Sample records for mapping insertions deletions

  1. Error Correcting Optical Mapping Data.

    PubMed

    Mukherjee, Kingshuk; Washimkar, Darshan; Muggli, Martin D; Salmela, Leena; Boucher, Christina

    2018-05-26

    Optical mapping is a unique system that is capable of producing high-resolution, high-throughput genomic map data that gives information about the structure of a genome [21]. Recently it has been used for scaffolding contigs and assembly validation for large-scale sequencing projects, including the maize [32], goat [6], and amborella [4] genomes. However, a major impediment in the use of this data is the variety and quantity of errors in the raw optical mapping data, which are called Rmaps. The challenges associated with using Rmap data are analogous to dealing with insertions and deletions in the alignment of long reads. Moreover, they are arguably harder to tackle since the data is numerical and susceptible to inaccuracy. We develop cOMET to error correct Rmap data, which to the best of our knowledge is the only optical mapping error correction method. Our experimental results demonstrate that cOMET has high prevision and corrects 82.49% of insertion errors and 77.38% of deletion errors in Rmap data generated from the E. coli K-12 reference genome. Out of the deletion errors corrected, 98.26% are true errors. Similarly, out of the insertion errors corrected, 82.19% are true errors. It also successfully scales to large genomes, improving the quality of 78% and 99% of the Rmaps in the plum and goat genomes, respectively. Lastly, we show the utility of error correction by demonstrating how it improves the assembly of Rmap data. Error corrected Rmap data results in an assembly that is more contiguous, and covers a larger fraction of the genome.

  2. Functional Studies and Homology Modeling of Msh2-Msh3 Predict that Mispair Recognition Involves DNA Bending and Strand Separation▿ †

    PubMed Central

    Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.

    2010-01-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420

  3. Functional studies and homology modeling of Msh2-Msh3 predict that mispair recognition involves DNA bending and strand separation.

    PubMed

    Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D

    2010-07-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.

  4. Mapping copy number variation by population-scale genome sequencing.

    PubMed

    Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

    2011-02-03

    Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

  5. Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

    PubMed

    Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

    1998-01-01

    Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

  6. Identification of genomic indels and structural variations using split reads

    PubMed Central

    2011-01-01

    Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

  7. A universal method for automated gene mapping

    PubMed Central

    Zipperlen, Peder; Nairz, Knud; Rimann, Ivo; Basler, Konrad; Hafen, Ernst; Hengartner, Michael; Hajnal, Alex

    2005-01-01

    Small insertions or deletions (InDels) constitute a ubiquituous class of sequence polymorphisms found in eukaryotic genomes. Here, we present an automated high-throughput genotyping method that relies on the detection of fragment-length polymorphisms (FLPs) caused by InDels. The protocol utilizes standard sequencers and genotyping software. We have established genome-wide FLP maps for both Caenorhabditis elegans and Drosophila melanogaster that facilitate genetic mapping with a minimum of manual input and at comparatively low cost. PMID:15693948

  8. Bovine Polledness – An Autosomal Dominant Trait with Allelic Heterogeneity

    PubMed Central

    Medugorac, Ivica; Seichter, Doris; Graf, Alexander; Russ, Ingolf; Blum, Helmut; Göpel, Karl Heinrich; Rothammer, Sophie; Förster, Martin; Krebs, Stefan

    2012-01-01

    The persistent horns are an important trait of speciation for the family Bovidae with complex morphogenesis taking place briefly after birth. The polledness is highly favourable in modern cattle breeding systems but serious animal welfare issues urge for a solution in the production of hornless cattle other than dehorning. Although the dominant inhibition of horn morphogenesis was discovered more than 70 years ago, and the causative mutation was mapped almost 20 years ago, its molecular nature remained unknown. Here, we report allelic heterogeneity of the POLLED locus. First, we mapped the POLLED locus to a ∼381-kb interval in a multi-breed case-control design. Targeted re-sequencing of an enlarged candidate interval (547 kb) in 16 sires with known POLLED genotype did not detect a common allele associated with polled status. In eight sires of Alpine and Scottish origin (four polled versus four horned), we identified a single candidate mutation, a complex 202 bp insertion-deletion event that showed perfect association to the polled phenotype in various European cattle breeds, except Holstein-Friesian. The analysis of the same candidate interval in eight Holsteins identified five candidate variants which segregate as a 260 kb haplotype also perfectly associated with the POLLED gene without recombination or interference with the 202 bp insertion-deletion. We further identified bulls which are progeny tested as homozygous polled but bearing both, 202 bp insertion-deletion and Friesian haplotype. The distribution of genotypes of the two putative POLLED alleles in large semi-random sample (1,261 animals) supports the hypothesis of two independent mutations. PMID:22737241

  9. Identification of three critical regions within mouse interleukin 2 by fine structural deletion analysis.

    PubMed Central

    Zurawski, S M; Zurawski, G

    1988-01-01

    We have analyzed structure--function relationships of the protein hormone murine interleukin 2 by fine structural deletion mapping. A total of 130 deletion mutant proteins, together with some substitution and insertion mutant proteins, was expressed in Escherichia coli and analyzed for their ability to sustain the proliferation of a cloned murine T cell line. This analysis has permitted a functional map of the protein to be drawn and classifies five segments of the protein, which together contain 48% of the sequence, as unessential to the biological activity of the protein. A further 26% of the protein is classified as important, but not crucial, for the activity. Three regions, consisting of amino acids 32-35, 66-77 and 119-141 contain the remaining 26% of the protein and are critical to the biological activity of the protein. The functional map is discussed in the context of the possible role of the identified critical regions in the structure of the hormone and its binding to the interleukin 2 receptor complex. Images PMID:3261239

  10. Evidence That Intergenic Spacer Repeats of Drosophila Melanogaster Rrna Genes Function as X-Y Pairing Sites in Male Meiosis, and a General Model for Achiasmatic Pairing

    PubMed Central

    McKee, B. D.; Habera, L.; Vrana, J. A.

    1992-01-01

    In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825

  11. Molecular Mapping of the ROSY Locus in DROSOPHILA MELANOGASTER

    PubMed Central

    Coté, Babette; Bender, Welcome; Curtis, Daniel; Chovnick, Arthur

    1986-01-01

    The DNA from the chromosomal region of the Drosophila rosy locus has been examined in 83 rosy mutant strains. Several spontaneous and radiation-induced alleles were associated with insertions and deletions, respectively. The lesions are clustered in a 4-kb region. Some of the alleles identified on the DNA map have been located on the genetic map by fine-structure recombination experiments. The genetic and molecular maps are collinear, and the alignment identifies the DNA location of the rosy control region. A rosy RNA of 4.5 kb has been identified; its 5' end lies in or near the control region. PMID:2420682

  12. A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2010-12-01

    We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. SfiI genomic cleavage map of Escherichia coli K-12 strain MG1655.

    PubMed Central

    Perkins, J D; Heath, J D; Sharma, B R; Weinstock, G M

    1992-01-01

    An SfiI restriction map of Escherichia coli K-12 strain MG1655 is presented. The map contains thirty-one cleavage sites separating fragments ranging in size from 407 kb to 3.7 kb. Several techniques were used in the construction of this map, including CHEF pulsed field gel electrophoresis; physical analysis of a set of twenty-six auxotrophic transposon insertions; correlation with the restriction map of Kohara and coworkers using the commercially available E. coli Gene Mapping Membranes; analysis of publicly available sequence information; and correlation of the above data with the combined genetic and physical map developed by Rudd, et al. The combination of these techniques has yielded a map in which all but one site can be localized within a range of +/- 2 kb, and over half the sites can be localized precisely by sequence data. Two sites present in the EcoSeq5 sequence database are not cleaved in MG1655 and four sites are noted to be sensitive to methylation by the dcm methylase. This map, combined with the NotI physical map of MG1655, can aid in the rapid, precise mapping of several different types of genetic alterations, including transposon mediated mutations and other insertions, inversions, deletions and duplications. Images PMID:1312707

  14. Using in situ hybridization and PFGE Southern hybridization to detect translocation breakpoints in a BOR/TRPS patient cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gu, J.Z.; Sapru, M.; Smith, D.

    Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder characterized by ear malformations, cervical fistulae, hearing loss and renal abnormalities. We have integrated the Genethon YAC contig maps with additional markers in the chromosome 8q region genetically linked by a unique patient cell line. This cell line is from a patient who has both the branchio-oto-renal syndrome and tricho-rhino-phalangeal syndrome (TRPS). High resolution cytogenetics demonstrated a direct insertion of materials from 8q13.3q21.13 to 8q24.11. TRPS has been previously linked to deletions involving 8q24.11-q24.13. The rearrangement in this patient suggests that TRPS results from loss of gene function due to insertion atmore » the 8q24.11 breakpoint and the possible location for the BOR gene is at either of the two breakpoints of 8q13.3 and 8q21.13. We have constructed cosmid contigs in 8q24.11. In situ hybridization with cosmids mapped to these locations as probes has helped to narrow down the breakpoints. Combinations of cosmids on either side or overlapping the 8q24.11 breakpoint show split signals on one chromosome 8q arm due to insertion of the materials from the proximal region. Cosmids mapped to the TRPS deletion region have been used to hybridize to pulsed field gel genomic blots of DNA from the patient cell line and detected rearranged genomic fragments. Both in situ hybridization and genomic PFGE Southern blot will be used to precisely locate the breakpoints.« less

  15. Detection limit of intragenic deletions with targeted array comparative genomic hybridization

    PubMed Central

    2013-01-01

    Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607

  16. Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

    PubMed Central

    Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

    2015-01-01

    ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

  17. Genome-Wide Estimates of Transposable Element Insertion and Deletion Rates in Drosophila Melanogaster

    PubMed Central

    Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.

    2017-01-01

    Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986

  18. Sorting genomes by reciprocal translocations, insertions, and deletions.

    PubMed

    Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

    2010-01-01

    The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

  19. Developing new mathematical method for search of the time series periodicity with deletions and insertions

    NASA Astrophysics Data System (ADS)

    Korotkov, E. V.; Korotkova, M. A.

    2017-01-01

    The purpose of this study was to detect latent periodicity in the presence of deletions or insertions in the analyzed data, when the points of deletions or insertions are unknown. A mathematical method was developed to search for periodicity in the numerical series, using dynamic programming and random matrices. The developed method was applied to search for periodicity in the Euro/Dollar (Eu/) exchange rate, since 2001. The presence of periodicity within the period length equal to 24 h in the analyzed financial series was shown. Periodicity can be detected only with insertions and deletions. The results of this study show that periodicity phase shifts, depend on the observation time. The reasons for the existence of the periodicity in the financial ranks are discussed.

  20. Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

    PubMed Central

    Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

    2016-01-01

    Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

  1. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    2001-01-01

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

  2. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  3. Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

    PubMed Central

    Letsou, Anthea; Liskay, R. Michael

    1987-01-01

    With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

  4. Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

    PubMed Central

    Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

    1986-01-01

    Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

  5. Using the Neandertal genome to study the evolution of small insertions and deletions in modern humans.

    PubMed

    Chintalapati, Manjusha; Dannemann, Michael; Prüfer, Kay

    2017-08-04

    Small insertions and deletions occur in humans at a lower rate compared to nucleotide changes, but evolve under more constraint than nucleotide changes. While the evolution of insertions and deletions have been investigated using ape outgroups, the now available genome of a Neandertal can shed light on the evolution of indels in more recent times. We used the Neandertal genome together with several primate outgroup genomes to differentiate between human insertion/deletion changes that likely occurred before the split from Neandertals and those that likely arose later. Changes that pre-date the split from Neandertals show a smaller proportion of deletions than those that occurred later. The presence of a Neandertal-shared allele in Europeans or Asians but the absence in Africans was used to detect putatively introgressed indels in Europeans and Asians. A larger proportion of these variants reside in intergenic regions compared to other modern human variants, and some variants are linked to SNPs that have been associated with traits in modern humans. Our results are in agreement with earlier results that suggested that deletions evolve under more constraint than insertions. When considering Neandertal introgressed variants, we find some evidence that negative selection affected these variants more than other variants segregating in modern humans. Among introgressed variants we also identify indels that may influence the phenotype of their carriers. In particular an introgressed deletion associated with a decrease in the time to menarche may constitute an example of a former Neandertal-specific trait contributing to modern human phenotypic diversity.

  6. Detection of a megabase deletion in a patient with brachio-oto-renal syndrome (BOR) and tricho-rhino-phalangeal syndrome (TRPS): Implications for mapping and cloning the BOR gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gu, J.Z.; Wells, D.E.; Wagner, M.J.

    Genetic linkage analysis has previously mapped the locus for the autosomal dominant disorder branchio-oto-renal syndrome (BOR) to the pericentric region of chromosome 8q. A YAC contig spanning the putative BOR region, from D8S543 to D8S541, was constructed and confirmed by sequence-tagged site content mapping using microsatellite markers and by DNA hybridization analysis. YACs spanning the BOR interval were used as fluorescence in situ hybridization probes on a cell line from a patient with BO and tricho-rhino-phalangeal syndrome I that involves a chromosome 8q rearrangement. In addition to the cytogenetically defined direct insertion of material from 8q13.3-q21.13 into 8q24.11, a previouslymore » unidentified deletion of just under one megabase was found in 8q13.3. These data narrowed the most likely location of the BOR gene to a region corresponding to the proximal two-thirds of YAC 869E10 between D8S543 and D8S279. 23 refs., 3 figs.« less

  7. A familial {open_quotes}balanced{close_quotes} 3;9 translocation with cryptic 8q insertion leading to deletion and duplication of 9p23 loci in siblings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagstaff, J.; Hemann, M.

    1995-01-01

    A child with phenotypic features of the 9p{sup {minus}} syndrome, including metopic craniosynostosis, small ears, abdominal wall defect, and mental retardation, as well as hypopigmentation, was found to have a cytogenetically balanced 3;9 translocation, with breakpoints at 3p11 and 9p23, inherited from his phenotypically normal father. Molecular analysis showed heterozygous deletion of the TYRP (tyrosinase-related protein) locus, as well as loci D9S157, D9S274, D9S268, and D9S267, in the child but in neither parent. FISH analysis of the proband`s father indicated that loci deleted in his son, including TYRP, were present on neither the der(3) nor the der(9) translocation products butmore » had been inserted into the long arm of chromosome 8. Therefore, the apparent deletion of these loci in the proband was the result of meiotic segregation of the father`s 3;9 translocation chromosomes together with his normal chromosome 8 (not bearing the insertion from 9p23). Neither the deletion of these 9p23 loci from the translocation chromosomes nor their insertion into 8q was detectable by standard chromosome banding techniques. The proband`s sister exhibited speech delay, mild facial dysmorphism, and renal malformation, and her karyotype was 46,XX. Molecular analysis showed that she had inherited normal chromosomes 3 and 9, as well as the chromosome 8 with the insertion of 9p23 material, from her father. This analysis illustrates a new mechanism to explain cases in which an apparently balanced translocation has been transmitted from a normal parent to a child with a phenotypic abnormality: submicroscopic deletion of material from the translocation breakpoint and insertion into a third chromosome in the balanced parent, with meiotic segregation leading to loss of the inserted material in the child. 36 refs., 9 figs., 1 tab.« less

  8. Mass-flow-rate-controlled fluid flow in nanochannels by particle insertion and deletion.

    PubMed

    Barclay, Paul L; Lukes, Jennifer R

    2016-12-01

    A nonequilibrium molecular dynamics method to induce fluid flow in nanochannels, the insertion-deletion method (IDM), is introduced. IDM inserts and deletes particles within distinct regions in the domain, creating locally high and low pressures. The benefits of IDM are that it directly controls a physically meaningful quantity, the mass flow rate, allows for pressure and density gradients to develop in the direction of flow, and permits treatment of complex aperiodic geometries. Validation of IDM is performed, yielding good agreement with the analytical solution of Poiseuille flow in a planar channel. Comparison of IDM to existing methods indicates that it is best suited for gases, both because it intrinsically accounts for compressibility effects on the flow and because the computational cost of particle insertion is lowest for low-density fluids.

  9. [Distribution of a deletion-insertion polymorphism in intergenic region V of mitochondrial DNA among the aboriginal population of Tuva].

    PubMed

    Golubenko, M V; Puzyrev, V P; Saliukov, V B; Kucher, A N; Sanchat, N O

    2000-03-01

    Mitochondrial DNA region V deletion-insertion polymorphism was examined in three Tuvinian populations inhabiting western, northeastern, and southeastern parts of the republic. The 9-bp deletion was characterized by nonrandom distribution across the Tuva territory: its frequency in the western population (13.37%) was statistically significantly higher than that in the northeastern (4.62%), and southeastern populations, as well as in Mongols, who are territorially and ethnically close to Tuvinians. The insertion mutation in the region V was detected with a frequency of about 3% in two out of the three populations tested.

  10. Improved adjoin-list for quality-guided phase unwrapping based on red-black trees

    NASA Astrophysics Data System (ADS)

    Cruz-Santos, William; López-García, Lourdes; Rueda-Paz, Juvenal; Redondo-Galvan, Arturo

    2016-08-01

    The quality-guide phase unwrapping is an important technique that is based on quality maps which guide the unwrapping process. The efficiency of this technique depends in the adjoin-list data structure implementation. There exists several proposals that improve the adjoin-list; Ming Zhao et. al. proposed an Indexed Interwoven Linked List (I2L2) that is based on dividing the quality values into intervals of equal size and inserting in a linked list those pixels with quality values within a certain interval. Ming Zhao and Qian Kemao proposed an improved I2L2 replacing each linked list in each interval by a heap data structure, which allows efficient procedures for insertion and deletion. In this paper, we propose an improved I2L2 which uses Red-Black trees (RBT) data structures for each interval. Our proposal has as main goal to avoid the unbalanced properties of the head and thus, reducing the time complexity of insertion. In order to maintain the same efficiency of the heap when deleting an element, we provide an efficient way to remove the pixel with the highest quality value in the RBT using a pointer to the rightmost element in the tree. We also provide a new partition strategy of the phase values that is based on a density criterion. Experimental results applied to phase shifting profilometry are shown for large images.

  11. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

    PubMed Central

    Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

    2016-01-01

    Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

  12. MOSAIK: a hash-based algorithm for accurate next-generation sequencing short-read mapping.

    PubMed

    Lee, Wan-Ping; Stromberg, Michael P; Ward, Alistair; Stewart, Chip; Garrison, Erik P; Marth, Gabor T

    2014-01-01

    MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me).

  13. MOSAIK: A Hash-Based Algorithm for Accurate Next-Generation Sequencing Short-Read Mapping

    PubMed Central

    Lee, Wan-Ping; Stromberg, Michael P.; Ward, Alistair; Stewart, Chip; Garrison, Erik P.; Marth, Gabor T.

    2014-01-01

    MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me). PMID:24599324

  14. Altools: a user friendly NGS data analyser.

    PubMed

    Camiolo, Salvatore; Sablok, Gaurav; Porceddu, Andrea

    2016-02-17

    Genotyping by re-sequencing has become a standard approach to estimate single nucleotide polymorphism (SNP) diversity, haplotype structure and the biodiversity and has been defined as an efficient approach to address geographical population genomics of several model species. To access core SNPs and insertion/deletion polymorphisms (indels), and to infer the phyletic patterns of speciation, most such approaches map short reads to the reference genome. Variant calling is important to establish patterns of genome-wide association studies (GWAS) for quantitative trait loci (QTLs), and to determine the population and haplotype structure based on SNPs, thus allowing content-dependent trait and evolutionary analysis. Several tools have been developed to investigate such polymorphisms as well as more complex genomic rearrangements such as copy number variations, presence/absence variations and large deletions. The programs available for this purpose have different strengths (e.g. accuracy, sensitivity and specificity) and weaknesses (e.g. low computation speed, complex installation procedure and absence of a user-friendly interface). Here we introduce Altools, a software package that is easy to install and use, which allows the precise detection of polymorphisms and structural variations. Altools uses the BWA/SAMtools/VarScan pipeline to call SNPs and indels, and the dnaCopy algorithm to achieve genome segmentation according to local coverage differences in order to identify copy number variations. It also uses insert size information from the alignment of paired-end reads and detects potential large deletions. A double mapping approach (BWA/BLASTn) identifies precise breakpoints while ensuring rapid elaboration. Finally, Altools implements several processes that yield deeper insight into the genes affected by the detected polymorphisms. Altools was used to analyse both simulated and real next-generation sequencing (NGS) data and performed satisfactorily in terms of positive predictive values, sensitivity, the identification of large deletion breakpoints and copy number detection. Altools is fast, reliable and easy to use for the mining of NGS data. The software package also attempts to link identified polymorphisms and structural variants to their biological functions thus providing more valuable information than similar tools.

  15. Intrachromosomal 3p insertion as a cause of reciprocal pure interstitial deletion and duplication in two siblings: further delineation of the emerging proximal 3p deletion syndrome.

    PubMed

    Lloveras, Elisabet; Vendrell, Teresa; Fernández, Asunción; Castells, Neus; Cueto, Ana; del Campo, Miguel; Hernando, Cristina; Villa, Olaya; Plaja, Alberto

    2014-01-01

    Very few cases of constitutional interstitial deletions of the proximal short arm of chromosome 3 have been reported; however, the proximal 3p deletion is emerging as a clinically recognizable syndrome. We present an intrachromosomal insertion of 3p12.3p14.1 in a phenotypic normal man (46,XY,ins(3)(p25p12.3p14.1)) which is responsible for the unbalanced karyotype in 2 affected offspring, one with a 3p12.3p14.1 interstitial deletion and the other with a reciprocal duplication. The exceptionality of these 2 reciprocal recombinants contributes to a better definition of the proximal 3p deletion syndrome and its duplication counterpart.

  16. The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

    PubMed Central

    Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

    2003-01-01

    A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

  17. The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

    PubMed

    Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

    2003-08-01

    A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

  18. Training alignment parameters for arbitrary sequencers with LAST-TRAIN.

    PubMed

    Hamada, Michiaki; Ono, Yukiteru; Asai, Kiyoshi; Frith, Martin C

    2017-03-15

    LAST-TRAIN improves sequence alignment accuracy by inferring substitution and gap scores that fit the frequencies of substitutions, insertions, and deletions in a given dataset. We have applied it to mapping DNA reads from IonTorrent and PacBio RS, and we show that it reduces reference bias for Oxford Nanopore reads. the source code is freely available at http://last.cbrc.jp/. mhamada@waseda.jp or mcfrith@edu.k.u-tokyo.ac.jp. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  19. A familial {open_quotes}balanced{close_quotes} 3;9 translocation with cryptic 8q insertion leading to deletion and duplication of 9p23 loci in siblings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagstaff, J.; Hemann, M.

    1994-09-01

    Families in which a balanced translocation has been transmitted from a normal parent to a child with a phenotypic abnormality have been a longstanding puzzle for human geneticists. A child with phenotypic features of the 9p- syndrome, including metopic craniosynostosis, small ears, abdominal wall defect, and mental retardation, was found to have a cytogenetically balanced 3;9 translocation, with breakpoints at 3p11 and 9p23, inherited from his normal father. He also exhibited marked hypopigmentation of hair and skin. Analysis with a cDNA probe from the TYRP1 (tyrosinase-related protein 1) gene in 9p23 showed heterozygous deletion in the child but in neithermore » parent. This submicroscopic deletion also included loci D9S157, D9S274, D9S268, and D9S267. FISH analysis of the proband`s father indicated the 9p23 loci deleted in his son were present on neither the der(3) nor the der(9) translocation product, but had been inserted into the long arm of chromosome 8. Therefore, the apparent deletion of these loci in the proband was the result of meiotic segregation of the father`s 3;9 translocation chromosomes together with his normal chromosome 8. Neither the deletion from the translocation chromosomes nor the insertion into 8q was detectable by standard chromosome banding techniques. The proband`s sister exhibited speech delay, mild facial dysmorphism, and renal malformation, and her karyotype was 46,XX. Molecular analysis of this sister showed 3 copies of 9p23 sequences, indicating that she had inherited normal chromosomes 3 and 9 from her father as well as the chromosome 8 with the insertion from 9p23. This analysis illustrates a new mechanism to explain cases of phenotypic discordance in familial balanced translocations: submicroscopic deletion of material from the translocation breakpoint and insertion into a third chromosome in the balanced parent, with meiotic segregation leading to loss of the inserted material in the child.« less

  20. Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

    PubMed Central

    Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

    2014-01-01

    The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

  1. Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

    PubMed

    Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

    2013-02-01

    To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

  2. Mapping of herpes simplex virus-1 neurovirulence to. gamma. sub 1 34. 5, a gene nonessential for growth in culture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, J.; Roizman, B.; Kern, E.R.

    1990-11-30

    The gene designated {gamma}{sub 1}34.5 maps in the inverted repeats flanking the long unique sequence of herpes simplex virus-1 (HSV-1) DNA, and therefore it is present in two copies per genome. This gene is not essential for viral growth in cell culture. Four recombinant viruses were genetically engineered to test the function of this gene. These were (i) a virus from which both copies of the gene were deleted, (ii) a virus containing a stop codon in both copies of the gene, (iii) a virus containing after the first codon an insert encoding a 16-amino acid epitope known to reactmore » with a specific monoclonal antibody, and (iv) a virus in which the deleted sequences were restored. The viruses from which the gene was deleted or which carried stop codons were avirulent on intracerebral inoculation of mice. The virus with the gene tagged by the sequence encoding the epitope was moderately virulent, whereas the restored virus reacquired the phenotype of the parent virus. Significant amounts of virus were recovered only from brains of animals inoculated with virulent viruses. Inasmuch as the product of the {gamma}{sub 1}34.5 gene extended the host range of the virus by enabling it to replicate and destroy brain cells, it is a viral neurovirulence factor.« less

  3. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solera, J.; Magallon, M.; Martin-Villar, J.

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

  4. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

    PubMed Central

    Traverse, Charles C.

    2017-01-01

    ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

  5. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

    PubMed

    Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

    2014-08-01

    The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

  7. An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

    PubMed

    Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

    2016-01-15

    Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Using Crowdsourced Trajectories for Automated OSM Data Entry Approach

    PubMed Central

    Basiri, Anahid; Amirian, Pouria; Mooney, Peter

    2016-01-01

    The concept of crowdsourcing is nowadays extensively used to refer to the collection of data and the generation of information by large groups of users/contributors. OpenStreetMap (OSM) is a very successful example of a crowd-sourced geospatial data project. Unfortunately, it is often the case that OSM contributor inputs (including geometry and attribute data inserts, deletions and updates) have been found to be inaccurate, incomplete, inconsistent or vague. This is due to several reasons which include: (1) many contributors with little experience or training in mapping and Geographic Information Systems (GIS); (2) not enough contributors familiar with the areas being mapped; (3) contributors having different interpretations of the attributes (tags) for specific features; (4) different levels of enthusiasm between mappers resulting in different number of tags for similar features and (5) the user-friendliness of the online user-interface where the underlying map can be viewed and edited. This paper suggests an automatic mechanism, which uses raw spatial data (trajectories of movements contributed by contributors to OSM) to minimise the uncertainty and impact of the above-mentioned issues. This approach takes the raw trajectory datasets as input and analyses them using data mining techniques. In addition, we extract some patterns and rules about the geometry and attributes of the recognised features for the purpose of insertion or editing of features in the OSM database. The underlying idea is that certain characteristics of user trajectories are directly linked to the geometry and the attributes of geographic features. Using these rules successfully results in the generation of new features with higher spatial quality which are subsequently automatically inserted into the OSM database. PMID:27649192

  9. Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites

    PubMed Central

    Pinto, Filipe; Pacheco, Catarina C.; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C.; Urchueguía, Javier F.; Tamagnini, Paula

    2015-01-01

    The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. PMID:26490728

  10. A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

    PubMed

    Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

    2011-07-01

    A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  11. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

    PubMed

    Traverse, Charles C; Ochman, Howard

    2017-08-29

    Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

  12. Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

    PubMed

    Negi, Vir S; Devaraju, Panneer; Gulati, Reena

    2015-09-01

    SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.

  13. VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

  14. Mispair-specific Recruitment of the Mlh1-Pms1 Complex Identifies Repair Substrates of the Saccharomyces cerevisiae Msh2-Msh3 Complex*

    PubMed Central

    Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D.

    2014-01-01

    DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions. PMID:24550389

  15. Mispair-specific recruitment of the Mlh1-Pms1 complex identifies repair substrates of the Saccharomyces cerevisiae Msh2-Msh3 complex.

    PubMed

    Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D

    2014-03-28

    DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions.

  16. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    PubMed

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  17. X-Linked Congenital Hypertrichosis Syndrome Is Associated with Interchromosomal Insertions Mediated by a Human-Specific Palindrome near SOX3

    PubMed Central

    Zhu, Hongwen; Shang, Dandan; Sun, Miao; Choi, Sunju; Liu, Qing; Hao, Jiajie; Figuera, Luis E.; Zhang, Feng; Choy, Kwong Wai; Ao, Yang; Liu, Yang; Zhang, Xiao-Lin; Yue, Fengzhen; Wang, Ming-Rong; Jin, Li; Patel, Pragna I.; Jing, Tao; Zhang, Xue

    2011-01-01

    X-linked congenital generalized hypertrichosis (CGH), an extremely rare condition characterized by universal overgrowth of terminal hair, was first mapped to chromosome Xq24-q27.1 in a Mexican family. However, the underlying genetic defect remains unknown. We ascertained a large Chinese family with an X-linked congenital hypertrichosis syndrome combining CGH, scoliosis, and spina bifida and mapped the disease locus to a 5.6 Mb critical region within the interval defined by the previously reported Mexican family. Through the combination of a high-resolution copy-number variation (CNV) scan and targeted genomic sequencing, we identified an interchromosomal insertion at Xq27.1 of a 125,577 bp intragenic fragment of COL23A1 on 5q35.3, with one X breakpoint within and the other very close to a human-specific short palindromic sequence located 82 kb downstream of SOX3. In the Mexican family, we found an interchromosomal insertion at the same Xq27.1 site of a 300,036 bp genomic fragment on 4q31.2, encompassing PRMT10 and TMEM184C and involving parts of ARHGAP10 and EDNRA. Notably, both of the two X breakpoints were within the short palindrome. The two palindrome-mediated insertions fully segregate with the CGH phenotype in each of the families, and the CNV gains of the respective autosomal genomic segments are not present in the public database and were not found in 1274 control individuals. Analysis of control individuals revealed deletions ranging from 173 bp to 9104 bp at the site of the insertions with no phenotypic consequence. Taken together, our results strongly support the pathogenicity of the identified insertions and establish X-linked congenital hypertrichosis syndrome as a genomic disorder. PMID:21636067

  18. Characterizing complex structural variation in germline and somatic genomes

    PubMed Central

    Quinlan, Aaron R.; Hall, Ira M.

    2011-01-01

    Genome structural variation (SV) is a major source of genetic diversity in mammals and a hallmark of cancer. While SV is typically defined by its canonical forms – duplication, deletion, insertion, inversion and translocation – recent breakpoint mapping studies have revealed a surprising number of “complex” variants that evade simple classification. Complex SVs are defined by clustered breakpoints that arose through a single mutation but cannot be explained by one simple end-joining or recombination event. Some complex variants exhibit profoundly complicated rearrangements between distinct loci from multiple chromosomes, while others involve more subtle alterations at a single locus. These diverse and unpredictable features present a challenge for SV mapping experiments. Here, we review current knowledge of complex SV in mammals, and outline techniques for identifying and characterizing complex variants using next-generation DNA sequencing. PMID:22094265

  19. A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

    PubMed

    Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

    2009-04-01

    Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

  20. Allelic imbalance modulates surface expression of the tolerance-inducing HLA-G molecule on primary trophoblast cells.

    PubMed

    Djurisic, S; Teiblum, S; Tolstrup, C K; Christiansen, O B; Hviid, T V F

    2015-03-01

    The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complications, partly explained by HLA-G polymorphisms which are associated with differences in the alternative splicing pattern and of the stability of HLA-G mRNA. Of special importance is a 14 bp insertion/deletion polymorphism located in the 3'-untranslated region of the HLA-G gene. In the current study, we present novel evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, using a very accurate and sensitive Digital droplet PCR technique. Allelic imbalance in heterozygous samples was observed as differential expression levels of 14 bp insertion/deletion allele-specific mRNA transcripts, which was further associated with low levels of HLA-G surface expression on primary trophoblast cells. Full gene sequencing of HLA-G allowed us to study correlations between HLA-G extended haplotypes and single-nucleotide polymorphisms and HLA-G surface expression. We found that a 1:1 expression (allelic balance) of the 14 bp insertion/deletion mRNA alleles was associated with high surface expression of HLA-G and with a specific HLA-G extended haplotype. The 14 bp del/del genotype was associated with a significantly lower abundance of the G1 mRNA isoform, and a higher abundance of the G3 mRNA isoform. Overall, the present study provides original evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, which influences HLA-G surface expression on primary trophoblast cells, considered to be important in the pathogenesis of pre-eclampsia and other pregnancy complications. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites.

    PubMed

    Pinto, Filipe; Pacheco, Catarina C; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C; Urchueguía, Javier F; Tamagnini, Paula

    2015-12-01

    The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  2. Partial trisomy 2p and partial monosomy 2q arising from a paternal intrachromosomal 2q-into-2p between-arm insertion and paracentric inversion: molecular cytogenetic characterization of a four-break rearrangement.

    PubMed

    Manolakos, E; Vetro, A; Papadopoulou, E; Kefalas, K; Lagou, M; Thomaidis, L; Peitsidis, P; Sifakis, S; Divane, A; Ziegler, M; Liehr, T; Zuffardi, O; Papoulidis, I

    2013-01-01

    We report on a 26-month-old boy with an interstitial duplication of 2p22.3p22.2 and an interstitial deletion of 2q14.1q21.2. The abnormality was derived from his father having a balanced paracentric inversion and pericentric insertion. The deletion in the child was identified by cytogenetic analysis and characterized in more detail by molecular cytogenetics and array comparative genomic hybridization. The latter revealed a 20-Mb deletion in the long arm and a 5.6-Mb duplication in the short arm of chromosome 2. Fluorescence in situ hybridization in paternal chromosomes characterized an intrachromosomal insertion of 2q14.1q21.2 into 2p23; additionally a paracentric inversion of 2p13p23 was observed. The boy with the unbalanced karyotype suffered from severe psychomotor retardation, thrombophilia due to protein C deficiency, and hypertrophic cardiomyopathy and also had phenotypic abnormalities. Most of these features have previously been described in individuals with interstitial deletion of 2q14.1. Copyright © 2013 S. Karger AG, Basel.

  3. An Extension to the Multilevel Logic Simulator for Microcomputers.

    DTIC Science & Technology

    1987-06-01

    gates .............................. 61 3. Add or delete inputs ............................... 61 4. Add or delete outputs...the gates affected by the deletion. 61 4. Add or delete outputs The only modification that will be done in the circuit is the insertion (deletion) of...recompilation of the circuit. P 105 -Z -- % % 9,m "N , " " " " " ’ ’-"" " " " " " " " - -" , " " -- -" - .’ TABLE 25 THE DELINP CASE FOR THE ALU CIRCUIT JI

  4. The evolution of small insertions and deletions in the coding genes of Drosophila melanogaster.

    PubMed

    Chong, Zechen; Zhai, Weiwei; Li, Chunyan; Gao, Min; Gong, Qiang; Ruan, Jue; Li, Juan; Jiang, Lan; Lv, Xuemei; Hungate, Eric; Wu, Chung-I

    2013-12-01

    Studies of protein evolution have focused on amino acid substitutions with much less systematic analysis on insertion and deletions (indels) in protein coding genes. We hence surveyed 7,500 genes between Drosophila melanogaster and D. simulans, using D. yakuba as an outgroup for this purpose. The evolutionary rate of coding indels is indeed low, at only 3% of that of nonsynonymous substitutions. As coding indels follow a geometric distribution in size and tend to fall in low-complexity regions of proteins, it is unclear whether selection or mutation underlies this low rate. To resolve the issue, we collected genomic sequences from an isogenic African line of D. melanogaster (ZS30) at a high coverage of 70× and analyzed indel polymorphism between ZS30 and the reference genome. In comparing polymorphism and divergence, we found that the divergence to polymorphism ratio (i.e., fixation index) for smaller indels (size ≤ 10 bp) is very similar to that for synonymous changes, suggesting that most of the within-species polymorphism and between-species divergence for indels are selectively neutral. Interestingly, deletions of larger sizes (size ≥ 11 bp and ≤ 30 bp) have a much higher fixation index than synonymous mutations and 44.4% of fixed middle-sized deletions are estimated to be adaptive. To our surprise, this pattern is not found for insertions. Protein indel evolution appear to be in a dynamic flux of neutrally driven expansion (insertions) together with adaptive-driven contraction (deletions), and these observations provide important insights for understanding the fitness of new mutations as well as the evolutionary driving forces for genomic evolution in Drosophila species.

  5. Hepatitis B Virus Core Gene Mutations Which Block Nucleocapsid Envelopment

    PubMed Central

    Koschel, Matthias; Oed, Daniela; Gerelsaikhan, Tudevdagwa; Thomssen, Reiner; Bruss, Volker

    2000-01-01

    Recently we generated a panel of hepatitis B virus core gene mutants carrying single insertions or deletions which allowed efficient expression of the core protein in bacteria and self-assembly of capsids. Eleven of these mutations were introduced into a eukaryotic core gene expression vector and characterized by trans complementation of a core-negative HBV genome in cotransfected human hepatoma HuH7 cells. Surprisingly, four mutants (two insertions [EFGA downstream of A11 and LDTASALYR downstream of R39] and two deletions [Y38-R39-E40 and L42]) produced no detectable capsids. The other seven mutants supported capsid formation and pregenome packaging/viral minus- and plus-strand-DNA synthesis but to different levels. Four of these seven mutants (two insertions [GA downstream of A11 and EHCSP downstream of P50] and two deletions [S44 and A80]) allowed virion morphogenesis and secretion. The mutant carrying a deletion of A80 at the tip of the spike protruding from the capsid was hepatitis B virus core antigen negative but wild type with respect to virion formation, indicating that this site might not be crucial for capsid-surface protein interactions during morphogenesis. The other three nucleocapsid-forming mutants (one insertion [LS downstream of S141] and two deletions [T12 and P134]) were strongly blocked in virion formation. The corresponding sites are located in the part of the protein forming the body of the capsid and not in the spike. These mutations may alter sites on the particle which contact surface proteins during envelopment, or they may block the appearance of a signal for the transport or the maturation of the capsid which is linked to viral DNA synthesis and required for envelopment. PMID:10590084

  6. Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

    PubMed Central

    Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

    1995-01-01

    Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

  7. A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

    PubMed

    Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

    2000-01-01

    Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

  8. Doping test results dependent on genotype of uridine diphospho-glucuronosyl transferase 2B17, the major enzyme for testosterone glucuronidation.

    PubMed

    Schulze, Jenny Jakobsson; Lundmark, Jonas; Garle, Mats; Skilving, Ilona; Ekström, Lena; Rane, Anders

    2008-07-01

    Testosterone abuse is conventionally assessed by the urinary testosterone/epitestosterone (T/E) ratio, levels above 4.0 being considered suspicious. The large variation in testosterone glucuronide (TG) excretion and its strong association with a deletion polymorphism in the uridine diphospho-glucuronosyl transferase (UGT) 2B17 gene challenge the accuracy of the T/E ratio test. Our objective was to investigate whether genotype-based cutoff values will improve the sensitivity and specificity of the test. This was an open three-armed comparative study. A total of 55 healthy male volunteers with either two, one, or no allele [insertion/insertion, insertion/deletion, or deletion/deletion (del/del)] of the UGT2B17 gene was included in the study. A single im dose of 500 mg testosterone enanthate was administered. Urinary excretion of TG after dose and the T/E ratio during 15 d were calculated. The degree and rate of increase in the TG excretion rate were highly dependent on the UGT2B17 genotype with a 20-fold higher average maximum increase in the insertion/insertion group compared with the del/del group. Of the del/del subjects, 40% never reached the T/E ratio of 4.0 on any of the 15 d after the dose. When differentiated cutoff levels for the del/del (1.0) and the other genotypes (6.0) were applied, the sensitivity increased substantially for the del/del group, and false positives in the other genotypes were eliminated. Consideration of the genetic variation in disposition of androgens will improve the sensitivity and specificity of the testosterone doping test. This is of interest not only for combating androgen doping in sports, but also for detecting and preventing androgen abuse in society.

  9. Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.

    PubMed

    Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu

    2017-11-14

    Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.

  10. Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

    PubMed

    Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

    2009-09-01

    Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

  11. Molecular mapping within the mouse albino-deletion complex.

    PubMed Central

    Johnson, D K; Hand, R E; Rinchik, E M

    1989-01-01

    Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

  12. The detection of large deletions or duplications in genomic DNA.

    PubMed

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  13. A Defect in DNA Ligase4 Enhances the Frequency of TALEN-Mediated Targeted Mutagenesis in Rice1[OPEN

    PubMed Central

    Cermak, Tomas; Sugimoto, Kazuhiko; Saika, Hiroaki; Mori, Akiko; Osakabe, Keishi; Hamada, Masao; Katayose, Yuichi; Voytas, Daniel F.

    2016-01-01

    We have established methods for site-directed mutagenesis via transcription activator-like effector nucleases (TALENs) in the endogenous rice (Oryza sativa) waxy gene and demonstrated stable inheritance of TALEN-induced somatic mutations to the progeny. To analyze the role of classical nonhomologous end joining (cNHEJ) and alternative nonhomologous end joining (altNHEJ) pathways in TALEN-induced mutagenesis in plant cells, we investigated whether a lack of DNA Ligase4 (Lig4) affects the kinetics of TALEN-induced double-strand break repair in rice cells. Deep-sequencing analysis revealed that the frequency of all types of mutations, namely deletion, insertion, combination of insertion with deletion, and substitution, in lig4 null mutant calli was higher than that in a lig4 heterozygous mutant or the wild type. In addition, the ratio of large deletions (greater than 10 bp) and deletions repaired by microhomology-mediated end joining (MMEJ) to total deletion mutations in lig4 null mutant calli was higher than that in the lig4 heterozygous mutant or wild type. Furthermore, almost all insertions (2 bp or greater) were shown to be processed via copy and paste of one or more regions around the TALENs cleavage site and rejoined via MMEJ regardless of genetic background. Taken together, our findings indicate that the dysfunction of cNHEJ leads to a shift in the repair pathway from cNHEJ to altNHEJ or synthesis-dependent strand annealing. PMID:26668331

  14. Genomic deletions created upon LINE-1 retrotransposition.

    PubMed

    Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V

    2002-08-09

    LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.

  15. A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

    PubMed Central

    Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

    2000-01-01

    Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

  16. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.)

    PubMed Central

    2012-01-01

    Background Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication. PMID:23241244

  17. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

    PubMed

    Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

    2012-12-15

    Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in the TN-DH population, (ii) the allelic diversity caused by MITE insertion/deletion upstream of BnFLC.A10 is one of the major causes of differentiation of winter and spring genotypes in rapeseed and (iii) winter rapeseed has evolved from spring genotypes through selection pressure at the BnFLC.A10 locus, enabling expanded cultivation of rapeseed along the route of Brassica domestication.

  18. On the inversion-indel distance

    PubMed Central

    2013-01-01

    Background The inversion distance, that is the distance between two unichromosomal genomes with the same content allowing only inversions of DNA segments, can be computed thanks to a pioneering approach of Hannenhalli and Pevzner in 1995. In 2000, El-Mabrouk extended the inversion model to allow the comparison of unichromosomal genomes with unequal contents, thus insertions and deletions of DNA segments besides inversions. However, an exact algorithm was presented only for the case in which we have insertions alone and no deletion (or vice versa), while a heuristic was provided for the symmetric case, that allows both insertions and deletions and is called the inversion-indel distance. In 2005, Yancopoulos, Attie and Friedberg started a new branch of research by introducing the generic double cut and join (DCJ) operation, that can represent several genome rearrangements (including inversions). Among others, the DCJ model gave rise to two important results. First, it has been shown that the inversion distance can be computed in a simpler way with the help of the DCJ operation. Second, the DCJ operation originated the DCJ-indel distance, that allows the comparison of genomes with unequal contents, considering DCJ, insertions and deletions, and can be computed in linear time. Results In the present work we put these two results together to solve an open problem, showing that, when the graph that represents the relation between the two compared genomes has no bad components, the inversion-indel distance is equal to the DCJ-indel distance. We also give a lower and an upper bound for the inversion-indel distance in the presence of bad components. PMID:24564182

  19. A Novel Assay for the Identification of NOTCH1 PEST Domain Mutations in Chronic Lymphocytic Leukemia

    PubMed Central

    Petroni, Roberta Cardoso; Muto, Nair Hideko; Sitnik, Roberta; de Carvalho, Flavia Pereira; Bacal, Nydia Strachman; Velloso, Elvira Deolinda Rodrigues Pereira; Oliveira, Gislaine Borba; Pinho, João Renato Rebello; Torres, Davi Coe; Mansur, Marcela Braga; Hassan, Rocio; Lorand-Metze, Irene Gyongyvér Heidemarie; Chiattone, Carlos Sérgio; Hamerschlak, Nelson; Mangueira, Cristovão Luis Pitangueira

    2016-01-01

    Aims. To develop a fast and robust DNA-based assay to detect insertions and deletions mutations in exon 34 that encodes the PEST domain of NOTCH1 in order to evaluate patients with chronic lymphocytic leukemia (CLL). Methods. We designed a multiplexed allele-specific polymerase chain reaction (PCR) combined with a fragment analysis assay to detect specifically the mutation c.7544_7545delCT and possibly other insertions and deletions in exon 34 of NOTCH1. Results. We evaluated our assay in peripheral blood samples from two cohorts of patients with CLL. The frequency of NOTCH1 mutations was 8.4% in the first cohort of 71 unselected CLL patients. We then evaluated a second cohort of 26 CLL patients with known cytogenetic abnormalities that were enriched for patients with trisomy 12. NOTCH1 mutations were detected in 43.7% of the patients with trisomy 12. Conclusions. We have developed a fast and robust assay combining allele-specific PCR and fragment analysis able to detect NOTCH1 PEST domain insertions and deletions. PMID:28074183

  20. Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

    PubMed Central

    Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

    1993-01-01

    Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

  1. Two open reading frames (ORF1 and ORF2) within the 2.0-kilobase latency-associated transcript of herpes simplex virus type 1 are not essential for reactivation from latency.

    PubMed Central

    Fareed, M U; Spivack, J G

    1994-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcripts (LATs) are dispensable for establishment and maintenance of latent infection. However, the LATs have been implicated in reactivation of the virus from its latent state. Since the reported LAT deletion and/or insertion variants that are reactivation impaired contain deletions in the putative LAT promoter, it is not known which LAT sequences are involved in reactivation. To examine the role of the 2.0-kb LAT in the process of reactivation and the functional importance of the putative open reading frames (ORF1 and ORF2) contained within the 2.0-kb LAT, we have constructed an HSV-1 variant that contains a precise deletion and insertion within the LAT-specific DNA sequences using site-directed mutagenesis. The HSV-1 variant FS1001K contains an 1,186-bp deletion starting precisely from the 5' end of the 2.0-kb LAT and, for identification, a XbaI restriction endonuclease site insertion. The FS1001K genome contains no other deletions and/or insertions as analyzed by a variety of restriction endonucleases. The deletion in FS1001K removes the entire 556-bp intron within the 2.0-kb LAT, the first 229 nucleotides of ORF1, and the first 159 nucleotides of ORF2 without having an affect on the RL2 (ICP0) gene. Explant cocultivation reactivation assays indicated that this deletion had a minimal effect on reactivation of the variant FS1001K compared with the parental wild-type virus using a mouse eye model. As expected, Northern (RNA) blot analyses have shown that the variant virus (FS1001K) does not produce the 2.0-kb LAT or the 1.45- to 1.5-kb LAT either in vitro or in vivo; however, FS1001K produces an intact RL2 transcript in tissue culture. These data suggest that the 2.0-kb LAT putative ORF1 and ORF2 (or the first 1,186 bp of the 2.0-kb LAT) are dispensable for explant reactivation of latent HSV-1. Images PMID:7966597

  2. Trinucleotide Insertions, Deletions, and Point Mutations in Glucose Transporters Confer K+ Uptake in Saccharomyces cerevisiae

    PubMed Central

    Liang, Hong; Ko, Christopher H.; Herman, Todd; Gaber, Richard F.

    1998-01-01

    Deletion of TRK1 and TRK2 abolishes high-affinity K+ uptake in Saccharomyces cerevisiae, resulting in the inability to grow on typical synthetic growth medium unless it is supplemented with very high concentrations of potassium. Selection for spontaneous suppressors that restored growth of trk1Δ trk2Δ cells on K+-limiting medium led to the isolation of cells with unusual gain-of-function mutations in the glucose transporter genes HXT1 and HXT3 and the glucose/galactose transporter gene GAL2. 86Rb uptake assays demonstrated that the suppressor mutations conferred increased uptake of the ion. In addition to K+, the mutant hexose transporters also conferred permeation of other cations, including Na+. Because the selection strategy required such gain of function, mutations that disrupted transporter maturation or localization to the plasma membrane were avoided. Thus, the importance of specific sites in glucose transport could be independently assessed by testing for the ability of the mutant transporter to restore glucose-dependent growth to cells containing null alleles of all of the known functional glucose transporter genes. Twelve sites, most of which are conserved among eukaryotic hexose transporters, were revealed to be essential for glucose transport. Four of these have previously been shown to be essential for glucose transport by animal or plant transporters. Eight represented sites not previously known to be crucial for glucose uptake. Each suppressor mutant harbored a single mutation that altered an amino acid(s) within or immediately adjacent to a putative transmembrane domain of the transporter. Seven of 38 independent suppressor mutations consisted of in-frame insertions or deletions. The nature of the insertions and deletions revealed a striking DNA template dependency: each insertion generated a trinucleotide repeat, and each deletion involved the removal of a repeated nucleotide sequence. PMID:9447989

  3. Refoldable Foldamers: Global Conformational Switching by Deletion or Insertion of a Single Hydrogen Bond

    PubMed Central

    Le Bailly, Bryden A. F.; Byrne, Liam

    2016-01-01

    Abstract Small changes in the structure of a foldamer may lead to gross changes in conformational preference. We show that the simple insertion or deletion of a single hydrogen bond by changes in pH or by photochemical deprotection is sufficient to refold a helical oligomer, interconverting M and P screw‐sense preference. As a consequence of the switch, information may be transmitted to a remote catalytic site, selectively directing the formation of either of two enantiomeric products by a reaction involving 1,22‐remote intermolecular asymmetric induction. PMID:26762559

  4. Chief of Naval Air Training Automated Management Information System (CAMIS). User’s Guide.

    DTIC Science & Technology

    1982-04-01

    display. This display allows the user to insert, update, delete , or analyze various data elements, or generate reports. The Flight Schedule Input...instructor, student, and aircraft utiliza- tion. Additionally, it provides a means to delete any erroneous sortie information previously entered. 5...appear: 10 Technical Report 121 VT-## FLIGHT SCHEDULE PROGRAM 1. ADD NEW FLIGHT SCHEDULE DATA 2. DELETE ERRONEOUS SORTIES PREVIOUSLY ENTERED KEY IN

  5. Low levels of LTR retrotransposon deletion by ectopic recombination in the gigantic genomes of salamanders.

    PubMed

    Frahry, Matthew Blake; Sun, Cheng; Chong, Rebecca A; Mueller, Rachel Lockridge

    2015-02-01

    Across the tree of life, species vary dramatically in nuclear genome size. Mutations that add or remove sequences from genomes-insertions or deletions, or indels-are the ultimate source of this variation. Differences in the tempo and mode of insertion and deletion across taxa have been proposed to contribute to evolutionary diversity in genome size. Among vertebrates, most of the largest genomes are found within the salamanders, an amphibian clade with genome sizes ranging from ~14 to ~120 Gb. Salamander genomes have been shown to experience slower rates of DNA loss through small (i.e., <30 bp) deletions than do other vertebrate genomes. However, no studies have addressed DNA loss from salamander genomes resulting from larger deletions. Here, we focus on one type of large deletion-ectopic-recombination-mediated removal of LTR retrotransposon sequences. In ectopic recombination, double-strand breaks are repaired using a "wrong" (i.e., ectopic, or non-allelic) template sequence-typically another locus of similar sequence. When breaks occur within the LTR portions of LTR retrotransposons, ectopic-recombination-mediated repair can produce deletions that remove the internal transposon sequence and the equivalent of one of the two LTR sequences. These deletions leave a signature in the genome-a solo LTR sequence. We compared levels of solo LTRs in the genomes of four salamander species with levels present in five vertebrates with smaller genomes. Our results demonstrate that salamanders have low levels of solo LTRs, suggesting that ectopic-recombination-mediated deletion of LTR retrotransposons occurs more slowly than in other vertebrates with smaller genomes.

  6. Interkinase domain of kit contains the binding site for phosphatidylinositol 3' kinase.

    PubMed Central

    Lev, S; Givol, D; Yarden, Y

    1992-01-01

    Our previous analysis of the signal transduction pathway used by the c-kit-encoded receptor for the stem cell factor (SCF) indicated efficient coupling to the type I phosphatidylinositol 3' kinase (PI3K). In an attempt to localize the receptor's site of interaction with PI3K, we separately deleted either the noncatalytic 68-amino-acid-long interkinase domain or the carboxyl-terminal portion distal to the catalytic sequences. Loss of ligand-induced association of PI3K with the former deletion mutant and retention of the PI3K association by the carboxyl-terminally deleted receptor implied interactions of PI3K with the kinase insert. This was further supported by partial inhibition of the association by an anti-peptide antibody directed against the kinase insert and lack of effect of an antibody directed to the carboxyl tail of the SCF receptor. A bacterially expressed kinase insert domain was used as a fusion protein to directly test its presumed function as a PI3K association site. This protein bound PI3K from cell lysate as demonstrated by PI3K activity and by an associated phosphoprotein of 85 kDa. The association was dependent on phosphorylation of the tyrosine residues on the expressed kinase insert. On the basis of these observations, we conclude that the kinase insert domain of the SCF receptor selectively interacts with the p85 regulatory subunit of PI3K and that this association requires phosphorylation of tyrosine residues in the kinase insert region, with apparently no involvement of the bulk cytoplasmic structure or tyrosine kinase function of the receptor. Images PMID:1370584

  7. Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases

    PubMed Central

    Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.

    2013-01-01

    There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777

  8. [Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

    PubMed

    Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

    2003-12-01

    To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

  9. A Functional Element Necessary for Fetal Hemoglobin Silencing

    PubMed Central

    Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

    2011-01-01

    BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

  10. Evidence from the structure and function of cytochromes c(2) that nonsulfur purple bacterial photosynthesis followed the evolution of oxygen respiration.

    PubMed

    Meyer, Terry; Van Driessche, Gonzalez; Ambler, Richard; Kyndt, John; Devreese, Bart; Van Beeumen, Jozef; Cusanovich, Michael

    2010-10-01

    Cytochromes c(2) are the nearest bacterial homologs of mitochondrial cytochrome c. The sequences of the known cytochromes c(2) can be placed in two subfamilies based upon insertions and deletions, one subfamily is most like mitochondrial cytochrome c (the small C2s, without significant insertions and deletions), and the other, designated large C2, shares 3- and 8-residue insertions as well as a single-residue deletion. C2s generally function between cytochrome bc(1) and cytochrome oxidase in respiration (ca 80 examples known to date) and between cytochrome bc(1) and the reaction center in nonsulfur purple bacterial photosynthesis (ca 21 examples). However, members of the large C2 subfamily are almost always involved in photosynthesis (12 of 14 examples). In addition, the gene for the large C2 (cycA) is associated with those for the photosynthetic reaction center (pufBALM). We hypothesize that the insertions in the large C2s, which were already functioning in photosynthesis, allowed them to replace the membrane-bound tetraheme cytochrome, PufC, that otherwise mediates between the small C2 or other redox proteins and photosynthetic reaction centers. Based upon our analysis, we propose that the involvement of C2 in nonsulfur purple bacterial photosynthesis was a metabolic feature subsequent to the evolution of oxygen respiration.

  11. Optical mapping and sequencing of the Escherichia coli KO11 genome reveal extensive chromosomal rearrangements, and multiple tandem copies of the Zymomonas mobilis pdc and adhB genes.

    PubMed

    Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O

    2012-04-01

    Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.

  12. Direct mapping of symbolic DNA sequence into frequency domain in global repeat map algorithm

    PubMed Central

    Glunčić, Matko; Paar, Vladimir

    2013-01-01

    The main feature of global repeat map (GRM) algorithm (www.hazu.hr/grm/software/win/grm2012.exe) is its ability to identify a broad variety of repeats of unbounded length that can be arbitrarily distant in sequences as large as human chromosomes. The efficacy is due to the use of complete set of a K-string ensemble which enables a new method of direct mapping of symbolic DNA sequence into frequency domain, with straightforward identification of repeats as peaks in GRM diagram. In this way, we obtain very fast, efficient and highly automatized repeat finding tool. The method is robust to substitutions and insertions/deletions, as well as to various complexities of the sequence pattern. We present several case studies of GRM use, in order to illustrate its capabilities: identification of α-satellite tandem repeats and higher order repeats (HORs), identification of Alu dispersed repeats and of Alu tandems, identification of Period 3 pattern in exons, implementation of ‘magnifying glass’ effect, identification of complex HOR pattern, identification of inter-tandem transitional dispersed repeat sequences and identification of long segmental duplications. GRM algorithm is convenient for use, in particular, in cases of large repeat units, of highly mutated and/or complex repeats, and of global repeat maps for large genomic sequences (chromosomes and genomes). PMID:22977183

  13. Landscape of Insertion Polymorphisms in the Human Genome

    PubMed Central

    Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

    2015-01-01

    Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

  14. Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

    PubMed Central

    Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

    2000-01-01

    Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

  15. Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

    PubMed

    He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

    2017-11-01

    Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are toleratedmore » at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.« less

  17. Accurate indel prediction using paired-end short reads

    PubMed Central

    2013-01-01

    Background One of the major open challenges in next generation sequencing (NGS) is the accurate identification of structural variants such as insertions and deletions (indels). Current methods for indel calling assign scores to different types of evidence or counter-evidence for the presence of an indel, such as the number of split read alignments spanning the boundaries of a deletion candidate or reads that map within a putative deletion. Candidates with a score above a manually defined threshold are then predicted to be true indels. As a consequence, structural variants detected in this manner contain many false positives. Results Here, we present a machine learning based method which is able to discover and distinguish true from false indel candidates in order to reduce the false positive rate. Our method identifies indel candidates using a discriminative classifier based on features of split read alignment profiles and trained on true and false indel candidates that were validated by Sanger sequencing. We demonstrate the usefulness of our method with paired-end Illumina reads from 80 genomes of the first phase of the 1001 Genomes Project ( http://www.1001genomes.org) in Arabidopsis thaliana. Conclusion In this work we show that indel classification is a necessary step to reduce the number of false positive candidates. We demonstrate that missing classification may lead to spurious biological interpretations. The software is available at: http://agkb.is.tuebingen.mpg.de/Forschung/SV-M/. PMID:23442375

  18. Nonoverlapping functions for Notch1 and Notch3 during murine steady-state thymic lymphopoiesis

    PubMed Central

    Shi, Jianjun; Fallahi, Mohammad; Luo, Jun-Li

    2011-01-01

    Notch1 signaling is absolutely essential for steady-state thymic lymphopoiesis, but the role of other Notch receptors, and their potential overlap with the function of Notch1, remains unclear. Here we show that like Notch1, Notch3 is differentially expressed by progenitor thymocytes, peaking at the DN3 progenitor stage. Using mice carrying a gene-trapped allele, we show that thymic cellularity is slightly reduced in the absence of Notch3, although progression through the defined sequence of TCR-αβ development is normal, as are NKT and TCRγδ cell production. The absence of a profound effect from Notch3 deletion is not explained by residual function of the gene-trapped allele because insertion mapping suggests that the targeted allele would not encode functional signaling domains. We also show that although Notch1 and Notch3 are coexpressed on some early intrathymic progenitors, the relatively mild phenotype seen after Notch3 deletion does not result from the compensatory function of Notch1, nor does Notch3 function explain the likewise mild phenotype seen after conditional (intrathymic) deletion of Notch1. Our studies indicate that Notch1 and Notch3 carry out nonoverlapping functions during thymocyte differentiation, and that while Notch1 is absolutely required early in the lymphopoietic process, neither receptor is essential at later stages. PMID:21768299

  19. Efficient generation of mutations mediated by CRISPR/Cas9 in the hairy root transformation system of Brassica carinata.

    PubMed

    Kirchner, Thomas W; Niehaus, Markus; Debener, Thomas; Schenk, Manfred K; Herde, Marco

    2017-01-01

    A protocol for the induction of site-directed deletions and insertions in the genome of Brassica carinata with CRISPR is described. The construct containing the Cas9 nuclease and the guide RNA (gRNA) was delivered by the hairy root transformation technique, and a successful transformation was monitored by GFP fluorescence. PAGE analysis of an amplified region, presumably containing the deletions and insertions, demonstrated up to seven different indels in one transgenic root and in all analyzed roots a wildtype allele of the modified gene was not detectable. Interestingly, many of these mutations consisted of relatively large indels with up to 112 bp. The exact size of the deletions was determined to allow an estimation whether the targeted gene was not functional due to a considerable deletion or a frame shift within the open reading frame. This allowed a direct phenotypic assessment of the previously characterized roots and, in fact, deletions in FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 1 (BcFLA1)-a gene with an expression pattern consistent with a role in root hair architecture-resulted in shorter root hairs compared to control roots ectopically expressing an allele of the gene that cannot be targeted by the gRNA in parallel to the CRISPR construct. As an additional line of evidence, we monitored BcFLA1 expression with qPCR and detected a significant reduction of the transcript in roots with an active CRISPR construct compared to the control, although residual amounts of the transcript were detected, possibly due to inefficient nonsense-mediated mRNA decay. Additionally, the presence of deletions and insertions were verified by Sanger sequencing of the respective amplicons. In summary we demonstrate the successful application of CRISPR/Cas9 in hairy roots of B. carinata, the proof of its effectiveness and its effect on the root hair phenotype. This study paves the way for experimental strategies involving the phenotypic assessment of gene lesions by CRISPR which do not require germline transmission.

  20. The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

    PubMed

    He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

    2014-01-01

    Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

  1. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gong, Y.; Li, X.M.; Shapiro, L.J.

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

  2. Expression of Wheat High Molecular Weight Glutenin Subunit 1Bx Is Affected by Large Insertions and Deletions Located in the Upstream Flanking Sequences

    PubMed Central

    Hao, Chenyang; Tang, Saijun; Zhang, Xueyong; Li, Tian

    2014-01-01

    To better understand the transcriptional regulation of high molecular weight glutenin subunit (HMW-GS) expression, we isolated four Glu-1Bx promoters from six wheat cultivars exhibiting diverse protein expression levels. The activities of the diverse Glu-1Bx promoters were tested and compared with β-glucuronidase (GUS) reporter fusions. Although all the full-length Glu-1Bx promoters showed endosperm-specific activities, the strongest GUS activity was observed with the 1Bx7OE promoter in both transient expression assays and stable transgenic rice lines. A 43 bp insertion in the 1Bx7OE promoter, which is absent in the 1Bx7 promoter, led to enhanced expression. Analysis of promoter deletion constructs confirmed that a 185 bp MITE (miniature inverted-repeat transposable element) in the 1Bx14 promoter had a weak positive effect on Glu-1Bx expression, and a 54 bp deletion in the 1Bx13 promoter reduced endosperm-specific activity. To investigate the effect of the 43 bp insertion in the 1Bx7OE promoter, a functional marker was developed to screen 505 Chinese varieties and 160 European varieties, and only 1Bx7-type varieties harboring the 43 bp insertion in their promoters showed similar overexpression patterns. Hence, the 1Bx7OE promoter should be important tool in crop genetic engineering as well as in molecular assisted breeding. PMID:25133580

  3. Trypanosoma brucei RNA Editing Complex

    PubMed Central

    O'Hearn, Sean F.; Huang, Catherine E.; Hemann, Mike; Zhelonkina, Alevtina; Sollner-Webb, Barbara

    2003-01-01

    Maturation of Trypanosoma brucei mitochondrial mRNA involves massive posttranscriptional insertion and deletion of uridine residues. This RNA editing utilizes an enzymatic complex with seven major proteins, band I through band VII. We here use RNA interference (RNAi) to examine the band II and band V proteins. Band II is found essential for viability; it is needed to maintain the normal structure of the editing complex and to retain the band V ligase protein. Previously, band III was found essential for certain activities, including maintenance of the editing complex and retention of the band IV ligase protein. Thus, band II and band V form a protein pair with features analogous to the band III/band IV ligase pair. Since band V is specific for U insertion and since band IV is needed for U deletion, their parallel organization suggests that the editing complex has a pseudosymmetry. However, unlike the essential band IV ligase, RNAi to band V has only a morphological but no growth rate effect, suggesting that it is stimulatory but nonessential. Indeed, in vitro analysis of band V RNAi cell extract demonstrates that band IV can seal U insertion when band V is lacking. Thus, band IV ligase is the first activity of the basic editing complex shown able to serve in both forms of editing. Our studies also indicate that the U insertional portion may be less central in the editing complex than the corresponding U deletional portion. PMID:14560033

  4. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  5. Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

    PubMed

    Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

    2017-03-01

    Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

  6. A cytological-physical map of 22q11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindsay, E.A.; Rizzu, P.; Gaddini, L.

    Our laboratory is involved in the construction of a cytological-physical map of 22q11 and isolation of expressed sequences from the region involved in DiGeorge syndrome (DGS) and Velo-Cardio-Facial syndrome (VCFS). One of the goals of the mapping is an understanding of the molecular mechanisms which generate the 22q11 microdeletions observed with high frequency in DGS and VCFS. Our of over 60 deleted patients studied in our laboratory, all but one were deleted for two loci approximately 1-2 Mb apart. There is evidence from patients with balanced and unbalanced translocations that deletion of the whole region is not necessary for determinationmore » of the clinical phenotype. Therefore, it is possible that deletion breakpoints occur as a consequence of structural characteristics of the DNA that predispose to rearrangements. A striking characteristic of the 22q11 region is the abundance of low copy repeat sequences. It is reasonable to think that recombination between these repeats may lead to microdeletions. However, a direct demonstration of such mechanism is not available yet. The presence of repeats makes standard physical mapping techniques based on hybridization or STS mapping often difficult to interpret. For example, we have found clones positive for the same STS that are located in different positions within 22q11. For this reason we have used high resolution cytological mapping as a supporting technique for map validation. We present the current status map which includes known polymorphic and non-polymorphic loci, newly isolated clones and chromosomal deletion breakpoints. The map extends from the loci D22S9/D22S24 to TOP1P2. Extended chromatin hybridization experiments visually demonstrate the presence of at least two repeat islands flanking (or at) the region where chromosomal breakpoints of the commonly deleted region occur.« less

  7. Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird

    PubMed Central

    2009-01-01

    Background With the publication of the draft chicken genome and the recent production of several BAC clone libraries from non-avian reptiles and birds, it is now possible to undertake more detailed comparative genomic studies in Reptilia. Of interest in particular are the genomic events that transformed the large, repeat-rich genomes of mammals and non-avian reptiles into the minimalist chicken genome. We have used paired BAC end sequences (BESs) from the American alligator (Alligator mississippiensis), painted turtle (Chrysemys picta) and emu (Dromaius novaehollandiae) to investigate patterns of sequence divergence, gene and retroelement content, and microsynteny between these species and chicken. Results From a total of 11,967 curated BESs, we successfully mapped 725, 773 and 2597 sequences in alligator, turtle, and emu, respectively, to sites in the draft chicken genome using a stringent BLAST protocol. Most commonly, sequences mapped to a single site in the chicken genome. Of 1675, 1828 and 2936 paired BESs obtained for alligator, turtle, and emu, respectively, a total of 34 (alligator, 2%), 24 (turtle, 1.3%) and 479 (emu, 16.3%) pairs were found to map with high confidence and in the correct orientation and with BAC-sized intermarker distances to single chicken chromosomes, including 25 such paired hits in emu mapping to the chicken Z chromosome. By determining the insert sizes of a subset of BAC clones from these three species, we also found a significant correlation between the intermarker distance in alligator and turtle and in chicken, with slopes as expected on the basis of the ratio of the genome sizes. Conclusion Our results suggest that a large number of small-scale chromosomal rearrangements and deletions in the lineage leading to chicken have drastically reduced the number of detected syntenies observed between the chicken and alligator, turtle, and emu genomes and imply that small deletions occurring widely throughout the genomes of reptilian and avian ancestors led to the ~50% reduction in genome size observed in birds compared to reptiles. We have also mapped and identified likely gene regions in hundreds of new BAC clones from these species. PMID:19607659

  8. Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird.

    PubMed

    Chapus, Charles; Edwards, Scott V

    2009-07-14

    With the publication of the draft chicken genome and the recent production of several BAC clone libraries from non-avian reptiles and birds, it is now possible to undertake more detailed comparative genomic studies in Reptilia. Of interest in particular are the genomic events that transformed the large, repeat-rich genomes of mammals and non-avian reptiles into the minimalist chicken genome. We have used paired BAC end sequences (BESs) from the American alligator (Alligator mississippiensis), painted turtle (Chrysemys picta) and emu (Dromaius novaehollandiae) to investigate patterns of sequence divergence, gene and retroelement content, and microsynteny between these species and chicken. From a total of 11,967 curated BESs, we successfully mapped 725, 773 and 2597 sequences in alligator, turtle, and emu, respectively, to sites in the draft chicken genome using a stringent BLAST protocol. Most commonly, sequences mapped to a single site in the chicken genome. Of 1675, 1828 and 2936 paired BESs obtained for alligator, turtle, and emu, respectively, a total of 34 (alligator, 2%), 24 (turtle, 1.3%) and 479 (emu, 16.3%) pairs were found to map with high confidence and in the correct orientation and with BAC-sized intermarker distances to single chicken chromosomes, including 25 such paired hits in emu mapping to the chicken Z chromosome. By determining the insert sizes of a subset of BAC clones from these three species, we also found a significant correlation between the intermarker distance in alligator and turtle and in chicken, with slopes as expected on the basis of the ratio of the genome sizes. Our results suggest that a large number of small-scale chromosomal rearrangements and deletions in the lineage leading to chicken have drastically reduced the number of detected syntenies observed between the chicken and alligator, turtle, and emu genomes and imply that small deletions occurring widely throughout the genomes of reptilian and avian ancestors led to the ~50% reduction in genome size observed in birds compared to reptiles. We have also mapped and identified likely gene regions in hundreds of new BAC clones from these species.

  9. Restriction fragment length polymorphisms in dairy and beef cattle at the growth hormone and prolactin loci.

    PubMed

    Hallerman, E M; Nave, A; Kashi, Y; Holzer, Z; Soller, M; Beckmann, J S

    1987-01-01

    Two bovine populations, a Holstein-Friesian dairy stock and a synthetic (Baladi X Hereford X Simmental X Charolais) beef stock, were screened for restriction fragment length polymorphisms (RFLPs) at the growth hormone and prolactin genes. Most RFLPs at the growth hormone gene are apparently the consequence of an insertion/deletion event which was localized to a region downstream of the structural gene. The restriction map for the genomic region including the growth hormone gene was extended. Two HindIII RFLPs at the growth hormone locus, as well as several RFLPs at the prolactin gene, seemed to be the consequence of a series of point mutations. The results are discussed in terms of the possibility that minor genomic variability underlies quantitative genetic variation.

  10. STS map of genes and anonymous DNA fragments on human chromosome 18 using a panel of somatic cell hybrids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Overhauser, J.; Mewar, R.; Rojas, K.

    1993-02-01

    Somatic cell hybrids containing different deleted regions of chromosome 18 derived form patients with balanced translocations or terminal deletions were used to create a deletion mapping panel. Twenty-four sequence-tagged sites (STSs) for 17 genes and 7 anonymous polymorphic DNA fragments were identified. These STSs were used to map the 24 loci to 18 defined regions of chromosome 18. Both ERV1, previously mapped to 18q22-q23, and YES1, previously mapped to 18q21.3, were found to map to 18p11.21-pter. Several genes previously mapped to 18q21 were found to be in the order cen-SSAV1-DCC-FECH-GRP-BCL2-PLANH2-tel. The precise mapping of genes to chromosome 18 should helpmore » in determining whether these genes may be involved in the etiology of specific chromosomal syndromes associated with chromosome 18. The mapping of the poloymorphic loci will assist in the integration of the physical map with the recombination map of chromosome 18. 43 refs., 2 figs., 1 tab.« less

  11. On the weight of indels in genomic distances

    PubMed Central

    2011-01-01

    Background Classical approaches to compute the genomic distance are usually limited to genomes with the same content, without duplicated markers. However, differences in the gene content are frequently observed and can reflect important evolutionary aspects. A few polynomial time algorithms that include genome rearrangements, insertions and deletions (or substitutions) were already proposed. These methods often allow a block of contiguous markers to be inserted, deleted or substituted at once but result in distance functions that do not respect the triangular inequality and hence do not constitute metrics. Results In the present study we discuss the disruption of the triangular inequality in some of the available methods and give a framework to establish an efficient correction for two models recently proposed, one that includes insertions, deletions and double cut and join (DCJ) operations, and one that includes substitutions and DCJ operations. Conclusions We show that the proposed framework establishes the triangular inequality in both distances, by summing a surcharge on indel operations and on substitutions that depends only on the number of markers affected by these operations. This correction can be applied a posteriori, without interfering with the already available formulas to compute these distances. We claim that this correction leads to distances that are biologically more plausible. PMID:22151784

  12. Variable presentation of primary hyperoxaluria type 1 in 2 patients homozygous for a novel combined deletion and insertion mutation in exon 8 of the AGXT gene.

    PubMed

    von Schnakenburg, C; Hulton, S A; Milford, D V; Roper, H P; Rumsby, G

    1998-01-01

    Two unrelated patients of Pakistani origin presented with primary hyperoxaluria type 1 (PH1) at 4 months and 3 years of age, respectively. While the younger patient failed to thrive and suffered from early renal failure, the older one showed a relatively benign history with urolithiasis as the main feature of the disease. In both patients the diagnosis was confirmed by assessment of alanine:glyoxylate aminotransferase catalytic and immunoreactivity in liver biopsy specimens. The underlying genetic defect was found to be a combined deletion and insertion in exon 8 which alters the reading frame of the protein. The nucleotide change introduces a Stu1 restriction site which facilitated typing of additional family members. Both patients and a further affected brother were homozygous for this mutation, while their parents were heterozygous for it. This mutation is the first deletion/insertion identified in PH1. Although rare in our PH1 patient cohort (2.5% of alleles), the finding of 2 homozygous apparently unrelated individuals of the same ethnic origin suggests that it may prove worthwhile to screen other Asian patients for this mutation. These PH1 cases present further evidence that factors other than genotype contribute significantly to the clinical presentation and severity of PH1.

  13. A Novel Retrotransposon Inserted in the Dominant Vrn-B1 Allele Confers Spring Growth Habit in Tetraploid Wheat (Triticum turgidum L.).

    PubMed

    Chu, C-G; Tan, C T; Yu, G-T; Zhong, S; Xu, S S; Yan, L

    2011-12-01

    Vernalization genes determine winter/spring growth habit in temperate cereals and play important roles in plant development and environmental adaptation. In wheat (Triticum L. sp.), it was previously shown that allelic variation in the vernalization gene VRN1 was due to deletions or insertions either in the promoter or in the first intron. Here, we report a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled haploid population that segregated for winter-spring growth habit but was derived from two spring tetraploid wheat genotypes, the durum wheat (T. turgidum subsp. durum) variety 'Lebsock' and T. turgidum subsp. carthlicum accession PI 94749. Genetic analysis revealed that Lebsock carried the dominant Vrn-A1 and recessive vrn-B1 alleles, whereas PI 94749 had the recessive vrn-A1 and dominant Vrn-B1 alleles. The Vrn-A1 allele in Lebsock was the same as the Vrn-A1c allele previously reported in hexaploid wheat. No differences existed between the vrn-B1 and Vrn-B1 alleles, except that a 5463-bp insertion was detected in the 5'-UTR region of the Vrn-B1 allele. This insertion was a novel retrotransposon (designated as retrotrans_VRN), which was flanked by a 5-bp target site duplication and contained primer binding site and polypurine tract motifs, a 325-bp long terminal repeat, and an open reading frame encoding 1231 amino acids. The insertion of retrotrans_VRN resulted in expression of Vrn-B1 without vernalization. Retrotrans_VRN is prevalent among T. turgidum subsp. carthlicum accessions, less prevalent among T. turgidum subsp. dicoccum accessions, and rarely found in other tetraploid wheat subspecies.

  14. QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

    PubMed

    Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

    2009-07-01

    Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

  15. A comprehensive study of small non-frameshift insertions/deletions in proteins and prediction of their phenotypic effects by a machine learning method (KD4i)

    PubMed Central

    2014-01-01

    Background Small insertion and deletion polymorphisms (Indels) are the second most common mutations in the human genome, after Single Nucleotide Polymorphisms (SNPs). Recent studies have shown that they have significant influence on genetic variation by altering human traits and can cause multiple human diseases. In particular, many Indels that occur in protein coding regions are known to impact the structure or function of the protein. A major challenge is to predict the effects of these Indels and to distinguish between deleterious and neutral variants. When an Indel occurs within a coding region, it can be either frameshifting (FS) or non-frameshifting (NFS). FS-Indels either modify the complete C-terminal region of the protein or result in premature termination of translation. NFS-Indels insert/delete multiples of three nucleotides leading to the insertion/deletion of one or more amino acids. Results In order to study the relationships between NFS-Indels and Mendelian diseases, we characterized NFS-Indels according to numerous structural, functional and evolutionary parameters. We then used these parameters to identify specific characteristics of disease-causing and neutral NFS-Indels. Finally, we developed a new machine learning approach, KD4i, that can be used to predict the phenotypic effects of NFS-Indels. Conclusions We demonstrate in a large-scale evaluation that the accuracy of KD4i is comparable to existing state-of-the-art methods. However, a major advantage of our approach is that we also provide the reasons for the predictions, in the form of a set of rules. The rules are interpretable by non-expert humans and they thus represent new knowledge about the relationships between the genotype and phenotypes of NFS-Indels and the causative molecular perturbations that result in the disease. PMID:24742296

  16. Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat

    PubMed Central

    Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying

    2018-01-01

    A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081

  17. Attenuation of Replication-Competent Adenovirus Serotype 26 Vaccines by Vectorization

    PubMed Central

    Maxfield, Lori F.; Abbink, Peter; Stephenson, Kathryn E.; Borducchi, Erica N.; Ng'ang'a, David; Kirilova, Marinela M.; Paulino, Noelix; Boyd, Michael; Shabram, Paul; Ruan, Qian; Patel, Mayank

    2015-01-01

    Replication-competent adenovirus (rcAd)-based vaccine vectors may theoretically provide immunological advantages over replication-incompetent Ad vectors, but they also raise additional potential clinical and regulatory issues. We produced replication-competent Ad serotype 26 (rcAd26) vectors by adding the E1 region back into a replication-incompetent Ad26 vector backbone with the E3 or E3/E4 regions deleted. We assessed the effect of vectorization on the replicative capacity of the rcAd26 vaccines. Attenuation occurred in a stepwise fashion, with E3 deletion, E4 deletion, and human immunodeficiency virus type 1 (HIV-1) envelope (Env) gene insertion all contributing to reduced replicative capacity compared to that with the wild-type Ad26 vector. The rcAd26 vector with E3 and E4 deleted and containing the Env transgene exhibited 2.7- to 4.4-log-lower replicative capacity than that of the wild-type Ad26 in vitro. This rcAd26 vector is currently being evaluated in a phase 1 clinical trial. Attenuation as a result of vectorization and transgene insertion has implications for the clinical development of replication-competent vaccine vectors. PMID:26376928

  18. Attenuation of Replication-Competent Adenovirus Serotype 26 Vaccines by Vectorization.

    PubMed

    Maxfield, Lori F; Abbink, Peter; Stephenson, Kathryn E; Borducchi, Erica N; Ng'ang'a, David; Kirilova, Marinela M; Paulino, Noelix; Boyd, Michael; Shabram, Paul; Ruan, Qian; Patel, Mayank; Barouch, Dan H

    2015-11-01

    Replication-competent adenovirus (rcAd)-based vaccine vectors may theoretically provide immunological advantages over replication-incompetent Ad vectors, but they also raise additional potential clinical and regulatory issues. We produced replication-competent Ad serotype 26 (rcAd26) vectors by adding the E1 region back into a replication-incompetent Ad26 vector backbone with the E3 or E3/E4 regions deleted. We assessed the effect of vectorization on the replicative capacity of the rcAd26 vaccines. Attenuation occurred in a stepwise fashion, with E3 deletion, E4 deletion, and human immunodeficiency virus type 1 (HIV-1) envelope (Env) gene insertion all contributing to reduced replicative capacity compared to that with the wild-type Ad26 vector. The rcAd26 vector with E3 and E4 deleted and containing the Env transgene exhibited 2.7- to 4.4-log-lower replicative capacity than that of the wild-type Ad26 in vitro. This rcAd26 vector is currently being evaluated in a phase 1 clinical trial. Attenuation as a result of vectorization and transgene insertion has implications for the clinical development of replication-competent vaccine vectors. Copyright © 2015, Maxfield et al.

  19. Diagnosis of Familial Wolf-Hirschhorn Syndrome due to a Paternal Cryptic Chromosomal Rearrangement by Conventional and Molecular Cytogenetic Techniques

    PubMed Central

    Venegas-Vega, Carlos A.; Zepeda, Luis M.; Garduño-Zarazúa, Luz M.; Berumen, Jaime; Kofman, Susana; Cervantes, Alicia

    2013-01-01

    The use of conventional cytogenetic techniques in combination with fluorescent in situ hybridization (FISH) and single-nucleotide polymorphism (SNP) microarrays is necessary for the identification of cryptic rearrangements in the diagnosis of chromosomal syndromes. We report two siblings, a boy of 9 years and 9 months of age and his 7-years- and 5-month-old sister, with the classic Wolf-Hirschhorn syndrome (WHS) phenotype. Using high-resolution GTG- and NOR-banding karyotypes, as well as FISH analysis, we characterized a pure 4p deletion in both sibs and a balanced rearrangement in their father, consisting in an insertion of 4p material within a nucleolar organizing region of chromosome 15. Copy number variant (CNV) analysis using SNP arrays showed that both siblings have a similar size of 4p deletion (~6.5 Mb). Our results strongly support the need for conventional cytogenetic and FISH analysis, as well as high-density microarray mapping for the optimal characterization of the genetic imbalance in patients with WHS; parents must always be studied for recognizing cryptic balanced chromosomal rearrangements for an adequate genetic counseling. PMID:23484094

  20. Identification and Characterization of Crr1a, a Gene for Resistance to Clubroot Disease (Plasmodiophora brassicae Woronin) in Brassica rapa L.

    PubMed Central

    Hatakeyama, Katsunori; Suwabe, Keita; Tomita, Rubens Norio; Kato, Takeyuki; Nunome, Tsukasa; Fukuoka, Hiroyuki; Matsumoto, Satoru

    2013-01-01

    Clubroot disease, caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin, is one of the most economically important diseases of Brassica crops in the world. Although many clubroot resistance (CR) loci have been identified through genetic analysis and QTL mapping, the molecular mechanisms of defense responses against P. brassicae remain unknown. Fine mapping of the Crr1 locus, which was originally identified as a single locus, revealed that it comprises two gene loci, Crr1a and Crr1b. Here we report the map-based cloning and characterization of Crr1a, which confers resistance to clubroot in Brassica rapa. Crr1aG004, cloned from the resistant line G004, encodes a Toll-Interleukin-1 receptor/nucleotide-binding site/leucine-rich repeat (TIR-NB-LRR) protein expressed in the stele and cortex of hypocotyl and roots, where secondary infection of the pathogen occurs, but not in root hairs, where primary infection occurs. Gain-of-function analysis proved that Crr1aG004 alone conferred resistance to isolate Ano-01 in susceptible Arabidopsis and B. rapa. In comparison, the susceptible allele Crr1aA9709 encodes a truncated NB-LRR protein, which lacked more than half of the TIR domain on account of the insertion of a solo-long terminal repeat (LTR) in exon 1 and included several substitutions and insertion-deletions in the LRR domain. This study provides a basis for further molecular analysis of defense mechanisms against P. brassicae and will contribute to the breeding of resistant cultivars of Brassica vegetables by marker-assisted selection. Data deposition The sequence reported in this paper has been deposited in the GenBank database (accession no. AB605024). PMID:23382954

  1. L1-Associated Genomic Regions are Deleted in Somatic Cells of the Healthy Human Brain

    PubMed Central

    Erwin, Jennifer A.; Paquola, Apuã C.M.; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy; Ivanio, Francisco; Butcher, Cheyenne R.; Herdy, Joseph R.; Sarkar, Anindita; Lasken, Roger S.; Muotri, Alysson R.; Gage, Fred H.

    2016-01-01

    The healthy human brain is a mosaic of varied genomes. L1 retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that Somatic L1-Associated Variants (SLAVs) are actually composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs are, in fact, somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition- independent rearrangements within inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2/PSD93, and affect between 44–63% of cells of the cells in the healthy brain. PMID:27618310

  2. A 6-amino acid insertion/deletion polymorphism in the mucin domain of TIM-1 confers protections against HIV-1 infection.

    PubMed

    Biasin, Mara; Sironi, Manuela; Saulle, Irma; Pontremoli, Chiara; Garziano, Micaela; Cagliani, Rachele; Trabattoni, Daria; Lo Caputo, Sergio; Vichi, Francesca; Mazzotta, Francesco; Forni, Diego; Riva, Stefania; Aguilar-Jimenez, Wbeimar; Cedeño, Samandhy; Sanchez, Jorge; Brander, Christian; Zapata, Wildeman; Rugeles, Maria Teresa; Clerici, Mario

    2017-01-01

    We investigated whether a 6-amino acid insertion/deletion polymorphism in the mucin domain of TIM-1 (T-cell immunoglobulin and mucin domain 1), modulates susceptibility to HIV-1 infection. The polymorphism was genotyped in three case/control cohorts of HIV-1 exposed seronegative individuals (HESN) and HIV-1 infected subjects from Italy, Peru, and Colombia; data from a Thai population were retrieved from the literature. Across all cohorts, homozygosity for the short TIM-1 allele was more common in HESNs than in HIV-1 infected subjects. A meta-analysis of the four association analyses yielded a p value of 0.005. In vitro infection assays of CD4+ T lymphocytes indicated that homozygosity for the short allele is associated with lower rate of HIV-1 replication. These results suggest that the deletion allele protects from HIV-1 infection with a recessive effect. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Sensory cortex limits cortical maps and drives top-down plasticity in thalamocortical circuits

    PubMed Central

    Zembrzycki, Andreas; Chou, Shen-Ju; Ashery-Padan, Ruth; Stoykova, Anastassia; O’Leary, Dennis D.M.

    2013-01-01

    Summary Primary somatosensory cortex (S1) contains a complete body map that mirrors subcortical maps developed by peripheral sensory input projecting to sensory hindbrain, thalamus, then S1. Peripheral changes during development alter these maps through ‘bottom-up’ plasticity. Unknown is how S1 size influences map organization and if an altered S1 map feedbacks to affect subcortical maps. We show in mice that S1 is significantly reduced by cortex-specific deletion of Pax6, resulting in a reduced body map and loss of body representations by exclusion of later-differentiating sensory thalamocortical input. An initially normal sensory thalamus was re-patterned to match the aberrant S1 map by apoptotic deletion of thalamic neurons representing body parts with axons excluded from S1. Deleted representations were rescued by altering competition between thalamocortical axons by sensory deprivation or increasing S1. Thus, S1 size determined resolution and completeness of body maps and engaged ‘top-down’ plasticity that re-patterned sensory thalamus to match S1. PMID:23831966

  4. Efficient Mutagenesis Independent of Ligation (EMILI).

    PubMed

    Füzik, Tibor; Ulbrich, Pavel; Ruml, Tomáš

    2014-11-01

    Site-directed mutagenesis is one of the most widely used techniques in life sciences. Here we describe an improved and simplified method for introducing mutations at desired sites. It consists of an inverse PCR using a plasmid template and two partially complementary primers. The synthesis step is followed by annealing of the PCR product's sticky ends, which are generated by exonuclease digestion. This method is fast, extremely efficient and cost-effective. It can be used to introduce large insertions and deletions, but also for multiple point mutations in a single step. To show the principle and to prove the efficiency of the method, we present a series of basic mutations (insertions, deletions, point mutations) on pUC19 plasmid DNA. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.

    PubMed

    Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K

    1987-03-01

    Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process.

  6. Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.

    PubMed Central

    Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K

    1987-01-01

    Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process. Images PMID:3031485

  7. Comparative genomics and transcriptional profiles of Saccharopolyspora erythraea NRRL 2338 and a classically improved erythromycin over-producing strain

    PubMed Central

    2012-01-01

    Background The molecular mechanisms altered by the traditional mutation and screening approach during the improvement of antibiotic-producing microorganisms are still poorly understood although this information is essential to design rational strategies for industrial strain improvement. In this study, we applied comparative genomics to identify all genetic changes occurring during the development of an erythromycin overproducer obtained using the traditional mutate-and- screen method. Results Compared with the parental Saccharopolyspora erythraea NRRL 2338, the genome of the overproducing strain presents 117 deletion, 78 insertion and 12 transposition sites, with 71 insertion/deletion sites mapping within coding sequences (CDSs) and generating frame-shift mutations. Single nucleotide variations are present in 144 CDSs. Overall, the genomic variations affect 227 proteins of the overproducing strain and a considerable number of mutations alter genes of key enzymes in the central carbon and nitrogen metabolism and in the biosynthesis of secondary metabolites, resulting in the redirection of common precursors toward erythromycin biosynthesis. Interestingly, several mutations inactivate genes coding for proteins that play fundamental roles in basic transcription and translation machineries including the transcription anti-termination factor NusB and the transcription elongation factor Efp. These mutations, along with those affecting genes coding for pleiotropic or pathway-specific regulators, affect global expression profile as demonstrated by a comparative analysis of the parental and overproducer expression profiles. Genomic data, finally, suggest that the mutate-and-screen process might have been accelerated by mutations in DNA repair genes. Conclusions This study helps to clarify the mechanisms underlying antibiotic overproduction providing valuable information about new possible molecular targets for rationale strain improvement. PMID:22401291

  8. LenVarDB: database of length-variant protein domains.

    PubMed

    Mutt, Eshita; Mathew, Oommen K; Sowdhamini, Ramanathan

    2014-01-01

    Protein domains are functionally and structurally independent modules, which add to the functional variety of proteins. This array of functional diversity has been enabled by evolutionary changes, such as amino acid substitutions or insertions or deletions, occurring in these protein domains. Length variations (indels) can introduce changes at structural, functional and interaction levels. LenVarDB (freely available at http://caps.ncbs.res.in/lenvardb/) traces these length variations, starting from structure-based sequence alignments in our Protein Alignments organized as Structural Superfamilies (PASS2) database, across 731 structural classification of proteins (SCOP)-based protein domain superfamilies connected to 2 730 625 sequence homologues. Alignment of sequence homologues corresponding to a structural domain is available, starting from a structure-based sequence alignment of the superfamily. Orientation of the length-variant (indel) regions in protein domains can be visualized by mapping them on the structure and on the alignment. Knowledge about location of length variations within protein domains and their visual representation will be useful in predicting changes within structurally or functionally relevant sites, which may ultimately regulate protein function. Non-technical summary: Evolutionary changes bring about natural changes to proteins that may be found in many organisms. Such changes could be reflected as amino acid substitutions or insertions-deletions (indels) in protein sequences. LenVarDB is a database that provides an early overview of observed length variations that were set among 731 protein families and after examining >2 million sequences. Indels are followed up to observe if they are close to the active site such that they can affect the activity of proteins. Inclusion of such information can aid the design of bioengineering experiments.

  9. Reference quality assembly of the 3.5-Gb genome of Capsicum annuum from a single linked-read library.

    PubMed

    Hulse-Kemp, Amanda M; Maheshwari, Shamoni; Stoffel, Kevin; Hill, Theresa A; Jaffe, David; Williams, Stephen R; Weisenfeld, Neil; Ramakrishnan, Srividya; Kumar, Vijay; Shah, Preyas; Schatz, Michael C; Church, Deanna M; Van Deynze, Allen

    2018-01-01

    Linked-Read sequencing technology has recently been employed successfully for de novo assembly of human genomes, however, the utility of this technology for complex plant genomes is unproven. We evaluated the technology for this purpose by sequencing the 3.5-gigabase (Gb) diploid pepper ( Capsicum annuum ) genome with a single Linked-Read library. Plant genomes, including pepper, are characterized by long, highly similar repetitive sequences. Accordingly, significant effort is used to ensure that the sequenced plant is highly homozygous and the resulting assembly is a haploid consensus. With a phased assembly approach, we targeted a heterozygous F 1 derived from a wide cross to assess the ability to derive both haplotypes and characterize a pungency gene with a large insertion/deletion. The Supernova software generated a highly ordered, more contiguous sequence assembly than all currently available C. annuum reference genomes. Over 83% of the final assembly was anchored and oriented using four publicly available  de novo linkage maps. A comparison of the annotation of conserved eukaryotic genes indicated the completeness of assembly. The validity of the phased assembly is further demonstrated with the complete recovery of both 2.5-Kb insertion/deletion haplotypes of the PUN1 locus in the F 1 sample that represents pungent and nonpungent peppers, as well as nearly full recovery of the BUSCO2 gene set within each of the two haplotypes. The most contiguous pepper genome assembly to date has been generated which demonstrates that Linked-Read library technology provides a tool to de novo assemble complex highly repetitive heterozygous plant genomes. This technology can provide an opportunity to cost-effectively develop high-quality genome assemblies for other complex plants and compare structural and gene differences through accurate haplotype reconstruction.

  10. Next Generation Satellite Communications: Automated Doppler Shift Compensation of PSK-31 Via Software-Defined Radio

    DTIC Science & Technology

    2014-05-09

    Interfaces Configuration – Wired Network Connections before Editing Move the cursor to the end of the line that ends with “eth0 inet dhcp ” and type...X”. This will delete text one character back from the cursor. Delete the word “ dhcp ”. Once this is done, type “a” to begin inserting text and add

  11. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    PubMed

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  12. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    PubMed Central

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

  13. Spectra of spontaneous frameshift mutations at the hisD3052 allele of Salmonella typhimurium in four DNA repair backgrounds.

    PubMed Central

    DeMarini, D M; Shelton, M L; Abu-Shakra, A; Szakmary, A; Levine, J G

    1998-01-01

    To characterize the hisD3052 -1 frameshift allele of Salmonella typhimurium, we analyzed approximately 6000 spontaneous revertants (rev) for a 2-base deletion hotspot within the sequence (CG)4, and we sequenced approximately 500 nonhotspot rev. The reversion target is a minimum of 76 bases (nucleotides 843-918) that code for amino acids within a nonconserved region of the histidinol dehydrogenase protein. Only 0.4-3.9% were true rev. Of the following classes, 182 unique second-site mutations were identified: hotspot, complex frameshifts requiring DeltauvrB + pKM101 (TA98-specific) or not (concerted), 1-base insertions, duplications, and nonhotspot deletions. The percentages of hotspot mutations were 13.8% in TA1978 (wild type), 24.5% in UTH8413 (pKM101), 31.6% in TA1538 (DeltauvrB), and 41.0% in TA98 (DeltauvrB, pKM101). The DeltauvrB allele decreased by three times the mutant frequency (MF, rev/10(8) survivors) of duplications and increased by about two times the MF of deletions. Separately, the DeltauvrB allele or pKM101 plasmid increased by two to three times the MF of hotspot mutations; combined, they increased this MF by five times. The percentage of 1-base insertions was not influenced by either DeltauvrB or pKM101. Hotspot deletions and TA98-specific complex frameshifts are inducible by some mutagens; concerted complex frameshifts and 1-base insertions are not; and there is little evidence for mutagen-induced duplications and nonhotspot deletions. Except for the base substitutions in TA98-specific complex frameshifts, all spontaneous mutations of the hisD3052 allele are likely templated. The mechanisms may involve (1) the potential of direct and inverted repeats to undergo slippage and misalignment and to form quasi-palindromes and (2) the interaction of these sequences with DNA replication and repair proteins. PMID:9584083

  14. Self-Organizing Distributed Architecture Supporting Dynamic Space Expanding and Reducing in Indoor LBS Environment

    PubMed Central

    Jeong, Seol Young; Jo, Hyeong Gon; Kang, Soon Ju

    2015-01-01

    Indoor location-based services (iLBS) are extremely dynamic and changeable, and include numerous resources and mobile devices. In particular, the network infrastructure requires support for high scalability in the indoor environment, and various resource lookups are requested concurrently and frequently from several locations based on the dynamic network environment. A traditional map-based centralized approach for iLBSs has several disadvantages: it requires global knowledge to maintain a complete geographic indoor map; the central server is a single point of failure; it can also cause low scalability and traffic congestion; and it is hard to adapt to a change of service area in real time. This paper proposes a self-organizing and fully distributed platform for iLBSs. The proposed self-organizing distributed platform provides a dynamic reconfiguration of locality accuracy and service coverage by expanding and contracting dynamically. In order to verify the suggested platform, scalability performance according to the number of inserted or deleted nodes composing the dynamic infrastructure was evaluated through a simulation similar to the real environment. PMID:26016908

  15. Characterization of LHI- and LHI+ Rhodobacter capsulatus pufA mutants.

    PubMed Central

    Richter, P; Brand, M; Drews, G

    1992-01-01

    The NH2 termini of light-harvesting complex I (LHI) polypeptides alpha and beta of Rhodobacter capsulatus are thought to be involved in the assembly of the LHI complex. For a more detailed study of the role of the NH2-terminal segment of the LHI alpha protein in insertion into the intracytoplasmic membrane (ICM) of R. capsulatus, amino acids 6 to 8, 9 to 11, 12 and 13, or 14 and 15 of the LHI alpha protein were deleted. Additionally, the hydrophobic stretch of the amino acids 7 to 11 was lengthened by insertion of hydrophobic or hydrophilic amino acids. All mutations abolished the ability of the mutant strains to form a functional LHI antenna complex. All changes introduced into the LHI alpha protein strongly reduced the stability of its LHI beta partner protein in the ICM. The effects on the mutated protein itself, however, were different. Deletion of amino acids 6 to 8, 9 to 11, or 14 and 15 drastically reduced the amount of the LHI alpha protein inserted into the membrane or prevented its insertion. Deletion of amino acids 12 and 13 and lengthening of the stretch of amino acids 7 to 11 reduced the half-life of the mutated LHI alpha protein in the ICM in comparison with the wild-type LHI alpha protein. Under the selective pressure of low light, revertants which regained a functional LHI antenna complex were identified only for the mutant strain deleted of amino acids 9 to 11 of the LHI alpha polypeptide [U43 (pTPR15)]. The restoration of the LHI+ phenotype was due to an in-frame duplication of 9 bp in the pufA gene directly upstream of the site of deletion present in strain U43(pTPR15). The duplicated nucleotides code for the amino acids Lys, Ile, and Trp. Membranes purified from the revertants were different from that of the reaction center-positive LHI+ LHII- control strain U43(pTX35) in doubling of the carotenoid content and increase of the size of the photosynthetic unit. By separating the reaction center and LHI complexes of the revertants by native preparative gel electrophoresis, we confirmed that the higher amount of carotenoids was associated with the LHI proteins. Images PMID:1569029

  16. Identification of structural variation in mouse genomes.

    PubMed

    Keane, Thomas M; Wong, Kim; Adams, David J; Flint, Jonathan; Reymond, Alexandre; Yalcin, Binnaz

    2014-01-01

    Structural variation is variation in structure of DNA regions affecting DNA sequence length and/or orientation. It generally includes deletions, insertions, copy-number gains, inversions, and transposable elements. Traditionally, the identification of structural variation in genomes has been challenging. However, with the recent advances in high-throughput DNA sequencing and paired-end mapping (PEM) methods, the ability to identify structural variation and their respective association to human diseases has improved considerably. In this review, we describe our current knowledge of structural variation in the mouse, one of the prime model systems for studying human diseases and mammalian biology. We further present the evolutionary implications of structural variation on transposable elements. We conclude with future directions on the study of structural variation in mouse genomes that will increase our understanding of molecular architecture and functional consequences of structural variation.

  17. A new physical mapping approach refines the sex-determining gene positions on the Silene latifolia Y-chromosome

    NASA Astrophysics Data System (ADS)

    Kazama, Yusuke; Ishii, Kotaro; Aonuma, Wataru; Ikeda, Tokihiro; Kawamoto, Hiroki; Koizumi, Ayako; Filatov, Dmitry A.; Chibalina, Margarita; Bergero, Roberta; Charlesworth, Deborah; Abe, Tomoko; Kawano, Shigeyuki

    2016-01-01

    Sex chromosomes are particularly interesting regions of the genome for both molecular genetics and evolutionary studies; yet, for most species, we lack basic information, such as the gene order along the chromosome. Because they lack recombination, Y-linked genes cannot be mapped genetically, leaving physical mapping as the only option for establishing the extent of synteny and homology with the X chromosome. Here, we developed a novel and general method for deletion mapping of non-recombining regions by solving “the travelling salesman problem”, and evaluate its accuracy using simulated datasets. Unlike the existing radiation hybrid approach, this method allows us to combine deletion mutants from different experiments and sources. We applied our method to a set of newly generated deletion mutants in the dioecious plant Silene latifolia and refined the locations of the sex-determining loci on its Y chromosome map.

  18. Deletion Mapping of zwf, the Gene for a Constitutive Enzyme, Glucose 6-Phosphate Dehydrogenase in ESCHERICHIA COLI

    PubMed Central

    Fraenkel, D. G.; Banerjee, Santimoy

    1972-01-01

    Genes for three enzymes of intermediary sugar metabolism in E. coli, zwf (glucose 6-phosphate dehydrogenase, constitutive), edd (gluconate 6-phosphate dehydrase, inducible), and eda (2-keto-3-deoxygluconate 6-phosphate aldolase, differently inducible) are closely linked on the E. coli genetic map, the overall gene order being man... old... eda. edd. zwf... cheB... uvrC... his. One class of apparent revertants of an eda mutant strain contains a secondary mutation in edd, and some of these mutations are deletions extending into zwf. We have used a series of spontaneous edd-zwf deletions to map a series of point mutants in zwf and thus report the first fine structure map of a gene for a constitutive enzyme (zwf). PMID:4560065

  19. Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

    PubMed

    Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

    2014-11-29

    Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

  20. BSM Delta qualification 2, volume 1

    NASA Technical Reports Server (NTRS)

    1994-01-01

    This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into Booster Separation Motor (BSM) flight hardware: (1) vulcanized-in-place nozzle aft closure insulation; (2) new isostatic ATJ bulk graphite throat insert material; (3) adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; (4) deletion of the igniter adapter insulator ring; (5) deletion of igniter adapter/igniter case interface RTV; and (6) deletion of Loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM Total Quality Management (TQM) Team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor testing - consisting of two motors, randomly selected by USBI's onsite quality personnel from production lot AAY, which were modified to accept the enhancements - were completed to provide the final qualification of the enhancements for incorporation into flight hardware. It is concluded that all of the enhancements herein tested are qualified to be incorporated into flight hardware for the BSM.

  1. Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

    PubMed

    Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

    2016-02-01

    The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

  2. BSM Delta Qualification 2, volume 2

    NASA Technical Reports Server (NTRS)

    1994-01-01

    This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM) flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material; adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor tests -- consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- were completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 2 details the environmental testing (vibration and shock) conducted at Marshall Space Flight Center (MSFC) to which the motors were subjected prior to static tests.

  3. Genome Engineering in Bacillus anthracis Using Cre Recombinase

    PubMed Central

    Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

    2006-01-01

    Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

  4. Enhanced production of recombinant proteins with Corynebacterium glutamicum by deletion of insertion sequences (IS elements).

    PubMed

    Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun

    2015-12-29

    In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.

  5. Genetics Home Reference: distal 18q deletion syndrome

    MedlinePlus

    ... Veltman JA, van Ravenswaaij-Arts CM. Genotype-phenotype mapping of chromosome 18q deletions by high-resolution array ... L, Pihko H. 18q deletions: clinical, molecular, and brain MRI findings of 14 individuals. Am J Med ...

  6. Assessing interethnic admixture using an X-linked insertion-deletion multiplex.

    PubMed

    Ribeiro-Rodrigues, Elzemar Martins; dos Santos, Ney Pereira Carneiro; dos Santos, Andrea Kely Campos Ribeiro; Pereira, Rui; Amorim, António; Gusmão, Leonor; Zago, Marco Antonio; dos Santos, Sidney Emanuel Batista

    2009-01-01

    In this study, a PCR multiplex was optimized, allowing the simultaneous analysis of 13 X-chromosome Insertion/deletion polymorphisms (INDELs). Genetic variation observed in Africans, Europeans, and Native Americans reveals high inter-population variability. The estimated proportions of X-chromosomes in an admixed population from the Brazilian Amazon region show a predominant Amerindian contribution (approximately 41%), followed by European (approximately 32%) and African (approximately 27%) contributions. The proportion of Amerindian contribution based on X-linked data is similar to the expected value based on mtDNA and Y-chromosome information. The accuracy for assessing interethnic admixture, and the high differentiation between African, European, and Native American populations, demonstrates the suitability of this INDEL set to measure ancestry proportions in three-hybrid populations, as it is the case of Latin American populations.

  7. U-insertion/deletion RNA editing multiprotein complexes and mitochondrial ribosomes in Leishmania tarentolae are located in antipodal nodes adjacent to the kinetoplast DNA.

    PubMed

    Wong, Richard G; Kazane, Katelynn; Maslov, Dmitri A; Rogers, Kestrel; Aphasizhev, Ruslan; Simpson, Larry

    2015-11-01

    We studied the intramitochondrial localization of several multiprotein complexes involved in U-insertion/deletion RNA editing in trypanosome mitochondria. The editing complexes are located in one or two antipodal nodes adjacent to the kinetoplast DNA (kDNA) disk, which are distinct from but associated with the minicircle catenation nodes. In some cases the proteins are in a bilateral sheet configuration. We also found that mitoribosomes have a nodal configuration. This type of organization is consistent with evidence for protein and RNA interactions of multiple editing complexes to form an ~40S editosome and also an interaction of editosomes with mitochondrial ribosomes. Copyright © 2015 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  8. Angiotensin converting enzyme insertion/deletion polymorphism: association with ethnic origin.

    PubMed

    Barley, J; Blackwood, A; Carter, N D; Crews, D E; Cruickshank, J K; Jeffery, S; Ogunlesi, A O; Sagnella, G A

    1994-08-01

    To determine the distribution of the insertion/deletion (I/D) polymorphism of the angiotensin converting enzyme (ACE) gene in several ethnic groups: Caucasian Europeans, Black Nigerians, Samoan Polynesians and Yanomami Indians. The ratio of the frequencies of the II, ID and DD genotypes were 1:2:1 in the Europeans, but there was a tendency towards a higher frequency of the D allele in the Nigerians. In contrast, the Samoans and the Yanomami Indians displayed a much higher frequency of the I allele than of the D allele. The relationship between ACE genotype and disease in these latter groups is still not known, but the present results clearly suggest that ethnic origin should be carefully considered in the increasing number of studies on the association between I/D ACE genotype and disease aetiology.

  9. High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing

    DTIC Science & Technology

    2010-10-14

    High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and

  10. A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

    PubMed Central

    2012-01-01

    Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

  11. Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs.

    PubMed

    Harrington, Jill M; Kolodner, Richard D

    2007-09-01

    DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding.

  12. Saccharomyces cerevisiae Msh2-Msh3 Acts in Repair of Base-Base Mispairs▿ †

    PubMed Central

    Harrington, Jill M.; Kolodner, Richard D.

    2007-01-01

    DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding. PMID:17636021

  13. BSM Delta Qualification 2, volume 3, book 2

    NASA Technical Reports Server (NTRS)

    1994-01-01

    This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM0 flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material, adhesive EA9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor testing--consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- was completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 3, Book 2 provides various supporting documentation to the previous volumes with regards to the testing of the two Delta qualification units: data acceptance records, thermal conditioning analysis, igniter adapter thermal flake analysis, laboratory adhesive (EA-9394) qualification report, throat insert thermal/structural analysis, Delta Qualification Nonconformance Reports (NCR's), O-ring seating tests, and interim test report for vulcanization process qualification.

  14. A NOS3 polymorphism determines endothelial response to folate in children with type 1 diabetes or obesity.

    PubMed

    Wiltshire, Esko J; Peña, Alexia S; MacKenzie, Karen; Bose-Sundernathan, Tulika; Gent, Roger; Couper, Jennifer J

    2015-02-01

    To determine the effect of polymorphisms in NOS3 and folate pathway enzymes on vascular function and folate status and endothelial response to folate in children with diabetes or obesity. A total of 244 subjects (age 13.8 ± 2.8 years, 125 males) were studied for NOS3 and/or folate pathway polymorphisms using polymerase chain reaction/restriction fragment length polymorphism, including at baseline: 139 with type 1 diabetes; 58 with obesity; and 47 controls. The effect of NOS3 genotype on endothelial response to folate (5 mg) was assessed in 85 subjects with diabetes and 28 obese subjects who received active treatment during intervention trials. Vascular function (flow-mediated dilatation [FMD] and glyceryl trinitrate-mediated dilatation), clinical, and biochemical measurements were assessed at baseline and 8 weeks in folate intervention studies. Folate pathway enzyme and NOS3 polymorphisms did not significantly affect baseline vascular function. The polymorphism in intron 4 of endothelial nitric oxide synthase altered endothelial response to folate significantly: in subjects with diabetes FMD improved by 6.4 ± 5% (insertion carriers) vs 2.3 ± 6.6% (deletion carriers), P = .01; in obese subjects FMD improved by 1.8 ± 5.4% (insertion carriers) and deteriorated by -3.2 ± 7.2% (deletion carriers), P = .05. More subjects carrying the insertion normalized FMD after folate supplementation (insertion 64% vs deletion 28%, χ(2) = 10.14, P = .001). A NOS3 polymorphism predicts endothelial response to folate in children with diabetes or obesity, with implications for vascular risk and folate intervention studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.

    PubMed

    Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan

    2015-07-01

    To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  16. 40 CFR 158.2110 - Microbial pesticides data requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

  17. 40 CFR 158.2110 - Microbial pesticides data requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

  18. 40 CFR 158.2110 - Microbial pesticides data requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

  19. 40 CFR 158.2110 - Microbial pesticides data requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

  20. A Population of Deletion Mutants and an Integrated Mapping and Exome-seq Pipeline for Gene Discovery in Maize

    PubMed Central

    Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David

    2016-01-01

    To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000

  1. L1-associated genomic regions are deleted in somatic cells of the healthy human brain.

    PubMed

    Erwin, Jennifer A; Paquola, Apuã C M; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy A; Alves, Francisco I A; Butcher, Cheyenne R; Herdy, Joseph R; Sarkar, Anindita; Lasken, Roger S; Muotri, Alysson R; Gage, Fred H

    2016-12-01

    The healthy human brain is a mosaic of varied genomes. Long interspersed element-1 (LINE-1 or L1) retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that somatic L1-associated variants (SLAVs) are composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs comprises somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition-independent rearrangements in inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2 (also called PSD93), and affect 44-63% of cells of the cells in the healthy brain.

  2. Implications of the angiotensin converting enzyme gene insertion/deletion polymorphism in health and disease: a snapshot review

    PubMed Central

    Gard, Paul R

    2010-01-01

    This review considers the 250+ papers concerning the association of the angiotensin converting enzyme (ACE) gene insertion/deletion polymorphism (rs1799752) and various disease conditions published in 2009. The deletion allele occurs in approximately 55% of the population and is associated with increased activity of the ACE enzyme. It might be predicted that the D allele, therefore, might be associated with pathologies involving increased activity of the renin-angiotensin system. The D allele was seen to be associated with an increased risk of hypertension, pre-eclampsia, heart failure, cerebral infarct, diabetic nephropathy, encephalopathy, asthma, severe hypoglycaemia in diabetes, gastric cancer (in Caucasians) and poor prognosis following kidney transplant. On the positive side, the D allele appears to offer protection against schizophrenia and chronic periodontitis and confers greater up-per-body strength in old age. The I allele, meanwhile, offers improved endurance/athletic performance and aerobic capacity as determined by lung function tests, although it does increase the risk of oral squamous cell carcinoma and obstructive sleep apnoea in hypertensives. PMID:21537387

  3. Generation of a Maize B Centromere Minimal Map Containing the Central Core Domain.

    PubMed

    Ellis, Nathanael A; Douglas, Ryan N; Jackson, Caroline E; Birchler, James A; Dawe, R Kelly

    2015-10-28

    The maize B centromere has been used as a model for centromere epigenetics and as the basis for building artificial chromosomes. However, there are no sequence resources for this important centromere. Here we used transposon display for the centromere-specific retroelement CRM2 to identify a collection of 40 sequence tags that flank CRM2 insertion points on the B chromosome. These were confirmed to lie within the centromere by assaying deletion breakpoints from centromere misdivision derivatives (intracentromere breakages caused by centromere fission). Markers were grouped together on the basis of their association with other markers in the misdivision series and assembled into a pseudocontig containing 10.1 kb of sequence. To identify sequences that interact directly with centromere proteins, we carried out chromatin immunoprecipitation using antibodies to centromeric histone H3 (CENH3), a defining feature of functional centromeric sequences. The CENH3 chromatin immunoprecipitation map was interpreted relative to the known transmission rates of centromere misdivision derivatives to identify a centromere core domain spanning 33 markers. A subset of seven markers was mapped in additional B centromere misdivision derivatives with the use of unique primer pairs. A derivative previously shown to have no canonical centromere sequences (Telo3-3) lacks these core markers. Our results provide a molecular map of the B chromosome centromere and identify key sequences within the map that interact directly with centromeric histone H3. Copyright © 2015 Ellis et al.

  4. Insertion and deletion polymorphisms of the ancient AluS family in the human genome.

    PubMed

    Kryatova, Maria S; Steranka, Jared P; Burns, Kathleen H; Payer, Lindsay M

    2017-01-01

    Polymorphic Alu elements account for 17% of structural variants in the human genome. The majority of these belong to the youngest AluY subfamilies, and most structural variant discovery efforts have focused on identifying Alu polymorphisms from these currently retrotranspositionally active subfamilies. In this report we analyze polymorphisms from the evolutionarily older AluS subfamily, whose peak activity was tens of millions of years ago. We annotate the AluS polymorphisms, assess their likely mechanism of origin, and evaluate their contribution to structural variation in the human genome. Of 52 previously reported polymorphic AluS elements ascertained for this study, 48 were confirmed to belong to the AluS subfamily using high stringency subfamily classification criteria. Of these, the majority (77%, 37/48) appear to be deletion polymorphisms. Two polymorphic AluS elements (4%) have features of non-classical Alu insertions and one polymorphic AluS element (2%) likely inserted by a mechanism involving internal priming. Seven AluS polymorphisms (15%) appear to have arisen by the classical target-primed reverse transcription (TPRT) retrotransposition mechanism. These seven TPRT products are 3' intact with 3' poly-A tails, and are flanked by target site duplications; L1 ORF2p endonuclease cleavage sites were also observed, providing additional evidence that these are L1 ORF2p endonuclease-mediated TPRT insertions. Further sequence analysis showed strong conservation of both the RNA polymerase III promoter and SRP9/14 binding sites, important for mediating transcription and interaction with retrotransposition machinery, respectively. This conservation of functional features implies that some of these are fairly recent insertions since they have not diverged significantly from their respective retrotranspositionally competent source elements. Of the polymorphic AluS elements evaluated in this report, 15% (7/48) have features consistent with TPRT-mediated insertion, thus suggesting that some AluS elements have been more active recently than previously thought, or that fixation of AluS insertion alleles remains incomplete. These data expand the potential significance of polymorphic AluS elements in contributing to structural variation in the human genome. Future discovery efforts focusing on polymorphic AluS elements are likely to identify more such polymorphisms, and approaches tailored to identify deletion alleles may be warranted.

  5. PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

    PubMed

    Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

    2016-11-03

    Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

  6. High-density ddRAD linkage and yield-related QTL mapping delimits a chromosomal region responsible for oil content in rapeseed (Brassica napus L.).

    PubMed

    Chen, Jun; Wang, Bo; Zhang, Yueli; Yue, Xiaopeng; Li, Zhaohong; Liu, Kede

    2017-06-01

    Rapeseed ( Brassica napus L.) is one of the most important oil crops almost all over the world. Seed-related traits, including oil content (OC), silique length (SL), seeds per silique (SS), and seed weight (SW), are primary targets for oil yield improvement. To dissect the genetic basis of these traits, 192 recombinant inbred lines (RILs) were derived from two parents with distinct oil content and silique length. High-density linkage map with a total length of 1610.4 cM were constructed using 1,329 double-digestion restriction site associated DNA (ddRAD) markers, 107 insertion/deletions (INDELs), and 90 well-distributed simple sequence repeats (SSRs) markers. A total of 37 consensus quantitative trait loci (QTLs) were detected for the four traits, with individual QTL explained 3.1-12.8% of the phenotypic variations. Interestingly, one OC consensus QTL ( cqOCA10b ) on chromosome A10 was consistently detected in all three environments, and explained 9.8% to 12.8% of the OC variation. The locus was further delimited into an approximately 614 kb genomic region, in which the flanking markers could be further evaluated for marker-assisted selection in rapeseed OC improvement and the candidate genes targeted for map-based cloning and genetic manipulation.

  7. Phylogenetic inference under varying proportions of indel-induced alignment gaps

    PubMed Central

    Dwivedi, Bhakti; Gadagkar, Sudhindra R

    2009-01-01

    Background The effect of alignment gaps on phylogenetic accuracy has been the subject of numerous studies. In this study, we investigated the relationship between the total number of gapped sites and phylogenetic accuracy, when the gaps were introduced (by means of computer simulation) to reflect indel (insertion/deletion) events during the evolution of DNA sequences. The resulting (true) alignments were subjected to commonly used gap treatment and phylogenetic inference methods. Results (1) In general, there was a strong – almost deterministic – relationship between the amount of gap in the data and the level of phylogenetic accuracy when the alignments were very "gappy", (2) gaps resulting from deletions (as opposed to insertions) contributed more to the inaccuracy of phylogenetic inference, (3) the probabilistic methods (Bayesian, PhyML & "MLε, " a method implemented in DNAML in PHYLIP) performed better at most levels of gap percentage when compared to parsimony (MP) and distance (NJ) methods, with Bayesian analysis being clearly the best, (4) methods that treat gapped sites as missing data yielded less accurate trees when compared to those that attribute phylogenetic signal to the gapped sites (by coding them as binary character data – presence/absence, or as in the MLε method), and (5) in general, the accuracy of phylogenetic inference depended upon the amount of available data when the gaps resulted from mainly deletion events, and the amount of missing data when insertion events were equally likely to have caused the alignment gaps. Conclusion When gaps in an alignment are a consequence of indel events in the evolution of the sequences, the accuracy of phylogenetic analysis is likely to improve if: (1) alignment gaps are categorized as arising from insertion events or deletion events and then treated separately in the analysis, (2) the evolutionary signal provided by indels is harnessed in the phylogenetic analysis, and (3) methods that utilize the phylogenetic signal in indels are developed for distance methods too. When the true homology is known and the amount of gaps is 20 percent of the alignment length or less, the methods used in this study are likely to yield trees with 90–100 percent accuracy. PMID:19698168

  8. Fluorescence in situ hybridization analyses of hematologic malignancies reveal frequent cytogenetically unrecognized 12p rearrangements.

    PubMed

    Andreasson, P; Johansson, B; Billström, R; Garwicz, S; Mitelman, F; Höglund, M

    1998-03-01

    Thirty-two hematologic malignancies--nine with cytogenetically identified 12p abnormalities and 23 with whole or partial losses of chromosome 12--were selected for fluorescence in situ hybridization (FISH) investigations of 12p. These analyses revealed structural 12p changes, such as translocations, deletions, insertions, inversions and amplification, in 20 cases. ETV6 rearrangements were detected in three acute leukemias. One acute undifferentiated leukemia had t(4;12)(q12;p13) as the sole anomaly. The second case, an acute myeloid leukemia (AML), displayed complex abnormalities involving, among others, chromosomes 9 and 12. The third case, also an AML, had an insertion of the distal part of ETV6 into chromosome arm 11q and into multiple ring chromosomes, which also contained chromosome 11 material, resulting in an amplification of a possible fusion gene. The fusion partners in these cases remain to be identified. Thirty-one additional breakpoints on 12p could be characterized in detail. The majority of these breaks were shown to result in interchromosomal rearrangements, possibly indicating the location of hitherto unrecognized genes of importance in the pathogenesis of hematologic malignancies. The FISH analyses disclosed terminal or interstitial 12p deletions in 18 cases. Seven myeloid malignancies showed deletions restricted to a region, including ETV6 and CDKN1B, which has been reported to be frequently lost in leukemias. In four cases, the deletions involved both these genes, whereas two AML displayed loss of CDKN1B but not ETV6, supporting previously reported findings indicating a region of deletion not including this gene. However, one myelodysplastic syndrome lacked one copy of ETV6 but not CDKN1B. Hence, we suggest a minimal region of deletion on 12p located between the ETV6 and CDKN1B genes.

  9. Hot Spots of Recombination in Fission Yeast: Inactivation of the M26 Hot Spot by Deletion of the Ade6 Promoter and the Novel Hotspot Ura4-Aim

    PubMed Central

    Zahn-Zabal, M.; Lehmann, E.; Kohli, J.

    1995-01-01

    The M26 mutation in the ade6 gene of Schizosaccharomyces pombe creates a hot spot of meiotic recombination. A single base substitution, the M26 mutation is situated within the open reading frame, near the 5' end. It has previously been shown that the heptanucleotide sequence 5' ATGACGT 3', which includes the M26 mutation, is required for hot spot activity. The 510-bp ade6-delXB deletion encompasses the promoter and the first 23 bp of the open reading frame, ending 112 bp upstream of M26. Deletion of the promoter in cis to M26 abolishes hot spot activity, while deletion in trans to M26 has no effect. Homozygous deletion of the promoter also eliminates M26 hot spot activity, indicating that the heterology created through deletion of the promoter per se is not responsible for the loss of hot spot activity. Thus, DNA sequences other than the heptanucleotide 5' ATGACGT 3', which must be located at the 5' end of the ade6 gene, appear to be required for hot spot activity. While the M26 hotspot stimulates crossovers associated with M26 conversion, it does not affect the crossover frequency in the intervals adjacent to ade6. The flanking marker ura4-aim, a heterology created by insertion of the ura4(+) gene upstream of ade6, turned out to be a hot spot itself. It shows disparity of conversion with preferential loss of the insertion. The frequency of conversion at ura4-aim is reduced when the M26 hot spot is active 15 kb away, indicating competition for recombination factors by hot spots in close proximity. PMID:7498729

  10. Illegitimate V(D)J recombination-mediated deletions in Notch1 and Bcl11b are not sufficient for extensive clonal expansion and show minimal age or sex bias in frequency or junctional processing

    PubMed Central

    Champagne, Devin P.; Shockett, Penny E.

    2014-01-01

    Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is similar for both genes and consistent with results at the TCRβ locus. Non-templated (N) nucleotide insertions appear to increase between fetal and postnatal stages for Notch1, consistent with normal terminal deoxynucleotidyl transferase (TdT) activity; however, neonatal Bcl11b junctions contain elevated levels of N insertions. Finally, contrasting with results at the HPRT1 locus, we find no obvious age or gender bias in junctional processing, and inverted repeats at recessed coding ends (Pr nucleotides) correspond mostly to single-base additions consistent with normal TdT activity. PMID:24530429

  11. Acid Evolution of Escherichia coli K-12 Eliminates Amino Acid Decarboxylases and Reregulates Catabolism.

    PubMed

    He, Amanda; Penix, Stephanie R; Basting, Preston J; Griffith, Jessie M; Creamer, Kaitlin E; Camperchioli, Dominic; Clark, Michelle W; Gonzales, Alexandra S; Chávez Erazo, Jorge Sebastian; George, Nadja S; Bhagwat, Arvind A; Slonczewski, Joan L

    2017-06-15

    Acid-adapted strains of Escherichia coli K-12 W3110 were obtained by serial culture in medium buffered at pH 4.6 (M. M. Harden, A. He, K. Creamer, M. W. Clark, I. Hamdallah, K. A. Martinez, R. L. Kresslein, S. P. Bush, and J. L. Slonczewski, Appl Environ Microbiol 81:1932-1941, 2015, https://doi.org/10.1128/AEM.03494-14). Revised genomic analysis of these strains revealed insertion sequence (IS)-driven insertions and deletions that knocked out regulators CadC (acid induction of lysine decarboxylase), GadX (acid induction of glutamate decarboxylase), and FNR (anaerobic regulator). Each acid-evolved strain showed loss of one or more amino acid decarboxylase systems, which normally help neutralize external acid (pH 5 to 6) and increase survival in extreme acid (pH 2). Strains from populations B11, H9, and F11 had an IS 5 insertion or IS-mediated deletion in cadC , while population B11 had a point mutation affecting the arginine activator adiY The cadC and adiY mutants failed to neutralize acid in the presence of exogenous lysine or arginine. In strain B11-1, reversion of an rpoC (RNA polymerase) mutation partly restored arginine-dependent neutralization. All eight strains showed deletion or downregulation of the Gad acid fitness island. Strains with the Gad deletion lost the ability to produce GABA (gamma-aminobutyric acid) and failed to survive extreme acid. Transcriptome sequencing (RNA-seq) of strain B11-1 showed upregulated genes for catabolism of diverse substrates but downregulated acid stress genes (the biofilm regulator ariR , yhiM , and Gad). Other strains showed downregulation of H 2 consumption mediated by hydrogenases ( hya and hyb ) which release acid. Strains F9-2 and F9-3 had a deletion of fnr and showed downregulation of FNR-dependent genes ( dmsABC , frdABCD , hybABO , nikABCDE , and nrfAC ). Overall, strains that had evolved in buffered acid showed loss or downregulation of systems that neutralize unbuffered acid and showed altered regulation of catabolism. IMPORTANCE Experimental evolution of an enteric bacterium under a narrow buffered range of acid pH leads to loss of genes that enhance fitness above or below the buffered pH range, including loss of enzymes that may raise external pH in the absence of buffer. Prominent modes of evolutionary change involve IS-mediated insertions and deletions that knock out key regulators. Over generations of acid stress, catabolism undergoes reregulation in ways that differ for each evolving strain. Copyright © 2017 American Society for Microbiology.

  12. Rapid 3D Reconstruction for Image Sequence Acquired from UAV Camera

    PubMed Central

    Qu, Yufu; Huang, Jianyu; Zhang, Xuan

    2018-01-01

    In order to reconstruct three-dimensional (3D) structures from an image sequence captured by unmanned aerial vehicles’ camera (UAVs) and improve the processing speed, we propose a rapid 3D reconstruction method that is based on an image queue, considering the continuity and relevance of UAV camera images. The proposed approach first compresses the feature points of each image into three principal component points by using the principal component analysis method. In order to select the key images suitable for 3D reconstruction, the principal component points are used to estimate the interrelationships between images. Second, these key images are inserted into a fixed-length image queue. The positions and orientations of the images are calculated, and the 3D coordinates of the feature points are estimated using weighted bundle adjustment. With this structural information, the depth maps of these images can be calculated. Next, we update the image queue by deleting some of the old images and inserting some new images into the queue, and a structural calculation of all the images can be performed by repeating the previous steps. Finally, a dense 3D point cloud can be obtained using the depth–map fusion method. The experimental results indicate that when the texture of the images is complex and the number of images exceeds 100, the proposed method can improve the calculation speed by more than a factor of four with almost no loss of precision. Furthermore, as the number of images increases, the improvement in the calculation speed will become more noticeable. PMID:29342908

  13. Rapid 3D Reconstruction for Image Sequence Acquired from UAV Camera.

    PubMed

    Qu, Yufu; Huang, Jianyu; Zhang, Xuan

    2018-01-14

    In order to reconstruct three-dimensional (3D) structures from an image sequence captured by unmanned aerial vehicles' camera (UAVs) and improve the processing speed, we propose a rapid 3D reconstruction method that is based on an image queue, considering the continuity and relevance of UAV camera images. The proposed approach first compresses the feature points of each image into three principal component points by using the principal component analysis method. In order to select the key images suitable for 3D reconstruction, the principal component points are used to estimate the interrelationships between images. Second, these key images are inserted into a fixed-length image queue. The positions and orientations of the images are calculated, and the 3D coordinates of the feature points are estimated using weighted bundle adjustment. With this structural information, the depth maps of these images can be calculated. Next, we update the image queue by deleting some of the old images and inserting some new images into the queue, and a structural calculation of all the images can be performed by repeating the previous steps. Finally, a dense 3D point cloud can be obtained using the depth-map fusion method. The experimental results indicate that when the texture of the images is complex and the number of images exceeds 100, the proposed method can improve the calculation speed by more than a factor of four with almost no loss of precision. Furthermore, as the number of images increases, the improvement in the calculation speed will become more noticeable.

  14. The N-terminus of the human copper transporter 1 (hCTR1) is localized extracellularly, and interacts with itself.

    PubMed Central

    Klomp, Adriana E M; Juijn, Jenneke A; van der Gun, Linda T M; van den Berg, Inge E T; Berger, Ruud; Klomp, Leo W J

    2003-01-01

    We have used indirect immunofluorescense studies and glycosylation-site insertion and deletion mapping to characterize the topology of human copper transporter 1 (hCTR1), the putative human high-affinity copper-import protein. Both approaches indicated that hCTR1 contains three transmembrane domains and that the N-terminus of hCTR1, which contains several putative copper-binding sites, is localized extracellularly, whereas the C-terminus is exposed to the cytosol. Based on previous observations that CTR1 proteins form high-molecular-mass complexes, we investigated directly whether CTR1 proteins interact with themselves. Yeast two-hybrid studies showed that interaction of yeast, mouse, rat and human CTR1 occurs at the sites of their N-terminal domains, and is not dependent on the copper concentration in the growth media. Analysis of deletion constructs indicated that multiple regions in the N-terminus are essential for this self-interaction. In contrast, the N-terminal tail of the presumed low-affinity copper transporter, hCTR2, does not interact with itself. Taken together, these results suggest that CTR1 spans the membrane at least six times, permitting formation of a channel, which is consistent with its proposed role as a copper transporter. PMID:12466020

  15. Magnetic resonance spectroscopy and molecular studies in ornithine transcarbamylase deficiency novel mutation c.802A>G in exon 8 (p.Met268Val).

    PubMed

    Jamroz, E; Paprocka, J; Sokół, M; Popowska, E; Ciara, E

    2013-01-01

    Ornithine transcarbamylase (OTC) deficiency, an X-linked, semidominant disorder, is the most common inherited de-fect in ureagenesis, resulting in hyperammonaemia type II. The OTC gene, localised on chromosome X, has been mapp-ed to band Xp21.1, proximate to the Duchenne muscular dystrophy (DMD) gene. More than 350 different mutations, including missense, nonsense, splice-site changes, small de-letions or insertions and gross deletions, have been describ-ed so far. Almost all mutations in consensus splicing sites confer a neonatal phenotype. Most mutations in the OTC gene are 'private' and are distributed throughout the gene with a paucity of mutation in the sequence encoding the leader peptide (exon 1 and beginning of exon 2) and in exon 7. They have familial origin or occur de novo. Even with sequencing of the entire reading frame and exon/intron boundaries, only about 80% of the mutations are detected in patients with proven OTC deficiency. The remainder probably occur within the introns or in regulatory domains. The authors present a 4-year-old boy with the unreported missense mutation c.802A>G. The nucleotide transition leads to amino acid substitution Met to Val at codon 268 of the OTC protein.

  16. Concealed Accessory Pathways with a Single Ventricular and Two Discrete Atrial Insertion Sites.

    PubMed

    Kipp, Ryan T; Abu Sham'a, Raed; Hiroyuki, Ito; Han, Frederick T; Refaat, Marwan; Hsu, Jonathan C; Field, Michael E; Kopp, Douglas E; Marcus, Gregory M; Scheinman, Melvin M; Hoffmayer, Kurt S

    2017-03-01

    Atrioventricular reciprocating tachycardia (AVRT) utilizing a concealed accessory pathway is common. It is well appreciated that some patients may have multiple accessory pathways with separate atrial and ventricular insertion sites. We present three cases of AVRT utilizing concealed pathways with evidence that each utilizing a single ventricular insertion and two discrete atrial insertion sites. In case one, two discrete atrial insertion sites were mapped in two separate procedures, and only during the second ablation was the Kent potential identified. Ablation of the Kent potential at this site remote from the two atrial insertion sites resulted in the termination of the retrograde conduction in both pathways. Case two presented with supraventricular tachycardia (SVT) with alternating eccentric atrial activation patterns without alteration in the tachycardia cycle length. The two distinct atrial insertion sites during orthodromic AVRT and ventricular pacing were targeted and each of the two atrial insertion sites were successfully mapped and ablated. In case three, retrograde decremental conduction utilizing both atrial insertion sites was identified prior to ablation. After mapping and ablation of the first discrete atrial insertion site, tachycardia persisted utilizing the second atrial insertion site. Only after ablation of the second atrial insertion site was SVT noninducible, and VA conduction was no longer present. Concealed retrograde accessory pathways with discrete atrial insertion sites may have a common ventricular insertion site. Identification and ablation of the ventricular insertion site or the separate discrete atrial insertion sites result in successful treatment. © 2017 Wiley Periodicals, Inc.

  17. A 16 kb naturally occurring genomic deletion including mce and PPE genes in Mycobacterium avium subspecies paratuberculosis isolates from goats with Johne's disease.

    PubMed

    Castellanos, Elena; Aranaz, Alicia; de Juan, Lucia; Dominguez, Lucas; Linedale, Richard; Bull, Tim J

    2012-09-14

    In this study we characterise the genomic and transcriptomic variability of a natural deletion strain of Mycobacterium avium subspecies paratuberculosis (MAP) prevalent in Spanish Guadarrama goats. Using a pan-genome microarray including MAP and M. avium subspecies hominissuis 104 genomes (MAPAC) we demonstrate the genotype to be MAP Type II with a single deletion of 19 contiguous ORFs (16 kb) including a complete mammalian cell entry (mce7_1) operon and adjacent proline-glutamic acid (PE)/proline-proline-glutamic acid (PPE) genes. A deletion specific PCR test was developed and a subsequent screening identified four goat herds infected with the variant strain. Each was located in central Spain and showed epidemiological links suggestive of transmission between herds. A majority of animals infected with the variant manifested a paucibacillary form of the disease. Comparisons between virulent complete genome compliment strains isolated from multibacillary diseased goats and the MAP variant strain during entry into activated macrophages demonstrated an increased sensitivity in the variant to intracellular killing in human and ovine macrophages. As PPE and mce genes are associated with mycobacterial virulence and pathogenesis we investigated the interplay of these gene sets during cell entry using the MAPAC array. This showed significant differential transcriptome profiles compared to full genome complement MAP controls that included changes in other undeleted mce operons and PE/PPE genes, esx-like signalling operons and stress response/fatty acid metabolism pathways. This strain represents the first report of a MAP Type II genotype with significant natural genomic deletions which remains able to cause disease and is transmissible in goats. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    PubMed

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  19. Subtelomeric Deletion of Chromosome 10p15.3: Clinical Findings and Molecular Cytogenetic Characterization

    PubMed Central

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H.; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia AL; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B.A.; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-01-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11,), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM# 608668) and DIP2C (OMIM# 611380) (UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. PMID:22847950

  20. Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

    PubMed

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-09-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

  1. Comprehensive annotation of Glossina pallidipes salivary gland hypertrophy virus from Ethiopian tsetse flies: a proteogenomics approach

    PubMed Central

    Kariithi, Henry M.; Cousserans, François; Parker, Nicolas J.; İnce, İkbal Agah; Scully, Erin D.; Boeren, Sjef; Geib, Scott M.; Mekonnen, Solomon; Vlak, Just M.; Parker, Andrew G.; Vreysen, Marc J. B.; Bergoin, Max

    2016-01-01

    Glossina pallidipes salivary gland hypertrophy virus (GpSGHV; family Hytrosaviridae) can establish asymptomatic and symptomatic infection in its tsetse fly host. Here, we present a comprehensive annotation of the genome of an Ethiopian GpSGHV isolate (GpSGHV-Eth) compared with the reference Ugandan GpSGHV isolate (GpSGHV-Uga; GenBank accession number EF568108). GpSGHV-Eth has higher salivary gland hypertrophy syndrome prevalence than GpSGHV-Uga. We show that the GpSGHV-Eth genome has 190 291 nt, a low G+C content (27.9 %) and encodes 174 putative ORFs. Using proteogenomic and transcriptome mapping, 141 and 86 ORFs were mapped by transcripts and peptides, respectively. Furthermore, of the 174 ORFs, 132 had putative transcriptional signals [TATA-like box and poly(A) signals]. Sixty ORFs had both TATA-like box promoter and poly(A) signals, and mapped by both transcripts and peptides, implying that these ORFs encode functional proteins. Of the 60 ORFs, 10 ORFs are homologues to baculovirus and nudivirus core genes, including three per os infectivity factors and four RNA polymerase subunits (LEF4, 5, 8 and 9). Whereas GpSGHV-Eth and GpSGHV-Uga are 98.1 % similar at the nucleotide level, 37 ORFs in the GpSGHV-Eth genome had nucleotide insertions (n = 17) and deletions (n = 20) compared with their homologues in GpSGHV-Uga. Furthermore, compared with the GpSGHV-Uga genome, 11 and 24 GpSGHV ORFs were deleted and novel, respectively. Further, 13 GpSGHV-Eth ORFs were non-canonical; they had either CTG or TTG start codons instead of ATG. Taken together, these data suggest that GpSGHV-Eth and GpSGHV-Uga represent two different lineages of the same virus. Genetic differences combined with host and environmental factors possibly explain the differential GpSGHV pathogenesis observed in different G. pallidipes colonies. PMID:26801744

  2. Effects of the -141C insertion/deletion polymorphism in the dopamine D2 receptor gene on the dopamine system in the striatum in patients with schizophrenia.

    PubMed

    Matsumoto, Junya; Nagaoka, Atsuko; Kunii, Yasuto; Miura, Itaru; Hino, Mizuki; Niwa, Shin-Ichi; Nawa, Hiroyuki; Takahashi, Hitoshi; Kakita, Akiyoshi; Yabe, Hirooki

    2018-06-01

    The relationships between -141C insertion/deletion (Ins/Del) polymorphisms in the dopamine D2 receptor gene and the two dopamine system integrators, i.e., dopamine- and cAMP-regulated phosphoprotein of molecular weight 32 kDa (DARPP-32) and calcineurin (CaN), are still unclear. In this study, we assessed the effect of this polymorphism on DARPP-32 and CaN protein expression in the postmortem striatum of patients with schizophrenia and control individuals. The expression levels of truncated DARPP and CaN were lower in Del allele carriers. These findings provide important insights into the mechanism by which this genotype could result in a poor response to antipsychotic drugs. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

    PubMed

    Kietrys, Anna M; Velema, Willem A; Kool, Eric T

    2017-11-29

    Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

  4. Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis.

    PubMed

    Vishwakarma, Manish K; Kale, Sandip M; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K; Varshney, Rajeev K

    2017-01-01

    Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis , we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut ( Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis . The majority of the InDels were of single bp (43.7%) and 2-10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of "K" genome, although distinct from both the "A" and "B" genomes, but more similar to "B" genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications.

  5. High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells

    PubMed Central

    Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian

    2015-01-01

    The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076

  6. Association of CAA and TATC Insertion/Deletion Genetic Polymorphisms in RTN4 3'-UTR with Hepatocellular Carcinoma Risk.

    PubMed

    Wang, NaNa; Chen, KeYu; Xu, Jia; Yuan, Fang; Li, HongYu; Deng, FengMei; Zhang, LuShun

    2018-01-01

    Evidence from recent researchers suggested that RTN4 is a multifunctional gene, including tumor suppression, apoptosis, vascular remodeling, and inhibition of axonal regeneration. The CAA and TATC insertion/deletion polymorphisms (CAA/TATC polymorphisms) of RTN4 3″-untranslated regions (UTRs) have been linked to cervical squamous cell carcinoma (CSCC), uterine leiomyomas (UL) and non-small cell lung cancer (NSCLC). However, the association between these two polymorphisms sites with Hepatocellular Carcinoma (HCC) risk was not carry out before. A total of 284 HCC patients and 484 control subjects were recruited for this study. The RTN4 CAA/TATC insertion/deletion genotypes were determined using polymerase chain reaction (PCR) assay. The ID/DD genotypes of CAA were significantly associated with an increased risk of HCC compared with the II genotype (ID vs. II: OR = 1.50, 95% CI: 1.10-2.04; DD vs. II: OR = 2.00, 95%CI: 1.15-3.46). Meanwhile, the frequency of D allele of CAA was significantly related with an increased risk of HCC compared with the I allele (D vs. I: OR = 1.39, 95% CI: 1.12-1.73). The ID genotypes of TATC was significantly associated with an increased risk of HCC compared with the DD genotype (ID vs. DD: OR = 1.70, 95% CI: 1.23-2.33). The present study provided evidence that RTN4 CAA/TATC polymorphisms were associated with HCC development in Chinese Han population.

  7. Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

    PubMed

    Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

    2017-12-01

    Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

  8. Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis

    PubMed Central

    Vishwakarma, Manish K.; Kale, Sandip M.; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K.; Varshney, Rajeev K.

    2017-01-01

    Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis, we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut (Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis. The majority of the InDels were of single bp (43.7%) and 2–10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of “K” genome, although distinct from both the “A” and “B” genomes, but more similar to “B” genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications. PMID:29312366

  9. CRISPR-based screening of genomic island excision events in bacteria.

    PubMed

    Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

    2015-06-30

    Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

  10. Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3.

    PubMed

    Habraken, Y; Sung, P; Prakash, L; Prakash, S

    1996-09-01

    DNA-mismatch repair removes mismatches from the newly replicated DNA strand. In humans, mutations in the mismatch repair genes hMSH2, hMLH1, hPMS1 and hPMS2 result in hereditary non-polyposis colorectal cancer (HNPCC) [1-8]. The hMSH2 (MSH for MutS homologue) protein forms a complex with a 160 kDa protein, and this heterodimer, hMutSalpha, has high affinity for a G/T mismatch [9,10]. Cell lines in which the 160 kDa subunit of hMutSalpha is mutated are specifically defective in the repair of base-base and single-nucleotide insertion/deletion mismatches [9,11]. Genetic studies in S. cerevisiae have suggested that MSH2 functions with either MSH3 or MSH6 in mismatch repair, and, in the absence of the latter two genes, MSH2 is inactive [12,13]. MSH6 encodes the yeast counterpart of the 160 kDa subunit of hMutSalpha [12,13]. As in humans, yeast MSH6 forms a complex with MSH2, and the MSH2-MSH6 heterodimer binds a G/T mismatch [14]. Here, we find that MSH2 and MSH3 form another stable heterodimer, and we purify this heterodimer to near homogeneity. We show that MSH2-MSH3 has low affinity for a G/T mismatch but binds to insertion/deletion mismatches with high specificity, unlike MSH2-MSH6.

  11. Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

    PubMed

    Bai, Ying; Chen, Yibing; Kong, Xiangdong

    2018-02-02

    It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

  12. A Study of Airbase Facility/Utility Energy R and D Requirements

    DTIC Science & Technology

    1992-04-01

    facility/utility energy requirements for system implementations, modifications, or deletions were collected, entered into the database, and compared with...BASE_________ ENERGY LOS1 %) 200 MBtu TOTAL COSTS 100 Motu ELECTRIC 100 Motu THERMAL337 Motu ,, OF1FUEL 100 MBtu OF(10 11 PURCHASED S 1800.00 ELECTRIC...this page. Usage Data = *.BTU I. Correct spelling of Base name and Command 2. Macro does the following: Inserts or deletes columns or rows so that D4

  13. A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

    PubMed

    Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

    2014-12-01

    Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

  14. Surveying a supercoil domain by using the gamma delta resolution system in Salmonella typhimurium.

    PubMed Central

    Higgins, N P; Yang, X; Fu, Q; Roth, J R

    1996-01-01

    A genetic system was developed to investigate the supercoil structure of bacterial chromosomes. New res-carrying transposons were derived from MudI1734 (MudJr1 and MudJr2) and Tn10 (Tn10dGn). The MudJr1 and MudJr2 elements each have a res site in opposite orientation so that when paired with a Tn10dGn element in the same chromosome, one MudJr res site will be ordered as a direct repeat. Deletion formation was studied in a nonessential region (approximately 100 kb) that extends from the his operon through the cob operon. Strains with a MudJr insertion in the cobT gene at the 5' end of the cob operon plus a Tn10dGn insertion positioned either clockwise or counterclockwise from cobT were exposed to a burst of RES protein. Following a pulse of resolvase expression, deletion formation was monitored by scoring the loss of the Lac+ phenotype or by loss of tetracycline resistance. In exponentially growing populations, deletion products appeared quickly in some cells (in 10 min) but also occurred more than an hour after RES induction. The frequency of deletion (y) diminished with increasing distance (x) between res sites. Results from 15 deletion intervals fit the exponential equation y = 120 . 10(-0.02x). We found that res sites can be plectonemically interwound over long distances ( > 100 kb) and that barriers to supercoil diffusion are placed stochastically within the 43- to 45-min region of the chromosome. PMID:8631670

  15. Transgenic expression of Map3k4 rescues T-associated sex reversal (Tas) in mice

    PubMed Central

    Warr, Nick; Siggers, Pam; Carré, Gwenn-Aël; Bogani, Debora; Brixey, Rachel; Akiyoshi, Mika; Tachibana, Makoto; Teboul, Lydia; Wells, Sara; Sanderson, Jeremy; Greenfield, Andy

    2014-01-01

    Disorders of sex development in the human population range in severity from mild genital defects to gonadal sex reversal. XY female development has been associated with heterozygous mutations in several genes, including SOX9, WT1 and MAP3K1. In contrast, XY sex reversal in mice usually requires complete absence of testis-determining gene products. One exception to this involves T-associated sex reversal (Tas), a phenomenon characterized by the formation of ovotestes or ovaries in XY mice hemizygous for the hairpin-tail (Thp) or T-Orleans (TOrl) deletions on proximal mouse chromosome 17. We recently reported that mice heterozygous for a null allele of Map3k4, which resides in the Thp deletion, exhibit XY ovotestis development and occasional gonadal sex reversal on the sensitized C57BL/6J-YAKR (B6-YAKR) genetic background, reminiscent of the Tas phenotype. However, these experiments did not exclude the possibility that loss of other loci in the Thp deletion, or other effects of the deletion itself, might contribute to Tas. Here, we show that disruption to Sry expression underlies XY gonadal defects in B6-YAKR embryos harbouring the Thp deletion and that a functional Map3k4 bacterial artificial chromosome rescues these abnormalities by re-establishing a normal Sry expression profile. These data demonstrate that Map3k4 haploinsufficiency is the cause of T-associated sex reversal and that levels of this signalling molecule are a major determinant of the expression profile of Sry. PMID:24452333

  16. Global Genomic Diversity of Oryza sativa Varieties Revealed by Comparative Physical Mapping

    PubMed Central

    Wang, Xiaoming; Kudrna, David A.; Pan, Yonglong; Wang, Hao; Liu, Lin; Lin, Haiyan; Zhang, Jianwei; Song, Xiang; Goicoechea, Jose Luis; Wing, Rod A.; Zhang, Qifa; Luo, Meizhong

    2014-01-01

    Bacterial artificial chromosome (BAC) physical maps embedding a large number of BAC end sequences (BESs) were generated for Oryza sativa ssp. indica varieties Minghui 63 (MH63) and Zhenshan 97 (ZS97) and were compared with the genome sequences of O. sativa spp. japonica cv. Nipponbare and O. sativa ssp. indica cv. 93-11. The comparisons exhibited substantial diversities in terms of large structural variations and small substitutions and indels. Genome-wide BAC-sized and contig-sized structural variations were detected, and the shared variations were analyzed. In the expansion regions of the Nipponbare reference sequence, in comparison to the MH63 and ZS97 physical maps, as well as to the previously constructed 93-11 physical map, the amounts and types of the repeat contents, and the outputs of gene ontology analysis, were significantly different from those of the whole genome. Using the physical maps of four wild Oryza species from OMAP (http://www.omap.org) as a control, we detected many conserved and divergent regions related to the evolution process of O. sativa. Between the BESs of MH63 and ZS97 and the two reference sequences, a total of 1532 polymorphic simple sequence repeats (SSRs), 71,383 SNPs, 1767 multiple nucleotide polymorphisms, 6340 insertions, and 9137 deletions were identified. This study provides independent whole-genome resources for intra- and intersubspecies comparisons and functional genomics studies in O. sativa. Both the comparative physical maps and the GBrowse, which integrated the QTL and molecular markers from GRAMENE (http://www.gramene.org) with our physical maps and analysis results, are open to the public through our Web site (http://gresource.hzau.edu.cn/resource/resource.html). PMID:24424778

  17. Genetic dissection of fruiting body-related traits using quantitative trait loci mapping in Lentinula edodes.

    PubMed

    Gong, Wen-Bing; Li, Lei; Zhou, Yan; Bian, Yin-Bing; Kwan, Hoi-Shan; Cheung, Man-Kit; Xiao, Yang

    2016-06-01

    To provide a better understanding of the genetic architecture of fruiting body formation of Lentinula edodes, quantitative trait loci (QTLs) mapping was employed to uncover the loci underlying seven fruiting body-related traits (FBRTs). An improved L. edodes genetic linkage map, comprising 572 markers on 12 linkage groups with a total map length of 983.7 cM, was constructed by integrating 82 genomic sequence-based insertion-deletion (InDel) markers into a previously published map. We then detected a total of 62 QTLs for seven target traits across two segregating testcross populations, with individual QTLs contributing 5.5 %-30.2 % of the phenotypic variation. Fifty-three out of the 62 QTLs were clustered in six QTL hotspots, suggesting the existence of main genomic regions regulating the morphological characteristics of fruiting bodies in L. edodes. A stable QTL hotspot on MLG2, containing QTLs for all investigated traits, was identified in both testcross populations. QTLs for related traits were frequently co-located on the linkage groups, demonstrating the genetic basis for phenotypic correlation of traits. Meta-QTL (mQTL) analysis was performed and identified 16 mQTLs with refined positions and narrow confidence intervals (CIs). Nine genes, including those encoding MAP kinase, blue-light photoreceptor, riboflavin-aldehyde-forming enzyme and cyclopropane-fatty-acyl-phospholipid synthase, and cytochrome P450s, were likely to be candidate genes controlling the shape of fruiting bodies. The study has improved our understanding of the genetic architecture of fruiting body formation in L. edodes. To our knowledge, this is the first genome-wide QTL detection of FBRTs in L. edodes. The improved genetic map, InDel markers and QTL hotspot regions revealed here will assist considerably in the conduct of future genetic and breeding studies of L. edodes.

  18. Mutations in TULP1, NR2E3, and MFRP genes in Indian families with autosomal recessive retinitis pigmentosa

    PubMed Central

    Singh, Hardeep; Sahini, Nishika; Jalali, Subhadra; Mohan, Gayathri

    2012-01-01

    Purpose To identify genes underlying autosomal recessive retinitis pigmentosa (ARRP) by homozygosity mapping. Methods Families with ARRP were recruited after complete ophthalmic evaluation of all members and diagnosis of RP by predefined criteria. Genomic DNA from affected members of 26 families was genotyped on Illumina single nucleotide polymorphism (SNP) 6.0 K arrays with standard procedures. Genotypes were evaluated for homozygous regions that were common and concordant between affected members of each family. The genes mapping to homozygous intervals within these families were screened for pathogenic changes with PCR amplification and sequencing of coding regions. Cosegegration of sequence changes with disease was determined within each pedigree, and each variation was tested for presence in 100 unrelated normal controls. Results A genome-wide scan for homozygosity showed homozygous regions harboring the tubby like protein 1 gene (TULP1; chromosome 6) in one family, the nuclear receptor subfamily 2, group E, member 3 gene (NR2E3; chromosome 15) in three families, and the membrane frizzled-related protein gene (MFRP; chromosome 11) in one family. Screening of the three genes in the respective families revealed homozygous disease-causing mutations in three families. These included a missense mutation in TULP1, a deletion-cum-insertion in NR2E3, and a single base deletion in MFRP. Patients from all three families had a rod-cone type of dystrophy with night blindness initially. The NR2E3 and MFRP genes were associated with fundus features atypical of RP. Conclusions This study shows involvement of the TULP1, NR2E3, and MFRP genes in ARRP in Indian cases. Genome-wide screening with SNP arrays followed by a prioritized candidate gene evaluation is useful in identifying genes in these patients. PMID:22605927

  19. YAC contigs covering an 8-megabase region of 3p deleted in the small-cell lung cancer cell line U2020

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Todd, S.; Bolin, R.; Drabkin, H.A.

    1995-01-01

    Somatic deletions of chromosome 3p occur at high frequencies in cancers of kidney, breast, cervix, head and neck, nasopharynx, and lung. The frequency of 3p deletion in lung cancer approaches 100% among small cell lesions and 70 to 80% in non-small cell lesions. This evidence strongly implies that one or more tumor suppressor genes of potentially widespread significance reside within the deleted region(s). Precise definition of the deleted target region(s) has been difficult due to the extensive area(s) lost and use of markers with low informativeness. However, improved definition remains essential to permit isolation of putative tumor suppressor genes frommore » 3p. The identification of several small, homozygous 3p deletions in lung cancer cell lines has provided a critical resource that will assist this search. The U2020 cell line contains a small homozygous deletion that maps to a very proximal region of 3p and includes the marker D3S3. We previously identified a subset of DNA markers located within the deleted region and determined their relative order by pulsed-field gel mapping studies. In the present report, we describe the development of YAC contigs that span the majority of the deleted region and link up to flanking markers on both sides. The centromere proximal portion of the contig crosses the breakpoint from an X;3 translocation located within 3p12 providing both location and orientation to the map. PCR-based (CA){sub n} microsatellite polymorphisms have been localized within and flanking the deletion region. These markers should greatly facilitate loss-of-heterozygosity studies of this region in human cancer. The contig provides a direct means for isolation of putative tumor suppressor genes from this segment of 3p. 51 refs., 3 figs., 3 tabs.« less

  20. A 1.5 Mb submicroscopic deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lorenzetti, D.; Roa, B.B.; Abbas, N.E.

    1994-09-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies that was recently associated with a 1.5 Mb deletion in chromosome 17p11.2-p12. Duplication of the same region is known to be associated with Charcot-Marie-Tooth disease type 1A (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity. The CMT1A duplication and HNPP deletion are reciprocal recombination products involving a repeat element (CMT1A-REP) which flanks the 1.5 Mb region involved in the duplication/deletion. Patients from 9 unrelated HNPP Italian families were clinically, electrophysiologically and histologically evaluated. Families were typed with amore » polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125 and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, suggesting the presence of deletion. Southern blot analysis of EcoRI digested genomic DNA from HNPP patients and control subjects was performed using a probe mapping within the CMT1A-REP elements. A reduced hybridization signal of a 6.0 kb EcoRI fragment, mapping within the distal CMT1A-REP, was observed in all HNPP patients suggesting the loss of one copy of this fragment in the HNPP-deleted chromosome. PFGE analysis of SacII digested genomic DNA from selected HNPP subjects showed the presence of a junction fragment which has previously been found in association with the 1.5 Mb HNPP deletion. Evidence for deletion could be demonstrated in all 9 families suggesting that the 17p11.2-p12 deletion is commonly associated with HNPP.« less

  1. Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

    PubMed Central

    Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

    2014-01-01

    Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

  2. Genetic Architecture of Natural Variation in Rice Nonphotochemical Quenching Capacity Revealed by Genome-Wide Association Study

    PubMed Central

    Wang, Quanxiu; Zhao, Hu; Jiang, Junpeng; Xu, Jiuyue; Xie, Weibo; Fu, Xiangkui; Liu, Chang; He, Yuqing; Wang, Gongwei

    2017-01-01

    The photoprotective processes conferred by nonphotochemical quenching (NPQ) serve fundamental roles in maintaining plant fitness and sustainable yield. So far, few loci have been reported to be involved in natural variation of NPQ capacity in rice (Oryza sativa), and the extents of variation explored are very limited. Here we conducted a genome-wide association study (GWAS) for NPQ capacity using a diverse worldwide collection of 529 O. sativa accessions. A total of 33 significant association loci were identified. To check the validity of the GWAS signals, three F2 mapping populations with parents selected from the association panel were constructed and assayed. All QTLs detected in mapping populations could correspond to at least one GWAS signal, indicating the GWAS results were quite reliable. OsPsbS1 was repeatedly detected and explained more than 40% of the variation in the whole association population in two years, and demonstrated to be a common major QTL in all three mapping populations derived from inter-group crosses. We revealed 43 single nucleotide polymorphisms (SNPs) and 7 insertions and deletions (InDels) within a 6,997-bp DNA fragment of OsPsbS1, but found no non-synonymous SNPs or InDels in the coding region, indicating the PsbS1 protein sequence is highly conserved. Haplotypes with the 2,674-bp insertion in the promoter region exhibited significantly higher NPQ values and higher expression levels of OsPsbS1. The OsPsbS1 RNAi plants and CRISPR/Cas9 mutants exhibited drastically decreased NPQ values. OsPsbS1 had specific and high-level expression in green tissues of rice. However, we didn't find significant function for OsPsbS2, the other rice PsbS homologue. Manipulation of the significant loci or candidate genes identified may enhance photoprotection and improve photosynthesis and yield in rice. PMID:29081789

  3. Genetic Architecture of Natural Variation in Rice Nonphotochemical Quenching Capacity Revealed by Genome-Wide Association Study.

    PubMed

    Wang, Quanxiu; Zhao, Hu; Jiang, Junpeng; Xu, Jiuyue; Xie, Weibo; Fu, Xiangkui; Liu, Chang; He, Yuqing; Wang, Gongwei

    2017-01-01

    The photoprotective processes conferred by nonphotochemical quenching (NPQ) serve fundamental roles in maintaining plant fitness and sustainable yield. So far, few loci have been reported to be involved in natural variation of NPQ capacity in rice ( Oryza sativa ), and the extents of variation explored are very limited. Here we conducted a genome-wide association study (GWAS) for NPQ capacity using a diverse worldwide collection of 529 O. sativa accessions. A total of 33 significant association loci were identified. To check the validity of the GWAS signals, three F2 mapping populations with parents selected from the association panel were constructed and assayed. All QTLs detected in mapping populations could correspond to at least one GWAS signal, indicating the GWAS results were quite reliable. OsPsbS1 was repeatedly detected and explained more than 40% of the variation in the whole association population in two years, and demonstrated to be a common major QTL in all three mapping populations derived from inter-group crosses. We revealed 43 single nucleotide polymorphisms (SNPs) and 7 insertions and deletions (InDels) within a 6,997-bp DNA fragment of OsPsbS1 , but found no non-synonymous SNPs or InDels in the coding region, indicating the PsbS1 protein sequence is highly conserved. Haplotypes with the 2,674-bp insertion in the promoter region exhibited significantly higher NPQ values and higher expression levels of OsPsbS1 . The OsPsbS1 RNAi plants and CRISPR/Cas9 mutants exhibited drastically decreased NPQ values. OsPsbS1 had specific and high-level expression in green tissues of rice. However, we didn't find significant function for OsPsbS2 , the other rice PsbS homologue. Manipulation of the significant loci or candidate genes identified may enhance photoprotection and improve photosynthesis and yield in rice.

  4. Fine-Mapping Angiotensin-Converting Enzyme Gene: Separate QTLs Identified for Hypertension and for ACE Activity

    PubMed Central

    Chung, Chia-Min; Wang, Ruey-Yun; Fann, Cathy S. J.; Chen, Jaw-Wen; Jong, Yuh-Shiun; Jou, Yuh-Shan; Yang, Hsin-Chou; Kang, Chih-Sen; Chen, Chien-Chung; Chang, Huan-Cheng; Pan, Wen-Harn

    2013-01-01

    Angiotensin-converting enzyme (ACE) has been implicated in multiple biological system, particularly cardiovascular diseases. However, findings associating ACE insertion/deletion polymorphism with hypertension or other related traits are inconsistent. Therefore, in a two-stage approach, we aimed to fine-map ACE in order to narrow-down the function-specific locations. We genotyped 31 single nucleotide polymorphisms (SNPs) of ACE from 1168 individuals from 305 young-onset (age ≤40) hypertension pedigrees, and found four linkage disequilibrium (LD) blocks. A tag-SNP, rs1800764 on LD block 2, upstream of and near the ACE promoter, was significantly associated with young-onset hypertension (p = 0.04). Tag-SNPs on all LD blocks were significantly associated with ACE activity (p-value: 10–16 to <10–33). The two regions most associated with ACE activity were found between exon13 and intron18 and between intron 20 and 3′UTR, as revealed by measured haplotype analysis. These two major QTLs of ACE activity and the moderate effect variant upstream of ACE promoter for young-onset hypertension were replicated by another independent association study with 842 subjects. PMID:23469169

  5. Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

    PubMed

    Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

    2005-03-01

    Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

  6. Cross protective immune responses in nursing piglets infected with a US spike-insertion deletion porcine epidemic diarrhea virus strain and challenged with an original US PEDV strain.

    PubMed

    Annamalai, Thavamathi; Lin, Chun-Ming; Gao, Xiang; Liu, Xinsheng; Lu, Zhongyan; Saif, Linda J; Wang, Qiuhong

    2017-10-06

    We investigated cross-protective immunity of a US spike-insertion deletion porcine epidemic diarrhea virus (PEDV) Iowa106 (S-INDEL) strain against the original US PEDV (PC21A) strain in nursing piglets. Piglets were inoculated orally with S-INDEL, PC21A or mock. At 20-29 days post-inoculation (dpi), all pigs were challenged with the PC21A strain. The S-INDEL-inoculated pigs had lower ileal IgA antibody secreting cells, serum IgA and neutralizing antibody titers compared with PC21A-inoculated pigs. No pigs in the PC21A-group developed diarrhea, whereas 81 and 100% of pigs in the S-INDEL and mock-groups had diarrhea post challenge, respectively. S-INDEL induced partial protective immunity against the original US PEDV strain.

  7. Population genetic analysis of insertion-deletion polymorphisms in a Brazilian population using the Investigator DIPplex kit.

    PubMed

    Ferreira Palha, Teresinha de Jesus Brabo; Ribeiro Rodrigues, Elzemar Martins; Cavalcante, Giovanna Chaves; Marrero, Andrea; de Souza, Ilíada Rainha; Seki Uehara, Clineu Julien; Silveira da Motta, Carlos Henrique Ares; Koshikene, Daniela; da Silva, Dayse Aparecida; de Carvalho, Elizeu Fagundes; Chemale, Gustavo; Freitas, Jorge M; Alexandre, Lídia; Paranaiba, Renato T F; Soler, Mirella Perruccio; Santos, Sidney

    2015-11-01

    The aim of this study was to estimate the diversity of 30 insertion/deletion (INDEL) markers (Investigator(®) DIPplex kit) in a sample of 519 individuals from six Brazilian states and to evaluate their applicability in forensic genetics. All INDEL markers were found to be highly polymorphic in the Brazilian population and were in Hardy-Weinberg equilibrium. To determine their forensic suitability in the Brazilian population, the markers were evaluated for discrimination power, match probability and exclusion power. The combined discrimination power (CDP), combined match power (CMP) and combined power of exclusion (CPE) were higher than 0.999999, 3.4 × 10(-13) and 0.9973, respectively. Further comparison of 29 worldwide populations revealed significant genetic differences between continental populations and a closer relationship between the Brazilian and European populations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ionasescu, V.; Ionasescu, R.; Searby, C.

    1996-06-14

    We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these familiesmore » showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.« less

  9. Development of a database system for mapping insertional mutations onto the mouse genome with large-scale experimental data

    PubMed Central

    2009-01-01

    Background Insertional mutagenesis is an effective method for functional genomic studies in various organisms. It can rapidly generate easily tractable mutations. A large-scale insertional mutagenesis with the piggyBac (PB) transposon is currently performed in mice at the Institute of Developmental Biology and Molecular Medicine (IDM), Fudan University in Shanghai, China. This project is carried out via collaborations among multiple groups overseeing interconnected experimental steps and generates a large volume of experimental data continuously. Therefore, the project calls for an efficient database system for recording, management, statistical analysis, and information exchange. Results This paper presents a database application called MP-PBmice (insertional mutation mapping system of PB Mutagenesis Information Center), which is developed to serve the on-going large-scale PB insertional mutagenesis project. A lightweight enterprise-level development framework Struts-Spring-Hibernate is used here to ensure constructive and flexible support to the application. The MP-PBmice database system has three major features: strict access-control, efficient workflow control, and good expandability. It supports the collaboration among different groups that enter data and exchange information on daily basis, and is capable of providing real time progress reports for the whole project. MP-PBmice can be easily adapted for other large-scale insertional mutation mapping projects and the source code of this software is freely available at http://www.idmshanghai.cn/PBmice. Conclusion MP-PBmice is a web-based application for large-scale insertional mutation mapping onto the mouse genome, implemented with the widely used framework Struts-Spring-Hibernate. This system is already in use by the on-going genome-wide PB insertional mutation mapping project at IDM, Fudan University. PMID:19958505

  10. Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.

    PubMed

    Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang

    2015-10-01

    The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.

  11. ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial dysfunction in patients with untreated hypertension.

    PubMed

    Makris, T K; Stavroulakis, G A; Dafni, U G; Gialeraki, A E; Krespi, P G; Hatzizacharias, A N; Tsoukala, C G; Vythoulkas, J S; Kyriakidis, M K

    2000-11-01

    Angiotensin-converting enzyme (ACE) gene polymorphism has been associated with an increased incidence of myocardial infarction. Recent studies have investigated a potential influence of ACE gene polymorphism on fibrinolysis or endothelial function. It has been previously established that essential hypertension is accompanied by endothelial dysfunction and fibrinolytic balance disorders. The aim of our study was to study the relation between ACE gene polymorphism and fibrinolytic/hemostatic factors as well as endothelial cell damage markers in patients with hypertension. The following parameters were evaluated in 104 patients with previously untreated hypertension: plasminogen activator inhibitor-1 (PAI-1), tissue plasminogen activator (tPA) antigen, fibrinogen, D-dimer, and von Willebrand factor (vWF). The genotype of the ACE gene was also determined (by the polymerase chain reaction method), and patients were characterized according to the observed alleles as deletion/deletion (DD), insertion/insertion (II), or insertion/deletion (ID). Those with DD genotype (n = 42) had significantly higher plasma levels of PAI-1 antigen (P =. 012), tPA antigen (P =.0001), fibrinogen (P =.0002), D-dimer (P =. 0001) and vWF (P =.0004) compared with ID (n = 30) or II (n = 32) genotypes. The ACE gene genotypes appeared to be significant predictors for plasma PAI-1 antigen, tPA antigen, fibrinogen, D -dimer, and vWF even after adjustment for age, sex, body mass index, triglyceride and cholesterol levels, and blood pressure. Our findings suggest that the ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial damage in patients with untreated hypertension.

  12. BSA Delta Qualification 2, volume 3, book 1

    NASA Technical Reports Server (NTRS)

    1994-01-01

    This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM) flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material; adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of Loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor tests -- consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- were completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 3 book 1 provides supporting documentation to the analyses and plans of testing the two Delta Qualification units including thermal cycling planning/data acceptance records, environmental test procedures and pretest temperature conditioning history, Delta Qualification test plan, and specification SE0837 -- mix acceptance test specification.

  13. Impact of Mutation Type and Amplicon Characteristics on Genetic Diversity Measures Generated Using a High-Resolution Melting Diversity Assay

    PubMed Central

    Cousins, Matthew M.; Donnell, Deborah; Eshleman, Susan H.

    2013-01-01

    We adapted high-resolution melting (HRM) technology to measure genetic diversity without sequencing. Diversity is measured as a single numeric HRM score. Herein, we determined the impact of mutation types and amplicon characteristics on HRM diversity scores. Plasmids were generated with single-base changes, insertions, and deletions. Different primer sets were used to vary the position of mutations within amplicons. Plasmids and plasmid mixtures were analyzed to determine the impact of mutation type, position, and concentration on HRM scores. The impact of amplicon length and G/C content on HRM scores was also evaluated. Different mutation types affected HRM scores to varying degrees (1-bp deletion < 1-bp change < 3-bp insertion < 9-bp insertion). The impact of mutations on HRM scores was influenced by amplicon length and the position of the mutation within the amplicon. Mutations were detected at concentrations of 5% to 95%, with the greatest impact at 50%. The G/C content altered melting temperature values of amplicons but had no impact on HRM scores. These data are relevant to the design of assays that measure genetic diversity using HRM technology. PMID:23178437

  14. Interactions of phosphatidylinositol kinase, GTPase-activating protein (GAP), and GAP-associated proteins with the colony-stimulating factor 1 receptor.

    PubMed Central

    Reedijk, M; Liu, X Q; Pawson, T

    1990-01-01

    The interactions of the macrophage colony-stimulating factor 1 (CSF-1) receptor with potential targets were investigated after ligand stimulation either of mouse macrophages or of fibroblasts that ectopically express mouse CSF-1 receptors. In Rat-2 cells expressing the mouse CSF-1 receptor, full activation of the receptor and cellular transformation require exogenous CSF-1, whereas NIH 3T3 cells expressing mouse c-fms are transformed by autocrine stimulation. Activated CSF-1 receptors physically associate with a phosphatidylinositol (PI) 3'-kinase. A mutant CSF-1 receptor with a deletion of the kinase insert region was deficient in its ability to bind functional PI 3'-kinase and to induce PI 3'-kinase activity precipitable with antiphosphotyrosine antibodies. In fibroblasts, CSF-1 stimulation also induced the phosphorylation of the GTPase-activating protein (GAP)-associated protein p62 on tyrosine, although GAP itself was a relatively poor substrate. In contrast to PI 3'-kinase association, phosphorylation of p62 and GAP was not markedly affected by deletion of the kinase insert region. These results indicate that the kinase insert region selectively enhances the CSF-1-dependent association of the CSF-1 receptor with active PI 3'-kinase. The insert deletion mutant retains considerable transforming activity in NIH 3T3 cells (G. Taylor, M. Reedijk, V. Rothwell, L. Rohrschneider, and T. Pawson, EMBO J. 8:2029-2037, 1989). This mutant was more seriously impaired in Rat-2 cell transformation, although mutant-expressing Rat-2 cells still formed small colonies in soft agar in the presence of CSF-1. Therefore, phosphorylation of GAP and p62 through activation of the CSF-1 receptor does not result in full fibroblast transformation. The interaction between the CSF-1 receptor and PI 3'-kinase may contribute to c-fms fibroblast transformation and play a role in CSF-1-stimulated macrophages. Images PMID:2172781

  15. Functional and structural characterization of the pentapeptide insertion of Theileria annulata lactate dehydrogenase by site-directed mutagenesis, comparative modeling and molecular dynamics simulations.

    PubMed

    Erdemir, Aysegul; Mutlu, Ozal

    2017-06-01

    Lactate dehydrogenase (LDH) is an important metabolic enzyme in glycolysis and it has been considered as the main energy source in many organisms including apicomplexan parasites. Differences at the active site loop of the host and parasite LDH's makes this enzyme an attractive target for drug inhibitors. In this study, five amino acid insertions in the active site pocket of Theileria annulata LDH (TaLDH) were deleted by PCR-based site-directed mutagenesis, expression and activity analysis of mutant and wild type TaLDH enzymes were performed. Removal of the insertion at the active site loop caused production of an inactive enzyme. Furthermore, structures of wild and mutant enzymes were predicted by comparative modeling and the importance of the insertions at the active site loop were also assigned by molecular docking and dynamics simulations in order to evaluate essential role of this loop for the enzymatic activity. Pentapeptide insertion removal resulted in loss of LDH activity due to deletion of Trp96 and conformational change of Arg98 because of loop instability. Analysis of wild type and mutant enzymes with comparative molecular dynamics simulations showed that the fluctuations of the loop residues increase in mutant enzyme. Together with in silico studies, in vitro results revealed that active site loop has a vital role in the enzyme activity and our findings promise hope for the further drug design studies against theileriosis and other apicomplexan parasite diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Reverse genetics of Newcastle disease virus

    USDA-ARS?s Scientific Manuscript database

    Reverse genetics allows the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique allows genetic manipulation and cloning of viral genomes, mutation through site-directed mutagenesis, and gene insertion or deletion, among othe...

  17. Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus1[OPEN

    PubMed Central

    Dillon, Andrew; Varanasi, Vijay K.; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E.; Friebe, Bernd

    2017-01-01

    Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus. PMID:27956489

  18. The genome sequence of sweet cherry (Prunus avium) for use in genomics-assisted breeding.

    PubMed

    Shirasawa, Kenta; Isuzugawa, Kanji; Ikenaga, Mitsunobu; Saito, Yutaro; Yamamoto, Toshiya; Hirakawa, Hideki; Isobe, Sachiko

    2017-10-01

    We determined the genome sequence of sweet cherry (Prunus avium) using next-generation sequencing technology. The total length of the assembled sequences was 272.4 Mb, consisting of 10,148 scaffold sequences with an N50 length of 219.6 kb. The sequences covered 77.8% of the 352.9 Mb sweet cherry genome, as estimated by k-mer analysis, and included >96.0% of the core eukaryotic genes. We predicted 43,349 complete and partial protein-encoding genes. A high-density consensus map with 2,382 loci was constructed using double-digest restriction site-associated DNA sequencing. Comparing the genetic maps of sweet cherry and peach revealed high synteny between the two genomes; thus the scaffolds were integrated into pseudomolecules using map- and synteny-based strategies. Whole-genome resequencing of six modern cultivars found 1,016,866 SNPs and 162,402 insertions/deletions, out of which 0.7% were deleterious. The sequence variants, as well as simple sequence repeats, can be used as DNA markers. The genomic information helps us to identify agronomically important genes and will accelerate genetic studies and breeding programs for sweet cherries. Further information on the genomic sequences and DNA markers is available in DBcherry (http://cherry.kazusa.or.jp (8 May 2017, date last accessed)). © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  19. A deletion in the chromosome of Bacteroides thetaiotaomicron that abolishes production of chondroitinase II does not affect survival of the organism in gastrointestinal tracts of exgermfree mice.

    PubMed Central

    Salyers, A A; Guthrie, E P

    1988-01-01

    Bacteroides thetaiotaomicron, an obligate anaerobe normally found in high concentrations in the human colon, is one of the few colon bacteria that can ferment host mucopolysaccharides such as chondroitin sulfate. Previously, we found that a directed insertional mutation in the gene that codes for the chondroitinase II gene of B. thetaiotaomicron did not affect growth on chondroitin sulfate despite the fact that chondroitinase II accounts for 70% of the total cellular chondroitinase activity. Thus, the chondroitinase II gene did not seem to contribute significantly to growth on chondroitin sulfate when the bacteria were grown in laboratory medium. To determine whether this enzyme is important for bacteria growing in the intestinal tract, we tested the ability of a strain that does not produce chondroitinase II to colonize the intestinal tracts of germfree mice and to compete with wild-type B. thetaiotaomicron. The mutant used in these experiments carried a 0.5-kilobase deletion in the chondroitinase II gene and was constructed so that, unlike the original insertion mutant, it contained no exogenous DNA. The deletion mutant colonized the intestinal tracts of germfree mice at the same levels as the wild type. When a mixture of the deletion mutant and wild type was used to colonize germfree mice, the percent wild type, measured by colony hybridization with the deleted 0.5-kilobase fragment as the hybridization probe, did not rise to 100% even after periods as long as 9 weeks. In most experiments, the percent wild type did not rise significantly above the percent in the original mixture.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:3140726

  20. Role of an archaeal PitA transporter in the copper and arsenic resistance of Metallosphaera sedula, an extreme thermoacidophile.

    PubMed

    McCarthy, Samuel; Ai, Chenbing; Wheaton, Garrett; Tevatia, Rahul; Eckrich, Valerie; Kelly, Robert; Blum, Paul

    2014-10-01

    Thermoacidophilic archaea, such as Metallosphaera sedula, are lithoautotrophs that occupy metal-rich environments. In previous studies, an M. sedula mutant lacking the primary copper efflux transporter, CopA, became copper sensitive. In contrast, the basis for supranormal copper resistance remained unclear in the spontaneous M. sedula mutant, CuR1. Here, transcriptomic analysis of copper-shocked cultures indicated that CuR1 had a unique regulatory response to metal challenge corresponding to the upregulation of 55 genes. Genome resequencing identified 17 confirmed mutations unique to CuR1 that were likely to change gene function. Of these, 12 mapped to genes with annotated function associated with transcription, metabolism, or transport. These mutations included 7 nonsynonymous substitutions, 4 insertions, and 1 deletion. One of the insertion mutations mapped to pseudogene Msed_1517 and extended its reading frame an additional 209 amino acids. The extended mutant allele was identified as a homolog of Pho4, a family of phosphate symporters that includes the bacterial PitA proteins. Orthologs of this allele were apparent in related extremely thermoacidophilic species, suggesting M. sedula naturally lacked this gene. Phosphate transport studies combined with physiologic analysis demonstrated M. sedula PitA was a low-affinity, high-velocity secondary transporter implicated in copper resistance and arsenate sensitivity. Genetic analysis demonstrated that spontaneous arsenate-resistant mutants derived from CuR1 all underwent mutation in pitA and nonselectively became copper sensitive. Taken together, these results point to archaeal PitA as a key requirement for the increased metal resistance of strain CuR1 and its accelerated capacity for copper bioleaching. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Role of an Archaeal PitA Transporter in the Copper and Arsenic Resistance of Metallosphaera sedula, an Extreme Thermoacidophile

    PubMed Central

    McCarthy, Samuel; Ai, Chenbing; Wheaton, Garrett; Tevatia, Rahul; Eckrich, Valerie; Kelly, Robert

    2014-01-01

    Thermoacidophilic archaea, such as Metallosphaera sedula, are lithoautotrophs that occupy metal-rich environments. In previous studies, an M. sedula mutant lacking the primary copper efflux transporter, CopA, became copper sensitive. In contrast, the basis for supranormal copper resistance remained unclear in the spontaneous M. sedula mutant, CuR1. Here, transcriptomic analysis of copper-shocked cultures indicated that CuR1 had a unique regulatory response to metal challenge corresponding to the upregulation of 55 genes. Genome resequencing identified 17 confirmed mutations unique to CuR1 that were likely to change gene function. Of these, 12 mapped to genes with annotated function associated with transcription, metabolism, or transport. These mutations included 7 nonsynonymous substitutions, 4 insertions, and 1 deletion. One of the insertion mutations mapped to pseudogene Msed_1517 and extended its reading frame an additional 209 amino acids. The extended mutant allele was identified as a homolog of Pho4, a family of phosphate symporters that includes the bacterial PitA proteins. Orthologs of this allele were apparent in related extremely thermoacidophilic species, suggesting M. sedula naturally lacked this gene. Phosphate transport studies combined with physiologic analysis demonstrated M. sedula PitA was a low-affinity, high-velocity secondary transporter implicated in copper resistance and arsenate sensitivity. Genetic analysis demonstrated that spontaneous arsenate-resistant mutants derived from CuR1 all underwent mutation in pitA and nonselectively became copper sensitive. Taken together, these results point to archaeal PitA as a key requirement for the increased metal resistance of strain CuR1 and its accelerated capacity for copper bioleaching. PMID:25092032

  2. Molecular Cloning and Characterization of Viruses Isolated from Chimpanzees with Pathogenic Human Immunodeficiency Virus Type 1 Infections

    PubMed Central

    Mwaengo, Dufton M.; Novembre, Francis J.

    1998-01-01

    We have previously described the development of AIDS in a chimpanzee (C499) infected with human immunodeficiency virus type 1 (HIV-1) and the subsequent pathogenic HIV-1 infection in another chimpanzee (C455) transfused with blood from C499 (F. J. Novembre et al., J. Virol. 71:4086–4091, 1997). In the present study, two virus isolates were derived from these animals: HIV-1JC from peripheral blood mononuclear cells (PBMC) of C499, and HIV-1NC from plasma of C455. These virus isolates were used to generate two infectious molecular clones, termed HIV-1JC16 and HIV-1NC7 (JC16 and NC7, respectively). Comparative analyses of the sequences of the two clones showed that they were highly interrelated but distinct. Based on heteroduplex mobility assays, JC16 and NC7 appear to represent dominant viruses in the uncloned stock population. Compared with amino acid sequences of the parental viruses HIV-1SF2, HIV-1LAV-1b, and HIV-1NDK, JC16 and NC7 showed a number of differences, including insertions, deletions, and point mutations spread throughout the genome. However, insertion/deletion footprints in several genes of both JC16 and NC7 suggested that recombination between SF2 and LAV-1b could have occurred, possibly contributing to the generation of a pathogenic virus. Comparative in vitro analyses of the molecular clones and the uncloned stocks of HIV-1JC and HIV-1NC revealed that these viruses had strikingly similar replicative abilities in mitogen-stimulated PBMC and in macrophages. Compared to the SF2 and LAV-1b isolates of HIV-1, HIV-1JC and HIV-1NC isolates were more similar to LAV-1b with respect to the ability to replicate in mitogen-stimulated PBMC and macrophages. These viruses should prove to be useful in mapping determinants of pathogenesis. PMID:9765443

  3. Polymorphisms in the phosducin (PDC) gene on chromosome 1q25-32

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humphries, P.; Mansergh, F.C.; Farrar, G.J.

    1994-09-01

    Phosducin (33 kDa protein or MEKA) is a principal water-soluble phosphoprotein in the rod and cone photoreceptor cells and pinealocytes. This protein modulates the phototransduction cascade by binding to the beta and gamma subunit complexes of transducin. The PDC gene has been mapped to 1q25-32, the region of linkage of two hereditary retinal degenerative disorders; autosomal dominant juvenile-onset open-angle glaucoma and one form of autosomal recessive RP. Using previously published sequence data, PCR primers were designed to amplify the coding and 5{prime} flanking regions of the PDC gene. Direct sequencing revealed three polymorphisms in the 5{prime} flanking region, two ofmore » which were in regions highly homologous between humans and mice. Analysis of the polymorphisms was then extended to larger population samples using SSCPE and denaturing gel analysis. The first polymorphism PDC1 resulted from an insertion of a G residue at position -653/4. Allele frequencies were determined to be 0.51 (insG) and 0.49 (normal) giving a PIC value of 0.50. A deletion of a T residue at position -488 was the basis of the PDC2 polymorphism with allele frequencies of 0.88 (normal) and 0.12 (delT) and a PIC value of 0.21. Interestingly, the allele with an inserted G residue in PDC1 always segregrated with the deleted T allele in PDC2. The third polymorphism PDC3 was caused by a T or G residue at position -1083. Allele frequencies of 0.26 (G residue) and 0.74 (T residue) were determined from an analysis of 80 individuals with an overall PIC value of 0.39. The identification of these three polymorphisms in the PDC gene will be useful for future genetic linkage studies of chromosome 1q in inherited retinopathies.« less

  4. Deletion modification enhances anthrax specific immunity and protective efficacy of a hepatitis B core particle-based anthrax epitope vaccine.

    PubMed

    Yin, Ying; Zhang, Sheng; Cai, Chenguang; Zhang, Jun; Dong, Dayong; Guo, Qiang; Fu, Ling; Xu, Junjie; Chen, Wei

    2014-02-01

    Protective antigen (PA) is one of the major virulence factors of anthrax and is also the major constituent of the current anthrax vaccine. Previously, we found that the 2β2-2β3 loop of PA contains a dominant neutralizing epitope, the SFFD. We successfully inserted the 2β2-2β3 loop of PA into the major immunodominant region (MIR) of hepatitis B virus core (HBc) protein. The resulting fusion protein, termed HBc-N144-PA-loop2 (HBcL2), can effectively produce anthrax specific protective antibodies in an animal model. However, the protective immunity caused by HBcL2 could still be improved. In this research, we removed amino acids 79-81 from the HBc MIR of the HBcL2. This region was previously reported to be the major B cell epitope of HBc, and in keeping with this finding, we observed that the short deletion in the MIR not only diminished the intrinsic immunogenicity of HBc but also stimulated a higher titer of anthrax specific immunity. Most importantly, this deletion led to the full protection of the immunized mice against a lethal dose anthrax toxin challenge. We supposed that the conformational changes which occurred after the short deletion and foreign insertion in the MIR of HBc were the most likely reasons for the improvement in the immunogenicity of the HBc-based anthrax epitope vaccine. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. Cloning and expression of the tabtoxin biosynthetic region from Pseudomonas syringae.

    PubMed Central

    Kinscherf, T G; Coleman, R H; Barta, T M; Willis, D K

    1991-01-01

    Pseudomonas syringae BR2, a causal agent of bean wildfire, was subjected to Tn5 mutagenesis in an effort to isolate mutants unable to produce the beta-lactam antibiotic tabtoxin. Three of the tabtoxin-minus (Tox-) mutants generated appeared to have physically linked Tn5 insertions and retained their resistance to the active toxin form, tabtoxnine-beta-lactam (T beta L). The wild-type DNA corresponding to the mutated region was cloned and found to restore the Tn5 mutants to toxin production. The use of cloned DNA from the region as hybridization probes revealed that the region is highly conserved among tabtoxin-producing pathovars of P. syringae and that the region deletes at a relatively high frequency (10(-3)/CFU) in BR2. The Tox- deletion mutants also lost resistance to tabtoxinine-beta-lactam. A cosmid designated pRTBL823 restored toxin production and resistance to BR2 deletion mutants. This cosmid also converted the tabtoxin-naive P. syringae epiphyte Cit7 to toxin production and resistance, indicating that pRTBL823 contains a complete set of biosynthetic and resistance genes. Tox- derivatives of BR2 did not produce disease symptoms on bean. Clones that restored toxin production to both insertion and deletion mutants also restored the ability to cause disease. However, tabtoxin-producing Cit7 derivatives remained nonpathogenic on bean and tobacco, suggesting that tabtoxin production alone is not sufficient to cause disease. Images PMID:1648077

  6. Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

    A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

  7. NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

    PubMed Central

    Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

    2000-01-01

    Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

  8. An inversion inv(4)(p12-p15.3) in autistic siblings implicates the 4p GABA receptor gene cluster.

    PubMed

    Vincent, J B; Horike, S I; Choufani, S; Paterson, A D; Roberts, W; Szatmari, P; Weksberg, R; Fernandez, B; Scherer, S W

    2006-05-01

    We describe the case of two brothers diagnosed with autism who both carry a paracentic inversion of the short arm of chromosome 4 (46,XY, inv(4)(p12-p15.3)). We have determined that this inversion is inherited from an apparently unaffected mother and unaffected maternal grandfather. Methods/ Using fluorescence in situ hybridisation analysis and Southern blot hybridisation we identified the breakpoints. The proximal breakpoint (4p12) maps to a region containing a cluster of gamma-aminobutyric acid A (GABA(A)) receptor genes, and directly interrupts the GABRG1 gene, the distal-most gene of the cluster. We also identified an insertion/deletion polymorphism for a approximately 2 kb LINE1 (L1) element that occurs within intron 7 of GABRG1. Our genotype analysis amongst autism families indicated that the L1 deletion allele did not show increased transmission to affected individuals. No linkage disequilibrium was evident between the L1 and single nucleotide polymorphisms in adjacent GABA(A) receptor genes on 4p, where a recent study has identified significant association with autism. Despite this, the identification of an inversion breakpoint disrupting GABRG1 provides solid support for the genetic involvement of the short arm of chromosome 4 in the genetic aetiology of autism, and for the hypothesis of disrupted GABA neurotransmission in autism.

  9. 77 FR 8095 - Review and Approval of Projects

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-14

    ... disposal facility; insert language authorizing renewal of expiring approvals, including Approvals by Rule (ABRs); delete specific references to geologic formations that may be the subject of natural gas development using hydrofracture stimulation and replace with a generic category--``unconventional natural gas...

  10. HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

    PubMed

    Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

    1997-04-01

    The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

  11. Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

    PubMed Central

    Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

    1995-01-01

    Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

  12. Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morrow, B.; Carlson, C.; Gupta, R.D.

    Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

  13. Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.

    PubMed

    Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V

    1992-12-01

    Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the aniridia candidate gene (AN2) and the Wilms tumor predisposition gene (WT1). This is therefore a rare case of an inherited WAGR deletion. Wilms tumor has so far only been associated with sporadic de novo aniridia cases. We have shown that a cosmid probe for a candidate aniridia gene, homologous to the mouse Pax-6 gene, is deleted in cell lines from aniridia patients with previously characterized deletions at 11p13, while another cosmid marker mapping between two aniridia-associated translocation breakpoints (and hence a second candidate marker) is present on both chromosomes. These results support the Pax-6 homologue as a strong candidate for the AN2 gene. FISH with cosmid probes has proved to be a fast and reliable technique for the molecular analysis of deletions. It can be used with limited amounts of material and has strong potential for clinical applications.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lachiewicz, A.; Rao, K.; Aylsworth, A.

    A 2-year-old boy with Martin-Bell syndrome was referred for molecular testing and found to have a large deletion of FMRI. His mother was found to have two FMR-1 alleles in the normal range for CGG repeats. DNA probes located both proximal and distal to FRAXA were used to delineate the approximation location of the deletion endpoints. Proximal to the fragile site, DXS312 (pX135) was absent but DXS98 (4D8) was present. Distal to the fragile site, DXS296 (VK21) was absent but DXS304 (U6.2) was present. Our patient does not appear to have clinical findings other than those typically associated with fragilemore » X syndrome suggesting that the deletion does not remove other contiguous genes, e.g., IDS. The deletion in this patient is larger than the patient reported by Gedeon et al., in whom approximately 2.5 megabases were estimated to be deleted. Using the physical map of Schlessinger et al., the physical extent of the deletion can be estimated to be at least 3 megabases. This patient may be useful in physical mapping of the chromosomal region near FMR-1. Continued long-term evaluation of this patient may uncover clinical findings suggestive that the deletion removes other genes near to FMR-1 or, alternatively, no findings atypical of the fragile X syndrome suggesting that no other genes lie in the deletion interval.« less

  15. Distinctive Protein Signatures Provide Molecular Markers and Evidence for the Monophyletic Nature of the Deinococcus-Thermus Phylum

    PubMed Central

    Griffiths, Emma; Gupta, Radhey S.

    2004-01-01

    The Deinococcus-Thermus group of species is currently recognized as a distinct phylum solely on the basis of their branching in 16S rRNA trees. No unique biochemical or molecular characteristics that can distinguish this group from all other bacteria are known at present. In this work, we describe eight conserved indels (viz., inserts or deletions) in seven widely distributed proteins that are distinctive characteristics of the Deinococcus-Thermus phylum but are not found in any other group of bacteria. The identified signatures include a 7-amino-acid (aa) insert in threonyl-tRNA synthetase, 1- and 3-aa inserts in the RNA polymerase β′ subunit, a 5-aa deletion in signal recognition particle (Ffh/SR54), a 2-aa insert in major sigma factor 70 (σ70), a 2-aa insert in seryl-tRNA synthetase (SerRS), a 1-aa insert in ribosomal protein L1, and a 2-aa insert in UvrA homologs. By using PCR primers for conserved regions, fragments of these genes were amplified from a number of Deinococcus-Thermus species, and all such fragments (except SerRS in Deinococcus proteolyticus) were found to contain the indicated signatures. The presence of these signatures in various species from all three known genera within this phylum, viz., Deinococcus, Thermus, and Meiothermus, provide evidence that they are likely distinctive characteristics of the entire phylum which were introduced in a common ancestor of this group. The signature in SerRS, which is absent in D. proteolyticus, was likely introduced after the branching of this species. Phylogenetic studies as well as the nature of the inserts in some of these proteins (viz., σ70 and SerRS) also support a sister group relationship between the Thermus and the Meiothermus genera. The identified signatures provide strong evidence for the monophyletic nature of the Deinococcus-Thermus phylum. These molecular markers should prove very useful in the identification of new species related to this group. PMID:15126471

  16. 30. Photocopy of map. Insert, p. 138, Master Plan Report, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. Photocopy of map. Insert, p. 138, Master Plan Report, 1960, Vol. II. Layton, Layton and Rohrbach, General Planning and Resource Consultants. 1960 MASTER PLAN, SHOWING PROPOSED LOCATION OF LINNAEAN HOUSE - Missouri Botanical Garden, 2345 Tower Grove Avenue, Saint Louis, Independent City, MO

  17. The rational design of a 'type 88' genetically stable peptide display vector in the filamentous bacteriophage fd.

    PubMed

    Enshell-Seijffers, D; Smelyanski, L; Gershoni, J M

    2001-05-15

    Filamentous bacteriophages are particularly efficient for the expression and display of combinatorial random peptides. Two phage proteins are often employed for peptide display: the infectivity protein, PIII, and the major coat protein, PVIII. The use of PVIII typically requires the expression of two pVIII genes: the wild-type and the recombinant pVIII gene, to generate mosaic phages. 'Type 88' vectors contain two pVIII genes in one phage genome. In this study a novel 'type 88' expression vector has been rationally designed and constructed. Two factors were taken into account: the insertion site and the genetic stability of the second pVIII gene. It was found that selective deletion of recombinant genes was encountered when inserts were cloned into either of the two non-coding regions of the phage genome. The deletions were independent of recA yet required a functional F-episome. Transcription was also found to be a positive factor for deletion. Taking the above into account led to the generation of a novel vector, designated fth1, which can be used to express recombinant peptides as pVIII chimeric proteins in mosaic bacteriophages. The fth1 vector is not only genetically stable but also of high copy number and produces high titers of recombinant phages.

  18. Single-stranded DNA-binding Protein in Vitro Eliminates the Orientation-dependent Impediment to Polymerase Passage on CAG/CTG Repeats*

    PubMed Central

    Delagoutte, Emmanuelle; Goellner, Geoffrey M.; Guo, Jie; Baldacci, Giuseppe; McMurray, Cynthia T.

    2008-01-01

    Small insertions and deletions of trinucleotide repeats (TNRs) can occur by polymerase slippage and hairpin formation on either template or newly synthesized strands during replication. Although not predicted by a slippage model, deletions occur preferentially when 5′-CTG is in the lagging strand template and are highly favored over insertion events in rapidly replicating cells. The mechanism for the deletion bias and the orientation dependence of TNR instability is poorly understood. We report here that there is an orientation-dependent impediment to polymerase progression on 5′-CAG and 5′-CTG repeats that can be relieved by the binding of single-stranded DNA-binding protein. The block depends on the primary sequence of the TNR but does not correlate with the thermodynamic stability of hairpins. The orientation-dependent block of polymerase passage is the strongest when 5′-CAG is the template. We propose a “template-push” model in which the slow speed of DNA polymerase across the 5′-CAG leading strand template creates a threat to helicase-polymerase coupling. To prevent uncoupling, the TNR template is pushed out and by-passed. Hairpins do not cause the block, but appear to occur as a consequence of polymerase pass-over. PMID:18263578

  19. The insertion-deletion polymorphism of the ACE gene is associated with increased blood pressure in women at the end of pregnancy.

    PubMed

    Reshetnikov, Evgeny A; Akulova, Ludmila Y; Dobrodomova, Irina S; Dvornyk, Volodymyr Y; Polonikov, Alexey V; Churnosov, Mikhail I

    2015-09-01

    Malfunctioning of the cardiovascular system during pregnancy may be responsible for adverse effects on the 'mother-fetus' system. The cardiovascular system of a pregnant woman develops adaptation to the increased load. Angiotensin-converting enzyme (ACE) is known to play an important role in the adaptation. The present study was designed to investigate whether the insertion-deletion (I/D) polymorphism of the ACE gene is associated with the level of arterial blood pressure in women before and during pregnancy. The level of blood pressure was measured in 591 Russian women (Central Russia) before and during (37-40 weeks term) pregnancy. The women were divided into three groups which were hypertensive, hypotensive, and normotensive according to blood pressure level. Genotyping of the ACE I/D polymorphism was performed using polymerase chain reaction (PCR) and amplified fragment length polymorphism assay. Women with genotype DD showed the highest blood pressure level both during and at the end of pregnancy (p<0.05). The highest frequencies of allele D and genotype DD were found in pregnant women in the hypertensive group. The deletion variant of the ACE gene is associated with high blood pressure level at the end of pregnancy. © The Author(s) 2013.

  20. The gene for replication factor C subunit 2 (RFC2) is within the 7q11.23 Williams syndrome deletion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peoples, R.; Perez-Jurado, L.; Francke, U.

    1996-06-01

    Williams syndrome (WS) is a developmental disorder with multiple system manifestations, including supraval var aortic stenosis (SVAS), peripheral pulmonic stenosis, connective tissue abnormalities, short stature, characteristic personality profile and cognitive deficits, and variable hypercalcemia in infancy. It is caused by heterozygosity for a chromosomal deletion of part of band 7q11.23 including the elastin locus (ELN). Since disruption of the ELN gene causes autosomal dominant SVAS, it is assumed that ELN haploinsufficiency is responsible for the cardiovascular features of WS. The deletion that extends from the ELN locus in both directions is {ge}200 kb in size, although estimates of {ge}2 Mbmore » are suggested by high-resolution chromosome banding and physical mapping studies. We have searched for additional dosage-sensitive genes within the deletion that may be responsible for the noncardiovascular features. We report here that the gene for replication factor C subunit 2 (RFC2) maps within the WS deletion region and was found to be deleted in all of 18 WS patients studied. The protein product of RFC2 is part of a multimeric complex involved in DNA elongation during replication. 14 refs., 3 figs.« less

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  2. The HLA-G 14 bp insertion/deletion polymorphism and its association with soluble HLA-G levels in women with recurrent miscarriages.

    PubMed

    Kalotra, V; Lall, M; Verma, I C; Kaur, A; Kaur, A

    2018-03-01

    HLA-G, a nonclassical class-Ib gene is mainly expressed on extravillous trophoblasts at the fetal-maternal interface. HLA-G molecule is considered to play an important role in maternal immune suppression during pregnancy. The 14 bp insertion/deletion polymorphism (rs66554220) in exon eight of the HLA-G gene influences HLA-G mRNA stability and isoform splicing patterns. In this study, 202 recurrent miscarriage (RM) women with two or more than two consecutive miscarriages, their 202 partners and 204 fertile control women with at least one live birth and no miscarriages were analyzed for 14 bp insertion/deletion polymorphism. Soluble HLA-G (sHLA-G) levels were also determined and compared between randomly selected 111 RM women and 111 control women using QAYEE-Bio ELISA kits. Student's t test and χ 2 test were used to depict the statistical differences. The results showed no significant differences for 14 bp allele and genotype frequencies between the study groups. However, our study showed a significant difference (P = .0107) for sHLA-G levels in RM women and control women. Furthermore, a significant difference (P = .0135) for sHLA-G levels in relation to +/-14 bp heterozygous genotype was seen between the two groups. The 14 bp allele sharing between the partners did not show any significant association with the number of miscarriages in RM couples. The association of 14 bp polymorphism and recurrent miscarriages was not significant in our study. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Twisted trees and inconsistency of tree estimation when gaps are treated as missing data - The impact of model mis-specification in distance corrections.

    PubMed

    McTavish, Emily Jane; Steel, Mike; Holder, Mark T

    2015-12-01

    Statistically consistent estimation of phylogenetic trees or gene trees is possible if pairwise sequence dissimilarities can be converted to a set of distances that are proportional to the true evolutionary distances. Susko et al. (2004) reported some strikingly broad results about the forms of inconsistency in tree estimation that can arise if corrected distances are not proportional to the true distances. They showed that if the corrected distance is a concave function of the true distance, then inconsistency due to long branch attraction will occur. If these functions are convex, then two "long branch repulsion" trees will be preferred over the true tree - though these two incorrect trees are expected to be tied as the preferred true. Here we extend their results, and demonstrate the existence of a tree shape (which we refer to as a "twisted Farris-zone" tree) for which a single incorrect tree topology will be guaranteed to be preferred if the corrected distance function is convex. We also report that the standard practice of treating gaps in sequence alignments as missing data is sufficient to produce non-linear corrected distance functions if the substitution process is not independent of the insertion/deletion process. Taken together, these results imply inconsistent tree inference under mild conditions. For example, if some positions in a sequence are constrained to be free of substitutions and insertion/deletion events while the remaining sites evolve with independent substitutions and insertion/deletion events, then the distances obtained by treating gaps as missing data can support an incorrect tree topology even given an unlimited amount of data. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Precise and heritable genome editing in evolutionarily diverse nematodes using TALENs and CRISPR/Cas9 to engineer insertions and deletions.

    PubMed

    Lo, Te-Wen; Pickle, Catherine S; Lin, Steven; Ralston, Edward J; Gurling, Mark; Schartner, Caitlin M; Bian, Qian; Doudna, Jennifer A; Meyer, Barbara J

    2013-10-01

    Exploitation of custom-designed nucleases to induce DNA double-strand breaks (DSBs) at genomic locations of choice has transformed our ability to edit genomes, regardless of their complexity. DSBs can trigger either error-prone repair pathways that induce random mutations at the break sites or precise homology-directed repair pathways that generate specific insertions or deletions guided by exogenously supplied DNA. Prior editing strategies using site-specific nucleases to modify the Caenorhabditis elegans genome achieved only the heritable disruption of endogenous loci through random mutagenesis by error-prone repair. Here we report highly effective strategies using TALE nucleases and RNA-guided CRISPR/Cas9 nucleases to induce error-prone repair and homology-directed repair to create heritable, precise insertion, deletion, or substitution of specific DNA sequences at targeted endogenous loci. Our robust strategies are effective across nematode species diverged by 300 million years, including necromenic nematodes (Pristionchus pacificus), male/female species (Caenorhabditis species 9), and hermaphroditic species (C. elegans). Thus, genome-editing tools now exist to transform nonmodel nematode species into genetically tractable model organisms. We demonstrate the utility of our broadly applicable genome-editing strategies by creating reagents generally useful to the nematode community and reagents specifically designed to explore the mechanism and evolution of X chromosome dosage compensation. By developing an efficient pipeline involving germline injection of nuclease mRNAs and single-stranded DNA templates, we engineered precise, heritable nucleotide changes both close to and far from DSBs to gain or lose genetic function, to tag proteins made from endogenous genes, and to excise entire loci through targeted FLP-FRT recombination.

  5. Angiotensin-converting enzyme insertion/deletion gene polymorphism in Egyptian children with systemic lupus erythematosus: a possible relation to proliferative nephritis.

    PubMed

    Hammad, A; Yahia, S; Laimon, W; Hamed, S M; Shouma, A; Shalaby, N M; Abdel-Hady, D; Ghanem, R; El-Farahaty, R M; El-Bassiony, S R; Hammad, E M

    2017-06-01

    Introduction Angiotensin-converting enzyme (ACE) is crucial in the pathogenesis of systemic lupus erythematosus through angiotensin II which regulates vascular tone and endothelial functions. Objectives To study the frequency of ACE insertion/deletion (I/D) gene polymorphism in Egyptian children with systemic lupus erythematosus and its possible relation to the renal pathology in cases with lupus nephritis. Subjects and methods The frequency of ACE gene insertion/deletion polymorphism genotypes was determined in 78 Egyptian children with systemic lupus erythematosus and compared to a matched group of 140 healthy controls using polymerase chain reaction. Results The DD genotype of the ACE gene was higher in systemic lupus erythematosus patients when compared to controls ( P<0.0001; odds ratio (OR) 2.4; 95% confidence interval (CI) 1.7-3.3) and the D allele was more frequent than the I allele in systemic lupus erythematosus patients in comparison to controls ( P < 0.0001; OR = 2.2; 95% CI = (1.6-3.1). In the lupus nephritis group, the DD genotype was significantly higher in those with proliferative lupus nephritis when compared to those with non-proliferative lupus nephritis ( P = 0.02; OR = 1.45; 95% CI = 1.4-1.6). Also, patients with proliferative lupus nephritis showed a higher frequency of the D allele ( P < 0.001; OR = 1.98; 95% CI = 1.3-2.9). Conclusion The D allele and DD genotype of the ACE gene appear to be a risk factor for the susceptibility of systemic lupus erythematosus and occurrence of proliferative nephritis in Egyptian children.

  6. Truncated Photosystem Chlorophyll Antenna Size in the Green Microalga Chlamydomonas reinhardtii upon Deletion of the TLA3-CpSRP43 Gene1[C][W][OA

    PubMed Central

    Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios

    2012-01-01

    The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions. PMID:23043081

  7. Signature-tagged mutagenesis screening revealed a novel smooth-to-rough transition determinant of Salmonella enterica serovar Enteritidis.

    PubMed

    Jiao, Yang; Guo, Rongxian; Tang, Peipei; Kang, Xilong; Yin, Junlei; Wu, Kaiyue; Geng, Shizhong; Li, Qiuchun; Sun, Jun; Xu, Xiulong; Zhou, Xiaohui; Gan, Junji; Jiao, Xinan; Liu, Xiufan; Pan, Zhiming

    2017-03-03

    Salmonella enterica serovar Enteritidis (S. Enteritidis) has emerged as one of the most important food-borne pathogens for humans. Lipopolysaccharide (LPS), as a component of the outer membrane, is responsible for the virulence and smooth-to-rough transition in S. Enteritidis. In this study, we screened S. Enteritidis signature-tagged transposon mutant library using monoclonal antibody against somatic O 9 antigen (O 9 MAb) and O 9 factor rabbit antiserum to identify novel genes that are involved in smooth-to-rough transition. A total of 480 mutants were screened and one mutant with transposon insertion in rfbG gene had smooth-to-rough transition phenotype. In order to verify the role of rfbG gene, an rfbG insertion or deletion mutant was constructed using λ-Red recombination system. Phenotypic and biological analysis revealed that rfbG insertion or deletion mutants were similar to the wild-type strain in growth rate and biochemical properties, but the swimming motility was reduced. SE Slide Agglutination test and ELISA test showed that rfbG mutants do not stimulate animals to produce agglutinating antibody. In addition, the half-lethal dose (LD 50 ) of the rfbG deletion mutant strain was 10 6.6 -fold higher than that of the parent strain in a mouse model when injected intraperitoneally. These data indicate that the rfbG gene is involved in smooth-to-rough transition, swimming motility and virulence of S. Enteritidis. Furthermore, somatic O-antigen antibody-based approach to screen signature-tagged transposon mutants is feasible to clarify LPS biosynthesis and to find suitable markers in DIVA-vaccine research.

  8. A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, O.; Masters, C.; Lewis, M.B.

    1994-09-01

    In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

  9. The Genetics of a Small Chromosome Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. IV: Scutoid, an Antimorphic Mutation

    PubMed Central

    Ashburner, M.; Tsubota, S.; Woodruff, R. C.

    1982-01-01

    Exchange mapping locates the dominant mutation Scutoid to the right of Adh on chromosome arm 2L of D. melanogaster. However, deletion mapping indicates that Sco is to the left of Adh. The phenotype of Sco is sensitive to mutation, or deletion, of noc+ and of three genes, el, l(2)br22, and l(2)br29 mapping immediately distal to noc. The four contiguous loci, el, l(2)br22, l(2)br29 and noc, although separable by deletion end points, interact, because certain (or all) alleles of these four loci show partial failure of complementation, or even negative complementation. The simplest hypothesis is that Sco is a small reciprocal transposition, the genes noc, osp, and Adh exchanging places with three genes normally mapping proximal to them: l(2)br34, l(2)br35 and rd. The Sco phenotype is thought to result from a position effect at the newly created noc/l(2)br28 junction. PMID:6816673

  10. 31. Photocopy of map. Insert from Master Plan Notes Prepared ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Photocopy of map. Insert from Master Plan Notes Prepared by Environmental Planning and Design, Pittsburgh, Pa. Original at Missouri Botanical Garden. 1972 MASTER PLAN 32. 'THE TREE,' SCULPTURE BY ALEXANDER CALDER, 1966 - Missouri Botanical Garden, 2345 Tower Grove Avenue, Saint Louis, Independent City, MO

  11. Evaluation of potential models for imprinted and nonimprinted components of human chromosome 15q11-q13 syndromes by fine-structure homology mapping in the mouse.

    PubMed Central

    Nicholls, R D; Gottlieb, W; Russell, L B; Davda, M; Horsthemke, B; Rinchik, E M

    1993-01-01

    Prader-Willi and Angelman syndromes are complex neurobehavioral contiguous gene syndromes whose expression depends on the unmasking of genomic imprinting for different genetic loci in human chromosome 15q11-q13. The homologous chromosomal region in the mouse genome has been fine-mapped by using interspecific (Mus spretus) crosses and overlapping, radiation-induced deletions to evaluate potential animal models for both imprinted and nonimprinted components of these syndromes. Four evolutionarily conserved sequences from human 15q11-q13, including two cDNAs from fetal brain (DN10, D15S12h; DN34, D15S9h-1), a microdissected clone (MN7; D15F37S1h) expressed in mouse brain, and the gene for the beta 3 subunit of the gamma-aminobutyric acid type A receptor (Gabrb3), were mapped in mouse chromosome 7 by analysis of deletions at the pink-eyed dilution (p) locus. Three of these loci are deleted in pre- and postnatally lethal p-locus mutations, which extend up to 5.5 +/- 1.7 centimorgans (cM) proximal to p; D15S9h-1, which maps 1.1 +/- 0.8 cM distal to p and is the mouse homolog of the human gene D15S9 (which shows a DNA methylation imprint), is not deleted in any of the p-locus deletion series. A transcript from the Gabrb3 gene, but not the transcript detected by MN7 at the D15F37S1h locus, is expressed in mice homozygous for the p6H deletion, which have an abnormal neurological phenotype. Furthermore, the Gabrb3 transcript is expressed equally well from the maternal or paternal chromosome 7 and, therefore, its expression is not imprinted in mouse brain. Deletions at the mouse p locus should serve as intermediate genetic reagents and models with which to analyze the genetics and etiology of individual components of human 15q11-q13 disorders. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:8095339

  12. Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

    PubMed Central

    Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

    2017-01-01

    The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

  13. Indel-tolerant read mapping with trinucleotide frequencies using cache-oblivious kd-trees.

    PubMed

    Mahmud, Md Pavel; Wiedenhoeft, John; Schliep, Alexander

    2012-09-15

    Mapping billions of reads from next generation sequencing experiments to reference genomes is a crucial task, which can require hundreds of hours of running time on a single CPU even for the fastest known implementations. Traditional approaches have difficulties dealing with matches of large edit distance, particularly in the presence of frequent or large insertions and deletions (indels). This is a serious obstacle both in determining the spectrum and abundance of genetic variations and in personal genomics. For the first time, we adopt the approximate string matching paradigm of geometric embedding to read mapping, thus rephrasing it to nearest neighbor queries in a q-gram frequency vector space. Using the L(1) distance between frequency vectors has the benefit of providing lower bounds for an edit distance with affine gap costs. Using a cache-oblivious kd-tree, we realize running times, which match the state-of-the-art. Additionally, running time and memory requirements are about constant for read lengths between 100 and 1000 bp. We provide a first proof-of-concept that geometric embedding is a promising paradigm for read mapping and that L(1) distance might serve to detect structural variations. TreQ, our initial implementation of that concept, performs more accurate than many popular read mappers over a wide range of structural variants. TreQ will be released under the GNU Public License (GPL), and precomputed genome indices will be provided for download at http://treq.sf.net. pavelm@cs.rutgers.edu Supplementary data are available at Bioinformatics online.

  14. Indel-tolerant read mapping with trinucleotide frequencies using cache-oblivious kd-trees

    PubMed Central

    Mahmud, Md Pavel; Wiedenhoeft, John; Schliep, Alexander

    2012-01-01

    Motivation: Mapping billions of reads from next generation sequencing experiments to reference genomes is a crucial task, which can require hundreds of hours of running time on a single CPU even for the fastest known implementations. Traditional approaches have difficulties dealing with matches of large edit distance, particularly in the presence of frequent or large insertions and deletions (indels). This is a serious obstacle both in determining the spectrum and abundance of genetic variations and in personal genomics. Results: For the first time, we adopt the approximate string matching paradigm of geometric embedding to read mapping, thus rephrasing it to nearest neighbor queries in a q-gram frequency vector space. Using the L1 distance between frequency vectors has the benefit of providing lower bounds for an edit distance with affine gap costs. Using a cache-oblivious kd-tree, we realize running times, which match the state-of-the-art. Additionally, running time and memory requirements are about constant for read lengths between 100 and 1000 bp. We provide a first proof-of-concept that geometric embedding is a promising paradigm for read mapping and that L1 distance might serve to detect structural variations. TreQ, our initial implementation of that concept, performs more accurate than many popular read mappers over a wide range of structural variants. Availability and implementation: TreQ will be released under the GNU Public License (GPL), and precomputed genome indices will be provided for download at http://treq.sf.net. Contact: pavelm@cs.rutgers.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22962448

  15. Identification of the Pr1 Gene Product Completes the Anthocyanin Biosynthesis Pathway of Maize

    PubMed Central

    Sharma, Mandeep; Cortes-Cruz, Moises; Ahern, Kevin R.; McMullen, Michael; Brutnell, Thomas P.; Chopra, Surinder

    2011-01-01

    In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3′H encoding gene (Zmf3′h1) and showed by segregation analysis that the red kernel phenotype is linked to this gene. Genetic mapping using SNP markers confirms its position on chromosome 5L. Furthermore, genetic complementation experiments using a CaMV 35S::ZmF3′H1 promoter–gene construct established that the encoded protein product was sufficient to perform a 3′-hydroxylation reaction. The Zmf3′h1-specific transcripts were detected in floral and vegetative tissues of Pr1 plants and were absent in pr1. Four pr1 alleles were characterized: two carry a 24 TA dinucleotide repeat insertion in the 5′-upstream promoter region, a third has a 17-bp deletion near the TATA box, and a fourth contains a Ds insertion in exon1. Genetic and transcription assays demonstrated that the pr1 gene is under the regulatory control of anthocyanin transcription factors red1 and colorless1. The cloning and characterization of pr1 completes the molecular identification of all genes encoding structural enzymes of the anthocyanin pathway of maize. PMID:21385724

  16. Repeat-associated plasticity in the Helicobacter pylori RD Gene Family

    USDA-ARS?s Scientific Manuscript database

    epetitive DNA facilitates genomic flexibility via increased recombination, deletion, and insertion. The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Examining the genomes of two H. pylori strains, we d...

  17. Genetic variation and forensic efficiency of autosomal insertion/deletion polymorphisms in Chinese Bai ethnic group: phylogenetic analysis to other populations

    PubMed Central

    Yang, Chun-Hua; Yin, Cai-Yong; Shen, Chun-Mei; Guo, Yu-Xin; Dong, Qian; Yan, Jiang-Wei; Wang, Hong-Dan; Zhang, Yu-Dang; Meng, Hao-Tian; Jin, Rui

    2017-01-01

    Thirty insertion/deletion loci were utilized to study the genetic diversities of 125 bloodstain samples collected from Bai group in Yunnan Dali region, China. The observed heterozygosity and expected heterozygosity of the 30 loci ranged from 0.1520 to 0.5680, and 0.1927 to 0.4997, respectively. No deviations from Hardy-Weinberg equilibrium tests after Bonferroni correction were found at all 30 loci in Bai group. The cumulative probability of exclusion and combined discrimination power were 0.9859 and 0.9999999999887, respectively, which indicated the 30 loci could be used as complementary genetic markers for paternity testing and were qualified for personal identification in forensic cases. We found the studied Bai group had close relationships with Tibetan, Yi and Han groups from China by the population structure, principal component analysis, population differentiations, and phylogenetic reconstruction studies. Even so, for a better understanding of Bai ethnicity's genetic milieu, DNA genotyping at various genetic markers is necessary in future studies. PMID:28465476

  18. ACE insertion/deletion (I/D) polymorphism and diabetic nephropathy.

    PubMed

    Rahimi, Zohreh

    2012-10-01

    Angiotensin converting enzyme (ACE) gene encodes ACE, a key component of renin angiotensin system (RAS), plays an important role in blood pressure homeostasis by generating the vasoconstrictor peptide angiotensin II. Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science have been searched. The presence of ACE insertion/deletion (I/D) polymorphism affects the plasma level of ACE. ACE DD genotype is associated with the highest systemic and renal ACE levels compared with the lowest ACE activity in carriers of II genotype. In this review focus has been performed on the study of ACE I/D polymorphism in various populations and its influence on the risk of onset and progression of diabetic nephropathy. Also, association between ACE I/D polymorphism and response to ACE inhibitor and angiotensin II receptor antagonists will be reviewed. Further, synergistic effect of this polymorphism and variants of some genes on the risk of development of diabetic nephropathy will be discussed.

  19. Genetic variation and forensic efficiency of autosomal insertion/deletion polymorphisms in Chinese Bai ethnic group: phylogenetic analysis to other populations.

    PubMed

    Yang, Chun-Hua; Yin, Cai-Yong; Shen, Chun-Mei; Guo, Yu-Xin; Dong, Qian; Yan, Jiang-Wei; Wang, Hong-Dan; Zhang, Yu-Dang; Meng, Hao-Tian; Jin, Rui; Chen, Feng; Zhu, Bo-Feng

    2017-06-13

    Thirty insertion/deletion loci were utilized to study the genetic diversities of 125 bloodstain samples collected from Bai group in Yunnan Dali region, China. The observed heterozygosity and expected heterozygosity of the 30 loci ranged from 0.1520 to 0.5680, and 0.1927 to 0.4997, respectively. No deviations from Hardy-Weinberg equilibrium tests after Bonferroni correction were found at all 30 loci in Bai group. The cumulative probability of exclusion and combined discrimination power were 0.9859 and 0.9999999999887, respectively, which indicated the 30 loci could be used as complementary genetic markers for paternity testing and were qualified for personal identification in forensic cases. We found the studied Bai group had close relationships with Tibetan, Yi and Han groups from China by the population structure, principal component analysis, population differentiations, and phylogenetic reconstruction studies. Even so, for a better understanding of Bai ethnicity's genetic milieu, DNA genotyping at various genetic markers is necessary in future studies.

  20. In vivo and in vitro disease modeling with CRISPR/Cas9.

    PubMed

    Kato, Tomoko; Takada, Shuji

    2017-01-01

    In the past few years, extensive progress has been made in the development of genome-editing technology. Among several genome-editing tools, the clustered regularly interspaced short palindrome repeat-associated Cas9 nuclease (CRISPR/Cas9) system is particularly widely used owing to the ease of sequence-specific nuclease construction and the highly efficient introduction of mutations. The CRISPR/Cas9 system was originally constructed to induce small insertion and deletion mutations, but various methods have been developed to introduce point mutations, deletions, insertions, chromosomal translocations and so on. These methods should be useful for the reconstruction of disease-causing mutations in cultured cell lines and living organisms to elucidate disease pathogenesis and for disease prevention, treatment and drug discovery. This review summarizes the current technical aspects of the CRISPR/Cas9 system for disease modeling in cultured cells and living organisms, mainly mice. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. TERRA Promotes Telomere Shortening through Exonuclease 1–Mediated Resection of Chromosome Ends

    PubMed Central

    Pfeiffer, Verena; Lingner, Joachim

    2012-01-01

    The long noncoding telomeric repeat containing RNA (TERRA) is expressed at chromosome ends. TERRA upregulation upon experimental manipulation or in ICF (immunodeficiency, centromeric instability, facial anomalies) patients correlates with short telomeres. To study the mechanism of telomere length control by TERRA in Saccharomyces cerevisiae, we mapped the transcriptional start site of TERRA at telomere 1L and inserted a doxycycline regulatable promoter upstream. Induction of TERRA transcription led to telomere shortening of 1L but not of other chromosome ends. TERRA interacts with the Exo1-inhibiting Ku70/80 complex, and deletion of EXO1 but not MRE11 fully suppressed the TERRA–mediated short telomere phenotype in presence and absence of telomerase. Thus TERRA transcription facilitates the 5′-3′ nuclease activity of Exo1 at chromosome ends, providing a means to regulate the telomere shortening rate. Thereby, telomere transcription can regulate cellular lifespan through modulation of chromosome end processing activities. PMID:22719262

  2. A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing

    PubMed Central

    Fu, Liezhen; Wen, Luan; Luu, Nga; Shi, Yun-Bo

    2016-01-01

    Genome editing with designer nucleases such as TALEN and CRISPR/Cas enzymes has broad applications. Delivery of these designer nucleases into organisms induces various genetic mutations including deletions, insertions and nucleotide substitutions. Characterizing those mutations is critical for evaluating the efficacy and specificity of targeted genome editing. While a number of methods have been developed to identify the mutations, none other than sequencing allows the identification of the most desired mutations, i.e., out-of-frame insertions/deletions that disrupt genes. Here we report a simple and efficient method to visualize and quantify the efficiency of genomic mutations induced by genome-editing. Our approach is based on the expression of a two-color fusion protein in a vector that allows the insertion of the edited region in the genome in between the two color moieties. We show that our approach not only easily identifies developing animals with desired mutations but also efficiently quantifies the mutation rate in vivo. Furthermore, by using LacZα and GFP as the color moieties, our approach can even eliminate the need for a fluorescent microscope, allowing the analysis with simple bright field visualization. Such an approach will greatly simplify the screen for effective genome-editing enzymes and identify the desired mutant cells/animals. PMID:27748423

  3. Exploring Beta-Amyloid Protein Transmembrane Insertion Behavior and Residue-Specific Lipid Interactions in Lipid Bilayers Using Multiscale MD Simulations

    NASA Astrophysics Data System (ADS)

    Qiu, Liming; Vaughn, Mark; Cheng, Kelvin

    2013-03-01

    Beta-amyloid (Abeta) interactions with neurons are linked to Alzheimer's. Using a multiscale MD simulation strategy that combines the high efficiency of phase space sampling of coarse-grained MD (CGD) and the high spatial resolution of Atomistic MD (AMD) simulations, we studied the Abeta insertion dynamics in cholesterol-enriched and -depleted lipid bilayers that mimic the neuronal membranes domains. Forward (AMD-CGD) and reverse (CGD-AMD) mappings were used. At the atomistic level, cholesterol promoted insertion of Abeta with high (folded) or low (unfolded) helical contents of the lipid insertion domain (Lys28-Ala42), and the insertions were stabilized by the Lys28 snorkeling and Ala42-anchoring to the polar lipid groups of the bilayer up to 200ns. After the forward mapping, the folded inserted state switched to a new extended inserted state with the Lys28 descended to the middle of the bilayer while the unfolded inserted state migrated to the membrane surface up to 4000ns. The two new states remained stable for 200ns at the atomistic scale after the reverse mapping. Our results suggested that different Abeta membrane-orientation states separated by free energy barriers can be explored by the multiscale MD more effectively than by Atomistic MD simulations alone. NIH RC1-GM090897-02

  4. An integrated genetic map based on four mapping populations and quantitative trait loci associated with economically important traits in watermelon (Citrullus lanatus)

    PubMed Central

    2014-01-01

    Background Modern watermelon (Citrullus lanatus L.) cultivars share a narrow genetic base due to many years of selection for desirable horticultural qualities. Wild subspecies within C. lanatus are important potential sources of novel alleles for watermelon breeding, but successful trait introgression into elite cultivars has had limited success. The application of marker assisted selection (MAS) in watermelon is yet to be realized, mainly due to the past lack of high quality genetic maps. Recently, a number of useful maps have become available, however these maps have few common markers, and were constructed using different marker sets, thus, making integration and comparative analysis among maps difficult. The objective of this research was to use single-nucleotide polymorphism (SNP) anchor markers to construct an integrated genetic map for C. lanatus. Results Under the framework of the high density genetic map, an integrated genetic map was constructed by merging data from four independent mapping experiments using a genetically diverse array of parental lines, which included three subspecies of watermelon. The 698 simple sequence repeat (SSR), 219 insertion-deletion (InDel), 36 structure variation (SV) and 386 SNP markers from the four maps were used to construct an integrated map. This integrated map contained 1339 markers, spanning 798 cM with an average marker interval of 0.6 cM. Fifty-eight previously reported quantitative trait loci (QTL) for 12 traits in these populations were also integrated into the map. In addition, new QTL identified for brix, fructose, glucose and sucrose were added. Some QTL associated with economically important traits detected in different genetic backgrounds mapped to similar genomic regions of the integrated map, suggesting that such QTL are responsible for the phenotypic variability observed in a broad array of watermelon germplasm. Conclusions The integrated map described herein enhances the utility of genomic tools over previous watermelon genetic maps. A large proportion of the markers in the integrated map are SSRs, InDels and SNPs, which are easily transferable across laboratories. Moreover, the populations used to construct the integrated map include all three watermelon subspecies, making this integrated map useful for the selection of breeding traits, identification of QTL, MAS, analysis of germplasm and commercial hybrid seed detection. PMID:24443961

  5. A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

    PubMed

    Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

    2016-10-01

    Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

  6. An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

    PubMed Central

    Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

    2007-01-01

    Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

  7. Polarity of recombination in transformation of Streptococcus pneumoniae

    PubMed Central

    Pasta, Franck; Sicard, Michel A.

    1999-01-01

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5′- and 3′-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami− transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5′ to the deletion, showing that, in vivo, the 5′ side is strongly favored by recombination. Further results suggest that exchanges occurring from 5′ to 3′ relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5′ preference. PMID:10077616

  8. Polarity of recombination in transformation of Streptococcus pneumoniae.

    PubMed

    Pasta, F; Sicard, M A

    1999-03-16

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

  9. Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

    NASA Astrophysics Data System (ADS)

    Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

    2013-12-01

    First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

  10. Detection and characterization of miniature inverted-repeat transposable elements in “Candidatus Liberibacter asiaticus”

    USDA-ARS?s Scientific Manuscript database

    Miniature inverted-repeat transposable elements (MITEs) are non-autonomous transposons (devoid a transposase gene, tps) involving insertion/deletion of genomic DNA in bacterial genomes influencing gene functions. No transposon has yet been reported in “Candidatus Liberibacter asiaticus”, an alpha-pr...

  11. The Teaching of Protein Synthesis--A Microcomputer Based Method.

    ERIC Educational Resources Information Center

    Goodridge, Frank

    1983-01-01

    Describes two computer programs (BASIC for 32K Commodore PET) for teaching protein synthesis. The first is an interactive test of base-pairing knowledge, and the second generates random DNA nucleotide sequences, with instructions for substitution, insertion, and deletion printed out for each student. (JN)

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Merriwether, D.A.; Huston, S.L.; Bunker, C.A.

    An intergenic region V Mitochondrial DNA (mtDNA) 9 bp deletion located between the genes for tRNA{sup LYS} and cytochrome oxidase II was discovered in a small percentage of Nigerian and Ivory Coast natives. Previously this deletion has been described as Asian-specific and has been reported throughout the New World, Asia, S.E. Asia, and the Pacific Islands at frequencies ranging from 0% to 100%. In the New World and the Pacific Islands, the deletion is almost always accompanied by an Hae III restriction site gain at nt 16517. All 9 occurrences of the deletion observed in Africa (from four different populations)more » co-occur with the Hae III 16517 site gain, indicating that the African deletion probably shares a common origin with the deletion described as {open_quotes}Asian-specific{close_quotes}. The deletion was found in Benin and Sokoto, Nigeria in 2/54 Edo Bini, 1/2 Edo Ishan, 3/99 Hausa, 0/18 Fulani, and 0/16 other Nigerians. The deletion was also detected in 3/115 Ivory Coast natives from Abidjan. A 9 bp insertion (triplication) was observed in 1/115 Ivory Coast natives. The triplicated individual also possessed the Hae III 16517 site gain. The fragment containing the African deletion was sequenced and found to be identical in sequence to the Asian deletion region. D-loop sequence of nts 15975 to 00048 revealed that 2 of the 3 Ivory Coast deleted individuals and 1 of the 6 Nigerians deleted (Hausa) had a T-C transition at nt position 16189 which is common in New World-deleted individuals. These results raise the possibility that the occurrence of this deletion predates the separation of Asian and African populations from a common ancestral populations, or that the deletion has occurred more than once in human evolution. Either explanation requires that caution be exercised when using the 9 bp deletion as a population marker.« less

  13. Zoom‐in comparative genomic hybridisation arrays for the characterisation of variable breakpoint contiguous gene syndromes

    PubMed Central

    Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G

    2007-01-01

    Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889

  14. [Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

    PubMed

    Cheng, L H; Liu, Y; Niu, T

    2017-05-14

    Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

  15. Fine Mapping and Transcriptome Analysis Reveal Candidate Genes Associated with Hybrid Lethality in Cabbage (Brassica Oleracea).

    PubMed

    Xiao, Zhiliang; Hu, Yang; Zhang, Xiaoli; Xue, Yuqian; Fang, Zhiyuan; Yang, Limei; Zhang, Yangyong; Liu, Yumei; Li, Zhansheng; Liu, Xing; Liu, Zezhou; Lv, Honghao; Zhuang, Mu

    2017-06-05

    Hybrid lethality is a deleterious phenotype that is vital to species evolution. We previously reported hybrid lethality in cabbage ( Brassica oleracea ) and performed preliminary mapping of related genes. In the present study, the fine mapping of hybrid lethal genes revealed that BoHL1 was located on chromosome C1 between BoHLTO124 and BoHLTO130, with an interval of 101 kb. BoHL2 was confirmed to be between insertion-deletion (InDels) markers HL234 and HL235 on C4, with a marker interval of 70 kb. Twenty-eight and nine annotated genes were found within the two intervals of BoHL1 and BoHL2 , respectively. We also applied RNA-Seq to analyze hybrid lethality in cabbage. In the region of BoHL1 , seven differentially expressed genes (DEGs) and five resistance (R)-related genes (two in common, i.e., Bo1g153320 and Bo1g153380 ) were found, whereas in the region of BoHL2 , two DEGs and four R-related genes (two in common, i.e., Bo4g173780 and Bo4g173810 ) were found. Along with studies in which R genes were frequently involved in hybrid lethality in other plants, these interesting R-DEGs may be good candidates associated with hybrid lethality. We also used SNP/InDel analyses and quantitative real-time PCR to confirm the results. This work provides new insight into the mechanisms of hybrid lethality in cabbage.

  16. Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.

    PubMed

    Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P

    2018-05-10

    Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.

  17. Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

    PubMed

    Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

    2018-03-01

    Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

  18. Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

    PubMed

    Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

    2007-07-01

    Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

  19. Specifications for an STD/CTD System at the NODC,

    DTIC Science & Technology

    1980-06-27

    insertion of an inter- polated value or the deletion of a data level. The system is inadequate in allowing only 800 characters of comments. More comments...returns to the interactive mode. The scientist may want to modify the data sets by the 3-14 addition or deletion of data flags. addition of quality...I ! a "- I II _! I I LOS1 , ; II ’ 1 i I t _ _ 4111,, I. ... ____i I t I i ,ir s T i I __ I - " -*- t I ii - - 0.I-I I I Fiur A3 " ,r,, Ir -- I I 1

  20. Physical function is weakly associated with angiotensin-converting enzyme gene I/D polymorphism in elderly Japanese subjects.

    PubMed

    Yoshihara, A; Tobina, T; Yamaga, T; Ayabe, M; Yoshitake, Y; Kimura, Y; Shimada, M; Nishimuta, M; Nakagawa, N; Ohashi, M; Hanada, N; Tanaka, H; Kiyonaga, A; Miyazaki, H

    2009-01-01

    The turning point in the deterioration of physical function seems to occur between the ages of 70 and 80 years. In particular, muscle strength may decline even more in subjects older than 75. A recent study found that the angiotensin-converting enzyme (ACE) genotype also affects physiological left ventricular hypertrophy. A very limited number of papers have examined genetic differences in resistance and endurance forms of a single sporting discipline. The purpose of this study was to evaluate the relationship between ACE genotype and physical function by controlling the known confounding factors including dental status. We selected 431 subjects who were aged 76 years and did not require special care for their daily activities. We conducted a medical examination, followed by 5 physical function tests, as follows: (1) maximum hand grip strength, (2) maximal isometric knee extensor strength, (3) maximal stepping rate for 10 s, (4) one-leg standing time with eyes open and (5) 10-meter maximum walking speed. Subjects were genotyped for the ACE intron 16 Alu insertion. In addition, serum concentrations of total cholesterol, total protein, IgA and IgG were measured at a commercial laboratory. The Eichner index was used as an indicator of occlusal condition. Multiple linear regression analysis was performed to evaluate the relationship between the ACE gene insertion/deletion (I/D) polymorphism and physical function considering confounding factors. The ACE gene I/D polymorphism was positively associated with hand grip strength and 10-meter maximum walking speed. Betas of hand grip strength were 0.09 for I/D (p = 0.022) and 0.12 for insertion/insertion (I/I; p = 0.004). Betas of 10-meter walking speed were -0.11 for I/D (p = 0.093) and -0.14 for I/I (p = 0.039). Dental status such as Eichner index class C was significantly associated with one-leg standing time with eyes open (beta -0.11; p = 0.028). This study suggests that there is a significant relationship between ACE genotype and physical function. In particular, subjects with the ACE deletion/deletion genotype were associated with upper extremities. Copyright 2009 S. Karger AG, Basel.

  1. DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

    PubMed

    Barkan, A; Mertz, J E

    1981-02-01

    The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

  2. Clinical resistance associated with a novel MAP2K1 mutation in a patient with Langerhans cell histiocytosis.

    PubMed

    Azorsa, David O; Lee, David W; Wai, Daniel H; Bista, Ranjan; Patel, Apurvi R; Aleem, Eiman; Henry, Michael M; Arceci, Robert J

    2018-05-16

    Patients with Langerhans cell histiocytosis (LCH) harbor BRAF V600E and activating mutations of MAP2K1/MEK1 in 50% and 25% of cases, respectively. We evaluated a patient with treatment-refractory LCH for mutations in the RAS-RAF-MEK-ERK pathway and identified a novel mutation in the MAP2K1 gene resulting in a p.L98_K104 > Q deletion and predicted to be auto-activating. During treatment with the MEK inhibitor trametinib, the patient's disease showed significant progression. In vitro characterization of the MAP2K1 p.L98_K104 > Q deletion confirmed its effect on cellular activation of the ERK pathway and drug resistance. © 2018 Wiley Periodicals, Inc.

  3. Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

    PubMed Central

    Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

    2013-01-01

    Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

  4. A mobile threat to genome stability: The impact of non-LTR retrotransposons upon the human genome

    PubMed Central

    Konkel, Miriam K.; Batzer, Mark A.

    2010-01-01

    It is now commonly agreed that the human genome is not the stable entity originally presumed. Deletions, duplications, inversions, and insertions are common, and contribute significantly to genomic structural variations (SVs). Their collective impact generates much of the inter-individual genomic diversity observed among humans. Not only do these variations change the structure of the genome; they may also have functional implications, e.g. altered gene expression. Some SVs have been identified as the cause of genetic disorders, including cancer predisposition. Cancer cells are notorious for their genomic instability, and often show genomic rearrangements at the microscopic and submicroscopic level to which transposable elements (TEs) contribute. Here, we review the role of TEs in genome instability, with particular focus on non-LTR retrotransposons. Currently, three non-LTR retrotransposon families – long interspersed element 1 (L1), SVA (short interspersed element (SINE-R), variable number of tandem repeats (VNTR), and Alu), and Alu (a SINE) elements – mobilize in the human genome, and cause genomic instability through both insertion- and post-insertion-based mutagenesis. Due to the abundance and high sequence identity of TEs, they frequently mislead the homologous recombination repair pathway into non-allelic homologous recombination, causing deletions, duplications, and inversions. While less comprehensively studied, non-LTR retrotransposon insertions and TE-mediated rearrangements are probably more common in cancer cells than in healthy tissue. This may be at least partially attributed to the commonly seen global hypomethylation as well as general epigenetic dysfunction of cancer cells. Where possible, we provide examples that impact cancer predisposition and/or development. PMID:20307669

  5. A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers.

    PubMed

    Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

    2015-12-01

    The ornamental peach cultivar 'Hongbaihuatao (HBH)' can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene-regulator involved in anthocyanin transport (Riant)-which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers

    PubMed Central

    Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

    2015-01-01

    The ornamental peach cultivar ‘Hongbaihuatao (HBH)’ can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene—regulator involved in anthocyanin transport (Riant)—which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. PMID:26357885

  7. 75 FR 56472 - Amendments to Enforceable Consent Agreement Procedural Rules

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-16

    ... process that EPA is changing include when and how to initiate negotiations and inserting a firm deadline at which negotiations will terminate. EPA is also deleting, modifying, or consolidating several... Committee (ITC) provisions in a separate section, to make it clearer that there is one ECA negotiation...

  8. Creation and genomic analysis of irradiation hybrids in Populus

    Treesearch

    Matthew S. Zinkgraf; K. Haiby; M.C. Lieberman; L. Comai; I.M. Henry; Andrew Groover

    2016-01-01

    Establishing efficient functional genomic systems for creating and characterizing genetic variation in forest trees is challenging. Here we describe protocols for creating novel gene-dosage variation in Populus through gamma-irradiation of pollen, followed by genomic analysis to identify chromosomal regions that have been deleted or inserted in...

  9. A TAD boundary is preserved upon deletion of the CTCF-rich Firre locus.

    PubMed

    Barutcu, A Rasim; Maass, Philipp G; Lewandowski, Jordan P; Weiner, Catherine L; Rinn, John L

    2018-04-13

    The binding of the transcriptional regulator CTCF to the genome has been implicated in the formation of topologically associated domains (TADs). However, the general mechanisms of folding the genome into TADs are not fully understood. Here we test the effects of deleting a CTCF-rich locus on TAD boundary formation. Using genome-wide chromosome conformation capture (Hi-C), we focus on one TAD boundary on chromosome X harboring ~ 15 CTCF binding sites and located at the long non-coding RNA (lncRNA) locus Firre. Specifically, this TAD boundary is invariant across evolution, tissues, and temporal dynamics of X-chromosome inactivation. We demonstrate that neither the deletion of this locus nor the ectopic insertion of Firre cDNA or its ectopic expression are sufficient to alter TADs in a sex-specific or allele-specific manner. In contrast, Firre's deletion disrupts the chromatin super-loop formation of the inactive X-chromosome. Collectively, our findings suggest that apart from CTCF binding, additional mechanisms may play roles in establishing TAD boundary formation.

  10. Files synchronization from a large number of insertions and deletions

    NASA Astrophysics Data System (ADS)

    Ellappan, Vijayan; Kumari, Savera

    2017-11-01

    Synchronization between different versions of files is becoming a major issue that most of the applications are facing. To make the applications more efficient a economical algorithm is developed from the previously used algorithm of “File Loading Algorithm”. I am extending this algorithm in three ways: First, dealing with non-binary files, Second backup is generated for uploaded files and lastly each files are synchronized with insertions and deletions. User can reconstruct file from the former file with minimizing the error and also provides interactive communication by eliminating the frequency without any disturbance. The drawback of previous system is overcome by using synchronization, in which multiple copies of each file/record is created and stored in backup database and is efficiently restored in case of any unwanted deletion or loss of data. That is, to introduce a protocol that user B may use to reconstruct file X from file Y with suitably low probability of error. Synchronization algorithms find numerous areas of use, including data storage, file sharing, source code control systems, and cloud applications. For example, cloud storage services such as Drop box synchronize between local copies and cloud backups each time users make changes to local versions. Similarly, synchronization tools are necessary in mobile devices. Specialized synchronization algorithms are used for video and sound editing. Synchronization tools are also capable of performing data duplication.

  11. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  12. Epistasis between 5-HTTLPR and ADRA2B polymorphisms influences attentional bias for emotional information in healthy volunteers.

    PubMed

    Naudts, Kris H; Azevedo, Ruben T; David, Anthony S; van Heeringen, Kees; Gibbs, Ayana A

    2012-09-01

    Individual differences in emotional processing are likely to contribute to vulnerability and resilience to emotional disorders such as depression and anxiety. Genetic variation is known to contribute to these differences but they remain incompletely understood. The serotonin transporter (5-HTTLPR) and α2B-adrenergic autoreceptor (ADRA2B) insertion/deletion polymorphisms impact on two separate but interacting monaminergic signalling mechanisms that have been implicated in both emotional processing and emotional disorders. Recent studies suggest that the 5-HTTLPR s allele is associated with a negative attentional bias and an increased risk of emotional disorders. However, such complex behavioural traits are likely to exhibit polygenicity, including epistasis. This study examined the contribution of the 5-HTTLPR and ADRA2B insertion/deletion polymorphisms to attentional biases for aversive information in 94 healthy male volunteers and found evidence of a significant epistatic effect (p<0.001). Specifically, in the presence of the 5-HTTLPR s allele, the attentional bias for aversive information was attenuated by possession of the ADRA2B deletion variant whereas in the absence of the s allele, the bias was enhanced. These data identify a cognitive mechanism linking genotype-dependent serotonergic and noradrenergic signalling that is likely to have implications for the development of cognitive markers for depression/anxiety as well as therapeutic drug effects and personalized approaches to treatment.

  13. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  14. First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

    PubMed

    Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F

    2014-01-01

    Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

  15. First Report of a Deletion Encompassing an Entire Exon in the Homogentisate 1,2-Dioxygenase Gene Causing Alkaptonuria

    PubMed Central

    Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.

    2014-01-01

    Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259

  16. Dissection of Insertion–Deletion Variants within Differentially Expressed Genes Involved in Wood Formation in Populus

    PubMed Central

    Gong, Chenrui; Du, Qingzhang; Xie, Jianbo; Quan, Mingyang; Chen, Beibei; Zhang, Deqiang

    2018-01-01

    Short insertions and deletions (InDels) are one of the major genetic variants and are distributed widely across the genome; however, few investigations of InDels have been conducted in long-lived perennial plants. Here, we employed a combination of RNA-seq and population resequencing to identify InDels within differentially expressed (DE) genes underlying wood formation in a natural population of Populus tomentosa (435 individuals) and utilized InDel-based association mapping to detect the causal variants under additive, dominance, and epistasis underlying growth and wood properties. In the present paper, 5,482 InDels detected from 629 DE genes showed uneven distributions throughout all 19 chromosomes, and 95.9% of these loci were diallelic InDels. Seventy-four InDels (positive false discovery rate q ≤ 0.10) from 68 genes exhibited significant additive/dominant effects on 10 growth and wood-properties, with an average of 14.7% phenotypic variance explained. Potential pleiotropy was observed in one-third of the InDels (representing 24 genes). Seven genes exhibited significantly differential expression among the genotypic classes of associated InDels, indicating possible important roles for these InDels. Epistasis analysis showed that overlapping interacting genes formed unique interconnected networks for each trait, supporting the putative biochemical links that control quantitative traits. Therefore, the identification and utilization of InDels in trees will be recognized as an effective marker system for molecular marker-assisted breeding applications, and further facilitate our understanding of quantitative genomics. PMID:29403506

  17. 4p16.3 microdeletions and microduplications detected by chromosomal microarray analysis: New insights into mechanisms and critical regions.

    PubMed

    Bi, Weimin; Cheung, Sau-Wai; Breman, Amy M; Bacino, Carlos A

    2016-10-01

    Deletions in the 4p16.3 region cause Wolf-Hirschhorn syndrome, a well known contiguous microdeletion syndrome with the critical region for common phenotype mapped in WHSCR2. Recently, duplications in 4p16.3 were reported in three patients with developmental delay and dysmorphic features. Through chromosomal microarray analysis, we identified 156 patients with a deletion (n = 109) or duplication (n = 47) in 4p16.3 out of approximately 60,000 patients analyzed by Baylor Miraca Genetics Laboratories. Seventy-five of the postnatally detected deletions encompassed the entire critical region, 32 (43%) of which were associated with other chromosome rearrangements, including six patients (8%) that had a duplication adjacent to the terminal deletion. Our data indicate that Wolf-Hirschhorn syndrome deletions with an adjacent duplication occur at a higher frequency than previously appreciated. Pure deletions (n = 14) or duplications (n = 15) without other copy number changes distal to or inside the WHSCR2 were identified for mapping of critical regions. Our data suggest that deletion of the segment from 0.6 to 0.9 Mb from the terminus of 4p causes a seizure phenotype and duplications of a region distal to the previously defined smallest region of overlap for 4p16.3 microduplication syndrome are associated with neurodevelopmental problems. We detected seven Wolf-Hirschhorn syndrome deletions and one 4p16.3 duplication prenatally; all of the seven are either >8 Mb in size and/or associated with large duplications. In conclusion, our study provides deeper insight into the molecular mechanisms, the critical regions and effective prenatal diagnosis for 4p16.3 deletions/ duplications. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Deletion mapping of chromosome 13q in head and neck squamous cell carcinoma in Indian patients: correlation with prognosis of the tumour

    PubMed Central

    Sabbir, Golam Md; Roy, Anup; Mandal, Syamsundar; Dam, Aniruddha; Roychoudhury, Susanta; Panda, Chinmay Kumar

    2006-01-01

    Deletions in chromosome (chr.) 13q occur frequently in head and neck squamous cell carcinoma (HNSCC). Previous studies failed to identify common deleted regions in chr.13q, though several candidate tumour suppressor genes (TSGs) loci, e.g. BRCA2, RB1 and BRCAX have been localized in this chromosome, as well as no prognostic significance of the deletion has been reported. Thus, in the present study, deletion mapping of chr. 13q has been done in 55 primary HNSCC samples of Indian patients using 11 highly polymorphic microsatellite markers of which three were intragenic to BRCA2 gene, one intragenic to RB1 gene and another from BRCAX locus. The deletion in chr.13q was significantly associated with progression of HNSCC. High frequencies (27–39%) of loss of heterozygosity were found in 13q13.1 (BRCA2), 13q14.2 (RB1), 13q21.2–22.1 (BRCAX) and 13q31.1 regions. Deletions in the BRCA2 and RB1 regions were significantly correlated. The four highly deleted regions were associated with clinical stage and histological grades of the tumour as well as poor patient outcome. Deletion in the 13q31.1 region was only found to be associated with HPV infection. High frequencies (11–23%) of microsatellite size alteration (MA) were seen to overlap with the highly deleted regions. Forty per cent of the samples showed rare biallelic alteration whereas loss of normal copy of chromosome 13q was seen in five tumours. Thus, it seems that the putative TSGs located in the BRCAX and 13q31.1 regions as well as the BRCA2 and RB1 genes may have some cumulative effect in progression and poor prognosis of HNSCC. Significant association between deletion in BRCA2 and RB1 gene loci may indicate functional relationship between the genes in this tumour progression. PMID:16623759

  19. Molecular definition of 22q11 deletions in 151 velo-cardio-facial syndrome patients.

    PubMed Central

    Carlson, C; Sirotkin, H; Pandita, R; Goldberg, R; McKie, J; Wadey, R; Patanjali, S R; Weissman, S M; Anyane-Yeboa, K; Warburton, D; Scambler, P; Shprintzen, R; Kucherlapati, R; Morrow, B E

    1997-01-01

    Velo-cardio-facial syndrome (VCFS) is a relatively common developmental disorder characterized by craniofacial anomalies and conotruncal heart defects. Many VCFS patients have hemizygous deletions for a part of 22q11, suggesting that haploinsufficiency in this region is responsible for its etiology. Because most cases of VCFS are sporadic, portions of 22q11 may be prone to rearrangement. To understand the molecular basis for chromosomal deletions, we defined the extent of the deletion, by genotyping 151 VCFS patients and performing haplotype analysis on 105, using 15 consecutive polymorphic markers in 22q11. We found that 83% had a deletion and >90% of these had a similar approximately 3 Mb deletion, suggesting that sequences flanking the common breakpoints are susceptible to rearrangement. We found no correlation between the presence or size of the deletion and the phenotype. To further define the chromosomal breakpoints among the VCFS patients, we developed somatic hybrid cell lines from a set of VCFS patients. An 11-kb resolution physical map of a 1,080-kb region that includes deletion breakpoints was constructed, incorporating genes and expressed sequence tags (ESTs) isolated by the hybridization selection method. The ordered markers were used to examine the two separated copies of chromosome 22 in the somatic hybrid cell lines. In some cases, we were able to map the chromosome breakpoints within a single cosmid. A 480-kb critical region for VCFS has been delineated, including the genes for GSCL, CTP, CLTD, HIRA, and TMVCF, as well as a number of novel ordered ESTs. PMID:9326327

  20. An Unbiased Genome-Wide View of the Mutation Rate and Spectrum of the Endosymbiotic Bacterium Teredinibacter turnerae.

    PubMed

    Senra, Marcus V X; Sung, Way; Ackerman, Matthew; Miller, Samuel F; Lynch, Michael; Soares, Carlos Augusto G

    2018-03-01

    Mutations contribute to genetic variation in all living systems. Thus, precise estimates of mutation rates and spectra across a diversity of organisms are required for a full comprehension of evolution. Here, a mutation-accumulation (MA) assay was carried out on the endosymbiotic bacterium Teredinibacter turnerae. After ∼3,025 generations, base-pair substitutions (BPSs) and insertion-deletion (indel) events were characterized by whole-genome sequencing analysis of 47 independent MA lines, yielding a BPS rate of 1.14 × 10-9 per site per generation and indel rate of 1.55 × 10-10 events per site per generation, which are among the highest within free-living and facultative intracellular bacteria. As in other endosymbionts, a significant bias of BPSs toward A/T and an excess of deletion mutations over insertion mutations are observed for these MA lines. However, even with a deletion bias, the genome remains relatively large (∼5.2 Mb) for an endosymbiotic bacterium. The estimate of the effective population size (Ne) in T. turnerae is quite high and comparable to free-living bacteria (∼4.5 × 107), suggesting that the heavy bottlenecking associated with many endosymbiotic relationships is not prevalent during the life of this endosymbiont. The efficiency of selection scales with increasing Ne and such strong selection may have been operating against the deletion bias, preventing genome erosion. The observed mutation rate in this endosymbiont is of the same order of magnitude of those with similar Ne, consistent with the idea that population size is a primary determinant of mutation-rate evolution within endosymbionts, and that not all endosymbionts have low Ne.

  1. Basecalling with LifeTrace

    PubMed Central

    Walther, Dirk; Bartha, Gábor; Morris, Macdonald

    2001-01-01

    A pivotal step in electrophoresis sequencing is the conversion of the raw, continuous chromatogram data into the actual sequence of discrete nucleotides, a process referred to as basecalling. We describe a novel algorithm for basecalling implemented in the program LifeTrace. Like Phred, currently the most widely used basecalling software program, LifeTrace takes processed trace data as input. It was designed to be tolerant to variable peak spacing by means of an improved peak-detection algorithm that emphasizes local chromatogram information over global properties. LifeTrace is shown to generate high-quality basecalls and reliable quality scores. It proved particularly effective when applied to MegaBACE capillary sequencing machines. In a benchmark test of 8372 dye-primer MegaBACE chromatograms, LifeTrace generated 17% fewer substitution errors, 16% fewer insertion/deletion errors, and 2.4% more aligned bases to the finished sequence than did Phred. For two sets totaling 6624 dye-terminator chromatograms, the performance improvement was 15% fewer substitution errors, 10% fewer insertion/deletion errors, and 2.1% more aligned bases. The processing time required by LifeTrace is comparable to that of Phred. The predicted quality scores were in line with observed quality scores, permitting direct use for quality clipping and in silico single nucleotide polymorphism (SNP) detection. Furthermore, we introduce a new type of quality score associated with every basecall: the gap-quality. It estimates the probability of a deletion error between the current and the following basecall. This additional quality score improves detection of single basepair deletions when used for locating potential basecalling errors during the alignment. We also describe a new protocol for benchmarking that we believe better discerns basecaller performance differences than methods previously published. PMID:11337481

  2. Genomic gigantism: DNA loss is slow in mountain grasshoppers.

    PubMed

    Bensasson, D; Petrov, D A; Zhang, D X; Hartl, D L; Hewitt, G M

    2001-02-01

    Several studies have shown DNA loss to be inversely correlated with genome size in animals. These studies include a comparison between Drosophila and the cricket, Laupala, but there has been no assessment of DNA loss in insects with very large genomes. Podisma pedestris, the brown mountain grasshopper, has a genome over 100 times as large as that of Drosophila and 10 times as large as that of Laupala. We used 58 paralogous nuclear pseudogenes of mitochondrial origin to study the characteristics of insertion, deletion, and point substitution in P. pedestris and Italopodisma. In animals, these pseudogenes are "dead on arrival"; they are abundant in many different eukaryotes, and their mitochondrial origin simplifies the identification of point substitutions accumulated in nuclear pseudogene lineages. There appears to be a mononucleotide repeat within the 643-bp pseudogene sequence studied that acts as a strong hot spot for insertions or deletions (indels). Because the data for other insect species did not contain such an unusual region, hot spots were excluded from species comparisons. The rate of DNA loss relative to point substitution appears to be considerably and significantly lower in the grasshoppers studied than in Drosophila or Laupala. This suggests that the inverse correlation between genome size and the rate of DNA loss can be extended to comparisons between insects with large or gigantic genomes (i.e., Laupala and Podisma). The low rate of DNA loss implies that in grasshoppers, the accumulation of point mutations is a more potent force for obscuring ancient pseudogenes than their loss through indel accumulation, whereas the reverse is true for Drosophila. The main factor contributing to the difference in the rates of DNA loss estimated for grasshoppers, crickets, and Drosophila appears to be deletion size. Large deletions are relatively rare in Podisma and Italopodisma.

  3. Dystrophin Hot-Spot Mutants Leading to Becker Muscular Dystrophy Insert More Deeply into Membrane Models than the Native Protein.

    PubMed

    Ameziane-Le Hir, Sarah; Paboeuf, Gilles; Tascon, Christophe; Hubert, Jean-François; Le Rumeur, Elisabeth; Vié, Véronique; Raguénès-Nicol, Céline

    2016-07-26

    Dystrophin (DYS) is a membrane skeleton protein whose mutations lead to lethal Duchenne muscular dystrophy or to the milder Becker muscular dystrophy (BMD). One third of BMD "in-frame" exon deletions are located in the region that codes for spectrin-like repeats R16 to R21. We focused on four prevalent mutated proteins deleted in this area (called RΔ45-47, RΔ45-48, RΔ45-49, and RΔ45-51 according to the deleted exon numbers), analyzing protein/membrane interactions. Two of the mutants, RΔ45-48 and RΔ45-51, led to mild pathologies and displayed a similar triple coiled-coil structure as the full-length DYS R16-21, whereas the two others, RΔ45-47 and RΔ45-49, induced more severe pathologies and showed "fractional" structures unrelated to the normal one. To explore lipid packing, small unilamellar liposomes (SUVs) and planar monolayers were used at various initial surface pressures. The dissociation constants determined by microscale thermophoresis (MST) were much higher for the full-length DYS R161-21 than for the mutants; thus the wild type protein has weaker SUV binding. Comparing surface pressures after protein adsorption and analysis of atomic force microscopy images of mixed protein/lipid monolayers revealed that the mutants insert more into the lipid monolayer than the wild type does. In fact, in both models every deletion mutant showed more interactions with membranes than the full-length protein did. This means that mutations in the R16-21 part of dystrophin disturb the protein's molecular behavior as it relates to membranes, regardless of whether the accompanying pathology is mild or severe.

  4. An Indel Polymorphism in the MtnA 3' Untranslated Region Is Associated with Gene Expression Variation and Local Adaptation in Drosophila melanogaster

    PubMed Central

    Glaser-Schmitt, Amanda; Duchen, Pablo; Parsch, John

    2016-01-01

    Insertions and deletions (indels) are a major source of genetic variation within species and may result in functional changes to coding or regulatory sequences. In this study we report that an indel polymorphism in the 3’ untranslated region (UTR) of the metallothionein gene MtnA is associated with gene expression variation in natural populations of Drosophila melanogaster. A derived allele of MtnA with a 49-bp deletion in the 3' UTR segregates at high frequency in populations outside of sub-Saharan Africa. The frequency of the deletion increases with latitude across multiple continents and approaches 100% in northern Europe. Flies with the deletion have more than 4-fold higher MtnA expression than flies with the ancestral sequence. Using reporter gene constructs in transgenic flies, we show that the 3' UTR deletion significantly contributes to the observed expression difference. Population genetic analyses uncovered signatures of a selective sweep in the MtnA region within populations from northern Europe. We also find that the 3’ UTR deletion is associated with increased oxidative stress tolerance. These results suggest that the 3' UTR deletion has been a target of selection for its ability to confer increased levels of MtnA expression in northern European populations, likely due to a local adaptive advantage of increased oxidative stress tolerance. PMID:27120580

  5. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping

    PubMed Central

    2012-01-01

    Background Most modern citrus cultivars have an interspecific origin. As a foundational step towards deciphering the interspecific genome structures, a reference whole genome sequence was produced by the International Citrus Genome Consortium from a haploid derived from Clementine mandarin. The availability of a saturated genetic map of Clementine was identified as an essential prerequisite to assist the whole genome sequence assembly. Clementine is believed to be a ‘Mediterranean’ mandarin × sweet orange hybrid, and sweet orange likely arose from interspecific hybridizations between mandarin and pummelo gene pools. The primary goals of the present study were to establish a Clementine reference map using codominant markers, and to perform comparative mapping of pummelo, sweet orange, and Clementine. Results Five parental genetic maps were established from three segregating populations, which were genotyped with Single Nucleotide Polymorphism (SNP), Simple Sequence Repeats (SSR) and Insertion-Deletion (Indel) markers. An initial medium density reference map (961 markers for 1084.1 cM) of the Clementine was established by combining male and female Clementine segregation data. This Clementine map was compared with two pummelo maps and a sweet orange map. The linear order of markers was highly conserved in the different species. However, significant differences in map size were observed, which suggests a variation in the recombination rates. Skewed segregations were much higher in the male than female Clementine mapping data. The mapping data confirmed that Clementine arose from hybridization between ‘Mediterranean’ mandarin and sweet orange. The results identified nine recombination break points for the sweet orange gamete that contributed to the Clementine genome. Conclusions A reference genetic map of citrus, used to facilitate the chromosome assembly of the first citrus reference genome sequence, was established. The high conservation of marker order observed at the interspecific level should allow reasonable inferences of most citrus genome sequences by mapping next-generation sequencing (NGS) data in the reference genome sequence. The genome of the haploid Clementine used to establish the citrus reference genome sequence appears to have been inherited primarily from the ‘Mediterranean’ mandarin. The high frequency of skewed allelic segregations in the male Clementine data underline the probable extent of deviation from Mendelian segregation for characters controlled by heterozygous loci in male parents. PMID:23126659

  6. Deletion of a target gene in Indica rice via CRISPR/Cas9.

    PubMed

    Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

    2017-08-01

    Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

  7. Angiotensin-converting enzyme insertion/deletion polymorphism genotyping error: the cause and a possible solution to the problem.

    PubMed

    Saracevic, Andrea; Simundic, Ana-Maria; Celap, Ivana; Luzanic, Valentina

    2013-07-01

    Rigat and colleagues were the first ones to develop a rapid PCR-based assay for identifying the angiotensin converting enzyme insertion/deletion (I/D) polymorphism. Due to a big difference between the length of the wild-type and mute alleles the PCR method is prone to mistyping because of preferential amplification of the D allele causing depicting I/D heterozygotes as D/D homozygotes. The aim of this study was to investigate whether this preferential amplification can be repressed by amplifying a longer DNA fragment in a so called Long PCR protocol. We also aimed to compare the results of genotyping using five different PCR protocols and to estimate the mistyping rate. The study included 200 samples which were genotyped using standard method used in our laboratory, a stepdown PCR, PCR protocol with the inclusion of 4 % DMSO, PCR with the use of insertion specific primers and new Long PCR method. The results of this study have shown that accurate ACE I/D polymorphism genotyping can be accomplished with the standard and the Long PCR method. Also, as of our results, accurate ACE I/D polymorphism genotyping can be accomplished regardless of the method used. Therefore, if the standard method is optimized more cautiously, accurate results can be obtained by this simple, inexpensive and rapid PCR protocol.

  8. Drosophila transposon insertions as unknowns for structured inquiry recombination mapping exercises in an undergraduate genetics course.

    PubMed

    Marcus, Jeffrey M; Hughes, Tia M

    2009-06-01

    Structured inquiry approaches, in which students receive a Drosophila strain of unknown genotype to analyze and map the constituent mutations, are a common feature of many genetics teaching laboratories. The required crosses frustrate many students because they are aware that they are participating in a fundamentally trivial exercise, as the map locations of the genes are already established and have been recalculated thousands of times by generations of students. We modified the traditional structured inquiry approach to include a novel research experience for the students in our undergraduate genetics laboratories. Students conducted crosses with Drosophila strains carrying P[lacW] transposon insertions in genes without documented recombination map positions, representing a large number of unique, but equivalent genetic unknowns. Using the eye color phenotypes associated with the inserts as visible markers, it is straightforward to calculate recombination map positions for the interrupted loci. Collectively, our students mapped 95 genetic loci on chromosomes 2 and 3. In most cases, the calculated 95% confidence interval for meiotic map location overlapped with the predicted map position based on cytology. The research experience evoked positive student responses and helped students better understand the nature of scientific research for little additional cost or instructor effort.

  9. Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii.

    PubMed

    Im, Chak Han; Park, Young-Hoon; Hammel, Kenneth E; Park, Bokyung; Kwon, Soon Wook; Ryu, Hojin; Ryu, Jae-San

    2016-07-01

    Breeding new strains with improved traits is a long-standing goal of mushroom breeders that can be expedited by marker-assisted selection (MAS). We constructed a genetic linkage map of Pleurotus eryngii based on segregation analysis of markers in postmeiotic monokaryons from KNR2312. In total, 256 loci comprising 226 simple sequence-repeat (SSR) markers, 2 mating-type factors, and 28 insertion/deletion (InDel) markers were mapped. The map consisted of 12 linkage groups (LGs) spanning 1047.8cM, with an average interval length of 4.09cM. Four independent populations (Pd3, Pd8, Pd14, and Pd15) derived from crossing between four monokaryons from KNR2532 as a tester strain and 98 monokaryons from KNR2312 were used to characterize quantitative trait loci (QTL) for nine traits such as yield, quality, cap color, and earliness. Using composite interval mapping (CIM), 71 QTLs explaining between 5.82% and 33.17% of the phenotypic variations were identified. Clusters of more than five QTLs for various traits were identified in three genomic regions, on LGs 1, 7 and 9. Regardless of the population, 6 of the 9 traits studied and 18 of the 71 QTLs found in this study were identified in the largest cluster, LG1, in the range from 65.4 to 110.4cM. The candidate genes for yield encoding transcription factor, signal transduction, mycelial growth and hydrolase are suggested by using manual and computational analysis of genome sequence corresponding to QTL region with the highest likelihood odds (LOD) for yield. The genetic map and the QTLs established in this study will help breeders and geneticists to develop selection markers for agronomically important characteristics of mushrooms and to identify the corresponding genes. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

    PubMed Central

    2012-01-01

    Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron-based markers for linkage and association mapping in common bean. The utility of these markers is discussed in relation with the usefulness of microsatellites, the molecular markers by excellence in this crop. PMID:22734675

  11. Lunar prospector mission design and trajectory support

    NASA Technical Reports Server (NTRS)

    Lozier, David; Galal, Ken; Folta, David; Beckman, Mark

    1998-01-01

    The Lunar Prospector mission is the first dedicated NASA lunar mapping mission since the Apollo Orbiter program which was flown over 25 years ago. Competitively selected under the NASA Discovery Program, Lunar Prospector was launched on January 7, 1998 on the new Lockheed Martin Athena 2 launch vehicle. The mission design of Lunar Prospector is characterized by a direct minimum energy transfer trajectory to the moon with three scheduled orbit correction maneuvers to remove launch and cislunar injection errors prior to lunar insertion. At lunar encounter, a series of three lunar orbit insertion maneuvers and a small circularization burn were executed to achieve a 100 km altitude polar mapping orbit. This paper will present the design of the Lunar Prospector transfer, lunar insertion and mapping orbits, including maneuver and orbit determination strategies in the context of mission goals and constraints. Contingency plans for handling transfer orbit injection and lunar orbit insertion anomalies are also summarized. Actual flight operations results are discussed and compared to pre-launch support analysis.

  12. Indel-seq: a fast-forward genetics approach for identification of trait-associated putative candidate genomic regions and its application in pigeonpea (Cajanus cajan).

    PubMed

    Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Sinha, Pallavi; Kale, Sandip M; Parupalli, Swathi; Kumar, Vinay; Chitikineni, Annapurna; Vechalapu, Suryanarayana; Sameer Kumar, Chanda Venkata; Sharma, Mamta; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Muniswamy, Sonnappa; Varshney, Rajeev K

    2017-07-01

    Identification of candidate genomic regions associated with target traits using conventional mapping methods is challenging and time-consuming. In recent years, a number of single nucleotide polymorphism (SNP)-based mapping approaches have been developed and used for identification of candidate/putative genomic regions. However, in the majority of these studies, insertion-deletion (Indel) were largely ignored. For efficient use of Indels in mapping target traits, we propose Indel-seq approach, which is a combination of whole-genome resequencing (WGRS) and bulked segregant analysis (BSA) and relies on the Indel frequencies in extreme bulks. Deployment of Indel-seq approach for identification of candidate genomic regions associated with fusarium wilt (FW) and sterility mosaic disease (SMD) resistance in pigeonpea has identified 16 Indels affecting 26 putative candidate genes. Of these 26 affected putative candidate genes, 24 genes showed effect in the upstream/downstream of the genic region and two genes showed effect in the genes. Validation of these 16 candidate Indels in other FW- and SMD-resistant and FW- and SMD-susceptible genotypes revealed a significant association of five Indels (three for FW and two for SMD resistance). Comparative analysis of Indel-seq with other genetic mapping approaches highlighted the importance of the approach in identification of significant genomic regions associated with target traits. Therefore, the Indel-seq approach can be used for quick and precise identification of candidate genomic regions for any target traits in any crop species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Factors influencing delivered mean airway pressure during nasal CPAP with the RAM cannula.

    PubMed

    Gerdes, Jeffrey S; Sivieri, Emidio M; Abbasi, Soraya

    2016-01-01

    To measure mean airway pressure (MAP) delivered through the RAM Cannula® when used with a ventilator in CPAP mode as a function of percent nares occlusion in a simulated nasal interface/test lung model and to compare the results to MAPs using a nasal continuous positive airway pressure (NCPAP) interface with nares fully occluded. An artificial airway model was connected to a spontaneous breathing lung model in which MAP was measured at set NCPAP levels between 4 and 8 cmH2 O provided by a Dräger Evita XL® ventilator and delivered through three sizes of RAM cannulae. Measurements were performed with varying leakage at the nasal interface by decreasing occlusion from 100% to 29%, half-way prong insertion, and simulated mouth leakage. Comparison measurements were made using the Dräger BabyFlow® NCPAP interface with a full nasal seal. With simulated mouth closed, the Dräger interface delivered MAPs within 0.5 cmH2 O of set CPAP levels. For the RAM cannula, with 60-80% nares occlusion, overall delivered MAPs were 60 ± 17% less than set CPAP levels (P < 0.001). Further, MAP decreased progressively with decreasing percent nares occlusion. The simulated open mouth condition resulted in significantly lower MAPs to <1.7 cmH2 O. The one-half prong insertion depth condition, with closed mouth, yielded MAPs approximately 35 ± 9% less than full insertion pressures (P < 0.001). In our bench tests, the RAM interface connected to a ventilator in NCPAP mode failed to deliver set CPAP levels when applied using the manufacturer recommended 60-80% nares occlusion, even with closed mouth and full nasal prong insertion conditions. © 2015 Wiley Periodicals, Inc.

  14. Use of BAC clones as standardized reagents for Marek’s disease virus research

    USDA-ARS?s Scientific Manuscript database

    The cloning of the Marek’s disease virus (MDV) genome as an infectious bacterial artificial chromosome (BAC) clone have led to major advances through our ability to study individual gene function by making precise insertions and deletions in the viral genome. We believe that MDV BAC clones will repl...

  15. 75 FR 6677 - Statement of Organization, Functions, and Delegations of Authority

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-10

    ... Order of Succession for the Centers for Disease Control and Prevention. Section C-C, Order of Succession: Delete in its entirety Section C- C, Order of Succession, and insert the following: During the absence or... a planned period of absence, the Director may specify a different order of succession: 1. Principal...

  16. 77 FR 22472 - Energy Conservation Program: Energy Conservation Standards for Certain External Power Supplies...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-16

    ... Conservation Program: Energy Conservation Standards for Certain External Power Supplies; Correction AGENCY... external power supplies to re-insert a table that had been inadvertently deleted by a technical amendment... standards for all Class A external power supplies to meet. DATES: This correction is effective April 16...

  17. Analysis of and Feedback on Phonetic Features in Pronunciation Training with a Virtual Teacher

    ERIC Educational Resources Information Center

    Engwall, Olov

    2012-01-01

    Pronunciation errors may be caused by several different deviations from the target, such as voicing, intonation, insertions or deletions of segments, or that the articulators are placed incorrectly. Computer-animated pronunciation teachers could potentially provide important assistance on correcting all these types of deviations, but they have an…

  18. [Orthopoxvirus genes for kelch-like proteins. III. Construction of mousepox (ectromelia) virus variants with targeted gene deletions].

    PubMed

    Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N

    2009-01-01

    Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.

  19. Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel; Kallioniemi, Olli-Pekka; Kallioniemi, Anne; Sakamoto, Masaru

    2009-10-06

    Methods and compositions for staining based upon nucleic acid sequence that employ nudeic nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML), retinoblastoma, ovarian and uterine cancers, and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

  20. Transposon Mutagenesis To Improve the Growth of Recombinant Saccharomyces cerevisiae on d-Xylose▿

    PubMed Central

    Ni, Haiying; Laplaza, José M.; Jeffries, Thomas W.

    2007-01-01

    Saccharomyces cerevisiae L2612 transformed with genes for xylose reductase and xylitol dehydrogenase (XYL1 and XYL2) grows well on glucose but very poorly on d-xylose. When a gene for d-xylulokinase (XYL3 or XKS1) is overexpressed, growth on glucose is unaffected, but growth on xylose is blocked. Spontaneous or chemically induced mutants of this engineered yeast that would grow on xylose could, however, be obtained. We therefore used insertional transposon mutagenesis to identify two loci that can relieve this xylose-specific growth inhibition. One is within the open reading frame (ORF) of PHO13, and the other is approximately 500 bp upstream from the TAL1 ORF. Deletion of PHO13 or overexpression of TAL1 resulted in a phenotype similar to the insertional mutation events. Quantitative PCR showed that deletion of PHO13 increased transcripts for TAL1, indicating that the growth inhibition imposed by the overexpression of XYL3 on xylose can be relieved by an overexpression of transcripts for downstream enzymes. These results may be useful in constructing better xylose-fermenting S. cerevisiae strains. PMID:17277207

  1. Efficient mouse genome engineering by CRISPR-EZ technology.

    PubMed

    Modzelewski, Andrew J; Chen, Sean; Willis, Brandon J; Lloyd, K C Kent; Wood, Joshua A; He, Lin

    2018-06-01

    CRISPR/Cas9 technology has transformed mouse genome editing with unprecedented precision, efficiency, and ease; however, the current practice of microinjecting CRISPR reagents into pronuclear-stage embryos remains rate-limiting. We thus developed CRISPR ribonucleoprotein (RNP) electroporation of zygotes (CRISPR-EZ), an electroporation-based technology that outperforms pronuclear and cytoplasmic microinjection in efficiency, simplicity, cost, and throughput. In C57BL/6J and C57BL/6N mouse strains, CRISPR-EZ achieves 100% delivery of Cas9/single-guide RNA (sgRNA) RNPs, facilitating indel mutations (insertions or deletions), exon deletions, point mutations, and small insertions. In a side-by-side comparison in the high-throughput KnockOut Mouse Project (KOMP) pipeline, CRISPR-EZ consistently outperformed microinjection. Here, we provide an optimized protocol covering sgRNA synthesis, embryo collection, RNP electroporation, mouse generation, and genotyping strategies. Using CRISPR-EZ, a graduate-level researcher with basic embryo-manipulation skills can obtain genetically modified mice in 6 weeks. Altogether, CRISPR-EZ is a simple, economic, efficient, and high-throughput technology that is potentially applicable to other mammalian species.

  2. The angiotensin-converting-enzyme insertion/deletion polymorphism is not related to venous thrombosis.

    PubMed

    Köppel, Herwig; Renner, Wilfried; Gugl, Alexander; Cichocki, Lisa; Gasser, Robert; Wascher, Thomas C; Pilger, Ernst

    2004-01-01

    The insertion/deletion (I/D) polymorphism of the gene for angiotensin-converting-enzyme (ACE) is associated with ACE plasma levels and activity. Conflicting results have been reported about the relevance of this polymorphism for venous thrombosis. The aim of the present study was to analyze the role of this polymorphism for deep venous thrombosis. The study was designed as a case-control study, including 330 patients with documented deep venous thrombosis and 354 controls. ACE genotype was determined by size-analysis of polymerase chain reaction products. Results showed that, ACE genotype frequencies were similar between patients (II: 24.8%; ID: 43.3%; DD: 31.8%) and controls (II: 22.9%; ID: 50.6%; DD: 26.6%, P = 0.15). The adjusted odds ratio of carriers of the DD geno-type for venous thrombosis was 1.24 (95% confidence interval 0.90-1.80). The polymorphism was furthermore not associated with age at first thromboembolic event or the occurrence of pulmonary embolism. From these results, we can conclude that the ACE I/D polymorphism is not a significant risk factor for deep venous thrombosis.

  3. Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells.

    PubMed

    Sternburg, Erin L; Dias, Kristen C; Karginov, Fedor V

    2017-06-16

    The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

  4. Immunoglobulin Gene Insertions and Deletions in the Affinity Maturation of HIV-1 Broadly Reactive Neutralizing Antibodies

    PubMed Central

    Kepler, Thomas B.; Liao, Hua-Xin; Alam, S. Munir; Bhaskarabhatla, Rekha; Zhang, Ruijun; Stewart, Shelley; Anasti, Kara; Kelsoe, Garnett; Parks, Robert; Lloyd, Krissey E.; Stolarchuk, Christina; Pritchett, Jamie; Solomon, Erika; Friberg, Emma; Morris, Lynn; Karim, Salim S. Abdool; Cohen, Myron S.; Walter, Emmanuel; Moody, M. Anthony; Wu, Xueling; Altae-Tran, Han R.; Georgiev, Ivelin S.; Kwong, Peter D.; Boyd, Scott D.; Fire, Andrew Z.; Mascola, John R.; Haynes, Barton F.

    2014-01-01

    Summary Induction of HIV-1 broad neutralizing antibodies (bnAbs) is a goal of HIV-1 vaccine development but has remained challenging partially due to unusual traits of bnAbs, including high somatic hypermutation (SHM) frequencies and in-frame insertions and deletions (indels). Here we examined the propensity and functional requirement for indels within HIV-1 bnAbs. High-throughput sequencing of the immunoglobulin (Ig) VHDJH genes in HIV-1 infected and uninfected individuals revealed that the indel frequency was elevated among HIV-1-infected subjects, with no unique properties attributable to bnAb-producing individuals. This increased indel occurrence depended only on the frequency of SHM point-mutations. Indel-encoded regions were generally proximal to antigen binding sites. Additionally, reconstruction of a HIV-1 CD4-binding site bnAb clonal lineage revealed that a large compound VHDJH indel was required for bnAb activity. Thus, vaccine development should focus on designing regimens targeted at sustained activation of bnAb lineages to achieve the required SHM and indel events. PMID:25211073

  5. New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

    PubMed

    D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

    2006-05-01

    We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

  6. Forensic evaluation and population genetic study of 30 insertion/deletion polymorphisms in a Chinese Yi group.

    PubMed

    Zhang, Yu-Dang; Shen, Chun-Mei; Jin, Rui; Li, Ya-Ni; Wang, Bo; Ma, Li-Xia; Meng, Hao-Tian; Yan, Jiang-Wei; Dan Wang, Hong-; Yang, Ze-Long; Zhu, Bo-Feng

    2015-05-01

    Insertion/deletion polymorphisms have become a research hot spot in forensic science due to their tremendous potential in recent years. In the present study, we investigated 30 indel loci in a Chinese Yi ethnic group. The allele frequencies of the short allele of the 30 indel loci were in the range of 0.1025-0.9221. The power of discrimination values were observed ranging from to 0.2630 (HLD111 locus) to 0.6607 (HLD70 locus) and probability of exclusion values ranged from 0.0189 (HLD111 locus) to 0.2343 (HLD56 locus). The combined power of discrimination and power of exclusion for 30 loci in the studied Yi group were 0.99999999995713 and 0.97746, respectively, which showed tremendous potential for forensic personal identification in the Yi group. Moreover, the DA distances, phylogenetic tree, principal component analysis, and cluster analysis showed the Yi group had close genetic relationships with the Tibetan, South Korean, Chinese Han, and She groups. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Angiotensin-converting enzyme gene insertion/deletion polymorphism studies in Asian Indian pregnant women biochemically identifies gestational diabetes mellitus.

    PubMed

    Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna

    2014-12-01

    Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.

  8. A short note on dynamic programming in a band.

    PubMed

    Gibrat, Jean-François

    2018-06-15

    Third generation sequencing technologies generate long reads that exhibit high error rates, in particular for insertions and deletions which are usually the most difficult errors to cope with. The only exact algorithm capable of aligning sequences with insertions and deletions is a dynamic programming algorithm. In this note, for the sake of efficiency, we consider dynamic programming in a band. We show how to choose the band width in function of the long reads' error rates, thus obtaining an [Formula: see text] algorithm in space and time. We also propose a procedure to decide whether this algorithm, when applied to semi-global alignments, provides the optimal score. We suggest that dynamic programming in a band is well suited to the problem of aligning long reads between themselves and can be used as a core component of methods for obtaining a consensus sequence from the long reads alone. The function implementing the dynamic programming algorithm in a band is available, as a standalone program, at: https://forgemia.inra.fr/jean-francois.gibrat/BAND_DYN_PROG.git.

  9. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

    PubMed Central

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

    2016-01-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

  10. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

    PubMed

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

    2016-08-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

  11. A 1.5-Mb deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lorenzetti, D.; Pandolfo, M.; Pareyson, D.

    1995-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies. A 1.5-Mb deletion in chromosome 17p11.2-p12 has been associated with HNPP. Duplication of the same 1.5-Mb region is known to be associated with Charcot-Marie-Tooth disease type 1 (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity (NCV). The CMT1A duplication and HNPP deletion appear to be the reciprocal products of a recombination event involving a repeat element (CMT1A-REP) that flanks the 1.5-Mb region involved in the duplication/deletion. Patients from nine unrelated Italian families who were diagnosed with HNPP onmore » the basis of clinical, electrophysiological, and histological evaluations were analyzed by molecular methods for DNA deletion on chromosome 17p. In all nine families, Southern analysis using a CMT1A-REP probe detected a reduced hybridization signal of a 6.0-kb EcoRI fragment mapping within the distal CMT1A-REP, indicating deletion of one copy of CMT1A-REP in these HNPP patients. Families were also typed with a polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125, and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, providing an independent indication for deletion. Furthermore, pulsed-field gel electrophoresis analysis of SacII-digested genomic DNA detected junction fragments specific to the 1.5-Mb HNPP deletion in seven of nine Italian families included in this study. These findings suggest that a 1.5-Mb deletion on 17p11.2-p12 is the most common mutation associated with HNPP. 51 refs., 5 figs., 1 tab.« less

  12. MinION Analysis and Reference Consortium: Phase 2 data release and analysis of R9.0 chemistry.

    PubMed

    Jain, Miten; Tyson, John R; Loose, Matthew; Ip, Camilla L C; Eccles, David A; O'Grady, Justin; Malla, Sunir; Leggett, Richard M; Wallerman, Ola; Jansen, Hans J; Zalunin, Vadim; Birney, Ewan; Brown, Bonnie L; Snutch, Terrance P; Olsen, Hugh E

    2017-01-01

    Long-read sequencing is rapidly evolving and reshaping the suite of opportunities for genomic analysis. For the MinION in particular, as both the platform and chemistry develop, the user community requires reference data to set performance expectations and maximally exploit third-generation sequencing. We performed an analysis of MinION data derived from whole genome sequencing of Escherichia coli K-12 using the R9.0 chemistry, comparing the results with the older R7.3 chemistry. We computed the error-rate estimates for insertions, deletions, and mismatches in MinION reads. Run-time characteristics of the flow cell and run scripts for R9.0 were similar to those observed for R7.3 chemistry, but with an 8-fold increase in bases per second (from 30 bps in R7.3 and SQK-MAP005 library preparation, to 250 bps in R9.0) processed by individual nanopores, and less drop-off in yield over time. The 2-dimensional ("2D") N50 read length was unchanged from the prior chemistry. Using the proportion of alignable reads as a measure of base-call accuracy, 99.9% of "pass" template reads from 1-dimensional ("1D")  experiments were mappable and ~97% from 2D experiments. The median identity of reads was ~89% for 1D and ~94% for 2D experiments. The total error rate (miscall + insertion + deletion ) decreased for 2D "pass" reads from 9.1% in R7.3 to 7.5% in R9.0 and for template "pass" reads from 26.7% in R7.3 to 14.5% in R9.0. These Phase 2 MinION experiments serve as a baseline by providing estimates for read quality, throughput, and mappability. The datasets further enable the development of bioinformatic tools tailored to the new R9.0 chemistry and the design of novel biological applications for this technology. K: thousand, Kb: kilobase (one thousand base pairs), M: million, Mb: megabase (one million base pairs), Gb: gigabase (one billion base pairs).

  13. CRISPR-Cas9D10A Nickase-Assisted Genome Editing in Lactobacillus casei

    PubMed Central

    Song, Xin; Huang, He; Xiong, Zhiqiang

    2017-01-01

    ABSTRACT Lactobacillus casei has drawn increasing attention as a health-promoting probiotic, while effective genetic manipulation tools are often not available, e.g., the single-gene knockout in L. casei still depends on the classic homologous recombination-dependent double-crossover strategy, which is quite labor-intensive and time-consuming. In the present study, a rapid and precise genome editing plasmid, pLCNICK, was established for L. casei genome engineering based on CRISPR-Cas9D10A. In addition to the P23-Cas9D10A and Pldh-sgRNA (single guide RNA) expression cassettes, pLCNICK includes the homologous arms of the target gene as repair templates. The ability and efficiency of chromosomal engineering using pLCNICK were evaluated by in-frame deletions of four independent genes and chromosomal insertion of an enhanced green fluorescent protein (eGFP) expression cassette at the LC2W_1628 locus. The efficiencies associated with in-frame deletions and chromosomal insertion is 25 to 62%. pLCNICK has been proved to be an effective, rapid, and precise tool for genome editing in L. casei, and its potential application in other lactic acid bacteria (LAB) is also discussed in this study. IMPORTANCE The lack of efficient genetic tools has limited the investigation and biotechnological application of many LAB. The CRISPR-Cas9D10A nickase-based genome editing in Lactobacillus casei, an important food industrial microorganism, was demonstrated in this study. This genetic tool allows efficient single-gene deletion and insertion to be accomplished by one-step transformation, and the cycle time is reduced to 9 days. It facilitates a rapid and precise chromosomal manipulation in L. casei and overcomes some limitations of previous methods. This editing system can serve as a basic technological platform and offers the possibility to start a comprehensive investigation on L. casei. As a broad-host-range plasmid, pLCNICK has the potential to be adapted to other Lactobacillus species for genome editing. PMID:28864652

  14. Characterization of frequencies and distribution of single nucleotide insertions/deletions in the human genome.

    PubMed

    Tan, Ene-Choo; Li, Haixia

    2006-07-19

    Most of the studies on single nucleotide variations are on substitutions rather than insertions/deletions. In this study, we examined the distribution and characteristics of single nucleotide insertions/deletions (SNindels), using data available from dbSNP for all the human chromosomes. There are almost 300,000 SNindels in the database, of which only 0.8% are validated. They occur at the frequency of 0.887 per 10 kb on average for the whole genome, or approximately 1 for every 11,274 bp. More than half occur in regions with mononucleotide repeats the longest of which is 47 bases. Overall the mononucleotide repeats involving C and G are much shorter than those for A and T. About 12% are surrounded by palindromes. There is general correlation between chromosome size and total number for each chromosome. Inter-chromosomal variation in density ranges from 0.6 to 21.7 per kilobase. The overall spectrum shows very high proportion of SNindel of types -/A and -/T at over 81%. The proportion of -/A and -/T SNindels for each chromosome is correlated to its AT content. Less than half of the SNindels are within or near known genes and even fewer (<0.183%) in coding regions, and more than 1.4% of -/C and -/G are in coding compared to 0.2% for -/A and -/T types. SNindels of -/A and -/T types make up 80% of those found within untranslated regions but less than 40% of those within coding regions. A separate analysis using the subset of 2324 validated SNindels showed slightly less AT bias of 74%, SNindels not within mononucleotide repeats showed even less AT bias at 58%. Density of validated SNindels is 0.007/10 kb overall and 90% are found within or near genes. Among all chromosomes, Y has the lowest numbers and densities for all SNindels, validated SNindels, and SNindels not within repeats.

  15. A mobile threat to genome stability: The impact of non-LTR retrotransposons upon the human genome.

    PubMed

    Konkel, Miriam K; Batzer, Mark A

    2010-08-01

    It is now commonly agreed that the human genome is not the stable entity originally presumed. Deletions, duplications, inversions, and insertions are common, and contribute significantly to genomic structural variations (SVs). Their collective impact generates much of the inter-individual genomic diversity observed among humans. Not only do these variations change the structure of the genome; they may also have functional implications, e.g. altered gene expression. Some SVs have been identified as the cause of genetic disorders, including cancer predisposition. Cancer cells are notorious for their genomic instability, and often show genomic rearrangements at the microscopic and submicroscopic level to which transposable elements (TEs) contribute. Here, we review the role of TEs in genome instability, with particular focus on non-LTR retrotransposons. Currently, three non-LTR retrotransposon families - long interspersed element 1 (L1), SVA (short interspersed element (SINE-R), variable number of tandem repeats (VNTR), and Alu), and Alu (a SINE) elements - mobilize in the human genome, and cause genomic instability through both insertion- and post-insertion-based mutagenesis. Due to the abundance and high sequence identity of TEs, they frequently mislead the homologous recombination repair pathway into non-allelic homologous recombination, causing deletions, duplications, and inversions. While less comprehensively studied, non-LTR retrotransposon insertions and TE-mediated rearrangements are probably more common in cancer cells than in healthy tissue. This may be at least partially attributed to the commonly seen global hypomethylation as well as general epigenetic dysfunction of cancer cells. Where possible, we provide examples that impact cancer predisposition and/or development. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Sec66-Dependent Regulation of Yeast Spindle-Pole Body Duplication Through Pom152

    PubMed Central

    Katta, Santharam S.; Chen, Jingjing; Gardner, Jennifer M.; Friederichs, Jennifer M.; Smith, Sarah E.; Gogol, Madelaine; Unruh, Jay R.; Slaughter, Brian D.; Jaspersen, Sue L.

    2015-01-01

    In closed mitotic systems such as Saccharomyces cerevisiae, the nuclear envelope (NE) does not break down during mitosis, so microtubule-organizing centers such as the spindle-pole body (SPB) must be inserted into the NE to facilitate bipolar spindle formation and chromosome segregation. The mechanism of SPB insertion has been linked to NE insertion of nuclear pore complexes (NPCs) through a series of genetic and physical interactions between NPCs and SPB components. To identify new genes involved in SPB duplication and NE insertion, we carried out genome-wide screens for suppressors of deletion alleles of SPB components, including Mps3 and Mps2. In addition to the nucleoporins POM152 and POM34, we found that elimination of SEC66/SEC71/KAR7 suppressed lethality of cells lacking MPS2 or MPS3. Sec66 is a nonessential subunit of the Sec63 complex that functions together with the Sec61 complex in import of proteins into the endoplasmic reticulum (ER). Cells lacking Sec66 have reduced levels of Pom152 protein but not Pom34 or Ndc1, a shared component of the NPC and SPB. The fact that Sec66 but not other subunits of the ER translocon bypass deletion mutants in SPB genes suggests a specific role for Sec66 in the control of Pom152 levels. Based on the observation that sec66∆ does not affect the distribution of Ndc1 on the NE or Ndc1 binding to the SPB, we propose that Sec66-mediated regulation of Pom152 plays an NPC-independent role in the control of SPB duplication. PMID:26510791

  17. [Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].

    PubMed

    Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K

    2005-07-01

    Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).

  18. Differential deletions in 3p are associated with the development of head and neck squamous cell carcinoma in Indian patients.

    PubMed

    Chakraborty, Suman Bhusan; Dasgupta, Santanu; Roy, Anup; Sengupta, Arunava; Ray, Bidyut; Roychoudhury, Susanta; Panda, Chinmay Kumar

    2003-10-15

    In this study we performed detailed deletion mapping of two broad regions in the short arm (p) of chromosome 3 (i.e., 3p21.2 approximately p22 and 3p12 approximately p13), which were shown to have a high rate of deletions in head and neck lesions in our previous study. Using 18 highly polymorphic microsatellite markers, the deletion mapping was done in 35 dysplastic lesions and 46 primary head and neck squamous cell carcinoma (HNSCC) samples from Indian patients. Within the 21.6-megabase (Mb) region of 3p21.1 approximately p21.33, we have identified four areas (D1, 3p21.33; D2, 3p21.32; D3, 3p21.31; D4, 3p21.1) that showed a high frequency (46%-69%) of deletions in our samples. In the 3p12 approximately p13 region, we narrowed down the deletion within the 0.7-Mb region (D5, 3p12.1). Among these five regions (D1-D5), deletion in D3 is suggested to be necessary for the development of early dysplastic lesions, whereas the deletion in D2 may be necessary for dysplastic lesions and tumor progression. On the other hand, the deletion in D5 is significantly associated with progression of the lesions from mild/moderate to severe dysplasia. The deletions in D1 and D4, however, are required for tumor progression. As in our previous study, microsatellite size alterations (MA) were observed to be high in and around the highly deleted regions and gradually increased during the progression of the tumor. Loss of normal copy/interstitial alterations of chromosome 3 in the late stages of the tumor as well as rare biallelic alterations around the highly deleted regions also were seen in our samples. Human papilloma virus infection has been found to be associated with the deletion in the D5 region and MA in the D1 region, whereas nodal involvement of the tumor correlated only with the MA in D1 and D5. Thus, this study indicates that multiple tumor suppressor genes whose differential deletions are associated with the development of HNSCC may be present in 3p.

  19. Mapping Cortical Morphology in Youth with Velocardiofacial (22q11.2 Deletion) Syndrome

    ERIC Educational Resources Information Center

    Kates, Wendy R.; Bansal, Ravi; Fremont, Wanda; Antshel, Kevin M.; Hao, Xuejun; Higgins, Anne Marie; Liu, Jun; Shprintzen, Robert J.; Peterson, Bradley S.

    2011-01-01

    Objective: Velocardiofacial syndrome (VCFS; 22q11.2 deletion syndrome) represents one of the highest known risk factors for schizophrenia. Insofar as up to 30% of individuals with this genetic disorder develop schizophrenia, VCFS constitutes a unique, etiologically homogeneous model for understanding the pathogenesis of schizophrenia. Method:…

  20. Intracistronic complementation in the simian virus 40 A gene.

    PubMed Central

    Tornow, J; Cole, C N

    1983-01-01

    A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

  1. Contiguous deletion of the NDP, MAOA, MAOB, and EFHC2 genes in a patient with Norrie disease, severe psychomotor retardation and myoclonic epilepsy.

    PubMed

    Rodriguez-Revenga, L; Madrigal, I; Alkhalidi, L S; Armengol, L; González, E; Badenas, C; Estivill, X; Milà, M

    2007-05-01

    Norrie disease (ND) is an X-linked disorder, inherited as a recessive trait that, therefore, mostly affects males. The gene responsible for ND, called NDP, maps to the short arm of chromosome X (Xp11.4-p11.3). We report here an atypical case of ND, consisting of a patient harboring a large submicroscopic deletion affecting not only the NDP gene but also the MAOA, MAOB, and EFHC2 genes. Microarray comparative genomic hybridization (CGH) analysis showed that 11 consecutive bacterial artificial chromosome (BAC) clones, mapping around the NDP gene, were deleted. These clones span a region of about 1 Mb on Xp11.3. The deletion was ascertained by fluorescent in situ hybridization (FISH) analysis with different BAC clones located within the region. Clinical features of the proband include bilateral retinal detachment, microcephaly, severe psychomotor retardation without verbal language skills acquired, and epilepsy. The identification and molecular characterization of this case reinforces the idea of a new contiguous gene syndrome that would explain the complex phenotype shared by atypical ND patients.

  2. A triallelic genetic male sterility locus in Brassica napus: an integrative strategy for its physical mapping and possible local chromosome evolution around it

    PubMed Central

    Lu, Wei; Liu, Jun; Xin, Qiang; Wan, Lili; Hong, Dengfeng; Yang, Guangsheng

    2013-01-01

    Background and Aims Spontaneous male sterility is an advantageous trait for both constructing efficient pollination control systems and for understanding the developmental process of the male reproductive unit in many crops. A triallelic genetic male-sterile locus (BnMs5) has been identified in Brassica napus; however, its complicated genome structure has greatly hampered the isolation of this locus. The aim of this study was to physically map BnMs5 through an integrated map-based cloning strategy and analyse the local chromosomal evolution around BnMs5. Methods A large F2 population was used to integrate the existing genetic maps around BnMs5. A map-based cloning strategy in combination with comparative mapping among B. napus, Arabidopsis, Brassica rapa and Brassica oleracea was employed to facilitate the identification of a target bacterial artificial chromosome (BAC) clone covering the BnMs5 locus. The genomic sequences from the Brassica species were analysed to reveal the regional chromosomal evolution around BnMs5. Key Results BnMs5 was finally delimited to a 0·3-cM genetic fragment from an integrated local genetic map, and was anchored on the B. napus A8 chromosome. Screening of a B. napus BAC clone library and identification of the positive clones validated that JBnB034L06 was the target BAC clone. The closest flanking markers restrict BnMs5 to a 21-kb region on JBnB034L06 containing six predicted functional genes. Good collinearity relationship around BnMs5 between several Brassica species was observed, while violent chromosomal evolutionary events including insertions/deletions, duplications and single nucleotide mutations were also found to have extensively occurred during their divergence. Conclusions This work represents major progress towards the molecular cloning of BnMs5, as well as presenting a powerful, integrative method to mapping loci in plants with complex genomic architecture, such as the amphidiploid B. napus. PMID:23243189

  3. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.)

    PubMed Central

    2009-01-01

    Background Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation between species allowed synteny comparisons to be made to sequenced genomes. This synteny analysis may support positional cloning of target genes in common bean through the use of genomic information from these other legumes. PMID:20030833

  4. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  5. Mars Observer Lecture: Mars Orbit Insertion

    NASA Technical Reports Server (NTRS)

    Dodd, Suzanne R. (Personal Name)

    1993-01-01

    The Mars Observer mission spacecraft was primarily designed for exploring Mars and the Martian environment. The Mars Observer was launched on September 25, 1992. The spacecraft was lost in the vicinity of Mars on August 21, 1993 when the spacecraft began its maneuvering sequence for Martian orbital insertion. This videotape shows a lecture by Suzanne R. Dodd, the Mission Planning Team Chief for the Mars Observer Project. Ms Dodd begins with a brief overview of the mission and the timeline from the launch to orbital insertion. Ms Dodd then reviews slides showing the trajectory of the spacecraft on its trip to Mars. Slides of the spacecraft being constructed are also shown. She then discusses the Mars orbit insertion and the events that will occur to move the spacecraft from the capture orbit into a mapping orbit. During the trip to Mars, scientists at JPL had devised a new strategy, called Power In that would allow for an earlier insertion into the mapping orbit. The talk summarizes this strategy, showing on a slide the planned transition orbits. There are shots of the Martian moon, Phobos, taken from the Viking spacecraft, as Ms Dodd explains that the trajectory will allow the orbiter to make new observations of that moon. She also explains the required steps to prepare for mapping after the spacecraft has achieved the mapping orbit around Mars. The lecture ends with a picture of Mars from the Observer on its approach to the planet.

  6. Characterization of genetic deletions in Becker muscular dystrophy using monoclonal antibodies against a deletion-prone region of dystrophin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thanh, L.T.; Man, Nguyen Thi; Morris, G.E.

    1995-08-28

    We have produced a new panel of 20 monoclonal antibodies (mAbs) against a region of the dystrophin protein corresponding to a deletion-prone region of the Duchenne muscular dystrophy gene (exons 45-50). We show that immunohistochemistry or Western blotting with these {open_quotes}exon-specific{close_quotes} mAbs can provide a valuable addition to Southern blotting or PCR methods for the accurate identification of genetic deletions in Becker muscular dystrophy patients. The antibodies were mapped to the following exons: exon 45 (2 mAbs), exon 46 (6), exon 47 (1), exons 47/48 (4), exons 48-50 (6), and exon 50 (1). PCR amplification of single exons or groupsmore » of exons was used both to produce specific dystrophin immunogens and to map the mAbs obtained. PCR-mediated mutagenesis was also used to identify regions of dystrophin important for mAb binding. Because the mAbs can be used to characterize the dystrophin produced by individual muscle fibres, they will also be useful for studying {open_quotes}revertant{close_quotes} fibres in Duchenne muscle and for monitoring the results of myoblast therapy trials in MD patients with deletions in this region of the dystrophin gene. 27 refs., 7 figs., 3 tabs.« less

  7. Genomic anatomy of the Tyrp1 (brown) deletion complex

    PubMed Central

    Smyth, Ian M.; Wilming, Laurens; Lee, Angela W.; Taylor, Martin S.; Gautier, Phillipe; Barlow, Karen; Wallis, Justine; Martin, Sancha; Glithero, Rebecca; Phillimore, Ben; Pelan, Sarah; Andrew, Rob; Holt, Karen; Taylor, Ruth; McLaren, Stuart; Burton, John; Bailey, Jonathon; Sims, Sarah; Squares, Jan; Plumb, Bob; Joy, Ann; Gibson, Richard; Gilbert, James; Hart, Elizabeth; Laird, Gavin; Loveland, Jane; Mudge, Jonathan; Steward, Charlie; Swarbreck, David; Harrow, Jennifer; North, Philip; Leaves, Nicholas; Greystrong, John; Coppola, Maria; Manjunath, Shilpa; Campbell, Mark; Smith, Mark; Strachan, Gregory; Tofts, Calli; Boal, Esther; Cobley, Victoria; Hunter, Giselle; Kimberley, Christopher; Thomas, Daniel; Cave-Berry, Lee; Weston, Paul; Botcherby, Marc R. M.; White, Sharon; Edgar, Ruth; Cross, Sally H.; Irvani, Marjan; Hummerich, Holger; Simpson, Eleanor H.; Johnson, Dabney; Hunsicker, Patricia R.; Little, Peter F. R.; Hubbard, Tim; Campbell, R. Duncan; Rogers, Jane; Jackson, Ian J.

    2006-01-01

    Chromosome deletions in the mouse have proven invaluable in the dissection of gene function. The brown deletion complex comprises >28 independent genome rearrangements, which have been used to identify several functional loci on chromosome 4 required for normal embryonic and postnatal development. We have constructed a 172-bacterial artificial chromosome contig that spans this 22-megabase (Mb) interval and have produced a contiguous, finished, and manually annotated sequence from these clones. The deletion complex is strikingly gene-poor, containing only 52 protein-coding genes (of which only 39 are supported by human homologues) and has several further notable genomic features, including several segments of >1 Mb, apparently devoid of a coding sequence. We have used sequence polymorphisms to finely map the deletion breakpoints and identify strong candidate genes for the known phenotypes that map to this region, including three lethal loci (l4Rn1, l4Rn2, and l4Rn3) and the fitness mutant brown-associated fitness (baf). We have also characterized misexpression of the basonuclin homologue, Bnc2, associated with the inversion-mediated coat color mutant white-based brown (Bw). This study provides a molecular insight into the basis of several characterized mouse mutants, which will allow further dissection of this region by targeted or chemical mutagenesis. PMID:16505357

  8. Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Layton, A.D.; Cross, F.T.; Steigler, G.L.

    1994-12-31

    We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

  9. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding Domain I in mismatch recognition.

    PubMed Central

    Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric

    2007-01-01

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869

  10. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition.

    PubMed

    Lee, Susan D; Surtees, Jennifer A; Alani, Eric

    2007-02-09

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.

  11. Presence of tannins in sorghum grains is conditioned by different natural alleles of Tannin1

    PubMed Central

    Wu, Yuye; Li, Xianran; Xiang, Wenwen; Zhu, Chengsong; Lin, Zhongwei; Wu, Yun; Li, Jiarui; Pandravada, Satchidanand; Ridder, Dustan D.; Bai, Guihua; Wang, Ming L.; Trick, Harold N.; Bean, Scott R.; Tuinstra, Mitchell R.; Tesso, Tesfaye T.; Yu, Jianming

    2012-01-01

    Sorghum, an ancient old-world cereal grass, is the dietary staple of over 500 million people in more than 30 countries in the tropics and semitropics. Its C4 photosynthesis, drought resistance, wide adaptation, and high nutritional value hold the promise to alleviate hunger in Africa. Not present in other major cereals, such as rice, wheat, and maize, condensed tannins (proanthocyanidins) in the pigmented testa of some sorghum cultivars have been implicated in reducing protein digestibility but recently have been shown to promote human health because of their high antioxidant capacity and ability to fight obesity through reduced digestion. Combining quantitative trait locus mapping, meta-quantitative trait locus fine-mapping, and association mapping, we showed that the nucleotide polymorphisms in the Tan1 gene, coding a WD40 protein, control the tannin biosynthesis in sorghum. A 1-bp G deletion in the coding region, causing a frame shift and a premature stop codon, led to a nonfunctional allele, tan1-a. Likewise, a different 10-bp insertion resulted in a second nonfunctional allele, tan1-b. Transforming the sorghum Tan1 ORF into a nontannin Arabidopsis mutant restored the tannin phenotype. In addition, reduction in nucleotide diversity from wild sorghum accessions to landraces and cultivars was found at the region that codes the highly conserved WD40 repeat domains and the C-terminal region of the protein. Genetic research in crops, coupled with nutritional and medical research, could open the possibility of producing different levels and combinations of phenolic compounds to promote human health. PMID:22699509

  12. Genetic Mapping of Brain Plasticity Across Development in Williams Syndrome: ERP Markers of Face and Language Processing

    PubMed Central

    Mills, D. L.; Dai, L.; Fishman, I.; Yam, A.; Appelbaum, L. G.; Galaburda, A.; Bellugi, U.; Korenberg, J. R.

    2014-01-01

    In Williams Syndrome (WS), a known genetic deletion results in atypical brain function with strengths in face and language processing. We examined how genetic influences on brain activity change with development. In three studies, ERPs from large samples of children, adolescents, and adults with the full genetic deletion for WS were compared to typically developing controls, and two adults with partial deletions for WS. Studies 1 and 2 identified ERP markers of brain plasticity in WS across development. Study 3 suggested that in adults with partial deletions for WS, specific genes may be differentially implicated in face and language processing. PMID:24219698

  13. The Evolution and Functional Impact of Human Deletion Variants Shared with Archaic Hominin Genomes

    PubMed Central

    Lin, Yen-Lung; Pavlidis, Pavlos; Karakoc, Emre; Ajay, Jerry; Gokcumen, Omer

    2015-01-01

    Allele sharing between modern and archaic hominin genomes has been variously interpreted to have originated from ancestral genetic structure or through non-African introgression from archaic hominins. However, evolution of polymorphic human deletions that are shared with archaic hominin genomes has yet to be studied. We identified 427 polymorphic human deletions that are shared with archaic hominin genomes, approximately 87% of which originated before the Human–Neandertal divergence (ancient) and only approximately 9% of which have been introgressed from Neandertals (introgressed). Recurrence, incomplete lineage sorting between human and chimp lineages, and hominid-specific insertions constitute the remaining approximately 4% of allele sharing between humans and archaic hominins. We observed that ancient deletions correspond to more than 13% of all common (>5% allele frequency) deletion variation among modern humans. Our analyses indicate that the genomic landscapes of both ancient and introgressed deletion variants were primarily shaped by purifying selection, eliminating large and exonic variants. We found 17 exonic deletions that are shared with archaic hominin genomes, including those leading to three fusion transcripts. The affected genes are involved in metabolism of external and internal compounds, growth and sperm formation, as well as susceptibility to psoriasis and Crohn’s disease. Our analyses suggest that these “exonic” deletion variants have evolved through different adaptive forces, including balancing and population-specific positive selection. Our findings reveal that genomic structural variants that are shared between humans and archaic hominin genomes are common among modern humans and can influence biomedically and evolutionarily important phenotypes. PMID:25556237

  14. Structural analysis of chromosomal rearrangements associated with the developmental mutations Ph, W19H, and Rw on mouse chromosome 5.

    PubMed Central

    Nagle, D L; Martin-DeLeon, P; Hough, R B; Bućan, M

    1994-01-01

    We are studying the chromosomal structure of three developmental mutations, dominant spotting (W), patch (Ph), and rump white (Rw) on mouse chromosome 5. These mutations are clustered in a region containing three genes encoding tyrosine kinase receptors (Kit, Pdgfra, and Flk1). Using probes for these genes and for a closely linked locus, D5Mn125, we established a high-resolution physical map covering approximately 2.8 Mb. The entire chromosomal segment mapped in this study is deleted in the W19H mutation. The map indicates the position of the Ph deletion, which encompasses not more than 400 kb around and including the Pdgfra gene. The map also places the distal breakpoint of the Rw inversion to a limited chromosomal segment between Kit and Pdgfra. In light of the structure of the Ph-W-Rw region, we interpret the previously published complementation analyses as indicating that the pigmentation defect in Rw/+ heterozygotes could be due to the disruption of Kit and/or Pdgfra regulatory sequences, whereas the gene(s) responsible for the recessive lethality of Rw/Rw embryos is not closely linked to the Ph and W loci and maps proximally to the W19H deletion. The structural analysis of chromosomal rearrangements associated with W19H, Ph, and Rw combined with the high-resolution physical mapping points the way toward the definition of these mutations in molecular terms and isolation of homologous genes on human chromosome 4. Images PMID:8041773

  15. A population of deletion mutants and an integrated mapping and Exome-seq pipeline for gene discovery in maize

    USDA-ARS?s Scientific Manuscript database

    To better understand maize endosperm filling and maturation, we developed a novel functional genomics platform that combined Bulked Segregant RNA and Exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. Using gamma-irradiation of B73 maize to...

  16. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature.

    PubMed

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-03-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3-15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS.

  17. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-01-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  18. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides.

    PubMed

    Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

    2017-05-31

    Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

  19. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides

    PubMed Central

    Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall’Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

    2017-01-01

    Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome. PMID:28561789

  20. High-resolution mapping of genotype-phenotype relationships in cridu chat syndrome using array comparative genomic hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xiaoxiao; Snijders, Antoine; Segraves, Richard

    2007-07-03

    We have used array comparative genomic hybridization to map DNA copy-number changes in 94 patients with cri du chat syndrome who had been carefully evaluated for the presence of the characteristic cry, speech delay, facial dysmorphology, and level of mental retardation (MR). Most subjects had simple deletions involving 5p (67 terminal and 12 interstitial). Genotype-phenotype correlations localized the region associated with the cry to 1.5 Mb in distal 5p15.31, between bacterial artificial chromosomes (BACs) containing markers D5S2054 and D5S676; speech delay to 3.2 Mb in 5p15.32-15.33, between BACs containing D5S417 and D5S635; and the region associated with facial dysmorphology tomore » 2.4 Mb in 5p15.2-15.31, between BACs containing D5S208 and D5S2887. These results overlap and refine those reported in previous publications. MR depended approximately on the 5p deletion size and location, but there were many cases in which the retardation was disproportionately severe, given the 5p deletion. All 15 of these cases, approximately two-thirds of the severely retarded patients, were found to have copy-number aberrations in addition to the 5p deletion. Restriction of consideration to patients with only 5p deletions clarified the effect of such deletions and suggested the presence of three regions, MRI-III, with differing effect on retardation. Deletions including MRI, a 1.2-Mb region overlapping the previously defined cri du chat critical region but not including MRII and MRIII, produced a moderate level of retardation. Deletions restricted to MRII, located just proximal to MRI, produced a milder level of retardation, whereas deletions restricted to the still-more proximal MRIII produced no discernible phenotype. However, MR increased as deletions that included MRI extended progressively into MRII and MRIII, and MR became profound when all three regions were deleted.« less

  1. Indel variant analysis of short-read sequencing data with Scalpel

    PubMed Central

    Fang, Han; Bergmann, Ewa A; Arora, Kanika; Vacic, Vladimir; Zody, Michael C; Iossifov, Ivan; O’Rawe, Jason A; Wu, Yiyang; Barron, Laura T Jimenez; Rosenbaum, Julie; Ronemus, Michael; Lee, Yoon-ha; Wang, Zihua; Dikoglu, Esra; Jobanputra, Vaidehi; Lyon, Gholson J; Wigler, Michael; Schatz, Michael C; Narzisi, Giuseppe

    2017-01-01

    As the second most common type of variation in the human genome, insertions and deletions (indels) have been linked to many diseases, but the discovery of indels of more than a few bases in size from short-read sequencing data remains challenging. Scalpel (http://scalpel.sourceforge.net) is an open-source software for reliable indel detection based on the microassembly technique. It has been successfully used to discover mutations in novel candidate genes for autism, and it is extensively used in other large-scale studies of human diseases. This protocol gives an overview of the algorithm and describes how to use Scalpel to perform highly accurate indel calling from whole-genome and whole-exome sequencing data. We provide detailed instructions for an exemplary family-based de novo study, but we also characterize the other two supported modes of operation: single-sample and somatic analysis. Indel normalization, visualization and annotation of the mutations are also illustrated. Using a standard server, indel discovery and characterization in the exonic regions of the example sequencing data can be completed in ~5 h after read mapping. PMID:27854363

  2. REDIdb 3.0: A Comprehensive Collection of RNA Editing Events in Plant Organellar Genomes.

    PubMed

    Lo Giudice, Claudio; Pesole, Graziano; Picardi, Ernesto

    2018-01-01

    RNA editing is an important epigenetic mechanism by which genome-encoded transcripts are modified by substitutions, insertions and/or deletions. It was first discovered in kinetoplastid protozoa followed by its reporting in a wide range of organisms. In plants, RNA editing occurs mostly by cytidine (C) to uridine (U) conversion in translated regions of organelle mRNAs and tends to modify affected codons restoring evolutionary conserved aminoacid residues. RNA editing has also been described in non-protein coding regions such as group II introns and structural RNAs. Despite its impact on organellar transcriptome and proteome complexity, current primary databases still do not provide a specific field for RNA editing events. To overcome these limitations, we developed REDIdb a specialized database for RNA editing modifications in plant organelles. Hereafter we describe its third release containing more than 26,000 events in a completely novel web interface to accommodate RNA editing in its genomics, biological and evolutionary context through whole genome maps and multiple sequence alignments. REDIdb is freely available at http://srv00.recas.ba.infn.it/redidb/index.html.

  3. Errant processing and structural alterations of genomes present in a varicella-zoster virus vaccine.

    PubMed Central

    Vlazny, D A; Hyman, R W

    1985-01-01

    Five minority populations of aberrant, varicella-zoster virus (VZV)-derived genomes were identified among the encapsidated DNAs obtained from the nuclear and cytoplasmic fractions of an in vitro infection initiated with a lyophilized sample of the BIKEN VZV vaccine (strain Oka). These were (i) VZV genomes, present within nuclear but not cytoplasmic viral capsids, which had been cleaved at a specific site within the short segment and which were, therefore, 3.15 megadaltons (approximately 4% of the VZV genome length) short of full length; (ii) highly deleted, repetitive VZV genomes which contained the errant cleavage site but not the usual VZV genome terminal sequences; (iii) VZV genomes into which multiples of 1 through 5 defective genome repeat units had been inserted into a homologous site; (iv) VZV genomes with additions of 0.1 or 0.18 megadaltons of DNA at both the terminal and internal ends of the short segment; and (v) VZV DNA which had lost the HindIII restriction site at map position 0.11. Images PMID:2993670

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    "rsed" is an R package that contains tools for stream editing: manipulating text files by making insertions, replacements, deletions, substitutions, or commenting. It hails from the powerful Unix command, "sed". While the "rsed" package is not nearly as powerful as "see", it is much simpler to use. R programmers often write scripts that may require simple manipulation of text files. "rsed" addresses that need.

  5. Child Development and Structural Variation in the Human Genome

    ERIC Educational Resources Information Center

    Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

    2013-01-01

    Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

  6. Genome-wide copy number variation in the bovine genome detected using low coverage sequence of popular beef breeds

    USDA-ARS?s Scientific Manuscript database

    Copy number variations (CNVs) are large insertions, deletions or duplications in the genome that vary between members of a species and are known to affect a wide variety of phenotypic traits. In this study, we identified CNVs in a population of bulls using low coverage next-generation sequence data....

  7. Study of the genetic diversity of the aflatoxin biosynthesis cluster in Aspergillus section Flavi using insertion/deletion markers in peanut seeds from Georgia, USA

    USDA-ARS?s Scientific Manuscript database

    Aflatoxins are among the most powerful carcinogens in nature. The major aflatoxin-producing fungi are Aspergillus flavus and A. parasiticus. Numerous crops, including peanut, are susceptible to aflatoxin contamination by these fungi. There has been an increased use of RNA interference (RNAi) technol...

  8. First Report of a Single Exon Deletion in TCOF1 Causing Treacher Collins Syndrome

    PubMed Central

    Beygo, J.; Buiting, K.; Seland, S.; Lüdecke, H.-J.; Hehr, U.; Lich, C.; Prager, B.; Lohmann, D.R.; Wieczorek, D.

    2012-01-01

    Treacher Collins syndrome (TCS) is a rare craniofacial disorder characterized by facial anomalies and ear defects. TCS is caused by mutations in the TCOF1 gene and follows autosomal dominant inheritance. Recently, mutations in the POLR1D and POLR1C genes have also been identified to cause TCS. However, in a subset of patients no causative mutation could be found yet. Inter- and intrafamilial phenotypic variability is high as is the variety of mainly family-specific mutations identified throughout TCOF1. No obvious correlation between pheno- and genotype could be observed. The majority of described point mutations, small insertions and deletions comprising only a few nucleotides within TCOF1 lead to a premature termination codon. We investigated a cohort of 112 patients with a tentative clinical diagnosis of TCS by multiplex ligation-dependent probe amplification (MLPA) to search for larger deletions not detectable with other methods used. All patients were selected after negative screening for mutations in TCOF1, POLR1D and POLR1C. In 1 patient with an unequivocal clinical diagnosis of TCS, we identified a 3.367 kb deletion. This deletion abolishes exon 3 and is the first described single exon deletion within TCOF1. On RNA level we observed loss of this exon which supposedly leads to haploinsufficiency of TREACLE, the nucleolar phosphoprotein encoded by TCOF1. PMID:22712005

  9. First Report of a Single Exon Deletion in TCOF1 Causing Treacher Collins Syndrome.

    PubMed

    Beygo, J; Buiting, K; Seland, S; Lüdecke, H-J; Hehr, U; Lich, C; Prager, B; Lohmann, D R; Wieczorek, D

    2012-01-01

    Treacher Collins syndrome (TCS) is a rare craniofacial disorder characterized by facial anomalies and ear defects. TCS is caused by mutations in the TCOF1 gene and follows autosomal dominant inheritance. Recently, mutations in the POLR1D and POLR1C genes have also been identified to cause TCS. However, in a subset of patients no causative mutation could be found yet. Inter- and intrafamilial phenotypic variability is high as is the variety of mainly family-specific mutations identified throughout TCOF1. No obvious correlation between pheno- and genotype could be observed. The majority of described point mutations, small insertions and deletions comprising only a few nucleotides within TCOF1 lead to a premature termination codon. We investigated a cohort of 112 patients with a tentative clinical diagnosis of TCS by multiplex ligation-dependent probe amplification (MLPA) to search for larger deletions not detectable with other methods used. All patients were selected after negative screening for mutations in TCOF1, POLR1D and POLR1C. In 1 patient with an unequivocal clinical diagnosis of TCS, we identified a 3.367 kb deletion. This deletion abolishes exon 3 and is the first described single exon deletion within TCOF1. On RNA level we observed loss of this exon which supposedly leads to haploinsufficiency of TREACLE, the nucleolar phosphoprotein encoded by TCOF1.

  10. Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.

    PubMed

    Toyama, H; Anthony, C; Lidstrom, M E

    1998-09-01

    Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.

  11. Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

    PubMed Central

    Kirkegaard, K; Nelsen, B

    1990-01-01

    Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

  12. Infectious Bovine Viral Diarrhea Virus (Strain NADL) RNA from Stable cDNA Clones: a Cellular Insert Determines NS3 Production and Viral Cytopathogenicity

    PubMed Central

    Mendez, Ernesto; Ruggli, Nicolas; Collett, Marc S.; Rice, Charles M.

    1998-01-01

    Bovine viral diarrhea virus (BVDV), strain NADL, was originally isolated from an animal with fatal mucosal disease. This isolate is cytopathic in cell culture and produces two forms of NS3-containing proteins: uncleaved NS2-3 and mature NS3. For BVDV NADL, the production of NS3, a characteristic of cytopathic BVDV strains, is believed to be a consequence of an in-frame insertion of a 270-nucleotide cellular mRNA sequence (called cIns) in the NS2 coding region. In this study, we constructed a stable full-length cDNA copy of BVDV NADL in a low-copy-number plasmid vector. As assayed by transfection of MDBK cells, uncapped RNAs transcribed from this template were highly infectious (>105 PFU/μg). The recovered virus was similar in plaque morphology, growth properties, polyprotein processing, and cytopathogenicity to the BVDV NADL parent. Deletion of cIns abolished processing at the NS2/NS3 site and produced a virus that was no longer cytopathic for MDBK cells. This deletion did not affect the efficiency of infectious virus production or viral protein production, but it reduced the level of virus-specific RNA synthesis and accumulation. Thus, cIns not only modulates NS3 production but also upregulates RNA replication relative to an isogenic noncytopathic derivative lacking the insert. These results raise the possibility of a linkage between enhanced BVDV NADL RNA replication and virus-induced cytopathogenicity. PMID:9573238

  13. Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

    PubMed

    Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

    1999-06-01

    Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

  14. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii.

    PubMed

    Shen, Bang; Powell, Robin H; Behnke, Michael S

    2017-06-22

    Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

  15. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

    PubMed Central

    Shen, Bang; Powell, Robin H.; Behnke, Michael S.

    2017-01-01

    Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites. PMID:28671645

  16. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx

    PubMed Central

    Suárez, Gabriel A.; Renda, Brian A.; Dasgupta, Aurko

    2017-01-01

    ABSTRACT The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase (dinP) and a DNA damage response regulator (umuDAb [the umuD gene of A. baylyi]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting “clean-genome” ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. PMID:28667117

  17. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx.

    PubMed

    Suárez, Gabriel A; Renda, Brian A; Dasgupta, Aurko; Barrick, Jeffrey E

    2017-09-01

    The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS 1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS 1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS 1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase ( dinP ) and a DNA damage response regulator ( umuD Ab [the umuD gene of A. baylyi ]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting "clean-genome" ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. Copyright © 2017 American Society for Microbiology.

  18. A new molecular evolution model for limited insertion independent of substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2013-10-01

    We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Coincidence of synteny breakpoints with malignancy-related deletions on human chromosome 3

    PubMed Central

    Kost-Alimova, Maria; Kiss, Hajnalka; Fedorova, Ludmila; Yang, Ying; Dumanski, Jan P.; Klein, George; Imreh, Stefan

    2003-01-01

    We have found previously that during tumor growth intact human chromosome 3 transferred into tumor cells regularly looses certain 3p regions, among them the ≈1.4-Mb common eliminated region 1 (CER1) at 3p21.3. Fluorescence in situ hybridization analysis of 12 mouse orthologous loci revealed that CER1 splits into two segments in mouse and therefore contains a murine/human conservation breakpoint region (CBR). Several breaks occurred in tumors within the region surrounding the CBR, and this sequence has features that characterize unstable chromosomal regions: deletions in yeast artificial chromosome clones, late replication, gene and segment duplications, and pseudogene insertions. Sequence analysis of the entire 3p12-22 revealed that other cancer-associated deletions (regions eliminated from monochromosomal hybrids carrying an intact chromosome 3 during tumor growth and homozygous deletions found in human tumors) colocalized nonrandomly with murine/human CBRs and were characterized by an increased number of local gene duplications and murine/human conservation mismatches (single genes that do not match into the conserved chromosomal segment). The CBR within CER1 contains a simple tandem TATAGA repeat capable of forming a 40-bp-long secondary hairpin-like structure. This repeat is nonrandomly localized within the other tumor-associated deletions and in the vicinity of 3p12-22 CBRs. PMID:12738884

  20. Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

    PubMed

    Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

    1998-01-01

    The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

  1. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    PubMed Central

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  2. Behavioral-Physiological Effects of Red Phosphorus Smoke Inhalation on Two Wildlife Species

    DTIC Science & Technology

    1989-04-01

    black-tailed prairie dog (Cynomys ludovicianus) and rock dove ( Columba livia ), with distributional range maps for each species shown as inserts...evaluations. This lack.of data led to the current work. Black-tailed prairie dogs (Cynomys ludovicianus) and rock doves ( Columba livia ) were selected ds...dove ( Columba livia ), with distributional range maps for each species shown as inserts. RP/BR-smoke exposure. As shown in Figure 1, both species share

  3. Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Omel`yanchuk, L.V.

    1995-12-01

    A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

  4. Software-implemented fault insertion: An FTMP example

    NASA Technical Reports Server (NTRS)

    Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.

    1987-01-01

    This report presents a model for fault insertion through software; describes its implementation on a fault-tolerant computer, FTMP; presents a summary of fault detection, identification, and reconfiguration data collected with software-implemented fault insertion; and compares the results to hardware fault insertion data. Experimental results show detection time to be a function of time of insertion and system workload. For the fault detection time, there is no correlation between software-inserted faults and hardware-inserted faults; this is because hardware-inserted faults must manifest as errors before detection, whereas software-inserted faults immediately exercise the error detection mechanisms. In summary, the software-implemented fault insertion is able to be used as an evaluation technique for the fault-handling capabilities of a system in fault detection, identification and recovery. Although the software-inserted faults do not map directly to hardware-inserted faults, experiments show software-implemented fault insertion is capable of emulating hardware fault insertion, with greater ease and automation.

  5. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    PubMed Central

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource for tetraploid cotton genome assembly, for cloning genes related to superior agronomic traits, and for further comparative genomic analyses in Gossypium. PMID:23046547

  6. Chromosome 22q11.2 deletion in a boy with Opitz (G/BBB) syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fryburg, J.S.; Lin, K.Y.; Golden, W.L.

    This report is on a 14-month-old boy with manifestations of Opitz (G/BBB) syndrome in whom a 22q11.2 deletion was found. Deletion analysis was requested because of some findings in this patient reminiscent of velocardiofacial (VCF) syndrome. The extent of aspiration and of respiratory symptoms in this child is not usually seen in VCF syndrome. Opitz syndrome maps to at least two loci, one on Xp, the other on 22q11.2. 12 refs., 2 figs.

  7. Homozygous deletions at 3p12 in breast and lung cancer.

    PubMed

    Sundaresan, V; Chung, G; Heppell-Parton, A; Xiong, J; Grundy, C; Roberts, I; James, L; Cahn, A; Bench, A; Douglas, J; Minna, J; Sekido, Y; Lerman, M; Latif, F; Bergh, J; Li, H; Lowe, N; Ogilvie, D; Rabbitts, P

    1998-10-01

    We have constructed a physical map of the region homozygously deleted in the U2020 cell line at 3p12, including the location of putative CpG islands. Adjacent to one of these islands, we have identified and cloned a new gene (DUTT1) and used probes from this gene to detect two other homozygous deletions occurring in lung and breast carcinomas: the smallest deletion is within the gene itself and would result in a truncated protein. The DUTT1 gene is a member of the neural cell adhesion molecule family, although its widespread expression suggests it plays a less specialized role compared to other members of the family.

  8. Stronger Federal Efforts Needed for Providing Employment Opportunities and Enforcing Labor Standards in Sheltered Workshops.

    DTIC Science & Technology

    1981-09-28

    based on the production level of a nonhandi- capped worker. The new jobs are expressed in staff-years of work for handicapped workers. For fiscal years...34nonhandicapped". Page 5-6. Lines 5 thru 8. Delete the sentence beginninq "Thus, if a workshop ..." and insert the following " The new jobs are

  9. Cloze, Discourse, and Approximations to English.

    ERIC Educational Resources Information Center

    Oller, John W., Jr.

    Five orders of approximation to normal English prose were constructed; 5th, 10th, 25th, 50th, and 100th plus. Five cloze tests were then constructed by inserting blanks for deleted words in 5 word segments (5th order), 10 word segments (10th), 25 word segments (25th), 50 word segments (50th), and 100 word segments of five different passages of…

  10. LoRTE: Detecting transposon-induced genomic variants using low coverage PacBio long read sequences.

    PubMed

    Disdero, Eric; Filée, Jonathan

    2017-01-01

    Population genomic analysis of transposable elements has greatly benefited from recent advances of sequencing technologies. However, the short size of the reads and the propensity of transposable elements to nest in highly repeated regions of genomes limits the efficiency of bioinformatic tools when Illumina or 454 technologies are used. Fortunately, long read sequencing technologies generating read length that may span the entire length of full transposons are now available. However, existing TE population genomic softwares were not designed to handle long reads and the development of new dedicated tools is needed. LoRTE is the first tool able to use PacBio long read sequences to identify transposon deletions and insertions between a reference genome and genomes of different strains or populations. Tested against simulated and genuine Drosophila melanogaster PacBio datasets, LoRTE appears to be a reliable and broadly applicable tool to study the dynamic and evolutionary impact of transposable elements using low coverage, long read sequences. LoRTE is an efficient and accurate tool to identify structural genomic variants caused by TE insertion or deletion. LoRTE is available for download at http://www.egce.cnrs-gif.fr/?p=6422.

  11. Angiotensin-converting enzyme gene insertion/deletion polymorphism in Saudi patients with rheumatic heart disease

    PubMed Central

    Al-Harbi, Khalid M.; Almuzaini, Ibrahim S.; Morsy, Mohamed M.; Abdelaziz, Nada A.; Al-Balawi, Alia M.; Abdallah, Atiyeh M.

    2015-01-01

    Objectives: To investigate the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism and rheumatic heart disease (RHD) in Saudi patients. Methods: A case-control study was conducted in Saudi RHD patients. Genomic DNA was isolated from 99 RHD patients attending the Pediatric Cardiology Clinic at the Maternity and Children Hospital, Al-Madinah, Saudi Arabia from March 2013 to June 2014, and from 145 age- and gender-matched controls. Patient clinical records were reviewed to report major and minor modified Jones’ criteria for diagnosis. The diagnosis was confirmed by echocardiography. The ACE I/D polymorphism was identified by polymerase chain reaction. Results: A significant difference in ACE D allele carriage (DD+ID) distribution between RHD cases and controls was identified (p=0.02, odds ratio = 3.6, 95% confidence interval: 1.2-10.8). The D allele carriage was significantly associated with development of mitral valve lesions alone (p=0.03). Conclusion: The ACE I/D polymorphism is associated with an increased risk of RHD in the Saudi population. Further studies are needed to confirm our findings and to understand the molecular mechanisms underlying this association. PMID:25719581

  12. Ac-immobilized, a stable source of Activator transposase that mediates sporophytic and gametophytic excision of Dissociation elements in maize.

    PubMed

    Conrad, Liza J; Brutnell, Thomas P

    2005-12-01

    We have identified and characterized a novel Activator (Ac) element that is incapable of excision yet contributes to the canonical negative dosage effect of Ac. Cloning and sequence analysis of this immobilized Ac (Ac-im) revealed that it is identical to Ac with the exception of a 10-bp deletion of sequences at the left end of the element. In screens of approximately 6800 seeds, no germinal transpositions of Ac-im were detected. Importantly, Ac-im catalyzes germinal excisions of a Ds element resident at the r1 locus resulting in the recovery of independent transposed Ds insertions in approximately 4.5% of progeny kernels. Many of these transposition events occur during gametophytic development. Furthermore, we demonstrate that Ac-im transactivates multiple Ds insertions in somatic tissues including those in reporter alleles at bronze1, anthocyaninless1, and anthocyaninless2. We propose a model for the generation of Ac-im as an aberrant transposition event that failed to generate an 8-bp target site duplication and resulted in the deletion of Ac end sequences. We also discuss the utility of Ac-im in two-component Ac/Ds gene-tagging programs in maize.

  13. Association of Guide RNA Binding Protein gBP21 with Active RNA Editing Complexes in Trypanosoma brucei

    PubMed Central

    Allen, Thomas E.; Heidmann, Stefan; Reed, RoseMary; Myler, Peter J.; Göringer, H. Ulrich; Stuart, Kenneth D.

    1998-01-01

    RNA editing in Trypanosoma brucei mitochondria produces mature mRNAs by a series of enzyme-catalyzed reactions that specifically insert or delete uridylates in association with a macromolecular complex. Using a mitochondrial fraction enriched for in vitro RNA editing activity, we produced several monoclonal antibodies that are specific for a 21-kDa guide RNA (gRNA) binding protein initially identified by UV cross-linking. Immunofluorescence studies localize the protein to the mitochondrion, with a preference for the kinetoplast. The antibodies cause a supershift of previously identified gRNA-specific ribonucleoprotein complexes and immunoprecipitate in vitro RNA editing activities that insert and delete uridylates. The immunoprecipitated material also contains gRNA-specific endoribonuclease, terminal uridylyltransferase, and RNA ligase activities as well as gRNA and both edited and unedited mRNA. The immunoprecipitate contains numerous proteins, of which the 21-kDa protein, a 90-kDa protein, and novel 55- and 16-kDa proteins can be UV cross-linked to gRNA. These studies indicate that the 21-kDa protein associates with the ribonucleoprotein complex (or complexes) that catalyze RNA editing. PMID:9742118

  14. Coiled-coil length: Size does matter.

    PubMed

    Surkont, Jaroslaw; Diekmann, Yoan; Ryder, Pearl V; Pereira-Leal, Jose B

    2015-12-01

    Protein evolution is governed by processes that alter primary sequence but also the length of proteins. Protein length may change in different ways, but insertions, deletions and duplications are the most common. An optimal protein size is a trade-off between sequence extension, which may change protein stability or lead to acquisition of a new function, and shrinkage that decreases metabolic cost of protein synthesis. Despite the general tendency for length conservation across orthologous proteins, the propensity to accept insertions and deletions is heterogeneous along the sequence. For example, protein regions rich in repetitive peptide motifs are well known to extensively vary their length across species. Here, we analyze length conservation of coiled-coils, domains formed by an ubiquitous, repetitive peptide motif present in all domains of life, that frequently plays a structural role in the cell. We observed that, despite the repetitive nature, the length of coiled-coil domains is generally highly conserved throughout the tree of life, even when the remaining parts of the protein change, including globular domains. Length conservation is independent of primary amino acid sequence variation, and represents a conservation of domain physical size. This suggests that the conservation of domain size is due to functional constraints. © 2015 Wiley Periodicals, Inc.

  15. A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

    PubMed Central

    Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

    2011-01-01

    Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

  16. Construction of the physical map of the gpa7 locus reveals that a large segment was deleted during rice domestication.

    PubMed

    Li, Xianran; Tian, Feng; Huang, Haiyan; Tan, Lubin; Zhu, Zuofeng; Hu, Songnian; Sun, Chuanqing

    2008-06-01

    To facilitate cloning gene(s) underlying gpa7, a deep-coverage BAC library was constructed for an isolate of common wild rice (Oryza rufipogon Griff.) collected from Dongxiang, Jiangxi Province, China (DXCWR). gpa7, a quantitative trait locus corresponding to grain number per panicle, is positioned in the short arm of chromosome 7. The BAC library containing 96,768 clones represents approximate 18 haploid genome equivalents. The contig spanning DXCWR gpa7 was constructed with a series of ordered markers. The putative physical map near the gpa7 locus of another accession of O. rufipogon (Accession: IRGC 105491) was also isolated in silico. Analysis of the physical maps of gpa7 indicated that a segment of about 150 kb was deleted during domestication of common wild rice.

  17. Analytic Validation of a Clinical-Grade PTEN Immunohistochemistry Assay in Prostate Cancer by Comparison to PTEN FISH

    PubMed Central

    Lotan, Tamara L.; Wei, Wei; Ludkovski, Olga; Morais, Carlos L.; Guedes, Liana B.; Jamaspishvili, Tamara; Lopez, Karen; Hawley, Sarah T.; Feng, Ziding; Fazli, Ladan; Hurtado-Coll, Antonio; McKenney, Jesse K.; Simko, Jeffrey; Carroll, Peter R.; Gleave, Martin; Lin, Daniel W.; Nelson, Peter S.; Thompson, Ian M.; True, Lawrence D.; Brooks, James D.; Lance, Raymond; Troyer, Dean; Squire, Jeremy A.

    2016-01-01

    PTEN loss is a promising prognostic and predictive biomarker in prostate cancer. Because it occurs most commonly via PTEN gene deletion, we developed a clinical-grade, automated and inexpensive immunohistochemical assay to detect PTEN loss. We studied the sensitivity and specificity of PTEN immunohistochemistry relative to 4-color fluorescence in situ hybridization (FISH) for detection of PTEN gene deletion in a multi-institutional cohort of 731 primary prostate tumors. Intact PTEN immunostaining was 91% specific for absence of PTEN gene deletion, (549/602 tumors with 2 copies of the PTEN gene by FISH showed intact expression of PTEN by immunohistochemistry) and 97% sensitive for presence of homozygous PTEN gene deletion (absent PTEN protein expression by immunohistochemistry in 65/67 tumors with homozygous deletion). PTEN immunohistochemistry was 65% sensitive for presence of hemizygous PTEN gene deletion, with protein loss in 40/62 hemizygous tumors. We reviewed the 53 cases where immunohistochemistry showed PTEN protein loss and FISH showed 2 intact copies of the PTEN gene. On re-review, there was ambiguous immunohistochemistry loss in 6% (3/53) and failure to analyze the same tumor area by both methods in 34% (18/53). Of the remaining discordant cases, 41% (13/32) revealed hemizygous (n=8) or homozygous (n=5) PTEN gene deletion that was focal in most cases (11/13). The remaining 19 cases had 2 copies of the PTEN gene by FISH, representing truly discordant cases. Our automated PTEN immunohistochemistry assay is a sensitive method for detection of homozygous PTEN gene deletions. Immunohistochemistry screening is particularly useful to identify cases with heterogeneous PTEN gene deletion in a subset of tumor glands. Mutations, small insertions or deletions and/or epigenetic or microRNA-mediated mechanisms may lead to PTEN protein loss in tumors with normal or hemizygous PTEN gene copy number. PMID:27174589

  18. Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

    PubMed

    Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

    2014-05-27

    We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

  19. DeF-GPU: Efficient and effective deletions finding in hepatitis B viral genomic DNA using a GPU architecture.

    PubMed

    Cheng, Chun-Pei; Lan, Kuo-Lun; Liu, Wen-Chun; Chang, Ting-Tsung; Tseng, Vincent S

    2016-12-01

    Hepatitis B viral (HBV) infection is strongly associated with an increased risk of liver diseases like cirrhosis or hepatocellular carcinoma (HCC). Many lines of evidence suggest that deletions occurring in HBV genomic DNA are highly associated with the activity of HBV via the interplay between aberrant viral proteins release and human immune system. Deletions finding on the HBV whole genome sequences is thus a very important issue though there exist underlying the challenges in mining such big and complex biological data. Although some next generation sequencing (NGS) tools are recently designed for identifying structural variations such as insertions or deletions, their validity is generally committed to human sequences study. This design may not be suitable for viruses due to different species. We propose a graphics processing unit (GPU)-based data mining method called DeF-GPU to efficiently and precisely identify HBV deletions from large NGS data, which generally contain millions of reads. To fit the single instruction multiple data instructions, sequencing reads are referred to as multiple data and the deletion finding procedure is referred to as a single instruction. We use Compute Unified Device Architecture (CUDA) to parallelize the procedures, and further validate DeF-GPU on 5 synthetic and 1 real datasets. Our results suggest that DeF-GPU outperforms the existing commonly-used method Pindel and is able to exactly identify the deletions of our ground truth in few seconds. The source code and other related materials are available at https://sourceforge.net/projects/defgpu/. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Genetic Diversity of the Q Fever Agent, Coxiella burnetii, Assessed by Microarray-Based Whole-Genome Comparisons†

    PubMed Central

    Beare, Paul A.; Samuel, James E.; Howe, Dale; Virtaneva, Kimmo; Porcella, Stephen F.; Heinzen, Robert A.

    2006-01-01

    Coxiella burnetii, a gram-negative obligate intracellular bacterium, causes human Q fever and is considered a potential agent of bioterrorism. Distinct genomic groups of C. burnetii are revealed by restriction fragment-length polymorphisms (RFLP). Here we comprehensively define the genetic diversity of C. burnetii by hybridizing the genomes of 20 RFLP-grouped and four ungrouped isolates from disparate sources to a high-density custom Affymetrix GeneChip containing all open reading frames (ORFs) of the Nine Mile phase I (NMI) reference isolate. We confirmed the relatedness of RFLP-grouped isolates and showed that two ungrouped isolates represent distinct genomic groups. Isolates contained up to 20 genomic polymorphisms consisting of 1 to 18 ORFs each. These were mostly complete ORF deletions, although partial deletions, point mutations, and insertions were also identified. A total of 139 chromosomal and plasmid ORFs were polymorphic among all C. burnetii isolates, representing ca. 7% of the NMI coding capacity. Approximately 67% of all deleted ORFs were hypothetical, while 9% were annotated in NMI as nonfunctional (e.g., frameshifted). The remaining deleted ORFs were associated with diverse cellular functions. The only deletions associated with isogenic NMI variants of attenuated virulence were previously described large deletions containing genes involved in lipopolysaccharide (LPS) biosynthesis, suggesting that these polymorphisms alone are responsible for the lower virulence of these variants. Interestingly, a variant of the Australia QD isolate producing truncated LPS had no detectable deletions, indicating LPS truncation can occur via small genetic changes. Our results provide new insight into the genetic diversity and virulence potential of Coxiella species. PMID:16547017

  1. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    PubMed

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  2. The accommodation index measures the perturbation associated with insertions and deletions in coiled‐coils: Application to understand signaling in histidine kinases

    PubMed Central

    Schmidt, Nathan W.; Grigoryan, Gevorg

    2017-01-01

    Abstract Coiled‐coils are essential components of many protein complexes. First discovered in structural proteins such as keratins, they have since been found to figure largely in the assembly and dynamics required for diverse functions, including membrane fusion, signal transduction and motors. Coiled‐coils have a characteristic repeating seven‐residue geometric and sequence motif, which is sometimes interrupted by the insertion of one or more residues. Such insertions are often highly conserved and critical to interdomain communication in signaling proteins such as bacterial histidine kinases. Here we develop the “accommodation index” as a parameter that allows automatic detection and classification of insertions based on the three dimensional structure of a protein. This method allows precise identification of the type of insertion and the “accommodation length” over which the insertion is structurally accommodated. A simple theory is presented that predicts the structural perturbations of 1, 3, 4 residue insertions as a function of the length over which the insertion is accommodated. Analysis of experimental structures is in good agreement with theory, and shows that short accommodation lengths give rise to greater perturbation of helix packing angles, changes in local helical phase, and increased structural asymmetry relative to long accommodation lengths. Cytoplasmic domains of histidine kinases in different signaling states display large changes in their accommodation lengths, which can now be seen to underlie diverse structural transitions including symmetry/asymmetry and local variations in helical phase that accompany signal transduction. PMID:27977891

  3. Direct Detection of Insertion/Deletion Polymorphisms in an Autosomal Region by Analyzing High-Density Markers in Individual Spermatozoa

    PubMed Central

    Pramanik, Sreemanta; Li, Honghua

    2002-01-01

    Direct polymerase chain reaction (PCR) detection of insertion/deletion (indel) polymorphisms requires sample homozygosity. For the indel polymorphisms that have the deletion allele with a relatively low frequency in the autosomal regions, direct PCR detection becomes difficult or impossible. The present study is, to our knowledge, the first designed to directly detect indel polymorphisms in a human autosomal region (i.e., the immunoglobulin VH region), through use of single haploid sperm cells as subjects. Unique marker sequences (n=32), spaced at ∼5-kb intervals, were selected near the 3′ end of the VH region. A two-round multiplex PCR protocol was used to amplify these sequences from single sperm samples from nine unrelated healthy donors. The parental haplotypes of the donors were determined by examining the presence or absence of these markers. Seven clustered markers in 6 of the 18 haplotypes were missing and likely represented a 35–40-kb indel polymorphism. The genotypes of the donors, with respect to this polymorphism, perfectly matched the expectation under Hardy-Weinberg equilibrium. Three VH gene segments, of which two are functional, are affected by this polymorphism. According to these results, >10% of individuals in the human population may not have these gene segments in their genome, and ∼44% may have only one copy of these gene segments. The biological impact of this polymorphism would be very interesting to study. The approach used in the present study could be applied to understand the physical structure and diversity of all other autosomal regions. PMID:12442231

  4. Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato.

    PubMed

    Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko

    2016-01-01

    Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Two different types of double-strand breaks in Saccharomyces cerevisiae are repaired by similar RAD52-independent, nonhomologous recombination events.

    PubMed Central

    Kramer, K M; Brock, J A; Bloom, K; Moore, J K; Haber, J E

    1994-01-01

    In haploid rad52 Saccharomyces cerevisiae strains unable to undergo homologous recombination, a chromosomal double-strand break (DSB) can be repaired by imprecise rejoining of the broken chromosome ends. We have used two different strategies to generate broken chromosomes: (i) a site-specific DSB generated at the MAT locus by HO endonuclease cutting or (ii) a random DSB generated by mechanical rupture during mitotic segregation of a conditionally dicentric chromosome. Broken chromosomes were repaired by deletions that were highly variable in size, all of which removed more sequences than was required either to prevent subsequent HO cleavage or to eliminate a functional centromere, respectively. The junction of the deletions frequently occurred where complementary strands from the flanking DNA could anneal to form 1 to 5 bp, although 12% (4 of 34) of the events appear to have occurred by blunt-end ligation. These types of deletions are very similar to the junctions observed in the repair of DSBs by mammalian cells (D. B. Roth and J. H. Wilson, Mol. Cell. Biol. 6:4295-4304, 1986). When a high level of HO endonuclease, expressed in all phases of the cell cycle, was used to create DSBs, we also recovered a large class of very small (2- or 3-bp) insertions in the HO cleavage site. These insertions appear to represent still another mechanism of DSB repair, apparently by annealing and filling in the overhanging 3' ends of the cleavage site. These types of events have also been well documented for vertebrate cells. PMID:8289808

  6. Breed relationships facilitate fine-mapping studies: A 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds

    PubMed Central

    Parker, Heidi G.; Kukekova, Anna V.; Akey, Dayna T.; Goldstein, Orly; Kirkness, Ewen F.; Baysac, Kathleen C.; Mosher, Dana S.; Aguirre, Gustavo D.; Acland, Gregory M.; Ostrander, Elaine A.

    2007-01-01

    The features of modern dog breeds that increase the ease of mapping common diseases, such as reduced heterogeneity and extensive linkage disequilibrium, may also increase the difficulty associated with fine mapping and identifying causative mutations. One way to address this problem is by combining data from multiple breeds segregating the same trait after initial linkage has been determined. The multibreed approach increases the number of potentially informative recombination events and reduces the size of the critical haplotype by taking advantage of shortened linkage disequilibrium distances found across breeds. In order to identify breeds that likely share a trait inherited from the same ancestral source, we have used cluster analysis to divide 132 breeds of dog into five primary breed groups. We then use the multibreed approach to fine-map Collie eye anomaly (cea), a complex disorder of ocular development that was initially mapped to a 3.9-cM region on canine chromosome 37. Combined genotypes from affected individuals from four breeds of a single breed group significantly narrowed the candidate gene region to a 103-kb interval spanning only four genes. Sequence analysis revealed that all affected dogs share a homozygous deletion of 7.8 kb in the NHEJ1 gene. This intronic deletion spans a highly conserved binding domain to which several developmentally important proteins bind. This work both establishes that the primary cea mutation arose as a single disease allele in a common ancestor of herding breeds as well as highlights the value of comparative population analysis for refining regions of linkage. PMID:17916641

  7. The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.

    PubMed Central

    Singh, Gurjeet; Klar, Amar J S

    2002-01-01

    The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain. PMID:12399374

  8. Mycobacterium avium subsp. paratuberculosis PPE Protein MAP1152 and Conserved Protein MAP1156 are Antigenic in Experimentally and Naturally Infected Cattle

    USDA-ARS?s Scientific Manuscript database

    Mycobacterium avium subsp. paratuberculosis (MAP) causes Johne’s Disease (JD) in ruminants resulting in significant production losses. An insertion mutation upstream from the MAP1152-MAP1156 region causes a change in colony morphotype and results in an attenuated phenotype in bovine monocyte derive...

  9. Secretome Analysis Defines the Major Role of SecDF in Staphylococcus aureus Virulence

    PubMed Central

    Quiblier, Chantal; Seidl, Kati; Roschitzki, Bernd; Zinkernagel, Annelies S.; Berger-Bächi, Brigitte; Senn, Maria M.

    2013-01-01

    The Sec pathway plays a prominent role in protein export and membrane insertion, including the secretion of major bacterial virulence determinants. The accessory Sec constituent SecDF has been proposed to contribute to protein export. Deletion of Staphylococcus aureus secDF has previously been shown to reduce resistance, to alter cell separation, and to change the expression of certain virulence factors. To analyse the impact of the secDF deletion in S. aureus on protein secretion, a quantitative secretome analysis was performed. Numerous Sec signal containing proteins involved in virulence were found to be decreased in the supernatant of the secDF mutant. However, two Sec-dependent hydrolases were increased in comparison to the wild type, suggesting additional indirect, regulatory effects to occur upon deletion of secDF. Adhesion, invasion, and cytotoxicity of the secDF mutant were reduced in human umbilical vein endothelial cells. Virulence was significantly reduced using a Galleria mellonella insect model. Altogether, SecDF is a promising therapeutic target for controlling S. aureus infections. PMID:23658837

  10. Performance analysis of different database in new internet mapping system

    NASA Astrophysics Data System (ADS)

    Yao, Xing; Su, Wei; Gao, Shuai

    2017-03-01

    In the Mapping System of New Internet, Massive mapping entries between AID and RID need to be stored, added, updated, and deleted. In order to better deal with the problem when facing a large number of mapping entries update and query request, the Mapping System of New Internet must use high-performance database. In this paper, we focus on the performance of Redis, SQLite, and MySQL these three typical databases, and the results show that the Mapping System based on different databases can adapt to different needs according to the actual situation.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schuffenhauer, S.; Daumer-Haas, C.; Murken, J.

    Karyotypes with an interstitial deletion and a marker chromosome formed from the deleted segment are rare. We identified such a rearrangement in a newborn infant, who presented with macrocephaly, asymmetric square skull, minor facial anomalies, omphalocele, inguinal hernias, hypospadias, and club feet. The karyotype 46,XY,del(5)(pter{r_arrow}p13::cen{r_arrow}qter)/47,XY,+dicr(5)(:p13{r_arrow}cen::p13{r_arrow}cen),del(5)(pter{r_arrow}p13::cen{r_arrow}qter) was identified by banding studies and FISH analysis in the peripheral lymphocytes. One breakpoint on the del(5) maps distal to GDNF, and FISH analysis using an {alpha}-satellite probe suggests that the proximal breakpoint maps within the centromere. The dicentric r(5) consists of two copies of the segment deleted in the del(5), resulting in trisomy ofmore » proximal 5p (5p13-cen). The phenotype of the propositus is compared with other trisomy 5p cases and possible mechanisms for the generation of this unique chromosomal rearrangement are discussed. 27 refs., 3 figs.« less

  12. Determining protein complex connectivity using a probabilistic deletion network derived from quantitative proteomics.

    PubMed

    Sardiu, Mihaela E; Gilmore, Joshua M; Carrozza, Michael J; Li, Bing; Workman, Jerry L; Florens, Laurence; Washburn, Michael P

    2009-10-06

    Protein complexes are key molecular machines executing a variety of essential cellular processes. Despite the availability of genome-wide protein-protein interaction studies, determining the connectivity between proteins within a complex remains a major challenge. Here we demonstrate a method that is able to predict the relationship of proteins within a stable protein complex. We employed a combination of computational approaches and a systematic collection of quantitative proteomics data from wild-type and deletion strain purifications to build a quantitative deletion-interaction network map and subsequently convert the resulting data into an interdependency-interaction model of a complex. We applied this approach to a data set generated from components of the Saccharomyces cerevisiae Rpd3 histone deacetylase complexes, which consists of two distinct small and large complexes that are held together by a module consisting of Rpd3, Sin3 and Ume1. The resulting representation reveals new protein-protein interactions and new submodule relationships, providing novel information for mapping the functional organization of a complex.

  13. Deletion mapping of 22q11 in CATCH22 syndrome: Identification of a second critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurahashi, Hiroki; Nakayama, Takahiro; Nishisho, Isamu

    1996-06-01

    The deletion at 22q11.2 implicates a variety of congenital anomaly syndromes, for which the acronym CATCH22 has been proposed . Most patients with these syndromes share the common large deletion spanning 1-2 Mb, while the phenotypic variability of the patients does not seem to correlate with the extent of the deletions. On the basis of the deletions of rare cases with unbalanced translocation, the shortest region of overlap (SRO) had been identified in the most-centromeric region of the common large deletion. One patient (ADU) has been reported to carry a balanced translocation with the breakpoint located in the SRO. Recently,more » three transcripts were identified at or very close to the ADU breakpoint (ADUBP), making them strong candidates for CATCH22 syndrome. Here, we describe one patient with a unique deletion at 22q11.2 revealed by quantitative hybridization and/or FISH with six DNA markers in the common large deletion. The patient was dizygous at loci within the SRO and hemizygous only at the most-telomeric locus in the common large deletion. This finding suggests that there must be another critical region in the common large deletion besides the breakpoint of the ADU and that haploinsufficiency of genes in this deletion may also play a major role in CATCH22 pathogenesis. 15 refs., 3 figs.« less

  14. Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

    PubMed

    Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

    2014-01-01

    Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

  15. Characterization of new allele influencing flowering time in bread wheat introgressed from Triticum militinae.

    PubMed

    Ivaničová, Zuzana; Jakobson, Irena; Reis, Diana; Šafář, Jan; Milec, Zbyněk; Abrouk, Michael; Doležel, Jaroslav; Järve, Kadri; Valárik, Miroslav

    2016-09-25

    Flowering time variation was identified within a mapping population of doubled haploid lines developed from a cross between the introgressive line 8.1 and spring bread wheat cv. Tähti. The line 8.1 carried introgressions from tetraploid Triticum militinae in the cv. Tähti genetic background on chromosomes 1A, 2A, 4A, 5A, 7A, 1B and 5B. The most significant QTL for the flowering time variation was identified within the introgressed region on chromosome 5A and its largest effect was associated with the VRN-A1 locus, accounting for up to 70% of phenotypic variance. The allele of T. militinae origin was designated as VRN-A1f-like. The effect of the VRN-A1f-like allele was verified in two other mapping populations. QTL analysis identified that in cv. Tähti and cv. Mooni genetic background, VRN-A1f-like allele incurred a delay of 1.9-18.6 days in flowering time, depending on growing conditions. Sequence comparison of the VRN-A1f-like and VRN-A1a alleles from the parental lines of the mapping populations revealed major mutations in the promoter region as well as in the first intron, including insertion of a MITE element and a large deletion. The sequence variation allowed construction of specific diagnostic PCR markers for VRN-A1f-like allele determination. Identification and quantification of the effect of the VRN-A1f-like allele offers a useful tool for wheat breeding and for studying fine-scale regulation of flowering pathways in wheat. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Experimental evolution, genetic analysis and genome re-sequencing reveal the mutation conferring artemisinin resistance in an isogenic lineage of malaria parasites

    PubMed Central

    2010-01-01

    Background Classical and quantitative linkage analyses of genetic crosses have traditionally been used to map genes of interest, such as those conferring chloroquine or quinine resistance in malaria parasites. Next-generation sequencing technologies now present the possibility of determining genome-wide genetic variation at single base-pair resolution. Here, we combine in vivo experimental evolution, a rapid genetic strategy and whole genome re-sequencing to identify the precise genetic basis of artemisinin resistance in a lineage of the rodent malaria parasite, Plasmodium chabaudi. Such genetic markers will further the investigation of resistance and its control in natural infections of the human malaria, P. falciparum. Results A lineage of isogenic in vivo drug-selected mutant P. chabaudi parasites was investigated. By measuring the artemisinin responses of these clones, the appearance of an in vivo artemisinin resistance phenotype within the lineage was defined. The underlying genetic locus was mapped to a region of chromosome 2 by Linkage Group Selection in two different genetic crosses. Whole-genome deep coverage short-read re-sequencing (Illumina® Solexa) defined the point mutations, insertions, deletions and copy-number variations arising in the lineage. Eight point mutations arise within the mutant lineage, only one of which appears on chromosome 2. This missense mutation arises contemporaneously with artemisinin resistance and maps to a gene encoding a de-ubiquitinating enzyme. Conclusions This integrated approach facilitates the rapid identification of mutations conferring selectable phenotypes, without prior knowledge of biological and molecular mechanisms. For malaria, this model can identify candidate genes before resistant parasites are commonly observed in natural human malaria populations. PMID:20846421

  17. Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

    USDA-ARS?s Scientific Manuscript database

    The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

  18. TCF21 hypermethylation in genetically quiescent clear cell sarcoma of the kidney | Office of Cancer Genomics

    Cancer.gov

    Clear Cell Sarcoma of the Kidney (CCSK) is a rare childhood tumor whose molecular pathogenesis remains poorly understood. We analyzed a discovery set of 13 CCSKs for changes in chromosome copy number, mutations, rearrangements, global gene expression and global DNA methylation. No recurrent segmental chromosomal copy number changes or somatic variants (single nucleotide or small insertion/deletion) were identified.

  19. The loss-of-allele assay for ES cell screening and mouse genotyping.

    PubMed

    Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

    2010-01-01

    Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  20. Investigation of tumor suppressor genes apart from VHL on 3p by deletion mapping in sporadic clear cell renal cell carcinoma (cRCC).

    PubMed

    Singh, Rashmi Bhat; Amare Kadam, Pratibha S

    2013-10-01

    To investigate the most recurrent deletion loci on 3p12-p26 by deletion mapping studies by PCR-LOH and BAC array-FISH in sporadic conventional renal cell carcinoma (cRCC) and further, to evaluate the their clinicopathologic significance in cRCC. Comparative allelotyping studies in cRCC and major epithelial carcinomas (MEC) such as lung, breast, and bladder tumors were also carried out to investigate the specificity of the targeted loci in cRCC. A total of 40 c-RCC patients were enrolled in this study, categorized in to 2 groups: group I comprises of patients of stages I and II and group II includes patients at stages III and IV. Loss of heterozygosity (LOH) studies were performed by PCR using 15 microsatellite markers of region 3p12-p26 on paired normal-tumor tissues. The recurrent LOH loci found in 27 cRCC tumors were further validated by BAC array-FISH using 23 serially mapped BAC clones. Simultaneously, the allelic deletion status of fragile histidine triad (FHIT) gene was studied by FISH in cRCC and major epithelial carcinoma (MEC) tumors. The numerical aberrations of chromosome 3 were also studied using the centromere enumeration probe (CEP) probe for chromosome 3 to validate the observed allelic losses by BAC array-FISH in cRCC as well as MECs. Our study revealed 3 affected regions of LOH on 3p in cRCC: 3p12.2-p14.1, 3p14.2-p21.1, and 3p24.2-p26.1 in both group I (stages I and II) and group II (stage III and IV). Comparative allelotyping studies revealed that except for LOH loci D3S2406 (20%), D3S1766 (14%), and D3S1560 (20%), remaining affected loci revealed retention of heterozygosity (ROH) in breast carcinomas. Lung and bladder tumors revealed ROH at all affected LOH loci. FISH with FHIT gene probe revealed deletions in cRCC (88%), breast (30%), and lung tumors (10%). FHIT gene deletions frequency was almost equal in both groups I and II (>70%), whereas a locus 3p13 (D3S2454) revealed the highest LOH in group II (83%) patients in comparison to group I (16%). BAC array-FISH studies in cRCC identified 15 recurrent deletion loci at crucial regions, 3p12.2, 3p14.2, 3p21.3, and 3p24.2-p26 with long continuous deletion of 3p14.1-p26.1 exclusively in patients of stages III and IV. Validation of LOH loci in breast carcinomas by BAC array-FISH with BAC clones mapped at these loci revealed comparatively lower deletion frequency for RP11-59E22 (3p12.2) (30%), RP11-759B7(3p21.1) (12%), and RP11-57D6 (3p25.2, proximal to VHL) (15%) than cRCC. Molecular cytogenetic studies by BAC array-FISH was found to be more sensitive over LOH. Deletion patterns on 3p explored that deletion of FHIT and flanking loci may occur as an initiating event followed by deletions at 3p12.2, 3p21.31-3p21.32, and 3p24.2-3p26.1 in the initial stage of development of disease, while continuous large deletions of 3p21.3-3p26.1 and 3p14.1-3p26.1 occur as progressive deletion due to genetic instability. Lack of VHL along with flanking loci in 50% cRCC patients that included both groups I and II supported the hypothesis of both VHL dependent and VHL independent pathways in cRCC tumorigenesis. Comparative allelotyping studies in cRCC and MECs indicated association of specific targeted loci including VHL in cRCC. Further expansion of these studies with characterization of the genes at targeted loci and correlation with clinical outcome will explore the prognostic significance and also provide an insight into the mechanisms of tumor suppressive pathways in genitourinary cancers such as CRCC. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Short and long-term genome stability analysis of prokaryotic genomes.

    PubMed

    Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

    2013-05-08

    Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were able to explore genome organization stability at different time-scales and to find significant differences for pathogen and non-pathogen species. The output of our framework also allows to identify the conserved gene clusters and/or partial occurrences thereof, making possible to explore how gene clusters assembled during evolution.

  2. Genetic polymorphisms of the renin-angiotensin system and obesity-related metabolic changes in response to low-energy diets in obese women.

    PubMed

    Hamada, Taku; Kotani, Kazuhiko; Nagai, Narumi; Tsuzaki, Kokoro; Sano, Yoshiko; Matsuoka, Yukiyo; Fujibayashi, Mami; Kiyohara, Natsuki; Tanaka, Seitaro; Yoshimura, Makiko; Egawa, Kahori; Kitagawa, Yoshinori; Kiso, Yoshinobu; Moritani, Toshio; Sakane, Naoki

    2011-01-01

    Genetic polymorphisms of the renin-angiotensin system have been implicated in cardiovascular and metabolic diseases. The purpose of this study was to investigate whether the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene and 3123C/A polymorphism of the angiotensin II type 2 receptor (AT(2)R) gene affect blood pressure and other obesity-related metabolic changes in response to low-energy diets using meal replacement shakes for weight loss. Clinical, metabolic, and biochemical profiles were measured before and after a 2-mo intervention in 32 obese women (age 49.9 ± 8.4 [SD] y; BMI 28.4 ± 3.3 kg/m²) restricted to 1200 kcal/d (5021 kJ/d). The polymorphisms were determined with an intercalater-mediated FRET probe assay system. Although weight loss and nutrient intake levels did not differ among the genotypes, the reduction in body fat after weight loss was significantly less in the ACE deletion/deletion (D/D) genotype than insertion/insertion (I/I) plus I/D genotype (-2.25 ± 1.40% versus -0.80 ± 1.57%, P < 0.05). The AT₂R A/A group had significantly less improved levels of systolic blood pressure (-7.23 ± 8.50 versus 2.50 ± 12.6 mmHg, P < 0.05), low-density lipoprotein-cholesterol (-0.36 ± 0.29 versus -0.09 ± 0.25 mmol/L, P < 0.05), carbohydrate (-54.4 ± 27.2 versus -31.8 ± 16.3 mg/min, P < 0.05) and fat oxidation (8.31 ± 11.86 versus 0.05 ± 9.99 mg/min, P < 0.05) than the C/C plus C/A genotypes. The present findings suggest that the homozygous form of the ACE gene may hinder the improvement of body fat and that the homozygous form of the AT₂R gene may make improving systolic blood pressure and some obesity-related metabolic parameters through a dietary intervention difficult among obese women. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Angiotensin-converting enzyme genetic polymorphism: its impact on cardiac remodeling

    PubMed Central

    de Albuquerque, Felipe Neves; Brandão, Andréa Araujo; da Silva, Dayse Aparecida; Mourilhe-Rocha, Ricardo; Duque, Gustavo Salgado; Gondar, Alyne Freitas Pereira; Neves, Luiza Maceira de Almeida; Bittencourt, Marcelo Imbroinise; Pozzan, Roberto; de Albuquerque, Denilson Campos

    2014-01-01

    Background The role of angiotensin-converting enzyme genetic polymorphisms as a predictor of echocardiographic outcomes on heart failure is yet to be established. The local profile should be identified so that the impact of those genotypes on the Brazilian population could be identified. This is the first study on exclusively non-ischemic heart failure over a follow-up longer than 5 years. Objective To determine the distribution of angiotensin-converting enzyme genetic polymorphism variants and their relation with echocardiographic outcome of patients with non-ischemic heart failure. Methods Secondary analysis of the medical records of 111 patients and identification of the angiotensin-converting enzyme genetic polymorphism variants, classified as DD (Deletion/Deletion), DI (Deletion/Insertion) or II (Insertion/Insertion). Results The cohort means were as follows: follow-up, 64.9 months; age, 59.5 years; male sex, 60.4%; white skin color, 51.4%; use of beta-blockers, 98.2%; and use of angiotensin-converting-enzyme inhibitors or angiotensin receptor blocker, 89.2%. The angiotensin-converting enzyme genetic polymorphism distribution was as follows: DD, 51.4%; DI, 44.1%; and II, 4.5%. No difference regarding the clinical characteristics or treatment was observed between the groups. The final left ventricular systolic diameter was the only isolated echocardiographic variable that significantly differed between the angiotensin-converting enzyme genetic polymorphisms: 59.2 ± 1.8 for DD versus 52.3 ± 1.9 for DI versus 59.2 ± 5.2 for II (p = 0.029). Considering the evolutionary behavior, all echocardiographic variables (difference between the left ventricular ejection fraction at the last and first consultation; difference between the left ventricular systolic diameter at the last and first consultation; and difference between the left ventricular diastolic diameter at the last and first consultation) differed between the genotypes (p = 0.024; p = 0.002; and p = 0.021, respectively). Conclusion The distribution of the angiotensin-converting enzyme genetic polymorphisms differed from that of other studies with a very small number of II. The DD genotype was independently associated with worse echocardiographic outcome, while the DI genotype, with the best echocardiographic profile (increased left ventricular ejection fraction and decreased left ventricular diameters). PMID:24270863

  4. Angiotensin-converting enzyme genetic polymorphism: its impact on cardiac remodeling.

    PubMed

    Albuquerque, Felipe Neves de; Brandão, Andréa Araujo; Silva, Dayse Aparecida da; Mourilhe-Rocha, Ricardo; Duque, Gustavo Salgado; Gondar, Alyne Freitas Pereira; Neves, Luiza Maceira de Almeida; Bittencourt, Marcelo Imbroinise; Pozzan, Roberto; Albuquerque, Denilson Campos de

    2014-01-01

    The role of angiotensin-converting enzyme genetic polymorphisms as a predictor of echocardiographic outcomes on heart failure is yet to be established. The local profile should be identified so that the impact of those genotypes on the Brazilian population could be identified. This is the first study on exclusively non-ischemic heart failure over a follow-up longer than 5 years. To determine the distribution of angiotensin-converting enzyme genetic polymorphism variants and their relation with echocardiographic outcome of patients with non-ischemic heart failure. Secondary analysis of the medical records of 111 patients and identification of the angiotensin-converting enzyme genetic polymorphism variants, classified as DD (Deletion/Deletion), DI (Deletion/Insertion) or II (Insertion/Insertion). The cohort means were as follows: follow-up, 64.9 months; age, 59.5 years; male sex, 60.4%; white skin color, 51.4%; use of beta-blockers, 98.2%; and use of angiotensin-converting-enzyme inhibitors or angiotensin receptor blocker, 89.2%. The angiotensin-converting enzyme genetic polymorphism distribution was as follows: DD, 51.4%; DI, 44.1%; and II, 4.5%. No difference regarding the clinical characteristics or treatment was observed between the groups. The final left ventricular systolic diameter was the only isolated echocardiographic variable that significantly differed between the angiotensin-converting enzyme genetic polymorphisms: 59.2 ± 1.8 for DD versus 52.3 ± 1.9 for DI versus 59.2 ± 5.2 for II (p = 0.029). Considering the evolutionary behavior, all echocardiographic variables (difference between the left ventricular ejection fraction at the last and first consultation; difference between the left ventricular systolic diameter at the last and first consultation; and difference between the left ventricular diastolic diameter at the last and first consultation) differed between the genotypes (p = 0.024; p = 0.002; and p = 0.021, respectively). The distribution of the angiotensin-converting enzyme genetic polymorphisms differed from that of other studies with a very small number of II. The DD genotype was independently associated with worse echocardiographic outcome, while the DI genotype, with the best echocardiographic profile (increased left ventricular ejection fraction and decreased left ventricular diameters).

  5. 76 FR 13994 - Privacy Act of 1974; System of Records

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-15

    ... received which result in a contrary determination. ADDRESSES: You may submit comments, identified by dock... of Defense. Deletion: K700.03 Manpower and Personnel System (MAPS) (February 22, 1993, 58 FR 10562). Reason: Manpower and Personnel System (MAPS) has been replaced with Open Source Corporate Management...

  6. Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population.

    PubMed

    Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki

    2004-12-01

    Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.

  7. SU-E-T-396: Dosimetric Accuracy of Proton Therapy for Patients with Metal Implants in CT Scans Using Metal Deletion Technique (MDT) Artifacts Reduction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, X; Kantor, M; Zhu, X

    2014-06-01

    Purpose: To evaluate the dosimetric accuracy for proton therapy patients with metal implants in CT using metal deletion technique (MDT) artifacts reduction. Methods: Proton dose accuracies under CT metal artifacts were first evaluated using a water phantom with cylindrical inserts of different materials (titanium and steel). Ranges and dose profiles along different beam angles were calculated using treatment planning system (Eclipse version 8.9) on uncorrected CT, MDT CT, and manually-corrected CT, where true Hounsfield units (water) were assigned to the streak artifacts. In patient studies, the treatment plans were developed on manually-corrected CTs, then recalculated on MDT and uncorrected CTs.more » DVH indices were compared between the dose distributions on all the CTs. Results: For water phantom study with 1/2 inch titanium insert, the proton range differences estimated by MDT CT were with 1% for all beam angles, while the range error can be up to 2.6% for uncorrected CT. For the study with 1 inch stainless steel insert, the maximum range error calculated by MDT CT was 1.09% among all the beam angles compared with maximum range error with 4.7% for uncorrected CT. The dose profiles calculated on MDT CTs for both titanium and steel inserts showed very good agreements with the ones calculated on manually-corrected CTs, while large dose discrepancies calculated using uncorrected CTs were observed in the distal end region of the proton beam. The patient study showed similar dose distribution and DVHs for organs near the metal artifacts recalculated on MDT CT compared with the ones calculated on manually-corrected CT, while the differences between uncorrected and corrected CTs were much pronounced. Conclusion: In proton therapy, large dose error could occur due to metal artifact. The MDT CT can be used for proton dose calculation to achieve similar dose accuracy as the current clinical practice using manual correction.« less

  8. Haploinsufficiency of HDAC4 Causes Brachydactyly Mental Retardation Syndrome, with Brachydactyly Type E, Developmental Delays, and Behavioral Problems

    PubMed Central

    Williams, Stephen R.; Aldred, Micheala A.; Der Kaloustian, Vazken M.; Halal, Fahed; Gowans, Gordon; McLeod, D. Ross; Zondag, Sara; Toriello, Helga V.; Magenis, R. Ellen; Elsea, Sarah H.

    2010-01-01

    Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4−/− mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome. PMID:20691407

  9. Haploinsufficiency of HDAC4 causes brachydactyly mental retardation syndrome, with brachydactyly type E, developmental delays, and behavioral problems.

    PubMed

    Williams, Stephen R; Aldred, Micheala A; Der Kaloustian, Vazken M; Halal, Fahed; Gowans, Gordon; McLeod, D Ross; Zondag, Sara; Toriello, Helga V; Magenis, R Ellen; Elsea, Sarah H

    2010-08-13

    Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4(-/-) mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome.

  10. AutoMap User’s Guide

    DTIC Science & Technology

    2006-10-01

    Hierarchy of Pre-Processing Techniques 3. NLP (Natural Language Processing) Utilities 3.1 Named-Entity Recognition 3.1.1 Example for Named-Entity... Recognition 3.2 Symbol RemovalN-Gram Identification: Bi-Grams 4. Stemming 4.1 Stemming Example 5. Delete List 5.1 Open a Delete List 5.1.1 Small...iterative and involves several key processes: • Named-Entity Recognition Named-Entity Recognition is an Automap feature that allows you to

  11. Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

    PubMed Central

    Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

    1989-01-01

    We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

  12. Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

    PubMed

    Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

    2000-12-15

    Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

  13. Genome sequencing of bacteria: sequencing, de novo assembly and rapid analysis using open source tools.

    PubMed

    Kisand, Veljo; Lettieri, Teresa

    2013-04-01

    De novo genome sequencing of previously uncharacterized microorganisms has the potential to open up new frontiers in microbial genomics by providing insight into both functional capabilities and biodiversity. Until recently, Roche 454 pyrosequencing was the NGS method of choice for de novo assembly because it generates hundreds of thousands of long reads (<450 bps), which are presumed to aid in the analysis of uncharacterized genomes. The array of tools for processing NGS data are increasingly free and open source and are often adopted for both their high quality and role in promoting academic freedom. The error rate of pyrosequencing the Alcanivorax borkumensis genome was such that thousands of insertions and deletions were artificially introduced into the finished genome. Despite a high coverage (~30 fold), it did not allow the reference genome to be fully mapped. Reads from regions with errors had low quality, low coverage, or were missing. The main defect of the reference mapping was the introduction of artificial indels into contigs through lower than 100% consensus and distracting gene calling due to artificial stop codons. No assembler was able to perform de novo assembly comparable to reference mapping. Automated annotation tools performed similarly on reference mapped and de novo draft genomes, and annotated most CDSs in the de novo assembled draft genomes. Free and open source software (FOSS) tools for assembly and annotation of NGS data are being developed rapidly to provide accurate results with less computational effort. Usability is not high priority and these tools currently do not allow the data to be processed without manual intervention. Despite this, genome assemblers now readily assemble medium short reads into long contigs (>97-98% genome coverage). A notable gap in pyrosequencing technology is the quality of base pair calling and conflicting base pairs between single reads at the same nucleotide position. Regardless, using draft whole genomes that are not finished and remain fragmented into tens of contigs allows one to characterize unknown bacteria with modest effort.

  14. A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

    PubMed

    White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

    2018-03-28

    A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

  15. Deletion analysis of male sterility effects of t-haplotypes in the mouse.

    PubMed

    Bennett, D; Artzt, K

    1990-01-01

    We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.

  16. ECK, a human EPH-related gene, maps to 1p36.1, a common region of alteration in human cancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sulman, E.P.; Brodeur, G.M.; Ikegaki, N.

    1997-03-01

    Mouse eck, a member of the EPH gene family, has been mapped to mouse chromosome 4. The syntenic relationship between this chromosome and human chromosome 1 suggests that the human ECK gene maps to the distal short arm of human chromosome 1 (1p). Since this region is frequently deleted or altered in certain tumors of neuroectodermal origin, it is important to define the specific chromosomal localization of the human ECK gene. PCR screening of a rodent-human somatic cell hybrid panel by ECK-specific primers showed that ECK is indeed localized to human chromosome 1. Additional PCR screening of a regional screeningmore » panel for chromosome 1p indicated that ECK is localized to 1p36, distal to FUCA1. Furthermore, fluorescence in situ hybridization analysis with an ECK-specific P1 clone showed that ECK maps proximal to genetic marker D1S228. Taken together, the data suggest that ECK maps to 1p36.1, a region that is frequently deleted in neuroblastoma, melanoma, and other neuroectodermal tumors. 23 refs., 3 figs.« less

  17. Amino Acid Insertion Frequencies Arising from Photoproducts Generated Using Aliphatic Diazirines

    NASA Astrophysics Data System (ADS)

    Ziemianowicz, Daniel S.; Bomgarden, Ryan; Etienne, Chris; Schriemer, David C.

    2017-10-01

    Mapping proteins with chemical reagents and mass spectrometry can generate a measure of accessible surface area, which in turn can be used to support the modeling and refinement of protein structures. Photolytically generated carbenes are a promising class of reagent for this purpose. Substituent effects appear to influence surface mapping properties, allowing for a useful measure of design control. However, to use carbene labeling data in a quantitative manner for modeling activities, we require a better understanding of their inherent amino acid reactivity, so that incorporation data can be normalized. The current study presents an analysis of the amino acid insertion frequency of aliphatic carbenes generated by the photolysis of three different diazirines: 3,3'-azibutyl-1-ammonium, 3,3'-azibutan-1-ol, and 4,4'-azipentan-1-oate. Leveraging an improved photolysis system for single-shot labeling of sub-microliter frozen samples, we used EThCD to localize insertion products in a large population of labeled peptides. Counting statistics were drawn from data-dependent LC-MS2 experiments and used to estimate the frequencies of insertion as a function of amino acid. We observed labeling of all 20 amino acids over a remarkably narrow range of insertion frequencies. However, the nature of the substituent could influence relative insertion frequencies, within a general preference for larger polar amino acids. We confirm a large (6-fold) increase in labeling yield when carbenes were photogenerated in the solid phase (77 K) relative to the liquid phase (293 K), and we suggest that carbene labeling should always be conducted in the frozen state to avoid information loss in surface mapping experiments. [Figure not available: see fulltext.

  18. Biasing genome-editing events toward precise length deletions with an RNA-guided TevCas9 dual nuclease.

    PubMed

    Wolfs, Jason M; Hamilton, Thomas A; Lant, Jeremy T; Laforet, Marcon; Zhang, Jenny; Salemi, Louisa M; Gloor, Gregory B; Schild-Poulter, Caroline; Edgell, David R

    2016-12-27

    The CRISPR/Cas9 nuclease is commonly used to make gene knockouts. The blunt DNA ends generated by cleavage can be efficiently ligated by the classical nonhomologous end-joining repair pathway (c-NHEJ), regenerating the target site. This repair creates a cycle of cleavage, ligation, and target site regeneration that persists until sufficient modification of the DNA break by alternative NHEJ prevents further Cas9 cutting, generating a heterogeneous population of insertions and deletions typical of gene knockouts. Here, we develop a strategy to escape this cycle and bias events toward defined length deletions by creating an RNA-guided dual active site nuclease that generates two noncompatible DNA breaks at a target site, effectively deleting the majority of the target site such that it cannot be regenerated. The TevCas9 nuclease, a fusion of the I-TevI nuclease domain to Cas9, functions robustly in HEK293 cells and generates 33- to 36-bp deletions at frequencies up to 40%. Deep sequencing revealed minimal processing of TevCas9 products, consistent with protection of the DNA ends from exonucleolytic degradation and repair by the c-NHEJ pathway. Directed evolution experiments identified I-TevI variants with broadened targeting range, making TevCas9 an easy-to-use reagent. Our results highlight how the sequence-tolerant cleavage properties of the I-TevI homing endonuclease can be harnessed to enhance Cas9 applications, circumventing the cleavage and ligation cycle and biasing genome-editing events toward defined length deletions.

  19. Construction of a BAC library and mapping BAC clones to the linkage map of Barramundi, Lates calcarifer.

    PubMed

    Wang, Chun Ming; Lo, Loong Chueng; Feng, Felicia; Gong, Ping; Li, Jian; Zhu, Ze Yuan; Lin, Grace; Yue, Gen Hua

    2008-03-25

    Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map. This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group. We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.

  20. Minimap2: pairwise alignment for nucleotide sequences.

    PubMed

    Li, Heng

    2018-05-10

    Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.

  1. A Phylogenetic Analysis of 34 Chloroplast Genomes Elucidates the Relationships between Wild and Domestic Species within the Genus Citrus

    PubMed Central

    Carbonell-Caballero, Jose; Alonso, Roberto; Ibañez, Victoria; Terol, Javier; Talon, Manuel; Dopazo, Joaquin

    2015-01-01

    Citrus genus includes some of the most important cultivated fruit trees worldwide. Despite being extensively studied because of its commercial relevance, the origin of cultivated citrus species and the history of its domestication still remain an open question. Here, we present a phylogenetic analysis of the chloroplast genomes of 34 citrus genotypes which constitutes the most comprehensive and detailed study to date on the evolution and variability of the genus Citrus. A statistical model was used to estimate divergence times between the major citrus groups. Additionally, a complete map of the variability across the genome of different citrus species was produced, including single nucleotide variants, heteroplasmic positions, indels (insertions and deletions), and large structural variants. The distribution of all these variants provided further independent support to the phylogeny obtained. An unexpected finding was the high level of heteroplasmy found in several of the analyzed genomes. The use of the complete chloroplast DNA not only paves the way for a better understanding of the phylogenetic relationships within the Citrus genus but also provides original insights into other elusive evolutionary processes, such as chloroplast inheritance, heteroplasmy, and gene selection. PMID:25873589

  2. Initial sequence and comparative analysis of the cat genome

    PubMed Central

    Pontius, Joan U.; Mullikin, James C.; Smith, Douglas R.; Lindblad-Toh, Kerstin; Gnerre, Sante; Clamp, Michele; Chang, Jean; Stephens, Robert; Neelam, Beena; Volfovsky, Natalia; Schäffer, Alejandro A.; Agarwala, Richa; Narfström, Kristina; Murphy, William J.; Giger, Urs; Roca, Alfred L.; Antunes, Agostinho; Menotti-Raymond, Marilyn; Yuhki, Naoya; Pecon-Slattery, Jill; Johnson, Warren E.; Bourque, Guillaume; Tesler, Glenn; O’Brien, Stephen J.

    2007-01-01

    The genome sequence (1.9-fold coverage) of an inbred Abyssinian domestic cat was assembled, mapped, and annotated with a comparative approach that involved cross-reference to annotated genome assemblies of six mammals (human, chimpanzee, mouse, rat, dog, and cow). The results resolved chromosomal positions for 663,480 contigs, 20,285 putative feline gene orthologs, and 133,499 conserved sequence blocks (CSBs). Additional annotated features include repetitive elements, endogenous retroviral sequences, nuclear mitochondrial (numt) sequences, micro-RNAs, and evolutionary breakpoints that suggest historic balancing of translocation and inversion incidences in distinct mammalian lineages. Large numbers of single nucleotide polymorphisms (SNPs), deletion insertion polymorphisms (DIPs), and short tandem repeats (STRs), suitable for linkage or association studies were characterized in the context of long stretches of chromosome homozygosity. In spite of the light coverage capturing ∼65% of euchromatin sequence from the cat genome, these comparative insights shed new light on the tempo and mode of gene/genome evolution in mammals, promise several research applications for the cat, and also illustrate that a comparative approach using more deeply covered mammals provides an informative, preliminary annotation of a light (1.9-fold) coverage mammal genome sequence. PMID:17975172

  3. Comparison of the genomic sequence of the microminipig, a novel breed of swine, with the genomic database for conventional pig.

    PubMed

    Miura, Naoki; Kucho, Ken-Ichi; Noguchi, Michiko; Miyoshi, Noriaki; Uchiumi, Toshiki; Kawaguchi, Hiroaki; Tanimoto, Akihide

    2014-01-01

    The microminipig, which weighs less than 10 kg at an early stage of maturity, has been reported as a potential experimental model animal. Its extremely small size and other distinct characteristics suggest the possibility of a number of differences between the genome of the microminipig and that of conventional pigs. In this study, we analyzed the genomes of two healthy microminipigs using a next-generation sequencer SOLiD™ system. We then compared the obtained genomic sequences with a genomic database for the domestic pig (Sus scrofa). The mapping coverage of sequenced tag from the microminipig to conventional pig genomic sequences was greater than 96% and we detected no clear, substantial genomic variance from these data. The results may indicate that the distinct characteristics of the microminipig derive from small-scale alterations in the genome, such as Single Nucleotide Polymorphisms or translational modifications, rather than large-scale deletion or insertion polymorphisms. Further investigation of the entire genomic sequence of the microminipig with methods enabling deeper coverage is required to elucidate the genetic basis of its distinct phenotypic traits. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model–based analyses of transposon-insertion sequencing data

    PubMed Central

    Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.

    2013-01-01

    The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011

  5. Genomic diversity and adaptation of Salmonella enterica serovar Typhimurium from analysis of six genomes of different phage types

    PubMed Central

    2013-01-01

    Background Salmonella enterica serovar Typhimurium (or simply Typhimurium) is the most common serovar in both human infections and farm animals in Australia and many other countries. Typhimurium is a broad host range serovar but has also evolved into host-adapted variants (i.e. isolated from a particular host such as pigeons). Six Typhimurium strains of different phage types (defined by patterns of susceptibility to lysis by a set of bacteriophages) were analysed using Illumina high-throughput genome sequencing. Results Variations between strains were mainly due to single nucleotide polymorphisms (SNPs) with an average of 611 SNPs per strain, ranging from 391 SNPs to 922 SNPs. There were seven insertions/deletions (indels) involving whole or partial gene deletions, four inactivation events due to IS200 insertion and 15 pseudogenes due to early termination. Four of these inactivated or deleted genes may be virulence related. Nine prophage or prophage remnants were identified in the six strains. Gifsy-1, Gifsy-2 and the sopE2 and sspH2 phage remnants were present in all six genomes while Fels-1, Fels-2, ST64B, ST104 and CP4-57 were variably present. Four strains carried the 90-kb plasmid pSLT which contains several known virulence genes. However, two strains were found to lack the plasmid. In addition, one strain had a novel plasmid similar to Typhi strain CT18 plasmid pHCM2. Conclusion The genome data suggest that variations between strains were mainly due to accumulation of SNPs, some of which resulted in gene inactivation. Unique genetic elements that were common between host-adapted phage types were not found. This study advanced our understanding on the evolution and adaptation of Typhimurium at genomic level. PMID:24138507

  6. A novel pathogenic mutation of the CYP27B1 gene in a patient with vitamin D-dependent rickets type 1: a case report.

    PubMed

    Babiker, Amir M I; Al Gadi, Iman; Al-Jurayyan, Nasir A M; Al Nemri, Abdulrahman M H; Al Haboob, Ali Abdu N; Al Boukai, Ahmed Amer; Al Zahrani, Ali; Habib, Hanan Ahmed

    2014-11-05

    Rickets can occur due to Vitamin D deficiency or defects in its metabolism. Three rare genetic types of rickets with different alterations of genes have been reported, including: Vitamin D dependent rickets type 1, Vitamin D dependent rickets type 2 or also known as Vitamin D resistant rickets and 25 hydroxylase deficiency rickets. Vitamin D dependent rickets type 1 is inherited in an autosomal recessive pattern, and is caused by mutations in the CYP27B1 gene encoding the 1α-hydroxylase enzyme. We report here a new mutation in CYP27B1, which lead to Vitamin D dependent rickets type 1. We report on a 13-month-old Arabic Saudi girl with Vitamin D dependent rickets type 1 presented with multiple fractures and classic features of rickets. A whole exome sequencing identified a novel pathogenic missense mutation (CYP27B1:Homozygous c.1510C > T(p.Q504X)) which results in a protein truncating alteration. Both parents are heterozygous carriers of the mutation. Based on data search in Human Gene Mutation Database, 63 CYP27B1 alterations were reported: only 28.6% are protein truncating (5 nonsense, 13 frameshift insertions/deletions, 0 gross deletions), while 61.9% are non-truncating (38 missense, 1 small in-frame insertions/deletion), and 9.5% are possible protein-truncating (5 splice, 1 regulatory). The deleterious effect of this alteration, which was the only mutation detected in the CYP27B1 common gene of Vitamin D dependent rickets type 1 in the proband, and its autosomal recessive inheritance fashion, both support a pathogenic nature of this mutation as the cause of Vitamin D dependent rickets type 1.

  7. Nature and Recurrence of AVPR2 Mutations in X-linked Nephrogenic Diabetes Insipidus

    PubMed Central

    Bichet, Daniel G.; Birnbaumer, Mariel; Lonergan, Michèle; Arthus, Marie-Françoise; Rosenthal, Walter; Goodyer, Paul; Nivet, Hubert; Benoit, Stéphane; Giampietro, Philip; Simonetti, Simonetta; Fish, Alfred; Whitley, Chester B.; Jaeger, Philippe; Gertner, Joseph; New, Maria; DiBona, Francis J.; Kaplan, Bernard S.; Robertson, Gary L.; Hendy, Geoffrey N.; Fujiwara, T. Mary; Morgan, Kenneth

    1994-01-01

    X-linked nephrogenic diabetes insipidus (NDI) is a rare disease with defective renal and extrarenal arginine-vasopressin V2 receptor responses due to mutations in the AVPR2 gene in Xq28. We analyzed 31 independent NDI families to determine the nature and recurrence of AVPR2 mutations. Twenty-one new putative disease-causing mutations were identified: 113delCT, 253del35, 255del9, 274insG, V88M, R106C, 402delCT, C112R, Y124X, S126F, W164S, S167L, 684delTA, 804insG, W284X, A285P, W293X, R337X, and three large deletions or gene rearrangements. Five other mutations—R113W, Y128S, R137H, R181C, and R202C—that previously had been reported in other families were detected. There was evidence for recurrent mutation for four mutations (R113W, R137H, S167L, and R337X). Eight de novo mutation events were detected (274insG, R106C, Y128S, 167L [twice], R202C, 684delTA, and R337X). The origins were maternal (one), grandmaternal (one), and grandpaternal (six). In the 31 NDI families and 6 families previously reported by us, there is evidence both for mutation hot spots for nucleotide substitutions and for small deletions and insertions. More than half (58%) of the nucleotide substitutions in 26 families could be a consequence of 5-methylcytosine deamination at a CpG dinucleotide. Most of the small deletions and insertions could be attributed to slipped mispairing during DNA replication. PMID:8037205

  8. Genetic differentiation and forensic efficiency evaluation for Chinese Salar ethnic minority based on a 5-dye multiplex insertion and deletion panel.

    PubMed

    Ma, Ruilin; Shen, Chunmei; Wei, Yuanyuan; Jin, Xiaoye; Guo, Yuxin; Mu, Yuling; Sun, Siqi; Chen, Chong; Cui, Wei; Wei, Zhaoming; Lian, Zhenmin

    2018-06-20

    The present study investigated the genetic diversities of 30 autosomal insertion and deletion (InDel) loci of Investigator DIPplex kit (Qiagen) in Chinese Salar ethnic minority and explored the genetic relationships between the studied Salar group and other populations. The allelic frequencies of deletion alleles at the 30 InDel loci were in the range of 0.1739 (HLD64) to 0.8478 (HLD39). The discrimination power, polymorphism information content and probability of exclusion ranged from 0.4101 (HLD39) to 0.6447 (HLD136), 0.2247 (HLD39) to 0.3750 (HLD92) and 0.0400 (HLD39) to 0.2806 (HLD92), respectively. The observed and expected heterozygosity were in the range of 0.2348 (HLD39) to 0.5913 (HLD92), and 0.2580 (HLD39) to 0.5000 (HLD92), respectively. The cumulative discrimination power and probability of exclusion of the 30 loci reached 0.999999999993418 and 0.99039, respectively. The results of population genetic differentiation comparisons revealed that Salar group had similar allele distributions with Qinghai Tibetan, Xibe and Yi groups. Population Bayesian cluster analysis showed that there were similar ancestry components between Salar group and most Chinese populations. Besides, the principal components analysis and phylogenetic reconstructions further indicated that Salar group had intimate genetic relationships with Qinghai Tibetan and Xibe groups. In short, the results of the current studies indicated the genetic distributions of the 30 InDel loci in Salar group were relatively high genetic polymorphisms, which could be used in forensic individual identifications and as a supplementary tool for complex paternity testing. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Development of an Expressed Sequence Tag (EST) Resource for Wheat (Triticum aestivum L.)

    PubMed Central

    Lazo, G. R.; Chao, S.; Hummel, D. D.; Edwards, H.; Crossman, C. C.; Lui, N.; Matthews, D. E.; Carollo, V. L.; Hane, D. L.; You, F. M.; Butler, G. E.; Miller, R. E.; Close, T. J.; Peng, J. H.; Lapitan, N. L. V.; Gustafson, J. P.; Qi, L. L.; Echalier, B.; Gill, B. S.; Dilbirligi, M.; Randhawa, H. S.; Gill, K. S.; Greene, R. A.; Sorrells, M. E.; Akhunov, E. D.; Dvořák, J.; Linkiewicz, A. M.; Dubcovsky, J.; Hossain, K. G.; Kalavacharla, V.; Kianian, S. F.; Mahmoud, A. A.; Miftahudin; Ma, X.-F.; Conley, E. J.; Anderson, J. A.; Pathan, M. S.; Nguyen, H. T.; McGuire, P. E.; Qualset, C. O.; Anderson, O. D.

    2004-01-01

    This report describes the rationale, approaches, organization, and resource development leading to a large-scale deletion bin map of the hexaploid (2n = 6x = 42) wheat genome (Triticum aestivum L.). Accompanying reports in this issue detail results from chromosome bin-mapping of expressed sequence tags (ESTs) representing genes onto the seven homoeologous chromosome groups and a global analysis of the entire mapped wheat EST data set. Among the resources developed were the first extensive public wheat EST collection (113,220 ESTs). Described are protocols for sequencing, sequence processing, EST nomenclature, and the assembly of ESTs into contigs. These contigs plus singletons (unassembled ESTs) were used for selection of distinct sequence motif unigenes. Selected ESTs were rearrayed, validated by 5′ and 3′ sequencing, and amplified for probing a series of wheat aneuploid and deletion stocks. Images and data for all Southern hybridizations were deposited in databases and were used by the coordinators for each of the seven homoeologous chromosome groups to validate the mapping results. Results from this project have established the foundation for future developments in wheat genomics. PMID:15514037

  10. Identification and Validation of PTEN Complex, Associated Proteins

    DTIC Science & Technology

    2006-11-01

    Signal Transduction 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC...a. REPORT U b. ABSTRACT U c. THIS PAGE U UU 18 19b. TELEPHONE NUMBER (include area code) Standard Form 298 (Rev. 8-98) Prescribed...nonsense, frame-shift, deletion or insertion mutations, (reviewed in [14]) are observed in prostate cancer, as well as in endometrial cancer, glioblastoma

  11. Image

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marsh, Amber; Harsch, Tim; Pitt, Julie

    2007-08-31

    The computer side of the IMAGE project consists of a collection of Perl scripts that perform a variety of tasks; scripts are available to insert, update and delete data from the underlying Oracle database, download data from NCBI's Genbank and other sources, and generate data files for download by interested parties. Web scripts make up the tracking interface, and various tools available on the project web-site (image.llnl.gov) that provide a search interface to the database.

  12. Detecting a hierarchical genetic population structure via Multi-InDel markers on the X chromosome

    PubMed Central

    Fan, Guang Yao; Ye, Yi; Hou, Yi Ping

    2016-01-01

    Detecting population structure and estimating individual biogeographical ancestry are very important in population genetics studies, biomedical research and forensics. Single-nucleotide polymorphism (SNP) has long been considered to be a primary ancestry-informative marker (AIM), but it is constrained by complex and time-consuming genotyping protocols. Following up on our previous study, we propose that a multi-insertion-deletion polymorphism (Multi-InDel) with multiple haplotypes can be useful in ancestry inference and hierarchical genetic population structures. A validation study for the X chromosome Multi-InDel marker (X-Multi-InDel) as a novel AIM was conducted. Genetic polymorphisms and genetic distances among three Chinese populations and 14 worldwide populations obtained from the 1000 Genomes database were analyzed. A Bayesian clustering method (STRUCTURE) was used to discern the continental origins of Europe, East Asia, and Africa. A minimal panel of ten X-Multi-InDels was verified to be sufficient to distinguish human ancestries from three major continental regions with nearly the same efficiency of the earlier panel with 21 insertion-deletion AIMs. Along with the development of more X-Multi-InDels, an approach using this novel marker has the potential for broad applicability as a cost-effective tool toward more accurate determinations of individual biogeographical ancestry and population stratification. PMID:27535707

  13. Evaluation of second-generation sequencing of 19 dilated cardiomyopathy genes for clinical applications.

    PubMed

    Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H

    2010-11-01

    Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.

  14. Whole genome analyses of marine fish pathogenic isolate, Mycobacterium sp. 012931.

    PubMed

    Kurokawa, Satoru; Kabayama, Jun; Hwang, Seong Don; Nho, Seong Won; Hikima, Jun-ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Mori, Tetsushi; Aoki, Takashi

    2014-10-01

    Mycobacterium is a genus within the order Actinomycetales that comprises of a large number of well-characterized species, several of which includes pathogens known to cause serious disease in human and animal. Here, we report the whole genome sequence of Mycobacterium sp. strain 012931 isolated from the marine fish, yellowtail (Seriola quinqueradiata). Mycobacterium sp. 012931 is a fish pathogen causing serious damage to aquaculture farms in Japan. DNA dot plot analysis showed that Mycobacterium sp. 012931 was more closely related to Mycobacterium marinum when compared across several Mycobacterium species. However, little conservation of the gene order was observed between Mycobacterium sp. 012931 and M. marinum genome. The annotated 5,464 genes of Mycobacterium sp. 012931 was classified into 26 subsystems. The insertion/deletion gene analysis shows Mycobacterium sp. 012931 had 643 unique genes that were not found in the M. marinum strains. In the virulence, disease, and defense subsystem, both insertion and deletion genes of Mycobacterium sp. 012931 were associated with the PPE gene cluster of Mycobacteria. Of seven plcB genes in Mycobacterium sp. 012931, plcB_2 and plcB_3 showed low identities with those of M. marinum strains. Therefore, Mycobacterium sp. 012931 has differences on genetic and virulence from M. marinum and may induce different interaction mechanisms between host and pathogen.

  15. Association between NFKB1 -94 insertion/deletion ATTG polymorphism and risk of intracranial aneurysm.

    PubMed

    Sima, Xiutian; Xu, Jianguo; Li, Jin; You, Chao

    2013-08-01

    Growing evidence indicates that vascular inflammation is a common phenomenon in the pathogenesis of intracranial aneurysms (IAs). Nuclear factor kappa B is a key molecule that is involved in the vascular inflammation of IA. We hypothesized that an insertion/deletion (ins/del) ATTG polymorphism located between two putative key promoter regulatory elements in the NFKB1 gene may be related to the risk of IA. We performed a case-control study, including 164 patients with IA and 525 healthy controls in a Chinese population using a polymerase chain reaction-polyacrylamide gel electrophoresis assay. A significantly decreased risk of IA was observed in the ATTG1/ATTG2 and ATTG2/ATTG2 genotypes compared with the ATTG1/ATTG1 genotype (ATTG1/ATTG2 vs. ATTG1/ATTG1: odds ratio [OR]=0.58, 95% confidence interval [95% CI]=0.39-0.87, p=0.007; ATTG2/ATTG2 vs. ATTG1/ATTG1: OR=0.12, 95% CI=0.06-0.23, p<0.001), and also the ATTG2 allele (ATTG2 vs. ATTG1: OR=0.41, 95% CI=0.32-0.54, p<0.001). These findings suggest that the NFKB1 -94ins/del ATTG polymorphism may contribute to the risk of IA.

  16. Short Communication: Analysis of Minor Populations of Human Immunodeficiency Virus by Primer Identification and Insertion-Deletion and Carry Forward Correction Pipelines.

    PubMed

    Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M

    2016-03-01

    Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.

  17. Removal of a putative inhibitory element reduces the calcium-dependent calmodulin activation of neuronal nitric-oxide synthase.

    PubMed

    Montgomery, H J; Romanov, V; Guillemette, J G

    2000-02-18

    Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.

  18. A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

    PubMed

    Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

    2011-10-01

    A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

  19. Self-synchronization for spread spectrum audio watermarks after time scale modification

    NASA Astrophysics Data System (ADS)

    Nadeau, Andrew; Sharma, Gaurav

    2014-02-01

    De-synchronizing operations such as insertion, deletion, and warping pose significant challenges for watermarking. Because these operations are not typical for classical communications, watermarking techniques such as spread spectrum can perform poorly. Conversely, specialized synchronization solutions can be challenging to analyze/ optimize. This paper addresses desynchronization for blind spread spectrum watermarks, detected without reference to any unmodified signal, using the robustness properties of short blocks. Synchronization relies on dynamic time warping to search over block alignments to find a sequence with maximum correlation to the watermark. This differs from synchronization schemes that must first locate invariant features of the original signal, or estimate and reverse desynchronization before detection. Without these extra synchronization steps, analysis for the proposed scheme builds on classical SS concepts and allows characterizes the relationship between the size of search space (number of detection alignment tests) and intrinsic robustness (continuous search space region covered by each individual detection test). The critical metrics that determine the search space, robustness, and performance are: time-frequency resolution of the watermarking transform, and blocklength resolution of the alignment. Simultaneous robustness to (a) MP3 compression, (b) insertion/deletion, and (c) time-scale modification is also demonstrated for a practical audio watermarking scheme developed in the proposed framework.

  20. Characterization of Lipooligosaccharide-Biosynthetic Loci of Campylobacter jejuni Reveals New Lipooligosaccharide Classes: Evidence of Mosaic Organizations▿ †

    PubMed Central

    Parker, Craig T.; Gilbert, Michel; Yuki, Nobuhiro; Endtz, Hubert P.; Mandrell, Robert E.

    2008-01-01

    The lipooligosaccharide (LOS) biosynthesis region is one of the more variable genomic regions between strains of Campylobacter jejuni. Indeed, eight classes of LOS biosynthesis loci have been established previously based on gene content and organization. In this study, we characterize additional classes of LOS biosynthesis loci and analyze various mechanisms that result in changes to LOS structures. To gain further insights into the genomic diversity of C. jejuni LOS biosynthesis region, we sequenced the LOS biosynthesis loci of 15 strains that possessed gene content that was distinct from the eight classes. This analysis identified 11 new classes of LOS loci that exhibited examples of deletions and insertions of genes and cassettes of genes found in other LOS classes or capsular biosynthesis loci leading to mosaic LOS loci. The sequence analysis also revealed both missense mutations leading to “allelic” glycosyltransferases and phase-variable and non-phase-variable gene inactivation by the deletion or insertion of bases. Specifically, we demonstrated that gene inactivation is an important mechanism for altering the LOS structures of strains possessing the same class of LOS biosynthesis locus. Together, these observations suggest that LOS biosynthesis region is a hotspot for genetic exchange and variability, often leading to changes in the LOS produced. PMID:18556784

  1. A Lightweight Data Integrity Scheme for Sensor Networks

    PubMed Central

    Kamel, Ibrahim; Juma, Hussam

    2011-01-01

    Limited energy is the most critical constraint that limits the capabilities of wireless sensor networks (WSNs). Most sensors operate on batteries with limited power. Battery recharging or replacement may be impossible. Security mechanisms that are based on public key cryptographic algorithms such as RSA and digital signatures are prohibitively expensive in terms of energy consumption and storage requirements, and thus unsuitable for WSN applications. This paper proposes a new fragile watermarking technique to detect unauthorized alterations in WSN data streams. We propose the FWC-D scheme, which uses group delimiters to keep the sender and receivers synchronized and help them to avoid ambiguity in the event of data insertion or deletion. The watermark, which is computed using a hash function, is stored in the previous group in a linked-list fashion to ensure data freshness and mitigate replay attacks, FWC-D generates a serial number SN that is attached to each group to help the receiver determines how many group insertions or deletions occurred. Detailed security analysis that compares the proposed FWC-D scheme with SGW, one of the latest integrity schemes for WSNs, shows that FWC-D is more robust than SGW. Simulation results further show that the proposed scheme is much faster than SGW. PMID:22163840

  2. Assessing the Pathogenicity of Insertion and Deletion Variants with the Variant Effect Scoring Tool (VEST‐Indel)

    PubMed Central

    Douville, Christopher; Masica, David L.; Stenson, Peter D.; Cooper, David N.; Gygax, Derek M.; Kim, Rick; Ryan, Michael

    2015-01-01

    ABSTRACT Insertion/deletion variants (indels) alter protein sequence and length, yet are highly prevalent in healthy populations, presenting a challenge to bioinformatics classifiers. Commonly used features—DNA and protein sequence conservation, indel length, and occurrence in repeat regions—are useful for inference of protein damage. However, these features can cause false positives when predicting the impact of indels on disease. Existing methods for indel classification suffer from low specificities, severely limiting clinical utility. Here, we further develop our variant effect scoring tool (VEST) to include the classification of in‐frame and frameshift indels (VEST‐indel) as pathogenic or benign. We apply 24 features, including a new “PubMed” feature, to estimate a gene's importance in human disease. When compared with four existing indel classifiers, our method achieves a drastically reduced false‐positive rate, improving specificity by as much as 90%. This approach of estimating gene importance might be generally applicable to missense and other bioinformatics pathogenicity predictors, which often fail to achieve high specificity. Finally, we tested all possible meta‐predictors that can be obtained from combining the four different indel classifiers using Boolean conjunctions and disjunctions, and derived a meta‐predictor with improved performance over any individual method. PMID:26442818

  3. Assessing the Pathogenicity of Insertion and Deletion Variants with the Variant Effect Scoring Tool (VEST-Indel).

    PubMed

    Douville, Christopher; Masica, David L; Stenson, Peter D; Cooper, David N; Gygax, Derek M; Kim, Rick; Ryan, Michael; Karchin, Rachel

    2016-01-01

    Insertion/deletion variants (indels) alter protein sequence and length, yet are highly prevalent in healthy populations, presenting a challenge to bioinformatics classifiers. Commonly used features--DNA and protein sequence conservation, indel length, and occurrence in repeat regions--are useful for inference of protein damage. However, these features can cause false positives when predicting the impact of indels on disease. Existing methods for indel classification suffer from low specificities, severely limiting clinical utility. Here, we further develop our variant effect scoring tool (VEST) to include the classification of in-frame and frameshift indels (VEST-indel) as pathogenic or benign. We apply 24 features, including a new "PubMed" feature, to estimate a gene's importance in human disease. When compared with four existing indel classifiers, our method achieves a drastically reduced false-positive rate, improving specificity by as much as 90%. This approach of estimating gene importance might be generally applicable to missense and other bioinformatics pathogenicity predictors, which often fail to achieve high specificity. Finally, we tested all possible meta-predictors that can be obtained from combining the four different indel classifiers using Boolean conjunctions and disjunctions, and derived a meta-predictor with improved performance over any individual method. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

  4. Automated Genotyping of a Highly Informative Panel of 40 Short Insertion-Deletion Polymorphisms Resolved in Polyacrylamide Gels for Forensic Identification and Kinship Analysis

    PubMed Central

    Pena, Heloisa B.; Pena, Sérgio D. J.

    2012-01-01

    Objective Short insertion-deletion polymorphisms (indels) are the second most abundant form of genetic variations in humans after SNPs. Since indel alleles differ in size, they can be typed using the same methodological approaches and equipment currently utilized for microsatellite genotyping, which is already operational in forensic laboratories. We have previously shown that a panel of 40 carefully chosen indels has excellent potential for forensic identification, with combined probability of identity (match probability) of 7.09 × 10–17 for Europeans. Methods We describe the successful development of a multiplex system for genotyping the 40-indel panel in long thin denaturing polyacrylamide gels with silver staining. We also demonstrate that the system can be easily fully automated with a simple large scanner and commercial software. Results and Conclusion The great advantage of the new system of typing is its very low cost. The total price for laboratory equipment is less than EUR 10,000.-, and genotyping of an individual patient will cost less than EUR 10.- in supplies. Thus, the 40-indel panel described here and the newly developed ‘low-tech’ analysis platform represent useful new tools for forensic identification and kinship analysis in laboratories with limited budgets, especially in developing countries. PMID:22851937

  5. The Genetics of a Probable Insertional Translocation in SORDARIA BREVICOLLIS.

    PubMed

    Bond, D J

    1979-05-01

    A chromosome rearrangement has been isolated and characterized in Sordaria brevicollis. Crosses to spore color mutants on each of the seven linkage groups have enabled the breakpoints to be mapped. The simplest hypothesis to account for the results is that a piece of linkage group VI has been translocated to linkage group V and inserted 2.7 map units from its centromere. Previous reports of markers on this linkage group with centromere distances greater than 2.7 units make it unlikely that the translocation is quasiterminal.

  6. The Genetics of a Probable Insertional Translocation in SORDARIA BREVICOLLIS

    PubMed Central

    Bond, D. J.

    1979-01-01

    A chromosome rearrangement has been isolated and characterized in Sordaria brevicollis. Crosses to spore color mutants on each of the seven linkage groups have enabled the breakpoints to be mapped. The simplest hypothesis to account for the results is that a piece of linkage group VI has been translocated to linkage group V and inserted 2.7 map units from its centromere. Previous reports of markers on this linkage group with centromere distances greater than 2.7 units make it unlikely that the translocation is quasiterminal. PMID:17248927

  7. P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

    PubMed Central

    Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

    1997-01-01

    We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

  8. Using genic sequence capture in combination with a syntenic pseudo genome to map a deletion mutant in a wheat species.

    PubMed

    Gardiner, Laura-Jayne; Gawroński, Piotr; Olohan, Lisa; Schnurbusch, Thorsten; Hall, Neil; Hall, Anthony

    2014-12-01

    Mapping-by-sequencing analyses have largely required a complete reference sequence and employed whole genome re-sequencing. In species such as wheat, no finished genome reference sequence is available. Additionally, because of its large genome size (17 Gb), re-sequencing at sufficient depth of coverage is not practical. Here, we extend the utility of mapping by sequencing, developing a bespoke pipeline and algorithm to map an early-flowering locus in einkorn wheat (Triticum monococcum L.) that is closely related to the bread wheat genome A progenitor. We have developed a genomic enrichment approach using the gene-rich regions of hexaploid bread wheat to design a 110-Mbp NimbleGen SeqCap EZ in solution capture probe set, representing the majority of genes in wheat. Here, we use the capture probe set to enrich and sequence an F2 mapping population of the mutant. The mutant locus was identified in T. monococcum, which lacks a complete genome reference sequence, by mapping the enriched data set onto pseudo-chromosomes derived from the capture probe target sequence, with a long-range order of genes based on synteny of wheat with Brachypodium distachyon. Using this approach we are able to map the region and identify a set of deleted genes within the interval. © 2014 The Authors.The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  9. Radiation hybrid maps of the D-genome of Aegilops tauschii and their application in sequence assembly of large and complex plant genomes.

    PubMed

    Kumar, Ajay; Seetan, Raed; Mergoum, Mohamed; Tiwari, Vijay K; Iqbal, Muhammad J; Wang, Yi; Al-Azzam, Omar; Šimková, Hana; Luo, Ming-Cheng; Dvorak, Jan; Gu, Yong Q; Denton, Anne; Kilian, Andrzej; Lazo, Gerard R; Kianian, Shahryar F

    2015-10-16

    The large and complex genome of bread wheat (Triticum aestivum L., ~17 Gb) requires high resolution genome maps with saturated marker scaffolds to anchor and orient BAC contigs/ sequence scaffolds for whole genome assembly. Radiation hybrid (RH) mapping has proven to be an excellent tool for the development of such maps for it offers much higher and more uniform marker resolution across the length of the chromosome compared to genetic mapping and does not require marker polymorphism per se, as it is based on presence (retention) vs. absence (deletion) marker assay. In this study, a 178 line RH panel was genotyped with SSRs and DArT markers to develop the first high resolution RH maps of the entire D-genome of Ae. tauschii accession AL8/78. To confirm map order accuracy, the AL8/78-RH maps were compared with:1) a DArT consensus genetic map constructed using more than 100 bi-parental populations, 2) a RH map of the D-genome of reference hexaploid wheat 'Chinese Spring', and 3) two SNP-based genetic maps, one with anchored D-genome BAC contigs and another with anchored D-genome sequence scaffolds. Using marker sequences, the RH maps were also anchored with a BAC contig based physical map and draft sequence of the D-genome of Ae. tauschii. A total of 609 markers were mapped to 503 unique positions on the seven D-genome chromosomes, with a total map length of 14,706.7 cR. The average distance between any two marker loci was 29.2 cR which corresponds to 2.1 cM or 9.8 Mb. The average mapping resolution across the D-genome was estimated to be 0.34 Mb (Mb/cR) or 0.07 cM (cM/cR). The RH maps showed almost perfect agreement with several published maps with regard to chromosome assignments of markers. The mean rank correlations between the position of markers on AL8/78 maps and the four published maps, ranged from 0.75 to 0.92, suggesting a good agreement in marker order. With 609 mapped markers, a total of 2481 deletions for the whole D-genome were detected with an average deletion size of 42.0 Mb. A total of 520 markers were anchored to 216 Ae. tauschii sequence scaffolds, 116 of which were not anchored earlier to the D-genome. This study reports the development of first high resolution RH maps for the D-genome of Ae. tauschii accession AL8/78, which were then used for the anchoring of unassigned sequence scaffolds. This study demonstrates how RH mapping, which offered high and uniform resolution across the length of the chromosome, can facilitate the complete sequence assembly of the large and complex plant genomes.

  10. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

    PubMed

    Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

    2006-08-15

    Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

  11. Recurrent Deletions and Reciprocal Duplications of 10q11.21q11.23 Including CHAT and SLC18A3 are Likely Mediated by Complex Low-Copy Repeats

    PubMed Central

    Stankiewicz, Paweł; Kulkarni, Shashikant; Dharmadhikari, Avinash V.; Sampath, Srirangan; Bhatt, Samarth S.; Shaikh, Tamim H.; Xia, Zhilian; Pursley, Amber N.; Cooper, M. Lance; Shinawi, Marwan; Paciorkowski, Alex R.; Grange, Dorothy K.; Noetzel, Michael J.; Saunders, Scott; Simons, Paul; Summar, Marshall; Lee, Brendan; Scaglia, Fernando; Fellmann, Florence; Martinet, Danielle; Beckmann, Jacques S.; Asamoah, Alexander; Platky, Kathryn; Sparks, Susan; Martin, Ann S.; Madan-Khetarpal, Suneeta; Hoover, Jacqueline; Medne, Livija; Bonnemann, Carsten G.; Moeschler, John B.; Vallee, Stephanie E.; Parikh, Sumit; Irwin, Polly; Dalzell, Victoria P.; Smith, Wendy E.; Banks, Valerie C.; Flannery, David B.; Lovell, Carolyn M.; Bellus, Gary A.; Golden-Grant, Kathryn; Gorski, Jerome L.; Kussmann, Jennifer L.; McGregor, Tracy L.; Hamid, Rizwan; Pfotenhauer, Jean; Ballif, Blake C.; Shaw, Chad A.; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Rosenfeld, Jill A.; Cheung, Sau Wai; Shaffer, Lisa G.

    2013-01-01

    We report 24 unrelated individuals with deletions and 17 additional cases with duplications at 10q11.21q21.1 identified by chromosomal microarray analysis. The rearrangements range in size from 0.3 to 12 Mb. Nineteen of the deletions and eight duplications are flanked by large, directly oriented segmental duplications of >98% sequence identity, suggesting that nonallelic homologous recombination (NAHR) caused these genomic rearrangements. Nine individuals with deletions and five with duplications have additional copy number changes. Detailed clinical evaluation of 20 patients with deletions revealed variable clinical features, with developmental delay (DD) and/or intellectual disability (ID) as the only features common to a majority of individuals. We suggest that some of the other features present in more than one patient with deletion, including hypotonia, sleep apnea, chronic constipation, gastroesophageal and vesicoureteral refluxes, epilepsy, ataxia, dysphagia, nystagmus, and ptosis may result from deletion of the CHAT gene, encoding choline acetyltransferase, and the SLC18A3 gene, mapping in the first intron of CHAT and encoding vesicular acetylcholine transporter. The phenotypic diversity and presence of the deletion in apparently normal carrier parents suggest that subjects carrying 10q11.21q11.23 deletions may exhibit variable phenotypic expressivity and incomplete penetrance influenced by additional genetic and nongenetic modifiers. PMID:21948486

  12. Homozygous hereditary C3 deficiency due to a partial gene deletion.

    PubMed Central

    Botto, M; Fong, K Y; So, A K; Barlow, R; Routier, R; Morley, B J; Walport, M J

    1992-01-01

    The molecular mechanism of C3 deficiency in an Afrikaans patient with recurrent pyogenic infections was studied. Restriction enzyme analysis showed a gene deletion of 800 base pairs (bp) mapping to the alpha chain of C3. Amplification of genomic DNA, using the PCR, demonstrated that the deletion included exons 22 and 23 of the C3 gene. Truncated mRNA was shown in an Epstein-Barr virus-transformed B-cell line by PCR amplification of first-strand cDNA. A consequence of this deletion was that the RNA transcribed 3' to the deletion was out of frame, resulting in formation of a stop codon 19 bp downstream from the deletion. The molecular basis of the deletion was compatible with homologous recombination between two Alu sequences located in introns 21 and 23. An unrelated nonconsanguineous relative and two of a sample of 174 Afrikaans-speaking individuals were heterozygous carriers of the same gene deletion. The wide prevalence of this null allele in this population is probably due to the effects of a small founder population. The presence of this deletion in the C3 gene is not compatible with production of any functional C3, supporting the idea that study of such patients offers a valid model for understanding physiological activities of C3 in vivo in humans. Images PMID:1350678

  13. Chromosomal DNA Deletions Explain Phenotypic Characteristics of Two Antigenic Variants, Phase II and RSA 514 (Crazy), of the Coxiella burnetii Nine Mile Strain†

    PubMed Central

    Hoover, T. A.; Culp, D. W.; Vodkin, M. H.; Williams, J. C.; Thompson, H. A.

    2002-01-01

    After repeated passages through embyronated eggs, the Nine Mile strain of Coxiella burnetii exhibits antigenic variation, a loss of virulence characteristics, and transition to a truncated lipopolysaccharide (LPS) structure. In two independently derived strains, Nine Mile phase II and RSA 514, these phenotypic changes were accompanied by a large chromosomal deletion (M. H. Vodkin and J. C. Williams, J. Gen. Microbiol. 132:2587-2594, 1986). In the work reported here, additional screening of a cosmid bank prepared from the wild-type strain was used to map the deletion termini of both mutant strains and to accumulate all the segments of DNA that comprise the two deletions. The corresponding DNAs were then sequenced and annotated. The Nine Mile phase II deletion was completely nested within the deletion of the RSA 514 strain. Basic alignment and homology studies indicated that a large group of LPS biosynthetic genes, arranged in an apparent O-antigen cluster, was deleted in both variants. Database homologies identified, in particular, mannose pathway genes and genes encoding sugar methylases and nucleotide sugar epimerase-dehydratase proteins. Candidate genes for addition of sugar units to the core oligosaccharide for synthesis of the rare sugar 6-deoxy-3-C-methylgulose (virenose) were identified in the deleted region. Repeats, redundancies, paralogous genes, and two regions with reduced G+C contents were found within the deletions. PMID:12438347

  14. Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

    NASA Astrophysics Data System (ADS)

    Panicali, Dennis; Paoletti, Enzo

    1982-08-01

    We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

  15. Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

    PubMed

    Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

    2006-04-01

    We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

  16. PAR1 deletions downstream of SHOX are the most frequent defect in a Spanish cohort of Léri-Weill dyschondrosteosis (LWD) probands.

    PubMed

    Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E

    2006-10-01

    Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.

  17. The Holstein Friesian Lethal Haplotype 5 (HH5) Results from a Complete Deletion of TBF1M and Cholesterol Deficiency (CDH) from an ERV-(LTR) Insertion into the Coding Region of APOB

    PubMed Central

    Schütz, Ekkehard; Wehrhahn, Christin; Wanjek, Marius; Bortfeld, Ralf; Wemheuer, Wilhelm E.; Beck, Julia; Brenig, Bertram

    2016-01-01

    Background With the availability of massive SNP data for several economically important cattle breeds, haplotype tests have been performed to identify unknown recessive disorders. A number of so-called lethal haplotypes, have been uncovered in Holstein Friesian cattle and, for at least seven of these, the causative mutations have been identified in candidate genes. However, several lethal haplotypes still remain elusive. Here we report the molecular genetic causes of lethal haplotype 5 (HH5) and cholesterol deficiency (CDH). A targeted enrichment for the known genomic regions, followed by massive parallel sequencing was used to interrogate for causative mutations in a case/control approach. Methods Targeted enrichment for the known genomic regions, followed by massive parallel sequencing was used in a case/control approach. PCRs for the causing mutations were developed and compared to routine imputing in 2,100 (HH5) and 3,100 (CDH) cattle. Results HH5 is caused by a deletion of 138kbp, spanning position 93,233kb to 93,371kb on chromosome 9 (BTA9), harboring only dimethyl-adenosine transferase 1 (TFB1M). The deletion breakpoints are flanked by bovine long interspersed nuclear elements Bov-B (upstream) and L1ME3 (downstream), suggesting a homologous recombination/deletion event. TFB1M di-methylates adenine residues in the hairpin loop at the 3’-end of mitochondrial 12S rRNA, being essential for synthesis and function of the small ribosomal subunit of mitochondria. Homozygous TFB1M-/- mice reportedly exhibit embryonal lethality with developmental defects. A 2.8% allelic frequency was determined for the German HF population. CDH results from a 1.3kbp insertion of an endogenous retrovirus (ERV2-1-LTR_BT) into exon 5 of the APOB gene at BTA11:77,959kb. The insertion is flanked by 6bp target site duplications as described for insertions mediated by retroviral integrases. A premature stop codon in the open reading frame of APOB is generated, resulting in a truncation of the protein to a length of only <140 amino acids. Such early truncations have been shown to cause an inability of chylomicron excretion from intestinal cells, resulting in malabsorption of cholesterol. The allelic frequency of this mutation in the German HF population was 6.7%, which is substantially higher than reported so far. Compared to PCR assays inferring the genetic variants directly, the routine imputing used so far showed a diagnostic sensitivity of as low as 91% (HH5) and 88% (CDH), with a high specificity for both (≥99.7%). Conclusion With the availability of direct genetic tests it will now be possible to more effectively reduce the carrier frequency and ultimately eliminate the disorders from the HF populations. Beside this, the fact that repetitive genomic elements (RE) are involved in both diseases, underline the evolutionary importance of RE, which can be detrimental as here, but also advantageous over generations. PMID:27128314

  18. New traits in crops produced by genome editing techniques based on deletions.

    PubMed

    van de Wiel, C C M; Schaart, J G; Lotz, L A P; Smulders, M J M

    2017-01-01

    One of the most promising New Plant Breeding Techniques is genome editing (also called gene editing) with the help of a programmable site-directed nuclease (SDN). In this review, we focus on SDN-1, which is the generation of small deletions or insertions (indels) at a precisely defined location in the genome with zinc finger nucleases (ZFN), TALENs, or CRISPR-Cas9. The programmable nuclease is used to induce a double-strand break in the DNA, while the repair is left to the plant cell itself, and mistakes are introduced, while the cell is repairing the double-strand break using the relatively error-prone NHEJ pathway. From a biological point of view, it could be considered as a form of targeted mutagenesis. We first discuss improvements and new technical variants for SDN-1, in particular employing CRISPR-Cas, and subsequently explore the effectiveness of targeted deletions that eliminate the function of a gene, as an approach to generate novel traits useful for improving agricultural sustainability, including disease resistances. We compare them with examples of deletions that resulted in novel functionality as known from crop domestication and classical mutation breeding (both using radiation and chemical mutagens). Finally, we touch upon regulatory and access and benefit sharing issues regarding the plants produced.

  19. The type III secretion system is involved in the invasion and intracellular survival of Escherichia coli K1 in human brain microvascular endothelial cells.

    PubMed

    Yao, Yufeng; Xie, Yi; Perace, Donna; Zhong, Yi; Lu, Jie; Tao, Jing; Guo, Xiaokui; Kim, Kwang Sik

    2009-11-01

    Type III secretion systems (T3SSs) have been documented in many Gram-negative bacteria, including enterohemorrhagic Escherichia coli. We have previously shown the existence of a putative T3SS in meningitis-causing E. coli K1 strains, referred to as E. coli type III secretion 2 (ETT2). The sequence of ETT2 in meningitis-causing E. coli K1 strain EC10 (O7:K1) revealed that ETT2 comprises the epr, epa and eiv genes, but bears mutations, deletions and insertions. We constructed the EC10 mutants deleted of ETT2 or eivA gene, and their contributions to bacterial pathogenesis were evaluated in human brain microvascular endothelial cells (HBMECs). The deletion mutant of ETT2 exhibited defects in invasion and intracellular survival compared with the parental E. coli K1 strain EC10. The mutant deleted of eivA within ETT2 was also significantly defective in invasion and intracellular survival in HBMECs, and the defects of the eiv mutant were restored to the levels of the parent strain EC10 by transcomplementation. These findings suggest that ETT2 plays a role in the pathogenesis of E. coli K1 infection, including meningitis.

  20. Optical mapping and its potential for large-scale sequencing projects.

    PubMed

    Aston, C; Mishra, B; Schwartz, D C

    1999-07-01

    Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.

  1. rasdaman Array Database: current status

    NASA Astrophysics Data System (ADS)

    Merticariu, George; Toader, Alexandru

    2015-04-01

    rasdaman (Raster Data Manager) is a Free Open Source Array Database Management System which provides functionality for storing and processing massive amounts of raster data in the form of multidimensional arrays. The user can access, process and delete the data using SQL. The key features of rasdaman are: flexibility (datasets of any dimensionality can be processed with the help of SQL queries), scalability (rasdaman's distributed architecture enables it to seamlessly run on cloud infrastructures while offering an increase in performance with the increase of computation resources), performance (real-time access, processing, mixing and filtering of arrays of any dimensionality) and reliability (legacy communication protocol replaced with a new one based on cutting edge technology - Google Protocol Buffers and ZeroMQ). Among the data with which the system works, we can count 1D time series, 2D remote sensing imagery, 3D image time series, 3D geophysical data, and 4D atmospheric and climate data. Most of these representations cannot be stored only in the form of raw arrays, as the location information of the contents is also important for having a correct geoposition on Earth. This is defined by ISO 19123 as coverage data. rasdaman provides coverage data support through the Petascope service. Extensions were added on top of rasdaman in order to provide support for the Geoscience community. The following OGC standards are currently supported: Web Map Service (WMS), Web Coverage Service (WCS), and Web Coverage Processing Service (WCPS). The Web Map Service is an extension which provides zoom and pan navigation over images provided by a map server. Starting with version 9.1, rasdaman supports WMS version 1.3. The Web Coverage Service provides capabilities for downloading multi-dimensional coverage data. Support is also provided for several extensions of this service: Subsetting Extension, Scaling Extension, and, starting with version 9.1, Transaction Extension, which defines request types for inserting, updating and deleting coverages. A web client, designed for both novice and experienced users, is also available for the service and its extensions. The client offers an intuitive interface that allows users to work with multi-dimensional coverages by abstracting the specifics of the standard definitions of the requests. The Web Coverage Processing Service defines a language for on-the-fly processing and filtering multi-dimensional raster coverages. rasdaman exposes this service through the WCS processing extension. Demonstrations are provided online via the Earthlook website (earthlook.org) which presents use-cases from a wide variety of application domains, using the rasdaman system as processing engine.

  2. Monoamine oxidase deficiency in males with an X chromosome deletion.

    PubMed

    Sims, K B; de la Chapelle, A; Norio, R; Sankila, E M; Hsu, Y P; Rinehart, W B; Corey, T J; Ozelius, L; Powell, J F; Bruns, G

    1989-01-01

    Mapping of the human MAOA gene to chromosomal region Xp21-p11 prompted our study of two affected males in a family previously reported to have Norrie disease resulting from a submicroscopic deletion in this chromosomal region. In this investigation we demonstrate in these cousins deletion of the MAOA gene, undetectable levels of MAO-A and MAO-B activities in their fibroblasts and platelets, respectively, loss of mRNA for MAO-A in fibroblasts, and substantial alterations in urinary catecholamine metabolites. The present study documents that a marked deficiency of MAO activity is compatible with life and that genes for MAO-A and MAO-B are near each other in this Xp chromosomal region. Some of the clinical features of these MAO deletion patients may help to identify X-linked MAO deficiency diseases in humans.

  3. High-coverage sequencing and annotated assembly of the genome of the Australian dragon lizard Pogona vitticeps.

    PubMed

    Georges, Arthur; Li, Qiye; Lian, Jinmin; O'Meally, Denis; Deakin, Janine; Wang, Zongji; Zhang, Pei; Fujita, Matthew; Patel, Hardip R; Holleley, Clare E; Zhou, Yang; Zhang, Xiuwen; Matsubara, Kazumi; Waters, Paul; Graves, Jennifer A Marshall; Sarre, Stephen D; Zhang, Guojie

    2015-01-01

    The lizards of the family Agamidae are one of the most prominent elements of the Australian reptile fauna. Here, we present a genomic resource built on the basis of a wild-caught male ZZ central bearded dragon Pogona vitticeps. The genomic sequence for P. vitticeps, generated on the Illumina HiSeq 2000 platform, comprised 317 Gbp (179X raw read depth) from 13 insert libraries ranging from 250 bp to 40 kbp. After filtering for low-quality and duplicated reads, 146 Gbp of data (83X) was available for assembly. Exceptionally high levels of heterozygosity (0.85 % of single nucleotide polymorphisms plus sequence insertions or deletions) complicated assembly; nevertheless, 96.4 % of reads mapped back to the assembled scaffolds, indicating that the assembly included most of the sequenced genome. Length of the assembly was 1.8 Gbp in 545,310 scaffolds (69,852 longer than 300 bp), the longest being 14.68 Mbp. N50 was 2.29 Mbp. Genes were annotated on the basis of de novo prediction, similarity to the green anole Anolis carolinensis, Gallus gallus and Homo sapiens proteins, and P. vitticeps transcriptome sequence assemblies, to yield 19,406 protein-coding genes in the assembly, 63 % of which had intact open reading frames. Our assembly captured 99 % (246 of 248) of core CEGMA genes, with 93 % (231) being complete. The quality of the P. vitticeps assembly is comparable or superior to that of other published squamate genomes, and the annotated P. vitticeps genome can be accessed through a genome browser available at https://genomics.canberra.edu.au.

  4. Optimization of sequence alignment for simple sequence repeat regions.

    PubMed

    Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C

    2011-07-20

    Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.

  5. Mapping the binding domain of the F18 fimbrial adhesin.

    PubMed

    Smeds, A; Pertovaara, M; Timonen, T; Pohjanvirta, T; Pelkonen, S; Palva, A

    2003-04-01

    F18 fimbrial Esherichia coli strains are associated with porcine postweaning diarrhea and pig edema disease. Recently, the FedF subunit was identified as the adhesin of the F18 fimbriae. In this study, adhesion domains of FedF were further studied by constructing deletions within the fedF gene and expressing FedF proteins with deletions either together with the other F18 fimbrial subunits or as fusion proteins tagged with maltose binding protein. The region essential for adhesion to porcine intestinal epithelial cells was mapped between amino acid residues 60 and 109 of FedF. To map the binding domain even more closely, all eight charged amino acid residues within this region were independently replaced by alanine. Three of these single point mutants expressing F18 fimbriae exhibited significantly diminished capabilities to adhere to porcine epithelial cells in vitro. In addition, a triple point mutation and a double point mutation completely abolished receptor adhesiveness. The result further confirmed that the region between amino acid residues 60 and 109 is essential for the binding of F18 fimbriae to their receptor. In addition, the adhesion capability of the binding domain was eliminated after treatment with iodoacetamide, suggesting the formation of a disulfide bridge between Cys-63 and Cys-83, whereas Cys-111 and Cys-116 could be deleted without affecting the binding ability of FedF.

  6. Genetic heterogeneity in patients with Bartter syndrome type 1

    PubMed Central

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-01-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888

  7. Genetic heterogeneity in patients with Bartter syndrome type 1.

    PubMed

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-02-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

  8. [Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

    PubMed

    Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

    2015-09-01

    For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

  9. Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

    PubMed

    Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

    2017-03-27

    Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

  10. Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.

    PubMed

    Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H

    2012-08-01

    Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.

  11. Full-length and defective enterovirus G genomes with distinct torovirus protease insertions are highly prevalent on a Chinese pig farm.

    PubMed

    Wang, Yan; Zhang, Wen; Liu, Zhijian; Fu, Xingli; Yuan, Jiaqi; Zhao, Jieji; Lin, Yuan; Shen, Quan; Wang, Xiaochun; Deng, Xutao; Delwart, Eric; Shan, Tongling; Yang, Shixing

    2018-05-21

    Recombination occurs frequently between enteroviruses (EVs) which are classified within the same species of the Picornaviridae family. Here, using viral metagenomics, the genomes of two recombinant EV-Gs (strains EVG 01/NC_CHI/2014 and EVG 02/NC_CHI/2014) found in the feces of pigs from a swine farm in China are described. The two strains are characterized by distinct insertion of a papain-like protease gene from toroviruses classified within the Coronaviridae family. According to recent reports the site of the torovirus protease insertion was located at the 2C/3A junction region in EVG 02/NC_CHI/2014. For the other variant EVG 01/NC_CHI/2014, the inserted protease sequence replaced the entire viral capsid protein region up to the VP1/2A junction. These two EV-G strains were highly prevalent in the same pig farm with all animals shedding the full-length genome (EVG 02/NC_CHI/2014) while 65% also shed the capsid deletion mutant (EVG 01/NC_CHI/2014). A helper-defective virus relationship between the two co-circulating EV-G recombinants is hypothesized.

  12. BACCardI--a tool for the validation of genomic assemblies, assisting genome finishing and intergenome comparison.

    PubMed

    Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C

    2005-04-01

    We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.

  13. Value of local electrogram characteristics predicting successful catheter ablation of left-versus right-sided accessory atrioventricular pathways by radiofrequency current.

    PubMed

    Lin, J L; Schie, J T; Tseng, C D; Chen, W J; Cheng, T F; Tsou, S S; Chen, J J; Tseng, Y Z; Lien, W P

    1995-01-01

    Despite similar guidance by local electrogram criteria, catheter ablation of right-sided accessory atrioventricular (AV) pathways by radiofrequency current has been less effective than that of left-sided ones. In order to elucidate the possible diversities in local electrosignal criteria, we systematically analyzed the morphological and timing characteristics of 215 bipolar local electrograms from catheter ablation sites of 65 left-sided accessory AV pathways and of 356 from those of 37 right-sided ones in 92 consecutive patients with Wolff-Parkinson-White syndrome or AV reentrant tachycardia incorporating concealed accessory AV pathways. After stepwise multivariate analysis, we selected the presence of a possible accessory pathway potential, local ventricular activation preceding QRS complex for 20 ms or more during ventricular insertion mapping, and the local retrograde ventriculoatrial (VA) continuity, local retrograde VA interval < or = 50 ms, electrogram stability (left-sided targets only), retrograde accessory pathway potential (right-sided targets only) during atrial insertion mapping, as independent local electrogram predictors for successful ablation of left- and right-sided accessory AV pathways. Combination of all local electrogram predictors could have moderate chance of success (80 and 51%) for the ventricular and atrial insertion ablation of left-sided accessory AV pathways, but only low probability of success (40% in ventricular insertion ablation) or very low sensitivity (12.5% in atrial insertion ablation) for right-sided ones. In conclusion, with the present approach, successful catheter ablation of right-sided accessory AV pathways, compared to left-sided ones, still necessitate a breakthrough in the precision mapping and the efficiency of energy delivery.

  14. Epilepsy with auditory features

    PubMed Central

    Licchetta, Laura; Baldassari, Sara; Palombo, Flavia; Menghi, Veronica; D'Aurizio, Romina; Leta, Chiara; Stipa, Carlotta; Boero, Giovanni; d'Orsi, Giuseppe; Magi, Alberto; Scheffer, Ingrid; Seri, Marco; Tinuper, Paolo; Bisulli, Francesca

    2015-01-01

    Objective: To identify novel genes implicated in epilepsy with auditory features (EAF) in phenotypically heterogeneous families with unknown molecular basis. Methods: We identified 15 probands with EAF in whom an LGI1 mutation had been excluded. We performed electroclinical phenotyping on all probands and available affected relatives. We used whole-exome sequencing (WES) in 20 individuals with EAF (including all the probands and 5 relatives) to identify single nucleotide variants, small insertions/deletions, and copy number variants. Results: WES revealed likely pathogenic variants in genes that had not been previously associated with EAF: a CNTNAP2 intragenic deletion, 2 truncating mutations of DEPDC5, and a missense SCN1A change. Conclusions: EAF is a clinically and molecularly heterogeneous disease. The association of EAF with CNTNAP2, DEPDC5, and SCN1A mutations widens the phenotypic spectrum related to these genes. CNTNAP2 encodes CASPR2, a member of the voltage-gated potassium channel complex in which LGI1 plays a role. The finding of a CNTNAP2 deletion emphasizes the importance of this complex in EAF and shows biological convergence. PMID:27066544

  15. Augmenting the Genetic Toolbox for Sulfolobus islandicus with a Stringent Positive Selectable Marker for Agmatine Prototrophy

    PubMed Central

    Cooper, Tara E.; Krause, David J.

    2013-01-01

    Sulfolobus species have become the model organisms for studying the unique biology of the crenarchaeal division of the archaeal domain. In particular, Sulfolobus islandicus provides a powerful opportunity to explore natural variation via experimental functional genomics. To support these efforts, we further expanded genetic tools for S. islandicus by developing a stringent positive selection for agmatine prototrophs in strains in which the argD gene, encoding arginine decarboxylase, has been deleted. Strains with deletions in argD were shown to be auxotrophic for agmatine even in nutrient-rich medium, but growth could be restored by either supplementation of exogenous agmatine or reintroduction of a functional copy of the argD gene from S. solfataricus P2 into the ΔargD host. Using this stringent selection, a robust targeted gene knockout system was established via an improved next generation of the MID (marker insertion and unmarked target gene deletion) method. Application of this novel system was validated by targeted knockout of the upsEF genes involved in UV-inducible cell aggregation formation. PMID:23835176

  16. Two-dimensional mapping of needle visibility with linear and curved array for ultrasound-guided interventional procedure

    NASA Astrophysics Data System (ADS)

    Susanti, Hesty; Suprijanto, Kurniadi, Deddy

    2018-02-01

    Needle visibility in ultrasound-guided technique has been a crucial factor for successful interventional procedure. It has been affected by several factors, i.e. puncture depth, insertion angle, needle size and material, and imaging technology. The influences of those factors made the needle not always well visible. 20 G needles of 15 cm length (Nano Line, facet) were inserted into water bath with variation of insertion angles and depths. Ultrasound measurements are performed with BK-Medical Flex Focus 800 using 12 MHz linear array and 5 MHz curved array in Ultrasound Guided Regional Anesthesia mode. We propose 3 criteria to evaluate needle visibility, i.e. maximum intensity, mean intensity, and the ratio between minimum and maximum intensity. Those criteria were then depicted into representative maps for practical purpose. The best criterion candidate for representing the needle visibility was criterion 1. Generally, the appearance pattern of the needle from this criterion was relatively consistent, i.e. for linear array, it was relatively poor visibility in the middle part of the shaft, while for curved array, it is relatively better visible toward the end of the shaft. With further investigations, for example with the use of tissue-mimicking phantom, the representative maps can be built for future practical purpose, i.e. as a tool for clinicians to ensure better needle placement in clinical application. It will help them to avoid the "dead" area where the needle is not well visible, so it can reduce the risks of vital structures traversing and the number of required insertion, resulting in less patient morbidity. Those simple criteria and representative maps can be utilized to evaluate general visibility patterns of the needle in vast range of needle types and sizes in different insertion media. This information is also important as an early investigation for future research of needle visibility improvement, i.e. the development of beamforming strategies and ultrasound enhanced (echogenic) needle.

  17. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

    2012-05-03

    Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

  18. Chimeric classical swine fever (CSF)-Japanese encephalitis (JE) viral particles as a non-transmissible bivalent marker vaccine candidate against CSF and JE infections

    USDA-ARS?s Scientific Manuscript database

    A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...

  19. Genetic and Hormonal Risk Factors for Prostate Cancer in African American Men

    DTIC Science & Technology

    2005-05-01

    Task 2. To perform DNA analyses to examine the following genotypes: Months 1-12 Months 12-24 LHB * CYP19 HSD3B2 CYP3A4 CYP17 IGF1 HSD17B2 We had...of publication of this article were defrayed in part by the payment of page mutation in exon 6 (P275A), and a 3-bp insertion/deletion in intron 7

  20. The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

    PubMed

    Tanaka, J; Fink, G R

    1985-01-01

    The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

Top