids are associated with increased detection of intestinal MAP DNA and decreased expression of certain MMPs. Frequent detection of MAP DNA in healthy controls might be attributable to the wide environmental distribution of MAP and its presence in the food-chain. PMID:21477272

Digital Detection of Multiple Minority Mutants and Expression Levels of Multiple Colorectal Cancer-Related Genes Using Digital-PCR Coupled with Bead-Array

PubMed Central

Huang, Huan; Li, Shuo; Sun, Lizhou; Zhou, Guohua

2015-01-01

To simultaneously analyze mutations and expression levels of multiple genes on one detection platform, we proposed a method termed “multiplex ligation-dependent probe amplification–digital amplification coupled with hydrogel bead-array” (MLPA–DABA) and applied it to diagnose colorectal cancer (CRC). CRC cells and tissues were sampled to extract nucleic acid, perform MLPA with sequence-tagged probes, perform digital emulsion polymerase chain reaction (PCR), and produce a hydrogel bead-array to immobilize beads and form a single bead layer on the array. After hybridization with fluorescent probes, the number of colored beads, which reflects the abundance of expressed genes and the mutation rate, was counted for diagnosis. Only red or green beads occurred on the chips in the mixed samples, indicating the success of single-molecule PCR. When a one-source sample was analyzed using mixed MLPA probes, beads of only one color occurred, suggesting the high specificity of the method in analyzing CRC mutation and gene expression. In gene expression analysis of a CRC tissue from one CRC patient, the mutant percentage was 3.1%, and the expression levels of CRC-related genes were much higher than those of normal tissue. The highly sensitive MLPA–DABA succeeds in the relative quantification of mutations and gene expressions of exfoliated cells in stool samples of CRC patients on the same chip platform. MLPA–DABA coupled with hydrogel bead-array is a promising method in the non-invasive diagnosis of CRC. PMID:25880764

Distinctive gene expression profiles characterize donor biopsies from HCV-positive kidney donors.

PubMed

Mas, Valeria R; Archer, Kellie J; Suh, Lacey; Scian, Mariano; Posner, Marc P; Maluf, Daniel G

2010-12-15

Because of the shortage of organs for transplantation, procurement of kidneys from extended criteria donors is inevitable. Frequently, donors infected with hepatitis C virus (HCV) are used. To elucidate an initial compromise of molecular pathways in HCV graft, gene expression profiles were evaluated. Twenty-four donor allograft biopsies (n=12 HCV positive (+) and n=12 HCV negative (-)) were collected at preimplantation time and profiled using microarrays. Donors were age, race, gender, and cold and warm ischemia time matched between groups. Probe level data were read into the R programming environment using the affy Bioconductor package, and the robust multiarray average method was used to obtain probe set expression summaries. To identify probe sets exhibiting differential expression, a two sample t test was performed. Molecular and biologic functions were analyzed using Interaction Networks and Functional Analysis. Fifty-eight probe sets were differentially expressed between HCV (+) versus HCV (-) donors (P<0.001). The molecular functions associated with the two top scored networks from the analysis of the differentially expressed genes were connective tissue development and function and tissue morphology (score 34), cell death, cell signaling, cellular assembly, and organization (score 32). Among the differentially affected top canonical pathways, we found the role of RIG1-like receptors in antiviral innate immunity (P<0.001), natural killer cell signaling (P=0.007), interleukin-8 signaling (P=0.048), interferon signaling (P=0.0 11; INFA21, INFGR1, and MED14), ILK signaling (P=0.001), and apoptosis signaling. A unique gene expression pattern was identified in HCV (+) kidney grafts. Innate immune system and inflammatory pathways were the most affected.

Mapping the magnetic field vector in a fountain clock

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gertsvolf, Marina; Marmet, Louis

2011-12-15

We show how the mapping of the magnetic field vector components can be achieved in a fountain clock by measuring the Larmor transition frequency in atoms that are used as a spatial probe. We control two vector components of the magnetic field and apply audio frequency magnetic pulses to localize and measure the field vector through Zeeman spectroscopy.

High-resolution tyramide-FISH mapping of markers tightly linked to the male-fertility restoration (Ms) locus of onion

USDA-ARS?s Scientific Manuscript database

Fluorescence in situ hybridization (FISH) has not been readily exploited for physical mapping of molecular markers in plants due to the technical challenge to visualize small single-copy probes. Signal amplification using tyramide (tyr) FISH can increase sensitivity up to 100 fold. We used tyr-FISH ...

Tomography of a Probe Potential Using Atomic Sensors on Graphene.

PubMed

Wyrick, Jonathan; Natterer, Fabian D; Zhao, Yue; Watanabe, Kenji; Taniguchi, Takashi; Cullen, William G; Zhitenev, Nikolai B; Stroscio, Joseph A

2016-12-27

Our ability to access and explore the quantum world has been greatly advanced by the power of atomic manipulation and local spectroscopy with scanning tunneling and atomic force microscopes, where the key technique is the use of atomically sharp probe tips to interact with an underlying substrate. Here we employ atomic manipulation to modify and quantify the interaction between the probe and the system under study that can strongly affect any measurement in low charge density systems, such as graphene. We transfer Co atoms from a graphene surface onto a probe tip to change and control the probe's physical structure, enabling us to modify the induced potential at a graphene surface. We utilize single Co atoms on a graphene field-effect device as atomic scale sensors to quantitatively map the modified potential exerted by the scanning probe over the whole relevant spatial and energy range.

Restoring Redundancy to the MAP Propulsion System

NASA Technical Reports Server (NTRS)

O'Donnell, James R., Jr.; Davis, Gary T.; Ward, David K.; Bauer, Frank H. (Technical Monitor)

2002-01-01

The Microwave Anisotropy Probe (MAP) is a follow-on to the Differential Microwave Radiometer (DMR) instrument on the Cosmic Background Explorer (COBE). Due to the MAP project's limited mass, power, and financial resources, a traditional reliability concept including fully redundant components was not feasible. The MAP design employs selective hardware redundancy, along with backup software modes and algorithms, to improve the odds of mission success. In particular, MAP's propulsion system, which is used for orbit maneuvers and momentum management, uses eight thrusters positioned and oriented in such a way that its thruster-based attitude control modes can maintain three-axis attitude control in the event of the failure of any one thruster.

Terahertz near-field imaging of surface plasmon waves in graphene structures

DOE PAGES

Mitrofanov, O.; Yu, W.; Thompson, R. J.; ...

2015-09-08

In this study, we introduce a near-field scanning probe terahertz (THz) microscopy technique for probing surface plasmon waves on graphene. Based on THz time-domain spectroscopy method, this near-field imaging approach is well suited for studying the excitation and evolution of THz plasmon waves on graphene as well as for mapping of graphene properties at THz frequencies on the sub-wavelength scale.

REGULATION OF EPHRIN-A EXPRESSION IN COMPRESSED RETINOCOLLICULAR MAPS

PubMed Central

Tadesse, T.; Cheng, Q.; Xu, M.; Baro, D.J.; Young, L.J.; Pallas, S.L.

2012-01-01

Retinotopic maps can undergo compression and expansion in response to changes in target size, but the mechanism underlying this compensatory process has remained a mystery. The discovery of ephrins as molecular mediators of Sperry’s chemoaffinity process allows a mechanistic approach to this important issue. In Syrian hamsters, neonatal, partial (PT) ablation of posterior superior colliculus (SC) leads to compression of the retinotopic map, independent of neural activity. Graded, repulsive EphA receptor/ephrin-A ligand interactions direct the formation of the retinocollicular map, but whether ephrins might also be involved in map compression is unknown. To examine whether map compression might be directed by changes in the ephrin expression pattern, we compared ephrin-A2 and ephrin-A5 mRNA expression between normal SC and PT SC using in situ hybridization and quantitative real-time PCR. We found that ephrin-A ligand expression in the compressed maps was low anteriorly and high posteriorly, as in normal animals. Consistent with our hypothesis, the steepness of the ephrin gradient increased in the lesioned colliculi. Interestingly, overall levels of ephrin-A2 and -A5 expression declined immediately after neonatal target damage, perhaps promoting axon outgrowth. These data establish a correlation between changes in ephrin-A gradients and map compression, and suggest that ephrin-A expression gradients may be regulated by target size. This in turn could lead to compression of the retinocollicular map onto the reduced target. These findings have important implications for mechanisms of recovery from traumatic brain injury. PMID:23008269

Measuring the Epoch of Reionization using [CII] Intensity Mapping with TIME-Pilot

NASA Astrophysics Data System (ADS)

Crites, Abigail; Bock, James; Bradford, Matt; Bumble, Bruce; Chang, Tzu-Ching; Cheng, Yun-Ting; Cooray, Asantha R.; Hailey-Dunsheath, Steve; Hunacek, Jonathon; Li, Chao-Te; O'Brient, Roger; Shirokoff, Erik; Staniszewski, Zachary; Shiu, Corwin; Uzgil, Bade; Zemcov, Michael B.; Sun, Guochao

2017-01-01

TIME-Pilot (the Tomographic Ionized carbon Intensity Mapping Experiment) is a new instrument designed to probe the epoch of reionization (EoR) by measuring the 158 um ionized carbon emission line [CII] from redshift 5 - 9. TIME-Pilot will also probe the molecular gas content of the universe during the epoch spanning the peak of star formation (z ~ 1 -3) by making an intensity mapping measurement of the CO transitions in the TIME-Pilot band (CO(3-2), CO(4-3), CO(5-4), and CO(6-5)). I will describe the instrument we are building which is an R of ~100 spectrometer sensitive to the 200-300 GHz radiation. The camera is designed to measure the line emission from galaxies using an intensity mapping technique. This instrument will allow us to detect the [CII] clustering fluctuations from faint galaxies during EoR and compare these measurements to predicted [CII] amplitudes from current models. The CO measurements will allow us to constrain models for galaxies at lower redshift. The [CII] intensity mapping measurements that will be made with TIME-Pilot and detailed measurements made with future more sensitive mm-wavelength spectrometers are complimentary to 21-cm measurements of the EoR and complimentary to direct detections of high redshift galaxies with HST, ALMA, and, in the future, JWST.

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

Sister grouping of chimpanzees and humans as revealed by genome-wide phylogenetic analysis of brain gene expression profiles

PubMed Central

Uddin, Monica; Wildman, Derek E.; Liu, Guozhen; Xu, Wenbo; Johnson, Robert M.; Hof, Patrick R.; Kapatos, Gregory; Grossman, Lawrence I.; Goodman, Morris

2004-01-01

Gene expression profiles from the anterior cingulate cortex (ACC) of human, chimpanzee, gorilla, and macaque samples provide clues about genetic regulatory changes in human and other catarrhine primate brains. The ACC, a cerebral neocortical region, has human-specific histological features. Physiologically, an individual's ACC displays increased activity during that individual's performance of cognitive tasks. Of ≈45,000 probe sets on microarray chips representing transcripts of all or most human genes, ≈16,000 were commonly detected in human ACC samples and comparable numbers, 14,000–15,000, in gorilla and chimpanzee ACC samples. Phylogenetic results obtained from gene expression profiles contradict the traditional expectation that the non-human African apes (i.e., chimpanzee and gorilla) should be more like each other than either should be like humans. Instead, the chimpanzee ACC profiles are more like the human than like the gorilla; these profiles demonstrate that chimpanzees are the sister group of humans. Moreover, for those unambiguous expression changes mapping to important biological processes and molecular functions that statistically are significantly represented in the data, the chimpanzee clade shows at least as much apparent regulatory evolution as does the human clade. Among important changes in the ancestry of both humans and chimpanzees, but to a greater extent in humans, are the up-regulated expression profiles of aerobic energy metabolism genes and neuronal function-related genes, suggesting that increased neuronal activity required increased supplies of energy. PMID:14976249

Expanding probe repertoire and improving reproducibility in human genomic hybridization

PubMed Central

Dorman, Stephanie N.; Shirley, Ben C.; Knoll, Joan H. M.; Rogan, Peter K.

2013-01-01

Diagnostic DNA hybridization relies on probes composed of single copy (sc) genomic sequences. Sc sequences in probe design ensure high specificity and avoid cross-hybridization to other regions of the genome, which could lead to ambiguous results that are difficult to interpret. We examine how the distribution and composition of repetitive sequences in the genome affects sc probe performance. A divide and conquer algorithm was implemented to design sc probes. With this approach, sc probes can include divergent repetitive elements, which hybridize to unique genomic targets under higher stringency experimental conditions. Genome-wide custom probe sets were created for fluorescent in situ hybridization (FISH) and microarray genomic hybridization. The scFISH probes were developed for detection of copy number changes within small tumour suppressor genes and oncogenes. The microarrays demonstrated increased reproducibility by eliminating cross-hybridization to repetitive sequences adjacent to probe targets. The genome-wide microarrays exhibited lower median coefficients of variation (17.8%) for two HapMap family trios. The coefficients of variations of commercial probes within 300 nt of a repetitive element were 48.3% higher than the nearest custom probe. Furthermore, the custom microarray called a chromosome 15q11.2q13 deletion more consistently. This method for sc probe design increases probe coverage for FISH and lowers variability in genomic microarrays. PMID:23376933

Scanning micro-Hall probe mapping of magnetic flux distributions and current densities in YBa2Cu3O7 thin films

NASA Technical Reports Server (NTRS)

Xing, W.; Heinrich, B.; Zhou, HU; Fife, A. A.; Cragg, A. R.; Grant, P. D.

1995-01-01

Mapping of the magnetic flux density B(sub z) (perpendicular to the film plane) for a YBa2Cu3O7 thin-film sample was carried out using a scanning micro-Hall probe. The sheet magnetization and sheet current densities were calculated from the B(sub z) distributions. From the known sheet magnetization, the tangential (B(sub x,y)) and normal components of the flux density B were calculated in the vicinity of the film. It was found that the sheet current density was mostly determined by 2B(sub x,y)/d, where d is the film thickness. The evolution of flux penetration as a function of applied field will be shown.

EFM data mapped into 2D images of tip-sample contact potential difference and capacitance second derivative.

PubMed

Lilliu, S; Maragliano, C; Hampton, M; Elliott, M; Stefancich, M; Chiesa, M; Dahlem, M S; Macdonald, J E

2013-11-27

We report a simple technique for mapping Electrostatic Force Microscopy (EFM) bias sweep data into 2D images. The method allows simultaneous probing, in the same scanning area, of the contact potential difference and the second derivative of the capacitance between tip and sample, along with the height information. The only required equipment consists of a microscope with lift-mode EFM capable of phase shift detection. We designate this approach as Scanning Probe Potential Electrostatic Force Microscopy (SPP-EFM). An open-source MATLAB Graphical User Interface (GUI) for images acquisition, processing and analysis has been developed. The technique is tested with Indium Tin Oxide (ITO) and with poly(3-hexylthiophene) (P3HT) nanowires for organic transistor applications.

Mapping the Heavens: Probing Cosmology with Large Surveys

ScienceCinema

Frieman, Joshua [Fermilab

2017-12-09

This talk will provide an overview of recent and on-going sky surveys, focusing on their implications for cosmology. I will place particular emphasis on the Sloan Digital Sky Survey, the most ambitious mapping of the Universe yet undertaken, showing a virtual fly-through of the survey that reveals the large-scale structure of the galaxy distribution. Recent measurements of this large-scale structure, in combination with observations of the cosmic microwave background, have provided independent evidence for a Universe dominated by dark matter and dark energy as well as insights into how galaxies and larger-scale structures formed. Future planned surveys will build on these foundations to probe the history of the cosmic expansion--and thereby the dark energy--with greater precision.

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

Simultaneous Interfacial Reactivity and Topography Mapping with Scanning Ion Conductance Microscopy.

PubMed

Momotenko, Dmitry; McKelvey, Kim; Kang, Minkyung; Meloni, Gabriel N; Unwin, Patrick R

2016-03-01

Scanning ion conductance microscopy (SICM) is a powerful technique for imaging the topography of a wide range of materials and interfaces. In this report, we develop the use and scope of SICM, showing how it can be used for mapping spatial distributions of ionic fluxes due to (electro)chemical reactions occurring at interfaces. The basic idea is that there is a change of ion conductance inside a nanopipet probe when it approaches an active site, where the ionic composition is different to that in bulk solution, and this can be sensed via the current flow in the nanopipet with an applied bias. Careful tuning of the tip potential allows the current response to be sensitive to either topography or activity, if desired. Furthermore, the use of a distance modulation SICM scheme allows reasonably faithful probe positioning using the resulting ac response, irrespective of whether there is a reaction at the interface that changes the local ionic composition. Both strategies (distance modulation or tuned bias) allow simultaneous topography-activity mapping with a single channel probe. The application of SICM reaction imaging is demonstrated on several examples, including voltammetric mapping of electrocatalytic reactions on electrodes and high-speed electrochemical imaging at rates approaching 4 s per image frame. These two distinct approaches provide movies of electrochemical current as a function of potential with hundreds of frames (images) of surface reactivity, to reveal a wealth of spatially resolved information on potential- (and time) dependent electrochemical phenomena. The experimental studies are supported by detailed finite element method modeling that places the technique on a quantitative footing.

A comparison of various "housekeeping" probes for northern analysis of normal and osteoarthritic articular cartilage RNA.

PubMed

Matyas, J R; Huang, D; Adams, M E

1999-01-01

Several approaches are commonly used to normalize variations in RNA loading on Northern blots, including: ethidium bromide (EthBr) fluorescence of 18S or 28S rRNA or autoradiograms of radioactive probes hybridized with constitutively expressed RNAs such as elongation factor-1alpha (ELF), glyceraldehyde-3-phosphate dehydrogenase (G3PDH), actin, 18S or 28S rRNA, or others. However, in osteoarthritis (OA) the amount of total RNA changes significantly and none of these RNAs has been clearly demonstrated to be expressed at a constant level, so it is unclear if any of these approaches can be used reliably for normalizing RNA extracted from osteoarthritic cartilage. Total RNA was extracted from normal and osteoarthritic cartilage and assessed by EthBr fluorescence. RNA was then transferred to a nylon membrane hybridized with radioactive probes for ELF, G3PDH, Max, actin, and an oligo-dT probe. The autoradiographic signal across the six lanes of a gel was quantified by scanning densitometry. When compared on the basis of total RNA, the coefficient of variation was lowest for 28S ethidium bromide fluorescence and oligo-dT (approximately 7%), followed by 18S ethidium bromide fluorescence and G3PDH (approximately 13%). When these values were normalized to DNA concentration, the coefficient of variation exceeded 50% for all signals. Total RNA and the signals for 18S, 28S rRNA, and oligo-dT all correlated highly. These data indicate that osteoarthritic chondrocytes express similar ratios of mRNA to rRNA and mRNA to total RNA as do normal chondrocytes. Of all the "housekeeping" probes, G3PDH correlated best with the measurements of RNA. All of these "housekeeping" probes are expressed at greater levels by osteoarthritic chondrocytes when compared with normal chondrocytes. Thus, while G3PDH is satisfactory for evaluating the amount of RNA loaded, its level of expression is not the same in normal and osteoarthritic chondrocytes.

Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain

PubMed Central

Okamura-Oho, Yuko; Shimokawa, Kazuro; Nishimura, Masaomi; Takemoto, Satoko; Sato, Akira; Furuichi, Teiichi; Yokota, Hideo

2014-01-01

Using a recently invented technique for gene expression mapping in the whole-anatomy context, termed transcriptome tomography, we have generated a dataset of 36,000 maps of overall gene expression in the adult-mouse brain. Here, using an informatics approach, we identified a broad co-expression network that follows an inverse power law and is rich in functional interaction and gene-ontology terms. Our framework for the integrated analysis of expression maps and graphs of co-expression networks revealed that groups of combinatorially expressed genes, which regulate cell differentiation during development, were present in the adult brain and each of these groups was associated with a discrete cell types. These groups included non-coding genes of unknown function. We found that these genes specifically linked developmentally conserved groups in the network. A previously unrecognized robust expression pattern covering the whole brain was related to the molecular anatomy of key biological processes occurring in particular areas. PMID:25382412

AT1 receptor-mediated uptake of angiotensin II and NHE-3 expression in proximal tubule cells through a microtubule-dependent endocytic pathway.

PubMed

Li, Xiao C; Hopfer, Ulrich; Zhuo, Jia L

2009-11-01

Angiotensin II (ANG II) is taken up by proximal tubule (PT) cells via AT1 (AT1a) receptor-mediated endocytosis, but the underlying cellular mechanisms remain poorly understood. The present study tested the hypothesis that the microtubule- rather than the clathrin-dependent endocytic pathway regulates AT1-mediated uptake of ANG II and ANG II-induced sodium and hydrogen exchanger-3 (NHE-3) expression in PT cells. The expression of AT1 receptors, clathrin light (LC) and heavy chain (HC) proteins, and type 1 microtubule-associated proteins (MAPs; MAP-1A and MAP-1B) in PT cells were knocked down by their respective small interfering (si) RNAs before AT1-mediated FITC-ANG II uptake and ANG II-induced NHE-3 expression were studied. AT1 siRNAs inhibited AT1 expression and blocked ANG II-induced NHE-3 expression in PT cells, as expected (P < 0.01). Clathrin LC or HC siRNAs knocked down their respective proteins by approximately 90% with a peak response at 24 h, and blocked the clathrin-dependent uptake of Alexa Fluor 594-transferrin (P < 0.01). However, neither LC nor HC siRNAs inhibited AT1-mediated uptake of FITC-ANG II or affected ANG II-induced NHE-3 expression. MAP-1A or MAP-1B siRNAs markedly knocked down MAP-1A or MAP-1B proteins in a time-dependent manner with peak inhibitions at 48 h (>76.8%, P < 0.01). MAP protein knockdown resulted in approximately 52% decreases in AT1-mediated FITC-ANG II uptake and approximately 66% decreases in ANG II-induced NHE-3 expression (P < 0.01). These effects were associated with threefold decreases in ANG II-induced MAP kinases ERK 1/2 activation (P < 0.01), but not with altered AT1 expression or clathrin-dependent transferrin uptake. Both losartan and AT1a receptor deletion in mouse PT cells completely abolished the effects of MAP-1A knockdown on ANG II-induced NHE-3 expression and activation of MAP kinases ERK1/2. Our findings suggest that the alternative microtubule-dependent endocytic pathway, rather than the canonical clathrin-dependent pathway, plays an important role in AT1 (AT1a)-mediated uptake of extracellular ANG II and ANG II-induced NHE-3 expression in PT cells.

Mapping the CMB with the Wilkinson Microwave Anisotropy Probe

NASA Technical Reports Server (NTRS)

Hinshaw, Gary F.

2007-01-01

The data from the Wilkinson Microwave Anisotropy Probe (WMAP) satellite provide detailed full-sky maps of the cosmic microwave background temperature anisotropy and new full-sky maps of the polarization. Together, the data provide a wealth of cosmological information, including the age of the universe, the epoch when the first stars formed, and the overall composition of baryonic matter, dark matter, and dark energy. The results also provide constraints on the period of inflationary expansion in the very first moments of time. These and other aspects of the mission results will be discussed and commented on. WMAP, part of NASA's Explorers program, was launched on June 30,200 1. The WMAP satellite was produced in a partnership between the Goddard Space Flight Center and Princeton University. The WMAP team also includes researchers at the Johns Hopkins University; the Canadian Institute of Theoretical Astrophysics; University of Texas; University of Chicago; Brown University; University of British Columbia; and University of California, Los Angeles.

Fluorescence spectroscopy using indocyanine green for lymph node mapping

NASA Astrophysics Data System (ADS)

Haj-Hosseini, Neda; Behm, Pascal; Shabo, Ivan; Wârdell, Karin

2014-02-01

The principles of cancer treatment has for years been radical resection of the primary tumor. In the oncologic surgeries where the affected cancer site is close to the lymphatic system, it is as important to detect the draining lymph nodes for metastasis (lymph node mapping). As a replacement for conventional radioactive labeling, indocyanine green (ICG) has shown successful results in lymph node mapping; however, most of the ICG fluorescence detection techniques developed are based on camera imaging. In this work, fluorescence spectroscopy using a fiber-optical probe was evaluated on a tissue-like ICG phantom with ICG concentrations of 6-64 μM and on breast tissue from five patients. Fiber-optical based spectroscopy was able to detect ICG fluorescence at low intensities; therefore, it is expected to increase the detection threshold of the conventional imaging systems when used intraoperatively. The probe allows spectral characterization of the fluorescence and navigation in the tissue as opposed to camera imaging which is limited to the view on the surface of the tissue.

Mapping the surface charge distribution of amyloid fibril

NASA Astrophysics Data System (ADS)

Lee, Gyudo; Lee, Wonseok; Lee, Hyungbeen; Woo Lee, Sang; Sung Yoon, Dae; Eom, Kilho; Kwon, Taeyun

2012-07-01

It is of high importance to measure and map the surface charge distribution of amyloids, since electrostatic interaction between amyloidogenic proteins and biomolecules plays a vital role in amyloidogenesis. In this work, we have measured and mapped the surface charge distributions of amyloids (i.e., β-lactoglobulin fibril) using Kelvin probe force microscopy. It is shown that the surface charge distribution is highly dependent on the conformation of amyloids (e.g., the helical pitch of amyloid fibrils) as well as the pH of a solvent.

"Hook"-calibration of GeneChip-microarrays: theory and algorithm.

PubMed

Binder, Hans; Preibisch, Stephan

2008-08-29

: The improvement of microarray calibration methods is an essential prerequisite for quantitative expression analysis. This issue requires the formulation of an appropriate model describing the basic relationship between the probe intensity and the specific transcript concentration in a complex environment of competing interactions, the estimation of the magnitude these effects and their correction using the intensity information of a given chip and, finally the development of practicable algorithms which judge the quality of a particular hybridization and estimate the expression degree from the intensity values. : We present the so-called hook-calibration method which co-processes the log-difference (delta) and -sum (sigma) of the perfect match (PM) and mismatch (MM) probe-intensities. The MM probes are utilized as an internal reference which is subjected to the same hybridization law as the PM, however with modified characteristics. After sequence-specific affinity correction the method fits the Langmuir-adsorption model to the smoothed delta-versus-sigma plot. The geometrical dimensions of this so-called hook-curve characterize the particular hybridization in terms of simple geometric parameters which provide information about the mean non-specific background intensity, the saturation value, the mean PM/MM-sensitivity gain and the fraction of absent probes. This graphical summary spans a metrics system for expression estimates in natural units such as the mean binding constants and the occupancy of the probe spots. The method is single-chip based, i.e. it separately uses the intensities for each selected chip. : The hook-method corrects the raw intensities for the non-specific background hybridization in a sequence-specific manner, for the potential saturation of the probe-spots with bound transcripts and for the sequence-specific binding of specific transcripts. The obtained chip characteristics in combination with the sensitivity corrected probe-intensity values provide expression estimates scaled in natural units which are given by the binding constants of the particular hybridization.

SU-E-I-81: Targeting of HER2-Expressing Tumors with Dual PET-MR Imaging Probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, P; Peng, Y; Sun, M

2015-06-15

Purpose: The detection of human epidermal growth factor receptor type 2 (HER2) expression in malignant tumors provides important information influencing patient management. Radionuclide in vivo imaging of HER2 may permit the detection of HER2 in both primary tumors and metastases by a single noninvasive procedure. Trastuzumab, effective in about 15 % of women with breast cancer, downregulates signalling through the Akt/PI3K and MAPK pathways.These pathways modulate metabolism which can be monitored by positron emission tomography (PET) and magnetic resonance imaging (MRI). Methods: The relationship between response of HER2 overexpressing tumours and changes in imaging PET or SPECT and MRI willmore » be examined by a integrated bimodal imaging probe.Small (7 kDa) high-affinity anti-HER2 Affibody molecules and KCCYSL targeting peptide may be suitable tracers for visualization of HER2-expressing tumors. Peptide-conjugated iron oxide nanoparticles (Fe3O4 NPs) as MRI imaging and CB-TE2A as PET imaging are integrated into a single synthetic molecule in the HER2 positive cancer. Results: One of targeted contrast bimodal imaging probe agents was synthesized and evaluated to target HER2-expressing tumors in a HER2 positive rat model. We will report the newest results regarding the development of bimodal imaging probes. Conclusion: The preliminary results of the bimodal imaging probe presents high correlation of MRI signal and PET imaging intensity in vivo. This unique feature can hardly be obtained by single model contrast agents. It is envisioned that this bimodal agents can hold great potential for accurate detection of HER2-expressing tumors which are critical for clinical management of the disease.« less

Magnetic Gold Nanoparticle-Labeled Heparanase Monoclonal Antibody and its Subsequent Application for Tumor Magnetic Resonance Imaging

NASA Astrophysics Data System (ADS)

Li, Ning; Jie, Meng-Meng; Yang, Min; Tang, Li; Chen, Si-Yuan; Sun, Xue-Mei; Tang, Bo; Yang, Shi-Ming

2018-04-01

Heparanase (HPA) is ubiquitously expressed in various metastatic malignant tumors; previous studies have demonstrated that HPA was a potential tumor-associated antigen (TAA) for tumor immunotherapy. We sought to evaluate the feasibility of HPA as a common TAA for magnetic resonance imaging (MRI) of tumor metastasis and its potential application in tumor molecular imaging. We prepared a targeted probe based on magnetic gold nanoparticles coupled with an anti-HPA antibody for the specific detection of HPA by MRI. The specificity of the targeted probe was validated in vitro by incubation of the probe with various tumor cells, and the probe was able to selectively detect HPA (+) cells. We found the probes displayed significantly reduced signal intensity in several tumor cells, and the signal intensity decreased significantly after the targeted probe was injected in tumor-bearing nude mice. In the study, we demonstrated that the HPA&GoldMag probe had excellent physical and chemical properties and immune activities and could specifically target many tumor cell tissues both in vitro and in vivo. This may provide an experimental base for molecular imaging of tumor highly expressing heparanase using HPA mAbs.

Mars Express en route for the Red Planet

NASA Astrophysics Data System (ADS)

2003-06-01

The probe, weighing in at 1 120 kg, was built on ESA’s behalf by a European team led by Astrium. It set out on its journey to Mars aboard a Soyuz-Fregat launcher, under Starsem operational management. The launcher lifted off from Baïkonur in Kazakhstan on 2 June at 23.45 local time (17:45 GMT). An interim orbit around the Earth was reached following a first firing of the Fregat upper stage. One hour and thirty-two minutes after lift off the probe was injected into its interplanetary orbit. "Europe is on its way to Mars to stake its claim in the most detailed and complete exploration ever done of the Red Planet. We can be very proud of this and of the speed with which have achieved this goal", said David Southwood, ESA's Director of Science witnessing the launch from Baikonur. Contact with Mars Express has been established by ESOC, ESA’s satellite control centre, located in Darmstadt, Germany. The probe is pointing correctly towards the Sun and has deployed its solar panels. All on-board systems are operating faultlessly. Two days from now, the probe will perform a corrective manœuvre that will place it in a Mars-bound trajectory, while the Fregat stage, trailing behind, will vanish into space - there will be no risk of it crashing into and contaminating the Red Planet. Mars Express will then travel away from Earth at a speed exceeding 30 km/s (3 km/s in relation to the Earth), on a six-month and 400 million kilometre journey through the solar system. Once all payload operations have been checked out, the probe will be largely deactivated. During this period, the spacecraft will contact Earth only once a day. Mid-journey correction of its trajectory is scheduled for September. There in time for Christmas Following reactivation of its systems at the end of November, Mars Express will get ready to release Beagle 2. The 60 kg capsule containing the tiny lander does not incorporate its own propulsion and steering system and will be released into a collision trajectory with Mars, on 20 December. It will enter the Martian atmosphere on Christmas day, after five days’ ballistic flight. As it descends, the lander will be protected in the first instance by a heat-shield; two parachutes will then open to provide further deceleration. With its weight down to 30 kg at most, it will land in an equatorial region known as Isidis Planitia. Three airbags will soften the final impact. This crucial phase in the mission will last just ten minutes, from entry into the atmosphere to landing. Meanwhile, the Mars Express probe proper will have performed a series of manœuvres through to a capture orbit. At this point its main motor will fire, providing the deceleration needed to acquire a highly elliptical transition orbit. Attaining the final operational orbit will call for four more firings. This 7.5 hour quasi-polar orbit will take the probe to within 250 km of the planet. Getting to know Mars - inside and out Having landed on Mars, Beagle 2 - named after HMS Beagle, on which Charles Darwin voyaged round the world, developing his evolutionary theory - will deploy its solar panels and the payload adjustable workbench, a set of instruments (two cameras, a microscope and two spectrometers) mounted on the end of a robot arm. It will proceed to explore its new environment, gathering geological and mineralogical data that should, for the first time, allow rock samples to be dated with absolute accuracy. Using a grinder and corer, and the “mole”, a wire-guided mini-robot able to borrow its way under rocks and dig the ground to a depth of 2 m, samples will be collected and then examined in the GAP automated mini-laboratory, equipped with 12 furnaces and a mass spectrometer. The spectrometer will have the job of detecting possible signs of life and dating rock samples. The Mars Express orbiter will carry out a detailed investigation of the planet, pointing its instruments at Mars for between half-an-hour and an hour per orbit and then, for the remainder of the time, at Earth to relay the information collected in this way and the data transmitted by Beagle 2. The orbiter’s seven on-board instruments are expected to provide considerable information about the structure and evolution of Mars. A very high resolution stereo camera, the HRSC, will perform comprehensive mapping of the planet at 10 m resolution and will even be capable of photographing some areas to a precision of barely 2 m. The OMEGA spectrometer will draw up the first mineralogical map of the planet to 100 m precision. This mineralogical study will be taken further by the PFS spectrometer - which will also chart the composition of the Martian atmosphere, a prerequisite for investigation of atmospheric dynamics. The MARSIS radar instrument, with its 40 m antenna, will sound the surface to a depth of 2 km, exploring its structure and above all searching for pockets of water. Another instrument, ASPERA, will be tasked with investigating interaction between the upper atmosphere and the interplanetary medium. The focus here will be on determining how and at what rate the solar wind, in the absence of a magnetic field capable of deflecting it, scattered the bulk of the Martian atmosphere into space. Atmospheric investigation will also be performed by the SPICAM spectrometer and the MaRS experiment, with special emphasis on stellar occultation and radio signal propagation phenomena. The orbiter mission should last at least one Martian year (687 days), while Beagle 2 is expected to operate on the planet’s surface for 180 days. Only a start to exploration This first European mission to Mars incorporates some of the objectives of the Euro-Russian Mars 96 mission, which came to grief when the Proton launcher failed. And indeed a Russian partner is cooperating on each of the orbiter’s instruments. Mars Express forms part of an international Mars exploration programme, featuring also the US probes Mars Surveyor and Mars Odyssey, the two Mars Exploration Rovers and the Japanese probe Nozomi. Mars Express may perhaps, within this partnership, relay data from the NASA rovers while Mars Odyssey may, if required, relay data from Beagle 2. The mission’s scientific goals are of outstanding importance. Mars Express will, it is hoped, supply answers to the many questions raised by earlier missions - questions concerning the planet’s evolution, the history of its internal activity, the presence of water below its surface, the possibility that Mars may at one time have been covered by oceans and thus have offered an environment conducive to the emergence of some form of life, and even the possibility that life may still be present, somewhere in putative subterranean aquifers. In addition the lander doing direct analysis of the soil and the environment comprises a truly unique mission. Mars Express, drawing heavily on elements of the Rosetta spacecraft awaiting to be launched to a comet next year, paves the way for other ESA-led planetary missions, with Venus Express planned for 2005 and the BepiColombo mission to Mercury at the end of the decade. It is a precursor too for continuing Mars mission activity under Aurora, the programme of exploration of our solar system.

Children's Representations of Facial Expression and Identity: Identity-Contingent Expression Aftereffects

ERIC Educational Resources Information Center

Vida, Mark D.; Mondloch, Catherine J.

2009-01-01

This investigation used adaptation aftereffects to examine developmental changes in the perception of facial expressions. Previous studies have shown that adults' perceptions of ambiguous facial expressions are biased following adaptation to intense expressions. These expression aftereffects are strong when the adapting and probe expressions share…

Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius.

PubMed

Johnston, Christopher D; Bannantine, John P; Govender, Rodney; Endersen, Lorraine; Pletzer, Daniel; Weingart, Helge; Coffey, Aidan; O'Mahony, Jim; Sleator, Roy D

2014-01-01

It is well documented that open reading frames containing high GC content show poor expression in A+T rich hosts. Specifically, G+C-rich codon usage is a limiting factor in heterologous expression of Mycobacterium avium subsp. paratuberculosis (MAP) proteins using Lactobacillus salivarius. However, re-engineering opening reading frames through synonymous substitutions can offset codon bias and greatly enhance MAP protein production in this host. In this report, we demonstrate that codon-usage manipulation of MAP2121c can enhance the heterologous expression of the major membrane protein (MMP), analogous to the form in which it is produced natively by MAP bacilli. When heterologously over-expressed, antigenic determinants were preserved in synthetic MMP proteins as shown by monoclonal antibody mediated ELISA. Moreover, MMP is a membrane protein in MAP, which is also targeted to the cellular surface of recombinant L. salivarius at levels comparable to MAP. Additionally, we previously engineered MAP3733c (encoding MptD) and show herein that MptD displays the tendency to associate with the cytoplasmic membrane boundary under confocal microscopy and the intracellularly accumulated protein selectively adheres to the MptD-specific bacteriophage fMptD. This work demonstrates there is potential for L. salivarius as a viable antigen delivery vehicle for MAP, which may provide an effective mucosal vaccine against Johne's disease.

Mycobacterium paratuberculosis, Mycobacterium smegmatis, and lipopolysaccharide induce different transcriptional and post-transcriptional regulation of the IRG1 gene in murine macrophages.

PubMed

Basler, Tina; Jeckstadt, Sabine; Valentin-Weigand, Peter; Goethe, Ralph

2006-03-01

Mycobacterium avium subspecies paratuberculosis (MAP) causes a chronic enteritis in ruminants. In addition, MAP is presently the most favored pathogen linked to Crohn's disease. In this study, we were interested in dissecting the molecular mechanisms of macrophage activation or deactivation after infection with MAP. By subtractive hybridization of cDNAs, we identified the immune-responsive gene 1 (IRG1), which was expressed substantially higher in lipopolysaccharide (LPS)-stimulated than in MAP-infected murine macrophage cell lines. A nuclear run-on transcription assay revealed that the IRG1 gene was activated transcriptionally in LPS-stimulated and MAP-infected macrophages with higher expression in LPS-stimulated cells. Analysis of post-transcriptional regulation demonstrated that IRG1 mRNA stability was increased in LPS-stimulated but not in MAP-infected macrophages. Furthermore, IRG1 gene expression of macrophages infected with the nonpathogenic Mycobacterium smegmatis differed from those of LPS-stimulated and MAP-infected macrophages. At 2 h postinfection, M. smegmatis-induced IRG1 gene expression was as low as in MAP-infected, and 8 h postinfection, it increased nearly to the level in LPS-stimulated macrophages. Transient transfection experiments revealed similar IRG1 promoter activities in MAP- and M. smegmatis-infected cells. Northern analysis demonstrated increased IRG1 mRNA stability in M. smegmatis-infected macrophages. IRG1 mRNA stabilization was p38 mitogen-activated protein kinase-independent. Inhibition of protein synthesis revealed that constitutively expressed factors seemed to be responsible for IRG1 mRNA destabilization. Thus, our data demonstrate that transcriptional and post-transcriptional mechanisms are responsible for a differential IRG1 gene expression in murine macrophages treated with LPS, MAP, and M. smegmatis.

Orbit Determination Support for the Microwave Anisotropy Probe (MAP)

NASA Technical Reports Server (NTRS)

Bauer, Frank (Technical Monitor); Truong, Son H.; Cuevas, Osvaldo O.; Slojkowski, Steven

2003-01-01

NASA's Microwave Anisotropy Probe (MAP) was launched from the Cape Canaveral Air Force Station Complex 17 aboard a Delta II 7425-10 expendable launch vehicle on June 30, 2001. The spacecraft received a nominal direct insertion by the Delta expendable launch vehicle into a 185-km circular orbit with a 28.7deg inclination. MAP was then maneuvered into a sequence of phasing loops designed to set up a lunar swingby (gravity-assisted acceleration) of the spacecraft onto a transfer trajectory to a lissajous orbit about the Earth-Sun L2 Lagrange point, about 1.5 million km from Earth. Because of its complex orbital characteristics, the mission provided a unique challenge for orbit determination (OD) support in many orbital regimes. This paper summarizes the premission trajectory covariance error analysis, as well as actual OD results. The use and impact of the various tracking stations, systems, and measurements will be also discussed. Important lessons learned from the MAP OD support team will be presented. There will be a discussion of the challenges presented to OD support including the effects of delta-Vs at apogee as well as perigee, and the impact of the spacecraft attitude mode on the OD accuracy and covariance analysis.

Multidirectional cross-species painting illuminates the history of karyotypic evolution in Perissodactyla.

PubMed

Trifonov, Vladimir A; Stanyon, Roscoe; Nesterenko, Anastasia I; Fu, Beiyuan; Perelman, Polina L; O'Brien, Patricia C M; Stone, Gary; Rubtsova, Nadezhda V; Houck, Marlys L; Robinson, Terence J; Ferguson-Smith, Malcolm A; Dobigny, Gauthier; Graphodatsky, Alexander S; Yang, Fengtang

2008-01-01

The order Perissodactyla, the group of odd-toed ungulates, includes three extant families: Equidae, Tapiridae, and Rhinocerotidae. The extremely rapid karyotypic diversification in perissodactyls has so far prevented the establishment of genome-wide homology maps between these three families by traditional cytogenetic approaches. Here we report the first genome-wide comparative chromosome maps of African rhinoceroses, four tapir species, four equine species, and humans. These maps were established by multidirectional chromosome painting, with paint probes derived from flow-sorted chromosomes of Equus grevyi, Tapirus indicus, and Ceratotherium simum as well as painting probes from horse and human. The Malayan tapir (Tapirus indicus), Baird's tapir (T. bairdii), mountain tapir (T. pinchaque), lowland tapir (T. terrestris), and onager (E. hemionus onager), were studied by cross-species chromosome painting for the first time. Our results, when integrated with previously published comparative chromosome maps of the other perissodactyl species, have enabled the reconstruction of perissodactyl, ceratomorph, and equid ancestral karyotypes, and the identification of the defining evolutionary chromosomal rearrangements along each lineage. Our results allow a more reliable estimate of the mode and tempo of evolutionary chromosomal rearrangements, revealing a striking switch between the slowly evolving ceratomorphs and extremely rapidly evolving equids.

Two-dimensional ice mapping of molecular cores

NASA Astrophysics Data System (ADS)

Noble, J. A.; Fraser, H. J.; Pontoppidan, K. M.; Craigon, A. M.

2017-06-01

We present maps of the column densities of H2O, CO2 and CO ices towards the molecular cores B 35A, DC 274.2-00.4, BHR 59 and DC 300.7-01.0. These ice maps, probing spatial distances in molecular cores as low as 2200 au, challenge the traditional hypothesis that the denser the region observed, the more ice is present, providing evidence that the relationships between solid molecular species are more varied than the generic picture we often adopt to model gas-grain chemical processes and explain feedback between solid phase processes and gas phase abundances. We present the first combined solid-gas maps of a single molecular species, based upon observations of both CO ice and gas phase C18O towards B 35A, a star-forming dense core in Orion. We conclude that molecular species in the solid phase are powerful tracers of 'small-scale' chemical diversity, prior to the onset of star formation. With a component analysis approach, we can probe the solid phase chemistry of a region at a level of detail greater than that provided by statistical analyses or generic conclusions drawn from single pointing line-of-sight observations alone.

A hemispherical Langmuir probe array detector for angular resolved measurements on droplet-based laser-produced plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gambino, Nadia, E-mail: gambinon@ethz.ch; Brandstätter, Markus; Rollinger, Bob

2014-09-15

In this work, a new diagnostic tool for laser-produced plasmas (LPPs) is presented. The detector is based on a multiple array of six motorized Langmuir probes. It allows to measure the dynamics of a LPP in terms of charged particles detection with particular attention to droplet-based LPP sources for EUV lithography. The system design permits to temporally resolve the angular and radial plasma charge distribution and to obtain a hemispherical mapping of the ions and electrons around the droplet plasma. The understanding of these dynamics is fundamental to improve the debris mitigation techniques for droplet-based LPP sources. The device hasmore » been developed, built, and employed at the Laboratory for Energy Conversion, ETH Zürich. The experimental results have been obtained on the droplet-based LPP source ALPS II. For the first time, 2D mappings of the ion kinetic energy distribution around the droplet plasma have been obtained with an array of multiple Langmuir probes. These measurements show an anisotropic expansion of the ions in terms of kinetic energy and amount of ion charge around the droplet target. First estimations of the plasma density and electron temperature were also obtained from the analysis of the probe current signals.« less

Mapping and controlling ultrafast dynamics of highly excited H 2 molecules by VUV-IR pump-probe schemes

DOE PAGES

Sturm, F. P.; Tong, X. M.; Palacios, A.; ...

2017-01-09

Here, we used ultrashort femtosecond vacuum ultraviolet (VUV) and infrared (IR) pulses in a pump-probe scheme to map the dynamics and nonequilibrium dissociation channels of excited neutral H 2 molecules. A nuclear wave packet is created in the B 1Σmore » $$+\\atop{u}$$ state of the neutral H 2 molecule by absorption of the ninth harmonic of the driving infrared laser field. Due to the large stretching amplitude of the molecule excited in the B 1Σ$$+\\atop{u}$$ electronic state, the effective H 2 + ionization potential changes significantly as the nuclear wave packet vibrates in the bound, highly electronically and vibrationally excited B potential-energy curve. We probed such dynamics by ionizing the excited neutral molecule using time-delayed VUV-or-IR radiation. We identified the nonequilibrium dissociation channels by utilizing three-dimensional momentum imaging of the ion fragments. We also found that different dissociation channels can be controlled, to some extent, by changing the IR laser intensity and by choosing the wavelength of the probe laser light. Furthermore, we concluded that even in a benchmark molecular system such as H 2*, the interpretation of the nonequilibrium multiphoton and multicolor ionization processes is still a challenging task, requiring intricate theoretical analysis.« less

Functional mapping of the pelvic floor and sphincter muscles from high-density surface EMG recordings.

PubMed

Peng, Yun; He, Jinbao; Khavari, Rose; Boone, Timothy B; Zhang, Yingchun

2016-11-01

Knowledge of the innervation of pelvic floor and sphincter muscles is of great importance to understanding the pathophysiology of female pelvic floor dysfunctions. This report presents our high-density intravaginal and intrarectal electromyography (EMG) probes and a comprehensive innervation zone (IZ) imaging technique based on high-density EMG readings to characterize the IZ distribution. Both intravaginal and intrarectal probes are covered with a high-density surface electromyography electrode grid (8 × 8). Surface EMG signals were acquired in ten healthy women performing maximum voluntary contractions of their pelvic floor. EMG decomposition was performed to separate motor-unit action potentials (MUAPs) and then localize their IZs. High-density surface EMG signals were successfully acquired over the vaginal and rectal surfaces. The propagation patterns of muscle activity were clearly visualized for multiple muscle groups of the pelvic floor and anal sphincter. During each contraction, up to 218 and 456 repetitions of motor units were detected by the vaginal and rectal probes, respectively. MUAPs were separated with their IZs identified at various orientations and depths. The proposed probes are capable of providing a comprehensive mapping of IZs of the pelvic floor and sphincter muscles. They can be employed as diagnostic and preventative tools in clinical practices.

Carbon-Based Solid-State Calcium Ion-Selective Microelectrode and Scanning Electrochemical Microscopy: A Quantitative Study of pH-Dependent Release of Calcium Ions from Bioactive Glass.

PubMed

Ummadi, Jyothir Ganesh; Downs, Corey J; Joshi, Vrushali S; Ferracane, Jack L; Koley, Dipankar

2016-03-15

Solid-state ion-selective electrodes are used as scanning electrochemical microscope (SECM) probes because of their inherent fast response time and ease of miniaturization. In this study, we report the development of a solid-state, low-poly(vinyl chloride), carbon-based calcium ion-selective microelectrode (Ca(2+)-ISME), 25 μm in diameter, capable of performing an amperometric approach curve and serving as a potentiometric sensor. The Ca(2+)-ISME has a broad linear response range of 5 μM to 200 mM with a near Nernstian slope of 28 mV/log[a(Ca(2+))]. The calculated detection limit for Ca(2+)-ISME is 1 μM. The selectivity coefficients of this Ca(2+)-ISME are log K(Ca(2+),A) = -5.88, -5.54, and -6.31 for Mg(2+), Na(+), and K(+), respectively. We used this new type of Ca(2+)-ISME as an SECM probe to quantitatively map the chemical microenvironment produced by a model substrate, bioactive glass (BAG). In acidic conditions (pH 4.5), BAG was found to increase the calcium ion concentration from 0.7 mM ([Ca(2+)] in artificial saliva) to 1.4 mM at 20 μm above the surface. In addition, a solid-state dual SECM pH probe was used to correlate the release of calcium ions with the change in local pH. Three-dimensional pH and calcium ion distribution mapping were also obtained by using these solid-state probes. The quantitative mapping of pH and Ca(2+) above the BAG elucidates the effectiveness of BAG in neutralizing and releasing calcium ions in acidic conditions.

Signatures of Relativistic Helical Motion in the Rotation Measures of Active Galactic Nucleus Jets

NASA Astrophysics Data System (ADS)

Broderick, Avery E.; Loeb, Abraham

2009-10-01

Polarization has proven to be an invaluable tool for probing magnetic fields in relativistic jets. Maps of the intrinsic polarization vectors have provided the best evidence to date for uniform, toroidally dominated magnetic fields within jets. More recently, maps of the rotation measure (RM) in jets have for the first time probed the field geometry of the cool, moderately relativistic surrounding material. In most cases, clear signatures of the toroidal magnetic field are detected, corresponding to gradients in RM profiles transverse to the jet. However, in many objects, these profiles also display marked asymmetries that are difficult to explain in simple helical jet models. Furthermore, in some cases, the RM profiles are strongly frequency and/or time dependent. Here we show that these features may be naturally accounted for by including relativistic helical motion in the jet model. In particular, we are able to reproduce bent RM profiles observed in a variety of jets, frequency-dependent RM profile morphologies, and even the time dependence of the RM profiles of knots in 3C 273. Finally, we predict that some sources may show reversals in their RM profiles at sufficiently high frequencies, depending upon the ratio of the components of jet sheath velocity transverse and parallel to the jet. Thus, multi-frequency RM maps promise a novel way in which to probe the velocity structure of relativistic outflows.

Evaluation of four affibody-based near-infrared fluorescent probes for optical imaging of epidermal growth factor receptor positive tumors.

PubMed

Qi, Shibo; Miao, Zheng; Liu, Hongguang; Xu, Yingding; Feng, Yaqing; Cheng, Zhen

2012-06-20

The epidermal growth factor receptor 1 (EGFR) has become an attractive target for cancer molecular imaging and therapy. An Affibody protein with strong binding affinity for EGFR, ZEGFR:1907, has been reported. We are interested in translating Affibody molecules to potential clinical optical imaging of EGFR positive cancers. In this study, four anti-EGFR Affibody based near-infrared (NIR) fluorescent probes were thus prepared, and their in vivo performance was evaluated in the mice bearing EGFR positive subcutaneous A431 tumors. The Affibody analogue, Ac-Cys-ZEGFR:1907, was synthesized using solid-phase peptide synthesis method. The purified small protein was then site-specifically conjugated with four NIR fluorescent dyes, Cy5.5-monomaleimide, Alex-Fluor-680-maleimide, SRfluor680-maleimide, or IRDye-800CW-maleimide, to produce four optical probes-Cy5.5-ZEGFR:1907, Alexa680-ZEGFR:1907, SR680-ZEGFR:1907, and 800CW-ZEGFR:1907. The EGFR binding property and specificity of the four NIR fluorescent Affibody probes were studied by fluorescence microscopy using high EGFR expressing A431 cells and low expressing MCF7 cells. The binding affinities of the probes (KD) to EGFR were further determined by flow cytometry. In vivo optical imaging of the four probes was performed in the mice bearing subcutaneous A431 tumors. The four NIR optical probes were prepared in high purity. In vitro cell imaging studies demonstrated that all of them could specifically bind to EGFR positive A431 cells while showing minimum uptake in low EGFR expressing MCF7 cells. Flow cytometry showed that Cy5.5-ZEGFR:1907 and Alexa680-ZEGFR:1907 possessed high binding affinity in low nanomolar range (43.6 ± 8.4 and 28.3 ± 4.9, respectively). In vivo optical imaging of the four probes revealed that they all showed fast tumor targeting ability and good tumor-to-normal tissue contrast as early as 0.5 h postinjection (p.i.). The tumor-to-normal tissue ratio reached a peak at 2 to 4 h p.i. by regional of interest (ROI) analysis of images. Ex vivo studies further demonstrated that the four probes had high tumor uptakes. Particularly, Cy5.5-ZEGFR:1907 and Alex680-ZEGFR:1907 displayed higher tumor-to-normal tissue ratios than those of the other two probes. This work demonstrates that Affibody proteins can be modified with different NIR fluorescent dyes and used for imaging of EGFR expressing tumors. Different NIR fluorescent dyes have variable impact on the in vitro binding and in vivo performance of the resulting Affibody based probes. Therefore, selection of an appropriate NIRF label is important for optical probe development. The probes developed are promising for further tumor imaging applications and clinical translation. Particularly, Alex680-ZEGFR:1907 and Cy5.5-ZEGFR:1907 are excellent candidates as EGFR-targeted probes for optical imaging.

Using Morpholinos to Probe Gene Networks in Sea Urchin.

PubMed

Materna, Stefan C

2017-01-01

The control processes that underlie the progression of development can be summarized in maps of gene regulatory networks (GRNs). A critical step in their assembly is the systematic perturbation of network candidates. In sea urchins the most important method for interfering with expression in a gene-specific way is application of morpholino antisense oligonucleotides (MOs). MOs act by binding to their sequence complement in transcripts resulting in a block in translation or a change in splicing and thus result in a loss of function. Despite the tremendous success of this technology, recent comparisons to mutants generated by genome editing have led to renewed criticism and challenged its reliability. As with all methods based on sequence recognition, MOs are prone to off-target binding that may result in phenotypes that are erroneously ascribed to the loss of the intended target. However, the slow progression of development in sea urchins has enabled extremely detailed studies of gene activity in the embryo. This wealth of knowledge paired with the simplicity of the sea urchin embryo enables careful analysis of MO phenotypes through a variety of methods that do not rely on terminal phenotypes. This article summarizes the use of MOs in probing GRNs and the steps that should be taken to assure their specificity.

Treatment with escitalopram improves the attentional bias toward negative facial expressions in patients with major depressive disorders.

PubMed

Zhou, Zhenhe; Cao, Suxia; Li, Hengfen; Li, Youhui

2015-10-01

We hypothesized that treatment with escitalopram would improve cognitive bias and contribute to the recovery process for patients with major depressive disorder (MDD). Many previous studies have established that patients with MDD tend to pay selective attention to negative stimuli. The assessment of the level of cognitive bias is regarded as a crucial dimension of treatment outcomes for MDD. To our knowledge, no prior studies have been reported on the effects of treatment with escitalopram on attentional bias in MDD, employing a dot probe task of facial expression. We studied 25 patients with MDD and 25 controls, and used a dot probe task of facial expression to measure cognitive bias. The patients' psychopathologies were rated using the Hamilton Depression Scale (HAMD) at baseline and after 8 weeks of treatment with escitalopram. All participants performed the facial expression dot probe task. The results revealed that the 8 week escitalopram treatment decreased the HAMD scores. The patients with MDD at baseline exhibited an attentional bias towards negative faces, however, no significant bias toward either negative or happy faces were observed in the controls. After the 8 week escitalopram treatment, no significant bias toward negative faces was observed in the patient group. In conclusion, patients with MDD pay more attention to negative facial expressions, and treatment with escitalopram improves this attentional bias toward negative facial expressions. This is the first study, to our knowledge, on the effects of treatment with escitalopram on attentional bias in patients with MDD that has employed a dot probe task of facial expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identity-expression interaction in face perception: sex, visual field, and psychophysical factors.

PubMed

Godard, Ornella; Baudouin, Jean-Yves; Bonnet, Philippe; Fiori, Nicole

2013-01-01

We investigated the psychophysical factors underlying the identity-emotion interaction in face perception. Visual field and sex were also taken into account. Participants had to judge whether a probe face, presented in either the left or the right visual field, and a central target face belonging to same person while emotional expression varied (Experiment 1) or to judge whether probe and target faces expressed the same emotion while identity was manipulated (Experiment 2). For accuracy we replicated the mutual facilitation effect between identity and emotion; no sex or hemispheric differences were found. Processing speed measurements, however, showed a lesser degree of interference in women than in men, especially for matching identity when faces expressed different emotions after a left visual presentation probe face. Psychophysical indices can be used to determine whether these effects are perceptual (A') or instead arise at a post-perceptual decision-making stage (B"). The influence of identity on the processing of facial emotion seems to be due to perceptual factors, whereas the influence of emotion changes on identity processing seems to be related to decisional factors. In addition, men seem to be more "conservative" after a LVF/RH probe-face presentation when processing identity. Women seem to benefit from better abilities to extract facial invariant aspects relative to identity.

The Probe of Inflation and Cosmic Origins

NASA Astrophysics Data System (ADS)

Hanany, Shaul; Inflation Probe Mission Study Team

2018-01-01

The Probe of Inflation and Cosmic Origins will map the polarization of the cosmic microwave background over the entire sky with unprecedented sensitivity. It will search for gravity wave signals from the inflationary epoch, thus probing quantum gravity and constraining the energy scale of inflation; it will test the standard model of particle physics by measuring the number of light particles in the Universe and the mass of the neutrino; it will elucidate the nature of dark matter and search for new forms of matter in the early Universe; it will constrain star formation history over cosmic time; and it will determine the mechanisms of structure formation from galaxy cluster to stellar scales. I will review the status of design of this probe-scale mission.

Leaving out control groups: an internal contrast analysis of gene expression profiles in atrial fibrillation patients--a systems biology approach to clinical categorization.

PubMed

Vanhoutte, Kurt; de Asmundis, Carlo; Francesconi, Anna; Figysl, Jurgen; Steurs, Griet; Boussy, Tim; Roos, Markus; Mueller, Andreas; Massimo, Lucio; Paparella, Gaetano; Van Caelenberg, Kristien; Chierchia, Gian Battista; Sarkozy, Andrea; Terradellas, Pedro Brugada Y; Zizi, Martin

2009-01-01

Atrial fibrillation (AF) is a frequent chronic dysrythmia with an incidence that increases with age (>40). Because of its medical and socio-economic impacts it is expected to become an increasing burden on most health care systems. AF is a multi-factorial disease for which the identification of subtypes is warranted. Novel approaches based on the broad concepts of systems biology may overcome the blurred notion of normal and pathological phenotype, which is inherent to high throughput molecular arrays analysis. Here we apply an internal contrast algorithm on AF patient data with an analytical focus on potential entry pathways into the disease. We used a RMA (Robust Multichip Average) normalized Affymetrix micro-array data set from 10 AF patients (geo_accession #GSE2240). Four series of probes were selected based on physiopathogenic links with AF entryways: apoptosis (remodeling), MAP kinase (cell remodeling), OXPHOS (ability to sustain hemodynamic workload) and glycolysis (ischemia). Annotated probe lists were polled with Bioconductor packages in R (version 2.7.1). Genetic profile contrasts were analysed with hierarchical clustering and principal component analysis. The analysis revealed distinct patient groups for all probe sets. A substantial part (54% till 67%) of the variance is explained in the first 2 principal components. Genes in PC1/2 with high discriminatory value were selected and analyzed in detail. We aim for reliable molecular stratification of AF. We show that stratification is possible based on physiologically relevant gene sets. Genes with high contrast value are likely to give pathophysiological insight into permanent AF subtypes.

Normal p21Ras/MAP kinase pathway expression and function in PBMC from patients with polycystic ovary disease.

PubMed

Buchs, A; Chagag, P; Weiss, M; Kish, E; Levinson, R; Aharoni, D; Rapoport, M J

2004-04-01

Polycystic ovary disease (PCOD) is associated with insulin resistance and increased prevalence of type II diabetes mellitus (T2DM). The p21Ras/MAP kinase is a major intracellular signaling pathway mediating insulin signaling in insulin responsive tissues. The expression, regulation and function of the p21Ras/MAP kinase pathway in PCOD patients were examined. Peripheral blood mononuclear cells (PBMC) were isolated from ten patients with PCOD and ten controls. The expression of p21Ras and its regulatory proteins; hSOS1 and p120GAP were studied. The basal and phytohemaglutinin (PHA) or insulin stimulated phosphorylation of MAP kinase was determined. Expression of p21Ras, and its regulatory proteins hSOS1 and p120GAP were similar in PCOD patients and controls. Basal, PHA and insulin stimulated phosphorylation of MAP kinase, were also comparable in the two groups as well as their PBMC proliferative response. These data indicate that the expression and overall function of the p21Ras/MAP kinase pathway remain intact in non-diabetic patients with PCOD.

Genomic structure and chromosomal mapping of the human CD22 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

1993-06-01

The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

Physical mapping of complex genomes

DOEpatents

Evans, Glen A.

1993-01-01

Method for simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts int he pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert int he common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed. In other preferred embodiments, the cosmid clones are arranged in a three dimensional matrix, pooled and compared in threes according to intersecting planes of the three dimensional matrix. Arrangements corresponding to geometries of higher dimensions may also be prepared and used to simultaneously identify overlapping clones in highly complex libraries with relatively few hybridization reactions.

Expression of SNCG, MAP2, SDF-1 and CXCR4 in gastric adenocarcinoma and their clinical significance

PubMed Central

Zheng, Shufang; Shi, Lifang; Zhang, Yi; He, Tao

2014-01-01

Objectives: The purpose of the study was to detect the expression of SNCG, MAP2, SDF-1 and CXCR4 in gastric adenocarcinoma, and to evaluate their roles in the carcinogenesis of gastric adenocarcinoma, development, invasion and metastasis as well as their clinical significance. Methods: The expression of SNCG, MAP2, SDF-1 and CXCR4 was detected by SP immunohistochemical method in 225 cases of gastric adenocarcinoma and 105 cases of nonneoplastic adjacent gastric tissue. The expression of SNCG, MAP2, SDF-1 and CXCR4 mRNA was also detected by RT-PCR method in 50 cases of gastric adenocarcinoma and 30 cases of nonneoplastic adjacent gastric tissue. Results: The expression of SNCG, MAP2, SDF-1 and CXCR4 in the gastric adenocarcinoma was remarkably higher than those in the nonneoplastic adjacent gastric tissue (P < 0.01); The positive expression of SNCG and MAP2 was correlated with the depth of tumor invasion and the metastasis of lymph nodes (P < 0.05), and that of SDF-1 and CXCR4 was correlated with the metastasis of lymph nodes (P < 0.05). Conclusions: SNCG, MAP2, SDF-1 and CXCR4 may play an important role in the carcinogenesis, progression, invasion and metastasis of gastric adenocarcinoma. However, it still needs more exploration whether they can serve as promising therapeutic targets of gastric adenocarcinoma. PMID:25400739

Mapping the yeast genome by melting in nanofluidic devices

NASA Astrophysics Data System (ADS)

Welch, Robert L.; Czolkos, Ilja; Sladek, Rob; Reisner, Walter

2012-02-01

Optical mapping of DNA provides large-scale genomic information that can be used to assemble contigs from next-generation sequencing, and to detect re-arrangements between single cells. A recent optical mapping technique called denaturation mapping has the unique advantage of using physical principles rather than the action of enzymes to probe genomic structure. The absence of reagents or reaction steps makes denaturation mapping simpler than other protocols. Denaturation mapping uses fluorescence microscopy to image the pattern of partial melting along a DNA molecule extended in a channel of cross-section ˜100nm at the heart of a nanofluidic device. We successfully aligned melting maps from single DNA molecules to a theoretical map of the yeast genome (11.6Mbp) to identify their location. By aligning hundreds of molecules we assembled a consensus melting map of the yeast genome with 95% coverage.

Fluorescence-based endoscopic imaging of Thomsen-Friedenreich antigen to improve early detection of colorectal cancer.

PubMed

Sakuma, Shinji; Yu, James Y H; Quang, Timothy; Hiwatari, Ken-Ichiro; Kumagai, Hironori; Kao, Stephanie; Holt, Alex; Erskind, Jalysa; McClure, Richard; Siuta, Michael; Kitamura, Tokio; Tobita, Etsuo; Koike, Seiji; Wilson, Kevin; Richards-Kortum, Rebecca; Liu, Eric; Washington, Kay; Omary, Reed; Gore, John C; Pham, Wellington

2015-03-01

Thomsen-Friedenreich (TF) antigen belongs to the mucin-type tumor-associated carbohydrate antigen. Notably, TF antigen is overexpressed in colorectal cancer (CRC) but is rarely expressed in normal colonic tissue. Increased TF antigen expression is associated with tumor invasion and metastasis. In this study, we sought to validate a novel nanobeacon for imaging TF-associated CRC in a preclinical animal model. We developed and characterized the nanobeacon for use with fluorescence colonoscopy. In vivo imaging was performed on an orthotopic rat model of CRC. Both white light and fluorescence colonoscopy methods were utilized to establish the ratio-imaging index for the probe. The nanobeacon exhibited specificity for TF-associated cancer. Fluorescence colonoscopy using the probe can detect lesions at the stage which is not readily confirmed by conventional visualization methods. Further, the probe can report the dynamic change of TF expression as tumor regresses during chemotherapy. Data from this study suggests that fluorescence colonoscopy can improve early CRC detection. Supplemented by the established ratio-imaging index, the probe can be used not only for early detection, but also for reporting tumor response during chemotherapy. Furthermore, since the data obtained through in vivo imaging confirmed that the probe was not absorbed by the colonic mucosa, no registered toxicity is associated with this nanobeacon. Taken together, these data demonstrate the potential of this novel probe for imaging TF antigen as a biomarker for the early detection and prediction of the progression of CRC at the molecular level. © 2014 UICC.

A Feature Selection Algorithm to Compute Gene Centric Methylation from Probe Level Methylation Data.

PubMed

Baur, Brittany; Bozdag, Serdar

2016-01-01

DNA methylation is an important epigenetic event that effects gene expression during development and various diseases such as cancer. Understanding the mechanism of action of DNA methylation is important for downstream analysis. In the Illumina Infinium HumanMethylation 450K array, there are tens of probes associated with each gene. Given methylation intensities of all these probes, it is necessary to compute which of these probes are most representative of the gene centric methylation level. In this study, we developed a feature selection algorithm based on sequential forward selection that utilized different classification methods to compute gene centric DNA methylation using probe level DNA methylation data. We compared our algorithm to other feature selection algorithms such as support vector machines with recursive feature elimination, genetic algorithms and ReliefF. We evaluated all methods based on the predictive power of selected probes on their mRNA expression levels and found that a K-Nearest Neighbors classification using the sequential forward selection algorithm performed better than other algorithms based on all metrics. We also observed that transcriptional activities of certain genes were more sensitive to DNA methylation changes than transcriptional activities of other genes. Our algorithm was able to predict the expression of those genes with high accuracy using only DNA methylation data. Our results also showed that those DNA methylation-sensitive genes were enriched in Gene Ontology terms related to the regulation of various biological processes.

Modeling the Insertion Mechanics of Flexible Neural Probes Coated with Sacrificial Polymers for Optimizing Probe Design

PubMed Central

Singh, Sagar; Lo, Meng-Chen; Damodaran, Vinod B.; Kaplan, Hilton M.; Kohn, Joachim; Zahn, Jeffrey D.; Shreiber, David I.

2016-01-01

Single-unit recording neural probes have significant advantages towards improving signal-to-noise ratio and specificity for signal acquisition in brain-to-computer interface devices. Long-term effectiveness is unfortunately limited by the chronic injury response, which has been linked to the mechanical mismatch between rigid probes and compliant brain tissue. Small, flexible microelectrodes may overcome this limitation, but insertion of these probes without buckling requires supporting elements such as a stiff coating with a biodegradable polymer. For these coated probes, there is a design trade-off between the potential for successful insertion into brain tissue and the degree of trauma generated by the insertion. The objective of this study was to develop and validate a finite element model (FEM) to simulate insertion of coated neural probes of varying dimensions and material properties into brain tissue. Simulations were performed to predict the buckling and insertion forces during insertion of coated probes into a tissue phantom with material properties of brain. The simulations were validated with parallel experimental studies where probes were inserted into agarose tissue phantom, ex vivo chick embryonic brain tissue, and ex vivo rat brain tissue. Experiments were performed with uncoated copper wire and both uncoated and coated SU-8 photoresist and Parylene C probes. Model predictions were found to strongly agree with experimental results (<10% error). The ratio of the predicted buckling force-to-predicted insertion force, where a value greater than one would ideally be expected to result in successful insertion, was plotted against the actual success rate from experiments. A sigmoidal relationship was observed, with a ratio of 1.35 corresponding to equal probability of insertion and failure, and a ratio of 3.5 corresponding to a 100% success rate. This ratio was dubbed the “safety factor”, as it indicated the degree to which the coating should be over-designed to ensure successful insertion. Probability color maps were generated to visually compare the influence of design parameters. Statistical metrics derived from the color maps and multi-variable regression analysis confirmed that coating thickness and probe length were the most important features in influencing insertion potential. The model also revealed the effects of manufacturing flaws on insertion potential. PMID:26959021

Spatial Memory Impairment is Associated with Intraneural Amyloid-β Immunoreactivity and Dysfunctional Arc Expression in the Hippocampal-CA3 Region of a Transgenic Mouse Model of Alzheimer's Disease.

PubMed

Morin, Jean-Pascal; Cerón-Solano, Giovanni; Velázquez-Campos, Giovanna; Pacheco-López, Gustavo; Bermúdez-Rattoni, Federico; Díaz-Cintra, Sofía

2016-01-01

Dysfunction of synaptic communication in cortical and hippocampal networks has been suggested as one of the neuropathological hallmarks of the early stages of Alzheimer's disease (AD). Also, several lines of evidence have linked disrupted levels of activity-regulated cytoskeletal associated protein (Arc), an immediate early gene product that plays a central role in synaptic plasticity, with AD "synaptopathy". The mapping of Arc expression patterns in brain networks has been extensively used as a marker of memory-relevant neuronal activity history. Here we evaluated basal and behavior-induced Arc expression in hippocampal networks of the 3xTg-AD mouse model of AD. The basal percentage of Arc-expressing cells in 10-month-old 3xTg-AD mice was higher than wild type in CA3 (4.88% versus 1.77% , respectively) but similar in CA1 (1.75% versus 2.75% ). Noteworthy, this difference was not observed at 3 months of age. Furthermore, although a Morris water maze test probe induced a steep (∼4-fold) increment in the percentage of Arc+ cells in the CA3 region of the 10-month-old wild-type group, no such increment was observed in age-matched 3xTg-AD, whereas the amount of Arc+ cells in CA1 increased in both groups. Further, we detected that CA3 neurons with amyloid-β were much more likely to express Arc protein under basal conditions. We propose that in 3xTg-AD mice, intraneuronal amyloid-β expression in CA3 could increase unspecific neuronal activation and subsequent Arc protein expression, which might impair further memory-stabilizing processes.

Three-dimensional atomic force microscopy mapping at the solid-liquid interface with fast and flexible data acquisition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Söngen, Hagen, E-mail: soengen@uni-mainz.de; Graduate School Materials Science in Mainz, Staudinger Weg 9, 55128 Mainz; Nalbach, Martin

2016-06-15

We present the implementation of a three-dimensional mapping routine for probing solid-liquid interfaces using frequency modulation atomic force microscopy. Our implementation enables fast and flexible data acquisition of up to 20 channels simultaneously. The acquired data can be directly synchronized with commercial atomic force microscope controllers, making our routine easily extendable for related techniques that require additional data channels, e.g., Kelvin probe force microscopy. Moreover, the closest approach of the tip to the sample is limited by a user-defined threshold, providing the possibility to prevent potential damage to the tip. The performance of our setup is demonstrated by visualizing themore » hydration structure above the calcite (10.4) surface in water.« less

Peering through Jupiter’s clouds with radio spectral imaging

NASA Astrophysics Data System (ADS)

de Pater, Imke; Sault, R. J.; Butler, Bryan; DeBoer, David; Wong, Michael H.

2016-06-01

Radio wavelengths can probe altitudes in Jupiter’s atmosphere below its visible cloud layers. We used the Very Large Array to map this unexplored region down to ~8 bar, ~100 kilometers below the visible clouds. Our maps reveal a dynamically active planet at pressures less than 2 to 3 bar. A radio-hot belt exists, consisting of relatively transparent regions (a low ammonia concentration, NH3 being the dominant source of opacity) probing depths to over ~8 bar; these regions probably coincide with 5-micrometer hot spots. Just to the south we distinguish an equatorial wave, bringing up ammonia gas from Jupiter’s deep atmosphere. This wave has been theorized to produce the 5-micrometer hot spots; we observed the predicted radio counterpart of such hot spots.

Dynamics of Hollow Atom Formation in Intense X-Ray Pulses Probed by Partial Covariance Mapping

NASA Astrophysics Data System (ADS)

Frasinski, L. J.; Zhaunerchyk, V.; Mucke, M.; Squibb, R. J.; Siano, M.; Eland, J. H. D.; Linusson, P.; v. d. Meulen, P.; Salén, P.; Thomas, R. D.; Larsson, M.; Foucar, L.; Ullrich, J.; Motomura, K.; Mondal, S.; Ueda, K.; Osipov, T.; Fang, L.; Murphy, B. F.; Berrah, N.; Bostedt, C.; Bozek, J. D.; Schorb, S.; Messerschmidt, M.; Glownia, J. M.; Cryan, J. P.; Coffee, R. N.; Takahashi, O.; Wada, S.; Piancastelli, M. N.; Richter, R.; Prince, K. C.; Feifel, R.

2013-08-01

When exposed to ultraintense x-radiation sources such as free electron lasers (FELs) the innermost electronic shell can efficiently be emptied, creating a transient hollow atom or molecule. Understanding the femtosecond dynamics of such systems is fundamental to achieving atomic resolution in flash diffraction imaging of noncrystallized complex biological samples. We demonstrate the capacity of a correlation method called “partial covariance mapping” to probe the electron dynamics of neon atoms exposed to intense 8 fs pulses of 1062 eV photons. A complete picture of ionization processes competing in hollow atom formation and decay is visualized with unprecedented ease and the map reveals hitherto unobserved nonlinear sequences of photoionization and Auger events. The technique is particularly well suited to the high counting rate inherent in FEL experiments.

Mapping Cannabinoid 1 Receptor Allosteric Site(s): Critical Molecular Determinant and Signaling Profile of GAT100, a Novel, Potent, and Irreversibly Binding Probe.

PubMed

Laprairie, Robert B; Kulkarni, Abhijit R; Kulkarni, Pushkar M; Hurst, Dow P; Lynch, Diane; Reggio, Patricia H; Janero, David R; Pertwee, Roger G; Stevenson, Lesley A; Kelly, Melanie E M; Denovan-Wright, Eileen M; Thakur, Ganesh A

2016-06-15

One of the most abundant G-protein coupled receptors (GPCRs) in brain, the cannabinoid 1 receptor (CB1R), is a tractable therapeutic target for treating diverse psychobehavioral and somatic disorders. Adverse on-target effects associated with small-molecule CB1R orthosteric agonists and inverse agonists/antagonists have plagued their translational potential. Allosteric CB1R modulators offer a potentially safer modality through which CB1R signaling may be directed for therapeutic benefit. Rational design of candidate, druglike CB1R allosteric modulators requires greater understanding of the architecture of the CB1R allosteric endodomain(s) and the capacity of CB1R allosteric ligands to tune the receptor's information output. We have recently reported the synthesis of a focused library of rationally designed, covalent analogues of Org27569 and PSNCBAM-1, two prototypic CB1R negative allosteric modulators (NAMs). Among the novel, pharmacologically active CB1R NAMs reported, the isothiocyanate GAT100 emerged as the lead by virtue of its exceptional potency in the [(35)S]GTPγS and β-arrestin signaling assays and its ability to label CB1R as a covalent allosteric probe with significantly reduced inverse agonism in the [(35)S]GTPγS assay as compared to Org27569. We report here a comprehensive functional profiling of GAT100 across an array of important downstream cell-signaling pathways and analysis of its potential orthosteric probe-dependence and signaling bias. The results demonstrate that GAT100 is a NAM of the orthosteric CB1R agonist CP55,940 and the endocannabinoids 2-arachidonoylglycerol and anandamide for β-arrestin1 recruitment, PLCβ3 and ERK1/2 phosphorylation, cAMP accumulation, and CB1R internalization in HEK293A cells overexpressing CB1R and in Neuro2a and STHdh(Q7/Q7) cells endogenously expressing CB1R. Distinctively, GAT100 was a more potent and efficacious CB1R NAM than Org27569 and PSNCBAM-1 in all signaling assays and did not exhibit the inverse agonism associated with Org27569 and PSNCBAM-1. Computational docking studies implicate C7.38(382) as a key feature of GAT100 ligand-binding motif. These data help inform the engineering of newer-generation, druggable CB1R allosteric modulators and demonstrate the utility of GAT100 as a covalent probe for mapping structure-function correlates characteristic of the druggable CB1R allosteric space.

UV laser interaction with a fluorescent dye solution studied using pulsed digital holography.

PubMed

Amer, Eynas; Gren, Per; Sjödahl, Mikael

2013-10-21

A frequency tripled Q-switched Nd-YAG laser (wavelength 355 nm, pulse duration 12 ns) has been used to pump Coumarin 153 dye solved in ethanol. Simultaneously, a frequency doubled pulse (532 nm) from the same laser is used to probe the solvent perpendicularly resulting in a gain through stimulated laser induced fluorescence (LIF) emission. The resulting gain of the probe beam is recorded using digital holography by blending it with a reference beam on the detector. Two digital holograms without and with the pump beam were recorded. Intensity maps were calculated from the recorded digital holograms and used to calculate the gain of the probe beam due to the stimulated LIF. In addition numerical data of the local temperature rise was calculated from the corresponding phase maps using Radon inversion. It was concluded that about 15% of the pump beam energy is transferred to the dye solution as heat while the rest is consumed in the radiative process. The results show that pulsed digital holography is a promising technique for quantitative study of fluorescent species.

An eQTL Analysis of Partial Resistance to Puccinia hordei in Barley

PubMed Central

Chen, Xinwei; Hackett, Christine A.; Niks, Rients E.; Hedley, Peter E.; Booth, Clare; Druka, Arnis; Marcel, Thierry C.; Vels, Anton; Bayer, Micha; Milne, Iain; Morris, Jenny; Ramsay, Luke; Marshall, David; Cardle, Linda; Waugh, Robbie

2010-01-01

Background Genetic resistance to barley leaf rust caused by Puccinia hordei involves both R genes and quantitative trait loci. The R genes provide higher but less durable resistance than the quantitative trait loci. Consequently, exploring quantitative or partial resistance has become a favorable alternative for controlling disease. Four quantitative trait loci for partial resistance to leaf rust have been identified in the doubled haploid Steptoe (St)/Morex (Mx) mapping population. Further investigations are required to study the molecular mechanisms underpinning partial resistance and ultimately identify the causal genes. Methodology/Principal Findings We explored partial resistance to barley leaf rust using a genetical genomics approach. We recorded RNA transcript abundance corresponding to each probe on a 15K Agilent custom barley microarray in seedlings from St and Mx and 144 doubled haploid lines of the St/Mx population. A total of 1154 and 1037 genes were, respectively, identified as being P. hordei-responsive among the St and Mx and differentially expressed between P. hordei-infected St and Mx. Normalized ratios from 72 distant-pair hybridisations were used to map the genetic determinants of variation in transcript abundance by expression quantitative trait locus (eQTL) mapping generating 15685 eQTL from 9557 genes. Correlation analysis identified 128 genes that were correlated with resistance, of which 89 had eQTL co-locating with the phenotypic quantitative trait loci (pQTL). Transcript abundance in the parents and conservation of synteny with rice allowed us to prioritise six genes as candidates for Rphq11, the pQTL of largest effect, and highlight one, a phospholipid hydroperoxide glutathione peroxidase (HvPHGPx) for detailed analysis. Conclusions/Significance The eQTL approach yielded information that led to the identification of strong candidate genes underlying pQTL for resistance to leaf rust in barley and on the general pathogen response pathway. The dataset will facilitate a systems appraisal of this host-pathogen interaction and, potentially, for other traits measured in this population. PMID:20066049

An activity-based near-infrared glucuronide trapping probe for imaging β-glucuronidase expression in deep tissues.

PubMed

Cheng, Ta-Chun; Roffler, Steve R; Tzou, Shey-Cherng; Chuang, Kuo-Hsiang; Su, Yu-Cheng; Chuang, Chih-Hung; Kao, Chien-Han; Chen, Chien-Shu; Harn, I-Hong; Liu, Kuan-Yi; Cheng, Tian-Lu; Leu, Yu-Ling

2012-02-15

β-glucuronidase is an attractive reporter and prodrug-converting enzyme. The development of near-IR (NIR) probes for imaging of β-glucuronidase activity would be ideal to allow estimation of reporter expression and for personalized glucuronide prodrug cancer therapy in preclinical studies. However, NIR glucuronide probes are not yet available. In this work, we developed two fluorescent probes for detection of β-glucuronidase activity, one for the NIR range (containing IR-820 dye) and the other for the visible range [containing fluorescein isothiocyanate (FITC)], by utilizing a difluoromethylphenol-glucuronide moiety (TrapG) to trap the fluorochromes in the vicinity of the active enzyme. β-glucuronidase-mediated hydrolysis of the glucuronyl bond of TrapG generates a highly reactive alkylating group that facilitates the attachment of the fluorochrome to nucleophilic moieties located near β-glucuronidase-expressing sites. FITC-TrapG was selectively trapped on purified β-glucuronidase or β-glucuronidase-expressing CT26 cells (CT26/mβG) but not on bovine serum albumin or non-β-glucuronidase-expressing CT26 cells used as controls. β-glucuronidase-activated FITC-TrapG did not interfere with β-glucuronidase activity and could label bystander proteins near β-glucuronidase. Both FITC-TrapG and NIR-TrapG specifically imaged subcutaneous CT26/mβG tumors, but only NIR-TrapG could image CT26/mβG tumors transplanted deep in the liver. Thus NIR-TrapG may provide a valuable tool for visualizing β-glucuronidase activity in vivo.

In Situ Detection of MicroRNA Expression with RNAscope Probes.

PubMed

Yin, Viravuth P

2018-01-01

Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.

Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures

PubMed Central

Naughton, Catherine; Avlonitis, Nicolaos; Corless, Samuel; Prendergast, James G.; Mati, Ioulia K.; Eijk, Paul P.; Cockroft, Scott L.; Bradley, Mark; Ylstra, Bauke; Gilbert, Nick

2013-01-01

DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes. PMID:23416946

Transposable Elements and Genetic Instabilities in Crop Plants

DOE R&D Accomplishments Database

Burr, B.; Burr, F.

1981-04-10

Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

Lyman-tomography of cosmic infrared background fluctuations with euclid : probing emissions and baryonic acoustic oscillations at z ≳ 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kashlinsky, A.; Arendt, R. G.; Atrio-Barandela, F.

2015-11-01

The Euclid space mission, designed to probe evolution of the Dark Energy (DE), will map a large area of the sky at three adjacent near-IR filters, Y, J, and H. This coverage will also enable mapping source-subtracted cosmic infrared background (CIB) fluctuations with unprecedented accuracy on sub-degree angular scales. Here, we propose methodology, using the Lyman-break tomography applied to the Euclid -based CIB maps, to accurately isolate the history of CIB emissions as a function of redshift from 10 ≲ z ≲ 20 and to identify the baryonic acoustic oscillations (BAOs) at those epochs. To identify the BAO signature, wemore » would assemble individual CIB maps over conservatively large contiguous areas of ≳400 deg{sup 2}. The method can isolate the CIB spatial spectrum by z to sub-percent statistical accuracy. We illustrate this with a specific model of CIB production at high z normalized to reproduce the measured Spitzer -based CIB fluctuation. We show that even if the latter contains only a small component from high- z sources, the amplitude of that component can be accurately isolated with the methodology proposed here and the BAO signatures at z ≳ 10 are recovered well from the CIB fluctuation spatial spectrum. Probing the BAO at those redshifts will be an important test of the underlying cosmological paradigm and would narrow the overall uncertainties on the evolution of cosmological parameters, including the DE. Similar methodology is applicable to the planned WFIRST mission, where we show that a possible fourth near-IR channel at ≥2 μ m would be beneficial.« less

Syntenic conservation of HSP70 genes in cattle and humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grosz, M.D.; Womack, J.E.; Skow, L.C.

1992-12-01

A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

A draft physical map of a D-genome cotton species (Gossypium raimondii)

PubMed Central

2010-01-01

Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427

Tn5099, a xylE promoter probe transposon for Streptomyces spp.

PubMed Central

Hahn, D R; Solenberg, P J; Baltz, R H

1991-01-01

Tn5099, a promoter probe transposon for Streptomyces spp., was constructed by inserting a promoterless xylE gene and a hygromycin resistance gene into IS493. Tn5099 transposed into different sites in the Streptomyces griseofuscus genome, and the xylE reporter gene was expressed in some of the transposition mutants. Strains containing Tn5099 insertions that gave regulated expression of the xylE gene were identified. Images PMID:1653213

Folate receptor targeting silica nanoparticle probe for two-photon fluorescence bioimaging

PubMed Central

Wang, Xuhua; Yao, Sheng; Ahn, Hyo-Yang; Zhang, Yuanwei; Bondar, Mykhailo V.; Torres, Joseph A.; Belfield, Kevin D.

2010-01-01

Narrow dispersity organically modified silica nanoparticles (SiNPs), diameter ~30 nm, entrapping a hydrophobic two-photon absorbing fluorenyl dye, were synthesized by hydrolysis of triethoxyvinylsilane and (3-aminopropyl)triethoxysilane in the nonpolar core of Aerosol-OT micelles. The surface of the SiNPs were functionalized with folic acid, to specifically deliver the probe to folate receptor (FR) over-expressing Hela cells, making these folate two-photon dye-doped SiNPs potential candidates as probes for two-photon fluorescence microscopy (2PFM) bioimaging. In vitro studies using FR over-expressing Hela cells and low FR expressing MG63 cells demonstrated specific cellular uptake of the functionalized nanoparticles. One-photon fluorescence microscopy (1PFM) imaging, 2PFM imaging, and two-photon fluorescence lifetime microscopy (2P-FLIM) imaging of Hela cells incubated with folate-modified two-photon dye-doped SiNPs were demonstrated. PMID:21258480

Comprehensive molecular cytogenetic analysis of sorghum genome architecture: distribution of euchromatin, heterochromatin, genes and recombination in comparison to rice

Treesearch

J.-S Kim; M.N. Islam-Faridi; P.E. Klein; D.M. Stelly; H.J. Price; R.R. Klein; J.E. Mullet

2005-01-01

Cyteogenetic maps of sorghum chromosomes 3-7, 9, and 10 were constructed on the basis of the fluorescence in situ hybridization (FISH) of ~18-30 BAC probes mapped across each of these chromosomes. Distal regions of euchromatin and pericentromeric regions of heterchromatin were delimited for all 10 sorghum chromosomes and their DNA content quantified. Euchromatic DNA...

The Chromosome Microdissection and Microcloning Technique.

PubMed

Zhang, Ying-Xin; Deng, Chuan-Liang; Hu, Zan-Min

2016-01-01

Chromosome microdissection followed by microcloning is an efficient tool combining cytogenetics and molecular genetics that can be used for the construction of the high density molecular marker linkage map and fine physical map, the generation of probes for chromosome painting, and the localization and cloning of important genes. Here, we describe a modified technique to microdissect a single chromosome, paint individual chromosomes, and construct single-chromosome DNA libraries.

Atom probe tomographic mapping directly reveals the atomic distribution of phosphorus in resin embedded ferritin

DOE PAGES

Perea, Daniel E.; Liu, Jia; Bartrand, Jonah A. G.; ...

2016-02-29

In this study, we report the atomic-scale analysis of biological interfaces using atom probe tomography. Embedding the protein ferritin in an organic polymer resin lacking nitrogen provided chemical contrast to visualize atomic distributions and distinguish organic-organic and organic-inorganic interfaces. The sample preparation method can be directly extended to further enhance the study of biological, organic and inorganic nanomaterials relevant to health, energy or the environment.

Chromosomal Rainbows detect Oncogenic Rearrangements of Signaling Molecules in Thyroid Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, Benjamin; Jossart, Gregg H.; Ito, Yuko

2010-08-19

Altered signal transduction can be considered a hallmark of many solid tumors. In thyroid cancers the receptor tyrosine kinase (rtk) genes NTRK1 (Online Mendelian Inheritance in Man = OMIM *191315, also known as 'TRKA'), RET ('Rearranged during Transfection protooncogene', OMIM *164761) and MET (OMIM *164860) have been reported as activated, rearranged or overexpressed. In many cases, a combination of cytogenetic and molecular techniques allows elucidation of cellular changes that initiate tumor development and progression. While the mechanisms leading to overexpression of the rtk MET gene remain largely unknown, a variety of chromosomal rearrangements of the RET or NTKR1 gene couldmore » be demonstrated in thyroid cancer. Abnormal expressions in these tumors seem to follow a similar pattern: the rearrangement translocates the 3'-end of the rtk gene including the entire catalytic domain to an expressed gene leading to a chimeric RNA and protein with kinase activity. Our research was prompted by an increasing number of reports describing translocations involving ret and previously unknown translocation partners. We developed a high resolution technique based on fluorescence in situ hybridization (FISH) to allow rapid screening for cytogenetic rearrangements which complements conventional chromosome banding analysis. Our technique applies simultaneous hybridization of numerous probes labeled with different reporter molecules which are distributed along the target chromosome allowing the detection of cytogenetic changes at near megabase-pair (Mbp) resolution. Here, we report our results using a probe set specific for human chromosome 10, which is altered in a significant portion of human thyroid cancers (TC's). While rendering accurate information about the cytogenetic location of rearranged elements, our multi-locus, multi-color analysis was developed primarily to overcome limitations of whole chromosome painting (WCP) and chromosome banding techniques for fine mapping of breakpoints in papillary thyroid cancer (PTC).« less

Evaluation of Parkinson Disease Risk Variants as Expression-QTLs

PubMed Central

Latourelle, Jeanne C.; Dumitriu, Alexandra; Hadzi, Tiffany C.; Beach, Thomas G.; Myers, Richard H.

2012-01-01

The recent Parkinson Disease GWAS Consortium meta-analysis and replication study reports association at several previously confirmed risk loci SNCA, MAPT, GAK/DGKQ, and HLA and identified a novel risk locus at RIT2. To further explore functional consequences of these associations, we investigated modification of gene expression in prefrontal cortex brain samples of pathologically confirmed PD cases (N = 26) and controls (N = 24) by 67 associated SNPs in these 5 loci. Association between the eSNPs and expression was evaluated using a 2-degrees of freedom test of both association and difference in association between cases and controls, adjusted for relevant covariates. SNPs at each of the 5 loci were tested for cis-acting effects on all probes within 250 kb of each locus. Trans-effects of the SNPs on the 39,122 probes passing all QC on the microarray were also examined. From the analysis of cis-acting SNP effects, several SNPs in the MAPT region show significant association to multiple nearby probes, including two strongly correlated probes targeting the gene LOC644246 and the duplicated genes LRRC37A and LRRC37A2, and a third uncorrelated probe targeting the gene DCAKD. Significant cis-associations were also observed between SNPs and two probes targeting genes in the HLA region on chromosome 6. Expanding the association study to examine trans effects revealed an additional 23 SNP-probe associations reaching statistical significance (p<2.8×10−8) including SNPs from the SNCA, MAPT and RIT2 regions. These findings provide additional context for the interpretation of PD associated SNPs identified in recent GWAS as well as potential insight into the mechanisms underlying the observed SNP associations. PMID:23071545

eQTL Mapping Using RNA-seq Data

PubMed Central

Hu, Yijuan

2012-01-01

As RNA-seq is replacing gene expression microarrays to assess genome-wide transcription abundance, gene expression Quantitative Trait Locus (eQTL) studies using RNA-seq have emerged. RNA-seq delivers two novel features that are important for eQTL studies. First, it provides information on allele-specific expression (ASE), which is not available from gene expression microarrays. Second, it generates unprecedentedly rich data to study RNA-isoform expression. In this paper, we review current methods for eQTL mapping using ASE and discuss some future directions. We also review existing works that use RNA-seq data to study RNA-isoform expression and we discuss the gaps between these works and isoform-specific eQTL mapping. PMID:23667399

The Affinity of the S9.6 Antibody for Double-Stranded RNAs Impacts the Accurate Mapping of R-Loops in Fission Yeast.

PubMed

Hartono, Stella R; Malapert, Amélie; Legros, Pénélope; Bernard, Pascal; Chédin, Frédéric; Vanoosthuyse, Vincent

2018-02-02

R-loops, which result from the formation of stable DNA:RNA hybrids, can both threaten genome integrity and act as physiological regulators of gene expression and chromatin patterning. To characterize R-loops in fission yeast, we used the S9.6 antibody-based DRIPc-seq method to sequence the RNA strand of R-loops and obtain strand-specific R-loop maps at near nucleotide resolution. Surprisingly, preliminary DRIPc-seq experiments identified mostly RNase H-resistant but exosome-sensitive RNAs that mapped to both DNA strands and resembled RNA:RNA hybrids (dsRNAs), suggesting that dsRNAs form widely in fission yeast. We confirmed in vitro that S9.6 can immuno-precipitate dsRNAs and provide evidence that dsRNAs can interfere with its binding to R-loops. dsRNA elimination by RNase III treatment prior to DRIPc-seq allowed the genome-wide and strand-specific identification of genuine R-loops that responded in vivo to RNase H levels and displayed classical features associated with R-loop formation. We also found that most transcripts whose levels were altered by in vivo manipulation of RNase H levels did not form detectable R-loops, suggesting that prolonged manipulation of R-loop levels could indirectly alter the transcriptome. We discuss the implications of our work in the design of experimental strategies to probe R-loop functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mapping the Baby Universe

NASA Technical Reports Server (NTRS)

Wanjek, Christopher

2003-01-01

In June, NASA plans to launch the Microwave Anisotropy Probe (MAP) to survey the ancient radiation in unprecedented detail. MAP will map slight temperature fluctuations within the microwave background that vary by only 0.00001 C across a chilly radiation that now averages 2.73 C above absolute zero. The temperature differences today point back to density differences in the fiery baby universe, in which there was a little more matter here and a little less matter there. Areas of slightly enhanced density had stronger gravity than low-density areas. The high-density areas pulled back on the background radiation, making it appear slightly cooler in those directions.

Genomic stability in the archaeae Haloferax volcanii and Haloferax mediterranei.

PubMed Central

López-García, P; St Jean, A; Amils, R; Charlebois, R L

1995-01-01

Through hybridization of available probes, we have added nine genes to the macrorestriction map of the Haloferax mediterranei chromosome and five genes to the contig map of Haloferax volcanii. Additionally, we hybridized 17 of the mapped cosmid clones from H. volcanii to the H. mediterranei genome. The resulting 35-point chromosomal comparison revealed only two inversions and a few translocations. Forces known to promote rearrangement, common in the haloarchaea, have been ineffective in changing global gene order throughout the nearly 10(7) years of these species' divergent evolution. PMID:7868620

Elemental mapping of biological samples using a scanning proton microprobe

NASA Astrophysics Data System (ADS)

Watt, F.; Grime, G. W.

1988-03-01

Elemental mapping using a scanning proton microprobe (SPM) can be a powerful technique for probing trace elements in biology, allowing complex interfaces to be studied in detail, identifying contamination and artefacts present in the specimen, and in certain circumstances obtaining indirect chemical information. Examples used to illustrate the advantages of the technique include the elemental mapping of growing pollen tubes, honey bee brain section, a mouse macrophage cell, human liver section exhibiting primary biliary cirrhosis, and the attack by a mildew fungus on a pea leaf.

An ergonomic handheld ultrasound probe providing contact forces and pose information.

PubMed

Yohan Noh; Housden, R James; Gomez, Alberto; Knight, Caroline; Garcia, Francesca; Hongbin Liu; Razavi, Reza; Rhode, Kawal; Althoefer, Kaspar

2015-08-01

This paper presents a handheld ultrasound probe which is integrated with sensors to measure force and pose (position/orientation) information. Using an integrated probe like this, one can relate ultrasound images to spatial location and create 3D ultrasound maps. The handheld device can be used by sonographers and also easily be integrated with robot arms for automated sonography. The handheld device is ergonomically designed; rapid attachment and removal of the ultrasound transducer itself is possible using easy-to-operate clip mechanisms. A cable locking mechanism reduces the impact that gravitational and other external forces have (originating from data and power supply cables connected to the probe) on our measurements. Gravitational errors introduced by the housing of the probe are compensated for using knowledge of the housing geometry and the integrated pose sensor that provides us with accurate orientation information. In this paper, we describe the handheld probe with its integrated force/pose sensors and our approach to gravity compensation. We carried out a set of experiments to verify the feasibility of our approach to obtain accurate spatial information of the handheld probe.

An MR/MRI compatible core holder with the RF probe immersed in the confining fluid.

PubMed

Shakerian, M; Balcom, B J

2018-01-01

An open frame RF probe for high pressure and high temperature MR/MRI measurements was designed, fabricated, and tested. The open frame RF probe was installed inside an MR/MRI compatible metallic core holder, withstanding a maximum pressure and temperature of 5000 psi and 80 °C. The open frame RF probe was tunable for both 1 H and 19 F resonance frequencies with a 0.2 T static magnetic field. The open frame structure was based on simple pillars of PEEK polymer upon which the RF probe was wound. The RF probe was immersed in the high pressure confining fluid during operation. The open frame structure simplified fabrication of the RF probe and significantly reduced the amount of polymeric materials in the core holder. This minimized the MR background signal detected. Phase encoding MRI methods were employed to map the spin density of a sulfur hexafluoride gas saturating a Berea core plug in the core holder. The SF 6 was imaged as a high pressure gas and as a supercritical fluid. Copyright © 2017 Elsevier Inc. All rights reserved.

An MR/MRI compatible core holder with the RF probe immersed in the confining fluid

NASA Astrophysics Data System (ADS)

Shakerian, M.; Balcom, B. J.

2018-01-01

An open frame RF probe for high pressure and high temperature MR/MRI measurements was designed, fabricated, and tested. The open frame RF probe was installed inside an MR/MRI compatible metallic core holder, withstanding a maximum pressure and temperature of 5000 psi and 80 °C. The open frame RF probe was tunable for both 1H and 19F resonance frequencies with a 0.2 T static magnetic field. The open frame structure was based on simple pillars of PEEK polymer upon which the RF probe was wound. The RF probe was immersed in the high pressure confining fluid during operation. The open frame structure simplified fabrication of the RF probe and significantly reduced the amount of polymeric materials in the core holder. This minimized the MR background signal detected. Phase encoding MRI methods were employed to map the spin density of a sulfur hexafluoride gas saturating a Berea core plug in the core holder. The SF6 was imaged as a high pressure gas and as a supercritical fluid.

The development and evaluation of head probes for optical imaging of the infant head

NASA Astrophysics Data System (ADS)

Branco, Gilberto

The objective of this thesis was to develop and evaluate optical imaging probes for mapping oxygenation and haemodynamic changes in the newborn infant brain. Two imaging approaches are being developed at University College London (UCL): optical topography (surface mapping of the cortex) and optical tomography (volume imaging). Both have the potential to provide information about the function of the normal brain and about a variety of neurophysiologies! abnormalities. Both techniques require an array of optical fibres/fibre bundles to be held in contact with the head, for periods of time from tens of seconds to an hour or more. The design of suitable probes must ensure the comfort and safety of the subject, and provide measurements minimally sensitive to external sources of light and patient motion. A series of prototype adaptable helmets were developed for optical tomography of the premature infant brain using the UCL 32-channel time-resolved system. They were required to attach 32 optical fibre bundles over the infant scalp, and were designed to accommodate infants with a variety of head shapes and sizes, aged between 24-weeks gestational age and term. Continual improvements to the helmet design were introduced following the evaluation of each prototype on infants in the hospital. Data were acquired to generate images revealing the concentration and oxygenation of blood in the brain, and the response of the brain to sensory stimulation. This part of the project also involved designing and testing new methods of acquiring calibration data using reference phantoms. The second focus of the project was the development of probes for use with the UCL frequency-multiplexed near-infrared topography system. This is being used to image functional activation in the infant cortex. A series of probes were developed and experiments were conducted to evaluate their sensitivity to patient motion and to compression of the probe. The probes have been used for a variety of functional activation studies.

Reduced transcript stabilization restricts TNF-alpha expression in RAW264.7 macrophages infected with pathogenic mycobacteria: evidence for an involvement of lipomannan.

PubMed

Basler, Tina; Holtmann, Helmut; Abel, Jens; Eckstein, Torsten; Baumer, Wolfgang; Valentin-Weigand, Peter; Goethe, Ralph

2010-01-01

Despite the critical role that TNF-alpha plays in the containment of mycobacterial infection, the mechanisms involved in regulation of its expression by mycobacteria are poorly defined. We addressed this question by studying MAP, which causes a chronic enteritis in ruminants and is linked to human Crohn's disease. We found that in MAP infected macrophages, TNF-alpha gene expression was substantially lower than in macrophages infected with nonpathogenic MS or stimulated with LPS. TNF-alpha transcriptional one could not fully explain the differential TNF-alpha mRNA expression, suggesting that there must be a substantial contribution by post-transcriptional mechanisms.Accordingly, we found reduced TNF-alpha mRNA stability in MAP-infected macrophages. Further comparison of MAP- and MS-infected macrophages revealed that lower TNF-alpha mRNA stability combined with lower mRNA and protein expression in MAP-infected macrophages correlated with lower p38 MAPK phosphorylation. These findings were independent of viability of MAP and MS. We demonstrate that the major mycobacterial cell-wall lipoglycan LM of MAP and MS induced TNF-alpha mRNA transcription,but only the MS-LM induced p38 MAPK-dependent transcript stabilization. Overall, our data suggest that pathogenic mycobacteria cause weak p38 and TNF-alpha mRNA stabilization as a result of their structural cell-wall components such as LM and thereby, restrict TNF-alpha expression in macrophages.

Three-Dimensional Gene Map of Cancer Cell Types: Structural Entropy Minimisation Principle for Defining Tumour Subtypes

PubMed Central

Li, Angsheng; Yin, Xianchen; Pan, Yicheng

2016-01-01

In this study, we propose a method for constructing cell sample networks from gene expression profiles, and a structural entropy minimisation principle for detecting natural structure of networks and for identifying cancer cell subtypes. Our method establishes a three-dimensional gene map of cancer cell types and subtypes. The identified subtypes are defined by a unique gene expression pattern, and a three-dimensional gene map is established by defining the unique gene expression pattern for each identified subtype for cancers, including acute leukaemia, lymphoma, multi-tissue, lung cancer and healthy tissue. Our three-dimensional gene map demonstrates that a true tumour type may be divided into subtypes, each defined by a unique gene expression pattern. Clinical data analyses demonstrate that most cell samples of an identified subtype share similar survival times, survival indicators and International Prognostic Index (IPI) scores and indicate that distinct subtypes identified by our algorithms exhibit different overall survival times, survival ratios and IPI scores. Our three-dimensional gene map establishes a high-definition, one-to-one map between the biologically and medically meaningful tumour subtypes and the gene expression patterns, and identifies remarkable cells that form singleton submodules. PMID:26842724

Shadows and Dust: Mid-Infrared Extinction Mapping of the Initial Conditions of Massive Star and Star Cluster Formation

NASA Astrophysics Data System (ADS)

Tan, Jonathan

We describe a research plan to develop and extend the mid-infrared (MIR) extinction mapping technique presented by Butler & Tan (2009), who studied Infrared Dark Clouds (IRDCs) using Spitzer Space Telescope Infrared Array Camera (IRAC) 8 micron images. This method has the ability to probe the detailed spatial structure of very high column density regions, i.e. the gas clouds thought to represent the initial conditions for massive star and star cluster formation. We will analyze the data Spitzer obtained at other wavelengths, i.e. the IRAC bands at 3.6, 4.5 and 5.8 microns, and the Multiband Imaging Photometer (MIPS) bands, especially at 24 microns. This will allow us to measure the dust extinction law across the MIR and search for evidence of dust grain evolution, e.g. grain growth and ice mantle formation, as a function of gas density and column density. We will also study the detailed structure of the extinction features, including individual cores that may form single stars or close binaries, especially focusing on those cores that may form massive stars. By studying independent dark cores in a given IRDC, we will be able to test if they have a common minimum observed intensity, which we will then attribute to the foreground. This is a new method that should allow us to more accurately map distant, high column density IRDCs, probing more extreme regimes of star formation. We will combine MIR extinction mapping, which works best at high column densities, with near- IR mapping based on 2MASS images of star fields, which is most useful at lower columns that probe the extended giant molecular cloud structure. This information is crucial to help understand the formation process of IRDCs, which may be the rate limiting step for global galactic star formation rates. We will use our new extinction mapping methods to analyze large samples of IRDCs and thus search the Galaxy for the most extreme examples of high column density cores and assess the global star formation efficiency in dense gas. We will estimate the ability of future NASA missions, such as JWST, to carry out MIR extinction mapping science. We will develop the results of this research into an E/PO presentation to be included in the various public outreach events organized and courses taught by the PI.

Nondestructive Superresolution Imaging of Defects and Nonuniformities in Metals, Semiconductors, Dielectrics, Composites, and Plants Using Evanescent Microwaves

NASA Technical Reports Server (NTRS)

Tabib-Azar, M.; Pathak, P. S.; Ponchak, G.; LeClair, S.

1999-01-01

We have imaged and mapped material nonuniformities and defects using microwaves generated at the end of a microstripline resonator with 0.4 micrometer lateral spatial resolution at 1 GHz. Here we experimentally examine the effect of microstripline substrate permittivity, the feedline-to-resonator coupling strength, and probe tip geometry on the spatial resolution of the probe. Carbon composites, dielectrics, semiconductors, metals, and botanical samples were scanned for defects, residual stresses, subsurface features, areas of different film thickness, and moisture content. The resulting evanescent microwave probe (EMP) images are discussed. The main objective of this work is to demonstrate the overall capabilities of the EMP imaging technique as well as to discuss various probe parameters that can be used to design EMPs for different applications.

Space charge enhanced plasma gradient effects on satellite electric field measurements

NASA Technical Reports Server (NTRS)

Diebold, Dan; Hershkowitz, Noah; Dekock, J.; Intrator, T.; Hsieh, M-K.

1991-01-01

It has been recognized that plasma gradients can cause error in magnetospheric electric field measurements made by double probes. Space charge enhanced Plasma Gradient Induced Error (PGIE) is discussed in general terms, presenting the results of a laboratory experiment designed to demonstrate this error, and deriving a simple expression that quantifies this error. Experimental conditions were not identical to magnetospheric conditions, although efforts were made to insure the relevant physics applied to both cases. The experimental data demonstrate some of the possible errors in electric field measurements made by strongly emitting probes due to space charge effects in the presence of plasma gradients. Probe errors in space and laboratory conditions are discussed, as well as experimental error. In the final section, theoretical aspects are examined and an expression is derived for the maximum steady state space charge enhanced PGIE taken by two identical current biased probes.

A Crowdsourcing Evaluation of the NIH Chemical Probes

PubMed Central

Oprea, Tudor I.; Bologa, Cristian G.; Boyer, Scott; Curpan, Ramona F.; Glen, Robert C.; Hopkins, Andrew L.; Lipinski, Christopher A.; Marshall, Garland R.; Martin, Yvonne C.; Ostopovici-Halip, Liliana; Rishton, Gilbert; Ursu, Oleg; Vaz, Roy J.; Waller, Chris; Waldmann, Herbert; Sklar, Larry A.

2013-01-01

Between 2004 and 2008, the NIH molecular libraries and imaging initiative (MLI) pilot phase funded ten high-throughput Screening Centers, resulting in the deposition of 691 assays into PubChem and the nomination of 64 chemical probes. We crowdsourced the MLI output to 11 experts, who expressed medium or high levels of confidence in 48 of these 64 probes. PMID:19536101

MnO2 nanosheet mediated "DD-A" FRET binary probes for sensitive detection of intracellular mRNA.

PubMed

Ou, Min; Huang, Jin; Yang, Xiaohai; Quan, Ke; Yang, Yanjing; Xie, Nuli; Wang, Kemin

2017-01-01

The donor donor-acceptor (DD-A) FRET model has proven to have a higher FRET efficiency than donor-acceptor acceptor (D-AA), donor-acceptor (D-A), and donor donor-acceptor acceptor (DD-AA) FRET models. The in-tube and in-cell experiments clearly demonstrate that the "DD-A" FRET binary probes can indeed increase the FRET efficiency and provide higher imaging contrast, which is about one order of magnitude higher than the ordinary "D-A" model. Furthermore, MnO 2 nanosheets were employed to deliver these probes into living cells for intracellular TK1 mRNA detection because they can adsorb ssDNA probes, penetrate across the cell membrane and be reduced to Mn 2+ ions by intracellular GSH. The results indicated that the MnO 2 nanosheet mediated "DD-A" FRET binary probes are capable of sensitive and selective sensing gene expression and chemical-stimuli changes in gene expression levels in cancer cells. We believe that the MnO 2 nanosheet mediated "DD-A" FRET binary probes have the potential as a simple but powerful tool for basic research and clinical diagnosis.

Imaging Primary Mouse Sarcomas After Radiation Therapy Using Cathepsin-Activatable Fluorescent Imaging Agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuneo, Kyle C.; Mito, Jeffrey K.; Javid, Melodi P.

2013-05-01

Purpose: Cathepsin-activated fluorescent probes can detect tumors in mice and in canine patients. We previously showed that these probes can detect microscopic residual sarcoma in the tumor bed of mice during gross total resection. Many patients with soft tissue sarcoma (STS) and other tumors undergo radiation therapy (RT) before surgery. This study assesses the effect of RT on the ability of cathepsin-activated probes to differentiate between normal and cancerous tissue. Methods and Materials: A genetically engineered mouse model of STS was used to generate primary hind limb sarcomas that were treated with hypofractionated RT. Mice were injected intravenously with cathepsin-activatedmore » fluorescent probes, and various tissues, including the tumor, were imaged using a hand-held imaging device. Resected tumor and normal muscle samples were harvested to assess cathepsin expression by Western blot. Uptake of activated probe was analyzed by flow cytometry and confocal microscopy. Parallel in vitro studies using mouse sarcoma cells were performed. Results: RT of primary STS in mice and mouse sarcoma cell lines caused no change in probe activation or cathepsin protease expression. Increasing radiation dose resulted in an upward trend in probe activation. Flow cytometry and immunofluorescence showed that a substantial proportion of probe-labeled cells were CD11b-positive tumor-associated immune cells. Conclusions: In this primary murine model of STS, RT did not affect the ability of cathepsin-activated probes to differentiate between tumor and normal muscle. Cathepsin-activated probes labeled tumor cells and tumor-associated macrophages. Our results suggest that it would be feasible to include patients who have received preoperative RT in clinical studies evaluating cathepsin-activated imaging probes.« less

Widespread antisense transcription of Populus genome under drought.

PubMed

Yuan, Yinan; Chen, Su

2018-06-06

Antisense transcription is widespread in many genomes and plays important regulatory roles in gene expression. The objective of our study was to investigate the extent and functional relevance of antisense transcription in forest trees. We employed Populus, a model tree species, to probe the antisense transcriptional response of tree genome under drought, through stranded RNA-seq analysis. We detected nearly 48% of annotated Populus gene loci with antisense transcripts and 44% of them with co-transcription from both DNA strands. Global distribution of reads pattern across annotated gene regions uncovered that antisense transcription was enriched in untranslated regions while sense reads were predominantly mapped in coding exons. We further detected 1185 drought-responsive sense and antisense gene loci and identified a strong positive correlation between the expression of antisense and sense transcripts. Additionally, we assessed the antisense expression in introns and found a strong correlation between intronic expression and exonic expression, confirming antisense transcription of introns contributes to transcriptional activity of Populus genome under drought. Finally, we functionally characterized drought-responsive sense-antisense transcript pairs through gene ontology analysis and discovered that functional groups including transcription factors and histones were concordantly regulated at both sense and antisense transcriptional level. Overall, our study demonstrated the extensive occurrence of antisense transcripts of Populus genes under drought and provided insights into genome structure, regulation pattern and functional significance of drought-responsive antisense genes in forest trees. Datasets generated in this study serve as a foundation for future genetic analysis to improve our understanding of gene regulation by antisense transcription.

ATLAS Probe: Exploring Frontiers in Galaxy Evolution, Cosmology, and Milky Way Science

NASA Astrophysics Data System (ADS)

Wang, Yun; Robberto, Massimo; Dickinson, Mark; Ferguson, Henry C.; Hillenbrand, Lynne; Hirata, Christopher M.; Cimatti, Andrea; Bartlett, James; Barkhouser, Robert; Benjamin, Robert A.; Brinchmann, Jarle; Chary, Ranga-Ram; Conroy, Charlie; Daddi, Emanuele; Donahue, Megan; Dore, Olivier; Eisenhardt, Peter; Fraser, Wesley C.; Helou, George; Kirkpatrick, J. Davy; Malhotra, Sangeeta; Moscardini, Lauro; Ninkov, Zoran; Ressler, Michael; Rhoads, James; Rhodes, Jason; Shapley, Alice; Smee, Stephen; ATLAS Probe Team

2018-01-01

ATLAS (Astrophysics Telescope for Large Area Spectroscopy) Probe is a concept for a NASA probe-class space mission that leverages WFIRST imaging for targeted spectroscopy. ATLAS Probe will obtain spectra of 90% of all galaxies imaged by the WFIRST High Latitude Survey at z > 0.5, with slit spectra of 300 million galaxies to z = 7. ATLAS Probe and WFIRST together will produce a 3D map of the Universe with Mpc resolution over 2200 sq deg, the definitive data sets for studying galaxy evolution, probing dark matter, dark energy and modification of general relativity, and quantifying the 3D structure and stellar content of the Milky Way.ATLAS Probe science spans four broad categories: (1) Revolutionize galaxy evolution studies by tracing the relation between galaxies and dark matter from the local group to cosmic voids and filaments, from the epoch of reionization through the peak era of galaxy assembly. (2) Open a new window into the Universe by mapping the dark matter filaments using 3D weak lensing with spectroscopic redshifts to unveil the nature of the dark Universe, and obtaining definitive measurements of dark energy and possible modification of general relativity using cosmic large-scale structure. (3) Probe the Milky Way's dust-shrouded regions, reaching the far side of our Galaxy. (4) Characterize asteroids and comets in the outer Solar System.ATLAS Probe is a 1.5m telescope with a field of view (FoV) of 0.4 sq deg, and uses Digital Micromirror Devices (DMDs) as slit selectors. It has a spectroscopic resolution of R = 600, and a wavelength range of 1-4μm. The lack of slit spectroscopy from space over a wide FoV is the obvious gap in current and planned future space missions; ATLAS fills this big gap with an unprecedented spectroscopic capability (with an estimated spectroscopic multiplex factor of 5000-10000). It has an estimated cost under $1B, with a single instrument, a telescope aperture that allows for a lighter launch vehicle, and mature technology (DMDs can reach Technology Readiness Level 6 within two years). ATLAS Probe will lead to transformative science over the entire range of astrophysics: from galaxy evolution to the dark Universe, from Solar System objects to the dusty regions of the Galaxy.

Evaluation of fluorescence in situ hybridization techniques to study long non-coding RNA expression in cultured cells

PubMed Central

Soares, Ricardo J; Maglieri, Giulia; Gutschner, Tony; Lund, Anders H; Nielsen, Boye S

2018-01-01

Abstract Deciphering the functions of long non-coding RNAs (lncRNAs) is facilitated by visualization of their subcellular localization using in situ hybridization (ISH) techniques. We evaluated four different ISH methods for detection of MALAT1 and CYTOR in cultured cells: a multiple probe detection approach with or without enzymatic signal amplification, a branched-DNA (bDNA) probe and an LNA-modified probe with enzymatic signal amplification. All four methods adequately stained MALAT1 in the nucleus in all of three cell lines investigated, HeLa, NHDF and T47D, and three of the methods detected the less expressed CYTOR. The sensitivity of the four ISH methods was evaluated by image analysis. In all three cell lines, the two methods involving enzymatic amplification gave the most intense MALAT1 signal, but the signal-to-background ratios were not different. CYTOR was best detected using the bDNA method. All four ISH methods showed significantly reduced MALAT1 signal in knock-out cells, and siRNA-induced knock-down of CYTOR resulted in significantly reduced CYTOR ISH signal, indicating good specificity of the probe designs and detection systems. Our data suggest that the ISH methods allow detection of both abundant and less abundantly expressed lncRNAs, although the latter required the use of the most specific and sensitive probe detection system. PMID:29059327

In situ monitoring of cytoplasmic precursor and mature microRNA using gold nanoparticle and graphene oxide composite probes.

PubMed

Hong, Min; Sun, Hongxiao; Xu, Lidan; Yue, Qiaoli; Shen, Guodong; Li, Meifang; Tang, Bo; Li, Chen-Zhong

2018-08-27

This study strategically fabricates a nucleic acid functionalized gold nanoparticle and graphene oxide composite probe (AuNP/GO probe) to achieve both the recognition and in situ monitoring of cytoplasmic target precursor microRNAs (pre-miRNAs) and mature microRNAs (miRNAs) in living cells. The pre-miRNA-21 detection with AuNP probes has a good linear range of 0-300 nM and a limit of detection (LOD) of 4.5 nM, whereas the GO probe has a linear relationship with mature miRNA-21 from 0.1 to 10 nM with a LOD of 1.74 nM. This assay was utilized to directly visualize the relative expression levels of pre- and mature forms of miRNA-21 and let-7a. The results suggested that the expression levels of precursor miRNAs remain constant in cancer cells and normal cells. However, the expression levels of mature miRNAs vary widely, demonstrating the "up-regulation" of miRNA-21 and "down-regulation" of let-7a in cancer cells in contrast to that in normal cells. The practicality of this strategy was verified by in situ monitoring changes in cytoplasmic pre-miRNA-21 and mature miRNA-21 in response to small-molecule inhibitors of miRNA-21. Copyright © 2018 Elsevier B.V. All rights reserved.

TIPMaP: a web server to establish transcript isoform profiles from reliable microarray probes.

PubMed

Chitturi, Neelima; Balagannavar, Govindkumar; Chandrashekar, Darshan S; Abinaya, Sadashivam; Srini, Vasan S; Acharya, Kshitish K

2013-12-27

Standard 3' Affymetrix gene expression arrays have contributed a significantly higher volume of existing gene expression data than other microarray platforms. These arrays were designed to identify differentially expressed genes, but not their alternatively spliced transcript forms. No resource can currently identify expression pattern of specific mRNA forms using these microarray data, even though it is possible to do this. We report a web server for expression profiling of alternatively spliced transcripts using microarray data sets from 31 standard 3' Affymetrix arrays for human, mouse and rat species. The tool has been experimentally validated for mRNAs transcribed or not-detected in a human disease condition (non-obstructive azoospermia, a male infertility condition). About 4000 gene expression datasets were downloaded from a public repository. 'Good probes' with complete coverage and identity to latest reference transcript sequences were first identified. Using them, 'Transcript specific probe-clusters' were derived for each platform and used to identify expression status of possible transcripts. The web server can lead the user to datasets corresponding to specific tissues, conditions via identifiers of the microarray studies or hybridizations, keywords, official gene symbols or reference transcript identifiers. It can identify, in the tissues and conditions of interest, about 40% of known transcripts as 'transcribed', 'not-detected' or 'differentially regulated'. Corresponding additional information for probes, genes, transcripts and proteins can be viewed too. We identified the expression of transcripts in a specific clinical condition and validated a few of these transcripts by experiments (using reverse transcription followed by polymerase chain reaction). The experimental observations indicated higher agreements with the web server results, than contradictions. The tool is accessible at http://resource.ibab.ac.in/TIPMaP. The newly developed online tool forms a reliable means for identification of alternatively spliced transcript-isoforms that may be differentially expressed in various tissues, cell types or physiological conditions. Thus, by making better use of existing data, TIPMaP avoids the dependence on precious tissue-samples, in experiments with a goal to establish expression profiles of alternative splice forms--at least in some cases.

Rice-arsenate interactions in hydroponics: whole genome transcriptional analysis.

PubMed

Norton, Gareth J; Lou-Hing, Daniel E; Meharg, Andrew A; Price, Adam H

2008-01-01

Rice (Oryza sativa) varieties that are arsenate-tolerant (Bala) and -sensitive (Azucena) were used to conduct a transcriptome analysis of the response of rice seedlings to sodium arsenate (AsV) in hydroponic solution. RNA extracted from the roots of three replicate experiments of plants grown for 1 week in phosphate-free nutrient with or without 13.3 muM AsV was used to challenge the Affymetrix (52K) GeneChip Rice Genome array. A total of 576 probe sets were significantly up-regulated at least 2-fold in both varieties, whereas 622 were down-regulated. Ontological classification is presented. As expected, a large number of transcription factors, stress proteins, and transporters demonstrated differential expression. Striking is the lack of response of classic oxidative stress-responsive genes or phytochelatin synthases/synthatases. However, the large number of responses from genes involved in glutathione synthesis, metabolism, and transport suggests that glutathione conjugation and arsenate methylation may be important biochemical responses to arsenate challenge. In this report, no attempt is made to dissect differences in the response of the tolerant and sensitive variety, but analysis in a companion article will link gene expression to the known tolerance loci available in the BalaxAzucena mapping population.

Rice–arsenate interactions in hydroponics: whole genome transcriptional analysis

PubMed Central

Norton, Gareth J.; Lou-Hing, Daniel E.; Meharg, Andrew A.; Price, Adam H.

2008-01-01

Rice (Oryza sativa) varieties that are arsenate-tolerant (Bala) and -sensitive (Azucena) were used to conduct a transcriptome analysis of the response of rice seedlings to sodium arsenate (AsV) in hydroponic solution. RNA extracted from the roots of three replicate experiments of plants grown for 1 week in phosphate-free nutrient with or without 13.3 μM AsV was used to challenge the Affymetrix (52K) GeneChip Rice Genome array. A total of 576 probe sets were significantly up-regulated at least 2-fold in both varieties, whereas 622 were down-regulated. Ontological classification is presented. As expected, a large number of transcription factors, stress proteins, and transporters demonstrated differential expression. Striking is the lack of response of classic oxidative stress-responsive genes or phytochelatin synthases/synthatases. However, the large number of responses from genes involved in glutathione synthesis, metabolism, and transport suggests that glutathione conjugation and arsenate methylation may be important biochemical responses to arsenate challenge. In this report, no attempt is made to dissect differences in the response of the tolerant and sensitive variety, but analysis in a companion article will link gene expression to the known tolerance loci available in the Bala×Azucena mapping population. PMID:18453530

Hot spot analysis for driving the development of hits into leads in fragment based drug discovery

PubMed Central

Hall, David R.; Ngan, Chi Ho; Zerbe, Brandon S.; Kozakov, Dima; Vajda, Sandor

2011-01-01

Fragment based drug design (FBDD) starts with finding fragment-sized compounds that are highly ligand efficient and can serve as a core moiety for developing high affinity leads. Although the core-bound structure of a protein facilitates the construction of leads, effective design is far from straightforward. We show that protein mapping, a computational method developed to find binding hot spots and implemented as the FTMap server, provides information that complements the fragment screening results and can drive the evolution of core fragments into larger leads with a minimal loss or, in some cases, even a gain in ligand efficiency. The method places small molecular probes, the size of organic solvents, on a dense grid around the protein, and identifies the hot spots as consensus clusters formed by clusters of several probes. The hot spots are ranked based on the number of probe clusters, which predicts the binding propensity of the subsites and hence their importance for drug design. Accordingly, with a single exception the main hot spot identified by FTMap binds the core compound found by fragment screening. The most useful information is provided by the neighboring secondary hot spots, indicating the regions where the core can be extended to increase its affinity. To quantify this information, we calculate the density of probes from mapping, which describes the binding propensity at each point, and show that the change in the correlation between a ligand position and the probe density upon extending or repositioning the core moiety predicts the expected change in ligand efficiency. PMID:22145575

In vivo inflammation mapping of periodontal disease based on diffuse reflectance spectral imaging: a clinical study

NASA Astrophysics Data System (ADS)

Prasanth, Chandra Sekhar; Betsy, Joseph; Jayanthi, Jayaraj L.; Nisha, Unni G.; Prasantila, Janam; Subhash, Narayanan

2013-02-01

Since conventional techniques using periodontal probes have inherent drawbacks in the diagnosis of different grades of gingival inflammation, development of noninvasive screening devices becomes significant. Diffuse reflectance (DR) spectra recorded with white light illumination is utilized to detect periodontal inflammation from the oxygenated hemoglobin absorption ratio R620/R575. A multispectral imaging system is utilized to record narrow-band DR images at 575 and 620 nm from the anterior sextant of the gingivia of 15 healthy volunteers and 25 patients (N=40). An experienced periodontist assesses the level of gingival inflammation at each site through periodontal probing and assigns diagnosis as healthy, mild, moderate, or severe inflammation. The DR image ratio R620/R575 computed for each pixel (8-μm resolution) from the monochrome images is pseudo-color-mapped to identify gingival inflammation sites. The DR image ratio values at each site are compared with clinical diagnosis to estimate the specificity and sensitivity of the DR imaging technique in inflammation mapping. The high diagnostic accuracy is utilized to detect underlying inflammation in six patients with a previous history of periodontitis.

Retinal vessel segmentation on SLO image

PubMed Central

Xu, Juan; Ishikawa, Hiroshi; Wollstein, Gadi; Schuman, Joel S.

2010-01-01

A scanning laser ophthalmoscopy (SLO) image, taken from optical coherence tomography (OCT), usually has lower global/local contrast and more noise compared to the traditional retinal photograph, which makes the vessel segmentation challenging work. A hybrid algorithm is proposed to efficiently solve these problems by fusing several designed methods, taking the advantages of each method and reducing the error measurements. The algorithm has several steps consisting of image preprocessing, thresholding probe and weighted fusing. Four different methods are first designed to transform the SLO image into feature response images by taking different combinations of matched filter, contrast enhancement and mathematical morphology operators. A thresholding probe algorithm is then applied on those response images to obtain four vessel maps. Weighted majority opinion is used to fuse these vessel maps and generate a final vessel map. The experimental results showed that the proposed hybrid algorithm could successfully segment the blood vessels on SLO images, by detecting the major and small vessels and suppressing the noises. The algorithm showed substantial potential in various clinical applications. The use of this method can be also extended to medical image registration based on blood vessel location. PMID:19163149

Face recognition from unconstrained three-dimensional face images using multitask sparse representation

NASA Astrophysics Data System (ADS)

Bentaieb, Samia; Ouamri, Abdelaziz; Nait-Ali, Amine; Keche, Mokhtar

2018-01-01

We propose and evaluate a three-dimensional (3D) face recognition approach that applies the speeded up robust feature (SURF) algorithm to the depth representation of shape index map, under real-world conditions, using only a single gallery sample for each subject. First, the 3D scans are preprocessed, then SURF is applied on the shape index map to find interest points and their descriptors. Each 3D face scan is represented by keypoints descriptors, and a large dictionary is built from all the gallery descriptors. At the recognition step, descriptors of a probe face scan are sparsely represented by the dictionary. A multitask sparse representation classification is used to determine the identity of each probe face. The feasibility of the approach that uses the SURF algorithm on the shape index map for face identification/authentication is checked through an experimental investigation conducted on Bosphorus, University of Milano Bicocca, and CASIA 3D datasets. It achieves an overall rank one recognition rate of 97.75%, 80.85%, and 95.12%, respectively, on these datasets.

X-ray fluorescence microscopy artefacts in elemental maps of topologically complex samples: Analytical observations, simulation and a map correction method

NASA Astrophysics Data System (ADS)

Billè, Fulvio; Kourousias, George; Luchinat, Enrico; Kiskinova, Maya; Gianoncelli, Alessandra

2016-08-01

XRF spectroscopy is among the most widely used non-destructive techniques for elemental analysis. Despite the known angular dependence of X-ray fluorescence (XRF), topological artefacts remain an unresolved issue when using X-ray micro- or nano-probes. In this work we investigate the origin of the artefacts in XRF imaging of topologically complex samples, which are unresolved problems in studies of organic matter due to the limited travel distances of low energy XRF emission from the light elements. In particular we mapped Human Embryonic Kidney (HEK293T) cells. The exemplary results with biological samples, obtained with a soft X-ray scanning microscope installed at a synchrotron facility were used for testing a mathematical model based on detector response simulations, and for proposing an artefact correction method based on directional derivatives. Despite the peculiar and specific application, the methodology can be easily extended to hard X-rays and to set-ups with multi-array detector systems when the dimensions of surface reliefs are in the order of the probing beam size.

Molecular mapping of chromosomes 17 and X. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1989-12-31

The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less

Molecular mapping of chromosomes 17 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1989-01-01

The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less

Design and Evaluation of a Balloon-Borne Electric Field Sensor

DTIC Science & Technology

1976-10-18

on a Lume A? A.3 Total Induced Charge vs, Orientation AB APPENDIX B ELEMflUICS PACAE B.l Electrometer Amplifier BI B.Z2 Charge Aplifier Bl B.3...properties change with height? 3) How strongly are fields mapped between the ground and the ionosphere? Because of its ability to make accurate profile...then each conductor should reach the potential of the average atmospheric potential surrounding the probes. These probes probably are of limited use

Personalized Medicine in Veterans with Traumatic Brain Injuries

DTIC Science & Technology

2012-05-01

UPGMA ) based on cosine correlation of row mean centered log2 signal values; this was the top 50%-tile, 3) In the DA top 50%-tile, selected probe sets...GeneMaths XT following row mean centering of log2 trans- formed MAS5.0 signal values; probe set cluster- ing was performed by the UPGMA method using...hierarchical clustering analysis using the UPGMA algorithm with cosine correlation as the similarity metric. Results are presented as a heat map (left

Mapping Autonomous System’s Router Level Topology in IPv6

DTIC Science & Technology

2007-06-01

useful and is called rate limiting. Rate limiting sends enough probes to one of the alias addresses to cause the router to begin rate limiting the...network. The second key capability required was alias and anonymous resolution: if there was no method of making these functions happen then any graph...command, then port unreachable responses were received by probes through d5 to interface d13 or d5. Again, it is believed that this happened

Identification of genes and gene pathways associated with major depressive disorder by integrative brain analysis of rat and human prefrontal cortex transcriptomes

PubMed Central

Malki, K; Pain, O; Tosto, M G; Du Rietz, E; Carboni, L; Schalkwyk, L C

2015-01-01

Despite moderate heritability estimates, progress in uncovering the molecular substrate underpinning major depressive disorder (MDD) has been slow. In this study, we used prefrontal cortex (PFC) gene expression from a genetic rat model of MDD to inform probe set prioritization in PFC in a human post-mortem study to uncover genes and gene pathways associated with MDD. Gene expression differences between Flinders sensitive (FSL) and Flinders resistant (FRL) rat lines were statistically evaluated using the RankProd, non-parametric algorithm. Top ranking probe sets in the rat study were subsequently used to prioritize orthologous selection in a human PFC in a case–control post-mortem study on MDD from the Stanley Brain Consortium. Candidate genes in the human post-mortem study were then tested against a matched control sample using the RankProd method. A total of 1767 probe sets were differentially expressed in the PFC between FSL and FRL rat lines at (q⩽0.001). A total of 898 orthologous probe sets was found on Affymetrix's HG-U95A chip used in the human study. Correcting for the number of multiple, non-independent tests, 20 probe sets were found to be significantly dysregulated between human cases and controls at q⩽0.05. These probe sets tagged the expression profile of 18 human genes (11 upregulated and seven downregulated). Using an integrative rat–human study, a number of convergent genes that may have a role in pathogenesis of MDD were uncovered. Eighty percent of these genes were functionally associated with a key stress response signalling cascade, involving NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells), AP-1 (activator protein 1) and ERK/MAPK, which has been systematically associated with MDD, neuroplasticity and neurogenesis. PMID:25734512

In vivo microvascular imaging of human oral and nasal cavities using swept-source optical coherence tomography with a single forward/side viewing probe

NASA Astrophysics Data System (ADS)

Choi, Woo June; Wang, Ruikang K.

2015-03-01

We report three-dimensional (3D) imaging of microcirculation within human cavity tissues in vivo using a high-speed swept-source optical coherence tomography (SS-OCT) at 1.3 μm with a modified probe interface. Volumetric structural OCT images of the inner tissues of oral and nasal cavities are acquired with a field of view of 2 mm x 2 mm. Two types of disposable and detachable probe attachments are devised and applied to the port of the imaging probe of OCT system, enabling forward and side imaging scans for selective and easy access to specific cavity tissue sites. Blood perfusion is mapped with OCT-based microangiography from 3D structural OCT images, in which a novel vessel extraction algorithm is used to decouple dynamic light scattering signals, due to moving blood cells, from the background scattering signals due to static tissue elements. Characteristic tissue anatomy and microvessel architectures of various cavity tissue regions of a healthy human volunteer are identified with the 3D OCT images and the corresponding 3D vascular perfusion maps at a level approaching capillary resolution. The initial finding suggests that the proposed method may be engineered into a promising tool for evaluating and monitoring tissue microcirculation and its alteration within a wide-range of cavity tissues in the patients with various pathological conditions.

"Gap hunting" to characterize clustered probe signals in Illumina methylation array data.

PubMed

Andrews, Shan V; Ladd-Acosta, Christine; Feinberg, Andrew P; Hansen, Kasper D; Fallin, M Daniele

2016-01-01

The Illumina 450k array has been widely used in epigenetic association studies. Current quality-control (QC) pipelines typically remove certain sets of probes, such as those containing a SNP or with multiple mapping locations. An additional set of potentially problematic probes are those with DNA methylation distributions characterized by two or more distinct clusters separated by gaps. Data-driven identification of such probes may offer additional insights for downstream analyses. We developed a procedure, termed "gap hunting," to identify probes showing clustered distributions. Among 590 peripheral blood samples from the Study to Explore Early Development, we identified 11,007 "gap probes." The vast majority (9199) are likely attributed to an underlying SNP(s) or other variant in the probe, although SNP-affected probes exist that do not produce a gap signals. Specific factors predict which SNPs lead to gap signals, including type of nucleotide change, probe type, DNA strand, and overall methylation state. These expected effects are demonstrated in paired genotype and 450k data on the same samples. Gap probes can also serve as a surrogate for the local genetic sequence on a haplotype scale and can be used to adjust for population stratification. The characteristics of gap probes reflect potentially informative biology. QC pipelines may benefit from an efficient data-driven approach that "flags" gap probes, rather than filtering such probes, followed by careful interpretation of downstream association analyses. Our results should translate directly to the recently released Illumina EPIC array given the similar chemistry and content design.

Probing High School Students' Cognitive Structures and Key Areas of Learning Difficulties on Ethanoic Acid Using the Flow Map Method

ERIC Educational Resources Information Center

Zhou, Qing; Wang, Tingting; Zheng, Qi

2015-01-01

The purpose of this study was primarily to explore high school students' cognitive structures and to identify their learning difficulties on ethanoic acid through the flow map method. The subjects of this study were 30 grade 1 students from Dong Yuan Road Senior High School in Xi'an, China. The interviews were conducted a week after the students…

Chemical State Mapping of Degraded B4C Control Rod Investigated with Soft X-ray Emission Spectrometer in Electron Probe Micro-analysis.

PubMed

Kasada, R; Ha, Y; Higuchi, T; Sakamoto, K

2016-05-10

B4C is widely used as control rods in light water reactors, such as the Fukushima Daiichi nuclear power plant, because it shows excellent neutron absorption and has a high melting point. However, B4C can melt at lower temperatures owing to eutectic interactions with stainless steel and can even evaporate by reacting with high-temperature steam under severe accident conditions. To reduce the risk of recriticality, a precise understanding of the location and chemical state of B in the melt core is necessary. Here we show that a novel soft X-ray emission spectrometer in electron probe microanalysis can help to obtain a chemical state map of B in a modeled control rod after a high-temperature steam oxidation test.

Resolution and contrast in Kelvin probe force microscopy

NASA Astrophysics Data System (ADS)

Jacobs, H. O.; Leuchtmann, P.; Homan, O. J.; Stemmer, A.

1998-08-01

The combination of atomic force microscopy and Kelvin probe technology is a powerful tool to obtain high-resolution maps of the surface potential distribution on conducting and nonconducting samples. However, resolution and contrast transfer of this method have not been fully understood, so far. To obtain a better quantitative understanding, we introduce a model which correlates the measured potential with the actual surface potential distribution, and we compare numerical simulations of the three-dimensional tip-specimen model with experimental data from test structures. The observed potential is a locally weighted average over all potentials present on the sample surface. The model allows us to calculate these weighting factors and, furthermore, leads to the conclusion that good resolution in potential maps is obtained by long and slender but slightly blunt tips on cantilevers of minimal width and surface area.

Temporal mapping of photochemical reactions and molecular excited states with carbon specificity

NASA Astrophysics Data System (ADS)

Wang, K.; Murahari, P.; Yokoyama, K.; Lord, J. S.; Pratt, F. L.; He, J.; Schulz, L.; Willis, M.; Anthony, J. E.; Morley, N. A.; Nuccio, L.; Misquitta, A.; Dunstan, D. J.; Shimomura, K.; Watanabe, I.; Zhang, S.; Heathcote, P.; Drew, A. J.

2017-04-01

Photochemical reactions are essential to a large number of important industrial and biological processes. A method for monitoring photochemical reaction kinetics and the dynamics of molecular excitations with spatial resolution within the active molecule would allow a rigorous exploration of the pathway and mechanism of photophysical and photochemical processes. Here we demonstrate that laser-excited muon pump-probe spin spectroscopy (photo-μSR) can temporally and spatially map these processes with a spatial resolution at the single-carbon level in a molecule with a pentacene backbone. The observed time-dependent light-induced changes of an avoided level crossing resonance demonstrate that the photochemical reactivity of a specific carbon atom is modified as a result of the presence of the excited state wavefunction. This demonstrates the sensitivity and potential of this technique in probing molecular excitations and photochemistry.

Scanning micro-Hall probe mapping of magnetic flux distributions and current densities in YBa{sub 2}Cu{sub 3}O{sub 7}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xing, W.; Heinrich, B.; Zhou, H.

1994-12-31

Mapping of the magnetic flux density B{sub z} (perpendicular to the film plane) for a YBa{sub 2}Cu{sub 3}O{sub 7} thin-film sample was carried out using a scanning micro-Hall probe. The sheet magnetization and sheet current densities were calculated from the B{sub z} distributions. From the known sheet magnetization, the tangential (B{sub x,y}) and normal components of the flux density B were calculated in the vicinity of the film. It was found that the sheet current density was mostly determined by 2B{sub x,y}/d, where d is the film thickness. The evolution of flux penetration as a function of applied field willmore » be shown.« less

X-Ray Absorption Microspectroscopy with Electrostatic Force Microscopy and its Application to Chemical States Mapping

NASA Astrophysics Data System (ADS)

Ishii, M.; Rigopoulos, N.; Poolton, N. R. J.; Hamilton, B.

2007-02-01

A new technique named X-EFM that measures the x-ray absorption fine structure (XAFS) of nanometer objects was developed. In X-EFM, electrostatic force microscopy (EFM) is used as an x-ray absorption detector, and photoionization induced by x-ray absorption of surface electron trapping sites is detected by EFM. An EFM signal with respect to x-ray photon energy provides the XAFS spectra of the trapping sites. We adopted X-EFM to observe Si oxide thin films. An edge jump shift intrinsic to the X-EFM spectrum was found, and it was explained with a model where an electric field between the trapping site and probe deepens the energy level of the inner-shell. A scanning probe under x-rays with fixed photon energy provided the chemical state mapping on the surface.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster

PubMed Central

He, Bing; Caudy, Amy; Parsons, Lance; Rosebrock, Adam; Pane, Attilio; Raj, Sandeep; Wieschaus, Eric

2012-01-01

Heterochromatin represents a significant portion of eukaryotic genomes and has essential structural and regulatory functions. Its molecular organization is largely unknown due to difficulties in sequencing through and assembling repetitive sequences enriched in the heterochromatin. Here we developed a novel strategy using chromosomal rearrangements and embryonic phenotypes to position unmapped Drosophila melanogaster heterochromatic sequence to specific chromosomal regions. By excluding sequences that can be mapped to the assembled euchromatic arms, we identified sequences that are specific to heterochromatin and used them to design heterochromatin specific probes (“H-probes”) for microarray. By comparative genomic hybridization (CGH) analyses of embryos deficient for each chromosome or chromosome arm, we were able to map most of our H-probes to specific chromosome arms. We also positioned sequences mapped to the second and X chromosomes to finer intervals by analyzing smaller deletions with breakpoints in heterochromatin. Using this approach, we were able to map >40% (13.9 Mb) of the previously unmapped heterochromatin sequences assembled by the whole-genome sequencing effort on arm U and arm Uextra to specific locations. We also identified and mapped 110 kb of novel heterochromatic sequences. Subsequent analyses revealed that sequences located within different heterochromatic regions have distinct properties, such as sequence composition, degree of repetitiveness, and level of underreplication in polytenized tissues. Surprisingly, although heterochromatin is generally considered to be transcriptionally silent, we detected region-specific temporal patterns of transcription in heterochromatin during oogenesis and early embryonic development. Our study provides a useful approach to elucidate the molecular organization and function of heterochromatin and reveals region-specific variation of heterochromatin. PMID:22745230

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans.

PubMed

Romanenko, Svetlana A; Perelman, Polina L; Trifonov, Vladimir A; Serdyukova, Natalia A; Li, Tangliang; Fu, Beiyuan; O'Brien, Patricia C M; Ng, Bee L; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents.

Ordered mapping of 3 alphoid DNA subsets on human chromosome 22

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonacci, R.; Baldini, A.; Archidiacono, N.

1994-09-01

Alpha satellite DNA consists of tandemly repeated monomers of 171 bp clustered in the centromeric region of primate chromosomes. Sequence divergence between subsets located in different human chromosomes is usually high enough to ensure chromosome-specific hybridization. Alphoid probes specific for almost every human chromosome have been reported. A single chromosome can carry different subsets of alphoid DNA and some alphoid subsets can be shared by different chromosomes. We report the physical order of three alphoid DNA subsets on human chromosome 22 determined by a combination of low and high resolution cytological mapping methods. Results visually demonstrate the presence of threemore » distinct alphoid DNA domains at the centromeric region of chromosome 22. We have measured the interphase distances between the three probes in three-color FISH experiments. Statistical analysis of the results indicated the order of the subsets. Two color experiments on prometaphase chromosomes established the order of the three domains relative to the arms of chromosome 22 and confirmed the results obtained using interphase mapping. This demonstrates the applicability of interphase mapping for alpha satellite DNA orderering. However, in our experiments, interphase mapping did not provide any information about the relationship between extremities of the repeat arrays. This information was gained from extended chromatin hybridization. The extremities of two of the repeat arrays were seen to be almost overlapping whereas the third repeat array was clearly separated from the other two. Our data show the value of extended chromatin hybridization as a complement of other cytological techniques for high resolution mapping of repetitive DNA sequences.« less

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans

PubMed Central

Romanenko, Svetlana A.; Perelman, Polina L.; Trifonov, Vladimir A.; Serdyukova, Natalia A.; Li, Tangliang; Fu, Beiyuan; O’Brien, Patricia C. M.; Ng, Bee L.; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S.; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents. PMID:26010445

Novel Single-Cell Analysis Platform Based on a Solid-State Zinc-Coadsorbed Carbon Quantum Dots Electrochemiluminescence Probe for the Evaluation of CD44 Expression on Breast Cancer Cells.

PubMed

Qiu, Youyi; Zhou, Bin; Yang, Xiaojuan; Long, Dongping; Hao, Yan; Yang, Peihui

2017-05-24

A novel single-cell analysis platform was fabricated using solid-state zinc-coadsorbed carbon quantum dot (ZnCQDs) nanocomposites as an electrochemiluminescence (ECL) probe for the detection of breast cancer cells and evaluation of the CD44 expression level. Solid-state ZnCQDs nanocomposite probes were constructed through the attachment of ZnCQDs to gold nanoparticles and then the loading of magnetic beads to amplify the ECL signal, exhibiting a remarkable 120-fold enhancement of the ECL intensity. Hyaluronic acid (HA)-functionalized solid-state probes were used to label a single breast cancer cell by the specific recognition of HA with CD44 on the cell surface, revealing more stable, sensitive, and effective tagging in comparison with the water-soluble CQDs. This strategy exhibited a good analytical performance for the analysis of MDA-MB-231 and MCF-7 single cells with linear range from 1 to 18 and from 1 to 12 cells, respectively. Furthermore, this single-cell analysis platform was used for evaluation of the CD44 expression level of these two cell lines, in which the MDA-MB-231 cells revealed a 2.8-5.2-fold higher CD44 expression level. A total of 20 single cells were analyzed individually, and the distributions of the ECL intensity revealed larger variations, indicating the high cellular heterogeneity of the CD44 expression level on the same cell line. The as-proposed single-cell analysis platform might provide a novel protocol to effectively study the individual cellular function and cellular heterogeneity.

Mechanism-based biomarker gene sets for glutathione depletion-related hepatotoxicity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao Weihua; Mizukawa, Yumiko; Nakatsu, Noriyuki

Chemical-induced glutathione depletion is thought to be caused by two types of toxicological mechanisms: PHO-type glutathione depletion [glutathione conjugated with chemicals such as phorone (PHO) or diethyl maleate (DEM)], and BSO-type glutathione depletion [i.e., glutathione synthesis inhibited by chemicals such as L-buthionine-sulfoximine (BSO)]. In order to identify mechanism-based biomarker gene sets for glutathione depletion in rat liver, male SD rats were treated with various chemicals including PHO (40, 120 and 400 mg/kg), DEM (80, 240 and 800 mg/kg), BSO (150, 450 and 1500 mg/kg), and bromobenzene (BBZ, 10, 100 and 300 mg/kg). Liver samples were taken 3, 6, 9 andmore » 24 h after administration and examined for hepatic glutathione content, physiological and pathological changes, and gene expression changes using Affymetrix GeneChip Arrays. To identify differentially expressed probe sets in response to glutathione depletion, we focused on the following two courses of events for the two types of mechanisms of glutathione depletion: a) gene expression changes occurring simultaneously in response to glutathione depletion, and b) gene expression changes after glutathione was depleted. The gene expression profiles of the identified probe sets for the two types of glutathione depletion differed markedly at times during and after glutathione depletion, whereas Srxn1 was markedly increased for both types as glutathione was depleted, suggesting that Srxn1 is a key molecule in oxidative stress related to glutathione. The extracted probe sets were refined and verified using various compounds including 13 additional positive or negative compounds, and they established two useful marker sets. One contained three probe sets (Akr7a3, Trib3 and Gstp1) that could detect conjugation-type glutathione depletors any time within 24 h after dosing, and the other contained 14 probe sets that could detect glutathione depletors by any mechanism. These two sets, with appropriate scoring systems, could be promising biomarkers for preclinical examination of hepatotoxicity.« less

In Situ Detection and Quantification of AR-V7, AR-FL, PSA, and KRAS Point Mutations in Circulating Tumor Cells.

PubMed

El-Heliebi, Amin; Hille, Claudia; Laxman, Navya; Svedlund, Jessica; Haudum, Christoph; Ercan, Erkan; Kroneis, Thomas; Chen, Shukun; Smolle, Maria; Rossmann, Christopher; Krzywkowski, Tomasz; Ahlford, Annika; Darai, Evangelia; von Amsberg, Gunhild; Alsdorf, Winfried; König, Frank; Löhr, Matthias; de Kruijff, Inge; Riethdorf, Sabine; Gorges, Tobias M; Pantel, Klaus; Bauernhofer, Thomas; Nilsson, Mats; Sedlmayr, Peter

2018-03-01

Liquid biopsies can be used in castration-resistant prostate cancer (CRPC) to detect androgen receptor splice variant 7 (AR-V7), a splicing product of the androgen receptor. Patients with AR-V7-positive circulating tumor cells (CTCs) have greater benefit of taxane chemotherapy compared with novel hormonal therapies, indicating a treatment-selection biomarker. Likewise, in those with pancreatic cancer (PaCa), KRAS mutations act as prognostic biomarkers. Thus, there is an urgent need for technology investigating the expression and mutation status of CTCs. Here, we report an approach that adds AR-V7 or KRAS status to CTC enumeration, compatible with multiple CTC-isolation platforms. We studied 3 independent CTC-isolation devices (CellCollector, Parsortix, CellSearch) for the evaluation of AR-V7 or KRAS status of CTCs with in situ padlock probe technology. Padlock probes allow highly specific detection and visualization of transcripts on a cellular level. We applied padlock probes for detecting AR-V7, androgen receptor full length (AR-FL), and prostate-specific antigen (PSA) in CRPC and KRAS wild-type (wt) and mutant (mut) transcripts in PaCa in CTCs from 46 patients. In situ analysis showed that 71% (22 of 31) of CRPC patients had detectable AR-V7 expression ranging from low to high expression [1-76 rolling circle products (RCPs)/CTC]. In PaCa patients, 40% (6 of 15) had KRAS mut expressing CTCs with 1 to 8 RCPs/CTC. In situ padlock probe analysis revealed CTCs with no detectable cytokeratin expression but positivity for AR-V7 or KRAS mut transcripts. Padlock probe technology enables quantification of AR-V7, AR-FL, PSA, and KRAS mut/wt transcripts in CTCs. The technology is easily applicable in routine laboratories and compatible with multiple CTC-isolation devices. © 2017 American Association for Clinical Chemistry.

ADAPT, a Novel Scaffold Protein-Based Probe for Radionuclide Imaging of Molecular Targets That Are Expressed in Disseminated Cancers.

PubMed

Garousi, Javad; Lindbo, Sarah; Nilvebrant, Johan; Åstrand, Mikael; Buijs, Jos; Sandström, Mattias; Honarvar, Hadis; Orlova, Anna; Tolmachev, Vladimir; Hober, Sophia

2015-10-15

Small engineered scaffold proteins have attracted attention as probes for radionuclide-based molecular imaging. One class of these imaging probes, termed ABD-Derived Affinity Proteins (ADAPT), has been created using the albumin-binding domain (ABD) of streptococcal protein G as a stable protein scaffold. In this study, we report the development of a clinical lead probe termed ADAPT6 that binds HER2, an oncoprotein overexpressed in many breast cancers that serves as a theranostic biomarker for several approved targeting therapies. Surface-exposed amino acids of ABD were randomized to create a combinatorial library enabling selection of high-affinity binders to various proteins. Furthermore, ABD was engineered to enable rapid purification, to eradicate its binding to albumin, and to enable rapid blood clearance. Incorporation of a unique cysteine allowed site-specific conjugation to a maleimido derivative of a DOTA chelator, enabling radionuclide labeling, ¹¹¹In for SPECT imaging and ⁶⁸Ga for PET imaging. Pharmacologic studies in mice demonstrated that the fully engineered molecule (111)In/⁶⁸Ga-DOTA-(HE)3-ADAPT6 was specifically bound and taken up by HER2-expressing tumors, with a high tumor-to-normal tissue ratio in xenograft models of human cancer. Unbound tracer underwent rapid renal clearance followed by high renal reabsorption. HER2-expressing xenografts were visualized by gamma-camera or PET at 1 hour after infusion. PET experiments demonstrated feasibility for discrimination of xenografts with high or low HER2 expression. Our results offer a preclinical proof of concept for the use of ADAPT probes for noninvasive in vivo imaging. ©2015 American Association for Cancer Research.

Regulation of an H-ras-related transcript by parathyroid hormone in rat osteosarcoma cells

NASA Technical Reports Server (NTRS)

Scott, D. K.; Weaver, W. R.; Clohisy, J. C.; Brakenhoff, K. D.; Kahn, A. J.; Partridge, N. C.

1992-01-01

The rat osteosarcoma cell line UMR 106-01 is a commonly used model system for the study of osteoblast function. However, it also expresses a phenotype characteristic of transformed cells. To test whether the latter could be accounted for by aberrant oncogene expression, we probed Northern blots of UMR and other osteoblastic cells with a panel of oncogene probes. These blots, when probed with a cDNA specific for v-H-ras, revealed a 7.0-kilobase (kb) H-ras-related transcript (designated HRRT) in UMR 106-01 cells that was not expressed in other osteoblastic cells. Osteoblast-enriched calvarial cells expressed the typical 1.1-kb H-ras mRNA, which was absent in UMR cells. Additionally, Western blots of lysates of UMR cells documented the presence of three proteins immunologically related to H-rasp21. To determine whether HRRT represented a recombinant retrovirus product, Northern blots were probed with a cDNA specific for the highly conserved gag-pol region of Moloney murine leukemia virus. These blots showed parallel cross-reactivity with an apparently identical transcript of 7.0 kb. The 7.0-kb transcripts detected by both v-H-ras and gag-pol probes declined to the same extent after treatment with concentrations of PTH known to inhibit proliferation of these cells. PTH regulated the abundance of HRRT in a time- and dose-dependent manner, with greatest repression of the transcript after 8 h of treatment with 10(-8) M PTH. The decrease in HRRT could not be completely accounted for by changes in transcriptional activity, as determined by nuclear run-on assays.(ABSTRACT TRUNCATED AT 250 WORDS).

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Comparison of genome-wide gene expression in suture- and alkali burn-induced murine corneal neovascularization

PubMed Central

Jia, Changkai; Zhu, Wei; Ren, Shengwei; Xi, Haijie; Li, Siyuan

2011-01-01

Purpose Suture placement and alkali burn to the cornea are often used to induce inflammatory corneal neovascularization (CorNV) models in animals. This study compares the changes in genome-wide gene expression under these two CorNV conditions in mice. Methods CorNV were induced in Balb/c mice by three interrupted 10–0 sutures placed at sites about 1 mm from the corneal apex, or by alkali burns that were 2 mm in size in the central area of the cornea. At the points in time when neovascularization progressed most quickly, some eyeballs were subjected to histological staining to examine CorNV and inflammatory cells infiltration, and some corneas were harvested to extract mRNA for microarray assay. After normalization and filtering, the microarray data were subject to statistical analysis using Significance Analysis of Microarray software, and interested genes were annotated using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) program. The expression change of classical proangiogenic molecule like vascular endothelial growth factor (VEGF) and antiangiogenic molecule like pigment epithelium-derived factor (PEDF) was further verified using western blotting. Results Suture placement induced CorNV in the areas between the suture and limbus, but did not affect the transparency of the yet unvasuclarized areas of the corneas. In contrast, alkali burn caused edema and total loss of transparency of the whole cornea. Histology showed that sutures only caused localized epithelial loss and inflammatory infiltration between the suture and limbus, but chemical burn depleted the whole epithelial layer of the central cornea and caused heavy cellular infiltration of the whole cornea. At day 5 after suture placement, 1,055 differentially expressed probes were identified, out of which 586 probes were upregulated and 469 probes were downregulated. At a comparable time point, namely on day 6 after the alkali burn to the corneas, 472 probes were upregulated and 389 probes were downregulated. Among these differentially expressed probes, a significant portion (530 probes in total, including 286 upregulated and 244 downregulated probes) showed a similar pattern of change in both models. Annotation (using DAVID) of the overlapping differential genes revealed that the significant enrichment gene ontology terms were “chemotaxis” and “immune response” for the upregulated genes, and “oxidation reduction” and “programmed cell death” for the downregulated genes. Some genes or gene families (e.g., S100A family or α-, β-, or γ-crystallin family) that had not been related to corneal pathogenesis or neovascularization were also revealed to be involved in CorNV. VEGF was upregulated and PEDF was stable as shown with western blotting. Conclusions Sutures and alkali burn to the corneas produced types of damage that affected transparency differentially, but gene profiling revealed similar patterns of changes in gene expression in these two CorNV models. Further studies of the primary genes found to be involved in CorNV will supplement current understanding about the pathogenesis of neovascularization diseases. PMID:21921991

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions.

PubMed

Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy

2014-01-16

The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers.

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions

PubMed Central

2014-01-01

Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. Conclusions The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers. PMID:24433256

The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Brody, L.C.; Martin, L.S.

1993-05-01

Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

Physical mapping of the torsion dystonia region of human chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozelius, L.J.; Hewett, J.; Shalish, C.

1994-09-01

Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

miR-188 promotes senescence of lineage-negative bone marrow cells by targeting MAP3K3 expression.

PubMed

Zheng, Yue; Liu, Hua; Kong, Ye

2017-08-01

Lineage-negative bone marrow cells (lin-BMCs) have reparative potential for overcoming endothelial dysfunction and reducing cardiovascular risk. Here, we found that miR-188 is upregulated and mitogen-activated protein kinase kinase kinase 3 (MAP3K3) is downregulated in aged lin-BMCs, whereas their expression is reversed in young lin-BMCs. We identified and confirmed MAP3K3 as a direct target of miR-188. MiR-188 overexpression or MAP3K3 silencing in young lin-BMCs increases p16 and p21 expression, enhances cell senescence, and decreases the ability for cell proliferation, migration, and tube formation. Conversely, miR-188 suppression in aged lin-BMCs yields the opposite results. We further found that MAP3K3 is involved in miR-188-induced promotion of lin-BMC senescence. All data reveal that miR-188 induces lin-BMC senescence by targeting MAP3K3 expression, thus, providing new theoretical basis for the prevention and treatment of cardiovascular diseases. © 2017 Federation of European Biochemical Societies.

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2007-11-01

SDS-PAGE gel . The Western blot made from this gel was probed with antibody that recognizes the myc-tag. When compared to the extracts from the...SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein in cells co...Specific Aim 2. Design and test antisense oligonucleotides ( ASOs ) that suppress PCDH-PC expression in prostate cancer cells. Work Done: We used

Using oligonucleotide aptamer probes for immunostaining of formalin-fixed and paraffin-embedded tissues

PubMed Central

Zeng, Zihua; Zhang, Peng; Zhao, Nianxi; Sheehan, Andrea M; Tung, Ching-Hsuan; Chang, Chung-Che; Zu, Youli

2011-01-01

For tissue immunostaining, antibodies are currently the only clinically validated and commercially available probes. Aptamers, which belong to a class of small molecule ligands composed of short single-stranded oligonucleotides, have emerged as probes over the last several decades; however, their potential clinical value has not yet been fully explored. Using cultured cells and an RNA-based CD30 aptamer, we recently demonstrated that the synthetic aptamer is useful as a specific probe for flow cytometric detection of CD30-expressing lymphoma cells. In this study, we further validated the use of this aptamer probe for immunostaining of formalin-fixed and paraffin-embedded lymphoma tissues. Using CD30 antibody as a standard control, we demonstrated that the synthetic CD30 aptamer specifically recognized and immunostained tumor cells of classical Hodgkin lymphoma and anaplastic large cell lymphoma, but did not react with background cells within tumor sites. Notably, the CD30 aptamer probe optimally immunostained lymphoma cells with lower temperature antigen retrieval (37 vs 96°C for antibody) and shorter probing reaction times (20 vs 90 min for antibody) than typical antibody immunostaining protocols. In addition, the CD30 aptamer probe showed no nonspecific background staining of cell debris in necrotic tissue and exhibited no cross-reaction to tissues that do not express CD30, as confirmed by a standard CD30 antibody staining. Therefore, our findings indicate that the synthetic oligonucleotide CD30 aptamer can be used as a probe for immunostaining of fixed tissue sections for disease diagnosis. PMID:20693984

An alternative methionine aminopeptidase, MAP-A, is required for nitrogen starvation and high-light acclimation in the cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Drath, Miriam; Baier, Kerstin; Forchhammer, Karl

2009-05-01

Methionine aminopeptidases (MetAPs or MAPs, encoded by map genes) are ubiquitous and pivotal enzymes for protein maturation in all living organisms. Whereas most bacteria harbour only one map gene, many cyanobacterial genomes contain two map paralogues, the genome of Synechocystis sp. PCC 6803 even three. The physiological function of multiple map paralogues remains elusive so far. This communication reports for the first time differential MetAP function in a cyanobacterium. In Synechocystis sp. PCC 6803, the universally conserved mapC gene (sll0555) is predominantly expressed in exponentially growing cells and appears to be a housekeeping gene. By contrast, expression of mapA (slr0918) and mapB (slr0786) genes increases during stress conditions. The mapB paralogue is only transiently expressed, whereas the widely distributed mapA gene appears to be the major MetAP during stress conditions. A mapA-deficient Synechocystis mutant shows a subtle impairment of photosystem II properties even under non-stressed conditions. In particular, the binding site for the quinone Q(B) is affected, indicating specific N-terminal methionine processing requirements of photosystem II components. MAP-A-specific processing becomes essential under certain stress conditions, since the mapA-deficient mutant is severely impaired in surviving conditions of prolonged nitrogen starvation and high light exposure.

All-optical mapping of barrel cortex circuits based on simultaneous voltage-sensitive dye imaging and channelrhodopsin-mediated photostimulation

PubMed Central

Lo, Shun Qiang; Koh, Dawn X. P.; Sng, Judy C. G.; Augustine, George J.

2015-01-01

Abstract. We describe an experimental approach that uses light to both control and detect neuronal activity in mouse barrel cortex slices: blue light patterned by a digital micromirror array system allowed us to photostimulate specific layers and columns, while a red-shifted voltage-sensitive dye was used to map out large-scale circuit activity. We demonstrate that such all-optical mapping can interrogate various circuits in somatosensory cortex by sequentially activating different layers and columns. Further, mapping in slices from whisker-deprived mice demonstrated that chronic sensory deprivation did not significantly alter feedforward inhibition driven by layer 5 pyramidal neurons. Further development of voltage-sensitive optical probes should allow this all-optical mapping approach to become an important and high-throughput tool for mapping circuit interactions in the brain. PMID:26158003

HectoMAPping the Universe. Karl Schwarzschild Award Lecture 2014

NASA Astrophysics Data System (ADS)

Geller, Margaret J.; Hwang, Ho Seong

2015-06-01

During the last three decades progress in mapping the Universe from an age of 400 000 years to the present has been stunning. Instrument/telescope combinations have naturally determined the sampling of various redshift ranges. Here we outline the impact of the Hectospec on the MMT on exploration of the Universe in the redshift range 0.2 ⪉ z ⪉ 0.8. We focus on dense redshift surveys, SHELS and HectoMAP. SHELS is a complete magnitude limited survey covering 8 square degrees. The HectoMAP survey combines a red-selected dense redshift survey and a weak lensing map covering 50 square degrees. Combining the dense redshift survey with a Subaru HyperSuprimeCam (HSC) weak lensing map will provide a powerful probe of the way galaxies trace the distribution of dark matter on a wide range of physical scales.

Adaptation of video game UVW mapping to 3D visualization of gene expression patterns

NASA Astrophysics Data System (ADS)

Vize, Peter D.; Gerth, Victor E.

2007-01-01

Analysis of gene expression patterns within an organism plays a critical role in associating genes with biological processes in both health and disease. During embryonic development the analysis and comparison of different gene expression patterns allows biologists to identify candidate genes that may regulate the formation of normal tissues and organs and to search for genes associated with congenital diseases. No two individual embryos, or organs, are exactly the same shape or size so comparing spatial gene expression in one embryo to that in another is difficult. We will present our efforts in comparing gene expression data collected using both volumetric and projection approaches. Volumetric data is highly accurate but difficult to process and compare. Projection methods use UV mapping to align texture maps to standardized spatial frameworks. This approach is less accurate but is very rapid and requires very little processing. We have built a database of over 180 3D models depicting gene expression patterns mapped onto the surface of spline based embryo models. Gene expression data in different models can easily be compared to determine common regions of activity. Visualization software, both Java and OpenGL optimized for viewing 3D gene expression data will also be demonstrated.

Analysis of multiplex gene expression maps obtained by voxelation.

PubMed

An, Li; Xie, Hongbo; Chin, Mark H; Obradovic, Zoran; Smith, Desmond J; Megalooikonomou, Vasileios

2009-04-29

Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological disease. Researchers have previously used voxelation in combination with microarrays for acquisition of genome-wide atlases of expression patterns in the mouse brain. On the other hand, some work has been performed on studying gene functions, without taking into account the location information of a gene's expression in a mouse brain. In this paper, we present an approach for identifying the relation between gene expression maps obtained by voxelation and gene functions. To analyze the dataset, we chose typical genes as queries and aimed at discovering similar gene groups. Gene similarity was determined by using the wavelet features extracted from the left and right hemispheres averaged gene expression maps, and by the Euclidean distance between each pair of feature vectors. We also performed a multiple clustering approach on the gene expression maps, combined with hierarchical clustering. Among each group of similar genes and clusters, the gene function similarity was measured by calculating the average gene function distances in the gene ontology structure. By applying our methodology to find similar genes to certain target genes we were able to improve our understanding of gene expression patterns and gene functions. By applying the clustering analysis method, we obtained significant clusters, which have both very similar gene expression maps and very similar gene functions respectively to their corresponding gene ontologies. The cellular component ontology resulted in prominent clusters expressed in cortex and corpus callosum. The molecular function ontology gave prominent clusters in cortex, corpus callosum and hypothalamus. The biological process ontology resulted in clusters in cortex, hypothalamus and choroid plexus. Clusters from all three ontologies combined were most prominently expressed in cortex and corpus callosum. The experimental results confirm the hypothesis that genes with similar gene expression maps might have similar gene functions. The voxelation data takes into account the location information of gene expression level in mouse brain, which is novel in related research. The proposed approach can potentially be used to predict gene functions and provide helpful suggestions to biologists.

Testing statistical isotropy in cosmic microwave background polarization maps

NASA Astrophysics Data System (ADS)

Rath, Pranati K.; Samal, Pramoda Kumar; Panda, Srikanta; Mishra, Debesh D.; Aluri, Pavan K.

2018-04-01

We apply our symmetry based Power tensor technique to test conformity of PLANCK Polarization maps with statistical isotropy. On a wide range of angular scales (l = 40 - 150), our preliminary analysis detects many statistically anisotropic multipoles in foreground cleaned full sky PLANCK polarization maps viz., COMMANDER and NILC. We also study the effect of residual foregrounds that may still be present in the Galactic plane using both common UPB77 polarization mask, as well as the individual component separation method specific polarization masks. However, some of the statistically anisotropic modes still persist, albeit significantly in NILC map. We further probed the data for any coherent alignments across multipoles in several bins from the chosen multipole range.

Astrophysics: Multi-Molecular Views of a Stellar Nursery

NASA Technical Reports Server (NTRS)

Wiseman, Jennifer; Sewilo, Marta

2017-01-01

New detectors for radio telescopes can map emissions from many different molecules simultaneously across interstellar clouds. One such pioneering study has probed a wide area of a star-forming cloud in the Orion constellation.

Astrophysics: Multi-molecular views of a stellar nursery

NASA Astrophysics Data System (ADS)

Wiseman, Jennifer; Sewilo, Marta

2017-06-01

New detectors for radio telescopes can map emissions from many different molecules simultaneously across interstellar clouds. One such pioneering study has probed a wide area of a star-forming cloud in the Orion constellation.

A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids.

PubMed

Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

2008-06-04

Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

Leaving out control groups: an internal contrast analysis of gene expression profiles in atrial fibrillation patients ‐ A systems biology approach to clinical categorization

PubMed Central

Vanhoutte, Kurt; de Asmundis, Carlo; Francesconi, Anna; Figys1, Jurgen; Steurs, Griet; Boussy, Tim; Roos, Markus; Mueller, Andreas; Massimo, Lucio; Paparella, Gaetano; Van Caelenberg, Kristien; Chierchia, Gian Battista; Sarkozy, Andrea; Y Terradellas, Pedro Brugada; Zizi, Martin

2009-01-01

Atrial fibrillation (AF) is a frequent chronic dysrythmia with an incidence that increases with age (>40). Because of its medical and socio-economic impacts it is expected to become an increasing burden on most health care systems. AF is a multi-factorial disease for which the identification of subtypes is warranted. Novel approaches based on the broad concepts of systems biology may overcome the blurred notion of normal and pathological phenotype, which is inherent to high throughput molecular arrays analysis. Here we apply an internal contrast algorithm on AF patient data with an analytical focus on potential entry pathways into the disease. We used a RMA (Robust Multichip Average) normalized Affymetrix micro-array data set from 10 AF patients (geo_accession #GSE2240). Four series of probes were selected based on physiopathogenic links with AF entryways: apoptosis (remodeling), MAP kinase (cell remodeling), OXPHOS (ability to sustain hemodynamic workload) and glycolysis (ischemia). Annotated probe lists were polled with Bioconductor packages in R (version 2.7.1). Genetic profile contrasts were analysed with hierarchical clustering and principal component analysis. The analysis revealed distinct patient groups for all probe sets. A substantial part (54% till 67%) of the variance is explained in the first 2 principal components. Genes in PC1/2 with high discriminatory value were selected and analyzed in detail. We aim for reliable molecular stratification of AF. We show that stratification is possible based on physiologically relevant gene sets. Genes with high contrast value are likely to give pathophysiological insight into permanent AF subtypes. PMID:19255648

Comparative mRNA analysis of behavioral and genetic mouse models of aggression.

PubMed

Malki, Karim; Tosto, Maria G; Pain, Oliver; Sluyter, Frans; Mineur, Yann S; Crusio, Wim E; de Boer, Sietse; Sandnabba, Kenneth N; Kesserwani, Jad; Robinson, Edward; Schalkwyk, Leonard C; Asherson, Philip

2016-04-01

Mouse models of aggression have traditionally compared strains, most notably BALB/cJ and C57BL/6. However, these strains were not designed to study aggression despite differences in aggression-related traits and distinct reactivity to stress. This study evaluated expression of genes differentially regulated in a stress (behavioral) mouse model of aggression with those from a recent genetic mouse model aggression. The study used a discovery-replication design using two independent mRNA studies from mouse brain tissue. The discovery study identified strain (BALB/cJ and C57BL/6J) × stress (chronic mild stress or control) interactions. Probe sets differentially regulated in the discovery set were intersected with those uncovered in the replication study, which evaluated differences between high and low aggressive animals from three strains specifically bred to study aggression. Network analysis was conducted on overlapping genes uncovered across both studies. A significant overlap was found with the genetic mouse study sharing 1,916 probe sets with the stress model. Fifty-one probe sets were found to be strongly dysregulated across both studies mapping to 50 known genes. Network analysis revealed two plausible pathways including one centered on the UBC gene hub which encodes ubiquitin, a protein well-known for protein degradation, and another on P38 MAPK. Findings from this study support the stress model of aggression, which showed remarkable molecular overlap with a genetic model. The study uncovered a set of candidate genes including the Erg2 gene, which has previously been implicated in different psychopathologies. The gene networks uncovered points at a Redox pathway as potentially being implicated in aggressive related behaviors. © 2016 Wiley Periodicals, Inc.

Vectorial nanoscale mapping of optical antenna fields by single molecule dipoles.

PubMed

Singh, Anshuman; Calbris, Gaëtan; van Hulst, Niek F

2014-08-13

Optical nanoantennas confine light on the nanoscale, enabling strong light-matter interactions and ultracompact optical devices. Such confined nanovolumes of light have nonzero field components in all directions (x, y, and z). Unfortunately mapping of the actual nanoscale field vectors has so far remained elusive, though antenna hotspots have been explored by several techniques. In this paper, we present a novel method to probe all three components of the local antenna field. To this end a resonant nanoantenna is fabricated at the vertex of a scanning tip. Next, the nanoantenna is deterministically scanned in close proximity to single fluorescent molecules, whose fixed excitation dipole moment reads out the local field vector. With nanometer molecular resolution, we distinctly map x-, y-, and z-field components of the dipole antenna, i.e. a full vectorial mode map, and show good agreement with full 3D FDTD simulations. Moreover, the fluorescence polarization maps the localized coupling, with emission through the longitudinal antenna mode. Finally, the resonant antenna probe is used for single molecule imaging with 40 nm fwhm response function. The total fluorescence enhancement is 7.6 times, while out-of-plane molecules, almost undetectable in far-field, are made visible by the strong antenna z-field with a fluorescence enhancement up to 100 times. Interestingly, the apparent position of molecules shifts up to 20 nm depending on their orientation. The capability to resolve orientational information on the single molecule level makes the scanning resonant antenna an ideal tool for extreme resolution bioimaging.

Robots and Humans in Planetary Exploration: Working Together?

NASA Technical Reports Server (NTRS)

Landis, Geoffrey A.; Lyons, Valerie (Technical Monitor)

2002-01-01

Today's approach to human-robotic cooperation in planetary exploration focuses on using robotic probes as precursors to human exploration. A large portion of current NASA planetary surface exploration is focussed on Mars, and robotic probes are seen as precursors to human exploration in: Learning about operation and mobility on Mars; Learning about the environment of Mars; Mapping the planet and selecting landing sites for human mission; Demonstration of critical technology; Manufacture fuel before human presence, and emplace elements of human-support infrastructure

Recent advancements in nanoelectrodes and nanopipettes used in combined scanning electrochemical microscopy techniques.

PubMed

Kranz, Christine

2014-01-21

In recent years, major developments in scanning electrochemical microscopy (SECM) have significantly broadened the application range of this electroanalytical technique from high-resolution electrochemical imaging via nanoscale probes to large scale mapping using arrays of microelectrodes. A major driving force in advancing the SECM methodology is based on developing more sophisticated probes beyond conventional micro-disc electrodes usually based on noble metals or carbon microwires. This critical review focuses on the design and development of advanced electrochemical probes particularly enabling combinations of SECM with other analytical measurement techniques to provide information beyond exclusively measuring electrochemical sample properties. Consequently, this critical review will focus on recent progress and new developments towards multifunctional imaging.

Semi-automatic 10/20 Identification Method for MRI-Free Probe Placement in Transcranial Brain Mapping Techniques.

PubMed

Xiao, Xiang; Zhu, Hao; Liu, Wei-Jie; Yu, Xiao-Ting; Duan, Lian; Li, Zheng; Zhu, Chao-Zhe

2017-01-01

The International 10/20 system is an important head-surface-based positioning system for transcranial brain mapping techniques, e.g., fNIRS and TMS. As guidance for probe placement, the 10/20 system permits both proper ROI coverage and spatial consistency among multiple subjects and experiments in a MRI-free context. However, the traditional manual approach to the identification of 10/20 landmarks faces problems in reliability and time cost. In this study, we propose a semi-automatic method to address these problems. First, a novel head surface reconstruction algorithm reconstructs head geometry from a set of points uniformly and sparsely sampled on the subject's head. Second, virtual 10/20 landmarks are determined on the reconstructed head surface in computational space. Finally, a visually-guided real-time navigation system guides the experimenter to each of the identified 10/20 landmarks on the physical head of the subject. Compared with the traditional manual approach, our proposed method provides a significant improvement both in reliability and time cost and thus could contribute to improving both the effectiveness and efficiency of 10/20-guided MRI-free probe placement.

Results of rocket measurements of D-region ionization over Thumba in MAP

NASA Technical Reports Server (NTRS)

Chakrabarty, D. K.; Beig, G.; Garg, S. C.; Subrahmanyam, P.; Zalpuri, K. S.; Somayajulu, Y. V.; Rao, M. N. M.; Tandel, C. B.; Murlikrishna, T. R.

1989-01-01

Under MAP, two rockets were launched from Thumba (8.5 N, 76.8 E) around 1030 hrs Lt with identical payloads on 7 and 10 March 1986 for D region studies. Positive ion densities were measured by spherical probe and Gerdien condenser and electron densities were measured by Langmuir probe and propagation experiments. In both flights a valley in ionization height profile was noticed around 83 km. The density of ionization at this altitude was about 4 x 10(2) cu cm. A detailed positive ion-chemical scheme was used to reproduce the measured ionization height profiles. The density of NO needed to reproduce the valley in ionization at 83 km came around 5 x 10(5) cu cm. A photochemical treatment without diffusion process was found inadequate to explain this value of NO. Calculations showed that the value of vertical eddy diffusion needed to reproduce the value of NO was around 10(6)sq cm/s. Interestingly, the same value of eddy diffusion coefficient was obtained when derived in the manner described by Thrane and his coworkers using only the positive ion current data of spherical probes.

Results from the Wilkinson Microwave Anisotropy Probe

NASA Technical Reports Server (NTRS)

Komatsu, E.; Bennett, Charles L.; Komatsu, Eiichiro

2015-01-01

The Wilkinson Microwave Anisotropy Probe (WMAP) mapped the distribution of temperature and polarization over the entire sky in five microwave frequency bands. These full-sky maps were used to obtain measurements of temperature and polarization anisotropy of the cosmic microwave background with the unprecedented accuracy and precision. The analysis of two-point correlation functions of temperature and polarization data gives determinations of the fundamental cosmological parameters such as the age and composition of the universe, as well as the key parameters describing the physics of inflation, which is further constrained by three-point correlation functions. WMAP observations alone reduced the flat ? cold dark matter (Lambda Cold Dark Matter) cosmological model (six) parameter volume by a factor of > 68, 000 compared with pre-WMAP measurements. The WMAP observations (sometimes in combination with other astrophysical probes) convincingly show the existence of non-baryonic dark matter, the cosmic neutrino background, flatness of spatial geometry of the universe, a deviation from a scale-invariant spectrum of initial scalar fluctuations, and that the current universe is undergoing an accelerated expansion. The WMAP observations provide the strongest ever support for inflation; namely, the structures we see in the universe originate from quantum fluctuations generated during inflation.

Quantitative energy-filtered TEM imaging of interfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bentley, J.; Kenik, E.A.; Siangchaew, K.

Quantitative elemental mapping by inner shell core-loss energy-filtered transmission electron microscopy (TEM) with a Gatan Imaging Filter (GIF) interfaced to a Philips CM30 TEM operated with a LaB{sub 6} filament at 300 kV has been applied to interfaces in a range of materials. In sensitized type 304L stainless steel aged 15 h at 600{degrees}C, grain-boundary Cr depletion occurs between Cr-rich intergranular M{sub 23}C{sub 6} particles. Images of net Cr L{sub 23} intensity show segregation profiles that agree quantitatively with focused-probe spectrum-line measurements recorded with a Gatan PEELS on a Philips EM400T/FEG (0.8 nA in 2-nm-diam probe) of the same regions.more » Rare-earth oxide additives that are used for the liquid-phase sintering of Si{sub 3}N{sub 4} generate second phases of complex composition at grain boundaries and edges. These grain boundary phases often control corrosion, crack growth and creep damage behavior. High resolution imaging has been widely and with focused probes can be compromised by beam damage, but elemental mapping by EFTEM appears not to cause appreciable beam damage.« less

Optical Design and Sensitivity of the Probe of Inflation and Cosmic Origins

NASA Astrophysics Data System (ADS)

Young, Karl S.; Hanany, Shaul; Wen, Qi

2018-01-01

The Probe of Inflation and Cosmic Origins (PICO) is a NASA probe-class mission concept being studied in preparation for the 2020 Astronomy and Astrophysics Decadal Survey. PICO will detect, or place new limits on, the energy scale of inflation and the physics of quantum gravity, determine the effective number of neutrino species and constrain the sum of neutrino masses, measure the optical depth to reionization to the cosmic variance limit, and shed new light on the role of magnetic fields in galactic evolution and star formation by making polarimetric maps of the full mm-wave sky with sensitivity 70 times higher than the Planck space mission. The maps made by PICO will provide a catalog of thousands of new proto clusters and infrared galaxies as well as tens of thousands of galaxy clusters which will further constrain cosmological parameters.PICO will have a 1.4 meter aperture telescope with 21 bands from 20 to 800 Ghz. We show the current PICO optics and discuss trade-offs between types of optical systems, limits imposed by scan strategies, and maximizing the number of detectors on sky. We present the instrument’s focal plane and the expected mission sensitivity.

Isolation of a novel human papillomavirus (type 51) from a cervical condyloma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuovo, G.J.; Crum, C.P.; Levine, R.U.

1988-04-01

The authors cloned the DNA from a novel human papillomavirus (HPV) present in a cervical condyloma. When DNA from this isolate was hybridized at high stringency with HPV types 1 through 50 (HPV-1 through HPV-50), it showed weak homology with HPV-6 and -16 and stronger homology with HPV-26. A detailed restriction endonuclease map was prepared which showed marked differences from the maps for other HPVs that have been isolated from the female genital tract. Reassociation kinetic analysis revealed that HPV-26 and this new isolate were less than 10% homologous; hence, the new isolate is a noel strain of HPV. Themore » approximate positions of the open reading frames of the new strain were surmised by hybridization with probes derived from individual open reading frames of HPV-16. In an analysis of 175 genital biopsies from patients with abnormal Papanicolaou smears, sequences hybridizing under highly stringent conditions to probes from this novel HPV type were found in 4.2, 6.1, and 2.4% of biopsies containing normal squamous epithelium, condylomata, and intraepithelial neoplasia, respectively. In addition, sequences homologous to probes from this novel isolate were detected in one of five cervical carcinomas examined.« less

3D Lifetime Tomography Reveals How CdCl 2 Improves Recombination Throughout CdTe Solar Cells

DOE PAGES

Barnard, Edward S.; Ursprung, Benedikt; Colegrove, Eric; ...

2016-11-15

When using two-photon tomography, carrier lifetimes are mapped in polycrystalline CdTe photovoltaic devices. These 3D maps probe subsurface carrier dynamics that are inaccessible with traditional optical techniques. They reveal that CdCl 2 treatment of CdTe solar cells suppresses nonradiative recombination and enhances carrier lifetimes throughout the film with substantial improvements particularly near subsurface grain boundaries and the critical buried p-n junction.

Patterns of developmental expression of the RNA editing enzyme rADAR2.

PubMed

Paupard M-C; O'Connell, M A; Gerber, A P; Zukin, R S

2000-01-01

To date, two structurally related RNA-editing enzymes with adenosine deaminase activity have been identified in mammalian tissue: ADAR1 and ADAR2 [Bass B. I. et al. (1997) RNA 3, 947-949]. In rodents, ADAR2 undergoes alternative RNA splicing, giving rise to two splice variants that differ by the presence or absence of a 10-amino-acid insert in the carboxy-terminal catalytic domain. However, the physiological significance of the splicing and its regional and developmental regulation are as yet unknown. The present study examined spatial and temporal patterns of ADAR2 gene transcripts within specific neuronal populations of rat brain. The two rodent ADAR2 isoforms were expressed at comparable levels at all ages examined. rADAR2 messenger RNA expression was first detectable in the thalamic nuclei formation at embryonic day E19. The rADAR2b insert and rADAR2a splice probes produced images similar to that of the rADAR2 pan probe. At birth, rADAR2a messenger RNA splice variants were abundantly expressed in the thalamic nuclei. No signal for any probe was detectable in other brain regions, including neocortex, hippocampus, striatum and cerebellum at this stage of development. During the first week of postnatal life, rADAR2 messenger RNA expression (detected with the pan probe) increased gradually in several brain regions, with low expression detected at postnatal day P7 in the olfactory bulb, inferior colliculus, and within the pyramidal and granule cell layers of the hippocampus. Hybridization patterns of the rADAR2a variant probe reached peak expression at about the second week of life, while peak expression of the rADAR2b probe was reached at about the third week of life. At the end of the first week of life (P7), expression of both splice variants was strongest in the thalamic nuclei. By P14, rADAR2 messenger RNA expression was more consolidated in the deeper structures, including the thalamic nuclei and the granule cell layer of the cerebellum. By P21, maximal levels of rADARb expression were observed in the thalamic nuclei, inferior colliculus, cerebellum and pontine nuclei. In the adult, rADAR2 messenger RNA expression was of highest intensity in the thalamic nuclei, with high levels of expression in the olfactory bulb, inferior colliculus, cerebellum and pontine nuclei. At the level of the hippocampus, positive labelling was restricted to the CA3 region of the Ammon's horn and the dentate gyrus, with weak signals in the CA1 subfield. rADAR2 pan expression was at near background levels throughout the neocortex and caudate putamen. In summary, our study shows that ADAR2 messenger RNA expression is regulated in a cell-specific manner throughout development. At early ages, ADAR2 messenger RNA is expressed only within (and restricted to) the thalamic nuclei. By the third postnatal week, expression of the editase enzyme is more widely distributed throughout the olfactory bulb, CA3 and dentate gyrus of the hippocampus, thalamus, inferior colliculus and the molecular cell layer of the cerebellum. ADAR2 is thought to act at specific nucleotide positions in primary transcripts encoding glutamate receptor subunits, thereby altering gating and ionic permeability properties of AMPA- and kainate-activated channels. ADAR2 also acts at pre-messenger RNA encoding the serotonin 5HT-2C receptor to alter G-protein coupling. Thus, RNA editing may be an important mechanism for fine-tuning of the physiological and pharmacological properties of transmitter receptors of the central nervous system.

Simulated cosmic microwave background maps at 0.5 deg resolution: Basic results

NASA Technical Reports Server (NTRS)

Hinshaw, G.; Bennett, C. L.; Kogut, A.

1995-01-01

We have simulated full-sky maps of the cosmic microwave background (CMB) anisotropy expected from cold dark matter (CDM) models at 0.5 deg and 1.0 deg angular resolution. Statistical properties of the maps are presented as a function of sky coverage, angular resolution, and instrument noise, and the implications of these results for observability of the Doppler peak are discussed. The rms fluctuations in a map are not a particularly robust probe of the existence of a Doppler peak; however, a full correlation analysis can provide reasonable sensitivity. We find that sensitivity to the Doppler peak depends primarily on the fraction of sky covered, and only secondarily on the angular resolution and noise level. Color plates of the simulated maps are presented to illustrate the anisotropies.

Molecular Imaging Probes for Positron Emission Tomography and Optical Imaging of Sentinel Lymph Node and Tumor

NASA Astrophysics Data System (ADS)

Qin, Zhengtao

Molecular imaging is visualizations and measurements of in vivo biological processes at the molecular or cellular level using specific imaging probes. As an emerging technology, biocompatible macromolecular or nanoparticle based targeted imaging probes have gained increasing popularities. Those complexes consist of a carrier, an imaging reporter, and a targeting ligand. The active targeting ability dramatically increases the specificity. And the multivalency effect may further reduce the dose while providing a decent signal. In this thesis, sentinel lymph node (SLN) mapping and cancer imaging are two research topics. The focus is to develop molecular imaging probes with high specificity and sensitivity, for Positron Emission Tomography (PET) and optical imaging. The objective of this thesis is to explore dextran radiopharmaceuticals and porous silicon nanoparticles based molecular imaging agents. Dextran polymers are excellent carriers to deliver imaging reporters or therapeutic agents due to its well established safety profile and oligosaccharide conjugation chemistry. There is also a wide selection of dextran polymers with different lengths. On the other hand, Silicon nanoparticles represent another class of biodegradable materials for imaging and drug delivery. The success in fluorescence lifetime imaging and enhancements of the immune activation potency was briefly discussed. Chapter 1 begins with an overview on current molecular imaging techniques and imaging probes. Chapter 2 presents a near-IR dye conjugated probe, IRDye 800CW-tilmanocept. Fluorophore density was optimized to generate the maximum brightness. It was labeled with 68Ga and 99mTc and in vivo SLN mapping was successfully performed in different animals, such as mice, rabbits, dogs and pigs. With 99mTc labeled IRDye 800CW-tilmanocept, chapter 3 introduces a two-day imaging protocol with a hand-held imager. Chapter 4 proposed a method to dual radiolabel the IRDye 800CW-tilmanocept with both 68Ga and 99mTc. Chapter 5 introduces a 68Ga metal chelating bioorthogonal tetrazine dextran probe for multistep imaging of a colon cancer. Chapter 6 presents the synthesis and in vivo evaluation of a Hepatocellular Carcinoma targeting PET probe 68Ga-Insulin-Dextran. Chapter 7 discusses a novel method to prepare silicon nanoparticles with great yield and size control. The last chapter 8 concludes all probes developed in this thesis and their clinical relevance.

Initial Results of the SSPX Transient Internal Probe System for Measuring Toroidal Field Profiles

NASA Astrophysics Data System (ADS)

Holcomb, C. T.; Jarboe, T. R.; Mattick, A. T.; Hill, D. N.; McLean, H. S.; Wood, R. D.; Cellamare, V.

2000-10-01

Lawrence Livermore National Laboratory, Livermore, CA 94550, USA. The Sustained Spheromak Physics Experiment (SSPX) is using a field profile diagnostic called the Transient Internal Probe (TIP). TIP consists of a verdet-glass bullet that is used to measure the magnetic field by Faraday rotation. This probe is shot through the spheromak by a light gas gun at speeds near 2 km/s. An argon laser is aligned along the path of the probe. The light passes through the probe and is retro-reflected to an ellipsometer that measures the change in polarization angle. The measurement is spatially resolved down to the probes’ 1 cm length to within 15 Gauss. Initial testing results are given. This and future data will be used to determine the field profile for equilibrium reconstruction. TIP can also be used in conjunction with wall probes to map out toroidal mode amplitudes and phases internally. This work was performed under the auspices of US DOE by the University of California Lawrence Livermore National Laboratory under Contract No. W-7405-ENG-48.

Quantitating Antibody Uptake In Vivo: Conditional Dependence on Antigen Expression Levels

PubMed Central

Thurber, Greg M.; Weissleder, Ralph

2010-01-01

Purpose Antibodies form an important class of cancer therapeutics, and there is intense interest in using them for imaging applications in diagnosis and monitoring of cancer treatment. Despite the expanding body of knowledge describing pharmacokinetic and pharmacodynamic interactions of antibodies in vivo, discrepancies remain over the effect of antigen expression level on tumoral uptake with some reports indicating a relationship between uptake and expression and others showing no correlation. Procedures Using a cell line with high EpCAM expression and moderate EGFR expression, fluorescent antibodies with similar plasma clearance were imaged in vivo. A mathematical model and mouse xenograft experiments were used to describe the effect of antigen expression on uptake of these high affinity antibodies. Results As predicted by the theoretical model, under subsaturating conditions, uptake of the antibodies in such tumors is similar because localization of both probes is limited by delivery from the vasculature. In a separate experiment, when the tumor is saturated, the uptake becomes dependent on the number of available binding sites. In addition, targeting of small micrometastases is shown to be higher than larger vascularized tumors. Conclusions These results are consistent with the prediction that high affinity antibody uptake is dependent on antigen expression levels for saturating doses and delivery for subsaturating doses. It is imperative for any probe to understand whether quantitative uptake is a measure of biomarker expression or transport to the region of interest. The data provide support for a predictive theoretical model of antibody uptake, enabling it to be used as a starting point for the design of more efficacious therapies and timely quantitative imaging probes. PMID:20809210

Quantitating antibody uptake in vivo: conditional dependence on antigen expression levels.

PubMed

Thurber, Greg M; Weissleder, Ralph

2011-08-01

Antibodies form an important class of cancer therapeutics, and there is intense interest in using them for imaging applications in diagnosis and monitoring of cancer treatment. Despite the expanding body of knowledge describing pharmacokinetic and pharmacodynamic interactions of antibodies in vivo, discrepancies remain over the effect of antigen expression level on tumoral uptake with some reports indicating a relationship between uptake and expression and others showing no correlation. Using a cell line with high epithelial cell adhesion molecule expression and moderate epidermal growth factor receptor expression, fluorescent antibodies with similar plasma clearance were imaged in vivo. A mathematical model and mouse xenograft experiments were used to describe the effect of antigen expression on uptake of these high-affinity antibodies. As predicted by the theoretical model, under subsaturating conditions, uptake of the antibodies in such tumors is similar because localization of both probes is limited by delivery from the vasculature. In a separate experiment, when the tumor is saturated, the uptake becomes dependent on the number of available binding sites. In addition, targeting of small micrometastases is shown to be higher than larger vascularized tumors. These results are consistent with the prediction that high affinity antibody uptake is dependent on antigen expression levels for saturating doses and delivery for subsaturating doses. It is imperative for any probe to understand whether quantitative uptake is a measure of biomarker expression or transport to the region of interest. The data provide support for a predictive theoretical model of antibody uptake, enabling it to be used as a starting point for the design of more efficacious therapies and timely quantitative imaging probes.

Assessing sensory versus optogenetic network activation by combining (o)fMRI with optical Ca2+ recordings.

PubMed

Schmid, Florian; Wachsmuth, Lydia; Schwalm, Miriam; Prouvot, Pierre-Hugues; Jubal, Eduardo Rosales; Fois, Consuelo; Pramanik, Gautam; Zimmer, Claus; Faber, Cornelius; Stroh, Albrecht

2016-11-01

Encoding of sensory inputs in the cortex is characterized by sparse neuronal network activation. Optogenetic stimulation has previously been combined with fMRI (ofMRI) to probe functional networks. However, for a quantitative optogenetic probing of sensory-driven sparse network activation, the level of similarity between sensory and optogenetic network activation needs to be explored. Here, we complement ofMRI with optic fiber-based population Ca 2+ recordings for a region-specific readout of neuronal spiking activity in rat brain. Comparing Ca 2+ responses to the blood oxygenation level-dependent signal upon sensory stimulation with increasing frequencies showed adaptation of Ca 2+ transients contrasted by an increase of blood oxygenation level-dependent responses, indicating that the optical recordings convey complementary information on neuronal network activity to the corresponding hemodynamic response. To study the similarity of optogenetic and sensory activation, we quantified the density of cells expressing channelrhodopsin-2 and modeled light propagation in the tissue. We estimated the effectively illuminated volume and numbers of optogenetically stimulated neurons, being indicative of sparse activation. At the functional level, upon either sensory or optogenetic stimulation we detected single-peak short-latency primary Ca 2+ responses with similar amplitudes and found that blood oxygenation level-dependent responses showed similar time courses. These data suggest that ofMRI can serve as a representative model for functional brain mapping. © The Author(s) 2015.

Optimization of pressure probe placement and data analysis of engine-inlet distortion

NASA Astrophysics Data System (ADS)

Walter, S. F.

The purpose of this research is to examine methods by which quantification of inlet flow distortion may be improved upon. Specifically, this research investigates how data interpolation effects results, optimizing sampling locations of the flow, and determining the sensitivity related to how many sample locations there are. The main parameters that are indicative of a "good" design are total pressure recovery, mass flow capture, and distortion. This work focuses on the total pressure distortion, which describes the amount of non-uniformity that exists in the flow as it enters the engine. All engines must tolerate some level of distortion, however too much distortion can cause the engine to stall or the inlet to unstart. Flow distortion is measured at the interface between the inlet and the engine. To determine inlet flow distortion, a combination of computational and experimental pressure data is generated and then collapsed into an index that indicates the amount of distortion. Computational simulations generate continuous contour maps, but experimental data is discrete. Researchers require continuous contour maps to evaluate the overall distortion pattern. There is no guidance on how to best manipulate discrete points into a continuous pattern. Using one experimental, 320 probe data set and one, 320 point computational data set with three test runs each, this work compares the pressure results obtained using all 320 points of data from the original sets, both quantitatively and qualitatively, with results derived from selecting 40 grid point subsets and interpolating to 320 grid points. Each of the two, 40 point sets were interpolated to 320 grid points using four different interpolation methods in an attempt to establish the best method for interpolating small sets of data into an accurate, continuous contour map. Interpolation methods investigated are bilinear, spline, and Kriging in Cartesian space, as well as angular in polar space. Spline interpolation methods should be used as they result in the most accurate, precise, and visually correct predictions when compared results achieved from the full data sets. Researchers were interested if fewer than the recommended 40 probes could be used - especially when placed in areas of high interest - but still obtain equivalent or better results. For this investigation, the computational results from a two-dimensional inlet and experimental results of an axisymmetric inlet were used. To find the areas of interest, a uniform sampling of all possible locations was run through a Monte Carlo simulation with a varying number of probes. A probability density function of the resultant distortion index was plotted. Certain probes are required to come within the desired accuracy level of the distortion index based on the full data set. For the experimental results, all three test cases could be characterized with 20 probes. For the axisymmetric inlet, placing 40 probes in select locations could get the results for parameters of interest within less than 10% of the exact solution for almost all cases. For the two dimensional inlet, the results were not as clear. 80 probes were required to get within 10% of the exact solution for all run numbers, although this is largely due to the small value of the exact result. The sensitivity of each probe added to the experiment was analyzed. Instead of looking at the overall pattern established by optimizing probe placements, the focus is on varying the number of sampled probes from 20 to 40. The number of points falling within a 1% tolerance band of the exact solution were counted as good points. The results were normalized for each data set and a general sensitivity function was found to determine the sensitivity of the results. A linear regression was used to generalize the results for all data sets used in this work. However, they can be used by directly comparing the number of good points obtained with various numbers of probes as well. The sensitivity in the results is higher when fewer probes are used and gradually tapers off near 40 probes. There is a bigger gain in good points when the number of probes is increased from 20 to 21 probes than from 39 to 40 probes.

Development of a Fluorescent Bodipy Probe for Visualization of the Serotonin 5-HT1A Receptor in Native Cells of the Immune System.

PubMed

Hernández-Torres, Gloria; Enríquez-Palacios, Ernesto; Mecha, Miriam; Feliú, Ana; Rueda-Zubiaurre, Ainoa; Angelina, Alba; Martín-Cruz, Leticia; Martín-Fontecha, Mar; Palomares, Oscar; Guaza, Carmen; Peña-Cabrera, Eduardo; López-Rodríguez, María L; Ortega-Gutiérrez, Silvia

2018-05-14

Serotonin (5-HT) modulates key aspects of the immune system. However, its precise function and the receptors involved in the observed effects have remained elusive. Among the different serotonin receptors, 5-HT 1A plays an important role in the immune system given its presence in cells involved in both the innate and adaptive immune responses, but its actual levels of expression under different conditions have not been comprehensively studied due to the lack of suitable tools. To further clarify the role of 5-HT 1A receptor in the immune system, we have developed a fluorescent small molecule probe that enables the direct study of the receptor levels in native cells. This probe allows direct profiling of the receptor expression in immune cells using flow cytometry. Our results show that important subsets of immune cells including human monocytes and dendritic cells express functional 5-HT 1A and that its activation is associated with anti-inflammatory signaling. Furthermore, application of the probe to the experimental autoimmune encephalomyelitis model of multiple sclerosis demonstrates its potential to detect the specific overexpression of the 5-HT 1A receptor in CD4+ T cells. Accordingly, the probe reported herein represents a useful tool whose use can be extended to study the levels of 5-HT 1A receptor in ex vivo samples of different immune system conditions.

Qualitative assessment of gene expression in affymetrix genechip arrays

NASA Astrophysics Data System (ADS)

Nagarajan, Radhakrishnan; Upreti, Meenakshi

2007-01-01

Affymetrix Genechip microarrays are used widely to determine the simultaneous expression of genes in a given biological paradigm. Probes on the Genechip array are atomic entities which by definition are randomly distributed across the array and in turn govern the gene expression. In the present study, we make several interesting observations. We show that there is considerable correlation between the probe intensities across the array which defy the independence assumption. While the mechanism behind such correlations is unclear, we show that scaling behavior and the profiles of perfect match (PM) as well as mismatch (MM) probes are similar and immune-to-background subtraction. We believe that the observed correlations are possibly an outcome of inherent non-stationarities or patchiness in the array devoid of biological significance. This is demonstrated by inspecting their scaling behavior and profiles of the PM and MM probe intensities obtained from publicly available Genechip arrays from three eukaryotic genomes, namely: Drosophila melanogaster (fruit fly), Homo sapiens (humans) and Mus musculus (house mouse) across distinct biological paradigms and across laboratories, with and without background subtraction. The fluctuation functions were estimated using detrended fluctuation analysis (DFA) with fourth-order polynomial detrending. The results presented in this study provide new insights into correlation signatures of PM and MM probe intensities and suggests the choice of DFA as a tool for qualitative assessment of Affymetrix Genechip microarrays prior to their analysis. A more detailed investigation is necessary in order to understand the source of these correlations.

Laser-Assisted Atom Probe Tomography of Deformed Minerals: A Zircon Case Study.

PubMed

La Fontaine, Alexandre; Piazolo, Sandra; Trimby, Patrick; Yang, Limei; Cairney, Julie M

2017-04-01

The application of atom probe tomography to the study of minerals is a rapidly growing area. Picosecond-pulsed, ultraviolet laser (UV-355 nm) assisted atom probe tomography has been used to analyze trace element mobility within dislocations and low-angle boundaries in plastically deformed specimens of the nonconductive mineral zircon (ZrSiO4), a key material to date the earth's geological events. Here we discuss important experimental aspects inherent in the atom probe tomography investigation of this important mineral, providing insights into the challenges in atom probe tomography characterization of minerals as a whole. We studied the influence of atom probe tomography analysis parameters on features of the mass spectra, such as the thermal tail, as well as the overall data quality. Three zircon samples with different uranium and lead content were analyzed, and particular attention was paid to ion identification in the mass spectra and detection limits of the key trace elements, lead and uranium. We also discuss the correlative use of electron backscattered diffraction in a scanning electron microscope to map the deformation in the zircon grains, and the combined use of transmission Kikuchi diffraction and focused ion beam sample preparation to assist preparation of the final atom probe tip.

Probing Zeolite Crystal Architecture and Structural Imperfections using Differently Sized Fluorescent Organic Probe Molecules.

PubMed

Hendriks, Frank C; Schmidt, Joel E; Rombouts, Jeroen A; Lammertsma, Koop; Bruijnincx, Pieter C A; Weckhuysen, Bert M

2017-05-05

A micro-spectroscopic method has been developed to probe the accessibility of zeolite crystals using a series of fluorescent 4-(4-diethylaminostyryl)-1-methylpyridinium iodide (DAMPI) probes of increasing molecular size. Staining large zeolite crystals with MFI (ZSM-5) topology and subsequent mapping of the resulting fluorescence using confocal fluorescence microscopy reveal differences in structural integrity: the 90° intergrowth sections of MFI crystals are prone to develop structural imperfections, which act as entrance routes for the probes into the zeolite crystal. Polarization-dependent measurements provide evidence for the probe molecule's alignment within the MFI zeolite pore system. The developed method was extended to BEA (Beta) crystals, showing that the previously observed hourglass pattern is a general feature of BEA crystals with this morphology. Furthermore, the probes can accurately identify at which crystal faces of BEA straight or sinusoidal pores open to the surface. The results show this method can spatially resolve the architecture-dependent internal pore structure of microporous materials, which is difficult to assess using other characterization techniques such as X-ray diffraction. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Ultra-reduced phases in Apollo 16 regolith: Combined field emission electron probe microanalysis and atom probe tomography of submicron Fe-Si grains in Apollo 16 sample 61500

NASA Astrophysics Data System (ADS)

Gopon, Phillip; Spicuzza, Michael J.; Kelly, Thomas F.; Reinhard, David; Prosa, Ty J.; Fournelle, John

2017-09-01

The lunar regolith contains a variety of chemically reduced phases of interest to planetary scientists and the most common, metallic iron, is generally ascribed to space weathering processes (Lucey et al. ). Reports of silicon metal and iron silicides, phases indicative of extremely reducing conditions, in lunar samples are rare (Anand et al. ; Spicuzza et al. ). Additional examples of Fe-silicides have been identified in a survey of particles from Apollo 16 sample 61501,22. Herein is demonstrated the utility of low keV electron probe microanalysis (EPMA), using the Fe Ll X-ray line, to analyze these submicron phases, and the necessity of accounting for carbon contamination. We document four Fe-Si and Si0 minerals in lunar regolith return material. The new Fe-Si samples have a composition close to (Fe,Ni)3Si, whereas those associated with Si0 are close to FeSi2 and Fe3Si7. Atom probe tomography of (Fe,Ni)3Si shows trace levels of C (60 ppma and nanodomains enriched in C, Ni, P, Cr, and Sr). These reduced minerals require orders of magnitude lower oxygen fugacity and more reducing conditions than required to form Fe0. Documenting the similarities and differences in these samples is important to constrain their formation processes. These phases potentially formed at high temperatures resulting from a meteorite impact. Whether carbon played a role in achieving the lower oxygen fugacities—and there is evidence of nearby carbonaceous chondritic material—it remains to be proven that carbon was the necessary component for the unique existence of these Si0 and iron silicide minerals.

Resonant antenna probes for tip-enhanced infrared near-field microscopy.

PubMed

Huth, Florian; Chuvilin, Andrey; Schnell, Martin; Amenabar, Iban; Krutokhvostov, Roman; Lopatin, Sergei; Hillenbrand, Rainer

2013-03-13

We report the development of infrared-resonant antenna probes for tip-enhanced optical microscopy. We employ focused-ion-beam machining to fabricate high-aspect ratio gold cones, which replace the standard tip of a commercial Si-based atomic force microscopy cantilever. Calculations show large field enhancements at the tip apex due to geometrical antenna resonances in the cones, which can be precisely tuned throughout a broad spectral range from visible to terahertz frequencies by adjusting the cone length. Spectroscopic analysis of these probes by electron energy loss spectroscopy, Fourier transform infrared spectroscopy, and Fourier transform infrared near-field spectroscopy corroborates their functionality as resonant antennas and verifies the broad tunability. By employing the novel probes in a scattering-type near-field microscope and imaging a single tobacco mosaic virus (TMV), we experimentally demonstrate high-performance mid-infrared nanoimaging of molecular absorption. Our probes offer excellent perspectives for optical nanoimaging and nanospectroscopy, pushing the detection and resolution limits in many applications, including nanoscale infrared mapping of organic, molecular, and biological materials, nanocomposites, or nanodevices.

Shock probes in a one-dimensional Katz-Lebowitz-Spohn model

NASA Astrophysics Data System (ADS)

Chatterjee, Sakuntala; Barma, Mustansir

2008-06-01

We consider shock probes in a one-dimensional driven diffusive medium with nearest-neighbor Ising interaction (KLS model). Earlier studies based on an approximate mapping of the present system to an effective zero-range process concluded that the exponents characterizing the decays of several static and dynamical correlation functions of the probes depend continuously on the strength of the Ising interaction. On the contrary, our numerical simulations indicate that over a substantial range of the interaction strength, these exponents remain constant and their values are the same as in the case of no interaction (when the medium executes an ASEP). We demonstrate this by numerical studies of several dynamical correlation functions for two probes and also for a macroscopic number of probes. Our results are consistent with the expectation that the short-ranged correlations induced by the Ising interaction should not affect the large time and large distance properties of the system, implying that scaling forms remain the same as in the medium with no interactions present.

Nanobits, Nembranes and Micro Four-Point Probes: Customizable Tools for insitu Manipulation and Characterisation of Nanostructures

NASA Astrophysics Data System (ADS)

Boggild, Peter; Hjorth Petersen, Dirch; Sardan Sukas, Ozlem; Dam, Henrik Friis; Lei, Anders; Booth, Timothy; Molhave, Kristian; Eicchorn, Volkmar

2010-03-01

We present a range of highly adaptable microtools for direct interaction with nanoscale structures; (i) semiautomatic pick-and-place assembly of multiwalled carbon nanotubes onto cantilevers for high-aspect ratio scanning probe microscopy, using electrothermal microgrippers inside a SEM. Topology optimisation was used to calculate the optimal gripper shape defined by the boundary conditions, resulting in 10-100 times better performance. By instead pre-defining detachable tips using electron beam lithography, free-form scanning probe tips (Nanobits) can be mounted in virtually any position on a cantilever; (ii) scanning micro four point probes allow fast, non- destructive mapping of local electrical properties (sheet resistance and Hall mobility) and hysteresis effects of graphene sheets; (iii) sub 100 nm freestanding devices with wires, heaters, actuators, sensors, resonators and probes were defined in a 100 nm thin membrane with focused ion beam milling. By patterning generic membrane templates (Nembranes) the fabrication time of a TEM compatible NEMS device is effectively reduced to less around 20 minutes.

Atom Probe Tomographic Mapping Directly Reveals the Atomic Distribution of Phosphorus in Resin Embedded Ferritin

NASA Astrophysics Data System (ADS)

Perea, Daniel E.; Liu, Jia; Bartrand, Jonah; Dicken, Quinten; Thevuthasan, S. Theva; Browning, Nigel D.; Evans, James E.

2016-02-01

Here we report the atomic-scale analysis of biological interfaces within the ferritin protein using atom probe tomography that is facilitated by an advanced specimen preparation approach. Embedding ferritin in an organic polymer resin lacking nitrogen provided chemical contrast to visualise atomic distributions and distinguish the inorganic-organic interface of the ferrihydrite mineral core and protein shell, as well as the organic-organic interface between the ferritin protein shell and embedding resin. In addition, we definitively show the atomic-scale distribution of phosphorus as being at the surface of the ferrihydrite mineral with the distribution of sodium mapped within the protein shell environment with an enhanced distribution at the mineral/protein interface. The sample preparation method is robust and can be directly extended to further enhance the study of biological, organic and inorganic nanomaterials relevant to health, energy or the environment.

Differential Measurement Periodontal Structures Mapping System

NASA Technical Reports Server (NTRS)

Companion, John A. (Inventor)

1998-01-01

This invention relates to a periodontal structure mapping system employing a dental handpiece containing first and second acoustic sensors for locating the Cemento-Enamel Junction (CEJ) and measuring the differential depth between the CEJ and the bottom of the periodontal pocket. Measurements are taken at multiple locations on each tooth of a patient, observed, analyzed by an optical analysis subsystem, and archived by a data storage system for subsequent study and comparison with previous and subsequent measurements. Ultrasonic transducers for the first and second acoustic sensors are contained within the handpiece and in connection with a control computer. Pressurized water is provided for the depth measurement sensor and a linearly movable probe sensor serves as the sensor for the CEJ finder. The linear movement of the CEJ sensor is obtained by a control computer actuated by the prober. In an alternate embodiment, the CEJ probe is an optical fiber sensor with appropriate analysis structure provided therefor.

Atom Probe Tomographic Mapping Directly Reveals the Atomic Distribution of Phosphorus in Resin Embedded Ferritin

PubMed Central

Perea, Daniel E.; Liu, Jia; Bartrand, Jonah; Dicken, Quinten; Thevuthasan, S. Theva; Browning, Nigel D.; Evans, James E.

2016-01-01

Here we report the atomic-scale analysis of biological interfaces within the ferritin protein using atom probe tomography that is facilitated by an advanced specimen preparation approach. Embedding ferritin in an organic polymer resin lacking nitrogen provided chemical contrast to visualise atomic distributions and distinguish the inorganic-organic interface of the ferrihydrite mineral core and protein shell, as well as the organic-organic interface between the ferritin protein shell and embedding resin. In addition, we definitively show the atomic-scale distribution of phosphorus as being at the surface of the ferrihydrite mineral with the distribution of sodium mapped within the protein shell environment with an enhanced distribution at the mineral/protein interface. The sample preparation method is robust and can be directly extended to further enhance the study of biological, organic and inorganic nanomaterials relevant to health, energy or the environment. PMID:26924804

Visualizing the orientational dependence of an intermolecular potential

NASA Astrophysics Data System (ADS)

Sweetman, Adam; Rashid, Mohammad A.; Jarvis, Samuel P.; Dunn, Janette L.; Rahe, Philipp; Moriarty, Philip

2016-02-01

Scanning probe microscopy can now be used to map the properties of single molecules with intramolecular precision by functionalization of the apex of the scanning probe tip with a single atom or molecule. Here we report on the mapping of the three-dimensional potential between fullerene (C60) molecules in different relative orientations, with sub-Angstrom resolution, using dynamic force microscopy (DFM). We introduce a visualization method which is capable of directly imaging the variation in equilibrium binding energy of different molecular orientations. We model the interaction using both a simple approach based around analytical Lennard-Jones potentials, and with dispersion-force-corrected density functional theory (DFT), and show that the positional variation in the binding energy between the molecules is dominated by the onset of repulsive interactions. Our modelling suggests that variations in the dispersion interaction are masked by repulsive interactions even at displacements significantly larger than the equilibrium intermolecular separation.

Viscoelastic Mapping of Living Cell Interiors

NASA Astrophysics Data System (ADS)

Heinrich, Doris; Sackmann, Erich; Koehler, Jana; Gerisch, Guenther

2004-03-01

We performed spatially resolved mapping of the viscoelastic properties of the cytoplasm of living cell interiors. A magnetic tweezer was applied as a local probe for the investigation of active and passive transport inside the slime mold cells Dictyostelium discoideum. Fluorescence labeled components, i.e. the microtubulins, the endoplasmatic reticulum or the core, allow for the determination of the interaction of the magnetic probes with the cytoplasm. By comparing the trajectories of the magnetic beads in the presence of an external magnetic force and in the absence of an external force, we can measure the viscosity at any given position within the cell. These experiments show that the cytoplasm consists of soft pathways (yield stress less or equal 10 Pa) and hard pathways (yield stress less or equal 500 Pa). Selective actin, myosin II or microtubulin network removal in the living cells allows for the determination of the influence of these cell parts on the viscoelastic properties.

A concept for transition mapping on a 10 deg-cone in the National Transonic Facility using flow-pressure variation

NASA Technical Reports Server (NTRS)

Gartenberg, Ehud

1995-01-01

A conceptual study was performed to define a technique for mapping the boundary-layer transition on a 10 deg-Cone in the National Transonic Facility (NTF) as a means of determining this cryogenic-tunnel suitability for laminar flow testing. A major challenge was to devise a test matrix using a fixed surface pitot probe, varying the flow pressure to pr oduce the actual Reynolds numbers for boundary-layer transition. This constraint resulted from a lack of a suitable and reliable electrical motor to drive the probe along the cone's surface under cryogenic flow conditions. The initial phase of this research was performed by the author in collaboration with the late Dr. William B. Igoe from the Aerodynamics Division at NASA Langley Research Center. His comments made during the drafting of this document were invaluable and a source of inspiration.

Standardized reference ideogram for physical mapping in the saltwater crocodile (Crocodylus porosus).

PubMed

Dalzell, P; Miles, L G; Isberg, S R; Glenn, T C; King, C; Murtagh, V; Moran, C

2009-01-01

Basic cytogenetic data, such as diploid number and general chromosome morphology, are available for many reptilian species. Here we present a detailed cytogenetic examination of the saltwater crocodile (Crocodylus porosus) karyotype, including the creation of the first fully annotated G-band standard ideogram for any crocodilian species. The C. porosus karyotype contains macrochromosomes and has a diploid number of 34. This study presents a detailed description of each chromosome, permitting unambiguous chromosome identification. The fully annotated standardized C. porosus ideogram provides the backbone to a standard nomenclature system which can be used to accurately identify specific band locations. Seven microsatellite containing fosmid clones were fluorescently labeled and used as fluorescent in situ hybridization (FISH) probes for physical localization. Chromosome locations for each of these FISH probes were successfully assigned, demonstrating the utility of the fully annotated ideogram for genome mapping. Copyright 2010 S. Karger AG, Basel.

Fiber-Optic Magnetometry and Thermometry Using Optically Detected Magnetic Resonance With Nitrogen-Vacancy Centers in Diamond

NASA Astrophysics Data System (ADS)

Blakley, Sean Michael

Nitrogen--vacancy diamond (NVD) quantum sensors are an emerging technology that has shown great promise in areas like high-resolution thermometry and magnetometry. Optical fibers provide attractive new application paradigms for NVD technology. A detailed description of the fabrication processes associated with the development of novel fiber-optic NVD probes are presented in this work. The demonstrated probes are tested on paradigmatic model systems designed to ascertain their suitability for use in challenging biological environments. Methods employing optically detected magnetic resonance (ODMR) are used to accurately measure and map temperature distributions of small objects and to demonstrate emergent temperature-dependent phenomena in genetically modified living organisms. These methods are also used to create detailed high resolution spatial maps of both magnetic scalar and magnetic vector field distributions of spatially localized weak field features in the presence of a noisy, high-field background.

Genomic Characterization of DArT Markers Based on High-Density Linkage Analysis and Physical Mapping to the Eucalyptus Genome

PubMed Central

Petroli, César D.; Sansaloni, Carolina P.; Carling, Jason; Steane, Dorothy A.; Vaillancourt, René E.; Myburg, Alexander A.; da Silva, Orzenil Bonfim; Pappas, Georgios Joannis; Kilian, Andrzej; Grattapaglia, Dario

2012-01-01

Diversity Arrays Technology (DArT) provides a robust, high throughput, cost-effective method to query thousands of sequence polymorphisms in a single assay. Despite the extensive use of this genotyping platform for numerous plant species, little is known regarding the sequence attributes and genome-wide distribution of DArT markers. We investigated the genomic properties of the 7,680 DArT marker probes of a Eucalyptus array, by sequencing them, constructing a high density linkage map and carrying out detailed physical mapping analyses to the Eucalyptus grandis reference genome. A consensus linkage map with 2,274 DArT markers anchored to 210 microsatellites and a framework map, with improved support for ordering, displayed extensive collinearity with the genome sequence. Only 1.4 Mbp of the 75 Mbp of still unplaced scaffold sequence was captured by 45 linkage mapped but physically unaligned markers to the 11 main Eucalyptus pseudochromosomes, providing compelling evidence for the quality and completeness of the current Eucalyptus genome assembly. A highly significant correspondence was found between the locations of DArT markers and predicted gene models, while most of the 89 DArT probes unaligned to the genome correspond to sequences likely absent in E. grandis, consistent with the pan-genomic feature of this multi-Eucalyptus species DArT array. These comprehensive linkage-to-physical mapping analyses provide novel data regarding the genomic attributes of DArT markers in plant genomes in general and for Eucalyptus in particular. DArT markers preferentially target the gene space and display a largely homogeneous distribution across the genome, thereby providing superb coverage for mapping and genome-wide applications in breeding and diversity studies. Data reported on these ubiquitous properties of DArT markers will be particularly valuable to researchers working on less-studied crop species who already count on DArT genotyping arrays but for which no reference genome is yet available to allow such detailed characterization. PMID:22984541

Potential of an emissive cylindrical probe in plasma.

PubMed

Fruchtman, A; Zoler, D; Makrinich, G

2011-08-01

The floating potential of an emissive cylindrical probe in a plasma is calculated for an arbitrary ratio of Debye length to probe radius and for an arbitrary ion composition. In their motion to the probe the ions are assumed to be collisionless. For a small Debye length, a two-scale analysis for the quasineutral plasma and for the sheath provides analytical expressions for the emitted and collected currents and for the potential as functions of a generalized mass ratio. For a Debye length that is not small, it is demonstrated that, as the Debye length becomes larger, the probe potential approaches the plasma potential and that the ion density near the probe is not smaller but rather is larger than it is in the plasma bulk.

Distributional fold change test – a statistical approach for detecting differential expression in microarray experiments

PubMed Central

2012-01-01

Background Because of the large volume of data and the intrinsic variation of data intensity observed in microarray experiments, different statistical methods have been used to systematically extract biological information and to quantify the associated uncertainty. The simplest method to identify differentially expressed genes is to evaluate the ratio of average intensities in two different conditions and consider all genes that differ by more than an arbitrary cut-off value to be differentially expressed. This filtering approach is not a statistical test and there is no associated value that can indicate the level of confidence in the designation of genes as differentially expressed or not differentially expressed. At the same time the fold change by itself provide valuable information and it is important to find unambiguous ways of using this information in expression data treatment. Results A new method of finding differentially expressed genes, called distributional fold change (DFC) test is introduced. The method is based on an analysis of the intensity distribution of all microarray probe sets mapped to a three dimensional feature space composed of average expression level, average difference of gene expression and total variance. The proposed method allows one to rank each feature based on the signal-to-noise ratio and to ascertain for each feature the confidence level and power for being differentially expressed. The performance of the new method was evaluated using the total and partial area under receiver operating curves and tested on 11 data sets from Gene Omnibus Database with independently verified differentially expressed genes and compared with the t-test and shrinkage t-test. Overall the DFC test performed the best – on average it had higher sensitivity and partial AUC and its elevation was most prominent in the low range of differentially expressed features, typical for formalin-fixed paraffin-embedded sample sets. Conclusions The distributional fold change test is an effective method for finding and ranking differentially expressed probesets on microarrays. The application of this test is advantageous to data sets using formalin-fixed paraffin-embedded samples or other systems where degradation effects diminish the applicability of correlation adjusted methods to the whole feature set. PMID:23122055

Kelvin Probe Force Microscopy in liquid using Electrochemical Force Microscopy

DOE PAGES

Collins, Liam; Jesse, Stephen; Kilpatrick, J.; ...

2015-01-19

Conventional closed loop-Kelvin probe force microscopy (KPFM) has emerged as a powerful technique for probing electric and transport phenomena at the solid-gas interface. The extension of KPFM capabilities to probe electrostatic and electrochemical phenomena at the solid–liquid interface is of interest for a broad range of applications from energy storage to biological systems. However, the operation of KPFM implicitly relies on the presence of a linear lossless dielectric in the probe-sample gap, a condition which is violated for ionically-active liquids (e.g., when diffuse charge dynamics are present). Here, electrostatic and electrochemical measurements are demonstrated in ionically-active (polar isopropanol, milli-Q watermore » and aqueous NaCl) and ionically-inactive (non-polar decane) liquids by electrochemical force microscopy (EcFM), a multidimensional (i.e., bias- and time-resolved) spectroscopy method. In the absence of mobile charges (ambient and non-polar liquids), KPFM and EcFM are both feasible, yielding comparable contact potential difference (CPD) values. In ionically-active liquids, KPFM is not possible and EcFM can be used to measure the dynamic CPD and a rich spectrum of information pertaining to charge screening, ion diffusion, and electrochemical processes (e.g., Faradaic reactions). EcFM measurements conducted in isopropanol and milli-Q water over Au and highly ordered pyrolytic graphite electrodes demonstrate both sample- and solvent-dependent features. Finally, the feasibility of using EcFM as a local force-based mapping technique of material-dependent electrostatic and electrochemical response is investigated. The resultant high dimensional dataset is visualized using a purely statistical approach that does not require a priori physical models, allowing for qualitative mapping of electrostatic and electrochemical material properties at the solid–liquid interface.« less

Mapping of Heavy Metal Ion Sorption to Cell-Extracellular Polymeric Substance-Mineral Aggregates by Using Metal-Selective Fluorescent Probes and Confocal Laser Scanning Microscopy

PubMed Central

Li, Jianli; Kappler, Andreas; Obst, Martin

2013-01-01

Biofilms, organic matter, iron/aluminum oxides, and clay minerals bind toxic heavy metal ions and control their fate and bioavailability in the environment. The spatial relationship of metal ions to biomacromolecules such as extracellular polymeric substances (EPS) in biofilms with microbial cells and biogenic minerals is complex and occurs at the micro- and submicrometer scale. Here, we review the application of highly selective and sensitive metal fluorescent probes for confocal laser scanning microscopy (CLSM) that were originally developed for use in life sciences and propose their suitability as a powerful tool for mapping heavy metals in environmental biofilms and cell-EPS-mineral aggregates (CEMAs). The benefit of using metal fluorescent dyes in combination with CLSM imaging over other techniques such as electron microscopy is that environmental samples can be analyzed in their natural hydrated state, avoiding artifacts such as aggregation from drying that is necessary for analytical electron microscopy. In this minireview, we present data for a group of sensitive fluorescent probes highly specific for Fe3+, Cu2+, Zn2+, and Hg2+, illustrating the potential of their application in environmental science. We evaluate their application in combination with other fluorescent probes that label constituents of CEMAs such as DNA or polysaccharides and provide selection guidelines for potential combinations of fluorescent probes. Correlation analysis of spatially resolved heavy metal distributions with EPS and biogenic minerals in their natural, hydrated state will further our understanding of the behavior of metals in environmental systems since it allows for identifying bonding sites in complex, heterogeneous systems. PMID:23974141

Exploiting sequence similarity to validate the sensitivity of SNP arrays in detecting fine-scaled copy number variations.

PubMed

Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam

2010-04-15

High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.

Extensive Chromosomal Reorganization in the Evolution of New World Muroid Rodents (Cricetidae, Sigmodontinae): Searching for Ancestral Phylogenetic Traits

PubMed Central

Pereira, Adenilson Leão; Malcher, Stella Miranda; Nagamachi, Cleusa Yoshiko; O’Brien, Patricia Caroline Mary; Ferguson-Smith, Malcolm Andrew; Mendes-Oliveira, Ana Cristina; Pieczarka, Julio Cesar

2016-01-01

Sigmodontinae rodents show great diversity and complexity in morphology and ecology. This diversity is accompanied by extensive chromosome variation challenging attempts to reconstruct their ancestral genome. The species Hylaeamys megacephalus–HME (Oryzomyini, 2n = 54), Necromys lasiurus—NLA (Akodontini, 2n = 34) and Akodon sp.–ASP (Akodontini, 2n = 10) have extreme diploid numbers that make it difficult to understand the rearrangements that are responsible for such differences. In this study we analyzed these changes using whole chromosome probes of HME in cross-species painting of NLA and ASP to construct chromosome homology maps that reveal the rearrangements between species. We include data from the literature for other Sigmodontinae previously studied with probes from HME and Mus musculus (MMU) probes. We also use the HME probes on MMU chromosomes for the comparative analysis of NLA with other species already mapped by MMU probes. Our results show that NLA and ASP have highly rearranged karyotypes when compared to HME. Eleven HME syntenic blocks are shared among the species studied here. Four syntenies may be ancestral to Akodontini (HME2/18, 3/25, 18/25 and 4/11/16) and eight to Sigmodontinae (HME26, 1/12, 6/21, 7/9, 5/17, 11/16, 20/13 and 19/14/19). Using MMU data we identified six associations shared among rodents from seven subfamilies, where MMU3/18 and MMU8/13 are phylogenetic signatures of Sigmodontinae. We suggest that the associations MMU2entire, MMU6proximal/12entire, MMU3/18, MMU8/13, MMU1/17, MMU10/17, MMU12/17, MMU5/16, MMU5/6 and MMU7/19 are part of the ancestral Sigmodontinae genome. PMID:26800516

Attachment of micro- and nano-particles on tipless cantilevers for colloidal probe microscopy.

PubMed

D'Sa, Dexter J; Chan, Hak-Kim; Chrzanowski, Wojciech

2014-07-15

Current colloidal probe preparation techniques face several challenges in the production of functional probes using particles ⩽5 μm. Challenges include: glue encapsulated particles, glue altered particle properties, improper particle or agglomerate attachment, and lengthy procedures. We present a method to rapidly and reproducibly produce functional micro and nano-colloidal probes. Using a six-step procedure, cantilevers mounted on a custom designed 45° holder were used to approach and obtain a minimal amount of epoxy resin (viscosity of ∼14,000 cP) followed by a single micron/nano particle on the apex of a tipless cantilever. The epoxy and particles were prepared on individual glass slides and subsequently affixed to a 10× or 40× optical microscope lens using another custom designed holder. Scanning electron microscopy and comparative glue-colloidal probe measurements were used to confirm colloidal probe functionality. The method presented allowed rapid and reproducible production of functional colloidal probes (80% success). Single nano-particles were prominently affixed to the apex of the cantilever, unaffected by the epoxy. Nano-colloidal probes were used to conduct topographical, instantaneous force, and adhesive force mapping measurements in dry and liquid media conveying their versatility and functionality in studying nano-colloidal systems. Copyright © 2014 Elsevier Inc. All rights reserved.

Applying Multivariate Adaptive Splines to Identify Genes With Expressions Varying After Diagnosis in Microarray Experiments.

PubMed

Duan, Fenghai; Xu, Ye

2017-01-01

To analyze a microarray experiment to identify the genes with expressions varying after the diagnosis of breast cancer. A total of 44 928 probe sets in an Affymetrix microarray data publicly available on Gene Expression Omnibus from 249 patients with breast cancer were analyzed by the nonparametric multivariate adaptive splines. Then, the identified genes with turning points were grouped by K-means clustering, and their network relationship was subsequently analyzed by the Ingenuity Pathway Analysis. In total, 1640 probe sets (genes) were reliably identified to have turning points along with the age at diagnosis in their expression profiling, of which 927 expressed lower after turning points and 713 expressed higher after the turning points. K-means clustered them into 3 groups with turning points centering at 54, 62.5, and 72, respectively. The pathway analysis showed that the identified genes were actively involved in various cancer-related functions or networks. In this article, we applied the nonparametric multivariate adaptive splines method to a publicly available gene expression data and successfully identified genes with expressions varying before and after breast cancer diagnosis.

MHC class I-associated peptides derive from selective regions of the human genome.

PubMed

Pearson, Hillary; Daouda, Tariq; Granados, Diana Paola; Durette, Chantal; Bonneil, Eric; Courcelles, Mathieu; Rodenbrock, Anja; Laverdure, Jean-Philippe; Côté, Caroline; Mader, Sylvie; Lemieux, Sébastien; Thibault, Pierre; Perreault, Claude

2016-12-01

MHC class I-associated peptides (MAPs) define the immune self for CD8+ T lymphocytes and are key targets of cancer immunosurveillance. Here, the goals of our work were to determine whether the entire set of protein-coding genes could generate MAPs and whether specific features influence the ability of discrete genes to generate MAPs. Using proteogenomics, we have identified 25,270 MAPs isolated from the B lymphocytes of 18 individuals who collectively expressed 27 high-frequency HLA-A,B allotypes. The entire MAP repertoire presented by these 27 allotypes covered only 10% of the exomic sequences expressed in B lymphocytes. Indeed, 41% of expressed protein-coding genes generated no MAPs, while 59% of genes generated up to 64 MAPs, often derived from adjacent regions and presented by different allotypes. We next identified several features of transcripts and proteins associated with efficient MAP production. From these data, we built a logistic regression model that predicts with good accuracy whether a gene generates MAPs. Our results show preferential selection of MAPs from a limited repertoire of proteins with distinctive features. The notion that the MHC class I immunopeptidome presents only a small fraction of the protein-coding genome for monitoring by the immune system has profound implications in autoimmunity and cancer immunology.

MHC class I–associated peptides derive from selective regions of the human genome

PubMed Central

Pearson, Hillary; Granados, Diana Paola; Durette, Chantal; Bonneil, Eric; Courcelles, Mathieu; Rodenbrock, Anja; Laverdure, Jean-Philippe; Côté, Caroline; Thibault, Pierre

2016-01-01

MHC class I–associated peptides (MAPs) define the immune self for CD8+ T lymphocytes and are key targets of cancer immunosurveillance. Here, the goals of our work were to determine whether the entire set of protein-coding genes could generate MAPs and whether specific features influence the ability of discrete genes to generate MAPs. Using proteogenomics, we have identified 25,270 MAPs isolated from the B lymphocytes of 18 individuals who collectively expressed 27 high-frequency HLA-A,B allotypes. The entire MAP repertoire presented by these 27 allotypes covered only 10% of the exomic sequences expressed in B lymphocytes. Indeed, 41% of expressed protein-coding genes generated no MAPs, while 59% of genes generated up to 64 MAPs, often derived from adjacent regions and presented by different allotypes. We next identified several features of transcripts and proteins associated with efficient MAP production. From these data, we built a logistic regression model that predicts with good accuracy whether a gene generates MAPs. Our results show preferential selection of MAPs from a limited repertoire of proteins with distinctive features. The notion that the MHC class I immunopeptidome presents only a small fraction of the protein-coding genome for monitoring by the immune system has profound implications in autoimmunity and cancer immunology. PMID:27841757

Alignment Measurements of the Microwave Anisotropy Probe (MAP) Instrument in a Thermal/Vacuum Chamber Using Photogrammetry

NASA Technical Reports Server (NTRS)

Hill, Michael D.; Herrera, Acey A.; Crane, J. Allen; Packard, Edward A.; Aviado, Carlos; Sampler, Henry P.; Obenschain, Arthur (Technical Monitor)

2000-01-01

The Microwave Anisotropy Probe (MAP) Observatory, scheduled for a late 2000 launch, is designed to measure temperature fluctuations (anisotropy) and produce a high sensitivity and high spatial resolution (< 0.3 deg at 90 GHz.) map of the cosmic microwave background (CMB) radiation over the entire sky between 22 and 90 GHz. MAP utilizes back-to-back Gregorian telescopes to focus the microwave signals into 10 differential microwave receivers, via 20 feed horns. Proper alignment of the telescope reflectors and the feed horns at the operating temperature of 90 K is a critical element to ensure mission success. We describe the hardware and methods used to validate the displacement/deformation predictions of the reflectors and the microwave feed horns during thermal/vacuum testing of the reflectors and the microwave instrument. The smallest deformations to be resolved by the measurement system were on the order of +/- 0.030 inches (0.762 mm). Performance of these alignment measurements inside a thermal/vacuum chamber with conventional alignment equipment posed several limitations. A photogrammetry (PG) system was chosen to perform the measurements since it is a non-contact measurement system, the measurements can be made relatively quickly and accurately, and the photogrammetric camera can be operated remotely. The hardware and methods developed to perform the MAP alignment measurements using PG proved to be highly successful. The PG measurements met the desired requirements, enabling the desired deformations to be measured and even resolved to an order of magnitude smaller than the imposed requirements. Viable data were provided to the MAP Project for a full analysis of the on-orbit performance of the Instrument's microwave system.

Alignment Measurements of the Microwave Anisotropy Probe (MAP) Instrument in a Thermal/Vacuum Chamber

NASA Technical Reports Server (NTRS)

Hill, Michael D.; Herrera, Acey A.; Crane, J. Allen; Packard, Edward A.; Aviado, Carlos; Sampler, Henry P.

2000-01-01

The Microwave Anisotropy Probe (MAP) Observatory, scheduled for a fall 2000 launch, is designed to measure temperature fluctuations (anisotropy) and produce a high sensitivity and high spatial resolution (approximately 0.2 degree) map of the cosmic microwave background (CMB) radiation over the entire sky between 22 and 90 GHz. MAP utilizes back-to-back Gregorian telescopes to focus the microwave signals into 10 differential microwave receivers, via 20 feed horns. Proper alignment of the telescope reflectors and the feed horns at the operating temperature of 90 K is a critical element to ensure mission success. We describe the hardware and methods used to validate the displacement/deformation predictions of the reflectors and the microwave feed horns during thermal/vacuum testing of the reflectors and the microwave instrument. The smallest deformation predictions to be measured were on the order of +/- 0.030 inches (+/- 0.762 mm). Performance of these alignment measurements inside a thermal/vacuum chamber with conventional alignment equipment posed several limitations. The most troublesome limitation was the inability to send personnel into the chamber to perform the measurements during the test due to vacuum and the temperature extremes. The photogrammetry (PG) system was chosen to perform the measurements since it is a non- contact measurement system, the measurements can be made relatively quickly and accurately, and the photogrammetric camera can be operated remotely. The hardware and methods developed to perform the MAP alignment measurements using PG proved to be highly successful. The measurements met the desired requirements, for the metal structures enabling the desired distortions to be measured resolving deformations an order of magnitude smaller than the imposed requirements. Viable data were provided to the MAP Project for a full analysis of the on-orbit performance of the Instrument's microwave system.

MethylViewer: computational analysis and editing for bisulfite sequencing and methyltransferase accessibility protocol for individual templates (MAPit) projects.

PubMed

Pardo, Carolina E; Carr, Ian M; Hoffman, Christopher J; Darst, Russell P; Markham, Alexander F; Bonthron, David T; Kladde, Michael P

2011-01-01

Bisulfite sequencing is a widely-used technique for examining cytosine DNA methylation at nucleotide resolution along single DNA strands. Probing with cytosine DNA methyltransferases followed by bisulfite sequencing (MAPit) is an effective technique for mapping protein-DNA interactions. Here, MAPit methylation footprinting with M.CviPI, a GC methyltransferase we previously cloned and characterized, was used to probe hMLH1 chromatin in HCT116 and RKO colorectal cancer cells. Because M.CviPI-probed samples contain both CG and GC methylation, we developed a versatile, visually-intuitive program, called MethylViewer, for evaluating the bisulfite sequencing results. Uniquely, MethylViewer can simultaneously query cytosine methylation status in bisulfite-converted sequences at as many as four different user-defined motifs, e.g. CG, GC, etc., including motifs with degenerate bases. Data can also be exported for statistical analysis and as publication-quality images. Analysis of hMLH1 MAPit data with MethylViewer showed that endogenous CG methylation and accessible GC sites were both mapped on single molecules at high resolution. Disruption of positioned nucleosomes on single molecules of the PHO5 promoter was detected in budding yeast using M.CviPII, increasing the number of enzymes available for probing protein-DNA interactions. MethylViewer provides an integrated solution for primer design and rapid, accurate and detailed analysis of bisulfite sequencing or MAPit datasets from virtually any biological or biochemical system.

Constrained optimization for position calibration of an NMR field camera.

PubMed

Chang, Paul; Nassirpour, Sahar; Eschelbach, Martin; Scheffler, Klaus; Henning, Anke

2018-07-01

Knowledge of the positions of field probes in an NMR field camera is necessary for monitoring the B 0 field. The typical method of estimating these positions is by switching the gradients with known strengths and calculating the positions using the phases of the FIDs. We investigated improving the accuracy of estimating the probe positions and analyzed the effect of inaccurate estimations on field monitoring. The field probe positions were estimated by 1) assuming ideal gradient fields, 2) using measured gradient fields (including nonlinearities), and 3) using measured gradient fields with relative position constraints. The fields measured with the NMR field camera were compared to fields acquired using a dual-echo gradient recalled echo B 0 mapping sequence. Comparisons were done for shim fields from second- to fourth-order shim terms. The position estimation was the most accurate when relative position constraints were used in conjunction with measured (nonlinear) gradient fields. The effect of more accurate position estimates was seen when compared to fields measured using a B 0 mapping sequence (up to 10%-15% more accurate for some shim fields). The models acquired from the field camera are sensitive to noise due to the low number of spatial sample points. Position estimation of field probes in an NMR camera can be improved using relative position constraints and nonlinear gradient fields. Magn Reson Med 80:380-390, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

In-cell RNA structure probing with SHAPE-MaP.

PubMed

Smola, Matthew J; Weeks, Kevin M

2018-06-01

This protocol is an extension to: Nat. Protoc. 10, 1643-1669 (2015); doi:10.1038/nprot.2015.103; published online 01 October 2015RNAs play key roles in many cellular processes. The underlying structure of RNA is an important determinant of how transcripts function, are processed, and interact with RNA-binding proteins and ligands. RNA structure analysis by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) takes advantage of the reactivity of small electrophilic chemical probes that react with the 2'-hydroxyl group to assess RNA structure at nucleotide resolution. When coupled with mutational profiling (MaP), in which modified nucleotides are detected as internal miscodings during reverse transcription and then read out by massively parallel sequencing, SHAPE yields quantitative per-nucleotide measurements of RNA structure. Here, we provide an extension to our previous in vitro SHAPE-MaP protocol with detailed guidance for undertaking and analyzing SHAPE-MaP probing experiments in live cells. The MaP strategy works for both abundant-transcriptome experiments and for cellular RNAs of low to moderate abundance, which are not well examined by whole-transcriptome methods. In-cell SHAPE-MaP, performed in roughly 3 d, can be applied in cell types ranging from bacteria to cultured mammalian cells and is compatible with a variety of structure-probing reagents. We detail several strategies by which in-cell SHAPE-MaP can inform new biological hypotheses and emphasize downstream analyses that reveal sequence or structure motifs important for RNA interactions in cells.

Comparison of tissue viability imaging and colorimetry: skin blanching.

PubMed

Zhai, Hongbo; Chan, Heidi P; Farahmand, Sara; Nilsson, Gert E; Maibach, Howard I

2009-02-01

Operator-independent assessment of skin blanching is important in the development and evaluation of topically applied steroids. Spectroscopic instruments based on hand-held probes, however, include elements of operator dependence such as difference in applied pressure and probe misalignment, while laser Doppler-based methods are better suited for demonstration of skin vasodilatation than for vasoconstriction. To demonstrate the potential of the emerging technology of Tissue Viability Imaging (TiVi) in the objective and operator-independent assessment of skin blanching. The WheelsBridge TiVi600 Tissue Viability Imager was used for quantification of human skin blanching with the Minolta chromameter CR 200 as an independent colorimeter reference method. Desoximetasone gel 0.05% was applied topically on the volar side of the forearm under occlusion for 6 h in four healthy adults. In a separate study, the induction of blanching in the occlusion phase was mapped using a transparent occlusion cover. The relative uncertainty in the blanching estimate produced by the Tissue Viability Imager was about 5% and similar to that of the chromameter operated by a single user and taking the a(*) parameter as a measure of blanching. Estimation of skin blanching could also be performed in the presence of a transient paradoxical erythema, using the integrated TiVi software. The successive induction of skin blanching during the occlusion phase could readily be mapped by the Tissue Viability Imager. TiVi seems to be suitable for operator-independent and remote mapping of human skin blanching, eliminating the main disadvantages of methods based on hand-held probes.

YAC cloning Mus musculus telomeric DNA: physical, genetic, in situ and STS markers for the distal telomere of chromosome 10.

PubMed

Kipling, D; Wilson, H E; Thomson, E J; Cooke, H J

1995-06-01

Three Mus musculus DBA/2 YAC libraries were constructed using a half-YAC telomere cloning vector. This functional complementation approach yields libraries which include terminal restriction fragments of the mouse genome. Screening all three libraries led to the isolation of 32 independent clones which carry linear YACs containing the mouse terminal repeat sequence, (TTAGGG)n. These YACs provide a resource to isolate regions of the mouse genome close to chromosome termini and excluded from existing conventional YAC libraries. To demonstrate their utility, a hybridization probe was isolated from Mtel-1, the first (TTAGGG)n-containing YAC isolated. This probe detects a approximately 70 kb Kpnl fragment in the mouse genome which is sensitive to pretreatment with BAL31 exonuclease. A PCR-based genetic marker generated from the sequence of this probe maps 4.4 cM from the most distal anchor locus on chromosome 10 in the EUCIB interspecific backcross. STS primers for this locus, D10Hgu1, were used to isolate YAC 110F4 from a commercially available mouse YAC library. Fluorescence in situ hybridization demonstrates that YAC 110F4 hybridizes to the distal telomere of chromosome 10. Clones in this collection of telomere YACs therefore partially overlap clones in conventional YAC libraries, and thus the previously unavailable terminal regions of the mouse genome can now be linked with the developing mouse STS YAC contig. Genetic markers such as D10Hgu1 allow the ends of the mouse genetic map to be defined, thus closing the map.

Chromosome map of the thermophilic archaebacterium Thermococcus celer

NASA Technical Reports Server (NTRS)

Noll, K. M.; Woese, C. R. (Principal Investigator)

1989-01-01

A physical map for the chromosome of the thermophilic archaebacterium Thermococcus celer Vu13 has been constructed. Thirty-four restriction endonucleases were tested for their ability to generate large restriction fragments from the chromosome of T. celer. Of these, the enzymes NheI, SpeI, and XbaI yielded the fewest fragments when analyzed by pulsed-field electrophoresis. NheI and SpeI each gave 5 fragments, while XbaI gave 12. The size of the T. celer chromosome was determined from the sum of the apparent sizes of restriction fragments derived from single and double digests by using these enzymes and was found to be 1,890 +/- 27 kilobase pairs. Partial and complete digests allowed the order of all but three small (less than 15 kilobase pairs) fragments to be deduced. These three fragments were assigned positions by using hybridization probes derived from these restriction fragments. The positions of the other fragments were confirmed by using hybridization probes derived in the same manner. The positions of the 5S, 16S, and 23S rRNA genes as well as the 7S RNA gene were located on this map by using cloned portions of these genes as hybridization probes. The 5S rRNA gene was localized 48 to 196 kilobases from the 5' end of the 16S gene. The 7S RNA gene was localized 190 to 504 kilobases from the 3' end of the 23S gene. These analyses demonstrated that the chromosome of T. celer is a single, circular DNA molecule. This is the first such demonstration of the structure of an archaebacterial chromosome.

Cardiac Fibroblast-Specific Activating Transcription Factor 3 Protects Against Heart Failure by Suppressing MAP2K3-p38 Signaling.

PubMed

Li, Yulin; Li, Zhenya; Zhang, Congcong; Li, Ping; Wu, Yina; Wang, Chunxiao; Bond Lau, Wayne; Ma, Xin-Liang; Du, Jie

2017-05-23

Hypertensive ventricular remodeling is a common cause of heart failure. However, the molecular mechanisms regulating ventricular remodeling remain poorly understood. We used a discovery-driven/nonbiased approach to identify increased activating transcription factor 3 (ATF3) expression in hypertensive heart. We used loss/gain of function approaches to understand the role of ATF3 in heart failure. We also examined the mechanisms through transcriptome, chromatin immunoprecipitation sequencing analysis, and in vivo and in vitro experiments. ATF3 expression increased in murine hypertensive heart and human hypertrophic heart. Cardiac fibroblast cells are the primary cell type expressing high ATF3 levels in response to hypertensive stimuli. ATF3 knockout (ATF3KO) markedly exaggerated hypertensive ventricular remodeling, a state rescued by lentivirus-mediated/miRNA-aided cardiac fibroblast-selective ATF3 overexpression. Conversely, conditional cardiac fibroblast cell-specific ATF3 transgenic overexpression significantly ameliorated ventricular remodeling and heart failure. We identified Map2K3 as a novel ATF3 target. ATF3 binds with the Map2K3 promoter, recruiting HDAC1, resulting in Map2K3 gene-associated histone deacetylation, thereby inhibiting Map2K3 expression. Genetic Map2K3 knockdown rescued the profibrotic/hypertrophic phenotype in ATF3KO cells. Last, we demonstrated that p38 is the downstream molecule of Map2K3 mediating the profibrotic/hypertrophic effects in ATF3KO animals. Inhibition of p38 signaling reduced transforming growth factor-β signaling-related profibrotic and hypertrophic gene expression, and blocked exaggerated cardiac remodeling in ATF3KO cells. Our study provides the first evidence that ATF3 upregulation in cardiac fibroblasts in response to hypertensive stimuli protects the heart by suppressing Map2K3 expression and subsequent p38-transforming growth factor-β signaling. These results suggest that positive modulation of cardiac fibroblast ATF3 may represent a novel therapeutic approach against hypertensive cardiac remodeling. © 2017 American Heart Association, Inc.

Lunar and Planetary Science XXXV: Missions and Instruments: Hopes and Hope Fulfilled

NASA Technical Reports Server (NTRS)

2004-01-01

The titles in this section include: 1) Mars Global Surveyor Mars Orbiter Camera in the Extended Mission: The MOC Toolkit; 2) Mars Odyssey THEMIS-VIS Calibration; 3) Early Science Operations and Results from the ESA Mars Express Mission: Focus on Imaging and Spectral Mapping; 4) The Mars Express/NASA Project at JPL; 5) Beagle 2: Mission to Mars - Current Status; 6) The Beagle 2 Microscope; 7) Mars Environmental Chamber for Dynamic Dust Deposition and Statics Analysis; 8) Locating Targets for CRISM Based on Surface Morphology and Interpretation of THEMIS Data; 9) The Phoenix Mission to Mars; 10) First Studies of Possible Landing Sites for the Phoenix Mars Scout Mission Using the BMST; 11) The 2009 Mars Telecommunications Orbiter; 12) The Aurora Exploration Program - The ExoMars Mission; 13) Electron-induced Luminescence and X-Ray Spectrometer (ELXS) System Development; 14) Remote-Raman and Micro-Raman Studies of Solid CO2, CH4, Gas Hydrates and Ice; 15) The Compact Microimaging Spectrometer (CMIS): A New Tool for In-Situ Planetary Science; 16) Preliminary Results of a New Type of Surface Property Measurement Ideal for a Future Mars Rover Mission; 17) Electrodynamic Dust Shield for Solar Panels on Mars; 18) Sensor Web for Spatio-Temporal Monitoring of a Hydrological Environment; 19) Field Testing of an In-Situ Neutron Spectrometer for Planetary Exploration: First Results; 20) A Miniature Solid-State Spectrometer for Space Applications - Field Tests; 21) Application of Laser Induced Breakdown Spectroscopy (LIBS) to Mars Polar Exploration: LIBS Analysis of Water Ice and Water Ice/Soil Mixtures; 22) LIBS Analysis of Geological Samples at Low Pressures: Application to Mars, the Moon, and Asteroids; 23) In-Situ 1-D and 2-D Mapping of Soil Core and Rock Samples Using the LIBS Long Spark; 24) Rocks Analysis at Stand Off Distance by LIBS in Martian Conditions; 25) Evaluation of a Compact Spectrograph/Detection System for a LIBS Instrument for In-Situ and Stand-Off Detection; 26) Analysis of Organic Compounds in Mars Analog Samples; 27) Report of the Organic Contamination Science Steering Group; 28) The Water-Wheel IR (WIR) - A Contact Survey Experiment for Water and Carbonates on Mars; 29) Mid-IR Fiber Optic Probe for In Situ Water Detection and Characterization; 30) Effects of Subsurface Sampling & Processing on Martian Simulant Containing Varying Quantities of Water; 31) The Subsurface Ice Probe (SIPR): A Low-Power Thermal Probe for the Martian Polar Layered Deposits; 32) Deploying Ground Penetrating Radar in Planetary Analog Sites to Evaluate Potential Instrument Capabilities on Future Mars Missions; 33) Evaluation of Rock Powdering Methods to Obtain Fine-grained Samples for CHEMIN, a Combined XRD/XRF Instrument; 34) Novel Sample-handling Approach for XRD Analysis with Minimal Sample Preparation; 35) A New Celestial Navigation Method for Mars Landers; 36) Mars Mineral Spectroscopy Web Site: A Resource for Remote Planetary Spectroscopy.

Expression mapping using a retroviral vector for CD8+ T cell epitopes: definition of a Mycobacterium tuberculosis peptide presented by H2-Dd.

PubMed

Aoshi, Taiki; Suzuki, Mina; Uchijima, Masato; Nagata, Toshi; Koide, Yukio

2005-03-01

Identification of CD8+ T cell epitopes is important because detection of specific CD8+ T cells after infection or immunization requires prior knowledge of epitope specificity. Furthermore, identification of CD8+ T cell epitopes permits the development of specific preventive and therapeutic approaches to both infections and tumors. Thus far, CD8+ T cell epitopes have been identified either using an overlapping peptide library covering an entire protein, or using algorithms designed to identify likely peptides that bind to major histocompatibility complex (MHC) class I molecules. The synthesis of overlapping peptides can be prohibitively expensive, and the algorithm programs used to predict CD8+ T cell epitopes are not always accurate. Here we describe a retroviral expression system that specifically allows longer polypeptides and shorter peptides to be expressed in the cytoplasm, and thereby to be processed onto class I MHC molecules. T cells from mice that were immunized with a DNA vaccine encoding MPT-51 were probed against MHC-compatible cell lines retrovirally transduced with overlapping gene fragments encoding 120-140 amino acids of the MPT-51 molecule. After further testing of shorter peptide sequences, we identified a CD8+ T cell epitope using cell lines expressing a relatively small number of algorithm-predicted candidate epitopes. We found that one of the requirements for cell surface display of the 20-mer peptide was the need for cotranslational ubiquitination. The restriction molecule was identified as Dd following transduction with MHC class I genes followed by transduction with the oligonucleotide encoding the epitope. The retroviral expression system described here is cost-effective, particularly if the target molecule is large, and could be adapted to identifying T cell epitopes recognized in infectious disease and against tumor cell antigens.

Towards Direct Measurement of Ultrafast Vibrational Energy Flow in Proteins

NASA Astrophysics Data System (ADS)

Müller-Werkmeister, Henrike M.; Essig, Martin; Durkin, Patrick; Budisa, Nediljko; Bredenbeck, Jens

Vibrational energy transfer (VET) within a molecule can be investigated in great detail with ultrafast IR spectroscopy. We report on progress towards mapping of VET pathways in proteins using unnatural amino acids as site-specific probes.

Spatial reconstruction of single-cell gene expression data.

PubMed

Satija, Rahul; Farrell, Jeffrey A; Gennert, David; Schier, Alexander F; Regev, Aviv

2015-05-01

Spatial localization is a key determinant of cellular fate and behavior, but methods for spatially resolved, transcriptome-wide gene expression profiling across complex tissues are lacking. RNA staining methods assay only a small number of transcripts, whereas single-cell RNA-seq, which measures global gene expression, separates cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos and generated a transcriptome-wide map of spatial patterning. We confirmed Seurat's accuracy using several experimental approaches, then used the strategy to identify a set of archetypal expression patterns and spatial markers. Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems.

A quantum spin-probe molecular microscope

NASA Astrophysics Data System (ADS)

Perunicic, V. S.; Hill, C. D.; Hall, L. T.; Hollenberg, L. C. L.

2016-10-01

Imaging the atomic structure of a single biomolecule is an important challenge in the physical biosciences. Whilst existing techniques all rely on averaging over large ensembles of molecules, the single-molecule realm remains unsolved. Here we present a protocol for 3D magnetic resonance imaging of a single molecule using a quantum spin probe acting simultaneously as the magnetic resonance sensor and source of magnetic field gradient. Signals corresponding to specific regions of the molecule's nuclear spin density are encoded on the quantum state of the probe, which is used to produce a 3D image of the molecular structure. Quantum simulations of the protocol applied to the rapamycin molecule (C51H79NO13) show that the hydrogen and carbon substructure can be imaged at the angstrom level using current spin-probe technology. With prospects for scaling to large molecules and/or fast dynamic conformation mapping using spin labels, this method provides a realistic pathway for single-molecule microscopy.

Mapping Ionic Currents and Reactivity on the Nanoscale: Electrochemical Strain Microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalinin, S.V.

2010-10-19

Solid-state electrochemical processes in oxides underpin a broad spectrum of energy and information storage devices, ranging from Li-ion and Li-air batteries, to solid oxide fuel cells (SOFC) to electroresistive and memristive systems. These functionalities are controlled by the bias-driven diffusive and electromigration transport of mobile ionic species, as well as intricate a set of electrochemical and defect-controlled reactions at interfaces and in bulk. Despite the wealth of device-level and atomistic studies, little is known on the mesoscopic mechanisms of ion diffusion and electronic transport on the level of grain clusters, individual grains, and extended defects. The development of the capabilitymore » for probing ion transport on the nanometer scale is a key to deciphering complex interplay between structure, functionality, and performance in these systems. Here we introduce Electrochemical Strain Microscopy, a scanning probe microscopy technique based on strong strain-bias coupling in the systems in which local ion concentrations are changed by electrical fields. The imaging capability, as well as time- and voltage spectroscopies analogous to traditional current based electrochemical characterization methods are developed. The reversible intercalation of Li and mapping electrochemical activity in LiCoO2 is demonstrated, illustrating higher Li diffusivity at non-basal planes and grain boundaries. In Si-anode device structure, the direct mapping of Li diffusion at extended defects and evolution of Li-activity with charge state is explored. The electrical field-dependence of Li mobility is studied to determine the critical bias required for the onset of electrochemical transformation, allowing reaction and diffusion processes in the battery system to be separated at each location. Finally, the applicability of ESM for probing oxygen vacancy diffusion and oxygen reduction/evolution reactions is illustrated, and the high resolution ESM maps are correlated with aberration corrected scanning transmission electron microscopy imaging. The future potential for deciphering mechanisms of electrochemical transformations on an atomically-defined single-defect level is discussed.« less