Alternaria and Cladosporium Fungal Allergen Epitopes are Denatured by Sodium Hypochlorite

PubMed Central

2009-01-01

Background Fungal allergens are ubiquitous; however, little progress has been made understanding fungal allergenic material removal from indoor environments. Purpose We investigated removal of environmental allergenic material derived from Alternaria and Cladosporium using sodium hypochlorite in vivo and in vitro. Methods Freeze dried allergen extract from Alternaria alternata and Cladosporium herbarum was treated with hypochlorite concentrations of 322, 88, 38, 16, 3, 0.3, and 0 mM, respectively. Remaining native allergenic material was quantified using enzyme immunoassay and remaining viable fungal material was evaluated. Results The results of treating Alternaria or Cladosporium extract with sodium hypochlorite are immediate and obvious. Concentrations greater than 100 mM remove color and concentrations between 100 and 38 mM partially uncolored the extract. Immunoassay for total antigenic and allergenic material remaining after treatment with sodium hypochlorite including 2 concentrations recommended for killing fungus confirmed a general destruction of antigenic and allergenic material at concentrations of 38 mM or greater. Conclusions This work confirms the ability of solutions of sodium hypochlorite to denature fungal allergenic material from common outdoor and indoor fungi A. alternata and C. herbarum. Destruction of recognized antigenic and allergenic epitopes occurs at hypochlorite concentrations commonly used for household cleaning. PMID:23282316

In vitro antifungal activity of fatty acid methyl esters of the seeds of Annona cornifolia A.St.-Hil. (Annonaceae) against pathogenic fungus Paracoccidioides brasiliensis.

PubMed

Lima, Luciana Alves Rodrigues dos Santos; Johann, Susana; Cisalpino, Patrícia Silva; Pimenta, Lúcia Pinheiro Santos; Boaventura, Maria Amélia Diamantino

2011-01-01

Fatty acids are abundant in vegetable oils. They are known to have antibacterial and antifungal properties. Antifungal susceptibility was evaluated by broth microdilution assay following CLSI (formerly the NCCLS) guidelines against 16 fungal strains of clinical interest. In this work, fatty acid methyl esters (FAME) was able to inhibit 12 clinical strains of the pathogenic fungus Paracoccidioides brasiliensis and were also active in the bioautographic assay against Cladosporium sphaerospermum. FAME was a more potent antifungal than trimethoprim-sulfamethoxazole against P. brasiliensis under the experimental conditions tested.

Synthesis and characterization of seaweed cellulose derived carboxymethyl cellulose.

PubMed

Lakshmi, Duraikkannu Shanthana; Trivedi, Nitin; Reddy, C R K

2017-02-10

In the present study, cellulose (SWC) extracted from green seaweed Ulva fasciata was processed to synthesize carboxymethyl cellulose (SWCMC). The seaweed cellulose (∼15% DW) was first processed for α cellulose extraction (10.1% on DW) followed by the synthesis and characterization of SWCMC. Thin films were prepared using commercial CMC (CCMC), SWCMC and SWCMC-metal nanoparticle (2% wt/v) by solvent evaporation technique. Films were studied for molecular weight, degree of carboxylation, viscosity and characterized by FT-IR and TGA. AFM surface morphology of SWCMC-metal nanoparticle film confirms the uniform distribution of sphere shaped metal nanoparticle on the film surface with the size in the range of 50-75nm. Further, SWCMC film showed antimicrobial activity when prepared with Ag and leaf extract of Azadirachta indica. The biodegradable nature of SWCMC film was confirmed by growing marine fungus Cladosporium spherospermum on CMC agar plates. Thus, SWCMC films exhibit potential applications in cosmetic, food, textiles, medical, agricultural and pharmaceutical industries. Copyright © 2016 Elsevier Ltd. All rights reserved.

Anti-proliferative effect of fungal taxol extracted from Cladosporium oxysporum against human pathogenic bacteria and human colon cancer cell line HCT 15

NASA Astrophysics Data System (ADS)

Gokul Raj, K.; Manikandan, R.; Arulvasu, C.; Pandi, M.

2015-03-01

Cladosporium oxysporum a new taxol producing endophytic fungus was identified and production of taxol were characterized using UV-visible spectroscopy (UV-vis), high-performance liquid chromatography (HPLC), infrared (IR) nuclear magnetic resonance spectroscopy (NMR (13C and 1H)) and liquid chromatography-mass spectrometry (LC-MS). The taxol biosynthetic gene (dbat) was evaluated for new taxol producing fungus. Antibacterial activity against six different human pathogenic bacteria was done by agar well diffusion method. The anticancer efficacy of isolated fungal taxol were also evaluated in human colon cancer cell HCT 15 by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), cytotoxicity and nuclear morphology analysis. The isolated fungal taxol showed positive towards biosynthetic gene (dbat) and effective against both Gram positive as well as Gram negative. The fungal taxol suppress growth of cancer cell line HCT 15 with an IC50 value of 3.5 μM concentration by 24 h treatment. Thus, the result reveals that C. oxysporum could be a potential alternative source for production of taxol and have antibacterial as well as anticancer properties with possible clinical applications.

Fungi isolated from flue-cured tobacco inoculated in the field with storage fungi.

PubMed

Welty, R E

1971-03-01

Flue-cured tobacco inoculated in the field with A. amstelodami, A. flavus, A. ochraceus, A. repens, A. ruber, and a species of Penicillium was rarely invaded by these fungi. Regardless of inoculum, the predominant fungi reisolated from green tissue were species of Alternaria and Cladosporium. After curing, A. repens, A. niger, and species of Alternaria and a species of Penicillium were the most commonly isolated fungi. The fungus used as inoculum was not the predominant fungus reisolated from green or cured tissue. Conditions during handling and storage prior to marketing probably determine when storage fungi become associated with the leaf and which species becomes predominant.

The Indoor Fungus Cladosporium halotolerans Survives Humidity Dynamics Markedly Better than Aspergillus niger and Penicillium rubens despite Less Growth at Lowered Steady-State Water Activity.

PubMed

Segers, Frank J J; van Laarhoven, Karel A; Huinink, Hendrik P; Adan, Olaf C G; Wösten, Han A B; Dijksterhuis, Jan

2016-09-01

Indoor fungi cause damage in houses and are a potential threat to human health. Indoor fungal growth requires water, for which the terms water activity (aw) and relative humidity (RH) are used. The ability of the fungi Aspergillus niger, Cladosporium halotolerans, and Penicillium rubens at different developmental stages to survive changes in aw dynamics was studied. Fungi grown on media with high aw were transferred to a controlled environment with low RH and incubated for 1 week. Growth of all developmental stages was halted during incubation at RHs below 75%, while growth continued at 84% RH. Swollen conidia, germlings, and microcolonies of A. niger and P. rubens could not reinitiate growth when retransferred from an RH below 75% to a medium with high aw All developmental stages of C. halotolerans showed growth after retransfer from 75% RH. Dormant conidia survived retransfer to medium with high aw in all cases. In addition, retransfer from 84% RH to medium with high aw resulted in burst hyphal tips for Aspergillus and Penicillium Cell damage of hyphae of these fungi after incubation at 75% RH was already visible after 2 h, as observed by staining with the fluorescent dye TOTO-1. Thus, C. halotolerans is more resistant to aw dynamics than A. niger and P. rubens, despite its limited growth compared to that of these fungi at a lowered steady-state aw The survival strategy of this phylloplane fungus in response to the dynamics of aw is discussed in relation to its morphology as studied by cryo-scanning electron microscopy (cryo-SEM). Indoor fungi cause structural and cosmetic damage in houses and are a potential threat to human health. Growth depends on water, which is available only at certain periods of the day (e.g., during cooking or showering). Knowing why fungi can or cannot survive indoors is important for finding novel ways of prevention. Until now, the ability of fungi to grow on media with little available water at steady state (unchanging conditions) has been important for evaluating whether a fungus can grow indoors. In the present study, we found that the fungus Cladosporium halotolerans, a common indoor fungus, is more resistant to changes in available water than the fungi Aspergillus niger and Penicillium rubens, despite the fact that the latter fungi can grow on media with low water availability. We concluded that the ability of fungi to deal with changes in humidity is at least as important as the ability to grow on low-water media. Copyright © 2016 Segers et al.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

Fungal Disfigurement of Paper, and Soft Rot of Cedar Shingles 1

PubMed Central

Eveleigh, D. E.

1970-01-01

Disfiguration of paper by Cladosporium cladosporioides is described, and the association between “soft rot” fungi and the greying of cedar shingles in marine locations is reported. Images PMID:5463581

Potential of the volatile-producing fungus Muscodor albus for control of building molds.

PubMed

Mercier, Julien; Jiménez, Jorge I

2007-03-01

The possibility of using the volatile-producing fungus Muscodor albus for biofumigation against building molds was investigated. Several species of Aspergillus and Penicillium as well as fungi belonging to nine other genera were inhibited or killed in vitro by volatiles produced by potato dextrose agar or rye grain cultures of M. albus. Trichoderma viride was the only fungus that was not inhibited by M. albus volatiles. To test biofumigation as a preventative treatment against fungal colonization of building material, dry pieces of gypsum drywall were fumigated with grain cultures of M. albus in closed boxes. After a simulated water damage and incubation under saturated humidity for 2 weeks, untreated drywall developed natural fungal populations of about 10(5)-10(6) cfu/cm2, while drywall fumigated with M. albus culture (20 g/11 L) had nondetectable fungal populations. To test for curative ability, moist pieces of drywall heavily colonized with Cladosporium cladosporioides, Aspergillus niger, or Stachybotrys chartarum were fumigated for 48 h with grain cultures of M. albus. Cladosporium cladosporioides was eliminated within 48 h, while A. niger and S. chartarum were usually more resistant. However, a longer curative fumigation of 96 h was effective in reducing A. niger or naturally occurring mold populations by about 5 log values. The production of volatile organic compounds from 20 g of rye grain culture in 11 L containers was monitored by solid-phase micro extraction and gas chromatography. Concentrations of isobutyric acid, the most abundant volatile, increased gradually in the headspace until it reached 25 microg/L (m/v) within 96 h. The second and third most abundant compounds, 2-methyl-1-butanol and isobutanol, peaked at about 10 and 5 microg/L (m/v), respectively, within the first 24 h and declined gradually afterwards.

Clinical Evaluation and Management of Patients with Suspected Fungus Sensitivity.

PubMed

Larenas-Linnemann, Desiree; Baxi, Sachin; Phipatanakul, Wanda; Portnoy, Jay M

2016-01-01

Fungus-sensitized patients usually present with symptoms that are similar to symptoms presented by those who are sensitized to other aeroallergens. Therefore, diagnosis and management should follow the same pathways used for patients with allergic conditions in general. The physician should consider that a relationship between fungal exposure and symptoms is not necessarily caused by an IgE-mediated mechanism, even when specific fungal IgE is detected. Until recently, IgE-mediated allergy has been documented only for a limited number of fungi. We propose a series of questions to be used to identify symptoms that occur in situations with high fungal exposure and a limited skin-prick-test panel (Alternaria, Cladosporium, Penicillium, Aspergillus, Candida) that can be amplified only in cases of high suspicion of other fungal exposure (eg, postfloods). We also review in vitro testing for fungi-specific IgE. Treatment includes environmental control, medical management, and, when appropriate, specific immunotherapy. Low-quality evidence exists supporting the use of subcutaneous immunotherapy for Alternaria to treat allergic rhinitis and asthma, and very low quality evidence supports the use of subcutaneous immunotherapy for Cladosporium and sublingual immunotherapy for Alternaria. As is the case for many allergens, evidence for immunotherapy with other fungal extracts is lacking. The so-called toxic mold syndrome is also briefly discussed. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patil, Swapnil M.; Chandanshive, Vishal V.; Rane, Niraj R.

In vitro grown untransformed adventitious roots (AR) culture of Ipomoea hederifolia and its endophytic fungus (EF) Cladosporium cladosporioides decolorized Navy Blue HE2R (NB-HE2R) at a concentration of 20 ppm up to 83.3 and 65%, respectively within 96 h. Whereas the AR-EF consortium decolorized the dye more efficiently and gave 97% removal within 36 h. Significant inductions in the enzyme activities of lignin peroxidase, tyrosinase and laccase were observed in roots, while enzymes like tyrosinase, laccase and riboflavin reductase activities were induced in EF. Metabolites of dye were analyzed using UV—vis spectroscopy, FTIR and gas chromatography-mass spectrometry. Possible metabolic pathways ofmore » NB-HE2R were proposed with AR, EF and AR-EF systems independently. Looking at the superior efficacy of AR-EF system, a rhizoreactor was developed for the treatment of NB-HE2R at a concentration of 1000 ppm. Control reactor systems with independently grown AR and EF gave 94 and 85% NB-HE2R removal, respectively within 36 h. The AR-EF rhizoreactor, however, gave 97% decolorization. The endophyte colonization additionally increased root and shoot lengths of candidate plants through mutualism. Combined bioreactor strategies can be effectively used for future eco-friendly remediation purposes. - Highlights: • Endophytic fungus on Ipomoea hederifolia promotes root growth and shoot development • Endophytic Cladosporium cladosporioides synergistically degrade Navy Blue-HE2R dye • Endophyte colonized I. hederifolia roots proved superior in dye decolorization • Dye stress and toxicity was efficiently dealt by root-endophyte consortium • Root-endophyte consortium can be used as a sustainable remediation strategy.« less

Antifungal isopimaranes from Hypoestes serpens.

PubMed

Rasoamiaranjanahary, L; Guilet, D; Marston, A; Randimbivololona, F; Hostettmann, K

2003-09-01

Five isopimarane diterpenes (7beta-hydroxyisopimara-8,15-dien-14-one, 14alpha-hydroxyisopimara-7,15-dien-1-one, 1beta,14alpha-dihydroxyisopimara-7,15-diene, 7beta-hydroxyisopimara-8(14),15-dien-1-one and 7beta-acetoxyisopimara-8(14),15-dien-1-one) have been isolated from the leaves of Hypoestes serpens (Acanthaceae). All compounds exhibited antifungal activity against both the plant pathogenic fungus Cladosporium cucumerinum and the yeast Candida albicans; two of them also displayed an acetylcholinesterase inhibition. The structures of the compounds were determined by means of spectrometric methods, including 1D and 2D NMR experiments and MS analysis.

Cladosporiosis in a tomato clownfish (Amphiprion frenatus).

PubMed

Silphaduang, U; Hatai, K; Wada, S; Noga, E

2000-06-01

Infection with Cladosporium sp., a deuteromycete, caused a deep dermal ulcer that extended to bone in a cultured tomato clownfish (Amphiprion frenatus). The infection may have been secondary to immunosuppression resulting from transport or confinement-induced stress or may have resulted from chronic exposure to copper. Reports of fungal infections in tropical marine fish are rare.

Potential Antiviral Agents from Marine Fungi: An Overview

PubMed Central

Zorofchian Moghadamtousi, Soheil; Nikzad, Sonia; Abdul Kadir, Habsah; Abubakar, Sazaly; Zandi, Keivan

2015-01-01

Biodiversity of the marine world is only partially subjected to detailed scientific scrutiny in comparison to terrestrial life. Life in the marine world depends heavily on marine fungi scavenging the oceans of lifeless plants and animals and entering them into the nutrient cycle by. Approximately 150 to 200 new compounds, including alkaloids, sesquiterpenes, polyketides, and aromatic compounds, are identified from marine fungi annually. In recent years, numerous investigations demonstrated the tremendous potential of marine fungi as a promising source to develop new antivirals against different important viruses, including herpes simplex viruses, the human immunodeficiency virus, and the influenza virus. Various genera of marine fungi such as Aspergillus, Penicillium, Cladosporium, and Fusarium were subjected to compound isolation and antiviral studies, which led to an illustration of the strong antiviral activity of a variety of marine fungi-derived compounds. The present review strives to summarize all available knowledge on active compounds isolated from marine fungi with antiviral activity. PMID:26204947

Secondary metabolites produced by solid fermentation of the marine-derived fungus Penicillium commune QSD-17.

PubMed

Gao, Shu-Shan; Shang, Zhuo; Li, Xiao-Ming; Li, Chun-Shun; Cui, Chuan-Ming; Wang, Bin-Gui

2012-01-01

The marine sediment-derived fungus Penicillium commune QSD-17 was re-investigated and cultured on rice solid medium. Two new compounds, isophomenone (1) and 3-deacetylcitreohybridonol (2), together with seven known derivatives (3-9), were identified. Their structures were determined by spectroscopic analysis.

New brefeldins and penialidins from marine fungus Penicillium janthinellum DT-F29.

PubMed

Cheng, Xiangwei; Yu, Liyan; Wang, Qianqian; Ding, Wanjing; Chen, Zhe; Ma, Zhongjun

2018-02-01

A fermentation of marine fungus Penicillium janthinellum DT-F29 on solid rice medium led to the isolation of three new compounds, brefeldin D (1) and penialidins D-E (5-6), along with other five known brefeldins and penialidins. The structures of above compounds were determined on the basis of MS and NMR analysis.

Diverse deep-sea fungi from the South China Sea and their antimicrobial activity.

PubMed

Zhang, Xiao-Yong; Zhang, Yun; Xu, Xin-Ya; Qi, Shu-Hua

2013-11-01

We investigated the diversity of fungal communities in nine different deep-sea sediment samples of the South China Sea by culture-dependent methods followed by analysis of fungal internal transcribed spacer (ITS) sequences. Although 14 out of 27 identified species were reported in a previous study, 13 species were isolated from sediments of deep-sea environments for the first report. Moreover, these ITS sequences of six isolates shared 84-92 % similarity with their closest matches in GenBank, which suggested that they might be novel phylotypes of genera Ajellomyces, Podosordaria, Torula, and Xylaria. The antimicrobial activities of these fungal isolates were explored using a double-layer technique. A relatively high proportion (56 %) of fungal isolates exhibited antimicrobial activity against at least one pathogenic bacterium or fungus among four marine pathogenic microbes (Micrococcus luteus, Pseudoaltermonas piscida, Aspergerillus versicolor, and A. sydowii). Out of these antimicrobial fungi, the genera Arthrinium, Aspergillus, and Penicillium exhibited antibacterial and antifungal activities, while genus Aureobasidium displayed only antibacterial activity, and genera Acremonium, Cladosporium, Geomyces, and Phaeosphaeriopsis displayed only antifungal activity. To our knowledge, this is the first report to investigate the diversity and antimicrobial activity of culturable deep-sea-derived fungi in the South China Sea. These results suggest that diverse deep-sea fungi from the South China Sea are a potential source for antibiotics' discovery and further increase the pool of fungi available for natural bioactive product screening.

Haenamindole, an unusual diketopiperazine derivative from a marine-derived Penicillium sp. KCB12F005.

PubMed

Kim, Jong Won; Ko, Sung-Kyun; Son, Sangkeun; Shin, Kee-Sun; Ryoo, In-Ja; Hong, Young-Soo; Oh, Hyuncheol; Hwang, Bang Yeon; Hirota, Hiroshi; Takahashi, Shunji; Kim, Bo Yeon; Osada, Hiroyuki; Jang, Jae-Hyuk; Ahn, Jong Seog

2015-11-15

During the chemical investigation of marine-derived fungus, an unusual diketopiperazine (DKP) alkaloid, haenamindole (1), was isolated from a culture of the marine-derived fungus Penicillium sp. KCB12F005. The structure of 1, which possesses benzyl-hydroxypiperazindione and phenyl-pyrimidoindole rings system in the molecule, was elucidated by analysis of NMR and MS data. The stereochemistry of 1 was determined by ROESY and advanced Marfey's method. Copyright © 2015 Elsevier Ltd. All rights reserved.

Leaf-cutting ants: an unexpected microenvironment holding human opportunistic black fungi.

PubMed

Duarte, A P M; Attili-Angelis, D; Baron, N C; Forti, L C; Pagnocca, F C

2014-09-01

Fungus-growing ants of the genus Atta are known for their leaf-cutting habit, a lifestyle they have maintained since their 50-million-year-old co-evolution with a mutualistic fungus, cultivated as food. Recent studies have highlighted that, in addition to the mutualistic fungus, nests of ants harbor a great diversity of microbial communities. Such microorganisms include the dematiaceous fungi, which are characterized by their melanized cell walls. In order to contribute to the knowledge of fungal ecology, as well as opportunistic strains that may be dispersed by these social insects, we isolated and identified fungi carried by gynes of Atta capiguara and Atta laevigata, collected from colonies located in Fazenda Santana, Botucatu (São Paulo, Brazil). The isolation was carried out using the oil flotation technique, which is suitable for the growth of black fungi. Inoculated plates were incubated at 25 and 35 °C until black cultures were visible (20-45 days). Isolates were identified based on microscopic and molecular characteristics. Some isolated genera were: Cladophialophora, Cladosporium, Exophiala, Ochroconis, Phaeococcomyces, Phialophora and Penidiella. Hyaline species were also found. The results obtained from this work showed that leaf-cutting gynes may contribute to the dispersal of opportunistic dematiaceous fungi. It is suggested that more attention should be paid to this still unexplored subject.

Comparative Transcriptome Analysis of the Cosmopolitan Marine Fungus Corollospora maritima Under Two Physiological Conditions

PubMed Central

Velez, Patricia; Alejandri-Ramírez, Naholi D.; González, María C.; Estrada, Karel J.; Sanchez-Flores, Alejandro; Dinkova, Tzvetanka D.

2015-01-01

Marine sandy beaches represent dynamic environments often subject to harsh conditions and climate fluctuations, where natural and anthropogenic inputs of freshwater from fluvial and pluvial sources alter salinity, which has been recognized as a key variable affecting the distribution of aquatic organisms and influencing critical physiological processes. The marine arenicolous fungus Corollospora maritima is a worldwide-distributed saprobe that has been reported to present tolerance to freshwater. Here, we present a transcriptome analysis that will provide the first insight of the genomic content for this fungus and a gene expression comparison between two different salinity conditions. We also identified genes that are candidates for being differentially expressed in response to environmental variations on salinity during the fungal growth. The de novo reconstruction of C. maritima transcriptome Illumina sequencing provided a total of 14,530 transcripts (16 megabases). The comparison between the two growth conditions rendered 103 genes specifically overexpressed in seawater, and 132 genes specifically up-regulated under freshwater. Using fungal isolates collected from different beaches, the specific environmental regulation of particular transcript differential expression was confirmed by RT-qPCR. To our knowledge, this is the first analysis that explores the marine fungus C. maritima molecular responses to overcome freshwater stress, and these data could shed light to understand the fungal adaptation and plasticity mechanisms to the marine habitat. PMID:26116293

Antifouling and antibacterial polyketides from marine gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023.

PubMed

Bao, Jie; Sun, Yu-Lin; Zhang, Xiao-Yong; Han, Zhuang; Gao, Hai-Chun; He, Fei; Qian, Pei-Yuan; Qi, Shu-Hua

2013-04-01

Two new polyketides, 6,8,5'6'-tetrahydroxy-3'-methylflavone (1) and paecilin C (2), together with six known analogs secalonic acid D (3), secalonic acid B (4) penicillixanthone A (5), emodin (6), citreorosein (7) and isorhodoptilometrin (8) were obtained from a broth of gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023. Compounds 1 and 6-8 had significant antifouling activity against Balanus amphitrite larvae settlement with EC50 values of 6.7, 6.1, 17.9 and 13.7 μg ml(-1), respectively, and 3-5 showed medium antibacterial activity against four tested bacterial strains. This was the first report of antibacterial activity of 3-5 against marine bacteria and antifouling activity of 6-8 against marine biofouling organism's larvae. The results indicated that gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023 strain could produce antifouling and antibacterial compounds that might aid the host gorgonian coral in protection against marine pathogen bacteria, biofouling organisms and other intruders.

Bioreactor with Ipomoea hederifolia adventitious roots and its endophyte Cladosporium cladosporioides for textile dye degradation.

PubMed

Patil, Swapnil M; Chandanshive, Vishal V; Rane, Niraj R; Khandare, Rahul V; Watharkar, Anuprita D; Govindwar, Sanjay P

2016-04-01

In vitro grown untransformed adventitious roots (AR) culture of Ipomoea hederifolia and its endophytic fungus (EF) Cladosporium cladosporioides decolorized Navy Blue HE2R (NB-HE2R) at a concentration of 20 ppm up to 83.3 and 65%, respectively within 96h. Whereas the AR-EF consortium decolorized the dye more efficiently and gave 97% removal within 36h. Significant inductions in the enzyme activities of lignin peroxidase, tyrosinase and laccase were observed in roots, while enzymes like tyrosinase, laccase and riboflavin reductase activities were induced in EF. Metabolites of dye were analyzed using UV-vis spectroscopy, FTIR and gas chromatography-mass spectrometry. Possible metabolic pathways of NB-HE2R were proposed with AR, EF and AR-EF systems independently. Looking at the superior efficacy of AR-EF system, a rhizoreactor was developed for the treatment of NB-HE2R at a concentration of 1000 ppm. Control reactor systems with independently grown AR and EF gave 94 and 85% NB-HE2R removal, respectively within 36h. The AR-EF rhizoreactor, however, gave 97% decolorization. The endophyte colonization additionally increased root and shoot lengths of candidate plants through mutualism. Combined bioreactor strategies can be effectively used for future eco-friendly remediation purposes. Copyright © 2016 Elsevier Inc. All rights reserved.

Penicillipyrones A and B, meroterpenoids from a marine-derived Penicillium sp. fungus.

PubMed

Liao, Lijuan; Lee, Jung-Ho; You, Minjung; Choi, Tae Joon; Park, Wanki; Lee, Sang Kook; Oh, Dong-Chan; Oh, Ki-Bong; Shin, Jongheon

2014-02-28

Penicillipyrones A (1) and B (2), two novel meroterpenoids, were isolated from the marine-derived fungus Penicillium sp. On the basis of the results of combined spectroscopic analyses, these compounds were structurally elucidated to be sesquiterpene γ-pyrones from a new skeletal class derived from a unique linkage pattern between the drimane sesquiterpene and pyrone moieties. Compound 2 elicited significant induction of quinone reductase.

Purification and Characterization of a Novel Chlorpyrifos Hydrolase from Cladosporium cladosporioides Hu-01

PubMed Central

Chen, Shaohua; Hu, Meiying; Luo, Jianjun; Li, Yanan

2012-01-01

Chlorpyrifos is of great environmental concern due to its widespread use in the past several decades and its potential toxic effects on human health. Thus, the degradation study of chlorpyrifos has become increasing important in recent years. A fungus capable of using chlorpyrifos as the sole carbon source was isolated from organophosphate-contaminated soil and characterized as Cladosporium cladosporioides Hu-01 (collection number: CCTCC M 20711). A novel chlorpyrifos hydrolase from cell extract was purified 35.6-fold to apparent homogeneity with 38.5% overall recovery by ammoniumsulfate precipitation, gel filtration chromatography and anion-exchange chromatography. It is a monomeric structure with a molecular mass of 38.3 kDa. The pI value was estimated to be 5.2. The optimal pH and temperature of the purified enzyme were 6.5 and 40°C, respectively. No cofactors were required for the chlorpyrifos-hydrolysis activity. The enzyme was strongly inhibited by Hg2+, Fe3+, DTT, β-mercaptoethanol and SDS, whereas slight inhibitory effects (5–10% inhibition) were observed in the presence of Mn2+, Zn2+, Cu2+, Mg2+, and EDTA. The purified enzyme hydrolyzed various organophosphorus insecticides with P-O and P-S bond. Chlorpyrifos was the preferred substrate. The Km and Vmax values of the enzyme for chlorpyrifos were 6.7974 μM and 2.6473 μmol·min−1, respectively. Both NH2-terminal sequencing and matrix-assisted laser desorption/ionization time-of-flight/time-of-flight mass spectrometer (MALDI-TOF-MS) identified an amino acid sequence MEPDGELSALTQGANS, which shared no similarity with any reported organophosphate-hydrolyzing enzymes. These results suggested that the purified enzyme was a novel hydrolase and might conceivably be developed to fulfill the practical requirements to enable its use in situ for detoxification of chlorpyrifos. Finally, this is the first described chlorpyrifos hydrolase from fungus. PMID:22693630

Sulfated steroid-amino acid conjugates from the Irish marine sponge Polymastia boletiformis.

PubMed

Smyrniotopoulos, Vangelis; Rae, Margaret; Soldatou, Sylvia; Ding, Yuanqing; Wolff, Carsten W; McCormack, Grace; Coleman, Christina M; Ferreira, Daneel; Tasdemir, Deniz

2015-03-24

Antifungal bioactivity-guided fractionation of the organic extract of the sponge Polymastia boletiformis, collected from the west coast of Ireland, led to the isolation of two new sulfated steroid-amino acid conjugates (1 and 2). Extensive 1D and 2D NMR analyses in combination with quantum mechanical calculations of the electronic circular dichroism (ECD) spectra, optical rotation, and 13C chemical shifts were used to establish the chemical structures of 1 and 2. Both compounds exhibited moderate antifungal activity against Cladosporium cucumerinum, while compound 2 was also active against Candida albicans. Marine natural products containing steroidal and amino acid constituents are extremely rare in nature.

Biosorption of Mercury (II) from Aqueous Solutions onto Fungal Biomass

PubMed Central

Martínez-Juárez, Víctor M.; Cárdenas-González, Juan F.; Torre-Bouscoulet, María Eugenia; Acosta-Rodríguez, Ismael

2012-01-01

The biosorption of mercury (II) on 14 fungal biomasses, Aspergillus flavus I–V, Aspergillus fumigatus I-II, Helminthosporium sp., Cladosporium sp., Mucor rouxii mutant, M. rouxii IM-80, Mucor sp 1 and 2, and Candida albicans, was studied in this work. It was found that the biomasses of the fungus M. rouxii IM-80, M. rouxii mutant, Mucor sp1, and Mucor sp 2 were very efficient removing the metal in solution, using dithizone, reaching the next percentage of removals: 95.3%, 88.7%, 80.4%, and 78.3%, respectively. The highest adsorption was obtained at pH 5.5, at 30°C after 24 hours of incubation, with 1 g/100 mL of fungal biomass. PMID:23028382

Symbiotic Fungus of Marine Sponge Axinella sp. Producing Antibacterial Agent

NASA Astrophysics Data System (ADS)

Trianto, A.; Widyaningsih, S.; Radjasa, OK; Pribadi, R.

2017-02-01

The emerging of multidrug resistance pathogenic bacteria cause the treatment of the diseaseshave become ineffective. There for, invention of a new drug with novel mode of action is an essential for curing the disease caused by an MDR pathogen. Marine fungi is prolific source of bioactive compound that has not been well explored. This study aim to obtain the marine sponges-associated fungus that producing anti-MDR bacteria substaces. We collected the sponge from Riung water, NTT, Indonesia. The fungus was isolated with affixed method, followed with purification with streak method. The overlay and disk diffusion agar methods were applied for bioactivity test for the isolate and the extract, respectively. Molecular analysis was employed for identification of the isolate. The sponge was identified based on morphological and spicular analysis. The ovelay test showed that the isolate KN15-3 active against the MDR Staphylococcus aureus and Eschericia coli. The extract of the cultured KN15-3 was also inhibited the S. aureus and E. coli with inhibition zone 2.95 mm and 4.13 mm, respectively. Based on the molecular analysis, the fungus was identified as Aspergillus sydowii. While the sponge was identified as Axinella sp.

Sulfated Steroid–Amino Acid Conjugates from the Irish Marine Sponge Polymastia boletiformis

PubMed Central

Smyrniotopoulos, Vangelis; Rae, Margaret; Soldatou, Sylvia; Ding, Yuanqing; Wolff, Carsten W.; McCormack, Grace; Coleman, Christina M.; Ferreira, Daneel; Tasdemir, Deniz

2015-01-01

Antifungal bioactivity-guided fractionation of the organic extract of the sponge Polymastia boletiformis, collected from the west coast of Ireland, led to the isolation of two new sulfated steroid-amino acid conjugates (1 and 2). Extensive 1D and 2D NMR analyses in combination with quantum mechanical calculations of the electronic circular dichroism (ECD) spectra, optical rotation, and 13C chemical shifts were used to establish the chemical structures of 1 and 2. Both compounds exhibited moderate antifungal activity against Cladosporium cucumerinum, while compound 2 was also active against Candida albicans. Marine natural products containing steroidal and amino acid constituents are extremely rare in nature. PMID:25812034

Cnidarian-derived filamentous fungi from Brazil: isolation, characterisation and RBBR decolourisation screening.

PubMed

Da Silva, M; Passarini, M R Z; Bonugli, R C; Sette, L D

2008-12-01

Marine-derived fungi represent a valuable source of structurally novel and biologically active metabolites of industrial interest. They also have drawn attention for their capacity to degrade several pollutants, including textile dyes, organochlorides and polycyclic aromatic hydrocarbons (PAHs), among others. The fungal tolerance to higher concentrations of salt might be considered an advantage for bioremediation processes in the marine environment. Therefore, filamentous fungi were isolated from cnidarians (scleractinian coral and zoanthids) collected from the north coast of São Paulo State, Brazil. A total of 144 filamentous fungi were morphologically and molecularly characterised. Among them there were several species of Penicillium and Aspergillus, in addition to Cladosporium spp., Eutypella sp., Fusarium spp., Khuskia sp., Mucor sp., Peacilomyces sp., Phoma sp. and Trichoderma spp. These fungi were tested regarding their decolourisation activity for Remazol Brilliant Blue R (RBBR), a textile dye used as an initial screening for PAH-degrading fungi. The most efficient fungi for RBBR decolourisation after 12 days were Penicillium citrinum CBMAI 853 (100%), Aspergillus sulphureus CBMAI 849 (95%), Cladosporium cladosporioides CBMAI 857 (93%) and Trichoderma sp. CBMAI 852 (89%). Besides its efficiency for dye decolourisation within liquid media, C. cladosporioides CBMAI 857 also decolourised dye on solid media, forming a decolourisation halo. Further research on the biotechnological potential, including studies on PAH metabolism, of these selected fungi are in progress.

Plant pathogens but not antagonists change in soil fungal communities across a land abandonment gradient in a Mediterranean landscape

NASA Astrophysics Data System (ADS)

Bosso, L.; Lacatena, F.; Varlese, R.; Nocerino, S.; Cristinzio, G.; Russo, D.

2017-01-01

We assessed whether the presence and abundance of plant pathogens and antagonists change in soil fungal communities along a land abandonment gradient. The study was carried out in the Cilento area (Southern Italy) at a site with three different habitats found along a land abandonment gradient: agricultural land, Mediterranean shrubland and woodland. For all microbiological substrates the colony forming units were about 3.1 × 106 g-1 soil for agricultural land and about 1.1 × 106 g-1 soil for Mediterranean shrubland and woodland. We found the following genera in all habitats: Cladosporium, Mortierella, Penicillium and Trichoderma. In agricultural land, the significantly most abundant fungus genera were Aspergillus, Fusarium, Cylindrocarpon and Nectria; in Mediterranean shrubland, Rhizopus and Trichoderma; and in woodland, Bionectria, Mortierella, Cladosporium, Diplodia, Paecilomyces, Penicillium and Trichoderma. We found a total of 8, 8 and 9 species of fungal antagonist, and 16, 6 and 6 species of fungal plant pathogens in agricultural land, Mediterranean shrubland and woodland respectively. Fungal plant pathogens decreased significantly over a land abandonment gradient, while we no found significant differences among fungal antagonists in the three habitats. We conclude that a decrease in the number of fungal pathogen species occurs when formerly cultivated areas are abandoned. On the other hand, fungal antagonists seem not to be affected by this process.

Aromatic compounds produced by Periconia atropurpurea, an endophytic fungus associated with Xylopia aromatica.

PubMed

Teles, Helder Lopes; Sordi, Renata; Silva, Geraldo Humberto; Castro-Gamboa, Ian; Bolzani, Vanderlan da Silva; Pfenning, Ludwig Heinrich; de Abreu, Lucas Magalhães; Costa-Neto, Claudio Miguel; Young, Maria Claudia Marx; Araújo, Angela Regina

2006-12-01

6,8-Dimethoxy-3-(2'-oxo-propyl)-coumarin (1) and 2,4-dihydroxy-6-[(1'E,3'E)-penta-1',3'-dienyl]-benzaldehyde (2), in addition to the known compound periconicin B (3), were isolated from the ethyl acetate extract of Periconia atropurpurea, an endophytic fungus obtained from the leaves of Xylopia aromatica, a native plant of the Brazilian Cerrado. Their chemical structures were assigned based on analyses of MS, 1D and 2D-NMR spectroscopic experiments. Biological analyses were performed using two mammalian cell lines, human cervix carcinoma (HeLa) and Chinese hamster ovary (CHO). The results showed that compound 1 had no effect when compared to the control group, which was treated with the vehicle (DMSO). Compound 2 was able to induce a slight increase in cell proliferation of HeLa (37% of increase) and CHO (38% of increase) cell lines. Analysis of compound 3 showed that it has potent cytotoxic activity against both cell lines, with an IC50 of 8.0 microM. Biological analyses using the phytopathogenic fungi Cladosporium sphaerospermum and C. cladosporioides revealed that also 2 showed potent antifungal activity compared to nystatin.

Biodegradation of the Pyrethroid Pesticide Esfenvalerate by Marine-Derived Fungi.

PubMed

Birolli, Willian G; Alvarenga, Natália; Seleghim, Mirna H R; Porto, André L M

2016-08-01

Esfenvalerate biodegradation by marine-derived fungi is reported here. Esfenvalerate (S,S-fenvalerate) and its main metabolites [3-phenoxybenzaldehyde (PBAld), 3-phenoxybenzoic acid (PBAc), 3-phenoxybenzyl alcohol (PBAlc), and 2-(4-chlorophenyl)-3-methylbutyric acid (CLAc)] were quantitatively analyzed by a validated method in triplicate experiments. All the strains (Penicillium raistrickii CBMAI 931, Aspergillus sydowii CBMAI 935, Cladosporium sp. CBMAI 1237, Microsphaeropsis sp. CBMAI 1675, Acremonium sp. CBMAI 1676, Westerdykella sp. CBMAI 1679, and Cladosporium sp. CBMAI 1678) were able to degrade esfenvalerate, however, with different efficiencies. Initially, 100 mg L(-1) esfenvalerate (Sumidan 150SC) was added to each culture in 3 % malt liquid medium. Residual esfenvalerate (64.8-95.2 mg L(-1)) and the concentrations of PBAc (0.5-7.4 mg L(-1)), ClAc (0.1-7.5 mg L(-1)), and PBAlc (0.2 mg L(-1)) were determined after 14 days. In experiments after 7, 14, 21, and 28 days of biodegradation with the three most efficient strains, increasing concentrations of the toxic compounds PBAc (2.7-16.6 mg L(-1), after 28 days) and CLAc (6.6-13.4 mg L(-1), after 28 days) were observed. A biodegradation pathway was proposed, based on HPLC-ToF results. The biodegradation pathway includes PBAld, PBAc, PBAlc, ClAc, 2-hydroxy-2-(3-phenoxyphenyl)acetonitrile, 3-(hydroxyphenoxy)benzoic acid, and methyl 3-phenoxy benzoate. Marine-derived fungi were able to biodegrade esfenvalerate in a commercial formulation and showed their potential for future bioremediation studies in contaminated soils and water bodies.

[Secondary metabolites of a marine mangrove fungus (Penicillium sp. no. 2556) from South China Sea].

PubMed

Li, Chun-Yuan; Ding, Wei-Jia; Shao, Chang-Lun; She, Zhi-Gang; Lin, Yong-Cheng

2008-07-01

The metabolites of a marine mangrove fungus (Penicillium sp. No. 2556) were studied in this paper and six compounds were isolated from the fermentation liquid. Their structures were elucidated by spectroscopy methods as Sch54796 (1), Sch54794 (2), 4-hydroxybenzoic acid (3), urail (4), succinic acid (5), Vermopyrone (6). Among them, compounds 1, 2 and 6 were firstly isolated from Penicillium sp., Coumpounds 1 and 2 remarkably inhibited the growth of cancer cell lines hep2 and hepG2.

Pretrichodermamides D-F from a Marine Algicolous Fungus Penicillium sp. KMM 4672.

PubMed

Yurchenko, Anton N; Smetanina, Olga F; Ivanets, Elena V; Kalinovsky, Anatoly I; Khudyakova, Yuliya V; Kirichuk, Natalya N; Popov, Roman S; Bokemeyer, Carsten; von Amsberg, Gunhild; Chingizova, Ekaterina A; Afiyatullov, Shamil Sh; Dyshlovoy, Sergey A

2016-06-27

Three new epidithiodiketopiperazines pretrichodermamides D-F (1-3), together with the known N-methylpretrichodermamide B (4) and pretrichodermamide С (5), were isolated from the lipophilic extract of the marine algae-derived fungus Penicillium sp. KMM 4672. The structures of compounds 1-5 were determined based on spectroscopic methods. The absolute configuration of pretrichodermamide D (1) was established by a combination of modified Mosher's method, NOESY data, and biogenetic considerations. N-Methylpretrichodermamide B (5) showed strong cytotoxicity against 22Rv1 human prostate cancer cells resistant to androgen receptor targeted therapies.

Natural Products from Marine Fungi—Still an Underrepresented Resource

PubMed Central

Imhoff, Johannes F.

2016-01-01

Marine fungi represent a huge potential for new natural products and an increased number of new metabolites have become known over the past years, while much of the hidden potential still needs to be uncovered. Representative examples of biodiversity studies of marine fungi and of natural products from a diverse selection of marine fungi from the author’s lab are highlighting important aspects of this research. If one considers the huge phylogenetic diversity of marine fungi and their almost ubiquitous distribution, and realizes that most of the published work on secondary metabolites of marine fungi has focused on just a few genera, strictly speaking Penicillium, Aspergillus and maybe also Fusarium and Cladosporium, the diversity of marine fungi is not adequately represented in investigations on their secondary metabolites and the less studied species deserve special attention. In addition to results on recently discovered new secondary metabolites of Penicillium species, the diversity of fungi in selected marine habitats is highlighted and examples of groups of secondary metabolites produced by representatives of a variety of different genera and their bioactivities are presented. Special focus is given to the production of groups of derivatives of metabolites by the fungi and to significant differences in biological activities due to small structural changes. PMID:26784209

Redoxcitrinin, a biogenetic precursor of citrinin from marine isolate of fungus Penicillium sp.

PubMed

Zhang, Dahai; Li, Xianguo; Kang, Jung Sook; Choi, Hong Dae; Jung, Jee H; Son, Byeng Wha

2007-05-01

A chemical analysis of the fermentation of the marine-derived fungus Penicillium sp. led to the isolation of a biogenetic precursor of citrinin, redoxcitrinin (1), together with polyketide mycotoxins, phenol A (2), citrinin H2 (3), 4-hydroxymellein (4), citrinin (5), and phenol A acid (6). The structures of compounds 1-6 were determined on the basis of physicochemical data analyses. Among them, compounds 1-3 exhibited a potent radical scavenging activity against 1,1-diphenyl-2-picrylhydrazyl (DPPH) with IC50 values of 27.7, 23.4, and 27.2 microM, respectively.

Three new compounds from the marine fungus Penicillium sp.

PubMed

Wu, Hong-Hua; Tian, Li; Feng, Bao-Min; Li, Zhi-Feng; Zhang, Qi-Hui; Pei, Yue-Hu

2010-01-01

Continuous research on the ethyl acetate extract of the fermentation broth of the marine fungus Y26-02 (Penicillium sp.) led to the purification of one known and three new compounds. Their structures were elucidated, respectively, as butyl 2-(4-oxo-5,6-dihydro-2H-pyran-3-yl) acetate (1), 4-hydroxyphenethyl 2-(4-oxo-5,6-dihydro-2H-pyran-3-yl) acetate (2), 3-hydroxybenzyl 2-(4-oxo-5,6-dihydro-2H-pyran-3-yl) acetate (3), and desoxypatulinic acid (4) on the basis of their spectroscopic and physico-chemical properties.

Hexylitaconic acid: a new inhibitor of p53-HDM2 interaction isolated from a marine-derived fungus, Arthrinium sp.

PubMed

Tsukamoto, Sachiko; Yoshida, Takushi; Hosono, Hidetaka; Ohta, Tomihisa; Yokosawa, Hideyoshi

2006-01-01

A new inhibitor of p53-HDM2 interaction was isolated from a culture of marine-derived fungus, Arthrinium sp. The structure was identified to be (-)-hexylitaconic acid (1) by spectroscopic analysis. The inhibition of p53-HDM2 binding was tested by the ELISA method, and 1 inhibited the binding with an IC(50) value of 50 microg/mL. Although a number of synthetic inhibitors of p53-HDM2 interaction have been reported so far, 1 is the second inhibitor isolated from natural resources.

[Gum-like exudate from Laguncularia racemosa (white mangrove) as culture media for fungi].

PubMed

Mesa, L M; León-Pinto, G

1993-01-01

Morphological studies of eight species of fungus: Aspergillus flavus Microsporum canis, Epidermophyton floccosum, Curvularia lunata, Cladosporium carrionii, Natrassia mangífera (Edo. Scytalidium), Sporotrix schenckii y Rhizophus oligosporus, which belong to families Mucedinaceae, Dematiaceae and Mucoraceae have been carried out in support medium based in gum exudate from Laguncularia racemosa (mangle blanco). This native polimer contains galactose, arabinose, rhamnose, uronic acid and proteins. Nitrogen calcium and magnesium are microconstituents of the gum. An economical substrate which contained gum exudate (4%) and agar (1.5%) was used in these studies. The results obtained showed that gum exudate-agar medium (EGA) permits an adequate identification of the studied species, therefore, it is a possible substitute for Sabouraud. It is important to know that the gum exudate is a natural product, economical and easy to obtain.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Sudden oak death: disease trends in Marin county plots after one year

Treesearch

Brice A. McPherson; David L. Wood; Andrew J. Storer; Nina Maggi Kelly; Richard B. Standiford

2002-01-01

Sudden oak death has emerged as a major threat to the oak forests of California. In oaks and tanoak, this disease complex consists of a previously unreported fungus-like pathogen, Phytophthora ramorum, insects (bark and ambrosia beetles), and a secondary fungus, Hypoxylon thouarsianum. Species monitored in this study were coast...

Effect of salinity medium on antioxidant and antidiabetic activity marine endophytic fungus of asperegillus elegans ptf 9

NASA Astrophysics Data System (ADS)

Mulyani, Hani; Artanti, Nina; Fitria, Irni; Filailla, Euis; Kandace, Yoice Sri; Udin, Linar Zalinar

2017-11-01

Our previous studies on screening of antioxidant activities from various endophytic fungi isolated from marine bioata showed that A. elegans PTF9 isolated from sea weed is one of the fungus that has good antioxidant activity. In current study we reported the effect of medium salinity (0, 3 and 10% salt in PDB medium) on antioxidant and antidiabetes activity of mycelium and filtrate ethyl acetate extracts of A. elegans Ptf 9. The antioxidant assay was conducted using DPPH free radical scavenging activity method. The antidiabetes assay was conducted using a-glucosidase inhibitory activity method. The results showed that the best antioxidant activity was obtained from filtrate extract of fungus cultures with 0% salt (IC50=1.56 ppm), whereas the best antidiabetes activity was obtained from filtrate extract of fungus culture with 10% salt (IC50= 3.64 ppm). Addition of salt reduced the antioxidant activity, but not the antidiabetes activity. The results suggest that A. elegans PTF9 showed potential for further studies on isolation of antioxidant and antidiabetes lead compounds that could be use for further development of new drugs.

Antimicrobials from the marine algal endophyte Penicillium sp.

PubMed

Flewelling, Andrew J; Johnson, John A; Gray, Christopher A

2013-03-01

An endophytic fungus identified as Penicillium sp. was isolated from the brown alga Fucus spiralis collected from the Shetland Islands, United Kingdom. Bioassay-guided fractionation of an extract of the fungus led to the isolation of cladosporin, epiepoformin, phyllostine, and patulin, all of which showed antimicrobial activity against either Staphylococcus aureus or Pseudomonas aeruginosa. Cladosporin has not previously been identified from a fungus of the genus Penicillium, and, despite being biosynthetically related, epiepoformin, phyllostine and patulin have not been previously reported from one source.

Fungal Allergy: Pattern of sensitization over the past 11 years.

PubMed

Fernández-Soto, R; Navarrete-Rodríguez, E M; Del-Rio-Navarro, B E; Sienra-Monge, J J Luis; Meneses-Sánchez, N A; Saucedo-Ramírez, O J

2018-05-05

Although the prevalence of sensitization to fungi is not precisely known, it can reach 50% in inner cities and has been identified as a risk factor in the development of asthma. Whereas the prevalence of allergic diseases is increasing, it is unclear whether the same occurs with sensitization to fungi. A retrospective study was performed at the "Hospital Infantil de México Federico Gómez". From skin tests taken between 2004 and 2015, information was gathered about Alternaria alternata, Aspergillus fumigatus, Candida albicans, Cladosporium herbarum, Mucor mucedo and Penicillium notatum. The participating patients were 2-18 years old, presented some type of allergic condition, and underwent immediate hypersensitivity tests to the fungi herein examined. Descriptive analysis and chi-squared distribution were used. Of the 8794 patients included in the study, 14% showed a negative result to the entire panel of environmental allergens. The remaining 7565 individuals displayed sensitization to at least one fungus, which most frequently was Aspergillus, with a rate of 16.8%. When the patients were divided into age groups, the same trend was observed. The highest percentage of sensitization (58%) toward at least one type of fungus was found in 2014, and the lowest percentage (49.8%) in 2008. The rate of sensitization to at least one type of fungus was presently over 50%, higher than that detected in other medical centers in Mexico. This rate was constant over the 11-year study, and Aspergillus exhibited the greatest frequency of sensitization among the patients. Copyright © 2018 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

Induced Marine Fungus Chondrostereum sp. as a Means of Producing New Sesquiterpenoids Chondrosterins I and J by Using Glycerol as the Carbon Source

PubMed Central

Li, Hou-Jin; Jiang, Wen-Han; Liang, Wan-Ling; Huang, Jia-Xin; Mo, Yu-Fei; Ding, Yan-Qing; Lam, Chi-Keung; Qian, Xiao-Jun; Zhu, Xiao-Feng; Lan, Wen-Jian

2014-01-01

Chondrostereum sp., a marine fungus isolated from a soft coral Sarcophyton tortuosum, can yield hirsutane framework sesquiterpenoids. However, the metabolites profiles vary dramatically with the composition change of the culture media. This fungus was cultured in a liquid medium containing glycerol as the carbon source, and two new metabolites, chondrosterins I and J (1 and 2), were obtained. Their structures were elucidated primarily based on MS, NMR and X-ray single-crystal diffraction data. By comparison with the known hirsutane sesquiterpenoids, chondrosterins I and J have unique structural features, including a methyl was migrated from C-2 to C-6, and the methyl at C-3 was carboxylated. Compound 2 exhibited potent cytotoxic activities against the cancer cell lines CNE-1 and CNE-2 with the IC50 values of 1.32 and 0.56 μM. PMID:24402176

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease

PubMed Central

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobroma cacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%. PMID:15951847

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease.

PubMed

Rubini, Marciano R; Silva-Ribeiro, Rute T; Pomella, Alan W V; Maki, Cristina S; Araújo, Welington L; Dos Santos, Deise R; Azevedo, João L

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobromacacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%.

Cladosporium cladosporioides and Cladosporium pseudocladosporioides as potential new fungal antagonists of Puccinia horiana Henn., the causal agent of chrysanthemum white rust.

PubMed

Torres, David Eduardo; Rojas-Martínez, Reyna Isabel; Zavaleta-Mejía, Emma; Guevara-Fefer, Patricia; Márquez-Guzmán, G Judith; Pérez-Martínez, Carolina

2017-01-01

Puccinia horiana Hennings, the causal agent of chrysanthemum white rust, is a worldwide quarantine organism and one of the most important fungal pathogens of Chrysanthemum × morifolium cultivars, which are used for cut flowers and as potted plants in commercial production regions of the world. It was previously reported to be controlled by Lecanicillium lecanii, Cladosporium sphaerospermum, C. uredinicola and Aphanocladium album, due to their antagonistic and hyperparasitic effects. We report novel antagonist species on Puccinia horiana. Fungi isolated from rust pustules in a commercial greenhouse from Villa Guerrero, México, were identified as Cladosporium cladosporioides and Cladosporium pseudocladosporioides based upon molecular analysis and morphological characters. The antagonism of C. cladosporioides and C. pseudocladosporioides on chrysanthemum white rust was studied using light and electron microscopy in vitro at the host/parasite interface. Cladosporium cladosporioides and C. pseudocladosporioides grew towards the white rust teliospores and colonized the sporogenous cells, but no direct penetration of teliospores was observed; however, the structure and cytoplasm of teliospores were altered. The two Cladosporium spp. were able to grow on media containing laminarin, but not when chitin was used as the sole carbon source; these results suggest that they are able to produce glucanases. Results from the study indicate that both Cladosporium species had potential as biological control agents of chrysanthemum white rust.

Cladosporium cladosporioides and Cladosporium pseudocladosporioides as potential new fungal antagonists of Puccinia horiana Henn., the causal agent of chrysanthemum white rust

PubMed Central

Guevara-Fefer, Patricia; Márquez-Guzmán, G. Judith; Pérez-Martínez, Carolina

2017-01-01

Puccinia horiana Hennings, the causal agent of chrysanthemum white rust, is a worldwide quarantine organism and one of the most important fungal pathogens of Chrysanthemum × morifolium cultivars, which are used for cut flowers and as potted plants in commercial production regions of the world. It was previously reported to be controlled by Lecanicillium lecanii, Cladosporium sphaerospermum, C. uredinicola and Aphanocladium album, due to their antagonistic and hyperparasitic effects. We report novel antagonist species on Puccinia horiana. Fungi isolated from rust pustules in a commercial greenhouse from Villa Guerrero, México, were identified as Cladosporium cladosporioides and Cladosporium pseudocladosporioides based upon molecular analysis and morphological characters. The antagonism of C. cladosporioides and C. pseudocladosporioides on chrysanthemum white rust was studied using light and electron microscopy in vitro at the host/parasite interface. Cladosporium cladosporioides and C. pseudocladosporioides grew towards the white rust teliospores and colonized the sporogenous cells, but no direct penetration of teliospores was observed; however, the structure and cytoplasm of teliospores were altered. The two Cladosporium spp. were able to grow on media containing laminarin, but not when chitin was used as the sole carbon source; these results suggest that they are able to produce glucanases. Results from the study indicate that both Cladosporium species had potential as biological control agents of chrysanthemum white rust. PMID:28141830

The genus Cladosporium

PubMed Central

Bensch, K.; Braun, U.; Groenewald, J.Z.; Crous, P.W.

2012-01-01

A monographic revision of the hyphomycete genus Cladosporium s. lat. (Cladosporiaceae, Capnodiales) is presented. It includes a detailed historic overview of Cladosporium and allied genera, with notes on their phylogeny, systematics and ecology. True species of Cladosporium s. str. (anamorphs of Davidiella), are characterised by having coronate conidiogenous loci and conidial hila, i.e., with a convex central dome surrounded by a raised periclinal rim. Recognised species are treated and illustrated with line drawings and photomicrographs (light as well as scanning electron microscopy). Species known from culture are described in vivo as well as in vitro on standardised media and under controlled conditions. Details on host range/substrates and the geographic distribution are given based on published accounts, and a re-examination of numerous herbarium specimens. Various keys are provided to support the identification of Cladosporium species in vivo and in vitro. Morphological datasets are supplemented by DNA barcodes (nuclear ribosomal RNA gene operon, including the internal transcribed spacer regions ITS1 and ITS2, the 5.8S nrDNA, as well as partial actin and translation elongation factor 1-α gene sequences) diagnostic for individual species. In total 993 names assigned to Cladosporium s. lat., including Heterosporium (854 in Cladosporium and 139 in Heterosporium), are treated, of which 169 are recognized in Cladosporium s. str. The other taxa are doubtful, insufficiently known or have been excluded from Cladosporium in its current circumscription and re-allocated to other genera by the authors of this monograph or previous authors. Taxonomic novelties: Cladosporium allicinum (Fr.: Fr.) Bensch, U. Braun & Crous, comb. nov., C. astroideum var. catalinense U. Braun, var. nov., Fusicladium tectonicola (Yong H. He & Z.Y. Zhang) U. Braun & Bensch, comb. nov., Septoidium uleanum (Henn.) U. Braun, comb. nov., Zasmidium adeniae (Hansf.) U. Braun, comb. nov., Zasmidium dianellae (Sawada & Katsuki) U. Braun, comb. nov., Zasmidium lythri (Westend.) U. Braun & H.D. Shin, comb. nov., Zasmidium wikstroemiae (Petch) U. Braun, comb. nov. PMID:22815589

Cyclodepsipeptides and other O-containing heterocyclic metabolites from Beauveria felina EN-135, a marine-derived entomopathogenic fungus.

PubMed

Du, Feng-Yu; Li, Xiao-Ming; Zhang, Peng; Li, Chun-Shun; Wang, Bin-Gui

2014-05-13

Bioassay-guided fractionation of a culture extract of Beauveria felina EN-135, an entomopathogenic fungus isolated from a marine bryozoan, led to the isolation of a new cyclodepsipeptide, iso-isariin D (1); two new O-containing heterocyclic compounds that we have named felinones A and B (2 and 3); and four known cyclodepsipeptides (4-7). The structures were elucidated via spectroscopic analysis, and the absolute configurations of 1 and 2 were determined using single-crystal X-ray diffraction and CD, respectively. All isolated compounds were evaluated for antimicrobial activity and brine-shrimp (Artemia salina) lethality.

Isolation of marine fungi Aspergillus sp. and its in vitro antifouling activity against marine bacteria.

PubMed

Thiyagarajan, Santhananmari; Bavya, Manoharan; Jamal, Alruwaili

2016-09-01

Biofouling is considered as a main issue of concern in aquatic environment causing severe economic loss and pollution. The aim of the present study was to isolate marine fungus antagonistic to biofouling bacteria and to define antifouling compounds present in it. Using standard plate method five predominant biofouling bacteria viz., Methylococcus sp., Flavobacterium sp., Marinococcus sp., Serratia sp. and Pseudomonas sp. were isolated from marine solid substances on Zobell's agar. Tolerance range of these bacteria to NaCl was 2-10%. Isolation of fungi from mangrove and estuarine sediments and their screening identified Aspergillus sp. EF4 as a potential isolate. This isolate caused inhibition of all the five test bacterial cultures measuring zone diameters respectively of 11, 16, 12, 13 and 11mm.? Subsequent to submerged fermentation using shaking flask method this fungus produced bioactive compounds within 5 days. The culture parameters optimized were raffinose as carbon source, yeast extract as lone nitrogen source, pH up to 9.0 and temperature up to 40?C. Antifouling compounds of culture filtrate were separated and detected by a three-step procedure involving thin layer chromatography, bioautography and preparative TLC. The in vitro assay involving glass slide-wooden stick-biofilm method revealed that these compounds could cause inhibition and destruction of bacteria to an extent of 2.16 x 104 CFU ml-1 and 2.46 x 104 CFU ml-1 respectively while growth of bacteria in control beaker was enumerated to be 4.41 x 104 CFU ml-1. High performance liquid chromatography of culture filtrate indicated probable principal antifouling compound as Fumonisin B2. Isolation of antagonistic marine fungus from Indian coast and detection of its antifouling compound would help in planning effective strategies for controlling biofouling in marine environment.

Phylogeny and ecology of the ubiquitous saprobe Cladosporium sphaerospermum, with descriptions of seven new species from hypersaline environments

PubMed Central

Zalar, P.; de Hoog, G.S.; Schroers, H.-J.; Crous, P.W.; Groenewald, J.Z.; Gunde-Cimerman, N.

2007-01-01

Saprobic Cladosporium isolates morphologically similar to C. sphaerospermum are phylogenetically analysed on the basis of DNA sequences of the ribosomal RNA gene cluster, including the internal transcribed spacer regions ITS1 and ITS2, the 5.8S rDNA (ITS) and the small subunit (SSU) rDNA as well as β-tubulin and actin gene introns and exons. Most of the C. sphaerospermum-like species show halotolerance as a recurrent feature. Cladosporium sphaerospermum, which is characterised by almost globose conidia, is redefined on the basis of its ex-neotype culture. Cladosporium dominicanum, C. psychrotolerans, C. velox, C. spinulosum and C. halotolerans, all with globoid conidia, are newly described on the basis of phylogenetic analyses and cryptic morphological and physiological characters. Cladosporium halotolerans was isolated from hypersaline water and bathrooms and detected once on dolphin skin. Cladosporium dominicanum and C. velox were isolated from plant material and hypersaline water. Cladosporium psychrotolerans, which grows well at 4 °C but not at 30 °C, and C. spinulosum, having conspicuously ornamented conidia with long digitate projections, are currently only known from hypersaline water. We also newly describe C. salinae from hypersaline water and C. fusiforme from hypersaline water and animal feed. Both species have ovoid to ellipsoid conidia and are therefore reminiscent of C. herbarum. Cladosporium langeronii (= Hormodendrum langeronii) previously described as a pathogen on human skin, is halotolerant but has not yet been recorded from hypersaline environments. PMID:18490999

Rapid Identification of Airborne Biological Particles by Flow Cytometry, Gas Chromatography, and Genetic Probes.

DTIC Science & Technology

1997-09-01

CONCLUSIONS ...................................... 36 REFERENCES ....................................... 39 -5- FIGURES la. Cladosporium and Mucor ...15 lb. Cladosporium and Heterobasidion .................... 16 Ic. Cladosporium and Penicillium ....................... 17 id. Mucor ...34. ........................................ 27 2b. "Blank 2". ........................................ 28 2c. Mucor spores ..................................... 29 2d. Aspergillus spores

Fungi in the healthy human gastrointestinal tract

PubMed Central

Hallen-Adams, Heather E.; Suhr, Mallory J.

2017-01-01

ABSTRACT Many species of fungi have been detected in the healthy human gut; however, nearly half of all taxa reported have only been found in one sample or one study. Fungi capable of growing in and colonizing the gut are limited to a small number of species, mostly Candida yeasts and yeasts in the family Dipodascaceae (Galactomyces, Geotrichum, Saprochaete). Malassezia and the filamentous fungus Cladosporium are potential colonizers; more work is needed to clarify their role. Other commonly-detected fungi come from the diet or environment but either cannot or do not colonize (Penicillium and Debaryomyces species, which are common on fermented foods but cannot grow at human body temperature), while still others have dietary or environmental sources (Saccharomyces cerevisiae, a fermentation agent and sometime probiotic; Aspergillus species, ubiquitous molds) yet are likely to impact gut ecology. The gut mycobiome appears less stable than the bacterial microbiome, and is likely subject to environmental factors. PMID:27736307

Fungi in the healthy human gastrointestinal tract.

PubMed

Hallen-Adams, Heather E; Suhr, Mallory J

2017-04-03

Many species of fungi have been detected in the healthy human gut; however, nearly half of all taxa reported have only been found in one sample or one study. Fungi capable of growing in and colonizing the gut are limited to a small number of species, mostly Candida yeasts and yeasts in the family Dipodascaceae (Galactomyces, Geotrichum, Saprochaete). Malassezia and the filamentous fungus Cladosporium are potential colonizers; more work is needed to clarify their role. Other commonly-detected fungi come from the diet or environment but either cannot or do not colonize (Penicillium and Debaryomyces species, which are common on fermented foods but cannot grow at human body temperature), while still others have dietary or environmental sources (Saccharomyces cerevisiae, a fermentation agent and sometime probiotic; Aspergillus species, ubiquitous molds) yet are likely to impact gut ecology. The gut mycobiome appears less stable than the bacterial microbiome, and is likely subject to environmental factors.

Melanins and Resistance of Fungi to Lysis

PubMed Central

Bloomfield, B. J.; Alexander, M.

1967-01-01

Hyphal walls of Aspergillus phoenicis and Sclerotium rolfsii are composed of large amounts of glucose- and N-acetylhexosamine-containing polysaccharides, and the walls are extensively digested by streptomycete culture filtrates or by a mixture of purified chitinase and β-(1 → 3) glucanase preparations with the release of the monomeric units. A. phoenicis conidial walls also contain polymers of glucose and N-acetylhexosamine, but these walls are resistant to digestion by microorganisms or the enzyme combination active on the hyphae. When the melanin-containing spicules were removed from the spore surface, however, the chitinase and glucanase partially digested the underlying structural components. Microorganisms decomposing hyphal walls of S. rolfsii did not attack the melanin-covered sclerotia produced by this fungus. No microorganism capable of lysing two fungi, Rhizoctonia solani and Cladosporium sp., producing hyphae containing abundant melanin was found. The ecological significance of these findings and possible mechanisms for the protective influence associated with melanins are discussed. PMID:6032507

Amino Acid Conjugated Anthraquinones from the Marine-Derived Fungus Penicillium sp. SCSIO sof101.

PubMed

Luo, Minghe; Cui, Zhaomeng; Huang, Hongbo; Song, Xianqin; Sun, Aijun; Dang, Yongjun; Lu, Laichun; Ju, Jianhua

2017-05-26

Emodacidamides A-H (1-8), natural products featuring anthraquinone-amino acid conjugates, have been isolated from a marine-derived fungus, Penicillium sp. SCSIO sof101, together with known anthraquinones 9 and 10. The planar structures of 1-8 were elucidated using a combination of NMR spectroscopy and mass spectrometry. The absolute configurations of the amino acid residues were confirmed using Marfey's method and chiral-phase HPLC analyses. Additionally, isolates were evaluated for possible immunomodulatory and cytotoxic activities. Emodacidamides A (1), C (3), D (4), and E (5) inhibited interleukin-2 secretion from Jurkat cells with IC 50 values of 4.1, 5.1, 12, and 5.4 μM, respectively.

Secondary metabolites from Penicillium pinophilum SD-272, a marine sediment-derived fungus.

PubMed

Wang, Ming-Hui; Li, Xiao-Ming; Li, Chun-Shun; Ji, Nai-Yun; Wang, Bin-Gui

2013-06-21

Two new secondary metabolites, namely, pinodiketopiperazine A (1) and 6,7-dihydroxy-3-methoxy-3-methylphthalide (2), along with alternariol 2,4-dimethyl ether (3) and L-5-oxoproline methyl ester (4), which were isolated from a natural source for the first time but have been previously synthesized, were characterized from the marine sediment-derived fungus Penicillium pinophilum SD-272. In addition, six known metabolites (5-10) were also identified. Their structures were elucidated by analysis of the NMR and mass spectroscopic data. The absolute configuration of compound 1 was determined by experimental and calculated ECD spectra. Compound 2 displayed potent brine shrimp (Artemia salina) lethality with LD₅₀ 11.2 μM.

Additional New Cytotoxic Triquinane-Type Sesquiterpenoids Chondrosterins K–M from the Marine Fungus Chondrostereum sp

PubMed Central

Huang, Lei; Lan, Wen-Jian; Deng, Rong; Feng, Gong-Kan; Xu, Qing-Yan; Hu, Zhi-Yu; Zhu, Xiao-Feng; Li, Hou-Jin

2016-01-01

By the method of 1H NMR prescreening and tracing the diagnostic proton signals of the methyl groups, three additional new triquinane-type sesquiterpenoids—chondrosterins K–M (1–3) and the known sesquiterpenoid anhydroarthrosporone (4)—were isolated from the marine fungus Chondrostereum sp. Their structures were elucidated on the basis of MS, 1D, and 2D NMR data. Chondrosterin K is a rare hirsutane sesquiterpenoid, in which a methyl group was migrated from C-2 to C-6 and has a double bond between C-2 and C-3. Compounds 1–3 showed significant cytotoxicities against various cancer cell lines in vitro. PMID:27571085

Occurrence of Cladosporium spp. and Alternaria spp. spores in Western, Northern and Central-Eastern Poland in 2004-2006 and relation to some meteorological factors

NASA Astrophysics Data System (ADS)

Grinn-Gofroń, Agnieszka; Rapiejko, Piotr

2009-08-01

The concentration of airborne spores of Cladosporium spp. and Alternaria spp. has been investigated at three monitoring stations situated along the west-north and central-east transect in Poland (Szczecin, Olsztyn, Warszawa,) i.e. from a height of 100 m to 149 m above sea level. The aerobiological monitoring of fungal spores was performed by means of three Lanzoni volumetric spore traps. Cladosporium spp. spores were dominant at all the stations. The highest Cladosporium spp. and Alternaria spp. numbers of spores were observed at all the cities in July and August. Statistically significant correlations have been found between the Cladosporium spp. and Alternaria spp. concentration in the air and the mean air temperature, amount of precipitation, air pressure and relative air humidity. The spore count of Cladosporium spp. and Alternaria spp. is determined by the diversity of local flora and weather conditions, especially by the air temperature. The identification of factors, which influence and shape spore concentrations, may significantly improve the current methods of allergy prevention.

Optimizing production of asperolide A, a potential anti-tumor tetranorditerpenoid originally produced by the algal-derived endophytic fungus Aspergillus wentii EN-48

NASA Astrophysics Data System (ADS)

Xu, Rui; Li, Xiaoming; Xu, Gangming; Wang, Bingui

2017-05-01

The marine algal-derived endophytic fungus Aspergillus wentii EN-48 produces the potential anti-tumor agent asperolide A, a tetranorlabdane diterpenoid active against lung cancer. However, the fermentation yield of asperolide A was very low and only produced in static cultures. Static fermentation conditions of A. wentii EN-48 were optimized employing response surface methodology to enhance the production of asperolide A. The optimized conditions resulted in a 13.9-fold yield enhancement, which matched the predicted value, and the optimized conditions were successfully used in scale-up fermentation for the production of asperolide A. Exogenous addition of plant hormones (especially 10 μmol/L methyl jasmonate) stimulated asperolide A production. To our knowledge, this is first optimized production of an asperolide by a marine-derived fungus. The optimization is Effective and valuable to supply material for further anti-tumor mechanism studies and preclinical evaluation of asperolide A and other norditerpenoids.

A peptidogalactomannan isolated from Cladosporium herbarum induces defense-related genes in BY-2 tobacco cells.

PubMed

Mattos, Bianca Braz; Montebianco, Caroline; Romanel, Elisson; da Franca Silva, Tatiane; Bernabé, Renato Barroso; Simas-Tosin, Fernanda; Souza, Lauro M; Sassaki, Guilherme L; Vaslin, Maite F S; Barreto-Bergter, Eliana

2018-05-01

Cladosporium herbarum is a plant pathogen associated with passion fruit scab and mild diseases in pea and soybean. In this study, a peptidogalactomannan (pGM) of C. herbarum mycelium was isolated and structurally characterized, and its role in plant-fungus interactions was evaluated. C. herbarum pGM is composed of carbohydrates (76%) and contains mannose, galactose and glucose as its main monosaccharides (molar ratio, 52:36:12). Methylation and 13 C-nuclear magnetic resonance ( 13 C-NMR) spectroscopy analysis have shown the presence of a main chain containing (1 → 6)-linked α-D-Manp residues, and β-D-Galf residues are present as (1 → 5)-interlinked side chains. β-Galactofuranose containing similar structures were characterized by our group in A. fumigatus, A. versicolor, A. flavus and C. resinae. Tobacco BY-2 cells were used as a model system to address the question of the role of C. herbarum pGM in cell viability and induction of the expression of plant defense-related genes. Native and partially acid hydrolyzed pGMs (lacking galactofuranosyl side-chain residues) were incubated with BY-2 cell suspensions at different concentrations. Cell viability drastically decreased after exposure to more than 400 μg ml -1 pGM; however no cell viability effect was observed after exposure to a partially acid hydrolyzed pGM. BY-2 cell contact with pGM strongly induce the expression of plant defense-related genes, such as phenylalanine ammonia lyase (PAL) and lipoxygenase (LOX), as well as the pathogen-related PR-1a, PR-2 and PR-3 genes, suggesting that pGM activates defense responses in tobacco cells. Interestingly, contact with partially hydrolyzed pGM also induced defense-related gene expression at earlier times than native pGM. These results show that the side chains of the (1 → 5)-linked β-D-galactofuranosyl units from pGM play an important role in the first line fungus-plant interactions mediating plant responses against C. herbarum. In addition, it was observed that pGM and/or C. herbarum conidia are able to induced HR when in contact with tobacco leaves and in vitro plantlets roots, producing necrotic lesions and peroxidase and NO burst, respectively. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Cyclodepsipeptides, sesquiterpenoids, and other cytotoxic metabolites from the filamentous fungus Trichothecium sp. (MSX 51320).

PubMed

Sy-Cordero, Arlene A; Graf, Tyler N; Adcock, Audrey F; Kroll, David J; Shen, Qi; Swanson, Steven M; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H

2011-10-28

Two new cyclodepsipeptides (1 and 2), two new sesquiterpenoids (3 and 4), and the known compounds guangomide A (5), roseotoxin S, and three simple trichothecenes were isolated from the cytotoxic organic extract of a terrestrial filamentous fungus, Trichothecium sp. The structures were determined using NMR spectroscopy and mass spectrometry. Absolute configurations of the cyclodepsipeptides were established by employing chiral HPLC, while the relative configurations of 3 and 4 were determined via NOESY data. The isolation of guangomide A was of particular interest, since it was reported previously from a marine-derived fungus.

Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics

PubMed Central

Schubert, K.; Groenewald, J. Z.; Braun, U.; Dijksterhuis, J.; Starink, M.; Hill, C.F.; Zalar, P.; de Hoog, G.S.; Crous, P.W.

2007-01-01

The Cladosporium herbarum complex comprises five species for which Davidiella teleomorphs are known. Cladosporium herbarum s. str. (D. tassiana), C. macrocarpum (D. macrocarpa) and C. bruhnei (D. allicina) are distinguishable by having conidia of different width, and by teleomorph characters. Davidiella variabile is introduced as teleomorph of C. variabile, a homothallic species occurring on Spinacia, and D. macrospora is known to be the teleomorph of C. iridis on Iris spp. The C. herbarum complex combines low molecular distance with a high degree of clonal or inbreeding diversity. Entities differ from each other by multilocus sequence data and by phenetic differences, and thus can be interpreted to represent individual taxa. Isolates of the C. herbarum complex that were formerly associated with opportunistic human infections, cluster with C. bruhnei. Several species are newly described from hypersaline water, namely C. ramotenellum, C. tenellum, C. subinflatum, and C. herbaroides. Cladosporium pseudiridis collected from Iris sp. in New Zealand, is also a member of this species complex and shown to be distinct from C. iridis that occurs on this host elsewhere in the world. A further new species from New Zealand is C. sinuosum on Fuchsia excorticata. Cladosporium antarcticum is newly described from a lichen, Caloplaca regalis, collected in Antarctica, and C. subtilissimum from grape berries in the U.S.A., while the new combination C. ossifragi, the oldest valid name of the Cladosporium known from Narthecium in Europe, is proposed. Standard protocols and media are herewith proposed to facilitate future morphological examination of Cladosporium spp. in culture, and neotypes or epitypes are proposed for all species treated. PMID:18490998

Microbial diversity on sedimentated rice fields due to coal mining activities in Tenggarong Seberang subdistrict of Kutai Kartanegara

NASA Astrophysics Data System (ADS)

Rosfiansyah; Sopialena

2018-04-01

The results showed that on upland rice fields with sediment found five genus of fungus with number of colonies 4.0 x 103 cfu/g to 9.3 x 104 cfu/g; three bacterial families with number of colonies 7,1 x 104 cfu/g to 2,8 x 105 cfu/g; and five genera of nematodes with the amount of 2.6 x 102/kg of soil to 1.1 x103/kg of soil. In unpolished upland rice fields were found four genus of fungus with colonies of 2.4 x 103 cfu/g to 8.4 x 104 cfu/g, three bacterial families with number of colonies 1.2 x 105 cfu/g to 2.7 x 105 cfu/g and four genera of nematodes with the amount of 9.6 x 102/kg of soil to 1.1 x103/kg of soil. The most common microbes are Aspergillus, Cladosporium, Penicillium, Phytium and Trichoderma (fungi), Achromobacteraceae, Brevibacteriaceae, Micrococcaceae (Bacteria), as well as Dorylaimus, Hemicycliophora, Mononchus, Meloidogyne, Paratrichodorus, Radopholus, Rotylenchulus, Rhabditis, Seinura and Trichodorus (Nematodes). Fungi, bacteria and nematodes have a good role in the process of soil decomposition. The results of soil chemical analysis showed that soil fertility is lower in upland rice fields with sediments compare to those without sediment.

Production and characterization of bioactive metabolites from piezotolerant deep sea fungus Nigrospora sp. in submerged fermentation.

PubMed

Arumugam, G K; Srinivasan, S K; Joshi, G; Gopal, D; Ramalingam, K

2015-01-01

To produce and characterize bioactive metabolites from piezotolerant marine fungus Nigrospora sp. in submerged fermentation. A distinct marine strain, Nigrospora sp. NIOT has been isolated from a depth of 800 m at the Arabian Sea. The 18S rRNA and internal transcribed spacers (ITS) analysis demonstrates its close association with the genus Nigrospora. Effect of pH, temperature, salinity, carbon source and amino acids was studied to optimize the fermentation conditions. Optimal mycelia growth and secondary metabolites production were observed at 6·0-8·0 pH, 20-30°C temperature, 7·5% salinity, sucrose as carbon source and tryptophan as amino acid source. The extracellular secondary metabolites exhibited high antimicrobial activities against both gram-positive and gram-negative pathogenic bacteria with minimal inhibitory concentration (MIC) values higher than 30 μg ml(-1). Strongest cytotoxicity was observed in all cell lines tested, GI50 (growth inhibition by 50%) was calculated to be 1·35, 3·2, 0·13 and 0·35 μg ml(-1) against U937, MCF-7, A673 and Jurkat, respectively. Fourier transform infrared spectroscopy (FTIR) and gas chromatography-mass spectrometry (GC-MS) analyses of secondary metabolites confirmed the production of antimicrobial and anticancer substances. A piezotolerant fungus Nigrospora sp. NIOT isolated from deep sea environment was successfully cultured under submerged fermentation. The secondary metabolites produced from this organism showed potent antimicrobial and anticancer activities with immediate application to cosmetics and pharmaceutical industries. This is the first study exploring Nigrospora sp. from 800 m in marine environment. This deep sea fungus under optimized culture conditions effectively produced bioactive secondary metabolites such as griseofulvin, spirobenzofuran and pyrone derivatives at higher concentrations. © 2014 The Society for Applied Microbiology.

Penilumamide, a novel lumazine peptide isolated from the marine-derived fungus, Penicillium sp. CNL-338.

PubMed

Meyer, Sven W; Mordhorst, Thorsten F; Lee, Choonghwan; Jensen, Paul R; Fenical, William; Köck, Matthias

2010-05-07

A novel lumazine peptide, penilumamide (1), was isolated from the fermentation broth of a marine-derived fungal strain, identified as Penicillium sp. (strain CNL-338) and the structure of the new metabolite was determined by analysis of ESI-TOF MS data combined with 1D and 2D NMR experiments.

Microfungal contaminants on mobile phones of health services vocational school students in Marmaris, Turkey.

PubMed

Özkan, Vedat Kadir; Sülün, Yusuf

2014-02-01

In this study, it was aimed to determine microfungi on mobile phones. Totally, 50 mobile phones were used belonging to Health Services Vocational School students. The samples were taken by swabbing the screen and keys of mobile phones using moistened sterile swab sticks. A total of 24 different microfungal species were obtained belonging to Alternaria, Aspergillus, Cladosporium, Geotrichum, Penicillium, Phoma, Rhinocladiella, Scopulariopsis, Trichoderma, and Trichophyton genera. The genera of microfungi most abundant in terms of the number of species on the mobile phones were Aspergillus, Cladosporium, and Penicillium. Numerically, Cladosporium was found as the most abundant on the mobile phones. Cladosporium herbarum colonies were highest in number, followed by Cladosporium sphaerospermum, and Penicillium verrucosum var. cyclopium. When percentages of each species present on the mobile phones were considered, C. herbarum and C. sphaerospermum were the most common. There was a great similarity between the dominant microfungi isolated from mobile phones and dominant microfungi obtained from studies of atmospheric microfungi in Turkey.

Biodegradation of Chlorpyrifos and Its Hydrolysis Product 3,5,6-Trichloro-2-Pyridinol by a New Fungal Strain Cladosporium cladosporioides Hu-01

PubMed Central

Peng, Chuyan; Liu, Hongmei; Hu, Meiying; Zhong, Guohua

2012-01-01

Intensive use of chlorpyrifos has resulted in its ubiquitous presence as a contaminant in surface streams and soils. It is thus critically essential to develop bioremediation methods to degrade and eliminate this pollutant from environments. We present here that a new fungal strain Hu-01 with high chlorpyrifos-degradation activity was isolated and identified as Cladosporium cladosporioides based on the morphology and 5.8S rDNA gene analysis. Strain Hu-01 utilized 50 mg·L−1 of chlorpyrifos as the sole carbon of source, and tolerated high concentration of chlorpyrifos up to 500 mg·L−1. The optimum degradation conditions were determined to be 26.8°C and pH 6.5 based on the response surface methodology (RSM). Under these conditions, strain Hu-01 completely metabolized the supplemented chlorpyrifos (50 mg·L−1) within 5 d. During the biodegradation process, transient accumulation of 3,5,6-trichloro-2-pyridinol (TCP) was observed. However, this intermediate product did not accumulate in the medium and disappeared quickly. No persistent accumulative metabolite was detected by gas chromatopraphy-mass spectrometry (GC-MS) analysis at the end of experiment. Furthermore, degradation kinetics of chlorpyrifos and TCP followed the first-order model. Compared to the non-inoculated controls, the half-lives (t 1/2) of chlorpyrifos and TCP significantly reduced by 688.0 and 986.9 h with the inoculum, respectively. The isolate harbors the metabolic pathway for the complete detoxification of chlorpyrifos and its hydrolysis product TCP, thus suggesting the fungus may be a promising candidate for bioremediation of chlorpyrifos-contaminated water, soil or crop. PMID:23056611

Peniciadametizine A, a Dithiodiketopiperazine with a Unique Spiro[furan-2,7'-pyrazino[1,2-b][1,2]oxazine] Skeleton, and a Related Analogue, Peniciadametizine B, from the Marine Sponge-Derived Fungus Penicillium adametzioides.

PubMed

Liu, Yang; Mándi, Attila; Li, Xiao-Ming; Meng, Ling-Hong; Kurtán, Tibor; Wang, Bin-Gui

2015-06-05

Peniciadametizine A (1); a new dithiodiketopiperazine derivative possessing a unique spiro[furan-2,7'-pyrazino[1,2-b][1,2]oxazine] skeleton, together with a highly oxygenated new analogue, peniciadametizine B (2); as well as two known compounds, brasiliamide A (3); and viridicatumtoxin (4), were isolated and identified from Penicillium adametzioides AS-53, a fungus obtained from an unidentified marine sponge. The unambiguous assignment of the relative and absolute configuration for the spiro center C-2 of compound 1 was solved by the combination of NMR and ECD measurements with Density-Functional Theory (DFT) conformational analysis and Time-Dependent Density-Functional Theory-Electronic Circular Dichroism (TDDFT-ECD) calculations. The spiro[furan-2,7'-pyrazino[1,2-b][1,2]oxazine] skeleton of 1 has not been reported yet among natural products and the biosynthetic pathway for 1 and 2 was discussed. Compounds 1 and 2 showed inhibitory activity against the pathogenic fungus Alternaria brassicae.

Proteomic Analysis of Anti-Cancerous Scopularide Production by a Marine Microascus brevicaulis Strain and Its UV Mutant.

PubMed

Kramer, Annemarie; Beck, Hans Christian; Kumar, Abhishek; Kristensen, Lars Peter; Imhoff, Johannes F; Labes, Antje

2015-01-01

The marine fungus Microascus brevicaulis strain LF580 is a non-model secondary metabolite producer with high yields of the two secondary metabolites scopularides A and B, which exhibit distinct activities against tumour cell lines. A mutant strain was obtained using UV mutagenesis, showing faster growth and differences in pellet formation besides higher production levels. Here, we show the first proteome study of a marine fungus. Comparative proteomics were applied to gain deeper understanding of the regulation of production and of the physiology of the wild type strain and its mutant. For this purpose, an optimised protein extraction protocol was established. In total, 4759 proteins were identified. The central metabolic pathway of strain LF580 was mapped using the KEGG pathway analysis and GO annotation. Employing iTRAQ labelling, 318 proteins were shown to be significantly regulated in the mutant strain: 189 were down- and 129 upregulated. Proteomics are a powerful tool for the understanding of regulatory aspects: The differences on proteome level could be attributed to limited nutrient availability in the wild type strain due to a strong pellet formation. This information can be applied for optimisation on strain and process level. The linkage between nutrient limitation and pellet formation in the non-model fungus M. brevicaulis is in consensus with the knowledge on model organisms like Aspergillus niger and Penicillium chrysogenum.

Proteomic Analysis of Anti-Cancerous Scopularide Production by a Marine Microascus brevicaulis Strain and Its UV Mutant

PubMed Central

Kramer, Annemarie; Beck, Hans Christian; Kumar, Abhishek; Kristensen, Lars Peter; Imhoff, Johannes F.; Labes, Antje

2015-01-01

The marine fungus Microascus brevicaulis strain LF580 is a non-model secondary metabolite producer with high yields of the two secondary metabolites scopularides A and B, which exhibit distinct activities against tumour cell lines. A mutant strain was obtained using UV mutagenesis, showing faster growth and differences in pellet formation besides higher production levels. Here, we show the first proteome study of a marine fungus. Comparative proteomics were applied to gain deeper understanding of the regulation of production and of the physiology of the wild type strain and its mutant. For this purpose, an optimised protein extraction protocol was established. In total, 4759 proteins were identified. The central metabolic pathway of strain LF580 was mapped using the KEGG pathway analysis and GO annotation. Employing iTRAQ labelling, 318 proteins were shown to be significantly regulated in the mutant strain: 189 were down- and 129 upregulated. Proteomics are a powerful tool for the understanding of regulatory aspects: The differences on proteome level could be attributed to limited nutrient availability in the wild type strain due to a strong pellet formation. This information can be applied for optimisation on strain and process level. The linkage between nutrient limitation and pellet formation in the non-model fungus M. brevicaulis is in consensus with the knowledge on model organisms like Aspergillus niger and Penicillium chrysogenum. PMID:26460745

[Cytotoxicity of the secondary metabolites of Marine Mangrove Fungus Paecilomyces sp. tree 1-7 on human hepatoma cell line HepG2].

PubMed

Cai, Xiao-Ling; Gao, Jun-Ping; Li, Qing; Wen, Lu; She, Zhi-Gang; Lin, Yong-Cheng

2008-06-01

To study the cytotoxicity of the secondary metabolites of Marine Mangrove Fungus Paecilomyces sp. Tree 1-7 on human hepatoma cell line HepG2 cultured in vitro. Three groups were divided: compounds group, 5-Fu group and control group. The cytotoxicity was measured by MTT method when HepG2 cells were treated by different concentration of the secondary metabolites of Paecilomyces sp. Tree 1-7. Secalonic acid A, tenellic acid A and alternin inhibited the growth of human hepatoma cell line HepG2, the IC50 separately were 2.0, 62.1 and 7.0 microg/ml. Secalonic acid A and alternin have strong cytotoxicity on HepG2 cultured in vitro.

Penilumamide, a novel lumazine peptide isolated from the marine-derived fungus, Penicillium sp. CNL-338†

PubMed Central

Meyer, Sven W.; Mordhorst, Thorsten F.; Lee, Choonghwan; Jensen, Paul R.; Fenical, William; Köck, Matthias

2013-01-01

A novel lumazine peptide, penilumamide (1), was isolated from the fermentation broth of a marine-derived fungal strain, identified as Penicillium sp. (strain CNL-338) and the structure of the new metabolite was determined by analysis of ESI-TOF MS data combined with 1D and 2D NMR experiments. PMID:20401392

Fungi Isolated From House Flies (Diptera: Muscidae) on Penned Cattle in South Texas

PubMed Central

Ysquierdo, Cherity A.; Olafson, Pia U.; Thomas, Donald B.

2017-01-01

Abstract Musca domestica L. were collected from cattle diagnosed with bovine ringworm to evaluate the potential of the house fly to disseminate Trichophyton verrucosum E. Bodin, a fungal dermatophyte that is the causative agent for ringworm in cattle. Fungal isolates were cultured from 45 individual flies on supplemented Sabouraud dextrose agar, and isolates were identified using morphological and microscopic approaches. Each isolate was identified further by PCR amplification of the ribosomal DNA locus with fungal-specific primers and subsequent amplicon sequencing. Trichophyton verrucosum was not identified using these approaches. However, 35 different fungal species representing 17 genera were cultured from collected flies, including several species that are allergenic and pathogenic to humans and animals. Several species within the fungal orders Hypocreales, Microascales, Onygenales, Saccharomycetales, Xylaniales, and Agaricales were observed for the first time on house flies. The most frequent fungus recovered was Cladosporium cladosporoides Fresen, which is known to be a ubiquitous, airborne allergen to humans. PMID:28399217

[Indoor air studies of mould fungus contamination of homes of selected patients with bronchial asthma (with special regard to evaluation problems)].

PubMed

Senkpiel, K; Kurowski, V; Ohgke, H

1996-02-01

Investigations of indoor air of the homes of seven patients with asthma bronchiale who showed up with positive reactions following intracutaneous application of fungal allergens revealed that their places of residence were contaminated by fungal and bacterial spores. The number of colony forming units of mesophilic fungal spores of the indoor air ranged from 100 to 1000 CFU/m3 and this was much higher than the mould flora of the outdoor air determined simultaneously. The major fungi species found by the indoor investigation were: Penicillium sp. > Aspergillus sp. > Cladosporium sp., Mucor sp., Chrysonilia sp., Verticillium sp. > Geotrichum sp., Trichoderma sp. In two cases Thermoactinomyces species could be detected in the indoor air. The main cause of fungal contamination were moist building materials on room walls, insufficient air ventilation, bad maintenance of the circulating air-machines and insufficient room hygiene (e.g. biological garbage in the kitchen).

Antimicrobial action of an endophytic fungi from Sophor flavescens and structure identification of its active constituent

PubMed Central

Yu, Na; He, Lu; Liu, Na; Wang, Yong; Xu, Hongbo; Liu, Dandan

2014-01-01

Endophytic fungus BS002 was isolated and characterized from Sophora flavescens by plate method, which has broad antimicrobial activity. Isolation and trace of a new bioactive compound from the fungus’ culture extracts with the method of column chromatography and TLC biological autoradiography was conducted. Finally, it was identified as 6,7-(2′E) dibutenyl-5,8-dihydroxy-(Z)-cyclooct-2-ene-1,4-dione by nuclear magnetic resonance, infrared and liquid chromatography–mass spectrometry. The compound presented strong antifungal activities for example: Botryosphaeria berengriana f.sp. piricola, Physalospora piricola, Cladosporium cucumerinum Ell. Arthur., Fusarium oxysporum f.sp. cucumerinum, Fusarium moniliforme. The inhibition to Physalospora piricola was the strongest with an antibacterial diameter of 45 mm. This paper is the first report of the antimicrobial activity of endophytic fungi BS002 that was the secondary metabolites extracted from the seeds of Sophora flavescens. The results provide a broad foreground for biopharmaceuticals and biopesticide. PMID:26019517

Respiratory disease of workers harvesting grain.

PubMed Central

Darke, C S; Knowelden, J; Lacey, J; Milford Ward, A

1976-01-01

The incidence of respiratory symptoms caused by grain dust during harvesting was surveyed in a group of Lincolnshire farmers. A quarter complained of respiratory distress after working on combine harvesters or near grain driers and elevators, with cough, wheezing, and breathlessness, sometimes so severe as to prevent work. The airborne dust around combine harvesters contained up to 200 million fungus spores/m3 air with Cladosporium predominant while drivers were exposed to up to 20 million spores/m3 air. Verticillium/Paecilomyces type spores, mostly from Verticillium lecanii, Aphanocladium album, and Paecilomyces bacillosporus, were abundant in the dust. Extracts of these species produced immediate weal reactions in skin tests, precipitin reactions with sera, and rapid decreases in FEV1 when inhaled by affected workers. There was no delayed reactions. Results suggest type I immediate hypersensitivity to the spores although the physical effect of a heavy dust deposit could be important. Drivers could be protected by cabs ventilated with filtered air. PMID:941115

Sensitization to Alternaria and Cladosporium in patients with respiratory allergy and outdoor counts of mold spores in Ankara atmosphere, Turkey.

PubMed

Bavbek, Sevim; Erkekol, Ferda Oner; Ceter, Talip; Mungan, Dilşad; Ozer, Faruk; Pinar, Münevver; Misirligil, Zeynep

2006-08-01

Sensitization to Alternaria and Cladosporium has been reported to be 3% to 30% in European countries. However, in Turkey, there is limited data about the prevalence of sensitization to these molds and the intensity of the two mold spores in Ankara atmosphere. This study was designed to evaluate the sensitization to Alternaria and Cladosporium in patients with respiratory allergy in Ankara and also the concentration of the two molds in Ankara atmosphere. Allergic rhinitis and asthma patients living in Ankara were included in the study. Demographic and diagnostic data of the patients were recorded. A skin prick test with extracts supplied by three different laboratories was used to evaluate the sensitization to Alternaria and Cladosporium. Mold spores were measured using a Burkard 7-day recording volumetric spore trap in Ankara atmosphere during a year. Overall sensitization to the two molds was found to be 14.8%, and isolated Alternaria or Cladosporiumsensitization was 3%. Considering the positive reaction to at least one of the three suppliers, the sensitization rate was 11.9% and 8.1% for Alternaria and Cladosporium, respectively. Cochran's Q homogenization test demonstrated that the positive and negative reaction were not homogeneous among three laboratories. The total number of mold spores in Ankara atmosphere was 429,264 spores/m3 of which 75.5% and 6% were constituted by Cladosporium and Alternaria, respectively. The prevalence of Cladosporium and Alternaria sensitization in respiratory allergy patients is quite similar to European countries; however, our data indicate that commercial mold extracts should be standardized to establish the real sensitization rates. Additionally, considering the great numbers of these mold spores in Ankara atmosphere, long-term follow-up studies are needed to evaluate the relationship between the mold load and sensitization patterns.

Eremophilane Sesquiterpenes from a Deep Marine-Derived Fungus, Aspergillus sp. SCSIOW2, Cultivated in the Presence of Epigenetic Modifying Agents.

PubMed

Wang, Liyan; Li, Mengjie; Tang, Jianqiang; Li, Xiaofan

2016-04-18

Chemical epigenetic manipulation was applied to a deep marine-derived fungus, Aspergillus sp. SCSIOW2, resulting in significant changes of the secondary metabolites. Three new eremophilane-type sesquiterpenes, dihydrobipolaroxin B (2), dihydrobipolaroxin C (3), and dihydrobipolaroxin D (4), along with one known analogue, dihydrobipolaroxin (1), were isolated from the culture treated with a combination of histone deacetylase inhibitor (suberohydroxamic acid) and DNA methyltransferase inhibitor (5-azacytidine). 1-4 were not produced in the untreated cultures. 2 and 3 might be artificial because 1 could form 2 and 3 spontaneously in water by intracellular acetalization reaction. The absolute configurations of 1 and 2 were assigned based on ECD spectroscopy combined with time-dependent density functional theory calculations. All four compounds exhibited moderate nitric oxide inhibitory activities without cytotoxic effects.

Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

PubMed

Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

2018-05-03

Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

Varioloid A, a new indolyl-6,10b-dihydro-5aH-[1]benzofuro[2,3-b]indole derivative from the marine alga-derived endophytic fungus Paecilomyces variotii EN-291.

PubMed

Zhang, Peng; Li, Xiao-Ming; Mao, Xin-Xin; Mándi, Attila; Kurtán, Tibor; Wang, Bin-Gui

2016-01-01

A new indolyl-6,10b-dihydro-5a H -[1]benzofuro[2,3- b ]indole derivative, varioloid A ( 1 ), was isolated from the marine alga-derived endophytic fungus Paecilomyces variotii EN-291. Its structure was elucidated on the basis of extensive analysis of 1D and 2D NMR data and the absolute configuration was determined by time-dependent density functional theory-electronic circular dichroism (TDDFT-ECD) calculations. A similar compound, whose planar structure was previously described but the relative and absolute configurations and 13 C NMR data were not reported, was also identified and was tentatively named as varioloid B ( 2 ). Both compounds 1 and 2 exhibited cytotoxicity against A549, HCT116, and HepG2 cell lines, with IC 50 values ranging from 2.6 to 8.2 µg/mL.

pH-Dependent accumulation of anticancer compound on mycelia in fermentation of marine fungus.

PubMed

Zhou, Weiqiang; Cai, Menghao; Na, Ke; Shen, Chu; Zhang, Xiaoxu; Zhou, Xiangshan; Zhao, Wenjie; Zhang, Yuanxing

2014-07-01

The real-time distribution of anticancer 1403C in fermentation broth of marine fungus Halorosellinia sp. was investigated. It was closely related with pH variations, which was, 1403C in the supernatant decreased while that in the mycelia increased with pH rising. There was only 0.5 % of the total 1403C left in the supernatant when pH reached 7.0. The scanning electron microscope then provided information that compounds precipitated on the mycelia when pH rose. Then, the pH-regulation experiments proved that 1403C mainly secreted extracellular and easily dissolved in acidic condition but precipitated and absorbed on the mycelia with the increase of broth pH. Thereby, a pH-regulation strategy was proposed and applied to accumulate 1403C on the mycelia before draw-off of fermentation broth. It significantly simplified purification process and is critical for 1403C preparation of industrial scale.

Potential role of Alternaria and Cladosporium species in canine lymphoplasmacytic rhinitis.

PubMed

Mercier, E; Peters, I R; Billen, F; Battaille, G; Clercx, C; Day, M J; Peeters, D

2013-04-01

To evaluate the possible role of Alternaria and Cladosporium species in the pathogenesis of canine lymphoplasmacytic rhinitis by comparing the amount of specific fungal DNA in nasal mucosal biopsies between dogs without nasal neoplasia and those with lymphoplasmacytic rhinitis or nasal neoplasia. Quantitative real-time polymerase chain reaction (qPCR) assays detecting DNA from Alternaria and Cladosporium fungi were applied to nasal mucosal biopsies collected from dogs with lymphoplasmacytic rhinitis (n = 8), dogs with nasal neoplasia (n = 10) and control animals (n = 10). A copy number for each sample was calculated using a standard curve of known copy number and differences amongst groups were assessed using Kruskal-Wallis tests. No significant difference was found between the groups. Low levels of Alternaria DNA (10-100 copies/PCR) were detected in one sample; very low levels of DNA (<10 copies/qPCR) were detected in 6 samples, and 21 samples were negative. Low levels of Cladosporium DNA were detected in 2 samples; very low levels of DNA in 18; and 8 were negative. Results of this study reveal that Alternaria and Cladosporium species are part of the canine nasal flora, and that these fungi are probably not involved in the pathogenesis of lymphoplasmacytic rhinitis. © 2013 British Small Animal Veterinary Association.

Aspergillus Sydowii Marine Fungal Bloom in Australian Coastal Waters, Its Metabolites and Potential Impact on Symbiodinium Dinoflagellates.

PubMed

Hayashi, Aiko; Crombie, Andrew; Lacey, Ernest; Richardson, Anthony J; Vuong, Daniel; Piggott, Andrew M; Hallegraeff, Gustaaf

2016-03-16

Dust has been widely recognised as an important source of nutrients in the marine environment and as a vector for transporting pathogenic microorganisms. Disturbingly, in the wake of a dust storm event along the eastern Australian coast line in 2009, the Continuous Plankton Recorder collected masses of fungal spores and mycelia (~150,000 spores/m³) forming a floating raft that covered a coastal area equivalent to 25 times the surface of England. Cultured A. sydowii strains exhibited varying metabolite profiles, but all produced sydonic acid, a chemotaxonomic marker for A. sydowii. The Australian marine fungal strains share major metabolites and display comparable metabolic diversity to Australian terrestrial strains and to strains pathogenic to Caribbean coral. Secondary colonisation of the rafts by other fungi, including strains of Cladosporium, Penicillium and other Aspergillus species with distinct secondary metabolite profiles, was also encountered. Our bioassays revealed that the dust-derived marine fungal extracts and known A. sydowii metabolites such as sydowic acid, sydowinol and sydowinin A adversely affect photophysiological performance (Fv/Fm) of the coral reef dinoflagellate endosymbiont Symbiodinium. Different Symbiodinium clades exhibited varying sensitivities, mimicking sensitivity to coral bleaching phenomena. The detection of such large amounts of A. sydowii following this dust storm event has potential implications for the health of coral environments such as the Great Barrier Reef.

Aspergillus Sydowii Marine Fungal Bloom in Australian Coastal Waters, Its Metabolites and Potential Impact on Symbiodinium Dinoflagellates

PubMed Central

Hayashi, Aiko; Crombie, Andrew; Lacey, Ernest; Richardson, Anthony J.; Vuong, Daniel; Piggott, Andrew M.; Hallegraeff, Gustaaf

2016-01-01

Dust has been widely recognised as an important source of nutrients in the marine environment and as a vector for transporting pathogenic microorganisms. Disturbingly, in the wake of a dust storm event along the eastern Australian coast line in 2009, the Continuous Plankton Recorder collected masses of fungal spores and mycelia (~150,000 spores/m3) forming a floating raft that covered a coastal area equivalent to 25 times the surface of England. Cultured A. sydowii strains exhibited varying metabolite profiles, but all produced sydonic acid, a chemotaxonomic marker for A. sydowii. The Australian marine fungal strains share major metabolites and display comparable metabolic diversity to Australian terrestrial strains and to strains pathogenic to Caribbean coral. Secondary colonisation of the rafts by other fungi, including strains of Cladosporium, Penicillium and other Aspergillus species with distinct secondary metabolite profiles, was also encountered. Our bioassays revealed that the dust-derived marine fungal extracts and known A. sydowii metabolites such as sydowic acid, sydowinol and sydowinin A adversely affect photophysiological performance (Fv/Fm) of the coral reef dinoflagellate endosymbiont Symbiodinium. Different Symbiodinium clades exhibited varying sensitivities, mimicking sensitivity to coral bleaching phenomena. The detection of such large amounts of A. sydowii following this dust storm event has potential implications for the health of coral environments such as the Great Barrier Reef. PMID:26999164

Airborne fungi in child day care centers in Edirne City, Turkey.

PubMed

Aydogdu, Halide; Asan, Ahmet

2008-12-01

The purpose of this study was to determine the concentration, in terms of monthly and seasonal distribution and in relation to meteorological factors, of indoor and outdoor microfungi at selected sites in several child day care centers in the city of Edirne, Turkey. Samples were collected at one month intervals over a period of 12 months between January-December 2004, by exposing petri plates containing Peptone Dextrose Agar with Rose-Bengal and Streptomycin medium to the air for 10-15 min. A total of 2,071 microfungal colonies were counted on 192 petri plates. Thirty microfungal genera (Acremonium, Alternaria, Arthrinium, Aspergillus, Bahusakala, Beauveria, Ceuthospora, Chaetomium, Cladosporium, Curvularia, Drechslera, Epicoccum, Eurotium, Fusarium, Mycotypha, Myrotechium, Paecilomyces, Penicillium, Pestalotiopsis, Phoma, Ramichloridium, Rhizopus, Scopulariopsis, Stachybotrys, Stemphylium, Torula, Trichoderma, Trichothecium, Ulocladium, Verticillium) and 75 microfungal species were isolated from the air indoor and outdoor of the day care centers. The dominant microfungal genera were Cladosporium, Penicillium and Alternaria (44.11%, 18.94%, 14.67% of the total respectively), while the genus with the most species richness was Penicillium (26 species). Alternaria, Cladosporium, Penicillium and non-sporulating microfungi were found every month. Cladosporium was the dominant genus in both indoor and outdoor air. Although the predominant genus was the same in both indoor and outdoor air, Cladosporium was followed by Penicillium, Alternaria and Aspergillus genera in indoor air and by Alternaria, Penicillium and Aspergillus genera in outdoor air. While a positive correlation was found between the concentration of monthly outdoor microfungi and monthly average temperature, a negative correlation was found between the concentration of monthly outdoor microfungi and monthly average wind velocity. Also, some relationships were found between the monthly concentrations of the most predominant microfungal genera (Cladosporium, Penicillium and Alternaria) and various meteorological factors.

Trichorenins A-C, Algicidal Tetracyclic Metabolites from the Marine-Alga-Epiphytic Fungus Trichoderma virens Y13-3.

PubMed

Shi, Zhen-Zhen; Miao, Feng-Ping; Fang, Sheng-Tao; Yin, Xiu-Li; Ji, Nai-Yun

2018-04-27

Three novel polyketide-like metabolites, trichorenins A-C (1-3), with a unique tetracyclic carbon skeleton were obtained from the culture of Trichoderma virens Y13-3, an epiphyte of the marine red alga Gracilaria vermiculophylla. Their structures and relative configurations were established by analysis of 1D/2D NMR and MS data, and their absolute configurations were unequivocally assigned by X-ray diffraction and ECD spectra aided by quantum chemical calculations. Compounds 1-3 exhibited potent inhibition against two marine phytoplankton species, Chattonella marina and Karlodinium veneficum.

DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

EPA Science Inventory

The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

Potent Anti-Inflammatory Activity of Pyrenocine A Isolated from the Marine-Derived Fungus Penicillium paxilli Ma(G)K

PubMed Central

Toledo, Thaís Regina; Dejani, Naiara N.; Monnazzi, Luis Gustavo Silva; Kossuga, Miriam H.; Berlinck, Roberto G. S.; Sette, Lara D.; Medeiros, Alexandra I.

2014-01-01

Very little is known about the immunomodulatory potential of secondary metabolites isolated from marine microorganisms. In the present study, we characterized pyrenocine A, which is produced by the marine-derived fungus Penicillium paxilli Ma(G)K and possesses anti-inflammatory activity. Pyrenocine A was able to suppress, both pretreatment and posttreatment, the LPS-induced activation of macrophages via the inhibition of nitrite production and the synthesis of inflammatory cytokines and PGE2. Pyrenocine A also exhibited anti-inflammatory effects on the expression of receptors directly related to cell migration (Mac-1) as well as costimulatory molecules involved in lymphocyte activation (B7.1). Nitrite production was inhibited by pyrenocine A in macrophages stimulated with CpG but not Poly I:C, suggesting that pyrenocine A acts through the MyD88-dependent intracellular signaling pathway. Moreover, pyrenocine A is also able to inhibit the expression of genes related to NFκB-mediated signal transduction on macrophages stimulated by LPS. Our results indicate that pyrenocine A has promissory anti-inflammatory properties and additional experiments are necessary to confirm this finding in vivo model. PMID:24574582

Relationships between airborne fungal spore concentration of Cladosporium and the summer climate at two sites in Britain

NASA Astrophysics Data System (ADS)

Hollins, P. D.; Kettlewell, P. S.; Atkinson, M. D.; Stephenson, D. B.; Corden, J. M.; Millington, W. M.; Mullins, J.

Cladosporium conidia have been shown to be important aeroallergens in many regions throughout the world, but annual spore concentrations vary considerably between years. Understanding these annual fluctuations may be of value in the clinical management of allergies. This study investigates the number of days in summer when spore concentration exceeds the allergenic threshold in relation to regional temperature and precipitation at two sites in England and Wales over 27 years. Results indicate that number of days in summer when the Cladosporium spores are above the allergenic concentration is positively correlated with regional temperature and negatively correlated with precipitation for both sites over the study period. Further analysis used a winter North Atlantic Oscillation index to explore the potential for long-range forecasting of the aeroallergen. For both spore measurement sites, a positive correlation exists between the winter North Atlantic Oscillation index and the number of days in summer above the allergenic threshold for Cladosporium spore concentration.

Morphological and molecular characterization of Cladosporium cladosporioides species complex causing pecan tree leaf spot.

PubMed

Walker, C; Muniz, M F B; Rolim, J M; Martins, R R O; Rosenthal, V C; Maciel, C G; Mezzomo, R; Reiniger, L R S

2016-09-16

The objective of this study was to characterize species of the Cladosporium cladosporioides complex isolated from pecan trees (Carya illinoinensis) with symptoms of leaf spot, based on morphological and molecular approaches. Morphological attributes were assessed using monosporic cultures on potato dextrose agar medium, which were examined for mycelial growth, sporulation, color, and conidia and ramoconidia size. Molecular characterization comprised isolation of DNA and subsequent amplification of the translation elongation factor 1α (TEF-1α) region. Three species of the C. cladosporioides complex were identified: C. cladosporioides, Cladosporium pseudocladosporioides, and Cladosporium subuliforme. Sporulation was the most important characteristic differentiating species of this genus. However, morphological features must be considered together with molecular analysis, as certain characters are indistinguishable between species. TEF-1αcan be effectively used to identify and group isolates belonging to the C. cladosporioides complex. The present study provides an important example of a methodology to ascertain similarity between isolates of this complex causing leaf spot in pecan trees, which should facilitate future pathogenicity studies.

Production of New Cladosporin Analogues by Reconstitution of the Polyketide Synthases Responsible for the Biosynthesis of this Antimalarial Agent.

PubMed

Cochrane, Rachel V K; Sanichar, Randy; Lambkin, Gareth R; Reiz, Béla; Xu, Wei; Tang, Yi; Vederas, John C

2016-01-11

The antimalarial agent cladosporin is a nanomolar inhibitor of the Plasmodium falciparum lysyl-tRNA synthetase, and exhibits activity against both blood- and liver-stage infection. Cladosporin can be isolated from the fungus Cladosporium cladosporioides, where it is biosynthesized by a highly reducing (HR) and a non-reducing (NR) iterative type I polyketide synthase (PKS) pair. Genome sequencing of the host organism and subsequent heterologous expression of these enzymes in Saccharomyces cerevisiae produced cladosporin, confirming the identity of the putative gene cluster. Incorporation of a pentaketide intermediate analogue indicated a 5+3 assembly by the HR PKS Cla2 and the NR PKS Cla3 during cladosporin biosynthesis. Advanced-intermediate analogues were synthesized and incorporated by Cla3 to furnish new cladosporin analogues. A putative lysyl-tRNA synthetase resistance gene was identified in the cladosporin gene cluster. Analysis of the active site emphasizes key structural features thought to be important in resistance to cladosporin. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of a Freeze-Dried Fungal Wettable Powder Preparation Able to Biodegrade Chlorpyrifos on Vegetables

PubMed Central

Chen, Shaohua; Xiao, Ying; Hu, Meiying; Zhong, Guohua

2014-01-01

Continuous use of the pesticide chlorpyrifos has resulted in harmful contaminations in environment and species. Based on a chlorpyrifos-degrading fungus Cladosporium cladosporioides strain Hu-01 (collection number: CCTCC M 20711), a fungal wettable powder preparation was developed aiming to efficiently remove chlorpyrifos residues from vegetables. The formula was determined to be 11.0% of carboxymethyl cellulose-Na, 9.0% of polyethylene glycol 6000, 5.0% of primary alcohol ethoxylate, 2.5% of glycine, 5.0% of fucose, 27.5% of kaolin and 40% of freeze dried fungi by response surface methodology (RSM). The results of quality inspection indicated that the fungal preparation could reach manufacturing standards. Finally, the degradation of chlorpyrifos by this fungal preparation was determined on pre-harvest cabbage. Compared to the controls without fungal preparation, the degradation of chlorpyrifos on cabbages, which was sprayed with the fungal preparation, was up to 91% after 7 d. These results suggested this freeze-dried fungal wettable powder may possess potential for biodegradation of chlorpyrifos residues on vegetables and provide a potential strategy for food and environment safety against pesticide residues. PMID:25061758

Development of a freeze-dried fungal wettable powder preparation able to biodegrade chlorpyrifos on vegetables.

PubMed

Liu, Jie; He, Yue; Chen, Shaohua; Xiao, Ying; Hu, Meiying; Zhong, Guohua

2014-01-01

Continuous use of the pesticide chlorpyrifos has resulted in harmful contaminations in environment and species. Based on a chlorpyrifos-degrading fungus Cladosporium cladosporioides strain Hu-01 (collection number: CCTCC M 20711), a fungal wettable powder preparation was developed aiming to efficiently remove chlorpyrifos residues from vegetables. The formula was determined to be 11.0% of carboxymethyl cellulose-Na, 9.0% of polyethylene glycol 6000, 5.0% of primary alcohol ethoxylate, 2.5% of glycine, 5.0% of fucose, 27.5% of kaolin and 40% of freeze dried fungi by response surface methodology (RSM). The results of quality inspection indicated that the fungal preparation could reach manufacturing standards. Finally, the degradation of chlorpyrifos by this fungal preparation was determined on pre-harvest cabbage. Compared to the controls without fungal preparation, the degradation of chlorpyrifos on cabbages, which was sprayed with the fungal preparation, was up to 91% after 7 d. These results suggested this freeze-dried fungal wettable powder may possess potential for biodegradation of chlorpyrifos residues on vegetables and provide a potential strategy for food and environment safety against pesticide residues.

Recognitional specificity and evolution in the tomato-Cladosporium fulvum pathosystem.

PubMed

Wulff, B B H; Chakrabarti, A; Jones, D A

2009-10-01

The interactions between plants and many biotrophic or hemibiotrophic pathogens are controlled by receptor proteins in the host and effector proteins delivered by the pathogen. Pathogen effectors facilitate pathogen growth through the suppression of host defenses and the manipulation of host metabolism, but recognition of a pathogen-effector protein by a host receptor enables the host to activate a suite of defense mechanisms that limit pathogen growth. In the tomato (Lycopersicon esculentum syn. Solanum lycopersicum)-Cladosporium fulvum (leaf mold fungus syn. Passalora fulva) pathosystem, the host receptors are plasma membrane-anchored, leucine-rich repeat, receptor-like proteins encoded by an array of Cf genes conferring resistance to C. fulvum. The pathogen effectors are mostly small, secreted, cysteine-rich, but otherwise largely dissimilar, extracellular proteins encoded by an array of avirulence (Avr) genes, so called because of their ability to trigger resistance and limit pathogen growth when the corresponding Cf gene is present in tomato. A number of Cf and Avr genes have been isolated, and details of the complex molecular interplay between tomato Cf proteins and C. fulvum effector proteins are beginning to emerge. Each effector appears to have a different role; probably most bind or modify different host proteins, but at least one has a passive role masking the pathogen. It is, therefore, not surprising that each effector is probably detected in a distinct and specific manner, some by direct binding, others as complexes with host proteins, and others via their modification of host proteins. The two papers accompanying this review contribute further to our understanding of the molecular specificity underlying effector perception by Cf proteins. This review, therefore, focuses on our current understanding of recognitional specificity in the tomato-C. fulvum pathosystem and highlights some of the critical questions that remain to be addressed. It also addresses the evolutionary causes and consequences of this specificity.

Molecular investigations of food-borne Cladosporium and Fusarium species from Nigeria

USDA-ARS?s Scientific Manuscript database

A sampling of contaminated foodstuffs throughout southwest Nigeria yielded three fungal isolates belonging to the genus Fusarium and two fungal isolates belonging to the genus Cladosporium. In this study we subjected these isolates to various molecular investigations. We were able to confirm or refi...

Three new asperentin derivatives from the algicolous fungus Aspergillus sp. F00785.

PubMed

Tang, Qian; Guo, Kai; Li, Xiao-Yang; Zheng, Xiu-Ying; Kong, Xiang-Jian; Zheng, Zhong-Hui; Xu, Qing-Yan; Deng, Xianming

2014-12-15

Three new asperentin-type compounds, 6-O-α-d-ribosylasperentin (1) and 6-O-α-d-ribosyl-8-O-methylasperentin (2) and 5-hydroxyl-6-O-methylasperentin (3), along with asperentin (4) and its known analogues (5-9), were isolated from a halotolerant Aspergillus sp. strain F00785, an endotrophic fungus from marine alga. Their structures were determined using extensive NMR and HRESIMS spectroscopic analysis, including the X-ray crystallographic data for the assignment of the absolute configurations of compound 9. Compound 4 exhibited highly potent inhibitory activity against crop pathogens, Colletotrichum gleosporioides Penz. and Colletotrichum gleosporioides (Penz.) Sacc.

Bioprospecting Chemical Diversity and Bioactivity in a Marine Derived Aspergillus terreus.

PubMed

Adpressa, Donovon A; Loesgen, Sandra

2016-02-01

A comparative metabolomic study of a marine derived fungus (Aspergillus terreus) grown under various culture conditions is presented. The fungus was grown in eleven different culture conditions using solid agar, broth cultures, or grain based media (OSMAC). Multivariate analysis of LC/MS data from the organic extracts revealed drastic differences in the metabolic profiles and guided our subsequent isolation efforts. The compound 7-desmethylcitreoviridin was isolated and identified, and is fully described for the first time. In addition, 16 known fungal metabolites were also isolated and identified. All compounds were elucidated by detailed spectroscopic analysis and tested for antibacterial activities against five human pathogens and tested for cytotoxicity. This study demonstrates that LC/MS based multivariate analysis provides a simple yet powerful tool to analyze the metabolome of a single fungal strain grown under various conditions. This approach allows environmentally-induced changes in metabolite expression to be rapidly visualized, and uses these differences to guide the discovery of new bioactive molecules. Copyright © 2016 Verlag Helvetica Chimica Acta AG, Zürich.

Anti-Inflammatory Activity of Tanzawaic Acid Derivatives from a Marine-Derived Fungus Penicillium steckii 108YD142

PubMed Central

Shin, Hee Jae; Pil, Gam Bang; Heo, Soo-Jin; Lee, Hyi-Seung; Lee, Jong Seok; Lee, Yeon-Ju; Lee, Jihoon; Won, Ho Shik

2016-01-01

Chemical investigation of a marine-derived fungus, Penicillium steckii 108YD142, resulted in the discovery of a new tanzawaic acid derivative, tanzawaic acid Q (1), together with four known analogues, tanzawaic acids A (2), C (3), D (4), and K (5). The structures of tanzawaic acid derivatives 1–5 were determined by the detailed analysis of 1D, 2D NMR and LC-MS data, along with chemical methods and literature data analysis. These compounds significantly inhibited nitric oxide (NO) production and the new tanzawaic acid Q (1) inhibited the lipopolysaccharide (LPS)-induced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) proteins and mRNA expressions in RAW 264.7 macrophages. Additionally, compound 1 reduced the mRNA levels of inflammatory cytokines. Taken together, the results of this study demonstrated that the new tanzawaic acid derivative inhibits LPS-induced inflammation. This is the first report on the anti-inflammatory activity of tanzawaic acid Q (1). PMID:26761016

Secondary metabolites from a marine-derived endophytic fungus Penicillium chrysogenum QEN-24S.

PubMed

Gao, Shu-Shan; Li, Xiao-Ming; Du, Feng-Yu; Li, Chun-Shun; Proksch, Peter; Wang, Bin-Gui

2010-12-27

Penicillium chrysogenum QEN-24S, an endophytic fungus isolated from an unidentified marine red algal species of the genus Laurencia, displayed inhibitory activity against the growth of pathogen Alternaria brassicae in dual culture test. Chemical investigation of this fungal strain resulted in the isolation of four new (1-3 and 5) and one known (4) secondary metabolites. Their structures were identified as two polyketide derivatives penicitides A and B (1 and 2), two glycerol derivatives 2-(2,4-dihydroxy-6-methylbenzoyl)-glycerol (3) and 1-(2,4-dihydroxy-6-methylbenzoyl)- glycerol (4), and one monoterpene derivative penicimonoterpene (5). Penicitides A and B (1 and 2) feature a unique 10-hydroxy- or 7,10-dihydroxy-5,7-dimethylundecyl moiety substituting at C-5 of the α-tetrahydropyrone ring, which is not reported previously among natural products. Compound 5 displayed potent activity against the pathogen A. brassicae, while compound 1 exhibited moderate cytotoxic activity against the human hepatocellular liver carcinoma cell line.

Exploring the chemodiversity and biological activities of the secondary metabolites from the marine fungus Neosartorya pseudofischeri.

PubMed

Liang, Wan-Ling; Le, Xiu; Li, Hou-Jin; Yang, Xiang-Ling; Chen, Jun-Xiong; Xu, Jun; Liu, Huan-Liang; Wang, Lai-You; Wang, Kun-Teng; Hu, Kun-Chao; Yang, De-Po; Lan, Wen-Jian

2014-11-24

The production of fungal metabolites can be remarkably influenced by various cultivation parameters. To explore the biosynthetic potentials of the marine fungus, Neosartorya pseudofischeri, which was isolated from the inner tissue of starfish Acanthaster planci, glycerol-peptone-yeast extract (GlyPY) and glucose-peptone-yeast extract (GluPY) media were used to culture this fungus. When cultured in GlyPY medium, this fungus produced two novel diketopiperazines, neosartins A and B (1 and 2), together with six biogenetically-related known diketopiperazines,1,2,3,4-tetrahydro-2, 3-dimethyl-1,4-dioxopyrazino[1,2-a]indole (3), 1,2,3,4-tetrahydro-2-methyl-3-methylen e-1,4-dioxopyrazino[1,2-a]indole (4), 1,2,3,4-tetrahydro-2-methyl-1,3,4-trioxopyrazino[1,2-a] indole (5), 6-acetylbis(methylthio)gliotoxin (10), bisdethiobis(methylthio)gliotoxin (11), didehydrobisdethiobis(methylthio)gliotoxin (12) and N-methyl-1H-indole-2-carboxamide (6). However, a novel tetracyclic-fused alkaloid, neosartin C (14), a meroterpenoid, pyripyropene A (15), gliotoxin (7) and five known gliotoxin analogues, acetylgliotoxin (8), reduced gliotoxin (9), 6-acetylbis(methylthio)gliotoxin (10), bisdethiobis(methylthio) gliotoxin (11) and bis-N-norgliovictin (13), were obtained when grown in glucose-containing medium (GluPY medium). This is the first report of compounds 3, 4, 6, 9, 10 and 12 as naturally occurring. Their structures were determined mainly by MS, 1D and 2D NMR data. The possible biosynthetic pathways of gliotoxin-related analogues and neosartin C were proposed. The antibacterial activity of compounds 2-14 and the cytotoxic activity of compounds 4, 5 and 7-13 were evaluated. Their structure-activity relationships are also preliminarily discussed.

Chemical constituents of the fermentation broth of the marine-derived fungus Penicillium roqueforti.

PubMed

Mioso, Roberto; Marante, Francisco Javier Toledo; Laguna, Irma Herrera Bravo de

2015-01-01

The filamentous fungus Penicillium roqueforti is a well-known multifunctional cell factory of high added-value biomolecules. The objective of this work was to carry out a detailed analysis of the metabolites present in the culture broth of a new marine-derived Penicillium roqueforti strain isolated in the Canary Islands, Spain. The fungal biomass production was carried out in liquid-state fermentation, and after 10-12 days of incubation at 22-25°C, the supernatant mycelia was separated by filtration, and the culture broth (12l) was stored in a refrigerator at 4°C for a subsequent liquid-liquid extraction with dichloromethane (3×), in accordance with the modified Kupchan method. The volatile and semi-volatile organic compounds were separated by chromatography and analyzed using GC-MS and NMR spectroscopy analyses. Several volatile organic compounds involved in the fatty acid pathway were identified: a terpenoid, a cyclic dipeptide, phthalates, and an alkyl adipate. In addition, three categories of non-volatile compounds (alkanes, fatty acids and 1-alkanols) were identified by spectroscopy. The results show that the fermented broth of this fungal strain has no mycotoxins under the culture conditions applied. It is hoped that this chemo-specific information will offer critical input for improving the biotechnological applications of this filamentous fungus. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Chaetopyranin, a benzaldehyde derivative, and other related metabolites from Chaetomium globosum, an endophytic fungus derived from the marine red alga Polysiphonia urceolata.

PubMed

Wang, Song; Li, Xiao-Ming; Teuscher, Franka; Li, Dong-Li; Diesel, Arnulf; Ebel, Rainer; Proksch, Peter; Wang, Bin-Gui

2006-11-01

Cultivation of the endophytic fungus Chaetomium globosum, which was isolated from the inner tissue of the marine red alga Polysiphonia urceolata, resulted in the isolation of chaetopyranin (1), a new benzaldehyde secondary metabolite. Ten known compounds were also isolated, including two benzaldehyde congeners, 2-(2',3-epoxy-1',3'-heptadienyl)-6-hydroxy-5-(3-methyl-2-butenyl)benzaldehyde (2) and isotetrahydroauroglaucin (3), two anthraquinone derivatives, erythroglaucin (4) and parietin (5), five asperentin derivatives including asperentin (6, also known as cladosporin), 5'-hydroxy-asperentin-8-methylether (7), asperentin-8-methyl ether (8), 4'-hydroxyasperentin (9), and 5'-hydroxyasperentin (10), and the prenylated diketopiperazine congener neoechinulin A (11). The structures of these compounds were determined on the basis of their spectroscopic data analysis (1H, 13C, 1H-1H COSY, HMQC, and HMBC NMR, as well as low- and high-resolution mass experiments). To our knowledge, compound 1 represents the first example of a 2H-benzopyran derivative of marine algal-derived fungi as well as of the fungal genus Chaetomium. Each isolate was tested for its DPPH (1,1-diphenyl-2-picrylhydrazyl) radical-scavenging property. Compounds 1-4 were found to have moderate activity. Chaetopyranin (1) also exhibited moderate to weak cytotoxic activity toward several tumor cell lines.

Secondary Metabolites from the Culture of the Marine Sponge-Associated Fungi Talaromyces tratensis and Sporidesmium circinophorum.

PubMed

Buttachon, Suradet; May Zin, War War; Dethoup, Tida; Gales, Luís; Pereira, José A; Silva, Artur M S; Kijjoa, Anake

2016-06-01

Wortmin (1), meso-1,4-bis(4-methoxybenzyl)-2,3-butanediol (2), and a new isocoumarin derivative tratenopyrone (3) were isolated from the marine sponge-associated fungus Talaromyces tratensis KUFA 0091. A new diphenyl ether derivative, circinophoric acid (4), was isolated, together with the previously reported anthraquinones catenarin and physcion, the benzophenone monomethylsoluchrin, and β-ergosterol-5,8-endoperoxide, from the marine sponge-associated fungus Sporidesmium circinophorum KUFA 0043. The structures of the new compounds were established based on an extensive analysis of 1D and 2D NMR spectra, and, in the case of compounds 2-4, also by X-ray analysis. All of the isolated compounds were tested for their antibacterial activity against Gram-positive and Gram-negative bacteria, and multidrug-resistant isolates from the environment, as well as for their anti-quorum sensing based on the pigment production of Chromobacterium violaceum ATCC 31523. None of the compounds exhibited either antibacterial (MIC > 256 µg/mL) or anti-quorum sensing activities. The compounds were also inactive in the antifungal (MIC > 512 µg/mL) and cancer cell line (GI50 > 150 µM) assays. Georg Thieme Verlag KG Stuttgart · New York.

[Antioxidative activities of two metabolites of cultured marine fungus, Halorosellinia oceanicum 323 in vitro].

PubMed

Luo, Jinghui; Yang, Yingbao; Lin, Yongcheng; Chen, Zhiliang; Jiang, Guangce

2004-03-01

To investigate the antioxidative effects of 323-A and 323-B, two isomers extracted from the metabolites of cultured marine fungus, Halorosellinia oceanicum 323 in vitro. NADH-PMS-NBT system was used to produce superoxide free radical (O2*-), EDTANa2-Fe(II)-H2O2 system to generate hydroxyl free radical (*OH), H2O2 to stimulate oxidative hemolysis of erythrocytes of rats, Cys-Fe2+ to induce malondialdehyde (MDA) production in homogenates, and ferrous-ascorbic acid system to increase the turbidity of mitochondria suspension in the liver of rats. And the antioxidative activities of 323-A and 323-B were studied. 323-A and 323-B not only scavenge O2*- and *OH produced by the experimental systems directly, but also inhibit H2O2 stimulated oxidative hemolysis of erythrocytes of rats, depress MDA production in homogenates induced by Cys-Fe2+ system, and reduce the turbidity of mitochondria suspension in the liver of rats increased by ferrous-ascorbic acid system in vitro. 323-A and 323-B showed comprehensive cleaning actions on free radicals and protective effects on the functions of tissues and cells against oxidative lesion. The results suggested that the marine microorganic metabolites might be a novel and profound source of antioxidative reagents.

An Unusual Conformational Isomer of Verrucosidin Backbone from a Hydrothermal Vent Fungus, Penicillium sp. Y-50-10.

PubMed

Pan, Chengqian; Shi, Yutong; Auckloo, Bibi Nazia; Chen, Xuegang; Chen, Chen-Tung Arthur; Tao, Xinyi; Wu, Bin

2016-08-18

A new verrucosidin derivative, methyl isoverrucosidinol (1), was isolated from the marine fungus Penicillium sp. Y-50-10, dwelling in sulfur rich sediment in the Kueishantao hydrothermal vents off Taiwan. The structure was established by spectroscopic means including HRMS and 2D-NMR spectroscopic analysis. The absolute configuration was defined mainly by comparison of quantum chemical TDDFT calculated and experimental ECD spectra. Among hitherto known compounds with a verrucosidine backbone isolated from natural resource, compound 1 represents the first example of a new conformational isomer of its skeleton, exhibiting antibiotic activity against Bacillus subtilis with MIC value 32 μg/mL.

Three New Asperentin Derivatives from the Algicolous Fungus Aspergillus sp. F00785

PubMed Central

Tang, Qian; Guo, Kai; Li, Xiao-Yang; Zheng, Xiu-Ying; Kong, Xiang-Jian; Zheng, Zhong-Hui; Xu, Qing-Yan; Deng, Xianming

2014-01-01

Three new asperentin-type compounds, 6-O-α-d-ribosylasperentin (1) and 6-O-α-d-ribosyl-8-O-methylasperentin (2) and 5-hydroxyl-6-O-methylasperentin (3), along with asperentin (4) and its known analogues (5–9), were isolated from a halotolerant Aspergillus sp. strain F00785, an endotrophic fungus from marine alga. Their structures were determined using extensive NMR and HRESIMS spectroscopic analysis, including the X-ray crystallographic data for the assignment of the absolute configurations of compound 9. Compound 4 exhibited highly potent inhibitory activity against crop pathogens, Colletotrichum gleosporioides Penz. and Colletotrichum gleosporioides (Penz.) Sacc. PMID:25517217

Colonization by Cladosporium spp. of painted metal surfaces associated with heating and air conditioning systems

NASA Technical Reports Server (NTRS)

Ahearn, D. G.; Simmons, R. B.; Switzer, K. F.; Ajello, L.; Pierson, D. L.

1991-01-01

Cladosporium cladosporioides and C. hebarum colonized painted metal surfaces of covering panels and register vents of heating, air conditioning and ventilation systems. Hyphae penetrated the paint film and developed characteristic conidiophores and conidia. The colonies were tightly appressed to the metal surface and conidia were not readily detectable via standard air sampling procedures.

Occurrence and infection of Cladosporium, Fusarium, Epicoccum and Aureobasidium in withered rotten grapes during post-harvest dehydration.

PubMed

Lorenzini, Marilinda; Zapparoli, Giacomo

2015-11-01

Fungi like Cladosporium, Fusarium, Epicoccum and Aureobasidium can occur on withered grapes causing spoilage of passito wine. There is little or no information on the pathogenic role of these fungi. This study describes the isolation, incidence and identification of several isolates from different withered rotten grapes. Representative isolates grouped in several phenotypes were identified by phylogenetic analysis of internal transcribed spacer, actin or elongation factor gene sequences. Isolates of Cladosporium and Fusarium were ascribed to different species, of these C. ramotenellum, C. halotolerans and F. graminearum were isolated from Vitis vinifera for the first time. All Epicoccum and Aureobasidium isolates belonged to E. nigrum and A. pullulans, respectively. Random amplified DNA polymorphism analysis showed high level of heterogenicity among Epicoccum and Fusarium isolates. Infection assays were carried out to evaluate infectivity in some strains under different withering conditions. Fusarium spp. strains had similar infectivity, while significant variability was observed among Cladosporium spp. and E. nigrum strains. A. pullulans resulted particularly infective. This study provided insights into the occurrence and infection of these fungi in fruit-drying rooms with important implications towards control management during the withering.

Special issue Oceans and Humans Health: the ecology of marine opportunists.

PubMed

Burge, Colleen A; Kim, Catherine J S; Lyles, Jillian M; Harvell, C Drew

2013-05-01

Opportunistic marine pathogens, like opportunistic terrestrial pathogens, are ubiquitous in the environment (waters, sediments, and organisms) and only cause disease in immune-compromised or stressed hosts. In this review, we discuss four host-pathogen interactions within the marine environment that are typically considered opportunistic: sea fan coral-fungus, eelgrass-Labyrinthula zosterae, sea fan-Labyrinthulomycetes, and hard clam-Quahog Parasite Unknown with particular focus on disease ecology, parasite pathology, host response, and known associated environmental conditions. Disease is a natural part of all ecosystems; however, in some cases, a shift in the balance between the host, pathogen, and the environment may lead to epizootics in natural or cultured populations. In marine systems, host-microbe interactions are less understood than their terrestrial counterparts. The biological and physical changes to the world's oceans, coupled with other anthropogenic influences, will likely lead to more opportunistic diseases in the marine environment.

Fungicide contamination reduces beneficial fungi in bee bread based on an area-wide field study in honey bee, Apis mellifera, colonies.

PubMed

Yoder, Jay A; Jajack, Andrew J; Rosselot, Andrew E; Smith, Terrance J; Yerke, Mary Clare; Sammataro, Diana

2013-01-01

Fermentation by fungi converts stored pollen into bee bread that is fed to honey bee larvae, Apis mellifera, so the diversity of fungi in bee bread may be related to its food value. To explore the relationship between fungicide exposure and bee bread fungi, samples of bee bread collected from bee colonies pollinating orchards from 7 locations over 2 years were analyzed for fungicide residues and fungus composition. There were detectable levels of fungicides from regions that were sprayed before bloom. An organic orchard had the highest quantity and variety of fungicides, likely due to the presence of treated orchards within bees' flight range. Aspergillus, Penicillium, Rhizopus, and Cladosporium (beneficial fungi) were the primary fungal isolates found, regardless of habitat differences. There was some variation in fungal components amongst colonies, even within the same apiary. The variable components were Absidia, Alternaria, Aureobasidium, Bipolaris, Fusarium, Geotrichum, Mucor, Nigrospora, Paecilomyces, Scopulariopsis, and Trichoderma. The number of fungal isolates was reduced as an effect of fungicide contamination. Aspergillus abundance was particularly affected by increased fungicide levels, as indicated by Simpson's diversity index. Bee bread showing fungicide contamination originated from colonies, many of which showed chalkbrood symptoms.

Pseudaboydins A and B: Novel Isobenzofuranone Derivatives from Marine Fungus Pseudallescheria boydii Associated with Starfish Acanthaster planci

PubMed Central

Lan, Wen-Jian; Liu, Wei; Liang, Wan-Ling; Xu, Zeng; Le, Xiu; Xu, Jun; Lam, Chi-Keung; Yang, De-Po; Li, Hou-Jin; Wang, Lai-You

2014-01-01

Two novel isobenzofuranone derivatives, pseudaboydins A (1) and B (2), along with five known compounds, including (R)-2-(2-hydroxypropan-2-yl)-2,3-dihydro-5-hydroxybenzofuran (3), (R)-2-(2-hydroxypropan-2-yl)-2,3-dihydro-5-methoxybenzofuran (4), 3,3′-dihydroxy-5,5′-dimethyldiphenyl ether (5), 3-(3-methoxy-5-methylphenoxy)-5-methylphenol (6) and (−)-regiolone (7), were isolated from the culture broth of the marine fungus, Pseudallescheria boydii, associated with the starfish, Acanthaster planci. Their structures were elucidated primarily based on NMR and MS data. The absolute configurations of 1–4 were determined by CD spectroscopy and single-crystal X-ray diffraction studies. The cytotoxic and antibacterial activities of 1–4 were evaluated. Pseudaboydin A (1) showed moderate cytotoxic activity against human nasopharyngeal carcinoma cell line HONE1, human nasopharyngeal carcinoma cell line SUNE1 and human glandular lung cancer cell line GLC82 with IC50 values of 37.1, 46.5 and 87.2 μM, respectively. PMID:25026266

Identification and bioactivity of compounds from the fungus Penicillium sp. CYE-87 isolated from a marine tunicate.

PubMed

Shaala, Lamiaa A; Youssef, Diaa T A

2015-03-25

In the course of our continuous interest in identifying bioactive compounds from marine microbes, we have investigated a tunicate-derived fungus, Penicillium sp. CYE-87. A new compound with the 1,4-diazepane skeleton, terretrione D (2), together with the known compounds, methyl-2-([2-(1H-indol-3-yl)ethyl]carbamoyl)acetate (1), tryptamine (3), indole-3-carbaldehyde (4), 3,6-diisobutylpyrazin-2(1H)-one (5) and terretrione C (6), were isolated from Penicillium sp. CYE-87. The structures of the isolated compounds were established by spectral analysis, including 1D (1H, 13C) and 2D (COSY, multiplicity edited-HSQC and HMBC) NMR and HRESIMS, as well as comparison of their NMR data with those in the literature. The compounds were evaluated for their antimigratory activity against the human breast cancer cell line (MDA-MB-231) and their antiproliferation activity against HeLa cells. Compounds 2 and 6 showed significant antimigratory activity against MDA-MB-231, as well as antifungal activity against C. albicans.

Identification and Bioactivity of Compounds from the Fungus Penicillium sp. CYE-87 Isolated from a Marine Tunicate

PubMed Central

Shaala, Lamiaa A.; Youssef, Diaa T. A.

2015-01-01

In the course of our continuous interest in identifying bioactive compounds from marine microbes, we have investigated a tunicate-derived fungus, Penicillium sp. CYE-87. A new compound with the 1,4-diazepane skeleton, terretrione D (2), together with the known compounds, methyl-2-([2-(1H-indol-3-yl)ethyl]carbamoyl)acetate (1), tryptamine (3), indole-3-carbaldehyde (4), 3,6-diisobutylpyrazin-2(1H)-one (5) and terretrione C (6), were isolated from Penicillium sp. CYE-87. The structures of the isolated compounds were established by spectral analysis, including 1D (1H, 13C) and 2D (COSY, multiplicity edited-HSQC and HMBC) NMR and HRESIMS, as well as comparison of their NMR data with those in the literature. The compounds were evaluated for their antimigratory activity against the human breast cancer cell line (MDA-MB-231) and their antiproliferation activity against HeLa cells. Compounds 2 and 6 showed significant antimigratory activity against MDA-MB-231, as well as antifungal activity against C. albicans. PMID:25815893

[Study on secondary metabolites of marine fungus Penicillium sp. FS60 from the South China Sea].

PubMed

Zhang, Ling; Li, Dong-Li; Chen, Yu-Chan; Tao, Mei-Hua; Zhang, Wei-Min

2012-07-01

To study the secondary metabolites of the marine fungus Penicillium sp. FS60 from the South China Sea and their cytotoxicities. The compounds were isolated from the culture of strain FS60 by various chromatographic methods (silica gel, reverse silica gel, Sephadex-LH20, preparative TLC, HPLC and PTLC) and recrystallization. Their structures were identified by extensive analysis of their spectroscopic data. Compounds were tested for their cytotoxicities against SF-268, MCF-7, and NCI-H460 cell lines by SRB method. While, Compounds were tested for their antibacterial activities against S. aureus, E. coli and P. aeruginosa. Seven compounds were isolated from the culture and identified as methyl 2,4-dihydroxy-3,5,6-trimethylbenzoate (1), 4-hydroxyacetophenone (2), 5-hydroxymethyl-furoic acid (3), isochromophilones VIII (4), ergosterol (5), ergosterol peroxide (6), and cerevisterol (7). Compound 1 is isolated from the genus Penicillium for the first time. Compound 3 is demonstrated to have significant inhibition against S. aureus and P. aeruginosa. Compound 4 is demonstrated to have significant inhibition against the three cell lines.

Application of response surface methodology for rapid chrysene biodegradation by newly isolated marine-derived fungus Cochliobolus lunatus strain CHR4D.

PubMed

Bhatt, Jwalant K; Ghevariya, Chirag M; Dudhagara, Dushyant R; Rajpara, Rahul K; Dave, Bharti P

2014-11-01

For the first time, Cochliobolus lunatus strain CHR4D, a marine-derived ascomycete fungus isolated from historically contaminated crude oil polluted shoreline of Alang-Sosiya ship-breaking yard, at Bhavnagar coast, Gujarat has been reported showing the rapid and enhanced biodegradation of chrysene, a four ringed high molecular weight (HMW) polycyclic aromatic hydrocarbon (PAH). Mineral Salt Broth (MSB) components such as ammonium tartrate and glucose along with chrysene, pH and trace metal solution have been successfully optimized by Response Surface Methodology (RSM) using central composite design (CCD). A validated, two-step optimization protocol has yielded a substantial 93.10% chrysene degradation on the 4(th) day, against unoptimized 56.37% degradation on the 14(th) day. The results depict 1.65 fold increase in chrysene degradation and 1.40 fold increase in biomass with a considerable decrement in time. Based on the successful laboratory experiments, C. lunatus strain CHR4D can thus be predicted as a potential candidate for mycoremediation of HMW PAHs impacted environments.

Microbiological Evaluation of Aviation Fuel Storage, Dispensing and Aircraft Systems

DTIC Science & Technology

1974-11-01

Penicillium sp . were the most consistently observed fungal contaminants. These microbiological analyses of the 26...unidentified 15 > 300 bacterial colonies 16 1 Alternaria sp . 17 1 Epicoccum sp . 18 1 Cytosporella U. 19 8 Penicillium M., 3 Cladosporium sp ., 1...Curvularia sp ., 1 Zygodesmus sp ., several bacteria colonies 20 5 Penicillium sp ., 3 Cladosporium sp ., 2 Curvularia §p., 1 Amerosporium sp ., 1

3-Nitroasterric Acid Derivatives from an Antarctic Sponge-Derived Pseudogymnoascus sp. Fungus.

PubMed

Figueroa, Luis; Jiménez, Carlos; Rodríguez, Jaime; Areche, Carlos; Chávez, Renato; Henríquez, Marlene; de la Cruz, Mercedes; Díaz, Caridad; Segade, Yuri; Vaca, Inmaculada

2015-04-24

Four new nitroasterric acid derivatives, pseudogymnoascins A-C (1-3) and 3-nitroasterric acid (4), along with the two known compounds questin and pyriculamide, were obtained from the cultures of a Pseudogymnoascus sp. fungus isolated from an Antarctic marine sponge belonging to the genus Hymeniacidon. The structures of the new compounds were determined by extensive NMR and MS analyses. These compounds are the first nitro derivatives of the known fungal metabolite asterric acid. Several asterric acid derivatives isolated from other fungal strains have shown antibacterial and antifungal activities. However, the new compounds described in this work were inactive against a panel of bacteria and fungi (MIC > 64 μg/mL).

An Unusual Conformational Isomer of Verrucosidin Backbone from a Hydrothermal Vent Fungus, Penicillium sp. Y-50-10

PubMed Central

Pan, Chengqian; Shi, Yutong; Auckloo, Bibi Nazia; Chen, Xuegang; Chen, Chen-Tung Arthur; Tao, Xinyi; Wu, Bin

2016-01-01

A new verrucosidin derivative, methyl isoverrucosidinol (1), was isolated from the marine fungus Penicillium sp. Y-50-10, dwelling in sulfur rich sediment in the Kueishantao hydrothermal vents off Taiwan. The structure was established by spectroscopic means including HRMS and 2D-NMR spectroscopic analysis. The absolute configuration was defined mainly by comparison of quantum chemical TDDFT calculated and experimental ECD spectra. Among hitherto known compounds with a verrucosidine backbone isolated from natural resource, compound 1 represents the first example of a new conformational isomer of its skeleton, exhibiting antibiotic activity against Bacillus subtilis with MIC value 32 μg/mL. PMID:27548192

Antifungal potential of Avicennia schaueriana Stapf & Leech. (Acanthaceae) against Cladosporium and Colletotrichum species.

PubMed

Fardin, K M; Young, M C M

2015-07-01

There is significant interest in research to develop plant extracts with fungicidal activities that are less harmful to the environment and human health than synthetic fungicides. This study aimed to evaluate the antifungal activity of the extracts of Avicennia schaueriana against Colletotrichum and Cladosporium species and to identify the compounds responsible for the activity. Leaves and stems of A. schaueriana were extracted with ethanol and partitioned with petroleum ether, chloroform and ethyl acetate. The antifungal activity of such extracts was tested by bioautography against Cladosporium sphaerospermum, Cladosporium cladosporioides and Colletotrichum lagenarium. Ethanolic extracts, petroleum ether and chloroform fractions of stems had the highest antifungal activity with several active bands (Rf = 0·72 and Rf = 0·55). In the agar dilution assay, ethanolic extract, petroleum ether and chloroform fractions of stems were the most efficacious, presenting 85, 62 and 63% growth inhibition of Colletotrichum gloeopsporioides and minimum inhibitory concentration values between 1 and 1·5 mg ml(-1) , respectively. Analysis carried out using gas chromatography coupled to a mass spectrometry of petroleum ether and chloroform fractions allowed the identification of fatty acids methyl esters, lupeol and naphthoquinones such as lapachol, α-lapachone, naphtho[2,3-b]furan-4,9-dione, 2-isopropyl- and avicenol-C. We may infer that the antifungal activity of A. schaueriana is due to the abundance of these compounds. This study shows that Avicennia schaueriana extracts have a high potential for the growth inhibition of Colletotrichum and Cladosporium ssp. and will provide a starting point for discovering new natural products with antifungal activity. Their development is of particular interest to organic production systems where synthetic fungicides cannot be used. © 2015 The Society for Applied Microbiology.

Optimization of culture conditions for penicilazaphilone C production by a marine-derived fungus Penicillium sclerotiorum M-22.

PubMed

Zhao, H-G; Wang, M; Lin, Y-Y; Zhou, S-L

2018-03-01

The aim of this study was to optimize the culture conditions of a marine-derived fungus Penicillium sclerotiorum M-22 for the production of penicilazaphilone C (PAC), a novel azaphilonidal derivative exhibiting broad cytotoxic and antibacterial effects. By single factor experiments, the effects to the production of PAC of aged seawater concentration, initial pH values, fermentation time, carbon sources, nitrogen sources and inorganic salt sources were investigated individually. Response surface methodology (RSM) analysis was adopted to investigate the interactions between variables and determine the optimal values for maximum PAC production. Evaluation of the experimental results signified that the optimum conditions for maximum production of PAC (19·85 mg l -1 ) in 250 ml Erlenmeyer flask were fermentation time 24·83 days, pH of 7·00, corn meal concentration of 10·72 g l -1 , yeast extract concentration of 4·58 g l -1 , crude sea salt concentration of 20·59 g l -1 . Production under optimized conditions increased to 1·344-fold comparing to its production prior to optimization. The higher PAC production and the penicilazaphilone C -producing marine fungus would be provide a promising alterative approach for industrial and commercial applications. Penicilazaphilone C (PAC) was a novel azaphilonidal derivative which had exhibited selective cytotoxicity and antibacterial activity. To further enhance production of PAC by optimizing fermentation conditions of Penicillium sclerotiorum M-22 would provide a promising alterative approach for industrial and commercial applications. We used the single factor test to determine the key factors which influence the PAC production. Then through the Response surface methodology and Box-Behnken design to determine the best fermentation condition for maximum production of PAC. Through these experimental designs and analysis will help us improve experimental efficiency and save time and materials. © 2017 The Society for Applied Microbiology.

Rhizovarins A-F, Indole-Diterpenes from the Mangrove-Derived Endophytic Fungus Mucor irregularis QEN-189.

PubMed

Gao, Shu-Shan; Li, Xiao-Ming; Williams, Katherine; Proksch, Peter; Ji, Nai-Yun; Wang, Bin-Gui

2016-08-26

Genome mining of the fungus Mucor irregularis (formerly known as Rhizomucor variabilis) revealed the presence of various gene clusters for secondary metabolite biosynthesis, including several terpene-based clusters. Investigation into the chemical diversity of M. irregularis QEN-189, an endophytic fungus isolated from the fresh inner tissue of the marine mangrove plant Rhizophora stylosa, resulted in the discovery of 20 structurally diverse indole-diterpenes including six new compounds, namely, rhizovarins A-F (1-6). Among them, compounds 1-3 represent the most complex members of the reported indole-diterpenes. The presence of an unusual acetal linked to a hemiketal (1) or a ketal (2 and 3) in an unprecedented 4,6,6,8,5,6,6,6,6-fused indole-diterpene ring system makes them chemically unique. Their structures and absolute configurations were elucidated by spectroscopic analysis, modified Mosher's method, and chemical calculations. Each of the isolated compounds was evaluated for antitumor activity against HL-60 and A-549 cell lines.

Natural Exposure versus Chamber Simulation.

DTIC Science & Technology

1984-09-01

Phoma) or at the Forested sites ( Trichoderma , Fusarum and Cephalosporium). -tNtter genera occured only once or twice out of eig-htfungal examinations...APR CURVULARIA x PENICILLIUM X X x X X FUSARIUM CLADOSPORIUM X PHOIAA X ASPERGILLUS X CEPHALOSPORIUM X X TRICHODERMA X PESTALOTIA GL TOCLADIUM...X x x * CLADOSPORIUM PHOMA x ASPERGILLUS. CEPHALOSPORI’JM X x x TRICHODERMA X X X X X X X PESTALOTIA x GLIOCLADIUM NIGROSPORA STEMPHYLIUM ALTERNARIA

Correlation of spring spore concentrations and meteorological conditions in Tulsa, Oklahoma

NASA Astrophysics Data System (ADS)

Troutt, C.; Levetin, E.

Different spore types are abundant in the atmosphere depending on the weather conditions. Ascospores generally follow precipitation, while spore types such as Alternaria and Cladosporium are abundant in dry conditions. This project attempted to correlate fungal spore concentrations with meteorological data from Tulsa, Oklahoma during May 1998 and May 1999. Air samples were collected and analyzed by the 12-traverse method. The spore types included were Cladosporium, Alternaria, Epicoccum, Curvularia, Pithomyces, Drechslera, smut spores, ascospores, basidiospores, and other spores. Weather variables included precipitation levels, temperature, dew point, air pressure, wind speed, wind direction and wind gusts. There were over 242.57 mm of rainfall in May 1999 and only 64.01 mm in May 1998. The most abundant spore types during May 1998 and May 1999 were Cladosporium, ascospores, and basidiospores. Results showed that there were significant differences in the dry-air spora between May 1998 and May 1999. There were twice as many Cladosporium in May 1998 as in May 1999; both ascospores and basidiospores showed little change. Multiple regression analysis was used to determine which meteorological variables influenced spore concentrations. Results showed that there was no single model for all spore types. Different combinations of factors were predictors of concentration for the various fungi examined; however, temperature and dew point seemed to be the most important meteorological factors.

Mycoflora of soybeans used for meju fermentation.

PubMed

Kim, Dae-Ho; Kim, Seon-Hwa; Kwon, Soon-Wo; Lee, Jong-Kyu; Hong, Seung-Beom

2013-06-01

Diverse fungi are present in Korean traditional meju and they are known to play an important role in fermented soybean products. To determine the origin of the fungi in meju, we examined the mycoflora of soybeans from 10 traditional meju factories. The samples were untreated or treated with sodium hypochlorite, and placed on malt extract agar (MEA), dichloran 18% glycerol agar (DG18), and dichloran rose bengal chloramphenicol agar (DRBC) medium. A total of 794 fungal strains were isolated and they were identified as 41 genera and 86 species. From sodium hypochlorite untreated soybeans, the genera, Cladosporium (55%), Eurotium (51%), Fusarium (33%), Penicillium (22%), and Aspergillus (exclusion of Eurotium) (20%), were mainly isolated, and Eurotium herbariorum (22%), Eurotium repens (18%), Cladosporium tenuissimum (18%), F. fujikuroi (18%), Aspergillus oryzae/flavus (7%), and Penicillium steckii (6%) were the predominant species. In case of sodium hypochlorite-treated soybeans, Eurotium (31%) and Cladosporium (5%) were frequently isolated, but Aspergillus (excluding Eurotium), Penicillium and Fusarium which were frequently isolated from untreated soybeans, were rarely isolated. Eurotium herbariorum (21%), Eurotium repens (8%), and Cladosporium tenuissimum (3%) were the predominant species. Of the 41 genera and 86 species isolated from soybeans, 13 genera and 33 species were also found in meju. These results suggest that the fungi on soybeans may influence the mycoflora of meju.

Mycoflora of Soybeans Used for Meju Fermentation

PubMed Central

Kim, Dae-Ho; Kim, Seon-Hwa; Kwon, Soon-Wo; Lee, Jong-Kyu

2013-01-01

Diverse fungi are present in Korean traditional meju and they are known to play an important role in fermented soybean products. To determine the origin of the fungi in meju, we examined the mycoflora of soybeans from 10 traditional meju factories. The samples were untreated or treated with sodium hypochlorite, and placed on malt extract agar (MEA), dichloran 18% glycerol agar (DG18), and dichloran rose bengal chloramphenicol agar (DRBC) medium. A total of 794 fungal strains were isolated and they were identified as 41 genera and 86 species. From sodium hypochlorite untreated soybeans, the genera, Cladosporium (55%), Eurotium (51%), Fusarium (33%), Penicillium (22%), and Aspergillus (exclusion of Eurotium) (20%), were mainly isolated, and Eurotium herbariorum (22%), Eurotium repens (18%), Cladosporium tenuissimum (18%), F. fujikuroi (18%), Aspergillus oryzae/flavus (7%), and Penicillium steckii (6%) were the predominant species. In case of sodium hypochlorite-treated soybeans, Eurotium (31%) and Cladosporium (5%) were frequently isolated, but Aspergillus (excluding Eurotium), Penicillium and Fusarium which were frequently isolated from untreated soybeans, were rarely isolated. Eurotium herbariorum (21%), Eurotium repens (8%), and Cladosporium tenuissimum (3%) were the predominant species. Of the 41 genera and 86 species isolated from soybeans, 13 genera and 33 species were also found in meju. These results suggest that the fungi on soybeans may influence the mycoflora of meju. PMID:23874133

Diphenyl ethers from a marine-derived isolate of Aspergillus sp. CUGB-F046.

PubMed

Xu, Xiuli; Yang, Haijin; Xu, Huitao; Yin, Liyuan; Chen, Zhengkun; Shen, Huihui

2018-04-01

One new diphenyl ether, diorcinol K (1), along with three known compounds, diorcinols D (2), F (3) and I (4) were isolated from the fermentation media of a marine-derived fungus Aspergillus sp. CUGB-F046 which was isolated from a sediment sample collected from the Bohai Sea, China. Their structures were elucidated by detailed spectroscopic methods. Compounds 1, 2 and 4 displayed significant antibacterial activities against Staphylococcus aureus and methicillin-resistant S. aureus with MIC values of 3.125, 6.25 and 6.25 μg/mL, respectively.

47 annual records of allergenic fungi spore: predictive models from the NW Iberian Peninsula.

PubMed

Aira, M Jesus; Rodriguez-Rajo, F; Jato, Victoria

2008-01-01

An analysis was carried out of the atmospheric representivity of Cladosporium and Alternaria spores in the north-western Iberian Peninsula, registering mean annual concentrations in excess of 300,000 spores/m(3). During the main sporulation period, the highest average daily concentrations corresponded to Cladosporium herbarum type (1,197 spores/m(3)) while the highest daily value was 7,556 spores/m(3) (Cladosporium cladosporioides type). Alternaria only represents between 0.1-1% of the total spores identified. In these spore types, the intraday variation was more acute inland than along the coastline due to oceanic influence. In the predictive models proposed that use the meteorological parameters with which a higher correlation was obtained (mean and maximum temperature) as predictive variables, it was seen that the predicted values did not reveal any significant differences as compared to those observed in 2006, data that was only used for verification purposes.

Recovery and phylogenetic diversity of culturable fungi associated with marine sponges Clathrina luteoculcitella and Holoxea sp. in the South China Sea.

PubMed

Ding, Bo; Yin, Ying; Zhang, Fengli; Li, Zhiyong

2011-08-01

Sponge-associated fungi represent an important source of marine natural products, but little is known about the fungal diversity and the relationship of sponge-fungal association, especially no research on the fungal diversity in the South China Sea sponge has been reported. In this study, a total of 111 cultivable fungi strains were isolated from two South China Sea sponges Clathrina luteoculcitella and Holoxea sp. using eight different media. Thirty-two independent representatives were selected for analysis of phylogenetic diversity according to ARDRA and morphological characteristics. The culturable fungal communities consisted of at least 17 genera within ten taxonomic orders of two phyla (nine orders of the phylum Ascomycota and one order of the phylum Basidiomycota) including some potential novel marine fungi. Particularly, eight genera of Apiospora, Botryosphaeria, Davidiella, Didymocrea, Lentomitella, Marasmius, Pestalotiopsis, and Rhizomucor were isolated from sponge for the first time. Sponge C. luteoculcitella has greater culturable fungal diversity than sponge Holoxea sp. Five genera of Aspergillus, Davidiella, Fusarium, Paecilomyces, and Penicillium were isolated from both sponges, while 12 genera of Apiospora, Botryosphaeria, Candida, Marasmius, Cladosporium, Didymocrea, Hypocrea, Lentomitella, Nigrospora, Pestalotiopsis, Rhizomucor, and Scopulariopsis were isolated from sponge C. luteoculcitella only. Order Eurotiales especially genera Penicillium, Aspergillus, and order Hypocreales represented the dominant culturable fungi in these two South China Sea sponges. Nigrospora oryzae strain PF18 isolated from sponge C. luteoculcitella showed a strong and broad spectrum antimicrobial activities suggesting the potential for antimicrobial compounds production.

Bacterial symbionts and natural products.

PubMed

Crawford, Jason M; Clardy, Jon

2011-07-21

The study of bacterial symbionts of eukaryotic hosts has become a powerful discovery engine for chemistry. This highlight looks at four case studies that exemplify the range of chemistry and biology involved in these symbioses: a bacterial symbiont of a fungus and a marine invertebrate that produce compounds with significant anticancer activity, and bacterial symbionts of insects and nematodes that produce compounds that regulate multilateral symbioses.

Enhancing aspergiolide A production from a shear-sensitive and easy-foaming marine-derived filamentous fungus Aspergillus glaucus by oxygen carrier addition and impeller combination in a bioreactor.

PubMed

Cai, Menghao; Zhou, Xiangshan; Lu, Jian; Fan, Weimin; Niu, Chuanpeng; Zhou, Jiushun; Sun, Xueqian; Kang, Li; Zhang, Yuanxing

2011-02-01

Production enhancement of a novel antitumor compound aspergiolide A from shear-sensitive and easy-foaming marine-derived fungus Aspergillus glaucus HB1-19 in a 5-l stirred bioreactor was investigated. Two types of impellers, i.e., six-flat-blade disc turbine impeller (DT) and three-sector-blade pitched blade turbine impeller (PB) were used in this work. In cultures with fermentation medium, the combination of upper PB and lower DT led to the maximum dry biomass (13.8 g/l) and aspergiolide A production (19.3 mg/l). However, two PBs brought the highest aspergiolide A yield coefficient (1.9 mg/g dry biomass) despite it produced the lowest dry biomass (5.3 g/l). By contrast, two DTs and the upper DT and lower PB showed insignificant results. Feeding 0.35% (v/v) n-dodecane in cultures with upper PB and lower DT further improved aspergiolide A production by 31.0%, i.e., 25.3 mg/l, which is also 322% higher than that in the ordinary cultures with two DTs. Copyright © 2010 Elsevier Ltd. All rights reserved.

Territrem and Butyrolactone Derivatives from a Marine-Derived Fungus Aspergillus Terreus

PubMed Central

Nong, Xu-Hua; Wang, Yi-Fei; Zhang, Xiao-Yong; Zhou, Mu-Ping; Xu, Xin-Ya; Qi, Shu-Hua

2014-01-01

Seventeen lactones including eight territrem derivatives (1–8) and nine butyrolactone derivatives (9–17) were isolated from a marine-derived fungus Aspergillus terreus SCSGAF0162 under solid-state fermentation of rice. Compounds 1–3 and 9–10 were new, and their structures were elucidated by spectroscopic analysis. The acetylcholinesterase inhibitory activity and antiviral activity of compounds 1–17 were evaluated. Among them, compounds 1 and 2 showed strong inhibitory activity against acetylcholinesterase with IC50 values of 4.2 ± 0.6, 4.5 ± 0.6 nM, respectively. This is the first time it has been reported that 3, 6, 10, 12 had evident antiviral activity towards HSV-1 with IC50 values of 16.4 ± 0.6, 6.34 ± 0.4, 21.8 ± 0.8 and 28.9 ± 0.8 μg·mL−1, respectively. Antifouling bioassay tests showed that compounds 1, 11, 12, 15 had potent antifouling activity with EC50 values of 12.9 ± 0.5, 22.1 ± 0.8, 7.4 ± 0.6, 16.1 ± 0.6 μg·mL−1 toward barnacle Balanus amphitrite larvae, respectively. PMID:25522319

A New Ergosterol Analog, a New Bis-Anthraquinone and Anti-Obesity Activity of Anthraquinones from the Marine Sponge-Associated Fungus Talaromyces stipitatus KUFA 0207

PubMed Central

Noinart, Jidapa; Buttachon, Suradet; Dethoup, Tida; Gales, Luís; Pereira, José A.; Urbatzka, Ralph; Freitas, Sara; Lee, Michael; Silva, Artur M. S.; Pinto, Madalena M. M.; Vasconcelos, Vítor; Kijjoa, Anake

2017-01-01

A new ergosterol analog, talarosterone (1) and a new bis-anthraquinone derivative (3) were isolated, together with ten known compounds including palmitic acid, ergosta-4,6,8(14),22-tetraen-3-one, ergosterol-5,8-endoperoxide, cyathisterone (2), emodin (4a), questinol (4b), citreorosein (4c), fallacinol (4d), rheoemodin (4e) and secalonic acid A (5), from the ethyl acetate extract of the culture of the marine sponge-associated fungus Talaromyces stipitatus KUFA 0207. The structures of the new compounds were established based on extensive 1D and 2D spectral analysis, and in the case of talarosterone (1), the absolute configurations of its stereogenic carbons were determined by X-ray crystallographic analysis. The structure and stereochemistry of cyathisterone (2) was also confirmed by X-ray analysis. The anthraquinones 4a–e and secalonic acid A (5) were tested for their anti-obesity activity using the zebrafish Nile red assay. Only citreorosein (4c) and questinol (4b) exhibited significant anti-obesity activity, while emodin (4a) and secalonic acid A (5) caused toxicity (death) for all exposed zebrafish larvae after 24 h. PMID:28509846

Rapid, sensitive and direct analysis of exopolysaccharides from biofilm on aluminum surfaces exposed to sea water using MALDI-TOF MS.

PubMed

Hasan, Nazim; Gopal, Judy; Wu, Hui-Fen

2011-11-01

Biofilm studies have extensive significance since their results can provide insights into the behavior of bacteria on material surfaces when exposed to natural water. This is the first attempt of using matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) for detecting the polysaccharides formed in a complex biofilm consisting of a mixed consortium of marine microbes. MALDI-MS has been applied to directly analyze exopolysaccharides (EPS) in the biofilm formed on aluminum surfaces exposed to seawater. The optimal conditions for MALDI-MS applied to EPS analysis of biofilm have been described. In addition, microbiologically influenced corrosion of aluminum exposed to sea water by a marine fungus was also observed and the fungus identity established using MALDI-MS analysis of EPS. Rapid, sensitive and direct MALDI-MS analysis on biofilm would dramatically speed up and provide new insights into biofilm studies due to its excellent advantages such as simplicity, high sensitivity, high selectivity and high speed. This study introduces a novel, fast, sensitive and selective platform for biofilm study from natural water without the need of tedious culturing steps or complicated sample pretreatment procedures. Copyright © 2011 John Wiley & Sons, Ltd.

A New Dihydrochromone Dimer and Other Secondary Metabolites from Cultures of the Marine Sponge-Associated Fungi Neosartorya fennelliae KUFA 0811 and Neosartorya tsunodae KUFC 9213

PubMed Central

Dethoup, Tida; Gales, Luís; Inácio, Ângela; Lee, Michael; Sekeroglu, Nazim

2017-01-01

A previously unreported dihydrochromone dimer, paecilin E (1), was isolated, together with eleven known compounds: β-sitostenone, ergosta-4,6,8 (14), 22-tetraen-3-one, cyathisterone, byssochlamic acid, dehydromevalonic acid lactone, chevalone B, aszonalenin, dankasterone A (2), helvolic acid, secalonic acid A and fellutanine A, from the culture filtrate extract of the marine sponge-associated fungus Neosartorya fennelliae KUFA 0811. Nine previously reported metabolites, including a chromanol derivative (3), (3β, 5α, 22E), 3,5-dihydroxyergosta-7,22-dien-6-one (4), byssochlamic acid, hopan-3β,22-diol, chevalone C, sartorypyrone B, helvolic acid, lumichrome and the alkaloid harmane were isolated from the culture of the marine-sponge associated fungus Neosartorya tsunodae KUFC 9213. Paecilin E (1), dankasterone A (2), a chromanol derivative (3), (3β, 5α, 22E)-3,5-dihydroxyergosta-7,22-dien-6-one (4), hopan-3β,22-diol (5), lumichrome (6), and harmane (7) were tested for their antibacterial activity against Gram-positive and Gram-negative reference and multidrug-resistant strains isolated from the environment. While paecilin E (1) was active against S. aureus ATCC 29213 and E. faecalis ATCC 29212, dankastetrone A (2) was only effective against E. faecalis ATCC 29212 and the multidrug-resistant VRE E. faecalis A5/102. Both compounds neither inhibit biofilm mass production in any of the strains at the concentrations tested nor exhibit synergistic association with antibiotics. PMID:29194412

Potent Antifouling Marine Dihydroquinolin-2(1H)-one-Containing Alkaloids from the Gorgonian Coral-Derived Fungus Scopulariopsis sp.

PubMed

Shao, Chang-Lun; Xu, Ru-Fang; Wang, Chang-Yun; Qian, Pei-Yuan; Wang, Kai-Ling; Wei, Mei-Yan

2015-08-01

Marine biofouling has a major economic impact, especially when it occurs on ship hulls or aquaculture facilities. Since the International Maritime Organization (IMO) treaty to ban the application of organotin-based paints to ships went into effect in 2008, there is an urgent demand for the development of efficient and environmentally friendly antifouling agents. Marine microorganisms have proved to be a potential source of antifouling natural compounds. In this study, six dihydroquinolin-2-one-containing alkaloids, three monoterpenoids combined with a 4-phenyl-3,4-dihydroquinolin-2(1H)-one (1-3) and three 4-phenyl-3,4-dihydroquinolin-2(1H)-one alkaloids (4-6), were isolated from the gorgonian coral-derived fungus Scopulariopsis sp. collected in the South China Sea. These dihydroquinolin-2-one-containing alkaloids were evaluated against the larval settlement of barnacle Balanus amphitrite, and antifouling activity was detected for the first time for this class of metabolites. All of them except 6 showed strong antifouling activity. Compounds 1 and 2 were discovered to be the most promising non-toxic antilarval settlement candidates. Especially, compound 1 is the strongest antifouling compound in nature until now which showed highly potent activity with picomolar level (EC50 17.5 pM) and a very safety and high therapeutic ratio (LC50/EC50 1200). This represents an effective non-toxic, anti-larval settlement structural class of promising antifouling lead compound.

Mass Spectrometric Characteristics of Prenylated Indole Derivatives from Marine-Derived Penicillium sp. NH-SL.

PubMed

Ding, Hui; Ding, Wanjing; Ma, Zhongjun

2017-03-22

Two prenylated indole alkaloids were isolated from the ethyl acetate extracts of a marine-derived fungus Penicillium sp. NH-SL and one of them exhibited potent cytotoxic activity against mouse hepa 1c1c7 cells. In order to detect other bioactive analogs, we used liquid chromatogram tandem mass spectrometry (LC-MS/MS) to analyze the mass spectrometric characteristics of the isolated compounds as well as the crude extracts. As a result, three other analogs were detected, and their structures were deduced according to the similar fragmentation patterns. This is the first systematic report on the mass spectrometric characteristics of prenylated indole derivatives.

Identification and Biological Evaluation of Secondary Metabolites from Marine Derived Fungi-Aspergillus sp. SCSIOW3, Cultivated in the Presence of Epigenetic Modifying Agents.

PubMed

Li, Xiaofan; Xia, Zhenyao; Tang, Jianqiang; Wu, Jiahui; Tong, Jing; Li, Mengjie; Ju, Jianhua; Chen, Huirong; Wang, Liyan

2017-08-04

Chemical epigenetic manipulation was applied to a deep marine-derived fungus, Aspergillus sp. SCSIOW3, resulting in significant changes of the secondary metabolites. One new diphenylether- O -glycoside (diorcinol 3- O -α-D-ribofuranoside), along with seven known compounds, were isolated from the culture treated with a combination of histone deacetylase inhibitor (suberohydroxamic acid) and DNA methyltransferase inhibitor (5-azacytidine). Compounds 2 and 4 exhibited significant biomembrane protective effect of erythrocytes. 2 also showed algicidal activity against Chattonella marina , a bloom forming alga responsible for large scale fish deaths.

Penicilones A-D, Anti-MRSA Azaphilones from the Marine-Derived Fungus Penicillium janthinellum HK1-6.

PubMed

Chen, Min; Shen, Nan-Xing; Chen, Zhi-Qi; Zhang, Feng-Min; Chen, Yang

2017-04-28

Four new azaphilones, penicilones A-D (1-4), were isolated from the mangrove rhizosphere soil-derived fungus Penicillium janthinellum HK1-6. Their planar structures and absolute configurations were determined by extensive analysis of NMR spectroscopic data, ECD spectra, the modified Mosher's method, and chemical conversions. Interestingly, 1 and 2 had the opposite configuration at C-7 compared to the closely related chloro analogues 3 and 4. Ester hydrolysis of 2 and 4 afforded their parental azaphilones, named penicilones E (5) and F (6). Compounds 1-6 were evaluated for their antibacterial activities in vitro. Penicilones B-D (2-4) showed potent anti-MRSA (Staphylococcus aureus ATCC 43300, ATCC 33591) activities with MIC values ranging from 3.13 to 6.25 μg/mL.

Characterisation and detection of spoilage mould responsible for black spot in dry-cured fermented sausages.

PubMed

Lozano-Ojalvo, Daniel; Rodríguez, Alicia; Cordero, Mirian; Bernáldez, Victoria; Reyes-Prieto, Mariana; Córdoba, Juan J

2015-02-01

Moulds responsible for black spot spoilage of dry-cured fermented sausages were characterised. For this purpose, samples were taken from those dry-cured fermented sausages which showed black spot alteration. Most of the mould strains were first tentatively identified as Penicillium spp. due to their morphological characteristics in different culture conditions, with one strain as Cladosporium sp. The Cladosporium strain was the only one which provoked blackening in culture media. This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. This mould strain was able to reproduce black spot formation in dry-cured fermented sausage 'salchichón' throughout the ripening process. In addition, a specific and sensitive real-time PCR method was also developed to detect Cladosporium oxysporum responsible for the black spot formation in sausages. This method could be of great interest for the meat industry to detect samples contaminated with this mould before spoilage of product avoiding economic losses for this sector.

The effect of meteorological factors on the daily variation of airborne fungal spores in Granada (southern Spain)

NASA Astrophysics Data System (ADS)

Sabariego, S.; Díaz de la Guardia, C.; Alba, F.

A study was made of the link between climatic factors and the daily content of certain fungal spores in the atmosphere of the city of Granada in 1994. Sampling was carried out with a Burkard 7-day-recording spore trap. The spores analysed corresponded to the taxa Alternaria, Ustilago and Cladosporium, with two morphologically different spore types in the latter genus, cladosporioides and herbarum. These spores were selected both for their allergenic capacity and for the high level of their presence in the atmosphere, particularly during the spring and autumn. The spores of Cladosporium were the most abundant (93.82% of the total spores identified). The Spearman correlation coefficients between the spore concentrations studied and the meteorological parameters show different indices depending on the taxon being analysed. Alternaria and Cladosporium are significantly correlated with temperature and hours of sunlight, while Ustilago shows positive correlation indices with relative humidity and negative indices with wind speed.

Analysis of Two in Planta Expressed LysM Effector Homologs from the Fungus Mycosphaerella graminicola Reveals Novel Functional Properties and Varying Contributions to Virulence on Wheat1[W][OA

PubMed Central

Marshall, Rosalind; Kombrink, Anja; Motteram, Juliet; Loza-Reyes, Elisa; Lucas, John; Hammond-Kosack, Kim E.; Thomma, Bart P.H.J.; Rudd, Jason J.

2011-01-01

Secreted effector proteins enable plant pathogenic fungi to manipulate host defenses for successful infection. Mycosphaerella graminicola causes Septoria tritici blotch disease of wheat (Triticum aestivum) leaves. Leaf infection involves a long (approximately 7 d) period of symptomless intercellular colonization prior to the appearance of necrotic disease lesions. Therefore, M. graminicola is considered as a hemibiotrophic (or necrotrophic) pathogen. Here, we describe the molecular and functional characterization of M. graminicola homologs of Ecp6 (for extracellular protein 6), the Lysin (LysM) domain-containing effector from the biotrophic tomato (Solanum lycopersicum) leaf mold fungus Cladosporium fulvum, which interferes with chitin-triggered immunity in plants. Three LysM effector homologs are present in the M. graminicola genome, referred to as Mg3LysM, Mg1LysM, and MgxLysM. Mg3LysM and Mg1LysM genes were strongly transcriptionally up-regulated specifically during symptomless leaf infection. Both proteins bind chitin; however, only Mg3LysM blocked the elicitation of chitin-induced plant defenses. In contrast to C. fulvum Ecp6, both Mg1LysM and Mg3LysM also protected fungal hyphae against plant-derived hydrolytic enzymes, and both genes show significantly more nucleotide polymorphism giving rise to nonsynonymous amino acid changes. While Mg1LysM deletion mutant strains of M. graminicola were fully pathogenic toward wheat leaves, Mg3LysM mutant strains were severely impaired in leaf colonization, did not trigger lesion formation, and were unable to undergo asexual sporulation. This virulence defect correlated with more rapid and pronounced expression of wheat defense genes during the symptomless phase of leaf colonization. These data highlight different functions for MgLysM effector homologs during plant infection, including novel activities that distinguish these proteins from C. fulvum Ecp6. PMID:21467214

Infectious crystalline keratopathy caused by Cladosporium sp. after penetrating keratoplasty: a case report

PubMed Central

Stock, Ricardo Alexandre; Bonamigo, Elcio Luiz; Cadore, Emeline; Oechsler, Rafael Allan

2016-01-01

Background Infectious crystalline keratopathy is a rare, progressive infection characterized by the insidious progression of branches and crystalline corneal opacities with minimal or no inflammation. This case report describes the evolution of an infectious crystalline keratopathy caused by Cladosporium sp., which developed after tectonic keratoplasty in a patient with a history of ocular trauma. Case presentation A 40-year-old Brazilian male was the victim of firework-induced trauma to the left eye, which resulted in a corneal laceration that could not be sutured as well as a severe traumatic cataract. The patient underwent penetrating keratoplasty and phacoemulsification. During postoperative follow-up, another therapeutic keratoplasty was required because unresponsive infectious keratitis was observed. The infiltrate’s characteristics were suggestive of infectious crystalline keratopathy; in particular, the infiltrate was insidious and progressive, and grayish-white branches appeared in the anterior corneal stroma. As different therapies were administered, inflammatory reactions ranging from mild to severe were observed. The infection was unresponsive to typical antifungal drugs. This lack of response most likely occurred due to steroid treatment and the diffuse corneal spread of an atypical microorganism, which was subsequently identified in culture as Cladosporium sp. After the second therapeutic keratoplasty, the patient’s eye integrity was successfully reestablished. Conclusion This study likely provides the first report describing a case of infectious crystalline keratopathy caused by Cladosporium sp. This case emphasizes the clinical characteristics and outcome of this type of keratitis. PMID:27621671

Effects of high salt stress on secondary metabolite production in the marine-derived fungus Spicaria elegans.

PubMed

Wang, Yi; Lu, Zhenyu; Sun, Kunlai; Zhu, Weiming

2011-01-01

To obtain structurally novel and bioactive natural compounds from marine-derived microorganisms, the effect of high salt stress on secondary metabolite production in the marine-derived fungal strain, Spicaria elegans KLA-03, was investigated. The organism, which was isolated from marine sediment, produced different secondary metabolites when cultured in 3% and 10% saline conditions. Four characteristic metabolites, only produced in the 10% salinity culture, were isolated, and their structures were identified as (2E,2'Z)-3,3'-(6,6'-dihydroxybiphenyl-3,3'-diyl)diacrylic acid (1), aspulvinone E (2), aspochalasin E (3) and trichodermamide B (6), according to their 1D and 2D NMR spectra. Compound 1 is a new compound. High salt stress may therefore be a promising means to induce the production of new and chlorinated compounds in halotolerant fungi. Compound 1 showed moderate antibacterial activity against Pseudomonas aeruginosa and Escherichia coli with minimum inhibitory concentration (MIC) values of 0.038 and 0.767 mM, respectively.

South African report of first case of chromoblastomycosis caused by Cladosporium (syn Cladophialophora) carrionii infection in a cat with feline immunodeficiency virus and lymphosarcoma.

PubMed

Zambelli, Anthony B; Griffiths, Catherine A

2015-04-01

This report describes a 6-year-old neutered male feline immunodeficiency-positive cat with repeated abdominal and thoracic effusions. The cat was diagnosed with and treated for lymphosarcoma but remission was short-lived and, on re-evaluation, a fungal peritoneal exudate was noted. Cytology of the organisms is described and the culture elucidated Cladosporium carrionii, an important cause of chromoblastomycosis. Treatment with itraconazole was unsuccessful in this case. © ISFM and AAFP 2014.

Fungi of the house dust in Riyadh, Saudi Arabia.

PubMed

Saad, R R; el-Gindy, A A

1990-01-01

30 species belonging to 18 genera were isolated from floor dust of 30 homes in Riyadh. Out of them 16 species and 10 genera were isolated from dust of air conditioners of the same homes. The most common genera in floor dust were Aspergillus, Penicillium and Cladosporium. Aspergillus repens, A. amstelodami, A. versicolor, A. fumigatus, Penicillium purpurogenum, P. crustosum, Cladosporium cladosporoides and C. herbarum were frequently isolated. The most abundant genera in air conditioner dust were Aspergillus and Penicillium. Aspergillus fumigatus, A. ochraceus, A. terreus, Penicillium oxalicium and P. crustosum were most frequent species.

Mass Spectrometric Characteristics of Prenylated Indole Derivatives from Marine-Derived Penicillium sp. NH-SL

PubMed Central

Ding, Hui; Ding, Wanjing; Ma, Zhongjun

2017-01-01

Two prenylated indole alkaloids were isolated from the ethyl acetate extracts of a marine-derived fungus Penicillium sp. NH-SL and one of them exhibited potent cytotoxic activity against mouse hepa 1c1c7 cells. In order to detect other bioactive analogs, we used liquid chromatogram tandem mass spectrometry (LC-MS/MS) to analyze the mass spectrometric characteristics of the isolated compounds as well as the crude extracts. As a result, three other analogs were detected, and their structures were deduced according to the similar fragmentation patterns. This is the first systematic report on the mass spectrometric characteristics of prenylated indole derivatives. PMID:28327529

Metabolites with Gram-negative bacteria quorum sensing inhibitory activity from the marine animal endogenic fungus Penicillium sp. SCS-KFD08.

PubMed

Kong, Fan Dong; Zhou, Li Man; Ma, Qing Yun; Huang, Sheng Zhuo; Wang, Pei; Dai, Hao Fu; Zhao, You Xing

2017-01-01

Three new compounds named penicitor A, aculene E and penicitor B, as well as four known compounds, were isolated from the fermentation broth of Penicillium sp. SCS-KFD08 associated with a marine animal Sipunculus nudus from the Haikou bay of China. Their planar structures and absolute configurations were unambiguously elucidated by spectroscopic data, Mosher's method, CD spectrum analysis along with quantum ECD calculation. Among them, compounds 2-7 showed quorum sensing inhibitory activity against Chromobacterium violaceum CV026, and could significantly reduce violacein production in N-hexanoyl-l-homoserine lactone (C6-HSL) induced C. violaceum CV026 cultures at sub-inhibitory concentrations.

[The metabolites of cyclic peptides from three endophytic mangrove fungi].

PubMed

Guo, Zhi-yong; Huang, Zhong-jing; Wen, Lu; Wan, Qiao; Liu, Fan; She, Zhi-gang; Lin, Yong-cheng; Zhou, Shi-ning

2007-12-01

Nine secondary metaboites of cyclic peptide were isolated from three mangrove endophytic fungi Paecilomyces sp. (treel-7), 4557,ZZF65. They were viscumamide(1),cyclo(Pro-Iso)(2),cyclo(Phe-Gly)(3),cyclo(Phe-Ana)(4),cyclo(Gly-Pro) (5),cyclo(Gly-Leu)(6), cyclo(Trp-Ana)(7),neoechinulin A(8),cyclo(Pro-Thr)(9). The compounds 1,7,8,9 were firstly isolated from marine fungus.

Epigenetic Tailoring for the Production of Anti-Infective Cytosporones from the Marine Fungus Leucostoma persoonii

PubMed Central

Beau, Jeremy; Mahid, Nida; Burda, Whittney N.; Harrington, Lacey; Shaw, Lindsey N.; Mutka, Tina; Kyle, Dennis E.; Barisic, Betty; van Olphen, Alberto; Baker, Bill J.

2012-01-01

Recent genomic studies have demonstrated that fungi can possess gene clusters encoding for the production of previously unobserved secondary metabolites. Activation of these attenuated or silenced genes to obtain either improved titers of known compounds or new ones altogether has been a subject of considerable interest. In our efforts to discover new chemotypes that are effective against infectious diseases, including malaria and methicillin-resistant Staphylococcus aureus (MRSA), we have isolated a strain of marine fungus, Leucostoma persoonii, that produces bioactive cytosporones. Epigenetic modifiers employed to activate secondary metabolite genes resulted in enhanced production of known cytosporones B (1, 360%), C (2, 580%) and E (3, 890%), as well as the production of the previously undescribed cytosporone R (4). Cytosporone E was the most bioactive, displaying an IC90 of 13 µM toward Plasmodium falciparum, with A549 cytotoxicity IC90 of 437 µM, representing a 90% inhibition therapeutic index (TI90 = IC90 A459/IC90 P. falciparum) of 33. In addition, cytosporone E was active against MRSA with a minimal inhibitory concentration (MIC) of 72 µM and inhibition of MRSA biofilm at roughly half that value (minimum biofilm eradication counts, MBEC90, was found to be 39 µM). PMID:22690142

Epigenetic tailoring for the production of anti-infective cytosporones from the marine fungus Leucostoma persoonii.

PubMed

Beau, Jeremy; Mahid, Nida; Burda, Whittney N; Harrington, Lacey; Shaw, Lindsey N; Mutka, Tina; Kyle, Dennis E; Barisic, Betty; van Olphen, Alberto; Baker, Bill J

2012-04-01

Recent genomic studies have demonstrated that fungi can possess gene clusters encoding for the production of previously unobserved secondary metabolites. Activation of these attenuated or silenced genes to obtain either improved titers of known compounds or new ones altogether has been a subject of considerable interest. In our efforts to discover new chemotypes that are effective against infectious diseases, including malaria and methicillin-resistant Staphylococcus aureus (MRSA), we have isolated a strain of marine fungus, Leucostoma persoonii, that produces bioactive cytosporones. Epigenetic modifiers employed to activate secondary metabolite genes resulted in enhanced production of known cytosporones B (1, 360%), C (2, 580%) and E (3, 890%), as well as the production of the previously undescribed cytosporone R (4). Cytosporone E was the most bioactive, displaying an IC(90) of 13 µM toward Plasmodium falciparum, with A549 cytotoxicity IC(90) of 437 µM, representing a 90% inhibition therapeutic index (TI(90) = IC(90) A459/IC(90)P. falciparum) of 33. In addition, cytosporone E was active against MRSA with a minimal inhibitory concentration (MIC) of 72 µM and inhibition of MRSA biofilm at roughly half that value (minimum biofilm eradication counts, MBEC90, was found to be 39 µM).

Mechanisms of fatty acid synthesis in marine fungus-like protists.

PubMed

Xie, Yunxuan; Wang, Guangyi

2015-10-01

Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.

Exophiala pisciphila. A study of its development.

PubMed

Gaskins, J E; Cheung, P J

1986-03-01

Exophiala pisciphila is a dematiaceous fungus that belongs to a group of fungi known as the 'black yeasts'. It was isolated from the skin lesions of a smooth dogfish, Mustelus canis Mitchill, that had been born in the shark exhibit tank of the New York Aquarium. The different stages of development of this fungus were studied by light microscopy and scanning electron microscopy to illustrate the morphology and surface structures of conidia and mycelium. The list of marine and fresh water fish, which have been infected by Exophiala spp. and Exophiala-like fungi has been up-dated. Potato Dextrose Agar and Malt Agar proved to be the best growth media, while Corn Meal Agar proved to be the best medium for studying the morphological features of the conidia and mycelial development of E. pisciphila, which exhibited polymorphic conidiogenesis.

The dynamics of the fungal aerospores Alternaria sp. and Cladosporium sp. in Parisian atmospheric air, in France

NASA Astrophysics Data System (ADS)

Brezoczki, V. M.

2016-08-01

The bioallergens occurring naturally in the atmospheric air are microorganisms, pollen grains, plant seeds, leaf and stem scrap, or their protein molecules. The presence of various airborne fungal spores determines a high allergenic potential for public health. This effect is due to the high number of produced spores, which under favourable meteorological conditions (dry weather and wind) reach the surrounding air. This paper traces the dynamics of two types of fungi, Alternaria sp and Cladosporium sp, fungi which can be found outdoors, in the surrounding air, as well as indoors, inside houses (especially the conidia of Cladosporium sp). The effects of these fungal spores on human health are varies, ranging from seasonal allergies (hay fever, rhinitis, sinusitis etc.) to sever afflictions of the respiratory system, onset of asthma, disfunctionalities of the nervous systems, of the immune system, zymoses etc. The monitoring of the dynamics of the aerospores Alternaria sp and Cladosporium sp was carried out between 2010 and 2013, over a period of 42 weeks during one calendar year, from February to the end of September, in the surrounding air in the French capital, Paris. The regional and global climate and meteorological conditions are directly involved in the occurrence and development of fungi colonies, the transportation and dispersion of fungal spores in the atmospheric air, as well as in the creation of the environment required for the interaction of chemical and biological components in the air. Knowledge of the dynamics of the studied fungal aerospores, coupled with climate and meteorological changes, offers a series of information on the magnitude of the allergenic potential these airborne spores can determine. Legal regulations in this domain set the allergen risk threshold for the Alternaria sp aerospores at 3500 ÷ 7000 spores/m3 air/week, and for the Cladosporium sp aerospores at 56,000 spores/m3 air/week. Besides these regulations there exist a series of health, social and individual recommendations meant to considerably reduce or even prevent exposure to aerobiological pollution.

Identifying risk factors for exposure to culturable allergenic moulds in energy efficient homes by using highly specific monoclonal antibodies.

PubMed

Sharpe, Richard A; Cocq, Kate Le; Nikolaou, Vasilis; Osborne, Nicholas J; Thornton, Christopher R

2016-01-01

The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. Copyright © 2015 Elsevier Inc. All rights reserved.

Marine organisms as a therapeutic source against herpes simplex virus infection.

PubMed

Vo, Thanh-Sang; Ngo, Dai-Hung; Ta, Quang Van; Kim, Se-Kwon

2011-09-18

Herpes simplex virus (HSV) is a member of the Herpesviridae family that causes general communicable infections in human populations throughout the world, the most common being genital and orolabial disease. The current treatments for HSV infections are nucleoside analogs such as acyclovir, valacyclovir and famciclovir. Despite the safety and efficacy, extensive clinical use of these drugs has led to the emergence of resistant viral strains, mainly in immunocompromised patients. To counteract these problems, alternative anti-HSV agents from natural products have been reported. Recently, a great deal of interest has been expressed regarding marine organisms such as algae, sponges, tunicates, echinoderms, mollusks, shrimp, bacteria, and fungus as promising anti-HSV agents. This contribution presents an overview of potential anti-HSV agents derived from marine organisms and their promising application in HSV therapy. Copyright © 2011 Elsevier B.V. All rights reserved.

Common but different: The expanding realm of Cladosporium

PubMed Central

Bensch, K.; Groenewald, J.Z.; Braun, U.; Dijksterhuis, J.; de Jesús Yáñez-Morales, M.; Crous, P.W.

2015-01-01

The genus Cladosporium (Cladosporiaceae, Dothideomycetes), which represents one of the largest genera of dematiaceous hyphomycetes, has been intensively investigated during the past decade. In the process, three major species complexes (C. cladosporioides, C. herbarum and C. sphaerospermum) were resolved based on morphology and DNA phylogeny, and a monographic revision of the genus (s. lat.) published reflecting the current taxonomic status quo. In the present study a further 19 new species are described based on phylogenetic characters (nuclear ribosomal RNA gene operon, including the internal transcribed spacer regions ITS1 and ITS2, as well as partial actin and translation elongation factor 1-α gene sequences) and morphological differences. For a selection of the species with ornamented conidia, scanning electron microscopic photos were prepared to illustrate the different types of surface ornamentation. Surprisingly, during this study Cladosporium ramotenellum was found to be a quite common saprobic species, being widely distributed and occurring on various substrates. Therefore, an emended species description is provided. Furthermore, the host range and distribution data for several previously described species are also expanded. PMID:26955200

Atmospheric mold spore counts in relation to meteorological parameters

NASA Astrophysics Data System (ADS)

Katial, R. K.; Zhang, Yiming; Jones, Richard H.; Dyer, Philip D.

Fungal spore counts of Cladosporium, Alternaria, and Epicoccum were studied during 8 years in Denver, Colorado. Fungal spore counts were obtained daily during the pollinating season by a Rotorod sampler. Weather data were obtained from the National Climatic Data Center. Daily averages of temperature, relative humidity, daily precipitation, barometric pressure, and wind speed were studied. A time series analysis was performed on the data to mathematically model the spore counts in relation to weather parameters. Using SAS PROC ARIMA software, a regression analysis was performed, regressing the spore counts on the weather variables assuming an autoregressive moving average (ARMA) error structure. Cladosporium was found to be positively correlated (P<0.02) with average daily temperature, relative humidity, and negatively correlated with precipitation. Alternaria and Epicoccum did not show increased predictability with weather variables. A mathematical model was derived for Cladosporium spore counts using the annual seasonal cycle and significant weather variables. The model for Alternaria and Epicoccum incorporated the annual seasonal cycle. Fungal spore counts can be modeled by time series analysis and related to meteorological parameters controlling for seasonallity; this modeling can provide estimates of exposure to fungal aeroallergens.

Polyketide derivatives from a marine-sponge-associated fungus Pestalotiopsis heterocornis.

PubMed

Lei, Hui; Lin, Xiuping; Han, Li; Ma, Jian; Dong, Kailin; Wang, Xingbo; Zhong, Jialiang; Mu, Yu; Liu, Yonghong; Huang, Xueshi

2017-10-01

Twelve previously undescribed polyketide derivatives, heterocornols A-L, and seven known analogues were isolated from a culture of the fungus Pestalotiopsis heterocornis associated with sponge. Their structures were elucidated by a comprehensive spectroscopic data analysis and CD Cotton effects. These compounds were evaluated for cytotoxic and antibacterial activities in vitro. Among them, heterocornols A-C, F-H, methyl-(2-formyl-3-hydroxyphenyl)propanoate, agropyrenol, and vaccinol G exhibited cytotoxicities against four human cancer cell lines with IC 50 values 15-100 μM, and they also showed antibacterial activities against Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis with MIC values ranging from 25 to 100 μg/mL. Moreover, compounds heterocornol C, heterocornol G, agropyrenol, and vaccinol G showed weak antifungal activities against Candida parapsilosis and Cryptococcus neoformans with MIC values 100 μg/mL. Copyright © 2017 Elsevier Ltd. All rights reserved.

Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales)

PubMed Central

Bensch, K.; Groenewald, J.Z.; Dijksterhuis, J.; Starink-Willemse, M.; Andersen, B.; Summerell, B.A.; Shin, H.-D.; Dugan, F.M.; Schroers, H.-J.; Braun, U.; Crous, P.W.

2010-01-01

The genus Cladosporium is one of the largest genera of dematiaceous hyphomycetes, and is characterised by a coronate scar structure, conidia in acropetal chains and Davidiella teleomorphs. Based on morphology and DNA phylogeny, the species complexes of C. herbarum and C. sphaerospermum have been resolved, resulting in the elucidation of numerous new taxa. In the present study, more than 200 isolates belonging to the C. cladosporioides complex were examined and phylogenetically analysed on the basis of DNA sequences of the nuclear ribosomal RNA gene operon, including the internal transcribed spacer regions ITS1 and ITS2, the 5.8S nrDNA, as well as partial actin and translation elongation factor 1-α gene sequences. For the saprobic, widely distributed species Cladosporium cladosporioides, both a neotype and epitype are designated in order to specify a well established circumscription and concept of this species. Cladosporium tenuissimum and C. oxysporum, two saprobes abundant in the tropics, are epitypified and shown to be allied to, but distinct from C. cladosporioides. Twenty-two species are newly described on the basis of phylogenetic characters and cryptic morphological differences. The most important phenotypic characters for distinguishing species within the C. cladosporioides complex, which represents a monophyletic subclade within the genus, are shape, width, length, septation and surface ornamentation of conidia and conidiophores; length and branching patterns of conidial chains and hyphal shape, width and arrangement. Many of the treated species, e.g., C. acalyphae, C. angustisporum, C. australiense, C. basiinflatum, C. chalastosporoides, C. colocasiae, C. cucumerinum, C. exasperatum, C. exile, C. flabelliforme, C. gamsianum, and C. globisporum are currently known only from specific hosts, or have a restricted geographical distribution. A key to all species recognised within the C. cladosporioides complex is provided. PMID:20877444

[Frequencies of airborne moulds in Zagreb].

PubMed

Segvić, Maja; Pepeljnjak, Stjepan

2004-06-01

Airborne fungi are sometimes associated with several respiratory diseases and allergies. This paper describes a study of qualitative and quantitative variations in the occurrence of airborne moulds in Zagreb area on three locations: centre of the city (C), Pharmaceutical Botanical Garden "Fran Kusan" (BG) and the mountain Medvednica (M) during autumn, winter, spring and summer 2002-03. Lower concentrations of airborne moulds were found in all three locations in autumn (up to 76.88 CFU/m3) and winter (31.46 CFU/m3), with significantly higher levels in C and BG than in M (P<0.001). In spring and summer, these concentrations were much higher in all sampling sites and were significantly higher in C (160.00 CFU/m3) and BG (134.00 CFU/m3) in spring than in M (90.07 CFU/m3) (P<0.001). In summer, significantly higher concentration was found in C (237.5 CFU/m3) than in BG (186.50 CFU/m3) (P<0.01), while concentrations in C and M (216.70 CFU/m3) were similar. Airspora belonging to 29 fungal genera were identified, and allergologicaly significant moulds, Cladosporium (up to 79.5%) and Alternaria (up to 59.4%) dominated in all sampling sites. Penicillium, Fusarium and Aspergillus were also constant fungal entities (43.0-70.5%), but in much lower concentrations than Cladosporium and Alternaria. Airsporas of Cladosporium and Alternaria were more frequent in spring and summer in all locations, with significantly higher concentrations in C and BG (P<0.05). The risk from allergies increases with higher airspora concentrations in spring and summer due to an increase in Cladosporium and Alternaria.

Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

NASA Astrophysics Data System (ADS)

Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

2017-02-01

Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

Pretreatment Hepatoprotective Effect of the Marine Fungus Derived from Sponge on Hepatic Toxicity Induced by Heavy Metals in Rats

PubMed Central

Abdel-Monem, Nehad M.; Abdel-Azeem, Ahmed M.; El-Ashry, El-Sayed H.; Ghareeb, Doaa A.; Nabil-adam, Asmaa

2013-01-01

The aim of this study was to evaluate the pretreatment hepatoprotective effect of the extract of marine-derived fungus Trichurus spiralis Hasselbr (TS) isolated from Hippospongia communis sponge on hepatotoxicity. Twenty-eight male Sprague-Dawley rats were divided into four groups (n = 7). Group I served as −ve control, group II served as the induced group receiving subcutaneously for seven days 0.25 mg heavy metal mixtures, group III received (i.p.) TS extract of dose 40 mg for seven days, and group IV served as the protected group pretreated with TS extract for seven days as a protection dose, and then treated with the heavy metal-mixture. The main pathological changes within the liver after heavy-metal mixtures administrations marked hepatic damage evidenced by foci of lobular necrosis with neutrophilic infiltration, adjacent to dysplastic hepatocytes. ALT and AST measurements show a significant increase in group II by 46.20% and 45.12%, respectively. Total protein, elevated by about 38.9% in induction group compared to the −ve control group, in contrast to albumin, decreased as a consequence of metal administration with significant elevation on bilirubin level. The results prove that TS extract possesses a hepatoprotective property due to its proven antioxidant and free-radical scavenging properties. PMID:23484129

Nutrition and bioprocess development for efficient biosynthesis of an antitumor compound from marine-derived fungus.

PubMed

Zhou, Weiqiang; Cai, Menghao; Zhou, Jiushun; Jiang, Tao; Zhou, Jiao; Wang, Meixia; Zhou, Xiangshan; Zhang, Yuanxing

2013-10-01

An integrated nutrition and bioprocess strategy was developed for improving the biosynthesis of an antitumor compound, 1403C, by a marine-derived fungus, Halorosellinia sp. (no. 1403). First, statistical design strategies were synthetically applied to optimize the nutritional composition. The resulting 1403C production reached 2.07 g/l, which was 143.5 % higher than the original production. However, it only produced 0.44 g/l of 1403C in 5-l bioreactor fermentation. Thus, the operating parameters including culture pH, dissolved oxygen, agitation speed, impeller type and inoculum level were considered to improve the fermentation process, and an effective control strategy for 1403C production by Halorosellinia sp. submerged in a 5-l bioreactor was established. When inoculating 0.22 g/l dry biomass, controlling dissolved oxygen not lower than 30 % during the growth phase but ranging between 30 and 40 % during the stationary phase, using a double-layer six-flat-blade Rushton disc turbine agitated at 400 rpm, keeping short-term low pH and rapid-rising pH with glucose starvation, the highest 1403C production was finally obtained at 1.32 g/l, which was promoted by 200 % compared to before optimization. Fermentation scale-up was finally performed in a 500-l bioreactor, and 1403C production of 1.09 g/l was obtained.

Comparison of background levels of culturable fungal spore concentrations in indoor and outdoor air in southeastern Austria

NASA Astrophysics Data System (ADS)

Haas, D.; Habib, J.; Luxner, J.; Galler, H.; Zarfel, G.; Schlacher, R.; Friedl, H.; Reinthaler, F. F.

2014-12-01

Background concentrations of airborne fungi are indispensable criteria for an assessment of fungal concentrations indoors and in the ambient air. The goal of this study was to define the natural background values of culturable fungal spore concentrations as reference values for the assessment of moldy buildings. The concentrations of culturable fungi were determined outdoors as well as indoors in 185 dwellings without visible mold, obvious moisture problems or musty odor. Samples were collected using the MAS-100® microbiological air sampler. The study shows a characteristic seasonal influence on the background levels of Cladosporium, Penicillium and Aspergillus. Cladosporium sp. had a strong outdoor presence, whereas Aspergillus sp. and Penicillium sp. were typical indoor fungi. For the region of Styria, the median outdoor concentrations are between 100 and 940 cfu/m³ for culturable xerophilic fungi in the course of the year. Indoors, median background levels are between 180 and 420 cfu/m³ for xerophilic fungi. The I/O ratios of the airborne fungal spore concentrations were between 0.2 and 2.0. For the assessment of indoor and outdoor air samples the dominant genera Cladosporium, Penicillium and Aspergillus should receive special consideration.

Significance of air humidity and air velocity for fungal spore release into the air

NASA Astrophysics Data System (ADS)

Pasanen, A.-L.; Pasanen, P.; Jantunen, M. J.; Kalliokoski, P.

Our previous field studies have shown that the presence of molds in buildings does not necessarily mean elevated airborne spore counts. Therefore, we investigated the release of fungal spores from cultures of Aspergillus fumigatus, Penicillium sp. and Cladosporium sp. at different air velocities and air humidities. Spores of A. fumigatus and Penicillium sp. were released from conidiophores already at air velocity of 0.5 ms -1, whereas Cladosporium spores required at least a velocity of 1.0 ms -1. Airborne spore counts of A. fumigatus and Penicillium sp. were usually higher in dry than moist air, being minimal at relative humidities (r.h.) above 70%, while the effect of r.h. on the release of Cladosporium sp. was ambivalent. The geometric mean diameter of released spores increased when the r.h. exceeded a certain level which depends on fungal genus. Thus, spores of all three fungi were hygroscopic but the hygroscopicity of various spores appeared at different r.h.-ranges. This study indicates that spore release is controlled by external factors and depends on fungal genus which can be one reason for considerable variation of airborne spore counts in buildings with mold problems.

Antifungal efficacy of thymol, carvacrol, eugenol and menthol as alternative agents to control the growth of food-relevant fungi.

PubMed

Abbaszadeh, S; Sharifzadeh, A; Shokri, H; Khosravi, A R; Abbaszadeh, A

2014-06-01

This work is an attempt to examine the antifungal activity of thymol, carvacrol, eugenol and menthol against 11 food-decaying fungi. The susceptibility test for the compounds was carried out in terms of minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) using microdilution method in 96 multi-well microtiter plates. Results indicated that all compounds were effective to varying extents against various fungal isolates, with the highest efficacy displayed by carvacrol (mean MIC value: 154.5 μg/mL) (P<0.05). The incorporation of increased concentrations of all compounds to the media led to progressive and significant reduction in growth for all fungi. The most potent inhibitory activity of thymol, carvacrol, eugenol and menthol was found for Cladosporium spp. (MIC: 100 μg/mL), Aspergillus spp. (MIC: 100 μg/mL), Cladosporium spp. (MIC: 350 μg/mL), and Aspergillus spp. and Cladosporium spp. (MIC: 125 μg/mL), respectively. Thus, the application of these herbal components could be considered as a good alternatives to inhibit fungal growth and to reduce the use of synthetic fungicides. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Bioremediation potential of hydrocarbon-utilizing fungi from select marine niches of India.

PubMed

Barnes, Natasha Maria; Khodse, Vishwas B; Lotlikar, Nikita P; Meena, Ram Murti; Damare, Samir R

2018-01-01

Ten fungal isolates with an ability to degrade crude oil were isolated from select marine substrates, such as mangrove sediments, Arabian Sea sediments, and tarballs. Out of the ten isolates, six belonged to Aspergillus , two to Fusarium and one each to Penicillium and Acremonium as identified using ITS rDNA sequencing. The selected ten fungal isolates were found to degrade the long-chain n -alkanes as opposed to short-chain n -alkanes from the crude oil. Mangrove fungus #NIOSN-M126 ( Penicillium citrinum ) was found to be highly efficient in biodegradation of crude oil, reducing the total crude oil content by 77% and the individual n -alkane fraction by an average of 95.37%, indicating it to be a potential candidate for the development into a bioremediation agent.

[Atmospheric concentration of fungus spores in Ankara and the effect of meteorological factors in 2003 period].

PubMed

Ceter, Talip; Pinar, Nur Münevver

2009-10-01

The atmospheric concentrations of airborne fungus spores change continuously according to the meteorological factors, and their intensity have important allergic effects on atopic subjects and opportunistic pathogenic effects on immunocompromised patients. The aim of this study was to identify the fungal spores found in Ankara atmosphere during 2003 period and to investigate the changes in spore concentrations in relation to meteorological factors. Fungal spores were sampled by using 7-day Burkard volumetric trap between January to December 2003, and probable identification was performed microscopically based on their morphological structures. A total of 433.079 spores/m3 belonging to 35 taxa were observed during the study. The rates of these taxa were as follows; 75.5% Cladosporium, 6.1% Alternaria, 2.2% Leptosphaeria, 2.2% Ustilago, 2.1% 1-septate ascospores, 2% Exosporium, 1.6% Pleospora, and 1.3% Drechslera. The other taxa with concentrations < 1% have consisted a total of 7.1% of all atmospheric spores (Puccinia, Curvularia, Coprinus, Nigrospora, Periconia, Melanomma, Torula, Ascobolus, Agrocybe, Pithomyces, Stemphyllium, Ganoderma, Boletus, Peronospora, Venturia, Paraphaeosphaeria, Epicoccum, Didymella, Chaetomium and Fusarium rates between 0.7-0.1%; Oidium, Xylaria, Botrytis, Melanospora, Dictyosporium, Sporormiella and Tetracoccosporium rates between 0.09-0.01%). Although fungal spores were detected in all months in Ankara atmosphere, the evaluation of the seasonal distribution of spore concentrations revealed that the highest value was detected in July (100.697 spores/m3), while the lowest value was in January (4268 spores/m3). When the effects of meteorological factors on spore concentrations were investigated, it was found that, monthly mean temperature (> 20 degrees C) has a strong positive correlation (p < 0.01), and monthly mean relative humidity (< %50) and precipitation (0-20 mm) have strong negative correlations (p < 0.01) on the spore concentrations, while wind velocity (3 m/s) has a slightly positive effect. An annual spore calendar which indicated weekly concentrations and allergenicity levels of those identified fungal spores, was also prepared in this study. In conclusion, it is expected that these data would be helpful for the researchers in the area of aeropalinology and for the clinicians to evaluate allergic diseases.

Diesel pollution biodegradation: synergetic effect of Mycobacterium and filamentous fungi.

PubMed

Li, You-Qing; Liu, Hong-Fang; Tian, Zhen-Le; Zhu, Li-Hua; Wu, Ying-Hui; Tang, He-Qing

2008-06-01

To biodegrade the diesel pollution in aqueous solution inoculated with Mycobacterium and filamentous fungi. Bacteria sampled from petroleum hydrocarbons contaminated sites in Karamay Oilfield were isolated and identified as Mycobacterium hyalinum (MH) and cladosporium. Spectrophotometry and gas chromatography (GC) were used to analyze of the residual concentrations of diesel oil and its biodegradation products. From the GC data, the values of apparent biodegradation ratio of the bacterial strain MH to diesel oil were close to those obtained in the control experiments. Moreover, the number of MH did not increase with degradation time. However, by using n-octadecane instead of diesel oil, the real biotic degradation ratio increased to 20.9% over 5 days of degradation. Cladosporium strongly biodegraded diesel oil with a real degradation ratio of up to 34% after 5 days treatment. When the two strains were used simultaneously, a significant synergistic effect between them resulted in almost complete degradation of diesel oil, achieving a total diesel removal of 99% over 5 days of treatment, in which one part of about 80% and another part of about 19% were attributed to biotic and abiotic processes, respectively. The observed synergistic effect was closely related to the aromatics-degrading ability of Cladosporium, which favored the growth of MH and promoted the bioavailability of diesel oil.

Associations between outdoor fungal spores and childhood and adolescent asthma hospitalizations.

PubMed

Tham, Rachel; Vicendese, Don; Dharmage, Shyamali C; Hyndman, Rob J; Newbigin, Ed; Lewis, Emma; O'Sullivan, Molly; Lowe, Adrian J; Taylor, Philip; Bardin, Philip; Tang, Mimi L K; Abramson, Michael J; Erbas, Bircan

2017-04-01

Childhood asthma is a significant public health problem and severe exacerbations can result in diminished quality of life and hospitalization. We sought to examine the contribution of outdoor fungi to childhood and adolescent asthma hospitalizations. The Melbourne Air Pollen Children and Adolescent study is a case-crossover study of 644 children and adolescents (aged 2-17 years) hospitalized for asthma. The Melbourne Air Pollen Children and Adolescent study collected individual data on human rhinovirus infection and sensitization to Alternaria and Cladosporium and daily counts of ambient concentrations of fungal spores, pollen, and air pollutants. Conditional logistic regression models were used to assess associations with increases in spore counts while controlling for potential confounding and testing interactions. Exposure to Alternaria (adjusted odds ratio [aOR], 1.07; 95% CI, 1.03-1.11), Leptosphaeria (aOR, 1.05; 95% CI, 1.02-1.07), Coprinus (aOR, 1.04; 95% CI, 1.01-1.07), Drechslera (aOR, 1.03; 95% CI, 1.00-1.05), and total spores (aOR, 1.05; 95% CI, 1.01-1.09) was significantly associated with child asthma hospitalizations independent of human rhinovirus infection. There were significant lagged effects up to 3 days with Alternaria, Leptosphaeria, Cladosporium, Sporormiella, Coprinus, and Drechslera. Some of these associations were significantly greater in participants with Cladosporium sensitization. Exposures to several outdoor fungal spore taxa, including some not reported in previous research, are associated with the risk of child and adolescent asthma hospitalization, particularly in individuals sensitized to Cladosporium. We need further studies to examine cross-reactivity causing asthma exacerbations. Identifying sensitization to multiple fungal allergens in children with asthma could support the design and implementation of more effective strategies to prevent asthma exacerbations. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

The Mycobiota of Air Inside and Outside the Meju Fermentation Room and the Origin of Meju Fungi.

PubMed

Kim, Dae-Ho; Kim, Sun-Hwa; Kwon, Soon-Wo; Lee, Jong-Kyu; Hong, Seung-Beom

2015-09-01

The fungi on Meju are known to play an important role as degrader of macromolecule of soybeans. In order to elucidate the origin of fungi on traditional Meju, mycobiota of the air both inside and outside traditional Meju fermentation rooms was examined. From 11 samples of air collected from inside and outside of 7 Meju fermentation rooms, 37 genera and 90 species of fungi were identified. In outside air of the fermentation room, Cladosporium sp. and Cladosporium cladosporioides were the dominant species, followed by Cladosporium tenuissimum, Eurotium sp., Phoma sp., Sistotrema brinkmannii, Alternaria sp., Aspergillus fumigatus, Schizophyllum commune, and Penicillium glabrum. In inside air of the fermentation room, Cladosporium sp., Aspergillus oryzae, Penicillium chrysogenum, Asp. nidulans, Aspergillus sp., Cla. cladosporioides, Eurotium sp., Penicillium sp., Cla. tenuissimum, Asp. niger, Eur. herbariorum, Asp. sydowii, and Eur. repens were collected with high frequency. The concentrations of the genera Aspergillus, Eurotium, and Penicillium were significantly higher in inside air than outside air. From this result and those of previous reports, the origin of fungi present on Meju was inferred. Of the dominant fungal species present on Meju, Lichtheimia ramosa, Mucor circinelloides, Mucor racemosus, and Scopulariopsis brevicaulis are thought to be originated from outside air, because these species are not or are rarely isolated from rice straw and soybean; however, they were detected outside air of fermentation room and are species commonly found in indoor environments. However, Asp. oryzae, Pen. polonicum, Eur. repens, Pen. solitum, and Eur. chevalieri, which are frequently found on Meju, are common in rice straw and could be transferred from rice straw to Meju. The fungi grow and produce abundant spores during Meju fermentation, and after the spores accumulate in the air of fermentation room, they could influence mycobiota of Meju fermentation in the following year. This could explain why concentrations of the genera Aspergillus, Eurotium, and Penicillium are much higher inside than outside of the fermentation rooms.

Identifying risk factors for exposure to culturable allergenic moulds in energy efficient homes by using highly specific monoclonal antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharpe, Richard A.; Cocq, Kate Le; Nikolaou, Vasilis

The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing ofmore » the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. - Highlights: • Monoclonal antibodies were used to track culturable allergenic moulds in homes. • Allergenic moulds were recovered from 82% of swabs from contaminated surfaces. • The mAbs were highly specific with 100% agreement to PCR of recovered fungi. • Improvements to energy efficiency lowered risk of exposure to allergenic fungi.« less

The Mycobiota of Air Inside and Outside the Meju Fermentation Room and the Origin of Meju Fungi

PubMed Central

Kim, Dae-Ho; Kim, Sun-Hwa; Kwon, Soon-wo; Lee, Jong-Kyu

2015-01-01

The fungi on Meju are known to play an important role as degrader of macromolecule of soybeans. In order to elucidate the origin of fungi on traditional Meju, mycobiota of the air both inside and outside traditional Meju fermentation rooms was examined. From 11 samples of air collected from inside and outside of 7 Meju fermentation rooms, 37 genera and 90 species of fungi were identified. In outside air of the fermentation room, Cladosporium sp. and Cladosporium cladosporioides were the dominant species, followed by Cladosporium tenuissimum, Eurotium sp., Phoma sp., Sistotrema brinkmannii, Alternaria sp., Aspergillus fumigatus, Schizophyllum commune, and Penicillium glabrum. In inside air of the fermentation room, Cladosporium sp., Aspergillus oryzae, Penicillium chrysogenum, Asp. nidulans, Aspergillus sp., Cla. cladosporioides, Eurotium sp., Penicillium sp., Cla. tenuissimum, Asp. niger, Eur. herbariorum, Asp. sydowii, and Eur. repens were collected with high frequency. The concentrations of the genera Aspergillus, Eurotium, and Penicillium were significantly higher in inside air than outside air. From this result and those of previous reports, the origin of fungi present on Meju was inferred. Of the dominant fungal species present on Meju, Lichtheimia ramosa, Mucor circinelloides, Mucor racemosus, and Scopulariopsis brevicaulis are thought to be originated from outside air, because these species are not or are rarely isolated from rice straw and soybean; however, they were detected outside air of fermentation room and are species commonly found in indoor environments. However, Asp. oryzae, Pen. polonicum, Eur. repens, Pen. solitum, and Eur. chevalieri, which are frequently found on Meju, are common in rice straw and could be transferred from rice straw to Meju. The fungi grow and produce abundant spores during Meju fermentation, and after the spores accumulate in the air of fermentation room, they could influence mycobiota of Meju fermentation in the following year. This could explain why concentrations of the genera Aspergillus, Eurotium, and Penicillium are much higher inside than outside of the fermentation rooms. PMID:26539041

(±)-Pestalachloride D, an antibacterial racemate of chlorinated benzophenone derivative from a soft coral-derived fungus Pestalotiopsis sp.

PubMed

Wei, Mei-Yan; Li, Dan; Shao, Chang-Lun; Deng, Dong-Sheng; Wang, Chang-Yun

2013-03-28

A new antibacterial chlorinated benzophenone derivative, (±)-pestalachloride D (1), along with a related analog, (±)-pestalachloride C (2), was recently isolated from the marine-derived fungus Pestalotiopsis sp. isolated from a soft coral Sarcophyton sp. collected from Yongxing Island in the South China Sea. Both chiral HPLC analysis and single-crystal X-ray data indicated that 1 is a racemic mixture. Interestingly, 1 did not exhibit any effect in the zebrafish embryo teratogenicity assay, while 2 led to abnormal growth. The potential impact on zebrafish embryo growth is discussed based on their crystal structures. The main difference of crystal structures between 1 and 2 is that the six-member non-aromatic ring (O4, C10, C9, C8, C2', and C3') in 1 exhibits a distorted chair conformation, while 2 shows a distorted boat conformation. Moreover, compounds 1 and 2 both exhibited moderate antibacterial activity.

(±)-Pestalachloride D, an Antibacterial Racemate of Chlorinated Benzophenone Derivative from a Soft Coral-Derived Fungus Pestalotiopsis sp

PubMed Central

Wei, Mei-Yan; Li, Dan; Shao, Chang-Lun; Deng, Dong-Sheng; Wang, Chang-Yun

2013-01-01

A new antibacterial chlorinated benzophenone derivative, (±)-pestalachloride D (1), along with a related analog, (±)-pestalachloride C (2), was recently isolated from the marine-derived fungus Pestalotiopsis sp. isolated from a soft coral Sarcophyton sp. collected from Yongxing Island in the South China Sea. Both chiral HPLC analysis and single-crystal X-ray data indicated that 1 is a racemic mixture. Interestingly, 1 did not exhibit any effect in the zebrafish embryo teratogenicity assay, while 2 led to abnormal growth. The potential impact on zebrafish embryo growth is discussed based on their crystal structures. The main difference of crystal structures between 1 and 2 is that the six-member non-aromatic ring (O4, C10, C9, C8, C2′, and C3′) in 1 exhibits a distorted chair conformation, while 2 shows a distorted boat conformation. Moreover, compounds 1 and 2 both exhibited moderate antibacterial activity. PMID:23538869

Bioactive Secondary Metabolites from a Thai Collection of Soil and Marine-Derived Fungi of the Genera Neosartorya and Aspergillus.

PubMed

Zin, War War May; Prompanya, Chadaporn; Buttachon, Suradet; Kijjoa, Anake

2016-01-01

Fungi are microorganisms which can produce interesting secondary metabolites with structural diversity. Although terrestrial fungi have been extensively investigated for their bioactive secondary metabolites such as antibiotics, marine-derived fungi have only recently attracted attention of Natural Products chemists. Our group has been working on the secondary metabolites produced by the cultures of the fungi of the genera Neosartorya and Aspergillus, collected from soil and marine environments from the tropical region for the purpose of finding new leads for anticancer and antibacterial drugs. This review covers only the secondary metabolites of four soil and six marine-derived species of Neosarorya as well as a new species of marine-derived Aspergillus, investigated by our group. In total, we have isolated fifty three secondary metabolites which can be categorized as polyketides (two), isocoumarins (six), terpenoids (two), meroterpenes (fourteen), alkaloids (twenty eight) and cyclic peptide (one). The anticancer and antibacterial activities of these fungal metabolites are also discussed. Among fifty three secondary metabolites isolated, only the alkaloid eurochevalierine and the cadinene sesquiterpene, isolated from the soil fungus N. pseudofisheri, showed relevant in vitro cytostatic activity against glioblastoma (U373) and non-small cell lung cancer (A549) cell lines while the meroditerpene aszonapyrone A exhibited strong antibacterial activity against multidrug-resistant Gram-positive bacteria and also strong antibiofilm activity in these isolates.

Identification of marine neuroactive molecules in behaviour-based screens in the larval zebrafish.

PubMed

Long, Si-Mei; Liang, Feng-Yin; Wu, Qi; Lu, Xi-Lin; Yao, Xiao-Li; Li, Shi-Chang; Li, Jing; Su, Huanxing; Pang, Ji-Yan; Pei, Zhong

2014-05-30

High-throughput behavior-based screen in zebrafish is a powerful approach for the discovery of novel neuroactive small molecules for treatment of nervous system diseases such as epilepsy. To identify neuroactive small molecules, we first screened 36 compounds (1-36) derived from marine natural products xyloketals and marine isoprenyl phenyl ether obtained from the mangrove fungus. Compound 1 demonstrated the most potent inhibition on the locomotor activity in larval zebrafish. Compounds 37-42 were further synthesized and their potential anti-epilepsy action was then examined in a PTZ-induced epilepsy model in zebrafish. Compound 1 and compounds 39, 40 and 41 could significantly attenuate PTZ-induced locomotor hyperactivity and elevation of c-fos mRNA in larval zebrafish. Compound 40 showed the most potent inhibitory action against PTZ-induced hyperactivity. The structure-activity analysis showed that the OH group at 12-position played a critical role and the substituents at the 13-position were well tolerated in the inhibitory activity of xyloketal derivatives. Thus, these derivatives may provide some novel drug candidates for the treatment of epilepsy.

Examination of fungi in domestic interiors by using factor analysis: Correlations and associations with home factors. [Cladosporium, Alternaria, Epicoccum, Aureobasidium, Aspergillus; Penicillium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, H.J.; Rotnitzky, A.; Spengler, J.D.

1992-01-01

Factor analysis was utilized to investigate correlations among airborne microorganisms collected with Andersen samplers from homes in Topeka, Kans., during the winter of 1987 to 1988. The factors derived were used to relate microbial concentrations with categorical, questionnaire-derived descriptions of housing conditions. This approach successfully identified groups of common aboveground decay fungi including Cladosporium, Alternaria, Epicoccum, and Aureobasidium spp. The common soil fungi Aspergillus and Penicillium spp. were also separated as a group. These previously known ecological groupings were confirmed with air sampling data by a quantitative evaluation technique. The above ground decay fungi sampled indoors in winter were presentmore » at relatively high concentrations in homes with gas stoves for cooking, suggesting a possible association between these fungi and increased humidity from the combustion process. Elevated concentrations of the soil fungi were significantly associated with the dirt floor, crawl-space type of basement. Elevated concentrations of water-requiring fungi, such as Fusarium spp., were shown to be associated with water collection in domestic interiors. Also, elevated mean concentrations for the group of fungi including Cladosporium, Epicoccum, Aureobasidium, and yeast spp. were found to be associated with symptoms reported on a health questionnaire. This finding was consistent with the authors previous study of associations between respiratory health and airborne microorganisms by univariate logistic regression analysis.« less

Molecular and morphological identification of fungal species isolated from bealmijang meju.

PubMed

Kim, Ji Yeun; Yeo, Soo-Hwan; Baek, Sung Yeol; Choi, Hye Sun

2011-12-01

Bealmijang is a short-term aged paste made from meju, which is a brick of fermented soybeans and other ingredients. Different types of bealmijang are available depending on the geographic region or ingredients used. However, no study has clarified the microbial diversity of these types. We identified 17 and 14 fungal species from black soybean meju (BSM) and buckwheat meju (BWM), respectively, on the basis of morphology, culture characteristics, and internal transcribed spacer and beta-tubulin gene sequencing. In both meju, Aspergillus oryzae, Rhizopus oryzae, Penicillium polonicum, P. steckii, Cladosporium tenuissimum, C. cladosporioides, C. uredinicola, and yeast species Pichia burtonii were commonly found. Moreover, A. flavus, A. niger, P. crustosum, P. citrinum, Eurotium niveoglaucum, Absidia corymbifera, Setomelanomma holmii, Cladosporium spp. and unclassified species were identified from BSM. A. clavatus, Mucor circinelloides, M. racemosus, P. brevicompactum, Davidiella tassiana, and Cladosporium spp. were isolated from BWM. Fast growing Zygomycetous fungi is considered important for the early stage of meju fermentation, and A. oryae and A. niger might play a pivotal role in meju fermentation owing to their excellent enzyme productive activities. It is supposed that Penicillium sp. and Pichia burtonii could contribute to the flavor of the final food products. Identification of this fungal diversity will be useful for understanding the microbiota that participate in meju fermentation, and these fungal isolates can be utilized in the fermented foods and biotechnology industries.

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae).

PubMed

Amatuzzi, R F; Cardoso, N; Poltronieri, A S; Poitevin, C G; Dalzoto, P; Zawadeneak, M A; Pimentel, I C

2017-11-09

This study reports the first assessment of endophytic fungi isolated from strawberry leaves and selection of isolates for the control of Duponchelia fovealis, a new pest of strawberries. A total of 400 strawberry leaves of the cultivar 'Albion' were collected in four commercial farms. Leaves were disinfected, cut in fragments, and placed on Petri dishes containing potato dextrose agar media with tetracycline and incubated for 30 days. Following this time, 517 fungal colonies were isolated, and thirteen genera were identified: Cladosporium, Aspergillus, Nigrospora, Fusarium, Trichoderma, Chaetomium, Alternaria, Paecilomyces, Penicillium, Ulocladium, Bipolaris, Diaporthe, and Phoma. Eight isolates belonging to the genera Aspergillus, Diaporthe, Paecilomyces, and Cladosporium were selected for pathogenicity bioassays against third instar larvae of D. fovealis. Isolates of Paecilomyces induced the highest mortality rates.

[Correlation between positive skin tests to molds, total IgE, and specific IgE using ELISA and mold cultures from the environment of the pediatric allergy patient].

PubMed

García Caballero, R; Nader, O; Morfin Maciel, B

2001-01-01

The aim of this study was to made a correlation between allergic symptoms, positive skin prick test to fungi, total and specific IgE and mold culture in the patient's environmental. There were included 35 children (3-16 years), with skin prick test positive to fungi. The most frequent were: Rhizopus, Aspergillus, Cladosporium and Candida. Total and specific IgE were measured with ELISA, with titers high in 77.2% and 31.4% respectively. Fungal cultures were collected from dwellings and schools. The most frequently isolated mold genera were Cladosporium, Alternaria and Penicillium in the same proportion in both places: dwellings and schools. We concluded fungi are commonly found in children's environment.

Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology.

PubMed

D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

2009-11-25

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1).

Laccase production in bioreactor scale under saline condition by the marine-derived basidiomycete Peniophora sp. CBMAI 1063.

PubMed

Mainardi, Pedro H; Feitosa, Valker A; Brenelli de Paiva, Livia B; Bonugli-Santos, Rafaella C; Squina, Fabio M; Pessoa, Adalberto; Sette, Lara D

2018-05-01

Laccase production in saline conditions is still poorly studied. The aim of the present study was to investigate the production of laccase in two different types of bioreactors by the marine-derived basidiomycete Peniophora sp. CBMAI 1063. The highest laccase activity and productivity were obtained in the Stirred Tank (ST) bioreactor, while the highest biomass concentration in Air-lift (AL) bioreactor. The main laccase produced was purified by ion exchange and size exclusion chromatography and appeared to be monomeric with molecular weight of approximately 55 kDa. The optimum oxidation activity was obtained at pH 5.0. The thermal stability of the enzyme ranged from 30 to 50 °C (120 min). The Far-UV Circular Dichroism revealed the presence of high β-sheet and low α-helical conformation in the protein structure. Additional experiments carried out in flask scale showed that the marine-derived fungus was able to produce laccase only in the presence of artificial seawater and copper sulfate. Results from the present study confirmed the fungal adaptation to marine conditions and its potential for being used in saline environments and/or processes. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Fatal bacterial septicemia in a bottlenose dolphin Tursiops truncatus caused by Streptococcus iniae.

PubMed

Song, Zhiqi; Yue, Ruichao; Sun, Yanming; Liu, Chunfa; Khan, Sher Hayat; Li, Chaosi; Zhao, Ying; Zhou, Xiangmei; Yang, Lifeng; Zhao, Deming

2017-01-24

A captive 8 yr old male bottlenose dolphin Tursiops truncatus succumbed to septicemia with multisystemic inflammation including suppurative enteritis, encephalitis, and pneumonia with chronic pancreatitis. A pure culture of beta-hemolytic, catalase- and oxidase-negative, Gram-positive cocci was isolated from the hilar lymph nodes and pancreas. The isolate was identified by 16S rDNA sequencing as Streptococcus iniae. Histological examination of the digestive system revealed a mixed infection of both bacteria and fungus. Recognized as a pathogen in fish, dolphins, and humans, this is the first report of S. iniae in a dolphin in mainland China. As the number of managed animals in oceanariums is increasing, so is the frequency of contact with fish used as food for marine mammals and humans, highlighting the importance of education and appropriate personal protective protocols to minimize the risk of transmission. An understanding of marine mammal infectious disease organisms is essential to ensuring the health of marine mammals and humans coming into contact with such animals and their food. This study illustrates a systematic clinical, microbiological, and pathological investigation into a septicemic bottlenose dolphin infected with S. iniae. Our findings provide useful information for those involved in the diagnosis and control of infectious diseases in marine mammals and offer insight into an important zoonotic pathogen.

Antibacterial and Antibiofilm Activities of Tryptoquivalines and Meroditerpenes Isolated from the Marine-Derived Fungi Neosartorya paulistensis, N. laciniosa, N. tsunodae, and the Soil Fungi N. fischeri and N. siamensis

PubMed Central

Gomes, Nelson M.; Bessa, Lucinda J.; Buttachon, Suradet; Costa, Paulo M.; Buaruang, Jamrearn; Dethoup, Tida; Silva, Artur M.S.; Kijjoa, Anake

2014-01-01

A new meroditerpene, sartorypyrone C (5), was isolated, together with the known tryptoquivalines l (1a), H (1b), F (1c), 3′-(4-oxoquinazolin-3-yl) spiro[1H-indole-3,5′]-2,2′-dione (2) and 4(3H)-quinazolinone (3), from the culture of the marine sponge-associated fungus Neosartorya paulistensis (KUFC 7897), while reexamination of the fractions remaining from a previous study of the culture of the diseased coral-derived fungus N. laciniosa (KUFC 7896) led to isolation of a new tryptoquivaline derivative tryptoquivaline T (1d). Compounds 1a–d, 2, 3, and 5, together with aszonapyrones A (4a) and B (4b), chevalones B (6) and C (7a), sartorypyrones B (7b) and A (8), were tested for their antibacterial activity against four reference strains (Staphylococcus aureus, Bacillus subtilis, Escherichia coli, and Pseudomonas aeruginosa), as well as the environmental multidrug-resistant isolates. Only aszonapyrone A (4a) and sartorypyrone A (8) exhibited significant antibacterial activity as well as synergism with antibiotics against the Gram-positive multidrug-resistant strains. Antibiofilm assays of aszonapyrone A (4a) and sartorypyrone A (8) showed that practically no biofilm was formed in the presence of their 2× MIC and MIC. However, the presence of a sub-inhibitory concentration of ½ MIC of 4a and 8 was found to increase the biofilm production in both reference strain and the multidrug-resistant isolates of S. aureus. PMID:24477284

Light regulation on growth, development, and secondary metabolism of marine-derived filamentous fungi.

PubMed

Cai, Menghao; Fang, Zhe; Niu, Chuanpeng; Zhou, Xiangshan; Zhang, Yuanxing

2013-11-01

Effects of different light conditions on development, growth, and secondary metabolism of three marine-derived filamentous fungi were investigated. Darkness irritated sexual development of Aspergillus glaucus HB1-19, while white, red, and blue lights improved its asexual behavior. The red and blue lights improved asexual stroma formation of Xylaria sp. (no. 2508), but the darkness and white light inhibited it. Differently, development of Halorosellinia sp. (no. 1403) turned out to be insensitive to any tested light irradiation. Upon the experimental data, no regularity was observed linking development with secondary metabolism. However, fungal growth showed inversely correlation with productions of major bioactive compounds (aspergiolide A, 1403C, and xyloketal B) from various strains. The results indicated that aspergiolide A biosynthesis favored blue light illumination, while 1403C and xyloketal B preferred red light irradiation. With the favorite light sensing conditions, productions of aspergiolide A, 1403C, and xyloketal B were enhanced by 32.9, 21.9, and 30.8 % compared with those in the dark, respectively. The phylogenetic analysis comparing the light-responding proteins of A. glaucus HB 1-19 with those in other systems indicated that A. glaucus HB 1-19 was closely related to Aspergillus spp. especially A. nidulans in spite of its role of marine-derived fungus. It indicated that marine fungi might conserve its light response system when adapting the marine environment. This work also offers useful information for process optimization involving light regulation on growth and metabolism for drug candidate production from light-sensitive marine fungi.

New Metabolites and Bioactive Chlorinated Benzophenone Derivatives Produced by a Marine-Derived Fungus Pestalotiopsis heterocornis.

PubMed

Lei, Hui; Lin, Xiuping; Han, Li; Ma, Jian; Ma, Qingjuan; Zhong, Jialiang; Liu, Yonghong; Sun, Tiemin; Wang, Jinhui; Huang, Xueshi

2017-03-13

Four new compounds, including two isocoumarins, pestaloisocoumarins A and B ( 1 , 2 ), one sesquiterpenoid degradation, isopolisin B ( 4 ), and one furan derivative, pestalotiol A ( 5 ), together with one known isocoumarin, gamahorin ( 3 ), and three chlorinated benzophenone derivatives, pestalachloride B ( 6 ), pestalachloride E ( 7 ) and a mixture of pestalalactone atropisomers ( 8a/8b ), were isolated from a culture of the fungus Pestalotiopsis heterocornis associated with sponge Phakellia fusca . These new chemical structures were established using NMR and MS spectroscopic data, as well as single-crystal X-ray crystallographic analysis and CD Cotton effects. All of the isolated compounds were evaluated for their antimicrobial and cytotoxic activities. Isocoumarins 1 - 3 , showed antibacterial activities against Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis with MIC values ranging from 25 to 100 μg/mL and weak antifungal activities. Chlorinated benzophenone derivatives 6 - 8 exhibited antibacterial activities against S. aureus and B. subtilis with MIC values ranging from 3.0 to 50 μg/mL and cytotoxicities against four human cancer cell lines with IC 50 values of 6.8-87.8 μM.

Enzymatic Activity and Susceptibility to Antifungal Agents of Brazilian Environmental Isolates of Hortaea werneckii.

PubMed

Formoso, Andrea; Heidrich, Daiane; Felix, Ciro Ramón; Tenório, Anne Carolyne; Leite, Belize R; Pagani, Danielle M; Ortiz-Monsalve, Santiago; Ramírez-Castrillón, Mauricio; Landell, Melissa Fontes; Scroferneker, Maria L; Valente, Patricia

2015-12-01

Four strains of Hortaea werneckii were isolated from different substrates in Brazil (a salt marsh macrophyte, a bromeliad and a marine zoanthid) and had their identification confirmed by sequencing of the 26S rDNA D1/D2 domain or ITS region. Most of the strains were able to express amylase, lipase, esterase, pectinase and/or cellulase, enzymes that recognize components of plant cells as substrates, but did not express albuminase, keratinase, phospholipase and DNAse, whose substrates are animal-related. Urease production was positive for all isolates, while caseinase, gelatinase and laccase production were variable among the strains. All the strains grew in media containing up to 30% NaCl. We propose that the primary substrate associated with H. werneckii is plant-related, in special in saline environments, where the fungus may live as a saprophyte and decomposer. Infection of animal-associated substrates would be secondary, with the fungus acting as an opportunistic animal pathogen. All strains were resistant to fluconazole and presented high MIC for amphotericin B, while they were susceptible to all the other antifungal agents tested.

Mold Occurring on the Air Cleaner High-Efficiency Particulate Air Filters Used in the Houses of Child Patients with Atopic Dermatitis

PubMed Central

Kim, Seong Hwan; Ahn, Geum Ran; Son, Seung Yeol; Bae, Gwi-Nam

2014-01-01

Fungi are the known sources of irritation associated with atopic diseases (e.g., asthma, allergic rhinoconjunctivitis, and atopic eczema). To quantitatively estimate their presence in the indoor environment of atopic dermatitis-inflicted child patient's houses (ADCPHs), the high-efficiency particulate air (HEPA) filters installed inside the air cleaners of three different ADCPHs were investigated for the presence of mold. The air cleaner HEPA filters obtained from the three different ADCPHs were coded as HEPA-A, -B, and -C, respectively, and tested for the presence of mold. The colony forming units (CFUs) corresponding to the HEPA-A, -B, and -C filters were estimated to be 6.51 × 102 ± 1.50 × 102 CFU/cm2, 8.72 × 102 ± 1.69 × 102 CFU/cm2, and 9.71 × 102 ± 1.35 × 102 CFU/cm2, respectively. Aspergillus, Penicillium, Alternaria, Cladosporium, Trichoderma, and other fungal groups were detected in the 2,494 isolates. The distribution of these fungal groups differed among the three filters. Cladosporium was the major fungal group in filters HEPA-A and -C, whereas Penicillium was the major fungal group in the filter HEPA-B. Nine fungal species, including some of the known allergenic species, were identified in these isolates. Cladosporium cladosporioides was the most common mold among all the three filters. This is the first report on the presence of fungi in the air cleaner HEPA filters from ADCPHs in Korea. PMID:25346608

Detection of fungal infectous agent of wheat grains in store-pits of Markazi province, Iran.

PubMed

Saberi-Riseh, R; Javan-Nikkhah, M; Heidarian, R; Hosseini, S; Soleimani, P

2004-01-01

Wheat is an economic and important crop that provides approximately 20% of food calorie in the world. It is first crop in Iran and cultivated in the most areas of this country. Store-pit fungi make undesirable changes in quality and appearance of wheat grains. Even, some fungi produce different mycotoxins which are toxic to human and livestock's that use wheat grains as source of food. In this study, several samples were randomly collected from each of five store-pits located in different areas of Markazi Province including: Arak, Mahallat, Khomein, Saveh and Sarband. Grains were treated on PDA, and blotter, agar and washing test also used for isolating and detection of fungi. At least 100 grains per each sample were randomly used for each test and treatment. The fungi that determined in this study were Cochliobolus australiensis, Cladosporium herbarum, Epicoccum sp., Tilletia leavis, Aspergillus flavus, A. niger, A. fumigatus, Alternaria alternata, Alternaria sp., Penicillium italicum, P. digitatum, Fusarium sp., Rhizopus sp., Ustilago tritici, Scytalidium sp. Among these fungi the most isolates were belonged to Cladosporium, Alternaria, Rhizopus and Fusarium. Cladosporium herbarum was the most common in different sampling areas. Tilletia laevis and Ustilago tritici were just recovered in washing test. This study revealed that different fungi are associated with wheat grains in store-pits in Markazi Province. Some of them like Aspergillus flavus normally produce aflatoxin, a very toxic and carcinogenic mycotoxin that is harmful for human.

Antibacterial and antimycotic activities of Slovenian honeys.

PubMed

Kuncic, M Kralj; Jaklic, D; Lapanje, A; Gunde-Cimerman, N

2012-01-01

In the present study, Slovenian honey samples produced from different floral sources are evaluated for their antibacterial and antifungal properties. The peroxide contribution to antibacterial activity is also determined. Minimum inhibitory concentration (MIC) of the honeys was assessed against four bacterial species (Escherichia coli, Enterococcus faecalis, Pseudomonas aeruginosa and Staphylococcus aureus) and against eight fungal species (Aspergillus niger, Aureobasidium pullulans, Candida albicans, Candida parapsilosis, Candida tropicalis, Cladosporium cladosporioides, Penicillium chrysogenum and Rhodotorula mucilaginosa). Honey at concentrations between 1% and 50% (v/v) were tested. Although all of the bacterial species were inhibited by the different honey samples, the chestnut and pasture honeys showed the highest antibacterial activities. The antifungal activities were concentration-dependent, with five (Aureobasidium pullulans, Candida parapsilosis, Candida tropicalis, Cladosporium cladosporioides, Rhodotorula mucilaginosa) inhibited only at honey concentrations greater than 50%. The fungi Aspergillus niger, Candida albicans and Penicillium chrysogenum were not inhibited by any of the tested honeys, even at the highest concentrations. The lowest MICs seen were 2.5% (v/v) for the chestnut, fir and forest honeys against Staphylococcus aureus, and 10.0% (v/v) for the chestnut and pasture honeys against Cladosporium cladosporioides. The non-peroxide action of chestnut honey was tested against Escherichia coli. The MIC of the catalase-treated chestnut honey was 50% (v/v). The antibacterial effect of Slovenian honeys is mostly due to peroxide action. These data support the concept that Slovenian honeys are effective antibacterials and antifungals, and can thus be applied for medicinal purposes.

Brocaenols A-C: novel polyketides from a marine derived Penicillium brocae.

PubMed

Bugni, Tim S; Bernan, Valerie S; Greenstein, Michael; Janso, Jeffrey E; Maiese, William M; Mayne, Charles L; Ireland, Chris M

2003-03-07

Chemical investigation of a Penicillium brocae, obtained from a tissue sample of a Fijian Zyzyya sp. sponge, yielded two known diketopiperazines and three novel cytotoxic polyketides, brocaenols A-C. The brocaenols contain an unusual enolized oxepine lactone ring system that to the best of our knowledge is unprecedented in the literature. The structures were elucidated by using 2D-NMR methods including an INADEQUATE experiment. The absolute stereochemistry of brocaenol A was established by using a modified Mosher method. The taxonomy of the producing fungus was elucidated by using both morphological and rDNA sequence analysis.

Respiratory allergy to fungi in Barcelona, Spain: clinical aspects, diagnosis and specific treatment in a general allergy unit.

PubMed

Torres-Rodríguez, Josep M; Pulido-Marrero, Zeida; Vera-García, Yolanda

2012-01-01

The importance of hypersensitivity to fungal allergens is a relatively unknown and somewhat controversial subject. An open prospective study was carried out in just one centre to determine the clinical and epidemiological characteristics as well as the diagnostic usefulness of skin prick and conjunctiva provocation tests, associated with total and specific IgE determination in two groups of patients, one of which was monosensitised to fungi and the other of which had multiple sensitisations, including fungi. Rhinitis, exclusive or associated with asthma, was the main consultation cause (88% in monosensitised patients). Severe asthma was rarely found. In the polysensitised group, 64% were simultaneously allergic to moulds and mites. Alternaria alternata was the most common sensitising fungus, although a considerable number of cases were associated with other species such as Cladosporium, Penicillium and/or Aspergillus. The skin prick test gave the highest sensitivity and specificity. In 67% of the cases, the specific IgE was found between classes 3 and 4. The conjunctival provocation test was an innocuous and highly useful method for verifying the diagnosis and determining the degree of clinical sensitisation. A large number of patients exclusively allergic to fungi received specific immunotherapy, and it was generally well tolerated. This protocolised study shows the importance of Alternaria and other fungi sensitisations in rhinitis alone or associated with asthma. Combined diagnosis of prick test, specific IgE and conjunctiva provocation test is very useful for deciding specific immunotherapy. Copyright © 2011 SEICAP. Published by Elsevier Espana. All rights reserved.

Fungi in Ontario maple syrup & some factors that determine the presence of mold damage.

PubMed

Frasz, Samantha L; Miller, J David

2015-08-17

Maple syrup is a high value artisanal product produced mainly in Canada and a number of States primarily in the northeast USA. Mold growth (Wallemia sebi) on commercial product was first reported in syrup in 1908. Since then, few data have been published. We conducted a systematic examination for fungi in maple syrup from 68 producers from all of the syrup-producing areas of Ontario, Canada. The mean pH of the samples was pH 6.82, sugar content averaged 68.0±0.89 °Brix and aw averaged 0.841±0.011. Some 23 species of fungi were isolated based on morphology and molecular techniques. The most common fungus in the maple syrup samples was Eurotium herbariorum, followed by Penicillium chrysogenum, Aspergillus penicillioides, Aspergillus restrictus, Aspergillus versicolor and two species of Wallemia. Cladosporium cladosporioides was also common but only recovered when fungi known from high sugar substrates were also present in the mold damaged sample. The rarely reported yeast Citeromyces matrinsis was found in samples from three producers. There appear to be three potential causes for mold damage observed. High aw was associated with about one third of the mold damage. Independently, cold packing (bottling at ~25 °C) was a risk factor. However, syrup of good quality and quite low aw values was contaminated. We hypothesize that sanitation in the bottling line and other aspects of the bottling process may be partial explanations. Clarifying this requires further study. Copyright © 2015 Elsevier B.V. All rights reserved.

Marine netpen farming leads to infections with some unusual parasites.

PubMed

Kent, M L

2000-03-01

Marine netpen farming of salmonid fishes is a rapidly growing industry in several countries. With this relatively recent industry, new or unusual infections by parasitic pathogens have been observed. This is due to different hosts being reared in new geographic areas, or by indigenous species being reared in a different environmental condition, i.e. the marine netpen. Examples of the former include Kudoa thyrsites (Myxozoa) and Hemobaphes disphaerocephalus (Copepoda) infections in Atlantic salmon (Salmo salar) reared in the Pacific Northwest, Ceratothoa gaudichaudii (Isopoda) infections in Atlantic salmon reared in Chile, Neoparamoeba (=Paramoeba) sp. (Sacromastigophora) from salmonids reared in Tasmania, and Stephanostomum tenue (Digenea) infections in rainbow trout (Oncorhynchus mykiss) reared in Atlantic Canada. Chinook salmon (Oncorhynchus tshawytscha) reared in its native region, the Pacific Northwest, provides some examples of unusual or more severe infections than those normally seen in wild or freshwater reared chinook salmon. These include infections by Loma salmonae (Microsporidia), Gilguina squali (Cestoda) and the rosette agent, an undescribed fungus-like organism related to choanoflagellates. As the industry continues to expand, it is certain that more novel host-parasite relationships will be observed, providing challenges for fish farmers and parasitologists.

Study on the effects of near-future ocean acidification on marine yeasts: a microcosm approach

NASA Astrophysics Data System (ADS)

Krause, Evamaria; Wichels, Antje; Erler, René; Gerdts, Gunnar

2013-12-01

Marine yeasts play an important role in biodegradation and nutrient cycling and are often associated with marine flora and fauna. They show maximum growth at pH levels lower than present-day seawater pH. Thus, contrary to many other marine organisms, they may actually profit from ocean acidification. Hence, we conducted a microcosm study, incubating natural seawater from the North Sea at present-day pH (8.10) and two near-future pH levels (7.81 and 7.67). Yeasts were isolated from the initial seawater sample and after 2 and 4 weeks of incubation. Isolates were classified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and representative isolates were identified by partial sequencing of the large subunit rRNA gene. From the initial seawater sample, we predominantly isolated a yeast-like filamentous fungus related to Aureobasidium pullulans, Cryptococcus sp., Candida sake, and various cold-adapted yeasts. After incubation, we found more different yeast species at near-future pH levels than at present-day pH. Yeasts reacting to low pH were related to Leucosporidium scottii, Rhodotorula mucilaginosa, Cryptococcus sp., and Debaryomyces hansenii. Our results suggest that these yeasts will benefit from seawater pH reductions and give a first indication that the importance of yeasts will increase in a more acidic ocean.

PTP1B Inhibitory and Anti-Inflammatory Effects of Secondary Metabolites Isolated from the Marine-Derived Fungus Penicillium sp. JF-55

PubMed Central

Lee, Dong-Sung; Jang, Jae-Hyuk; Ko, Wonmin; Kim, Kyoung-Su; Sohn, Jae Hak; Kang, Myeong-Suk; Ahn, Jong Seog; Kim, Youn-Chul; Oh, Hyuncheol

2013-01-01

Protein tyrosine phosphatase 1B (PTP1B) plays a major role in the negative regulation of insulin signaling, and is thus considered as an attractive therapeutic target for the treatment of diabetes. Bioassay-guided investigation of the methylethylketone extract of marine-derived fungus Penicillium sp. JF-55 cultures afforded a new PTP1B inhibitory styrylpyrone-type metabolite named penstyrylpyrone (1), and two known metabolites, anhydrofulvic acid (2) and citromycetin (3). Compounds 1 and 2 inhibited PTP1B activity in a dose-dependent manner, and kinetic analyses of PTP1B inhibition suggested that these compounds inhibited PTP1B activity in a competitive manner. In an effort to gain more biological potential of the isolated compounds, the anti-inflammatory effects of compounds 1–3 were also evaluated. Among the tested compounds, only compound 1 inhibited the production of NO and PGE2, due to the inhibition of the expression of iNOS and COX-2. Penstyrylpyrone (1) also reduced TNF-α and IL-1β production, and these anti-inflammatory effects were shown to be correlated with the suppression of the phosphorylation and degradation of IκB-α, NF-κB nuclear translocation, and NF-κB DNA binding activity. In addition, using inhibitor tin protoporphyrin (SnPP), an inhibitor of HO-1, it was verified that the inhibitory effects of penstyrylpyrone (1) on the pro-inflammatory mediators and NF-κB DNA binding activity were associated with the HO-1 expression. Therefore, these results suggest that penstyrylpyrone (1) suppresses PTP1B activity, as well as the production of pro-inflammatory mediators via NF-κB pathway, through expression of anti-inflammatory HO-1. PMID:23612372

A mycosis-like granuloma of fish

USGS Publications Warehouse

Wood, E.M.; Yasutake, W.T.; Lehman, W.L.

1955-01-01

Mycoses of systemic distribution are rarely observed in fresh-water fish in this country. In a recent review of atypical cell growths in fishes, Nigrelli cited the only known instance of a mycetoma in a North American fresh-water fish which occurred in the head of fingerling landlocked salmon from an Idaho hatchery. The fungus associated with this granuloma was characterized by a branching septate mycelium. Rucker reported a streptomycete which was pathogenic to blueblack salmon. This organism produced internal nodules containing masses of hyphae but no inflammatory response. A pathogenic fungus has been observed frequently in marine fish, however, and in both marine and fresh-water fish in Europe. This organism was tentatively classified as a Phycomycete in or near the order Chytridiales and was assigned to the genus and species Ichthyophonus hoferi, later reclassified as Ichthyosporidium hoferi. The graduloma described in this report occurs in fresh-water trout and is apparently caused by a budding, yeast-like form with no hyphae which evokes a tremendous inflammatory reaction. Morphologically, the organism does not resemble the previously described Ichthyosporidium. The lesions were first seen accidentally in sections prepared from a diplobacillus infection of brook trout termed “kidney disease.” Subsequently, the granuloma was observed in three widely separated infections involving the diplobacillus in each instance.The histological material was received in a fixed condition; thus, no cultural data was available and the nomenclature and classification of the mycotic organism were not attempted. The present distribution of the disease, however, with its potential threat to domestic fish populations, seemed to warrant a description and discussion of the disease. Efforts are in progress to culture the organism.

The relationship between gorgonian coral (Cnidaria: Gorgonacea) diseases and African dust storms

USGS Publications Warehouse

Weir-Brush, J. R.; Garrison, V.H.; Smith, G.W.; Shinn, E.A.

2004-01-01

The number of reports of coral diseases has increased throughout the world in the last 20 years. Aspergillosis, which primarily affects Gorgonia ventalina and G. flabellum, is one of the few diseases to be characterized. This disease is caused by Aspergillus sydowii, a terrestrial fungus with a worldwide distribution. Upon infection, colonies may lose tissue, and ultimately, mortality may occur if the infection is not sequestered. The spores of A. sydowii are <5 ??m, small enough to be easily picked up by winds and dispersed over great distances. Aspergillosis is prevalent in the Caribbean, and it appears that this primarily terrestrial fungus has adapted to a marine environment. It has been proposed that dust storms originating in Africa may be one way in which potential coral pathogens are distributed and deposited into the marine environments of the Caribbean. To test the hypothesis that African dust storms transport and deposit pathogens, we collected air samples from both dust storms and periods of nondust in St. John, U.S. Virgin Islands. Because we focused on fungal pathogens and used A. sydowii as a model, we isolated and cultured fungi on various types of media. Fungi including Aspergillus spp. were isolated from air samples taken from dust events and non-dust events. Twenty-three separate cultures and seven genera were isolated from dust event samples whereas eight cultures from five genera were isolated from non-dust air samples. Three isolates from the Virgin Islands dust event samples morphologically identified as Aspergillus spp. produced signs of aspergillosis in seafans, and the original pathogens were re-isolated from those diseased seafans fulfilling Koch's Postulates. This research supports the hypothesis that African dust storms transport across the Atlantic Ocean and deposit potential coral pathogens in the Caribbean.

Diversity and antibacterial activities of fungi derived from the Gorgonian Echinogorgia rebekka from the South China Sea.

PubMed

Wang, Ya-Nan; Shao, Chang-Lun; Zheng, Cai-Juan; Chen, Yi-Yan; Wang, Chang-Yun

2011-01-01

The diversity of symbiotic fungi associated with the gorgonian coral Echinogorgia rebekka from the Weizhou coral reef in the South China Sea was investigated. Combined with morphologic traits, ITS-rDNA sequences revealed 18 fungal strains from this gorgonian. All of the 18 fungi belonged to the phylum Ascomycota and were distributed among seven genera in five orders: Eurotiales (Aspergillus and Penicillium), Pleosporales (Alternaria), Capnodiales (Cladosporium), Trichosphaeriales (Nigrospora) and Hypocreales (Hypocrea and Nectria). Antibacterial activities of these fungal strains were investigated with five pathogenic bacteria. All of the 18 fungal strains displayed different levels of antibacterial activities, most of which exhibited moderate to high antibacterial activities to the Gram-positive pathogens Staphylococcus aureus and Micrococcus tetragenus, and showed relatively low bioactivities to other three pathogenic bacteria. Several fungal strains in the genera Penicillium and Cladosporium with strong antibacterial activities provide potential for further research on isolation of bioactive secondary metabolites.

Mycotoxin-producing potential of fungi associated with qat (Catha edulis) leaves in Yemen.

PubMed

Mahmoud, A L

2000-01-01

Forty-four fungal species belonging to 20 genera were isolated from 30 samples of qat leaves. The most frequent genera were Aspergillus, Alternaria, Penicillium, and Cladosporium followed by Fusarium, Drechslera, Chaetomium, and Mucor. The most prevalent species in above genera were Aspergillus niger, A. flavus, A fumigatus, Alternaria alternata, Penicillium chrysogenum, P. citrinum, Cladosporium cladosporioides, and Fusarium verticillioides. From these fungi, 17 species (39%) related to 7 genera (35%) proved to be true endophytes. Eleven out of 75 isolates were mycotoxigenic. A. alternata produced alternariol and alternariol monomethyl ether whereas A. flavus produced aflatoxins B1 and B2. Ochratoxin A, sterigmatocystin, citrinin and T-2 toxin were produced by A. ochraceus, A. versicolor, P. citrinum and F. oxysporum, respectively. The presence of such toxigenic fungi associated with qat leaves is considered to be a threat to public health.

Mould and yeast flora in fresh berries, grapes and citrus fruits.

PubMed

Tournas, V H; Katsoudas, Eugenia

2005-11-15

Fresh fruits are prone to fungal contamination in the field, during harvest, transport, marketing, and with the consumer. It is important to identify fungal contaminants in fresh fruits because some moulds can grow and produce mycotoxins on these commodities while certain yeasts and moulds can cause infections or allergies. In this study, 251 fresh fruit samples including several varieties of grapes, strawberries, blueberries, raspberries, blackberries, and various citrus fruits were surface-disinfected, incubated at room temperature for up to 14 days without supplemental media, and subsequently examined for mould and yeast growth. The level of contamination (percent of contaminated items/sample) varied depending on the type of fruit. All raspberry and blackberry samples were contaminated at levels ranging from 33% to 100%, whereas 95% of the blueberry samples supported mould growth at levels between 10% and 100% of the tested berries, and 97% of strawberry samples showed fungal growth on 33-100% of tested berries. The most common moulds isolated from these commodities were Botrytis cinerea, Rhizopus (in strawberries), Alternaria, Penicillium, Cladosporium and Fusarium followed by yeasts, Trichoderma and Aureobasidium. Thirty-five percent of the grape samples tested were contaminated and supported fungal growth; the levels of contamination ranged from 9% to 80%. The most common fungi spoiling grapes were Alternaria, B. cinerea and Cladosporium. Eighty-three percent of the citrus fruit samples showed fungal growth at levels ranging from 25% to 100% of tested fruits. The most common fungi in citrus fruits were Alternaria, Cladosporium, Penicillium, Fusarium and yeasts. Less common were Trichoderma, Geotrichum and Rhizopus.

Health hazards related to conidia of Cladosporium-biological air pollutants in Poland, central Europe.

PubMed

Weryszko-Chmielewska, Elzbieta; Kasprzyk, Idalia; Nowak, Malgorzata; Sulborska, Aneta; Kaczmarek, Joanna; Szymanska, Agata; Haratym, Weronika; Gilski, Miroslaw; Jedryczka, Malgorzata

2018-03-01

The spores of Cladosporium Link. are often present in the air in high quantities and produce many allergenic proteins, which may lead to asthma. An aerobiological spore monitoring program can inform patients about the current spore concentration in air and help their physicians determine the spore dose that is harmful for a given individual. This makes it possible to develop optimized responses and propose personalized therapy for a particular sensitive patient. The aim of this study was to assess the extent of the human health hazard posed by the fungal genus Cladosporium. For the first time, we have determined the number of days on which air samples in Poland exceeded the concentrations linked to allergic responses of sensitive patients, according to thresholds established by three different groups (2800/3000/4000 spores per 1m 3 of the air). The survey was conducted over three consecutive growing seasons (April-September, 2010-2012) in three cities located in different climate zones of Poland (Poznan, Lublin and Rzeszow). The average number of days exceeding 2800 spores per cubic meter (the lowest threshold) ranged from 61 (2010) through 76 (2011) to 93 (2012), though there was significant variation between cities. In each year the highest concentration of spores in the air was detected in either Poznan or Lublin, both located on large plains with intensive agriculture. We have proposed that an effective, science-based software platform to support policy-making on air quality should incorporate biological air pollutant data, such as allergenic fungal spores and pollen grains. Copyright © 2017. Published by Elsevier B.V.

Mold occurring on the air cleaner high-efficiency particulate air filters used in the houses of child patients with atopic dermatitis.

PubMed

Kim, Seong Hwan; Ahn, Geum Ran; Son, Seung Yeol; Bae, Gwi-Nam; Yun, Yeo Hong

2014-09-01

Fungi are the known sources of irritation associated with atopic diseases (e.g., asthma, allergic rhinoconjunctivitis, and atopic eczema). To quantitatively estimate their presence in the indoor environment of atopic dermatitis-inflicted child patient's houses (ADCPHs), the high-efficiency particulate air (HEPA) filters installed inside the air cleaners of three different ADCPHs were investigated for the presence of mold. The air cleaner HEPA filters obtained from the three different ADCPHs were coded as HEPA-A, -B, and -C, respectively, and tested for the presence of mold. The colony forming units (CFUs) corresponding to the HEPA-A, -B, and -C filters were estimated to be 6.51 × 10(2) ± 1.50 × 10(2) CFU/cm(2), 8.72 × 10(2) ± 1.69 × 10(2) CFU/cm(2), and 9.71 × 10(2) ± 1.35 × 10(2) CFU/cm(2), respectively. Aspergillus, Penicillium, Alternaria, Cladosporium, Trichoderma, and other fungal groups were detected in the 2,494 isolates. The distribution of these fungal groups differed among the three filters. Cladosporium was the major fungal group in filters HEPA-A and -C, whereas Penicillium was the major fungal group in the filter HEPA-B. Nine fungal species, including some of the known allergenic species, were identified in these isolates. Cladosporium cladosporioides was the most common mold among all the three filters. This is the first report on the presence of fungi in the air cleaner HEPA filters from ADCPHs in Korea.

Biotransformation of cholesterol and 16,17-alpha epoxypregnenolone by novel Cladosporium sp. strain IS547.

PubMed

Pang, Cuiping; Cao, Yuting; Zhu, Xiangdong

2017-01-01

Nowadays, there are a few steroid drugs or intermediates that have been obtained via the transformation of microorganisms, and many strains of transformed steroids have not been found yet. Therefore, it is very significant to screen for the strains that have the abilities to transform steroids to produce valuable products. This study has focused on the screen and identification of strains, the structural identification of converted products, and the optimization of transformation conditions, as well as the establishment of transformation systems. A soil microbiota was screened for strain involved in the biotransformation of steroids. A new isolate IS547 is capable of converting a variety of steroids (such as cholesterol, ergosterol, hydrocortisone, progesterone, pregnenolone, and 16,17-alpha-epoxypregnenolone). Based on the 18S rDNA gene sequence comparison, the isolate IS547 has been demonstrated to be very closely related to Cladosporium sp. genus. Present paper is the first report regarding the microbial transformation by Cladosporium sp. to produce active intermediates, which include 7-hydroxy cholesterol, 20-droxyl-16α,17α-epoxypregna-4-dien-3-one, 7-ketocholesterol, and 7-droxyl-16α,17α-epoxypregna-4-dien-3,20-dione. Under the optimum conditions, the yields of product 3 and product 4 were 20.58 and 17.42%, respectively, higher than that prior to the optimization. The transformation rate increased significantly under the optimum fermentation conditions. This study describes an efficient, rapid, and inexpensive biotransformation system for the production of active pharmaceutical intermediates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prevalence of culturable airborne spores of selected allergenic and pathogenic fungi in outdoor air

NASA Astrophysics Data System (ADS)

O'Gorman, Céline M.; Fuller, Hubert T.

2008-06-01

Temporal and spatial variations in airborne spore concentrations of selected allergenic and pathogenic fungi were examined in Dublin, Ireland, in 2005. Air samples were taken at four outdoor locations in the city every 2 weeks, coupled with measurements of meteorological conditions. Total culturable airborne fungal spore concentrations in Dublin ranged from 30-6800 colony forming units per cubic metre of air (CFU m-3) over the 12-month period. Cladosporium, Penicillium, Aspergillus and Alternaria spores were constantly present in the Dublin atmosphere, representing >20% of the total culturable spore count. Concentrations of Cladosporium increased significantly in summer and reached allergenic threshold levels, peaking at over 3200 CFU m-3 in August. Penicillium spore concentrations never reached allergenic threshold levels, with average concentrations of <150 CFU m-3. Alternaria conidia formed only 0.3% of the total culturable fungal spore count and concentrations never exceeded 50 CFU m-3, attributable to the coastal position of Dublin and its low levels of arable production. The opportunistic human pathogen Aspergillus fumigatus was present throughout the year in nominal concentrations (<10 CFU m-3), but sporadic high counts were also recorded (300-400 CFU m-3), the potential health implications of which give cause for concern. Spores of neither Cryptococcus neoformans nor Stachybotrys chartarum were detected, but airborne basidiospores of Schizophyllum commune were evidenced by the dikaryotization of monokaryon tester strains following exposure to the air. The relationships between airborne fungal spore concentrations and meteorological factors were analysed by redundancy analysis and revealed positive correlations between temperature and Cladosporium and relative humidity and Penicillium and Aspergillus.

[Airborne fungal community composition in indoor environments in Beijing].

PubMed

Fang, Zhi-guo; Ouyang, Zhi-yun; Liu, Peng; Sun, Li; Wang, Xiao-yong

2013-05-01

Indoor environmental quality has significant effects on human health. It is reported that adults in China spent about 80%-90% of their time in indoor environments, and a number of physically handicapped people such as the elderly and infants stayed in the room even up to 95% of their total time. Moreover, air conditioner in indoor environments becomes more and more important in modern life, and a closed circulatory system can be formed among human body, room and air conditioner in indoor environments with an air conditioner, which can make the microbes such as bacteria, viruses and mold indoors propagate rapidly or abundantly. Therefore, studies on the microbial pollution in the air at places such as mall, classroom, office, and family home have been the research hotspots recently. In the present study, the community composition and concentration variation pattern of airborne fungi were investigated from Nov 2009 to Oct 2010 in 31 family homes with children in Beijing. Results showed that 24 generas of airborne fungi in family homes were identified from 225 isolates. The most common fungi were Penicillium, Cladosporium, Aspergillus, Alternaria and Phoma. The frequency of Penicillium, Cladosporium, Aspergillus, Alternaria and Monilia was much higher than those of other fungal genera in family home, and the frequency of Penicillium was more than 90%. As for the concentration percentage, airborne fungi with most high concentrations were Penicillium, Cladosporium, Aspergillus, No-sporing, and Alternaria, and totally accounted for more than 65.0%. Penicillium contributed to 32.2% of the total airborne fungi in family homes. In the 31 family homes selected, the fungal concentration in the air ranged from 62-3 498 CFU x m(-3), and the mean concentration was 837 CFU x m(-3). Seasonal variation pattern of total fungi, and Cladosporium, Aspergillus, Alternaria concentration was consistent, and the highest fungal concentration was observed in summer, followed by spring and autumn, and the lowest in winter. Concerning the Penicillium concentration, the seasonal variation pattern was different, and higher concentration was observed in spring than summer, autumn and winter. Finally, we also found that higher fungal concentration was detected in families with boys than those with girls, and negative correlation was found between airborne fungal concentration and living area per capita.

Microbiological contamination with moulds in work environment in libraries and archive storage facilities.

PubMed

Zielinska-Jankiewicz, Katarzyna; Kozajda, Anna; Piotrowska, Malgorzata; Szadkowska-Stanczyk, Irena

2008-01-01

Microbiological contamination with fungi, including moulds, can pose a significant health hazard to those working in archives or museums. The species involved include Aspergillus, Penicillium, Geotrichum, Alternaria, Cladosporium, Mucor, Rhizopus, Trichoderma, Fusarium which are associated mostly with allergic response of different types. The aim of the study was to analyse, both in quantitative and qualitative terms, workplace air samples collected in a library and archive storage facilities. Occupational exposure and the related health hazard from microbiological contamination with moulds were assessed in three archive storage buildings and one library. Air samples (total 60) were collected via impact method before work and at hourly intervals during work performance. Surface samples from the artifacts were collected by pressing a counting (RODAC) plate filled with malt extract agar against the surface of the artifacts. The air sample and surface sample analyses yielded 36 different mould species, classified into 19 genera, of which Cladosporium and Penicillium were the most prevalent. Twelve species were regarded as potentially pathogenic for humans: 8 had allergic and 11 toxic properties, the latter including Aspergillus fumigatus. Quantitative analysis revealed air microbiological contamination with moulds at the level ranging from 1.8 x 10(2)-2.3 x 10(3) cfu/m(3). In surface samples from library and archive artifacts, 11 fungal species were distinguished; the number of species per artifact varying from 1-6 and colony count ranging from 4 x 10(1) to 8-10(1) cfu/100 cm(2). Higher contamination levels were found only for Cladosporium cladosporioides (1.48 x 10(3) cfu/100 cm(2)) and Paecillomyces varioti (1.2 x 10(2) cfu/100 cm(2)). At the workposts examined, although no clearly visible signs of mould contamination could be found, the study revealed abundant micromycetes, with the predominant species of Cladosporium and Penicillium. The detected species included also potentially pathogenic microorganisms which can cause allergic and toxic effects, such as Aspergillus fumigatus, that could be hazardous to workers' health. For some species, the concentration levels exceeded the values considered the proposed hygienic standards for total microscopical fungi in occupational settings. The findings of the study point to unsatisfactory hygienic conditions at the worksites examined, resulting in microbiological contamination with moulds, as well as the necessity for prompt remedial activities on the part of the employers.

Chrodrimanins O-S from the fungus Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculusnudus.

PubMed

Kong, Fan-Dong; Zhang, Ren-Shuai; Ma, Qing-Yun; Xie, Qing-Yi; Wang, Pei; Chen, Peng-Wei; Zhou, Li-Man; Dai, Hao-Fu; Luo, Du-Qiang; Zhao, You-Xing

2017-10-01

Five new meroterpenoids, chrodrimanins O-S (1-5), as well as a known one (6), were isolated from the fermentation broth of Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculusnudus, from Haikou Bay, China. The structures including the absolute configurations of the new compounds were unambiguously elucidated by spectroscopic data and ECD spectra analysis along with quantum ECD calculations. Among them, compound 1 represents the first example of an unusual trichlorinated meroterpenoid with an unique dichlorine functionality. Compounds 1 and 4-6 displayed inhibitory activity of protein tyrosine phosphatase 1B (PTP1B) with IC 50 values of 71.6, 62.5, 63.1, and 39.6μM, respectively, and showed no apparent activity against three tumor cell lines (A549, HepG2, and Hela) and human umbilical vein endothelial cells (HUVEC) at 10μM. Copyright © 2017 Elsevier B.V. All rights reserved.

Chrodrimanins K-N and Related Meroterpenoids from the Fungus Penicillium sp. SCS-KFD09 Isolated from a Marine Worm, Sipunculus nudus.

PubMed

Kong, Fan-Dong; Ma, Qing-Yun; Huang, Sheng-Zhuo; Wang, Pei; Wang, Jun-Feng; Zhou, Li-Man; Yuan, Jing-Zhe; Dai, Hao-Fu; Zhao, You-Xing

2017-04-28

Six new meroterpenoids, chrodrimanins K-N (1-4), including two uncommon chlorinated ones (1 and 2), and verruculides B2 (5) and B3 (6), as well as seven known ones (7-13), were isolated from the fermentation broth of Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculus nudus, from Haikou Bay, China. The structures including the absolute configurations of the new compounds were unambiguously elucidated by spectroscopic data, X-ray diffraction analysis, and ECD spectra analysis along with quantum ECD calculations. In addition, the X-ray crystal structures and absolute configurations of two previously reported meroterpenoids, chrodrimanins F (9) and A (11), are described for the first time. Compounds 1, 4, and 7 displayed anti-H1N1 activity with IC 50 values of 74, 58, and 34 μM, respectively, while compound 5 showed weak inhibitory activity against Staphylococcus aureus with an MIC of 32 μg/mL.

Studies on silver nanoparticles synthesized by a marine fungus, Penicillium fellutanum isolated from coastal mangrove sediment.

PubMed

Kathiresan, K; Manivannan, S; Nabeel, M A; Dhivya, B

2009-06-01

In this work, in vitro biosynthesis of silver nanoparticles was achieved using AgNO(3) as a substrate by Penicillium fellutanum isolated from coastal mangrove sediment. The biosynthesis was faster within minutes of silver ion coming in contact with the cell filtrate. Presence of silver nanoparticles in the culture filtrate was confirmed by absorption peak at 430 nm, as well under transmission electron microscope. The biosynthesis of nanoparticles was the maximum when the culture filtrate was treated with 1.0 mM AgNO(3), maintained at 0.3% NaCl and pH 6.0, incubated at 5 degrees C for 24h. The culture filtrate, precipitated with ammonium sulphate, was proved to have a single protein band with a molecular weight of 70 kDa using polyacrylamide gel electrophoresis. The present work highlighted the possibility of using the marine fungal strain of P. fellutanum to achieve a fast rate of nanoparticles synthesis.

New Metabolites and Bioactive Chlorinated Benzophenone Derivatives Produced by a Marine-Derived Fungus Pestalotiopsis heterocornis

PubMed Central

Lei, Hui; Lin, Xiuping; Han, Li; Ma, Jian; Ma, Qingjuan; Zhong, Jialiang; Liu, Yonghong; Sun, Tiemin; Wang, Jinhui; Huang, Xueshi

2017-01-01

Four new compounds, including two isocoumarins, pestaloisocoumarins A and B (1, 2), one sesquiterpenoid degradation, isopolisin B (4), and one furan derivative, pestalotiol A (5), together with one known isocoumarin, gamahorin (3), and three chlorinated benzophenone derivatives, pestalachloride B (6), pestalachloride E (7) and a mixture of pestalalactone atropisomers (8a/8b), were isolated from a culture of the fungus Pestalotiopsis heterocornis associated with sponge Phakellia fusca. These new chemical structures were established using NMR and MS spectroscopic data, as well as single-crystal X-ray crystallographic analysis and CD Cotton effects. All of the isolated compounds were evaluated for their antimicrobial and cytotoxic activities. Isocoumarins 1–3, showed antibacterial activities against Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis with MIC values ranging from 25 to 100 μg/mL and weak antifungal activities. Chlorinated benzophenone derivatives 6–8 exhibited antibacterial activities against S. aureus and B. subtilis with MIC values ranging from 3.0 to 50 μg/mL and cytotoxicities against four human cancer cell lines with IC50 values of 6.8–87.8 μM. PMID:28335391

Marine-Natural-Product Development: First Discovery of Nortopsentin Alkaloids as Novel Antiviral, Anti-phytopathogenic-Fungus, and Insecticidal Agents.

PubMed

Ji, Xiaofei; Guo, Jincheng; Liu, Yuxiu; Lu, Aidang; Wang, Ziwen; Li, Yongqiang; Yang, Shaoxiang; Wang, Qingmin

2018-04-25

Nortopsentin alkaloids were found to have potent antiviral, anti-phytopathogenic-fungus, and insecticidal activities for the first time. Antiviral-activity tests revealed that these compounds were very sensitive to substituents, so a series of nortopsentin derivatives were designed, synthesized, and systematically evaluated for their antiviral activities against TMV, their fungicidal activities, and their insecticidal activities on the basis of a structural-diversity-derivation strategy. Compounds 2e (in vivo inactivation-, curative-, and protective-activity inhibitory rates of 50, 59, and 56%, respectively, at 500 μg/mL) and 2k (in vivo inactivation-, curative-, and protective-activity inhibitory rates of 60, 58, and 52%, respectively, at 500 μg/mL), with excellent antiviral activities and good physicochemical properties, emerged as new lead compounds for novel-antiviral-agent development. Further fungicidal-activity tests revealed that these alkaloids displayed broad-spectrum fungicidal activities. Compounds 2f, 2h, and 2j emerged as new lead compounds for antifungal-activity research. Additionally, all the compounds displayed good insecticidal activities against five kinds of insects, including Mythimna separate, Helicoverpa armigera, Ostrinia nubilalis, Plutella xylostella, and Culex pipiens pallens.

Anti-mycobacterial activity of marine fungus-derived 4-deoxybostrycin and nigrosporin.

PubMed

Wang, Cong; Wang, Juan; Huang, Yuhong; Chen, Hong; Li, Yan; Zhong, Lili; Chen, Yi; Chen, Shengping; Wang, Jun; Kang, Juling; Peng, Yi; Yang, Bin; Lin, Yongcheng; She, Zhigang; Lai, Xiaomin

2013-01-29

4-Deoxybostrycin is a natural anthraquinone compound isolated from the Mangrove endophytic fungus Nigrospora sp. collected from the South China Sea. Nigrosporin is the deoxy-derivative of 4-deoxybostrycin. They were tested against mycobacteria, especially Mycobacterium tuberculosis. In the Kirby-Bauer disk diffusion susceptibility test, they both had inhibition zone sizes of over 25 mm. The results of the absolute concentration susceptibility test suggested that they had inhibitory effects against mycobacteria. Moreover, 4-deoxybostrycin exhibited good inhibition which was even better than that of first line anti-tuberculosis (TB) drugs against some clinical multidrug-resistant (MDR) M. tuberculosis strains. The gene expression profile of M. tuberculosis H37Rv after treatment with 4-deoxybostrycin was compared with untreated bacteria. One hundred and nineteen out of 3,875 genes were significantly different in M. tuberculosis exposed to 4-deoxybostrycin from control. There were 46 functionally known genes which are involved in metabolism, information storage and processing and cellular processes. The differential expressions of six genes were further confirmed by quantitative real-time polymerase chain reaction (qRT-PCR). The present study provides a useful experiment basis for exploitation of correlative new drugs against TB and for finding out new targets of anti-mycobacterial therapy.

Growth study and hydrocarbonoclastic potential of microorganisms isolated from aviation fuel spill site in Ibeno, Nigeria.

PubMed

Etuk, C U; John, R C; Ekong, U E; Akpan, M M

2012-10-01

The growth study and hydrocarbonoclastic potential of microorganisms isolated from aviation fuel spill sites at Inua-eyet Ikot in Ibeno, Nigeria were examined using standard microbiological methods. The results of the analysis revealed that the viable plate count of microorganisms in the polluted soil ranged from 2.2 ± 0.04 × 10(3) to 3.4 ± 0.14 × 10(6) cfu/g for bacteria and 1.4 ± 0.5 × 10(2) to 2.3 ± 0.4 × 10(4) cfu/g for fungi while count of biodegraders ranged from 1.2 ± 0.4 × 10(3) to 2.1 ± 0.8 × 10(5) cfu/g. A total of 11 microbial isolates comprising of Micrococcus, Klebsiella, Flavobacterium, Bacillus, Pseudomonas, Candida, Aspergillus, Cladosporium, Penicillium, Saccharomyces and Fusarium were characterized. The ability of the selected isolates to utilize the pollutant (aviation fuel) as their sole source of carbon and energy was examined and noticed to vary in growth profiles between the isolates. The results of their degradability after 28 days of incubation shows that species of Cladosporium, Pseudomonas, Candida, Bacillus, Micrococcus and Penicillium were the most efficient Aviation fuel degraders with percentage weight loss of 86.2, 78.4, 78, 56, 53 and 50.6 respectively. Flavobacterium, Saccharomyces and Aspergillus exhibited moderate growth with percentage weight loss of 48, 45.8 and 43.4 respectively while Klebsiella and Fusarium species showed minimal growth with percentage weight loss of 20 and 18.5 respectively. The results imply that the most efficient biodegraders like Cladosporium, Pseudomonas, Candida, Bacillus and Microoccus could tolerate and remove aviation fuel from the environment.

Effect of interaction between Aspergillus carbonarius and non-ochratoxigenic grape-associated fungal isolates on growth and ochratoxin A production at different water activities and temperatures.

PubMed

Kogkaki, Efstathia A; Natskoulis, Pantelis I; Magan, Naresh; Panagou, Efstathios Z

2015-04-01

The effect of water activity (0.90, 0.94, and 0.98 aw) and temperature (15, 20, and 25 °C) on the in vitro interactions between three ochratoxigenic strains of Aspergillus carbonarius (Ac-28, Ac-29, and Ac-33) and eleven non ochratoxigenic grape-associated fungal strains was assessed in this study. Fungal strains were allowed to grow in dual cultures on Synthetic Grape-juice Medium (SGM) for 15 days and fungal interactions were given a numerical score to obtain an Index of Dominance (ID) for each fungus. Results showed that in most cases A. carbonarius toxigenic strains were dominant against other fungal species. However, A. carbonarius presented mutual antagonism with A. section Nigri strains regardless of water activity (aw) and temperature. Moreover, interactions with Penicillium spinulosum and Cladosporium spp. at 15 °C, as well as Botrytis cinerea at 20 °C, showed that the antagonists were more competitive against A. carbonarius. In some cases, growth rates of A. carbonarius strains were either slightly stimulated or inhibited after interaction in dual cultures, depending on temperature, aw and competing species. Regarding OTA production, the presence of other species sometimes decreased the production or slightly enhanced it, depending on fungal competitor and environmental conditions. Overall, OTA production was higher at 15 °C/0.98 aw and 20 °C/0.98 aw for all target strains and at 20 °C/0.94 aw for Ac-33 strain only, but decreased at higher temperatures regardless of aw and interacting species. Copyright © 2014 Elsevier Ltd. All rights reserved.

Elevated atmospheric carbon dioxide concentrations amplify Alternaria alternata sporulation and total antigen production.

PubMed

Wolf, Julie; O'Neill, Nichole R; Rogers, Christine A; Muilenberg, Michael L; Ziska, Lewis H

2010-09-01

Although the effect of elevated carbon dioxide (CO2) concentration on pollen production has been established in some plant species, impacts on fungal sporulation and antigen production have not been elucidated. Our purpose was to examine the effects of rising atmospheric CO2 concentrations on the quantity and quality of fungal spores produced on timothy (Phleum pratense) leaves. Timothy plants were grown at four CO2 concentrations (300, 400, 500, and 600 micromol/mol). Leaves were used as growth substrate for Alternaria alternata and Cladosporium phlei. The spore abundance produced by both fungi, as well as the size (microscopy) and antigenic protein content (ELISA) of A. alternata, were quantified. Leaf carbon-to-nitrogen ratio was greater at 500 and 600 micromol/mol, and leaf biomass was greater at 600 micromol/mol than at the lower CO2 concentrations. Leaf carbon-to-nitrogen ratio was positively correlated with A. alternata spore production per gram of leaf but negatively correlated with antigenic protein content per spore. At 500 and 600 micromol/mol CO2 concentrations, A. alternata produced nearly three times the number of spores and more than twice the total antigenic protein per plant than at lower concentrations. C. phlei spore production was positively correlated with leaf carbon-to-nitrogen ratio, but overall spore production was much lower than in A. alternata, and total per-plant production did not vary among CO2 concentrations. Elevated CO2 concentrations often increase plant leaf biomass and carbon-to-nitrogen ratio. Here we demonstrate for the first time that these leaf changes are associated with increased spore production by A. alternata, a ubiquitous allergenic fungus. This response may contribute to the increasing prevalence of allergies and asthma.

In vitro evaluation of the ovistatic and ovicidal effect of the cosmopolitan filamentous fungi isolated from soil on Ascaris suum eggs.

PubMed

Blaszkowska, Joanna; Kurnatowski, Piotr; Wojcik, Anna; Goralska, Katarzyna; Szwabe, Katarzyna

2014-01-31

The ovicidal activity of seven fungal strains: Acremonium alabamense, Alternaria chlamydospora, Cladosporium herbarum, Fusarium solani, Paecilomyces variotii, Paecilomyces viridis and Penicillium verruculosum isolated from urban soil samples from Poland was determined in vitro. The fungal mycelium was co-cultured with Ascaris suum eggs on plates with 2% water-agar for 28 days. Eggs exposed and unexposed (control) to fungal mycelium were observed weekly by light microscopy and the percentage of malformed eggs were determined. The eggs were classified according to following parameters: type 1 - biochemical and physiological effect without morphological damage to the eggshell; type 2 - lytic effect with morphological alteration of the eggshell and embryo; type 3 - lytic effect with morphological alteration of eggshell and embryo with hyphal penetration and internal egg colonization. All examined species of fungi extended embryogenesis, but the retardation of embryonic development was varied and depended on the species. A. alabamense, A. chlamydospora and P. verruculosum exhibited very high inhibitory activity on A. suum egg development. The fungus-exposed eggs revealed morphological alternations in all stages of embryogenesis. Isolates of F. solani, P. variotii and P. viridis showed hyphal penetration and internal colonization of A. suum eggs (type 3 effect). No appressoria were produced and simple hyphal penetrations were most commonly observed. A. alabamense and P. verruculosum demonstrated morphological destruction, with eggshell destruction. The remaining fungi showed type 1 effect. The results demonstrated that examined strains of F. solani, P. variotii and P. viridis may be considered to be potential limiting factors of parasitic geohelminth populations. Copyright © 2013 Elsevier B.V. All rights reserved.

Micorbial Colonization of Materials at Innisfail, Queensland.

DTIC Science & Technology

1979-08-01

Trichoderma and Paecilomyces were isolated from more than a single type of material. The dominance of Cladosporium here concurs with its abundance in the air...Stemphylium, Torula, Trichoderma and Trichocladium. This is the first record of Bahusakala and Scytalidium on materials at JTTRE. Algae were not

Grazing preference and utilization of soil fungi by Folsomia candida (Collembola)

NASA Astrophysics Data System (ADS)

Hedenec, Petr; Frouz, Jan

2016-04-01

Soil fungi are important food resources for soil fauna. Here we ask whether the collembolan Folsomia candida shows selectivity in grazing between four saprophytic fungi (Penicillium chrysogenum, Penicillium expansum, Absidia glauca, and Cladosporium herbarum), whether grazing preference corresponds to effects on collembolan reproduction, and whether the effects of fungi on grazing and reproduction depends on the fungal substrate, which included three kinds of litter (Alnus glutinosa, Salix caprea, and Quercus robur) and one kind of agar (yeast extract). On agar, Cladosporium herbarum and Absidia glauca were the most preferred fungi and supported the highest collembolan reproduction. On fungal-colonized litter, grazing preference was more affected by litter type than by fungal species whereas collembolan reproduction was affected by both litter type and fungal species. On fungal-colonized litter, the litter type that was most preferred for grazing did not support the highest reproduction, i.e., there was an inconsistency between food preference and suitability. Alder and willow were preferred over oak for grazing, but alder supported the least reproduction.

Investigating the role of polyols in Cladosporium fulvum during growth under hyper-osmotic stress and in planta.

PubMed

Clark, Anthony J; Blissett, Kerry J; Oliver, Richard P

2003-02-01

The role of the large amounts of polyols accumulated by the fungal tomato pathogen, Cladosporium fulvum (syn. Fulvia fulva, Cooke) both in planta and in axenic cultures has been examined. Arabinitol and glycerol accumulated in response to hyper-osmotic stress in vitro. Mannitol levels were lower in osmo-stressed mycelium. (13)C NMR spectroscopy indicated that carbon flow from glucose to mannitol was redirected to arabinitol and glycerol in hyper-osmotic conditions. Infected tomato ( Lycopersicon esculentum Mill.) plants contained all three polyols whereas glycerol was the only polyol present in uninfected plants, suggesting that the mannitol and arabinitol were of fungal origin. Substantially higher levels of arabinitol and glycerol were present in infected plants that were subjected to a restricted watering regime compared to fully watered plants. The results suggest that a primary role of fungal arabinitol and glycerol, but not mannitol, is osmoregulation and that water acquisition is an important aspect of pathogenicity.

Exposure level and distribution characteristics of airborne bacteria and fungi in Seoul metropolitan subway stations.

PubMed

Kim, Ki Youn; Kim, Yoon Shin; Kim, Daekeun; Kim, Hyeon Tae

2011-01-01

The exposure level and distribution characteristics of airborne bacteria and fungi were assessed in the workers' activity areas (station office, bedroom, ticket office and driver's seat) and passengers' activity areas (station precinct, inside the passenger carriage, and platform) of the Seoul metropolitan subway. Among investigated areas, the levels of airborne bacteria and fungi in the workers' bedroom and station precincts were relatively high. No significant difference was found in the concentration of airborne bacteria and fungi between the underground and above ground activity areas of the subway. The genera identified in all subway activity areas with a 5% or greater detection rate were Staphylococcus, Micrococcus, Bacillus and Corynebacterium for airborne bacteria and Penicillium, Cladosporium, Chrysosporium, Aspergillus for airborne fungi. Staphylococcus and Micrococcus comprised over 50% of the total airborne bacteria and Penicillium and Cladosporium comprised over 60% of the total airborne fungi, thus these four genera are the predominant genera in the subway station.

[The secondary metabolites of the mangrove endophytic fungi ZZF13 and Guignardia sp. 4382 from the South China Sea].

PubMed

Xia, Xue-kui; Liu, Chang-heng; Yuan, Wen-peng; Wang, Xiao-jun; Meng, Xiu-mei; Zhang, Mian-song; She, Zhi-gang; Lin, Yong-cheng

2009-09-01

The secondary metabolites of the fungus ZZF13 isolated from the leaves of the mangrove sample Kandelia candel in Zhanjiang and Guignardia sp. 4382 isolated from bark of Kandelia candel (endophyte) of Mai Po, Hong Kong were studied. The compounds were isolated by siliga gel, and their structures were identified by IR, MS and NMR. Four compounds were isolated from the culture of this strain. Their structures were identified as Bacillpsporin C (1), 5-carboxymellein (2), 5-methylmellein (3) and 1-(2,6-dihydroxyphenyl) butanone (4). The compounds 2 - 4 are isolated from the Guignardia sp. of Marine fungi for the first time.

Two Novel Tyrosinase Inhibitory Sesquiterpenes Induced by CuCl2 from a Marine-Derived Fungus Pestalotiopsis sp. Z233

PubMed Central

Wu, Bin; Wu, Xiaodan; Sun, Min; Li, Minhui

2013-01-01

Two new sesquiterpenes, 1β,5α,6α,14-tetraacetoxy-9α-benzoyloxy-7βH-eudesman-2β,11-diol (1) and 4α,5α-diacetoxy-9α-benzoyloxy-7βH-eudesman-1β,2β,11,14-tetraol (2), were produced as stress metabolites in the cultured mycelia of Pestalotiopsis sp. Z233 isolated from the algae Sargassum horneri in response to abiotic stress elicitation by CuCl2. Their structures were established by spectroscopic means. New compounds 1 and 2 showed tyrosinase inhibitory activities with IC50 value of 14.8 µM and 22.3 µM. PMID:23917067

Two novel tyrosinase inhibitory sesquiterpenes induced by CuCl2 from a marine-derived fungus Pestalotiopsis sp. Z233.

PubMed

Wu, Bin; Wu, Xiaodan; Sun, Min; Li, Minhui

2013-08-02

Two new sesquiterpenes, 1β,5α,6α,14-tetraacetoxy-9α-benzoyloxy-7β H-eudesman-2β,11-diol (1) and 4α,5α-diacetoxy-9α-benzoyloxy-7βH-eudesman-1β,2β,11, 14-tetraol (2), were produced as stress metabolites in the cultured mycelia of Pestalotiopsis sp. Z233 isolated from the algae Sargassum horneri in response to abiotic stress elicitation by CuCl2. Their structures were established by spectroscopic means. New compounds 1 and 2 showed tyrosinase inhibitory activities with IC50 value of 14.8 µM and 22.3 µM.

Biodegradative Activities of Selected Environmental Fungi on a Polyester Polyurethane Varnish and Polyether Polyurethane Foams

PubMed Central

Álvarez-Barragán, Joyce; Domínguez-Malfavón, Lilianha; Vargas-Suárez, Martín; González-Hernández, Ricardo; Aguilar-Osorio, Guillermo

2016-01-01

ABSTRACT Polyurethane (PU) is widely used in many aspects of modern life because of its versatility and resistance. However, PU waste disposal generates large problems, since it is slowly degraded, there are limited recycling processes, and its destruction may generate toxic compounds. In this work, we isolated fungal strains able to grow in mineral medium with a polyester PU (PS-PU; Impranil DLN) or a polyether PU (PE-PU; Poly Lack) varnish as the only carbon source. Of the eight best Impranil-degrading strains, the six best degraders belonged to the Cladosporium cladosporioides complex, including the species C. pseudocladosporioides, C. tenuissimum, C. asperulatum, and C. montecillanum, and the two others were identified as Aspergillus fumigatus and Penicillium chrysogenum. The best Impranil degrader, C. pseudocladosporioides strain T1.PL.1, degraded up to 87% after 14 days of incubation. Fourier transform infrared (FTIR) spectroscopy analysis of Impranil degradation by this strain showed a loss of carbonyl groups (1,729 cm−1) and N—H bonds (1,540 and 1,261 cm−1), and gas chromatography-mass spectrometry (GC-MS) analysis showed a decrease in ester compounds and increase in alcohols and hexane diisocyanate, indicating the hydrolysis of ester and urethane bonds. Extracellular esterase and low urease, but not protease activities were detected at 7 and 14 days of culture in Impranil. The best eight Impranil-degrading fungi were also able to degrade solid foams of the highly recalcitrant PE-PU type to different extents, with the highest levels generating up to 65% of dry-weight losses not previously reported. Scanning electron microscopy (SEM) analysis of fungus-treated foams showed melted and thinner cell wall structures than the non-fungus-treated ones, demonstrating fungal biodegradative action on PE-PU. IMPORTANCE Polyurethane waste disposal has become a serious problem. In this work, fungal strains able to efficiently degrade different types of polyurethanes are reported, and their biodegradative activity was studied by different experimental approaches. Varnish biodegradation analyses showed that fungi were able to break down the polymer in some of their precursors, offering the possibility that they may be recovered and used for new polyurethane synthesis. Also, the levels of degradation of solid polyether polyurethane foams reported in this work have never been observed previously. Isolation of efficient polyurethane-degrading microorganisms and delving into the mechanisms they used to degrade the polymer provide the basis for the development of biotechnological processes for polyurethane biodegradation and recycling. PMID:27316963

Biodegradative Activities of Selected Environmental Fungi on a Polyester Polyurethane Varnish and Polyether Polyurethane Foams.

PubMed

Álvarez-Barragán, Joyce; Domínguez-Malfavón, Lilianha; Vargas-Suárez, Martín; González-Hernández, Ricardo; Aguilar-Osorio, Guillermo; Loza-Tavera, Herminia

2016-09-01

Polyurethane (PU) is widely used in many aspects of modern life because of its versatility and resistance. However, PU waste disposal generates large problems, since it is slowly degraded, there are limited recycling processes, and its destruction may generate toxic compounds. In this work, we isolated fungal strains able to grow in mineral medium with a polyester PU (PS-PU; Impranil DLN) or a polyether PU (PE-PU; Poly Lack) varnish as the only carbon source. Of the eight best Impranil-degrading strains, the six best degraders belonged to the Cladosporium cladosporioides complex, including the species C. pseudocladosporioides, C. tenuissimum, C. asperulatum, and C. montecillanum, and the two others were identified as Aspergillus fumigatus and Penicillium chrysogenum The best Impranil degrader, C. pseudocladosporioides strain T1.PL.1, degraded up to 87% after 14 days of incubation. Fourier transform infrared (FTIR) spectroscopy analysis of Impranil degradation by this strain showed a loss of carbonyl groups (1,729 cm(-1)) and N-H bonds (1,540 and 1,261 cm(-1)), and gas chromatography-mass spectrometry (GC-MS) analysis showed a decrease in ester compounds and increase in alcohols and hexane diisocyanate, indicating the hydrolysis of ester and urethane bonds. Extracellular esterase and low urease, but not protease activities were detected at 7 and 14 days of culture in Impranil. The best eight Impranil-degrading fungi were also able to degrade solid foams of the highly recalcitrant PE-PU type to different extents, with the highest levels generating up to 65% of dry-weight losses not previously reported. Scanning electron microscopy (SEM) analysis of fungus-treated foams showed melted and thinner cell wall structures than the non-fungus-treated ones, demonstrating fungal biodegradative action on PE-PU. Polyurethane waste disposal has become a serious problem. In this work, fungal strains able to efficiently degrade different types of polyurethanes are reported, and their biodegradative activity was studied by different experimental approaches. Varnish biodegradation analyses showed that fungi were able to break down the polymer in some of their precursors, offering the possibility that they may be recovered and used for new polyurethane synthesis. Also, the levels of degradation of solid polyether polyurethane foams reported in this work have never been observed previously. Isolation of efficient polyurethane-degrading microorganisms and delving into the mechanisms they used to degrade the polymer provide the basis for the development of biotechnological processes for polyurethane biodegradation and recycling. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Fungi associated with rocks of the Atacama Desert: taxonomy, distribution, diversity, ecology and bioprospection for bioactive compounds

USDA-ARS?s Scientific Manuscript database

This study assessed the diversity of fungi living in rocks from different altitudes in the Atacama Desert, Chile. Eighty-one fungal isolates obtained were identified as 21 species of 12 genera from Ascomycota using molecular techniques. Cladosporium halotolerans, Penicillium chrysogenum and Penicill...

The first fossil fungus gardens of Isoptera: oldest evidence of symbiotic termite fungiculture (Miocene, Chad basin)

NASA Astrophysics Data System (ADS)

Duringer, Philippe; Schuster, Mathieu; Genise, Jorge F.; Likius, Andossa; Mackaye, Hassan Taisso; Vignaud, Patrick; Brunet, Michel

2006-12-01

Higher termites of the subfamily Macrotermitinae (fungus-growing termites) are known to build fungus gardens where a symbiotic fungus ( Termitomyces sp.) is cultivated. The fungus grows on a substrate called fungus comb, a structure built with the termites’ own faeces. Here we present the first fossil fungus combs ever found in the world. They were extracted from 7-million-year-old continental sandstone (Chad basin). Fossilized fungus combs have an ovoid morphology with a more or less flattened concave base and a characteristic general alveolar aspect. Under lens, they display a typical millimetre-scale pelletal structure. The latter, as well as the general shape and alveolar aspect, are similar to the morphology of fungus combs from extant fungus-growing termites.

Penicillinolide A: a new anti-inflammatory metabolite from the marine fungus Penicillium sp. SF-5292.

PubMed

Lee, Dong-Sung; Ko, Wonmin; Quang, Tran Hong; Kim, Kyoung-Su; Sohn, Jae Hak; Jang, Jae-Hyuk; Ahn, Jong Seog; Kim, Youn-Chul; Oh, Hyuncheol

2013-11-12

In the course of studies on bioactive metabolites from marine fungi, a new 10-membered lactone, named penicillinolide A (1) was isolated from the organic extract of Penicillium sp. SF-5292 as a potential anti-inflammatory compound. The structure of penicillinolide A (1) was mainly determined by analysis of NMR and MS data and Mosher's method. Penicillinolide A (1) inhibited the production of NO and PGE2 due to inhibition of the expression of iNOS and COX-2. Penicillinolide A (1) also reduced TNF-α, IL-1β and IL-6 production, and these anti-inflammatory effects were shown to be correlated with the suppression of the phosphorylation and degradation of IκB-α, NF-κB nuclear translocation, and NF-κB DNA binding activity. In addition, using inhibitor tin protoporphyrin (SnPP), a competitive inhibitor of HO activity, it was verified that the inhibitory effects of compound 1 on the production of pro-inflammatory mediators and NF-κB DNA binding activity were partially associated with HO-1 expression through Nrf2 nuclear translocation.

A Dereplication and Bioguided Discovery Approach to Reveal New Compounds from a Marine-Derived Fungus Stilbella fimetaria

PubMed Central

Kildgaard, Sara; Subko, Karolina; Phillips, Emma; Goidts, Violaine; de la Cruz, Mercedes; Díaz, Caridad; Gotfredsen, Charlotte H.; Frisvad, Jens C.; Nielsen, Kristian F.; Larsen, Thomas O.

2017-01-01

A marine-derived Stilbella fimetaria fungal strain was screened for new bioactive compounds based on two different approaches: (i) bio-guided approach using cytotoxicity and antimicrobial bioassays; and (ii) dereplication based approach using liquid chromatography with both diode array detection and high resolution mass spectrometry. This led to the discovery of several bioactive compound families with different biosynthetic origins, including pimarane-type diterpenoids and hybrid polyketide-non ribosomal peptide derived compounds. Prefractionation before bioassay screening proved to be a great aid in the dereplication process, since separate fractions displaying different bioactivities allowed a quick tentative identification of known antimicrobial compounds and of potential new analogues. A new pimarane-type diterpene, myrocin F, was discovered in trace amounts and displayed cytotoxicity towards various cancer cell lines. Further media optimization led to increased production followed by the purification and bioactivity screening of several new and known pimarane-type diterpenoids. A known broad-spectrum antifungal compound, ilicicolin H, was purified along with two new analogues, hydroxyl-ilicicolin H and ilicicolin I, and their antifungal activity was evaluated. PMID:28805711

Penicillinolide A: A New Anti-Inflammatory Metabolite from the Marine Fungus Penicillium sp. SF-5292

PubMed Central

Lee, Dong-Sung; Ko, Wonmin; Quang, Tran Hong; Kim, Kyoung-Su; Sohn, Jae Hak; Jang, Jae-Hyuk; Ahn, Jong Seog; Kim, Youn-Chul; Oh, Hyuncheol

2013-01-01

In the course of studies on bioactive metabolites from marine fungi, a new 10-membered lactone, named penicillinolide A (1) was isolated from the organic extract of Penicillium sp. SF-5292 as a potential anti-inflammatory compound. The structure of penicillinolide A (1) was mainly determined by analysis of NMR and MS data and Mosher’s method. Penicillinolide A (1) inhibited the production of NO and PGE2 due to inhibition of the expression of iNOS and COX-2. Penicillinolide A (1) also reduced TNF-α, IL-1β and IL-6 production, and these anti-inflammatory effects were shown to be correlated with the suppression of the phosphorylation and degradation of IκB-α, NF-κB nuclear translocation, and NF-κB DNA binding activity. In addition, using inhibitor tin protoporphyrin (SnPP), a competitive inhibitor of HO activity, it was verified that the inhibitory effects of compound 1 on the production of pro-inflammatory mediators and NF-κB DNA binding activity were partially associated with HO-1 expression through Nrf2 nuclear translocation. PMID:24225730

Asperpyrone-Type Bis-Naphtho-γ-Pyrones with COX-2-Inhibitory Activities from Marine-Derived Fungus Aspergillus niger.

PubMed

Fang, Wei; Lin, Xiuping; Wang, Jianjiao; Liu, Yonghong; Tao, Huaming; Zhou, Xuefeng

2016-07-20

Bis-naphtho-γ-pyrones (BNPs) are an important group of aromatic polyketides derived from fungi, and asperpyrone-type BNPs are produced primarily by Aspergillus species. The fungal strain Aspergillus niger SCSIO Jcsw6F30, isolated from a marine alga, Sargassum sp., and identified according to its morphological traits and the internal transcribed spacer (ITS) region sequence, was studied for BNPs secondary metabolisms. After HPLC/MS analysis of crude extract of the fermentation broth, 11 asperpyrone-type BNPs were obtained directly and quickly by chromatographic separation in the extract, and those isolated asperpyrone-type BNPs were structurally identified by NMR and MS analyses. All of the BNPs showed weak cytotoxicities against 10 human tumor cells (IC50 > 30 μM). However, three of them, aurasperone F (3), aurasperone C (6) and asperpyrone A (8), exhibited obvious COX-2-inhibitory activities, with the IC50 values being 11.1, 4.2, and 6.4 μM, respectively. This is the first time the COX-2-inhibitory activities of BNPs have been reported.

Screening of marine fungus from Nanji Island and activity of their metabolites against pathogenic Vibrio from Pseudosciaena crocea

NASA Astrophysics Data System (ADS)

Zhao, Shujiang; Li, Shuping; Liu, Huihui; Zhao, Qian; Wang, Jieyou; Yan, Maocang

2012-09-01

Seventy-eight marine fungal strains were isolated from sediment samples collected off the coast of Nanji Island, Wenzhou, Zhejiang Province, China. Antibacterial screening using the agar disc method showed that 19 of the isolated strains could inhibit at least one pathogenic V ibrio from P seudosciaena crocea. Subsequent screening confirmed that nine strains produced antibacterial metabolites that had activity against one or several types of pathogenic V ibrio. Strain NJ0104 had the widest antimicrobial spectrum and strong activity, particularly against Vibrio parahaemolyticus-MM0810072. A preliminary study of NJ0104 antibacterial metabolites demonstrated that they had thermal stability up to 80°C, ultraviolet stability up to 40 min and pH stability between 4.0-7.0. In addition, the antibacterial metabolites were readily soluble in butanol. To identify the specific strain, the ITS-5.8S rDNA regions of NJ0104 were PCR amplified and sequenced. Based on the combination of phenotypic and genotypic data, the strain was identified as Arthrinium sp.

Bis-Indolyl Benzenoids, Hydroxypyrrolidine Derivatives and Other Constituents from Cultures of the Marine Sponge-Associated Fungus Aspergillus candidus KUFA0062

PubMed Central

Ramos, Alice A.; Inácio, Ângela; Dethoup, Tida; Lee, Michael; Sekeroglu, Nazim; Rocha, Eduardo

2018-01-01

A previously unreported bis-indolyl benzenoid, candidusin D (2e) and a new hydroxypyrrolidine alkaloid, preussin C (5b) were isolated together with fourteen previously described compounds: palmitic acid, clionasterol, ergosterol 5,8-endoperoxides, chrysophanic acid (1a), emodin (1b), six bis-indolyl benzenoids including asterriquinol D dimethyl ether (2a), petromurin C (2b), kumbicin B (2c), kumbicin A (2d), 2″-oxoasterriquinol D methyl ether (3), kumbicin D (4), the hydroxypyrrolidine alkaloid preussin (5a), (3S, 6S)-3,6-dibenzylpiperazine-2,5-dione (6) and 4-(acetylamino) benzoic acid (7), from the cultures of the marine sponge-associated fungus Aspergillus candidus KUFA 0062. Compounds 1a, 2a–e, 3, 4, 5a–b, and 6 were tested for their antibacterial activity against Gram-positive and Gram-negative reference and multidrug-resistant strains isolated from the environment. Only 5a exhibited an inhibitory effect against S. aureus ATCC 29213 and E. faecalis ATCC29212 as well as both methicillin-resistant S. aureus (MRSA) and vancomycin-resistant enterococci (VRE) strains. Both 1a and 5a also reduced significant biofilm formation in E. coli ATCC 25922. Moreover, 2b and 5a revealed a synergistic effect with oxacillin against MRSA S. aureus 66/1 while 5a exhibited a strong synergistic effect with the antibiotic colistin against E. coli 1410/1. Compound 1a, 2a–e, 3, 4, 5a–b, and 6 were also tested, together with the crude extract, for cytotoxic effect against eight cancer cell lines: HepG2, HT29, HCT116, A549, A 375, MCF-7, U-251, and T98G. Except for 1a, 2a, 2d, 4, and 6, all the compounds showed cytotoxicity against all the cancer cell lines tested. PMID:29642369

Antiproliferative effect of extract from endophytic fungus Curvularia trifolii isolated from the "Veracruz Reef System" in Mexico.

PubMed

Couttolenc, Alan; Espinoza, Cesar; Fernández, José J; Norte, Manuel; Plata, Gabriela B; Padrón, José M; Shnyreva, Alla; Trigos, Ángel

2016-08-01

It is well known that marine fungi are an excellent source of biologically active secondary metabolites, and by 2011, it was reported that over 400 bioactive metabolites were derived from marine fungi. This study establishes the basis for future research on antiproliferative compounds of marine endophytes inhabited in the Veracruz Reef System. Isolation of the 34 fungal strains was carried out by microbiological method from samples of sponges, corals, and other biological material from the Veracruz Reef System. The fungal biomass and broth were separated and extracted with a mixture of solvents MeOH:CHCl3. Characterization and molecular identification of the fungal strains were performed through microbiological methods and the analysis of the ITS-rDNA regions. Antiproliferative activity was tested at a dose of 250 μg/mL on human solid tumor cell lines HBL-100, HeLa, SW1573, T-47D, and WiDr by the SRB assay after 48 h-exposure to the fungal extracts. The extracts from five isolates showed an antiproliferative effect against one or more of the tested cell lines (percentage growth < 50%). The mycelial extract from the isolate LAEE 03 manifested the highest activity against the five cell lines (% PG of 17 HBL-100, 19 HeLa, 23 SW1573, -6 T-47D, and 10 WiDr) and the strain was identified as Curvularia trifolii (Kauffman) Boedijn (Pleosporaceae). The results obtained indicate that the extract from a marine derived C. trifolii has the antiproliferative effect, thus suggesting that this organism is a good candidate for further analysis of its metabolites.

Hexose Oxidase-Mediated Hydrogen Peroxide as a Mechanism for the Antibacterial Activity in the Red Seaweed Ptilophora subcostata

PubMed Central

Ogasawara, Kimi; Yamada, Kenji; Hatsugai, Noriyuki; Imada, Chiaki; Nishimura, Mikio

2016-01-01

Marine algae have unique defense strategies against microbial infection. However, their mechanisms of immunity remain to be elucidated and little is known about the similarity of the immune systems of marine algae and terrestrial higher plants. Here, we suggest a possible mechanism underlying algal immunity, which involves hexose oxidase (HOX)-dependent production of hydrogen peroxide (H2O2). We examined crude extracts from five different red algal species for their ability to prevent bacterial growth. The extract from one of these algae, Ptilophora subcostata, was particularly active and prevented the growth of gram-positive and -negative bacteria, which was completely inhibited by treatment with catalase. The extract did not affect the growth of either a yeast or a filamentous fungus. We partially purified from P. subcostata an enzyme involved in its antibacterial activity, which shared 50% homology with the HOX of red seaweed Chondrus crispus. In-gel carbohydrate oxidase assays revealed that P. subcostata extract had the ability to produce H2O2 in a hexose-dependent manner and this activity was highest in the presence of galactose. In addition, Bacillus subtilis growth was strongly suppressed near P. subcostata algal fronds on GYP agar plates. These results suggest that HOX plays a role in P. subcostata resistance to bacterial attack by mediating H2O2 production in the marine environment. PMID:26867214

Incidence of Systemic Fungal Infection and Related Mortality Following Severe Burns

DTIC Science & Technology

2008-01-01

had Mucor , 7 patients had Fusarium, 3 patients had Alternaria, 4 patients had Penicillium, 2 patients had Cladosporium, 2 patients had Trichsoporon, 1...Aspergillus in these 13 cases included Candida in 3 patients, Mucor in 2 patients, and Fusarium in 2 patients. The presence of fungal elements in autopsied

HOW to Recognize and Control Sooty Molds

Treesearch

Kenneth J. Jr. Kessler

1992-01-01

Sooty molds are dark fungi that grow on honeydew excreted by sucking insects or on exudates from leaves of certain plants. Typically, sooty mold growths are composed of fungal complexes made up of ascomycetes and fungi imperfecti. Some of the common genera of fungi found in sooty mold complexes are Cladosporium, Aureobasidium, Antennariella, Limacinula, Scorias, and...

Diagnosis of mold allergy by RAST and skin prick testing.

PubMed

Nordvall, S L; Agrell, B; Malling, H J; Dreborg, S

1990-11-01

Sera from 33 patients with mold allergy proven by bronchial provocation were analyzed for specific IgE against six mold species comparing an improved Phadebas RAST with four other techniques. The new method was more sensitive and gave significantly higher IgE antibody concentrations for all tested molds except Cladosporium herbarum.

Filamentous fungi associated with natural infection of noble rot on withered grapes.

PubMed

Lorenzini, M; Simonato, B; Favati, F; Bernardi, P; Sbarbati, A; Zapparoli, G

2018-05-02

The effects of noble rot infection of grapes on the characteristics of different types of wine, including Italian passito wine, are well known. Nevertheless, there is still little information on filamentous fungi associated with noble-rotten grapes. In this study, withered Garganega grapes for passito wine production, naturally infected by noble rot, were analyzed and compared to sound grapes. Skin morphology and fungal population on berry surfaces were analyzed. Scanning electron microscopy analysis revealed microcracks, germination conidia and branched hyphae on noble-rotten berries. Penicillium, Aureobasidium and Cladosporium were the most frequent genera present. Analysis of single berries displayed higher heterogeneity of epiphytic fungi in those infected by noble-rot than in sound berries. Penicillium adametzoides, Cladosporium cladospoirioides and Coniochaeta polymorpha were recovered. These, to the best of our knowledge, had never been previously isolated from withered grapes and, for C. polymorpha, from grapevine. This study provided novel data on noble rot mycobiota and suggests that fungi that co-habit with B. cinerea could have an important role on grape and wine quality. Copyright © 2018 Elsevier B.V. All rights reserved.

Taxonomy, phylogeny and ecology of cultivable fungi present in seawater gradients across the Northern Antarctica Peninsula.

PubMed

Gonçalves, Vívian N; Vitoreli, Gislaine A; de Menezes, Graciéle C A; Mendes, Carlos R B; Secchi, Eduardo R; Rosa, Carlos A; Rosa, Luiz H

2017-11-01

Thirty-six seawater samples collected at different depths of the Gerlache and Bransfield Straits in the Northern Antarctic Peninsula were analyzed, and the average of the total fungal counts ranged from 0.3 to >300 colony forming units per liter (CFU/L) in density. The fungal were purified and identified as 15 taxa belonged to the genera Acremonium, Aspergillus, Cladosporium, Cystobasidium, Exophiala, Glaciozyma, Graphium, Lecanicillium, Metschnikowia, Penicillium, Purpureocillium and Simplicillium. Penicillium chrysogenum, Cladosporium sphaerospermum, and Graphium rubrum were found at high densities in at least two different sites and depths. Our results show at the first time that in the seawater of Antarctic Ocean occur diverse fungal assemblages despite extreme conditions, which suggests the presence of a complex aquatic fungi food web, including species reported as barophiles, symbionts, weak and strong saprobes, parasites and pathogens, as well as those found in the polluted environments of the world. Additionally, some taxa were found in different sites, suggesting that the underwater current might contribute to fungal (and microbial) dispersal across the Antarctic Ocean, and nearby areas such as South America and Australia.

Evaluation of fungal growth on cellulose-containing and inorganic ceiling tile.

PubMed

Karunasena, E; Markham, N; Brasel, T; Cooley, J D; Straus, D C

2001-01-01

Buildings with poor indoor air quality (IAQ) frequently have many areas with surface fungal contamination. Studies have demonstrated that certain fungal genera (e.g., Cladosporium, Penicillium, and Stachybotrys) are able to grow on building materials such as wallpaper, drywall, and ceiling tiles, particularly after water damage has occurred. Due to the increasing awareness of sick building syndrome (SBS), it has become essential to identify building materials that prevent the interior growth of fungi. The objective of this study was to identify building materials that would not support the growth of certain fungal genera, regardless of whether an external food source was made available. The growth of three fungal genera (Cladosporium, Penicillium, and Stachybotrys) was evaluated on cellulose-containing ceiling tile (CCT) and inorganic ceiling tile (ICT). Both types of ceiling tile were exposed to environmental conditions which can occur inside a building. Our results show that ICT did not support the growth of these three fungal genera while CCT did. Our data demonstrate that ICT could serve as an ideal replacement for CCT.

A new aurone glycoside with antifungal activity from marine-derived fungus Penicillium sp. FJ-1.

PubMed

Song, Yan-xia; Ma, Qiang; Li, Jie

2015-03-01

Endophytic fungi which reside in the tissue of mangrove plants seem to play an important role in the discovery of new biologically active substances. During the course of screening for the antimicrobial metabolites from the endophytic fugus Penicillium sp. FJ-1 of mangrove plant Avicennia marina, a new aurone glycoside (1) was isolated by repeated column chromatography on silica gel and recrystallization methods. The structure of 1 was elucidated as (Z)-7,4'-dimethoxy-6-hydroxy-aurone-4-O-β-glucopyranoside, on the basis of spectroscopic analysis. Compound 1 exhibited antifungal activity against Candida sp., with the potency comparable to amphotericin B and much better than fluconazole. Compound 1 can also inhibit extracellular phospholipase secretion in a concentration-dependent manner.

Antimicrobial activity and molecular docking studies of a novel anthraquinone from a marine-derived fungus Aspergillus versicolor.

PubMed

Wang, Weiyi; Chen, Ruixuan; Luo, Zhuhua; Wang, Wei; Chen, Jianming

2018-03-01

A novel anthraquinone, 2-(dimethoxymethyl)-1-hydroxyanthracene-9,10-dione (1), together with nine known compounds (2-10), were isolated from the fermentation of Aspergillus versicolor derived from deep sea sediment. Their structures were established through spectroscopic methods. Compound 1 exhibited strong inhibitory activities against MRSA ATCC 43300 and MRSA CGMCC 1.12409 (with MIC values of 3.9 and 7.8 μg/mL respectively) and moderate activities against tested strains of Vibrio (with MIC values ranging from 15.6 to 62.5 μg/mL). Compound 1 was subjected to molecular docking studies for inhibition of topoisomerase IV and AmpC β-lactamase enzymes indicating its usefulness as antimicrobial agent.

A Biocontrol Strain of Bacillus subtilis WXCDD105 Used to Control Tomato Botrytis cinerea and Cladosporium fulvum Cooke and Promote the Growth of Seedlings

PubMed Central

Wang, Hui; Shi, Yuying; Wang, Doudou; Yao, Zhongtong; Wang, Yimei; Liu, Jiayin; Zhang, Shumei; Wang, Aoxue

2018-01-01

In this study, a strain named WXCDD105, which has strong antagonistic effects on Botrytis cinerea and Cladosporium fulvum Cooke, was screened out from the rhizosphere of healthy tomato plants. The tomato plants had inhibition diameter zones of 5.00 mm during the dual culture for four days. Based on the morphological and physiological characteristics, the 16S rDNA sequence, and the gyrB gene sequence analysis, the strain WXCDD105 was identified as Bacillus subtilis suBap. subtilis. The results of the mycelial growth test showed that the sterile filtrate of the strain WXCDD105 could significantly inhibit mycelial growth of Botrytis cinerea and Cladosporium fulvum Cooke. The inhibition rates were 95.28 and 94.44%, respectively. The potting experiment showed that the strain WXCDD105 made effective the control of tomato gray mold and tomato leaf mold. The control efficiencies were 74.70 and 72.07%. The antagonistic test results showed that the strain WXCDD105 had different degrees of inhibition on 10 kinds of plant pathogenic fungi and the average inhibition rates were more than 80%. We also found that the strain WXCDD105 stimulated both the seed germination and seedling growth of tomatoes. Using the fermentation liquid of WXCDD105 (108 cfu·mL−1) to treat the seeds, the germination rate and radicle length were increased. Under the treatment of the fermentation liquid of the strain WXCDD105 (106 cfu·mL−1), nearly all physiological indexes of tomato seedlings were significantly higher than that of the control groups. This could not only keep the nutritional quality of tomato fruits but also prevent them from rotting. This study provided us with an excellent strain for biological control of tomato gray mold, tomato leaf mold, and tomato growth promotion. This also laid the technical foundation for its application. PMID:29734678

A Biocontrol Strain of Bacillus subtilis WXCDD105 Used to Control Tomato Botrytis cinerea and Cladosporium fulvum Cooke and Promote the Growth of Seedlings.

PubMed

Wang, Hui; Shi, Yuying; Wang, Doudou; Yao, Zhongtong; Wang, Yimei; Liu, Jiayin; Zhang, Shumei; Wang, Aoxue

2018-05-04

In this study, a strain named WXCDD105, which has strong antagonistic effects on Botrytis cinerea and Cladosporium fulvum Cooke, was screened out from the rhizosphere of healthy tomato plants. The tomato plants had inhibition diameter zones of 5.00 mm during the dual culture for four days. Based on the morphological and physiological characteristics, the 16S rDNA sequence, and the gyrB gene sequence analysis, the strain WXCDD105 was identified as Bacillus subtilis suBap. subtilis . The results of the mycelial growth test showed that the sterile filtrate of the strain WXCDD105 could significantly inhibit mycelial growth of Botrytis cinerea and Cladosporium fulvum Cooke. The inhibition rates were 95.28 and 94.44%, respectively. The potting experiment showed that the strain WXCDD105 made effective the control of tomato gray mold and tomato leaf mold. The control efficiencies were 74.70 and 72.07%. The antagonistic test results showed that the strain WXCDD105 had different degrees of inhibition on 10 kinds of plant pathogenic fungi and the average inhibition rates were more than 80%. We also found that the strain WXCDD105 stimulated both the seed germination and seedling growth of tomatoes. Using the fermentation liquid of WXCDD105 (10⁸ cfu·mL −1 ) to treat the seeds, the germination rate and radicle length were increased. Under the treatment of the fermentation liquid of the strain WXCDD105 (10⁶ cfu·mL −1 ), nearly all physiological indexes of tomato seedlings were significantly higher than that of the control groups. This could not only keep the nutritional quality of tomato fruits but also prevent them from rotting. This study provided us with an excellent strain for biological control of tomato gray mold, tomato leaf mold, and tomato growth promotion. This also laid the technical foundation for its application.

Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lasure, Linda L; Dai, Ziyu

2008-10-21

The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

[Effects of fungus on the growth of Dendrobium candidum and D. nobile in vitro culture].

PubMed

Song, J Y; Guo, S X

2001-12-01

To examine effects of fungus AR-18 (Epulorhiza sp.) on the growth of Dendrobium candidum and D. nobile in vitro culture. Effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when agar was used as rest, and effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum and D. nobile were studied in vitro culture, when vermiculite was used as rest. In agar medium, effects of fungus AR-18 on fresh weight and dry weight of D. candidum and D. nobile were not significant (P > 0.05). However, in vermiculite medium, the effect of fungus AR-18 on fresh weight of D. nobile was significant (P < 0.05). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 16% compared with the non-inoculated ones (control). The effect of fungus AR-18 on dry weight of D. nobile was very significant (P < 0.01). Dry weight of D. nobile inoculated with fungus AR-18 was increased by 21% compared with the control. In vermiculite medium, the effect of combination treatment (Fungus AR-18 + Distilled H2O) on fresh weight of D. nobile was very significant (P < 0.01). Fresh weight of D. nobile inoculated with fungus AR-18 was increased by 47% compared with the control, while the effect of combination treatment (Fungus AR-18 + Nutrients) on fresh weight of D. nobile was not significant (P > 0.05). In addition, the effect of combinations treatment (Fungus AR-18 + Nutrients) and (Fungus AR-18 + Distilled H2O) on dry weight of D. nobile was not significant (P > 0.05). So the combination treatment (Fungus AR-18 + Distilled H2O) was the best for the growth of D. nobile. In vermiculite medium, effects of fungus AR-18 and nutrients on fresh weight and dry weight of D. candidum were not significant (P > 0.05). It is important in vitro culture to select a proper rest for the control of the growth of fungus to establish a beneficial symbiotic relationship between plants and fungi. If the fungus AR-18 is utilized as biological manure in got-up planting of D. nobile, a good result may be obtained.

Exploring the Antibacterial and Antifungal Potential of Jellyfish-Associated Marine Fungi by Cultivation-Dependent Approaches.

PubMed

Yue, Yang; Yu, Huahua; Li, Rongfeng; Xing, Ronge; Liu, Song; Li, Pengcheng

2015-01-01

Fungi isolated from marine invertebrates are of considerable importance as new promising sources of unique secondary metabolites with significant biomedical potential. However, the cultivable fungal community harbored in jellyfish was less investigated. In this work, we seek to recover symbiotic fungi from different tissues of jellyfish Nemopilema nomurai. A total of seven morphotypes were isolated, which were assigned into four genera (Aspergillus, Cladosporium, Purpureocillium, and Tilletiopsis) from two phyla (Ascomycota and Basidiomycota) by comparing the rDNA-ITS sequences with the reference sequences in GenBank. The most fungi were found in the inner tissues of subumbrella. Two of the cultivation-independent procedures, changing media type and co-cultivation, were employed to maximize the complexity of metabolites. Thus, thirteen EtOAc gum were obtained and fingerprinted by High Performance Liquid Chromatography (HPLC) equipped with a photodiode array (PDA) detector. Antibacterial and antifungal activities of these complex mixtures were tested against a panel of bacterial and fungal pathogens. The antimicrobial results showed that all of the 13 EtOAc extracts displayed different levels of antibacterial activity, three of which exhibited strong to significant antibacterial activity to the bacterial pathogens Staphylococcus aureus and Salmonella entrica. Antifungal activity indicated that the EtOAc extracts from pure culture of Aspergillus versicolor and co-culture of A. versicolor and Tilletiopsis sp. in rice media were promising for searching new compounds, with the maximal mycelial growth inhibition of 82.32% ± 0.61% for Rhizoctonia solani and 48.41% ± 11.02% for Botrytis cinerea at 200 μg/ml, respectively. This study is the first report on the antibacterial and antifungal activity of jellyfish-associated fungi and allows the first sight into cultivable fungal community residing in jellyfish. Induced metabolites by cultivation-dependent approaches provides a new reservoir for drug discovery from jellyfish-derived fungi.

Exploring the Antibacterial and Antifungal Potential of Jellyfish-Associated Marine Fungi by Cultivation-Dependent Approaches

PubMed Central

Yue, Yang; Yu, Huahua; Li, Rongfeng; Xing, Ronge; Liu, Song; Li, Pengcheng

2015-01-01

Fungi isolated from marine invertebrates are of considerable importance as new promising sources of unique secondary metabolites with significant biomedical potential. However, the cultivable fungal community harbored in jellyfish was less investigated. In this work, we seek to recover symbiotic fungi from different tissues of jellyfish Nemopilema nomurai. A total of seven morphotypes were isolated, which were assigned into four genera (Aspergillus, Cladosporium, Purpureocillium, and Tilletiopsis) from two phyla (Ascomycota and Basidiomycota) by comparing the rDNA-ITS sequences with the reference sequences in GenBank. The most fungi were found in the inner tissues of subumbrella. Two of the cultivation-independent procedures, changing media type and co-cultivation, were employed to maximize the complexity of metabolites. Thus, thirteen EtOAc gum were obtained and fingerprinted by High Performance Liquid Chromatography (HPLC) equipped with a photodiode array (PDA) detector. Antibacterial and antifungal activities of these complex mixtures were tested against a panel of bacterial and fungal pathogens. The antimicrobial results showed that all of the 13 EtOAc extracts displayed different levels of antibacterial activity, three of which exhibited strong to significant antibacterial activity to the bacterial pathogens Staphylococcus aureus and Salmonella entrica. Antifungal activity indicated that the EtOAc extracts from pure culture of Aspergillus versicolor and co-culture of A. versicolor and Tilletiopsis sp. in rice media were promising for searching new compounds, with the maximal mycelial growth inhibition of 82.32% ± 0.61% for Rhizoctonia solani and 48.41% ± 11.02% for Botrytis cinerea at 200 μg/ml, respectively. This study is the first report on the antibacterial and antifungal activity of jellyfish-associated fungi and allows the first sight into cultivable fungal community residing in jellyfish. Induced metabolites by cultivation-dependent approaches provides a new reservoir for drug discovery from jellyfish-derived fungi. PMID:26637162

Pulmonary aspergilloma

MedlinePlus

Aspergillosis is an infection caused by the fungus aspergillus. Aspergillomas are formed when the fungus grows in ... of fungus that causes disease in humans is Aspergillus fumigatus . Aspergillus is a common fungus. It grows ...

Quinones from Heliotropium ovalifolium.

PubMed

Guntern, A; Ioset, J R; Queiroz, E F; Foggin, C M; Hostettmann, K

2001-10-01

Two new benzoquinones, heliotropinones A and B, have been isolated from the aerial parts of Heliotropium ovalifolium. Their structures were elucidated by spectrometric methods including high resolution electrospray ionization (ESI-HR), EI mass spectrometry, 1H, 13C and 2D NMR experiments. The two quinones demonstrated antifungal activities against Cladosporium cucumerinum and Candida albicans as well as antibacterial activity against Bacillus subtilis.

Inhibitors of BRD4 Protein from a Marine-Derived Fungus Alternaria sp. NH-F6

PubMed Central

Ding, Hui; Zhang, Dashan; Zhou, Biao; Ma, Zhongjun

2017-01-01

Bromodomains (BRD) are readers of the epigenetic code that regulate gene transcription through their recognition of acetyl-lysine modified histone tails. Recently, bromodomain-containing proteins such as BRD4 have been demonstrated to be druggable through the discovery of potent inhibitors. These protein–protein interaction inhibitors have the potential to modulate multiple diseases by their profound anti-inflammatory and antiproliferative effects. In order to explore new BRD4 inhibitors as well as lead compounds for the development of new drugs, the secondary metabolites of Alternaria sp. NH-F6, a fungus isolated from deep-sea sediment samples, were analyzed systematically. Five new compounds including two new perylenequinones (1–2), one new alternaric acid (3), 2-(N-vinylacetamide)-4-hydroxymethyl-3-ene-butyrolactone (4), one new cerebroside (5), together with 19 known compounds (6–24) were isolated from the ethyl acetate extracts of this strain. Their structures were elucidated using nuclear magnetic resonance (NMR) and high resolution electrospray ionization mass spectrometry (HR-ESI-MS) analyses. Finally, all these compounds were evaluated for their inhibitory activity against BRD4 protein, and compound 2 exhibited a potent inhibition rate of 88.1% at a concentration of 10 µM. This research provides a new BRD4 inhibitor which may possess potential antitumoral, antiviral, or anti-inflammatory pharmaceutical values. PMID:28300771

Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

2008-11-11

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

DOEpatents

Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

2014-05-27

The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

Pulmonary and systemic fungal infections in an Atlantic spotted dolphin and a Bryde's whale, Brazil.

PubMed

Groch, Kátia R; Díaz-Delgado, Josué; Sacristán, Carlos; Oliveira, Denyiélim E; Souza, Gabriela; Sánchez-Sarmiento, Angélica M; Costa-Silva, Samira; Marigo, Juliana; Castilho, Pedro V; Cremer, Marta J; Rodrigues Hoffmann, Aline; Esperón, Fernando; Catão-Dias, José L

2018-03-22

We report the gross and microscopic findings and molecular identification of 2 cases of hyphate fungal infection in cetaceans from Brazil. The first case involved an adult male Atlantic spotted dolphin Stenella frontalis with localized pulmonary disease characterized by pyogranulomatous and necrotizing bronchopneumonia with intralesional hyphae. The second case involved an adult male Bryde's whale Balaenoptera edeni with orchitis, periorchitis, mesenteric lymphadenitis and pyogranulomatous bronchopneumonia with intralesional hyphae. PCR analysis from the dolphin's lung yielded Aspergillus fumigatus, and the fungus from the whale's mesenteric lymph node showed the greatest identity to Nanniziopsis obscura and Stagonosporopsis cucurbitacearum These cases represent the first reports of pulmonary aspergillosis by A. fumigatus in an Atlantic spotted dolphin and systemic mycosis by a possibly novel Onygenales in marine mammals.

Dentigerumycin: a bacterial mediator of an ant-fungus symbiosis

PubMed Central

Oh, Dong-Chan; Poulsen, Michael; Currie, Cameron R.; Clardy, Jon

2009-01-01

Fungus-growing ants engage in mutualistic associations with both the fungus they cultivate for food and actinobacteria (Pseudonocardia spp.) that produce selective antibiotics to defend that fungus from specialized fungal parasites. In the first system to be analyzed at the molecular level, the bacterium associated with the ant Apterostigma dentigerum produces dentigerumycin, a cyclic depsipeptide with highly modified amino acids, to selectively inhibit the parasitic fungus (Escovopsis sp.). PMID:19330011

Fungal production of volatiles during growth on fiberglass.

PubMed Central

Ezeonu, I M; Price, D L; Simmons, R B; Crow, S A; Ahearn, D G

1994-01-01

Acoustic and thermal fiberglass insulation materials used in heating, ventilation, and air-conditioning systems were colonized with fungi in laboratory chambers. The mixed fungal population, principally Aspergillus versicolor, Acremonium obclavatum, and Cladosporium herbarum, produced odoriferous volatiles, including 2-ethyl hexanol, cyclohexane, and benzene. These volatiles may be related to poor indoor air quality and the sick building syndrome. PMID:7993098

Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum.

PubMed

Rivas, Susana; Thomas, Colwyn M

2005-01-01

The interaction between tomato and the leaf mold pathogen Cladosporium fulvum is controlled in a gene-for-gene manner. This interaction has provided useful insights to the molecular basis of recognition specificity in plant disease resistance (R) proteins, disease resistance (R) gene evolution, R-protein mediated signaling, and cellular responses to pathogen attack. Tomato Cf genes encode type I membrane-associated receptor-like proteins (RLPs) comprised predominantly of extracellular leucine-rich repeats (eLRRs) and which are anchored in the plasma membrane. Cf proteins recognize fungal avirulence (Avr) peptides secreted into the leaf apoplast during infection. A direct interaction of Cf proteins with their cognate Avr proteins has not been demonstrated and the molecular mechanism of Avr protein perception is not known. Following ligand perception Cf proteins trigger a hypersensitive response (HR) and the arrest of pathogen development. Cf proteins lack an obvious signaling domain, suggesting that defense response activation is mediated through interactions with other partners. Avr protein perception results in the rapid accumulation of active oxygen species (AOS), changes in cellular ion fluxes, activation of protein kinase cascades, changes in gene expression and, possibly, targeted protein degradation. Here we review our current understanding of Cf-mediated responses in resistance to C. fulvum.

Mycobiota variation in stored rice straw and its cellulolytic profile.

PubMed

El-Metwally, Mohammad Magdy; Ghoneem, Khalid Mohammad; Saber, Wesam El-Din Ismail Ali

2014-09-01

Rice Straw (RS) one of most important agrowaste worldwide. Variation in mycobiota inhabiting long stored RS and its cellulolytic profile were studied. The highest number of fungi (23 species) was recovered from 1st storage period (1-3 year). Alternaria alternata, Aspergillus sp., Cladosporium herbarum, Fusarium incarnatum, Geotrichum candidum, Penicillium sp., Stemphylium lycopersici and Ulocladium atrum are the most frequent genera. Among 21 fungal species recovered in the 2nd period (3-5 year), Cladosporium herbarum, Fusarium incarnatum, Stemphylium lycopersici and Ulocladium atrum recorded 100% frequency, whereas Ulocladium atrum, Veticillium lecanii, Stemphylium lycopersici and Penicillium sp., were the most frequent species in the 3rd period (> 5 years). Regarding the pathogenic fungal isolates, Nigrospora oryzae was the most frequent with high intensity in all samples of the three storage periods, whereas Alternaria padwikii reached the highest frequency and intensity in the 1st period and absent the 2nd and 3rd ones. The isolated fungal species showed a high production of cellulases comparing to previous studies with positive and significant correlation between FPase from one side and CMCase (r = 0.634, p ≤ 0.05) and β-glucosidase (r = 0.775, p ≤ 0.05) from the other side.

Free chlorine inactivation of fungi in drinking water sources.

PubMed

Pereira, V J; Marques, R; Marques, M; Benoliel, M J; Barreto Crespo, M T

2013-02-01

The effectiveness of free chlorine for the inactivation of fungi present in settled surface water was tested. In addition, free chlorine inactivation rate constants of Cladosporium tenuissimum, Cladosporium cladosporioides, Phoma glomerata, Aspergillus terreus, Aspergillus fumigatus, Penicillium griseofulvum, and Penicillium citrinum that were found to occur in different source waters were determined in different water matrices (laboratory grade water and settled water). The effect of using different disinfectant concentrations (1 and 3 mg/l), temperatures (21 and 4 °C), and pH levels (6 and 7) was addressed. The sensitivity degree of different fungi isolates to chlorine disinfection varied among different genera with some species showing a higher resistance to disinfection and others expected to be more prone to protection from inactivation by the water matrix components. When the disinfection efficiency measured in terms of the chlorine concentration and contact time (Ct) values needed to achieve 99% inactivation were compared with the Ct values reported as being able to achieve the same degree of inactivation of other microorganisms, fungi were found to be more resistant to chlorine inactivation than bacteria and viruses and less resistant than Cryptosporidium oocysts. Copyright © 2012 Elsevier Ltd. All rights reserved.

Exploration of cultivable fungal communities in deep coal-bearing sediments from ∼1.3 to 2.5 km below the ocean floor.

PubMed

Liu, Chang-Hong; Huang, Xin; Xie, Tian-Ning; Duan, Ning; Xue, Ya-Rong; Zhao, Tan-Xi; Lever, Mark A; Hinrichs, Kai-Uwe; Inagaki, Fumio

2017-02-01

Although subseafloor sediments are known to harbour a vast number of microbial cells, the distribution, diversity, and origins of fungal populations remain largely unexplored. In this study, we cultivated fungi from 34 of 47 deep coal-associated sediment samples collected at depths ranging from 1289 to 2457 m below the seafloor (mbsf) off the Shimokita Peninsula, Japan (1118 m water depth). We obtained a total of 69 fungal isolates under strict contamination controls, representing 61 Ascomycota (14 genera, 23 species) and 8 Basidiomycota (4 genera, 4 species). Penicillium and Aspergillus relatives were the most dominant genera within the Ascomycetes, followed by the members of genera Cladosporium, Hamigera, Chaetomium, Eutypella, Acremonium, Aureobasidium, Candida, Eurotium, Exophiala, Nigrospora, Bionectria and Pseudocercosporella. Four Basidiomycota species were identified as genera Schizophyllum, Irpex, Bjerkandera and Termitomyces. Among these isolates, Cladosporium sphaerospermum and Aspergillus sydowii relatives were isolated from a thin lignite coal-sandstone formation at 2457 mbsf. Our results indicate that these cultivable fungal populations are indigenous, originating from past terrigenous environments, which have persisted, possibly as spores, through ∼20 million years of depositional history. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Microfungi in cultivated fields in Eskişehir provience (Turkey).

PubMed

Demirel, Rasime; Ilhan, Semra; Asan, Ahmet; Kinaci, Engin; Oner, Setenay

2005-01-01

The soil microfungi flora was investigated in four locations of Eskişehir (Turkey). 56 soil samples were seasonaly collected from 14 stations in the areas of Karacahöyük, Bahçecik, OGU I, and OGU II. A total of 110 species belonging to 32 genera were encountered including Absidia, Acremonium, Alternaria, Aspergillus, Beauveria, Botryoderma, Chaetomium, Chrysosporium, Cladosporium, Eupenicillium, Eurotium, Fusarium, Geotrichum, Gliocladium, Gonytrichum, Metarrhizium, Mucor, Myrothecium, Paecilomyces, Penicillium, Phoma, Plectosphaerella, Rhizoctania, Rhizopus, Scopulariopsis, Septonema, Stachybotrys, Trichocladium, Trichoderma, Ulocladium, Verticillium, and Wardomyces. Twenty five species were more frequent (all locations) while twenty seven species were rare (only one sample). Mainly, Acremonium kiliense, Aspergillus ochraceus, A. terricola var. americanus, A. versicolor, Cladosporium cladosporioides, Fusarium oxysporum, F. solani, Gliocladium roseum, Penicillium chrysogenum, P. corylophum, P. expansum, P. griseofulvum, P. implicatum, P. restrictum, and Stachybotrys chartarum were the most common and abundant microfungi in all locations. Five species Aspergillus subsessilis, A. terreus var. africanus, Eupenicillium egyptiacum, Paecilomyces ramosus, and Penicillium novae-zeelandiae are likely to be newly recorded for Turkey. The microfungi number in Eskişehir soils was between 25,000-234,000 CFU/g (mean value at 126,375 CFU/g). Copyright (c) 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combating a Global Threat to a Clonal Crop: Banana Black Sigatoka Pathogen Pseudocercospora fijiensis (Synonym Mycosphaerella fijiensis) Genomes Reveal Clues for Disease Control

PubMed Central

Aerts, Andrea; Carlier, Jean; Crane, Charles F.; de Vries, Ineke; Dietrich, Robert; Farmer, Andrew D.; Fortes Fereira, Claudia; Garcia, Suzana; Guzman, Mauricio; Hamelin, Richard C.; Lindquist, Erika A.; Mehrabi, Rahim; Quiros, Olman; Schmutz, Jeremy; Reynolds, Elizabeth; Scalliet, Gabriel; Souza, Manoel; Stergiopoulos, Ioannis; Van der Lee, Theo A. J.; De Wit, Pierre J. G. M.; Zapater, Marie-Françoise; Zwiers, Lute-Harm; Grigoriev, Igor V.; Goodwin, Stephen B.; Kema, Gert H. J.

2016-01-01

Black Sigatoka or black leaf streak disease, caused by the Dothideomycete fungus Pseudocercospora fijiensis (previously: Mycosphaerella fijiensis), is the most significant foliar disease of banana worldwide. Due to the lack of effective host resistance, management of this disease requires frequent fungicide applications, which greatly increase the economic and environmental costs to produce banana. Weekly applications in most banana plantations lead to rapid evolution of fungicide-resistant strains within populations causing disease-control failures throughout the world. Given its extremely high economic importance, two strains of P. fijiensis were sequenced and assembled with the aid of a new genetic linkage map. The 74-Mb genome of P. fijiensis is massively expanded by LTR retrotransposons, making it the largest genome within the Dothideomycetes. Melting-curve assays suggest that the genomes of two closely related members of the Sigatoka disease complex, P. eumusae and P. musae, also are expanded. Electrophoretic karyotyping and analyses of molecular markers in P. fijiensis field populations showed chromosome-length polymorphisms and high genetic diversity. Genetic differentiation was also detected using neutral markers, suggesting strong selection with limited gene flow at the studied geographic scale. Frequencies of fungicide resistance in fungicide-treated plantations were much higher than those in untreated wild-type P. fijiensis populations. A homologue of the Cladosporium fulvum Avr4 effector, PfAvr4, was identified in the P. fijiensis genome. Infiltration of the purified PfAVR4 protein into leaves of the resistant banana variety Calcutta 4 resulted in a hypersensitive-like response. This result suggests that Calcutta 4 could carry an unknown resistance gene recognizing PfAVR4. Besides adding to our understanding of the overall Dothideomycete genome structures, the P. fijiensis genome will aid in developing fungicide treatment schedules to combat this pathogen and in improving the efficiency of banana breeding programs. PMID:27512984

A mutational analysis of the cytosolic domain of the tomato Cf-9 disease-resistance protein shows that membrane-proximal residues are important for Avr9-dependent necrosis.

PubMed

Chakrabarti, Apratim; Velusamy, Thilaga; Tee, Choon Yang; Jones, David A

2016-05-01

The tomato Cf-9 gene encodes a membrane-anchored glycoprotein that imparts race-specific resistance against the tomato leaf mould fungus Cladosporium fulvum in response to the avirulence protein Avr9. Although the N-terminal half of the extracellular leucine-rich repeat (eLRR) domain of the Cf-9 protein determines its specificity for Avr9, the C-terminal half, including its small cytosolic domain, is postulated to be involved in signalling. The cytosolic domain of Cf-9 carries several residues that are potential sites for ubiquitinylation or phosphorylation, or signals for endocytic uptake. A targeted mutagenesis approach was employed to investigate the roles of these residues and cellular processes in Avr9-dependent necrosis triggered by Cf-9. Our results indicate that the membrane-proximal region of the cytosolic domain of Cf-9 plays an important role in Cf-9-mediated necrosis, and two amino acids within this region, a threonine (T835) and a proline (P838), are particularly important for Cf-9 function. An alanine mutation of T835 had no effect on Cf-9 function, but an aspartic acid mutation, which mimics phosphorylation, reduced Cf-9 function. We therefore postulate that phosphorylation/de-phosphorylation of T835 could act as a molecular switch to determine whether Cf-9 is in a primed or inactive state. Yeast two-hybrid analysis was used to show that the cytosolic domain of Cf-9 interacts with the cytosolic domain of tomato VAP27. This interaction could be disrupted by an alanine mutation of P838, whereas interaction with CITRX remained unaffected. We therefore postulate that a proline-induced kink in the membrane-proximal region of the cytosolic domain of Cf-9 may be important for interaction with VAP27, which may, in turn, be important for Cf-9 function. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Combating a Global Threat to a Clonal Crop: Banana Black Sigatoka Pathogen Pseudocercospora fijiensis (Synonym Mycosphaerella fijiensis) Genomes Reveal Clues for Disease Control

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arango Isaza, Rafael E.; Diaz-Trujillo, Caucasella; Dhillon, Braham

Black Sigatoka or black leaf streak disease, caused by the Dothideomycete fungus Pseudocercospora fijiensis (previously: Mycosphaerella fijiensis), is the most significant foliar disease of banana worldwide. Due to the lack of effective host resistance, management of this disease requires frequent fungicide applications, which greatly increase the economic and environmental costs to produce banana. Weekly applications in most banana plantations lead to rapid evolution of fungicide-resistant strains within populations causing disease-control failures throughout the world. Given its extremely high economic importance, two strains of P. fijiensis were sequenced and assembled with the aid of a new genetic linkage map. The 74-Mbmore » genome of P. fijiensis is massively expanded by LTR retrotransposons, making it the largest genome within the Dothideomycetes. Melting-curve assays suggest that the genomes of two closely related members of the Sigatoka disease complex, P. eumusae and P. musae, also are expanded. Electrophoretic karyotyping and analyses of molecular markers in P. fijiensis field populations showed chromosome-length polymorphisms and high genetic diversity. Genetic differentiation was also detected using neutral markers, suggesting strong selection with limited gene flow at the studied geographic scale. Frequencies of fungicide resistance in fungicide-treated plantations were much higher than those in untreated wild-type P. fijiensis populations. A homologue of the Cladosporium fulvum Avr4 effector, PfAvr4, was identified in the P. fijiensis genome. Infiltration of the purified PfAVR4 protein into leaves of the resistant banana variety Calcutta 4 resulted in a hypersensitive-like response. This result suggests that Calcutta 4 could carry an unknown resistance gene recognizing PfAVR4. Besides adding to our understanding of the overall Dothideomycete genome structures, the P. fijiensis genome will aid in developing fungicide treatment schedules to combat this pathogen and in improving the efficiency of banana breeding programs.« less

Diversity of endophytic fungi in Glycine max.

PubMed

Fernandes, Elio Gomes; Pereira, Olinto Liparini; da Silva, Cynthia Cânedo; Bento, Claudia Braga Pereira; de Queiroz, Marisa Vieira

2015-12-01

Endophytic fungi are microorganisms that live within plant tissues without causing disease during part of their life cycle. With the isolation and identification of these fungi, new species are being discovered, and ecological relationships with their hosts have also been studied. In Glycine max, limited studies have investigated the isolation and distribution of endophytic fungi throughout leaves and roots. The distribution of these fungi in various plant organs differs in diversity and abundance, even when analyzed using molecular techniques that can evaluate fungal communities in different parts of the plants, such as denaturing gradient gel electrophoresis (DGGE). Our results show there is greater species richness of culturable endophytic filamentous fungi in the leaves G. max as compared to roots. Additionally, the leaves had high values for diversity indices, i.e. Simpsons, Shannon and Equitability. Conversely, dominance index was higher in roots as compared to leaves. The fungi Ampelomyces sp., Cladosporium cladosporioides, Colletotrichum gloeosporioides, Diaporthe helianthi, Guignardia mangiferae and Phoma sp. were more frequently isolated from the leaves, whereas the fungi Fusarium oxysporum, Fusarium solani and Fusarium sp. were prevalent in the roots. However, by evaluating the two communities by DGGE, we concluded that the species richness was higher in the roots than in the leaves. UPGMA analysis showed consistent clustering of isolates; however, the fungus Leptospora rubella, which belongs to the order Dothideales, was grouped among species of the order Pleosporales. The presence of endophytic Fusarium species in G. max roots is unsurprising, since Fusarium spp. isolates have been previously described as endophyte in other reports. However, it remains to be determined whether the G. max Fusarium endophytes are latent pathogens or non-pathogenic forms that benefit the plant. This study provides a broader knowledge of the distribution of the fungal community in G. max leaves and roots, and identifies the genetic relationships among the isolated species. Copyright © 2015 Elsevier GmbH. All rights reserved.

Combating a Global Threat to a Clonal Crop: Banana Black Sigatoka Pathogen Pseudocercospora fijiensis (Synonym Mycosphaerella fijiensis) Genomes Reveal Clues for Disease Control

DOE PAGES

Arango Isaza, Rafael E.; Diaz-Trujillo, Caucasella; Dhillon, Braham; ...

2016-08-11

Black Sigatoka or black leaf streak disease, caused by the Dothideomycete fungus Pseudocercospora fijiensis (previously: Mycosphaerella fijiensis), is the most significant foliar disease of banana worldwide. Due to the lack of effective host resistance, management of this disease requires frequent fungicide applications, which greatly increase the economic and environmental costs to produce banana. Weekly applications in most banana plantations lead to rapid evolution of fungicide-resistant strains within populations causing disease-control failures throughout the world. Given its extremely high economic importance, two strains of P. fijiensis were sequenced and assembled with the aid of a new genetic linkage map. The 74-Mbmore » genome of P. fijiensis is massively expanded by LTR retrotransposons, making it the largest genome within the Dothideomycetes. Melting-curve assays suggest that the genomes of two closely related members of the Sigatoka disease complex, P. eumusae and P. musae, also are expanded. Electrophoretic karyotyping and analyses of molecular markers in P. fijiensis field populations showed chromosome-length polymorphisms and high genetic diversity. Genetic differentiation was also detected using neutral markers, suggesting strong selection with limited gene flow at the studied geographic scale. Frequencies of fungicide resistance in fungicide-treated plantations were much higher than those in untreated wild-type P. fijiensis populations. A homologue of the Cladosporium fulvum Avr4 effector, PfAvr4, was identified in the P. fijiensis genome. Infiltration of the purified PfAVR4 protein into leaves of the resistant banana variety Calcutta 4 resulted in a hypersensitive-like response. This result suggests that Calcutta 4 could carry an unknown resistance gene recognizing PfAVR4. Besides adding to our understanding of the overall Dothideomycete genome structures, the P. fijiensis genome will aid in developing fungicide treatment schedules to combat this pathogen and in improving the efficiency of banana breeding programs.« less

Comparison of skin prick tests with specific serum immunoglobulin E in the diagnosis of fungal sensitization in patients with severe asthma.

PubMed

O'Driscoll, B R; Powell, G; Chew, F; Niven, R M; Miles, J F; Vyas, A; Denning, D W

2009-11-01

It has been shown that patients with allergic bronchopulmonary aspergillosis (ABPA) and patients with severe asthma with fungal sensitization (SAFS) can benefit from antifungal therapy. It is not known whether allergy skin prick tests (SPT) or specific IgE tests are more sensitive in the identification of patients who are sensitized to fungi and who are therefore candidates for antifungal therapy. To compare SPT and specific serum IgE tests for fungal sensitization in patients with severe asthma. We have undertaken SPT and specific serum IgE tests to six fungi (Aspergillus fumigatus, Candida albicans, Penicillium notatum, Cladosporium herbarum, Alternaria alternata and Botrytis cineria) and specific serum IgE test for Trichophyton in 121 patients with severe asthma (British Thoracic Society/SIGN steps 4 and 5). Sixty-six percent of patients were sensitized to one or more fungi based on SPT and/or specific serum IgE results. Positivity to SPT and/or specific serum IgE was as follows: A. fumigatus 45%, C. albicans 36%, P. notatum 29%, C. herbarum 24%, A. alternata 22%, B. cineria 18%, Trichophyton 17% (specific serum IgE only). Concordance between the tests was 77% overall but only 14-56% for individual fungi. Twenty-nine (24%) patients were sensitized to a single fungus and seven (6%) were sensitized to all seven fungal species. Fifty percent of patients were sensitized to fungal and non-fungal extracts, 21% were sensitized only to non-fungal extracts, 16% were sensitized only to fungal extracts and 13% had no positive tests. This study is consistent with previous reports that fungal sensitization is common in patients with severe asthma. At present, it remains necessary to undertake both SPT and specific serum IgE testing to identify all cases of fungal sensitization. This may be important in the identification of patients with ABPA and SAFS who may benefit from antifungal therapy.

Resistance to Black Dot in Potato

USDA-ARS?s Scientific Manuscript database

Black dot fungus can colonize tubers on the surface, in the stolon end, or in a combination of both.On the surface the fungus is prevalent as sclerotia, and in the stolon end the fungus colonizes the vascular tissuesas hyphae. The fungus is introduced to non-infested soils mostly by infected potato ...

Activity of different proteinaceous ice nucleating particles

NASA Astrophysics Data System (ADS)

Hartmann, Susann; Augustin-Bauditz, Stefanie; Grawe, Sarah; Ling, Meilee; Hellner, Lisa; Zapf, Jean-Michel; Šantl-Temkiv, Tina; Pummer, Bernhard; Boesen, Thomas; Wex, Heike; Finster, Kai; Stratmann, Frank

2017-04-01

A variety of microorganisms (bacteria, fungi, lichen) from land produce protein structures, which act as a template for ice nucleation [1]. Also marine sources of ice nucleating particles (INPs) came in focus in the recent years. The atmospheric spatio-temporal distribution of INPs from microorganisms is still not well known. However, it is often assumed that the observed onset of atmospheric ice nucleation (T>-20°C) is due to the existence of ice-nucleation active biological particles. In this study we compare the ice nucleation activity of different proteinaceous particles produced by bacteria and fungi. For bacteria we investigate (i) cells and fragments of Pseudomonas syringae from commercially available SnomaxTM and (ii) the Pseudomonas syringae INA protein expressed in living Escherichia coli bacteria. We also analyzed freeze-dried leaves [2] where we assume that proteinaceous particles are responsible for the ice nucleation activity. For fungi the widespread soil fungus Mortierella alpina was investigated which had been extracted from natural soil [3]. Immersion freezing experiments are performed at the cold stage LINA (Leipzig Ice Nucleation Array). We attempt to describe the activity of a single proteinaceous ice nucleating particle [4] in order to achieve direct comparability. Further, the results are compared with complex natural systems e.g. soil dust. The objectives of this study are to clarify potential differences in the ice nucleation potential of proteinaceous particles and to draw conclusions concerning the need to differentiate them for modelling purposes. 1. Szyrmer, W. and I. Zawadzki, Biogenic and anthropogenic sources of ice-forming nuclei: A review, Bull. Amer. Meteorol. Soc., 1997. 2. Schnell, R.C. and G. Vali, Biogenic ice nucleai .1: Terrestrial and marine sources, doi: 10.1175/1520-0469(1976)033<1554:binpit>2.0.co;2, 1976. 3. Froehlich-Nowoisky, J. et al., Ice nucleation activity in the widespread soil fungus Mortierella alpina, doi: 10.5194/bg-12-1057-2015, 2015. 4. Hartmann, S. et al., Immersion freezing of ice nucleation active protein complexes, Atmos. Chem. Phys., doi: 10.5194/acp-13-5751-2013, 2013.

THE IMPORTANCE OF ANIMAL INFECTIONS FOR THE HUMAN

DTIC Science & Technology

tuberculosis, leptospiroses. VIRUS-CAUSED ZOOANTHROPONOSES: Rickettsioses, ornithosis, lyssa, arboviroses. FUNGUS-CAUSED ANIMAL-HUMAN INFECTIONS: filamentous fungus, yeast fungus. PROTOZOA DISEASES: Toxoplasmoses .

Contamination of Pine Seeds by the Pitch Canker Fungus

Treesearch

L. David Dwinell; S.W. Fraedrich

1999-01-01

The pitch canker fungus, Fusarium subglutinans f. sp. pini, has been identified as a significant problem in man pine seed orchards and nursuries in the South. THe fungus causes strobilus mortality, seed deterioation, and cankers on the main stem, branches, and shoots of pines Dwinell and others 1985). The pitche canker fungus...

Cause of Mortality in Thermally Injured Patients

DTIC Science & Technology

1993-01-01

11 patients, Cladosporium species from nine patients, Penicillium species from seven patients, and Phycomycetes ( mucor species and rhizopus species...infecting organisms were filamentous fungi, Aspergillus species in 16 and Mucor species in two, and in four patients C(nlida species were the causative...surface. Twelve, or 75 %, of the 16 patients with Aspergillus wound infections died but, somewhat surprisingly, both of the patients with mucor species

Microbiological and Corrosivity Characterizations of Biodiesels and Advanced Diesel Fuels

DTIC Science & Technology

2009-01-01

hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and...including corrosion inhibitors. Requirements for microbial growth are water and nutrients. In addition to carbon , all organisms require nitrogen...microbial mineralization of fuel to generate a water phase for further proliferation. For example, Cladosporium resinae grew in 80 mg water per liter

Native arbuscular mycorrhizal symbiosis alters foliar bacterial community composition.

PubMed

Poosakkannu, Anbu; Nissinen, Riitta; Kytöviita, Minna-Maarit

2017-11-01

The effects of arbuscular mycorrhizal (AM) fungi on plant-associated microbes are poorly known. We tested the hypothesis that colonization by an AM fungus affects microbial species richness and microbial community composition of host plant tissues. We grew the grass, Deschampsia flexuosa in a greenhouse with or without the native AM fungus, Claroideoglomus etunicatum. We divided clonally produced tillers into two parts: one inoculated with AM fungus spores and one without AM fungus inoculation (non-mycorrhizal, NM). We characterized bacterial (16S rRNA gene) and fungal communities (internal transcribed spacer region) in surface-sterilized leaf and root plant compartments. AM fungus inoculation did not affect microbial species richness or diversity indices in leaves or roots, but the AM fungus inoculation significantly affected bacterial community composition in leaves. A total of three OTUs in leaves belonging to the phylum Firmicutes positively responded to the presence of the AM fungus in roots. Another six OTUs belonging to the Proteobacteria (Alpha, Beta, and Gamma) and Bacteroidetes were significantly more abundant in NM plants when compared to AM fungus-inoculated plants. Further, there was a significant correlation between plant dry weight and leaf microbial community compositional shift. Also, there was a significant correlation between leaf bacterial community compositional shift and foliar nitrogen content changes due to AM fungus inoculation. The results suggest that AM fungus colonization in roots has a profound effect on plant physiology that is reflected in leaf bacterial community composition.

Final Environmental Assessment and Finding of No Significant Impact: Deployment of Up to Four F-16C Aircraft to the 133rd Airlift Wing for Air Sovereignty Alert Operations

DTIC Science & Technology

2007-11-01

species of moss FUNGI Endangered Fuscoboletinus weaverae . . . . . . . . . . . . . . a species of fungus Psathyrella cystidiosa...a species of fungus Psathyrella rhodospora . . . . . . . . . . . . . . . a species of fungus Special concern Laccaria trullisata...SC . . . . . . . . . caddisfly Psathyrella cystidiosa . . . . . . . . . . . . . . . . a species of fungus

Host deception: Predaceous fungus, esteya vermicola, entices pine wood nematode by mimicking the scent of its host pine for nutrient

USDA-ARS?s Scientific Manuscript database

A nematophagous fungus, Esteya vermicola, is recorded as the first endoparasitic fungus of pine wood nematode (PWN), Burasphelenchus xylophilus, in the last century. E. vermicola exhibited high infectivity toward PWN in the laboratory conditions and conidia spraying of this fungus on Japanese red pi...

Vaccinols J-S, ten new salicyloid derivatives from the marine mangrove-derived endophytic fungus Pestalotiopsis vaccinii.

PubMed

Wang, Jun-Feng; Liang, Rui; Liao, Sheng-Rong; Yang, Bin; Tu, Zheng-Chao; Lin, Xiu-Ping; Wang, Bin-Gui; Liu, Yonghong

2017-07-01

Ten new salicyloid derivatives, namely vaccinols J-S (1-10), along with five known compounds (11-15) were isolated from Pestalotiopsis vaccinii (cgmcc3.9199) endogenous with the mangrove plant Kandelia candel (L.) Druce (Rhizophoraceae). Their structures including absolute configurations were established on the basis of spectroscopic analysis, optical rotation, CD spectra, quantum ECD calculations. To the best of our knowledge, vaccinol J (1) is the first example of salicyloid derivatives containing 2-methylfuran moiety. All of the new compounds were tested for their anti-enterovirus 7l (EV71) and cytotoxic activities. Among them, vaccinol J (1) exhibited in vitro anti-EV71 with IC 50 value of 30.7μM (IC 50 177.0μM for the positive control ribavirin). Copyright © 2017. Published by Elsevier B.V.

Isolation and characterization of an ether-type polyurethane-degrading micro-organism and analysis of degradation mechanism by Alternaria sp.

PubMed

Matsumiya, Y; Murata, N; Tanabe, E; Kubota, K; Kubo, M

2010-06-01

To degrade ether-type polyurethane (ether-PUR), ether-PUR-degrading micro-organism was isolated. Moreover, ether-PUR-degrading mechanisms were analysed using model compounds of ether-PUR. A fungus designated as strain PURDK2, capable of changing the configuration of ether-PUR, has been isolated. This isolated fungus was identified as Alternaria sp. Using a scanning electron microscope, the grid structure of ether-PUR was shown to be melted and disrupted by the fungus. The degradation of ether-PUR by the fungus was analysed, and the ether-PUR was degraded by the fungus by about 27.5%. To analyse the urethane-bond degradation by the fungus, a degraded product of ethylphenylcarbamate was analysed using GC/MS. Aniline and ethanol were detected by degradation with the supernatant, indicating that the fungus secreted urethane-bond-degrading enzyme(s). PURDK2 also degraded urea bonds when diphenylmethane-4,4'-dibutylurea was used as a substrate. The enzyme(s) from PURDK2 degraded urethane and urea bonds to convert the high molecular weight structure of ether-PUR to small molecules; and then the fungus seems to use the small molecules as an energy source. Ether-PUR-degrading fungus, strain PURDK2, was isolated, and the urethane- and urea-bonds-degrading enzymes from strain PURDK2 could contribute to the material recycling of ether-PUR.

Antagonism of Bacillus spp. isolated from marine biofilms against terrestrial phytopathogenic fungi.

PubMed

Ortega-Morales, B O; Ortega-Morales, F N; Lara-Reyna, J; De la Rosa-García, S C; Martínez-Hernández, A; Montero-M, Jorge

2009-01-01

We aimed at determining the antagonistic behavior of bacteria derived from marine biofilms against terrestrial phytopathogenic fungi. Some bacteria closely related to Bacillus mojavensis (three isolates) and Bacillus firmus (one isolate) displayed antagonistic activity against Colletotrichum gloeosporioides ATCC 42374, selected as first screen organism. The four isolates were further quantitatively tested against C. gloeosporioides, Colletotrichum fragariae, and Fusarium oxysporum on two culture media, potato dextrose agar (PDA) and a marine medium-based agar [yeast extract agar (YEA)] at different times of growth of the antagonists (early, co-inoculation with the pathogen and late). Overall antagonistic assays showed differential susceptibility among the pathogens as a function of the type of culture media and time of colonization (P < 0.05). In general, higher suppressive activities were recorded for assays performed on YEA than on PDA; and also when the antagonists were allowed to grow 24 h earlier than the pathogen. F. oxysporum was the most resistant fungus while the most sensitive was C. gloeosporioides ATCC 42374. Significant differences in antagonistic activity (P < 0.05) were found between the different isolates. In general, Bacillus sp. MC3B-22 displayed a greater antagonistic effect than the commercial biocontrol strain Bacillus subtilis G03 (Kodiak). Further incubation studies and scanning electronic microscopy revealed that Bacillus sp. MC3B-22 was able to colonize, multiply, and inhibit C. gloeosporioides ATCC 42374 when tested in a mango leaf assay, showing its potential for fungal biocontrol. Additional studies are required to definitively identify the active isolates and to determine their mode of antifungal action, safety, and biocompatibility.

Histoplasmosis

MedlinePlus

... by the fungus Histoplasma. The fungus lives in soil. You get the infection by breathing in spores ... construction, gardening, or any activity that disturbs the soil can release fungus spores into the air. If ...

Blastomycosis

MedlinePlus

... dermatitidis fungus. The fungus is found in decaying wood and soil. Causes You can get blastomycosis by ... moist soil, most commonly where there is rotting wood and leaves. The fungus enters the body through ...

Scanning electron microscopy of Ancylostoma spp. dog infective larvae captured and destroyed by the nematophagous fungus Duddingtonia flagrans.

PubMed

Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G

2009-06-01

The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).

Growth inhibition of an Araucaria angustifolia (Coniferopsida) fungal seed pathogen, Neofusicoccum parvum, by soil streptomycetes

PubMed Central

2013-01-01

Background Araucariaceae are important forest trees of the southern hemisphere. Life expectancy of their seedlings can largely be reduced by fungal infections. In this study we have isolated and characterized such a fungus and investigated the potential of Streptomyces Actinobacteria from the respective rhizosphere to act as antagonists. Results The pathogenic fungus from Araucaria angustifolia seeds was identified by morphological markers (pore-associated Woronin-bodies) as belonging to the Pezizomycotina. Molecular data identified the fungus as Neofusicoccum parvum (Botryosphaeriaceae). Co-cultures on agar of this fungus with certain streptomycete isolates from the rhizosphere, and from the surface of Araucaria roots significantly reduced the growth of the fungus. HPLC analysis of the agar yielded streptomycete-specific exudate compounds which were partly identified. There were differences in compounds between single (bacteria, fungus) and dual cultures (bacteria + fungus). Conclusion Streptomycetes from the rhizosphere of Araucariaceae produce exudates which can suppress the development of pathogenic fungi in their seeds. PMID:23866024

Caecomyces sympodialis sp. nov., a new rumen fungus isolated from Bos indicus.

PubMed

Chen, Yo-Chia; Tsai, Sheng-Da; Cheng, Hsueh-Ling; Chien, Chiu-Yuan; Hu, Chun-Yi; Cheng, Tai-Yi

2007-01-01

A new anaerobic rumen fungus was isolated from the rumen fluid of a yellow cow (Bos indicus). This fungus appears to be a previously undescribed species of the genus Caecomyces, it possessing uniflagellate zoospores, a spherical holdfast, tubular sporangiophores and bulbous rhizoids. This new fungus also features distinctive multisporangiate thallus sympodially distributed on sporangiophores. The fungus resembles Caecomyces communis and C. equi in that it characterizes bulbous rhizoids and uniflagellate zoospores but differs from C. communis and C. equi in that it possesses multisporangiate and sympodial sporangia. This new fungus and Cyllamyces aberensis both reveal similar morphology during early thallus development in having a spherical holdfast, but they vary from unbranched sporangiophores and additional bulbous rhizoids. In addition, the molecular phylogenetic analyses ITS1 (internal transcribed spacer 1) also conform to the results of the morphological examinations of Caecomyces. For the mentioned reasons, this new species of fungus is described as Caecomyces sympodialis sp. nov. The genera of Neocallimasticaceae and species of Caecomyces are also keyed out.

Ocean warming and acidification have complex interactive effects on the dynamics of a marine fungal disease

PubMed Central

Williams, Gareth J.; Price, Nichole N.; Ushijima, Blake; Aeby, Greta S.; Callahan, Sean; Davy, Simon K.; Gove, Jamison M.; Johnson, Maggie D.; Knapp, Ingrid S.; Shore-Maggio, Amanda; Smith, Jennifer E.; Videau, Patrick; Work, Thierry M.

2014-01-01

Diseases threaten the structure and function of marine ecosystems and are contributing to the global decline of coral reefs. We currently lack an understanding of how climate change stressors, such as ocean acidification (OA) and warming, may simultaneously affect coral reef disease dynamics, particularly diseases threatening key reef-building organisms, for example crustose coralline algae (CCA). Here, we use coralline fungal disease (CFD), a previously described CCA disease from the Pacific, to examine these simultaneous effects using both field observations and experimental manipulations. We identify the associated fungus as belonging to the subphylum Ustilaginomycetes and show linear lesion expansion rates on individual hosts can reach 6.5 mm per day. Further, we demonstrate for the first time, to our knowledge, that ocean-warming events could increase the frequency of CFD outbreaks on coral reefs, but that OA-induced lowering of pH may ameliorate outbreaks by slowing lesion expansion rates on individual hosts. Lowered pH may still reduce overall host survivorship, however, by reducing calcification and facilitating fungal bio-erosion. Such complex, interactive effects between simultaneous extrinsic environmental stressors on disease dynamics are important to consider if we are to accurately predict the response of coral reef communities to future climate change. PMID:24452029

Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

PubMed

Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

2015-11-01

Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Tanzawaic acid derivatives from a marine isolate of Penicillium sp. (SF-6013) with anti-inflammatory and PTP1B inhibitory activities.

PubMed

Quang, Tran Hong; Ngan, Nguyen Thi Thanh; Ko, Wonmin; Kim, Dong-Cheol; Yoon, Chi-Su; Sohn, Jae Hak; Yim, Joung Han; Kim, Youn-Chul; Oh, Hyuncheol

2014-12-15

Chemical investigation of a marine-derived fungus Penicillium sp. SF-6013 resulted in the discovery of a new tanzawaic acid derivative, 2E,4Z-tanzawaic acid D (1), together with four known analogues, tanzawaic acids A (2) and D (3), a salt form of tanzawaic acid E (4), and tanzawaic acid B (5). Their structures were mainly determined by analysis of NMR and MS data, along with chemical methods. Preliminary screening for anti-inflammatory effects in lipopolysaccharide (LPS)-activated microglial BV-2 cells showed that compounds 1, 2, and 5 inhibited the production of nitric oxide (NO) with IC50 values of 37.8, 7.1, and 42.5 μM, respectively. Compound 2 also inhibited NO production in LPS-stimulated RAW264.7 murine macrophages with an IC50 value of 27.0 μM. Moreover, these inhibitory effects correlated with the suppressive effect of compound 2 on inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) expression in LPS-stimulated RAW264.7 and BV2 cells. In addition, compounds 2 and 5 significantly inhibited the activity of protein tyrosine phosphatase 1B (PTP1B) with the same IC50 value (8.2 μM). Copyright © 2014 Elsevier Ltd. All rights reserved.

Ocean warming and acidification have complex interactive effects on the dynamics of a marine fungal disease.

PubMed

Williams, Gareth J; Price, Nichole N; Ushijima, Blake; Aeby, Greta S; Callahan, Sean; Davy, Simon K; Gove, Jamison M; Johnson, Maggie D; Knapp, Ingrid S; Shore-Maggio, Amanda; Smith, Jennifer E; Videau, Patrick; Work, Thierry M

2014-03-07

Diseases threaten the structure and function of marine ecosystems and are contributing to the global decline of coral reefs. We currently lack an understanding of how climate change stressors, such as ocean acidification (OA) and warming, may simultaneously affect coral reef disease dynamics, particularly diseases threatening key reef-building organisms, for example crustose coralline algae (CCA). Here, we use coralline fungal disease (CFD), a previously described CCA disease from the Pacific, to examine these simultaneous effects using both field observations and experimental manipulations. We identify the associated fungus as belonging to the subphylum Ustilaginomycetes and show linear lesion expansion rates on individual hosts can reach 6.5 mm per day. Further, we demonstrate for the first time, to our knowledge, that ocean-warming events could increase the frequency of CFD outbreaks on coral reefs, but that OA-induced lowering of pH may ameliorate outbreaks by slowing lesion expansion rates on individual hosts. Lowered pH may still reduce overall host survivorship, however, by reducing calcification and facilitating fungal bio-erosion. Such complex, interactive effects between simultaneous extrinsic environmental stressors on disease dynamics are important to consider if we are to accurately predict the response of coral reef communities to future climate change.

Ocean warming and acidification have complex interactive effects on the dynamics of a marine fungal disease

USGS Publications Warehouse

Williams, Gareth J.; Price, Nichole N.; Ushijima, Blake; Aeby, Greta S.; Callahan, Sean M.; Davy, Simon K.; Gove, Jamison M.; Johnson, Maggie D.; Knapp, Ingrid S.; Shore-Maggio, Amanda; Smith, Jennifer E.; Videau, Patrick; Work, Thierry M.

2014-01-01

Diseases threaten the structure and function of marine ecosystems and are contributing to the global decline of coral reefs. We currently lack an understanding of how climate change stressors, such as ocean acidification (OA) and warming, may simultaneously affect coral reef disease dynamics, particularly diseases threatening key reef-building organisms, for example crustose coralline algae (CCA). Here, we use coralline fungal disease (CFD), a previously described CCA disease from the Pacific, to examine these simultaneous effects using both field observations and experimental manipulations. We identify the associated fungus as belonging to the subphylum Ustilaginomycetes and show linear lesion expansion rates on individual hosts can reach 6.5 mm per day. Further, we demonstrate for the first time, to our knowledge, that ocean-warming events could increase the frequency of CFD outbreaks on coral reefs, but that OA-induced lowering of pH may ameliorate outbreaks by slowing lesion expansion rates on individual hosts. Lowered pH may still reduce overall host survivorship, however, by reducing calcification and facilitating fungal bio-erosion. Such complex, interactive effects between simultaneous extrinsic environmental stressors on disease dynamics are important to consider if we are to accurately predict the response of coral reef communities to future climate change.

COMPARISON OF GENETIC METHODS TO OPTICAL METHODS IN THE IDENTIFICATION AND ASSESSMENT OF MOLD IN THE BUILT ENVIRONMENT -- COMPARISON OF TAQMAN AND MICROSCOPIC ANALYSIS OF CLADOSPORIUM SPORES RETRIEVED FROM ZEFON AIR-O-CELL TRACES

EPA Science Inventory

Recent advances in the sequencing of relevant water intrusion fungi by the EPA, combined with the development of probes and primers have allowed for the unequivocal quantitative and qualitative identification of fungi in selected matrices.

In this pilot study, quantitative...

Airborne culturable fungi in naturally ventilated primary school environments in a subtropical climate

NASA Astrophysics Data System (ADS)

Salonen, Heidi; Duchaine, Caroline; Mazaheri, Mandana; Clifford, Sam; Morawska, Lidia

2015-04-01

There is currently a lack of reference values for indoor air fungal concentrations to allow for the interpretation of measurement results in subtropical school settings. Analysis of the results of this work established that, in the majority of properly maintained subtropical school buildings, without any major affecting events such as floods or visible mould or moisture contamination, indoor culturable fungi levels were driven by outdoor concentration. The results also allowed us to benchmark the "baseline range" concentrations for total culturable fungi, Penicillium spp., Cladosporium spp. and Aspergillus spp. in such school settings. The measured concentration of total culturable fungi and three individual fungal genera were estimated using Bayesian hierarchical modelling. Pooling of these estimates provided a predictive distribution for concentrations at an unobserved school. The results indicated that "baseline" indoor concentration levels for indoor total fungi, Penicillium spp., Cladosporium spp. and Aspergillus spp. in such school settings were generally ≤1450, ≤680, ≤480 and ≤90 cfu/m3, respectively, and elevated levels would indicate mould damage in building structures. The indoor/outdoor ratio for most classrooms had 95% credible intervals containing 1, indicating that fungi concentrations are generally the same indoors and outdoors at each school. Bayesian fixed effects regression modelling showed that increasing both temperature and humidity resulted in higher levels of fungi concentration.

Investigation of the microbial communities colonizing prepainted steel used for roofing and walling.

PubMed

Huynh, Tran T; Jamil, Ili; Pianegonda, Nicole A; Blanksby, Stephen J; Barker, Philip J; Manefield, Mike; Rice, Scott A

2017-04-01

Microbial colonization of prepainted steel, commonly used in roofing applications, impacts their aesthetics, durability, and functionality. Understanding the relevant organisms and the mechanisms by which colonization occurs would provide valuable information that can be subsequently used to design fouling prevention strategies. Here, next-generation sequencing and microbial community finger printing (T-RFLP) were used to study the community composition of microbes colonizing prepainted steel roofing materials at Burrawang, Australia and Kapar, Malaysia over a 52-week period. Community diversity was low and was dominated by Bacillus spp., cyanobacteria, actinobacteria, Cladosporium sp., Epicoccum nigrum, and Teratosphaeriaceae sp. Cultivation-based methods isolated approximately 20 different fungi and bacteria, some of which, such as E. nigrum and Cladosporium sp., were represented in the community sequence data. Fluorescence in situ hybridization imaging showed that fungi were the most dominant organisms present. Analysis of the sequence and T-RFLP data indicated that the microbial communities differed significantly between locations and changed significantly over time. The study demonstrates the utility of molecular ecology tools to identify and characterize microbial communities associated with the fouling of painted steel surfaces and ultimately can enable the targeted development of control strategies based on the dominant species responsible for fouling. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Chemical modification of L-asparaginase from Cladosporium sp. for improved activity and thermal stability.

PubMed

Mohan Kumar, N S; Kishore, Vijay; Manonmani, H K

2014-01-01

L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (kd), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment.

Construction of Potent Recombinant Strain Through Intergeneric Protoplast Fusion in Endophytic Fungi for Anticancerous Enzymes Production Using Rice Straw.

PubMed

El-Gendy, Mervat Morsy Abbas Ahmed; Al-Zahrani, Salha Hassan Mastour; El-Bondkly, Ahmed Mohamed Ahmed

2017-09-01

Among all fungal endophytes isolates derived from different ethno-medical plants, the hyper-yield L-asparaginase and L-glutaminase wild strains Trichoderma sp. Gen 9 and Cladosporium sp. Gen 20 using rice straw under solid-state fermentation (SSF) were selected. The selected strains were used as parents for the intergeneric protoplast fusion program to construct recombinant strain for prompt improvement production of these enzymes in one recombinant strain. Among 21 fusants obtained, the recombinant strain AYA 20-1, with 2.11-fold and 2.58-fold increase in L-asparaginase and L-glutaminase activities more than the parental isolates Trichoderma sp. Gen 9 and Cladosporium sp. Gen 20, respectively, was achieved using rice straw under SSF. Both therapeutic enzymes L-asparaginase and L-glutaminase were purified and characterized from the culture supernatant of the recombinant AYA 20-1 strain with molecular weights of 50.6 and 83.2 kDa, respectively. Both enzymes were not metalloenzymes. Whereas thiol group blocking reagents such as p-chloromercurybenzoate and iodoacetamide totally inhibited L-asparaginase activity, which refer to sulfhydryl groups and cysteine residues involved in its catalytic activity, they have no effect toward L-glutaminase activity. Interestingly, potent anticancer, antioxidant, and antimicrobial activities were detected for both enzymes.

Further studies on Egyptian soil fungi: succession of sugar and osmophilic fungi in soil amended with five organic substrates.

PubMed

Shaban, G M

1996-01-01

The sugar and osmophilic fungal composition of soils amended with five organic substrates (newspaper, orange peel, bromegrass leaves, wheat straw and wood sawdust) was estimated after 2, 4, 6, 8 and 10 weeks using the dilution plate method on glucose and 50% sucrose Czapek's agar media. Wheat straw was the best substrate for total counts of both sugar and osmophilic fungi followed by newspaper, bromegrass leaves, wood sawdust and orange peel. Wood sawdust supported the highest average counts of total sugar fungi, Fusarium, Mucor, Scopulariopsis, Trichoderma and Trimmatostroma spp.; Newspaper, of Aspergillus (8 spp.), Penicillium (4 spp.) and Chaetomium sp.; bromegrass leaves of Cladosporium sp., Humicola sp. and Sporotrichum sp.; orange peel, of Alternaria sp., Circinella sp. and Stachybotrys sp.; and wheat straw, of Botryotrichum sp. and Myrothecium sp. Bromegrass leaves and orange peel supported the highest average counts of total osmophilic fungi, Aspergillus (10 spp.), Cladosporium sp. Paecillomyces sp. and Rhizopus sp.; and of Stemphylium sp., Trichoderma sp., Humicola sp. and Circinella sp. respectively; wheat straw, of Epicoccum sp., Scopulariopsis sp. and Trichothecium sp.; newspaper, of Penicillium (4 spp.) and Alternaria sp.; and wood sawdust of Curvularia sp. and Fusarium (3 spp.). The best colonizers throughout the experimental periods were Aspergilus and Penicillium spp.

Carbon dioxide sensing in an obligate insect-fungus symbiosis: CO2 preferences of leaf-cutting ants to rear their mutualistic fungus.

PubMed

Römer, Daniela; Bollazzi, Martin; Roces, Flavio

2017-01-01

Defense against biotic or abiotic stresses is one of the benefits of living in symbiosis. Leaf-cutting ants, which live in an obligate mutualism with a fungus, attenuate thermal and desiccation stress of their partner through behavioral responses, by choosing suitable places for fungus-rearing across the soil profile. The underground environment also presents hypoxic (low oxygen) and hypercapnic (high carbon dioxide) conditions, which can negatively influence the symbiont. Here, we investigated whether workers of the leaf-cutting ant Acromyrmex lundii use the CO2 concentration as an orientation cue when selecting a place to locate their fungus garden, and whether they show preferences for specific CO2 concentrations. We also evaluated whether levels preferred by workers for fungus-rearing differ from those selected for themselves. In the laboratory, CO2 preferences were assessed in binary choices between chambers with different CO2 concentrations, by quantifying number of workers in each chamber and amount of relocated fungus. Leaf-cutting ants used the CO2 concentration as a spatial cue when selecting places for fungus-rearing. A. lundii preferred intermediate CO2 levels, between 1 and 3%, as they would encounter at soil depths where their nest chambers are located. In addition, workers avoided both atmospheric and high CO2 levels as they would occur outside the nest and at deeper soil layers, respectively. In order to prevent fungus desiccation, however, workers relocated fungus to high CO2 levels, which were otherwise avoided. Workers' CO2 preferences for themselves showed no clear-cut pattern. We suggest that workers avoid both atmospheric and high CO2 concentrations not because they are detrimental for themselves, but because of their consequences for the symbiotic partner. Whether the preferred CO2 concentrations are beneficial for symbiont growth remains to be investigated, as well as whether the observed preferences for fungus-rearing influences the ants' decisions where to excavate new chambers across the soil profile.

Biological control of horse cyathostomin (Nematoda: Cyathostominae) using the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Braga, Fabio Ribeiro; Araújo, Jackson Victor; Silva, André Ricardo; Araujo, Juliana Milani; Carvalho, Rogério Oliva; Tavela, Alexandre Oliveira; Campos, Artur Kanadani; Carvalho, Giovanni Ribeiro

2009-08-26

The viability of a fungal formulation using the nematode-trapping fungus Duddingtonia flagrans was assessed for the biological control of horse cyathostomin. Two groups (fungus-treated and control without fungus treatment), consisting of eight crossbred mares (3-18 years of age) were fed on Cynodon sp. pasture naturally infected with equine cyathostome larvae. Each animal of the treated group received oral doses of sodium alginate mycelial pellets (1g/(10 kg live weight week)), during 6 months. Significant reduction (p<0.01) in the number of eggs per gram of feces and coprocultures was found for animals of the fungus-treated group compared with the control group. There was difference (p<0.01) of 78.5% reduction in herbage samples collected up to (0-20 cm) between the fungus-treated group and the control group, during the experimental period (May-October). Difference of 82.5% (p<0.01) was found between the fungus-treated group and the control group in the sampling distance (20-40 cm) from fecal pats. During the last 3 months of the experimental period (August, September and October), fungus-treated mares had significant weight gain (p<0.01) compared with the control group, an increment of 38 kg. The treatment with sodium alginate pellets containing the nematode-trapping fungus D. flagrans reduced cyathostomin in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in horses.

The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands

Treesearch

J.A. Torres

1989-01-01

Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food.  These oils supplement the fungus material eaten by this...

Rust-red stringy white rot: The Indian paint fungus, Echinodontium tinctorium

Treesearch

A. D. Wilson

1997-01-01

Older trees are more susceptible to damage by this fungus, although even very young trees are susceptible to infection. Infections occur most frequently in dense stands where selfpruning creates infection courts for the fungus.

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies.

PubMed

Cloyd, Raymond A

2015-04-09

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems.

Sequential batch culture studies for the decolorisation of reactive dye by Coriolus versicolor.

PubMed

Sanghi, Rashmi; Dixit, Awantika; Guha, Sauymen

2006-02-01

The white rot fungus Coriolus versicolor could decolorise reactive dye Remazol Brilliant Violet to almost 90%. The fungal mycelia removed color as well as COD up to 95% and 75%, respectively, in a batch reactor. Decolorising activity was observed during the repeated reuse of the fungus. It was possible to substantially increase the dye decolorising activity of the fungus by carefully selecting the operational conditions such as media composition, age of fungus and nitrogen source. The fungal pellets could be used for eight cycles during the long term operation, where medium and dye was replenished at the end of each cycle and the fungus was recycled. Presence of a nitrogen source and nutrient content of media played an important role in sustaining the decolorisation activity of the fungus. The form of nitrogen source (e.g. peptone vs. urea) was also important to maintain the decolorising activity with peptone showing better decolorisation.

Oligocene Termite Nests with In Situ Fungus Gardens from the Rukwa Rift Basin, Tanzania, Support a Paleogene African Origin for Insect Agriculture

PubMed Central

Roberts, Eric M.; Todd, Christopher N.; Aanen, Duur K.; Nobre, Tânia; Hilbert-Wolf, Hannah L.; O’Connor, Patrick M.; Tapanila, Leif; Mtelela, Cassy; Stevens, Nancy J.

2016-01-01

Based on molecular dating, the origin of insect agriculture is hypothesized to have taken place independently in three clades of fungus-farming insects: the termites, ants or ambrosia beetles during the Paleogene (66–24 Ma). Yet, definitive fossil evidence of fungus-growing behavior has been elusive, with no unequivocal records prior to the late Miocene (7–10 Ma). Here we report fossil evidence of insect agriculture in the form of fossil fungus gardens, preserved within 25 Ma termite nests from southwestern Tanzania. Using these well-dated fossil fungus gardens, we have recalibrated molecular divergence estimates for the origins of termite agriculture to around 31 Ma, lending support to hypotheses suggesting an African Paleogene origin for termite-fungus symbiosis; perhaps coinciding with rift initiation and changes in the African landscape. PMID:27333288

Ecology of Fungus Gnats (Bradysia spp.) in Greenhouse Production Systems Associated with Disease-Interactions and Alternative Management Strategies

PubMed Central

Cloyd, Raymond A.

2015-01-01

Fungus gnats (Bradysia spp.) are major insect pests of greenhouse-grown horticultural crops mainly due to the direct feeding damage caused by the larvae, and the ability of larvae to transmit certain soil-borne plant pathogens. Currently, insecticides and biological control agents are being used successively to deal with fungus gnat populations in greenhouse production systems. However, these strategies may only be effective as long as greenhouse producers also implement alternative management strategies such as cultural, physical, and sanitation. This includes elimination of algae, and plant and growing medium debris; placing physical barriers onto the growing medium surface; and using materials that repel fungus gnat adults. This article describes the disease-interactions associated with fungus gnats and foliar and soil-borne diseases, and the alternative management strategies that should be considered by greenhouse producers in order to alleviate problems with fungus gnats in greenhouse production systems. PMID:26463188

Survey of Contamination in Fuel Tanks of DD-963 Class Ships.

DTIC Science & Technology

1982-07-23

and Identifly by block num0b.’) Diesel fuel Fuel sludge Bacteria Fuel contamination Cladosporium resinae Sludge composition assess sources of... resinae ) predominated. Viable sulfate reducers were sometimes present but rarely sulfide. Below pH 4 bacteria were rare and fungi and yeasts were numerous...but the variety tended to be restricted to C. resinae and Candida. Differences in viable microbial varieties present in these sludge categories are

Meroterpenoid and diphenyl ether derivatives from Penicillium sp. MA-37, a fungus isolated from marine mangrove rhizospheric soil.

PubMed

Zhang, Yi; Li, Xiao-Ming; Shang, Zhuo; Li, Chun-Shun; Ji, Nai-Yun; Wang, Bin-Gui

2012-11-26

Penicillium sp. MA-37, which was obtained from the rhizospheric soil of the mangrove plant Bruguiera gymnorrhiza, exhibited different chemical profiles in static and shaken fermentation modes. Three new meroterpenoid derivatives, 4,25-dehydrominiolutelide B (1), 4,25-dehydro-22-deoxyminiolutelide B (2), and isominiolutelide A (3), together with three known ones were characterized from its static fermentation, while three new diphenyl ether derivatives, namely, Δ(1('),3('))-1'-dehydroxypenicillide (4), 7-O-acetylsecopenicillide C (5), and hydroxytenellic acid B (6), along with five related metabolites were isolated from the shaken culture. The structures of these compounds were elucidated on the basis of spectroscopic analysis, and the structure of compound 2 was confirmed by X-ray crystallographic analysis. The absolute configurations of 1-3 and 6 were determined by ECD and modified Mosher's method, respectively. All isolated compounds were evaluated for brine shrimp lethality and antibacterial activity.

Noninvasive medical management of fungus ball uropathy in a premature infant.

PubMed

Alkalay, A L; Srugo, I; Blifeld, C; Komaiko, M S; Pomerance, J J

1991-09-01

Unilateral renal obstruction secondary to fungus balls is described in a premature infant. Noninvasive medical management, which included amphotericin B and 5-flucytosine therapy and forced diuresis, resulted in disappearance of fungus balls and resolution of the obstruction.

THE ROLE OF PREDISPOSING FACTORS IN EXPERIMENTAL FUNGUS INFECTIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheldon, W.H.; Bauer, H.

Among other factors, the influence of ionizing radiations on susceptibility to fungus diseases is reviewed. X irradiation singly or in combination with cortisone administration has been employed in the study of experimental fungus diseases, and it has been shown that total-body radiation enhaaced infection with Candida albicans, Blastomyces dermatididis, and Cryptococcus neoformans in mice. Enhanced susceptibility to fungus infections following radiation therapy has also been reported, the mechanism resulting in lowered host resistance being presumably the same as in other infections. (BBB)

Exploring the potential for actinobacteria as defensive symbionts in fungus-growing termites.

PubMed

Visser, Anna A; Nobre, Tânia; Currie, Cameron R; Aanen, Duur K; Poulsen, Michael

2012-05-01

In fungus-growing termites, fungi of the subgenus Pseudoxylaria threaten colony health through substrate competition with the termite fungus (Termitomyces). The potential mechanisms with which termites suppress Pseudoxylaria have remained unknown. Here we explore if Actinobacteria potentially play a role as defensive symbionts against Pseudoxylaria in fungus-growing termites. We sampled for Actinobacteria from 30 fungus-growing termite colonies, spanning the three main termite genera and two geographically distant sites. Our isolations yielded 360 Actinobacteria, from which we selected subsets for morphological (288 isolates, grouped in 44 morphotypes) and for 16S rRNA (35 isolates, spanning the majority of morphotypes) characterisation. Actinobacteria were found throughout all sampled nests and colony parts and, phylogenetically, they are interspersed with Actinobacteria from origins other than fungus-growing termites, indicating lack of specificity. Antibiotic-activity screening of 288 isolates against the fungal cultivar and competitor revealed that most of the Actinobacteria-produced molecules with antifungal activity. A more detailed bioassay on 53 isolates, to test the specificity of antibiotics, showed that many Actinobacteria inhibit both Pseudoxylaria and Termitomyces, and that the cultivar fungus generally is more susceptible to inhibition than the competitor. This suggests that either defensive symbionts are not present in the system or that they, if present, represent a subset of the community isolated. If so, the antibiotics must be used in a targeted fashion, being applied to specific areas by the termites. We describe the first discovery of an assembly of antibiotic-producing Actinobacteria occurring in fungus-growing termite nests. However, due to the diversity found, and the lack of both phylogenetic and bioactivity specificity, further work is necessary for a better understanding of the putative role of antibiotic-producing bacteria in the fungus-growing termite mutualistic system.

Zebrafish-Based Discovery of Antiseizure Compounds from the Red Sea: Pseurotin A2 and Azaspirofuran A.

PubMed

Copmans, Daniëlle; Rateb, Mostafa; Tabudravu, Jioji N; Pérez-Bonilla, Mercedes; Dirkx, Nina; Vallorani, Riccardo; Diaz, Caridad; Pérez Del Palacio, José; Smith, Alan J; Ebel, Rainer; Reyes, Fernando; Jaspars, Marcel; de Witte, Peter A M

2018-04-19

In search for novel antiseizure drugs (ASDs), the European FP7-funded PharmaSea project used zebrafish embryos and larvae as a drug discovery platform to screen marine natural products to identify promising antiseizure hits in vivo for further development. Within the framework of this project, seven known heterospirocyclic γ-lactams, namely, pseurotin A, pseurotin A 2 , pseurotin F1, 11- O-methylpseurotin A, pseurotin D, azaspirofuran A, and azaspirofuran B, were isolated from the bioactive marine fungus Aspergillus fumigatus, and their antiseizure activity was evaluated in the larval zebrafish pentylenetetrazole (PTZ) seizure model. Pseurotin A 2 and azaspirofuran A were identified as antiseizure hits, while their close chemical analogues were inactive. Besides, electrophysiological analysis from the zebrafish midbrain demonstrated that pseurotin A 2 and azaspirofuran A also ameliorate PTZ-induced epileptiform discharges. Next, to determine whether these findings translate to mammalians, both compounds were analyzed in the mouse 6 Hz (44 mA) psychomotor seizure model. They lowered the seizure duration dose-dependently, thereby confirming their antiseizure properties and suggesting activity against drug-resistant seizures. Finally, in a thorough ADMET assessment, pseurotin A 2 and azaspirofuran A were found to be drug-like. Based on the prominent antiseizure activity in both species and the drug-likeness, we propose pseurotin A 2 and azaspirofuran A as lead compounds that are worth further investigation for the treatment of epileptic seizures. This study not only provides the first evidence of antiseizure activity of pseurotins and azaspirofurans, but also demonstrates the value of the zebrafish model in (marine) natural product drug discovery in general, and for ASD discovery in particular.

Mn(II) oxidation by an ascomycete fungus is linked to superoxide production during asexual reproduction

PubMed Central

Hansel, Colleen M.; Zeiner, Carolyn A.; Santelli, Cara M.; Webb, Samuel M.

2012-01-01

Manganese (Mn) oxides are among the most reactive minerals within the environment, where they control the bioavailability of carbon, nutrients, and numerous metals. Although the ability of microorganisms to oxidize Mn(II) to Mn(III/IV) oxides is scattered throughout the bacterial and fungal domains of life, the mechanism and physiological basis for Mn(II) oxidation remains an enigma. Here, we use a combination of compound-specific chemical assays, microspectroscopy, and electron microscopy to show that a common Ascomycete filamentous fungus, Stilbella aciculosa, oxidizes Mn(II) to Mn oxides by producing extracellular superoxide during cell differentiation. The reactive Mn oxide phase birnessite and the reactive oxygen species superoxide and hydrogen peroxide are colocalized at the base of asexual reproductive structures. Mn oxide formation is not observed in the presence of superoxide scavengers (e.g., Cu) and inhibitors of NADPH oxidases (e.g., diphenylene iodonium chloride), enzymes responsible for superoxide production and cell differentiation in fungi. Considering the recent identification of Mn(II) oxidation by NADH oxidase-based superoxide production by a common marine bacterium (Roseobacter sp.), these results introduce a surprising homology between some prokaryotic and eukaryotic organisms in the mechanisms responsible for Mn(II) oxidation, where oxidation appears to be a side reaction of extracellular superoxide production. Given the versatility of superoxide as a redox reactant and the widespread ability of fungi to produce superoxide, this microbial extracellular superoxide production may play a central role in the cycling and bioavailability of metals (e.g., Hg, Fe, Mn) and carbon in natural systems. PMID:22802654

Mn(II) oxidation by an ascomycete fungus is linked to superoxide production during asexual reproduction.

PubMed

Hansel, Colleen M; Zeiner, Carolyn A; Santelli, Cara M; Webb, Samuel M

2012-07-31

Manganese (Mn) oxides are among the most reactive minerals within the environment, where they control the bioavailability of carbon, nutrients, and numerous metals. Although the ability of microorganisms to oxidize Mn(II) to Mn(III/IV) oxides is scattered throughout the bacterial and fungal domains of life, the mechanism and physiological basis for Mn(II) oxidation remains an enigma. Here, we use a combination of compound-specific chemical assays, microspectroscopy, and electron microscopy to show that a common Ascomycete filamentous fungus, Stilbella aciculosa, oxidizes Mn(II) to Mn oxides by producing extracellular superoxide during cell differentiation. The reactive Mn oxide phase birnessite and the reactive oxygen species superoxide and hydrogen peroxide are colocalized at the base of asexual reproductive structures. Mn oxide formation is not observed in the presence of superoxide scavengers (e.g., Cu) and inhibitors of NADPH oxidases (e.g., diphenylene iodonium chloride), enzymes responsible for superoxide production and cell differentiation in fungi. Considering the recent identification of Mn(II) oxidation by NADH oxidase-based superoxide production by a common marine bacterium (Roseobacter sp.), these results introduce a surprising homology between some prokaryotic and eukaryotic organisms in the mechanisms responsible for Mn(II) oxidation, where oxidation appears to be a side reaction of extracellular superoxide production. Given the versatility of superoxide as a redox reactant and the widespread ability of fungi to produce superoxide, this microbial extracellular superoxide production may play a central role in the cycling and bioavailability of metals (e.g., Hg, Fe, Mn) and carbon in natural systems.

Biological activities of ophiobolin K and 6-epi-ophiobolin K produced by the endophytic fungus Aspergillus calidoustus

USDA-ARS?s Scientific Manuscript database

The endophytic fungus, Aspergillus calidoustus, was isolated from the plant species Acanthospermum australe (Asteraceae). A dichloromethane extract of the fungus displayed antifungal, antiprotozoal, and cytotoxic activities. Aspergillus calidoustus was identified using molecular, physiological and m...

Effects of Some Pesticides on the Growth of ARF18 and Its Pathogenicity to Heterodera glycines

PubMed Central

Kim, D. G.; Riggs, R. D.

1998-01-01

The effects of 22 pesticides on the mycelial growth and pathogenicity of the biocontrol fungus ARFI8 to Heterodera glycines were tested in vitro. The chemicals were added to agar at 10, 100, and 1,000 ppm a.i.; a block of agar containing the fungus was added to each test concentration; and fungal growth was measured. Subsequently, a block of the fungus on the pesticide-containing agar was used to determine the ability of the fungus to parasitize eggs of H. glycines. Aldicarb, bentazone, and chlorothalonil had little or no effect on fungal growth, whereas benomyl and thiophanate methyl completely inhibited growth of the fungus at 10 ppm. The relative insensitivity of ARF18 to certain pesticides would permit selected use of those pesticides with ARF18 in an integrated control program if the effects on the fungus in the field are similar to results from petri dish studies. PMID:19274211

Performance of Metarhizium anisopliae-treated foam in combination with Phytoseiulus longipes Evans on Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae).

PubMed

Azandémè Hounmalon, Ginette Y; Maniania, Nguya K; Niassy, Saliou; Fellous, Simon; Kreiter, Serge; Delétré, Emilie; Fiaboe, Komi K; Martin, Thibaud

2018-05-13

Tetranychus evansi (Te) is an exotic pest of solanaceous crops in Africa. The predatory mite Phytoseiulus longipes (Pl) and the fungus Metarhizium anisopliae (Ma), are potential biocontrol agents of Te. The present study investigated efficacy of fungus-treated foam placed above or below the third Te-infested tomato leaf. The persistence of fungus-treated foam and the performance of Pl with or without fungus-treated foam were evaluated. The fungus-treated foam was effective when Te infestation was below the third tomato leaf as no damage was recorded on all upper tomato leaves up to 30 days post-treatment. However, in the control treatments, the infestation increased considerably from 9±0.3% to 100±0% at 15 days post-treatment. The reuse of the fungus-treated foam at 15, 30 and 45 days post-treatment resulted in 19±1.4%, 25±1.2% and 54±2.1% respective infestation by Te. The fungus-treated foam and Pl alone are efficient, but there is no benefit to combinting both against Te. The fungus-treated foam is an effective method to optimize the use of Ma in screenhouse conditions. These two control agents could be integrated in an IPM strategy for crops protection. However, these results need to be confirmed in large field trials. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Microsatellite variability in the entomopathogenic fungus Paeciolomyces fumosoroseus: genetic diversity and population structure

USDA-ARS?s Scientific Manuscript database

The hyphomycete Paecilomyces fumosoroseus (Pfr) is a geographically widespread fungus capable of infecting various insect hosts. The fungus has been used for the biological control of several important insect pests of agriculture. However knowledge of the fungus’ genetic diversity and population str...

Metacridamides A and B from the biocontrol fungus metarhizium acridum

USDA-ARS?s Scientific Manuscript database

Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

Flavonoids from Ulex airensis and Ulex europaeus ssp. europaeus.

PubMed

Máximo, Patrícia; Lourenço, Ana; Feio, Sónia Savluchinske; Roseiro, José Carlos

2002-02-01

From the dichloromethane extract of Ulex airensis three new isoflavonoids, ulexin C (1), ulexin D (2), and 7-O-methylisolupalbigenin (3), were isolated and characterized by spectroscopic methods. Ulexin D (2) was also identified from the dichloromethane extract of Ulex europaeus ssp. europaeus. Together with these new metabolites, 18 compounds of previously known structures were isolated and identified from both species. The antifungal activity of these compounds was tested against Cladosporium cucumerinum by a bioautographic TLC assay.

Environmental Sustainability and Mold Hygiene in Buildings

PubMed Central

Ng, Tsz Wai; Lai, Ka Man

2018-01-01

Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management. PMID:29617339

Environmental Sustainability and Mold Hygiene in Buildings.

PubMed

Wu, Haoxiang; Ng, Tsz Wai; Wong, Jonathan Wc; Lai, Ka Man

2018-04-04

Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management.

Microbiological consequences of indoor composting.

PubMed

Naegele, A; Reboux, G; Vacheyrou, M; Valot, B; Millon, L; Roussel, S

2016-08-01

Recycling of organic waste appeals to more and more people. The aim of this study was to evaluate the microbiological contamination around organic waste bins at three distances over a 12-month period. Contamination near the customary trash of control households was evaluated at the beginning to ensure that there is no recruitment bias. Air samples using the MAS 100 impactor were carried out in 38 dwellings that do household waste composting and in 10 dwellings of controls. Collection of particles by CIP 10 rotating cup sampler and dust samples collected by electrostatic dust collector cloths were acquired in dwellings that do household waste composting. Samples were analyzed by culture and by real-time quantitative PCR. Information about dwelling characteristics and inhabitant practices was obtained by a standardized questionnaire. The genera most often isolated were Penicillium, Aspergillus, Cladosporium and Streptomyces. Near the organic waste bins, bioaerosol samples showed an increase of Acarus siro (P = 0.001). Sedimented dust analyses highlighted an increase of A. siro, Wallemia sebi, Aspergillus versicolor, and Cladosporium sphaerospermum concentrations after a 12-month survey compared to the beginning. Composting favors microorganism development over time, but does not seem to have an effect on the bioaerosol levels and the surface microbiota beyond 0.5 m from the waste bin. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Investigation on Indoor Air Pollution and Childhood Allergies in Households in Six Chinese Cities by Subjective Survey and Field Measurements

PubMed Central

Hu, Jinhua; Li, Nianping; Lv, Yang; Liu, Jing; Xie, Jingchao; Zhang, Huibo

2017-01-01

Greater attention is currently being paid to the relationship between indoor environment and childhood allergies, however, the lack of reliable data and the disparity among different areas hinders reliable assessment of the relationship. This study focuses on the effect of indoor pollution on Chinese schoolchildren and the relationship between specific household and health problems suffered. The epidemiological questionnaire survey and the field measurement of the indoor thermal environment and primary air pollutants including CO2, fine particulate matter (PM2.5), chemical pollutants and fungi were performed in six Chinese cities. A total of 912 questionnaires were eligible for statistical analyses and sixty houses with schoolchildren aged 9–12 were selected for field investigation. Compared with Chinese national standards, inappropriate indoor relative humidity (<30% or >70%), CO2 concentration exceeding 1000 ppm and high PM2.5 levels were found in some monitored houses. Di(2-ethylhexyl) phthalate (DEHP) and dibutyl phthalate (DBP) were the most frequently detected semi-volatile organic compounds (SVOCs) in house dust. Cladosporium, Aspergillus and Penicillium were detected in both indoor air and house dust. This study indicates that a thermal environment with CO2 exceeding 1000 ppm, DEHP and DBP exceeding 1000 μg/g, and high level of PM2.5, Cladosporium, Aspergillus and Penicillium increases the risk of children’s allergies. PMID:28850091

Investigation on Indoor Air Pollution and Childhood Allergies in Households in Six Chinese Cities by Subjective Survey and Field Measurements.

PubMed

Hu, Jinhua; Li, Nianping; Lv, Yang; Liu, Jing; Xie, Jingchao; Zhang, Huibo

2017-08-29

Greater attention is currently being paid to the relationship between indoor environment and childhood allergies, however, the lack of reliable data and the disparity among different areas hinders reliable assessment of the relationship. This study focuses on the effect of indoor pollution on Chinese schoolchildren and the relationship between specific household and health problems suffered. The epidemiological questionnaire survey and the field measurement of the indoor thermal environment and primary air pollutants including CO₂, fine particulate matter (PM 2.5 ), chemical pollutants and fungi were performed in six Chinese cities. A total of 912 questionnaires were eligible for statistical analyses and sixty houses with schoolchildren aged 9-12 were selected for field investigation. Compared with Chinese national standards, inappropriate indoor relative humidity (<30% or >70%), CO₂ concentration exceeding 1000 ppm and high PM 2.5 levels were found in some monitored houses. Di(2-ethylhexyl) phthalate (DEHP) and dibutyl phthalate (DBP) were the most frequently detected semi-volatile organic compounds (SVOCs) in house dust. Cladosporium , Aspergillus and Penicillium were detected in both indoor air and house dust. This study indicates that a thermal environment with CO₂ exceeding 1000 ppm, DEHP and DBP exceeding 1000 μg/g, and high level of PM 2.5 , Cladosporium , Aspergillus and Penicillium increases the risk of children's allergies.

Microbial associates of the vine mealybug Planococcus ficus (Hemiptera: Pseudococcidae) under different rearing conditions.

PubMed

Iasur-Kruh, Lilach; Taha-Salaime, Leena; Robinson, Wyatt E; Sharon, Rakefet; Droby, Samir; Perlman, Steve J; Zchori-Fein, Einat

2015-01-01

Sap-feeding insects harbor diverse microbial endosymbionts that play important roles in host ecology and evolution, including contributing to host pest status. The vine mealybug, Planococcus ficus, is a serious pest of grapevines, vectoring a number of pathogenic grape viruses. Previous studies have shown that virus transmission is abolished when mealybugs are raised in the laboratory on potato. To examine the possible role of microbial symbionts in virus transmission, the archaeal, bacterial, and fungal microbiota of field and laboratory P. ficus were characterized using molecular and classical microbiological methods. Lab and field colonies of P. ficus harbored different microbiota. While both were dominated by the bacterial obligate nutritional symbionts Moranella and Tremblaya, field samples also harbored a third bacterium that was allied with cluster L, a lineage of bacterial symbionts previously identified in aphids. Archaea were not found in any of the samples. Fungal communities in field-collected mealybugs were dominated by Metschnikowia and Cladosporium species, while those from laboratory-reared mealybugs were dominated by Alternaria and Cladosporium species. In conclusion, this study has identified a diverse set of microbes, most of which appear to be facultatively associated with P. ficus, depending on environmental conditions. The role of various members of the mealybug microbiome, as well as how the host plant affects microbial community structure, remains to be determined.

The occurrence of molds in patients with chronic sinusitis.

PubMed

Twarużek, Magdalena; Soszczyńska, Ewelina; Winiarski, Piotr; Zwierz, Aleksander; Grajewski, Jan

2014-05-01

Chronic rhinosinusitis (CRS) is a common inflammatory condition of nasal and paranasal sinus mucosa. Although pathogenic bacteria were postulated as main etiological factor responsible for most cases of CRS, the involvement of molds was recently proved in some cases. The aim of the study was to conduct mycological analysis of material obtained from patients operated on due to chronic sinusitis. The study included 107 patients, 45 women and 62 men. During the surgery, a fragment of mucosa from the region of the ethmoid bulla was obtained as microbiological characteristics of this material closely resemble those of sinus mucosa. In addition, maxillary sinus lavage was obtained. The control group comprised patients without chronic sinusitis. The dithiothreitol solution method was used for the lavage examination. The tissue material (mucosal fragment from the region of the ethmoid bulla) was incubated in 2% liquid Sabouraud medium for 24 h. The material was inoculated onto culture media. The presence of molds was detected in 67% of examined samples. Overall, 41 species belonging to 12 genera were isolated. The most frequently detected genera included Penicillium spp. (46%) and Aspergillus spp. (16%). In addition, Cladosporium spp. (11%), Fusarium spp. (7%), Acremonium spp. (4%), Eurotium spp. (4%), Alternaria spp. (2%), Chaetomium spp. (1%), Geotrichum spp. (1%), Verticillium spp. (1%), Rhizopus spp. (1%), and some unidentified colonies (5%) were isolated. Penicillium crustosum, Penicillium citrinum, Aspergillus niger, Cladosporium cladosporioides, and Fusarium verticillioides were the most prevalent species.

Bioconversion of straw into improved fodder: fungal flora decomposing rice straw.

PubMed

Helal, G A

2005-09-01

The fungal flora decomposing rice straw were investigated all over the soil of Sharkia Province, east of Nile Delta, Egypt, using the nylon net bag technique. Sixty-four straw-decomposing species belonging to 30 genera were isolated by the dilution plate method in ground rice straw-Czapek's agar medium at pH 6. The plates were incubated separately at 5℃, 25℃ and 45℃, respectively. Twenty nine species belonging to 14 genera were isolated at 5℃. The most frequent genus was Penicillium (seven species), and the next frequent genera were Acremonium (three species), Fusarium (three species), Alternaria, Chaetomium, Cladosporium, Mucor, Stachybotrys (two species) and Rhizopus stolonifer. At 25℃, 47 species belonging to 24 genera were isolated. The most frequent genus was Aspergillus (nine species), and the next frequent genera were ranked by Penicillium (five species), Chaetomium (three species), Fusarium (three species). Each of Alternaria, Cladosporium, Mucor, Myrothecium and Trichoderma was represented by two species. At 45℃, 15 species belonging to seven genera were isolated. These were seven species of Aspergillus, two species of Chaetomium and two species of Emericella, while Humicola, Malbranchea, Rhizomucor and Talaromyces were represented by one species respectively. The total counts of fungi the genera, and species per gram of dry straw were significantly affected by incubation temperature and soil analysis (P < 0.05).

RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola

USDA-ARS?s Scientific Manuscript database

The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers’ symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop ...

Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fungus

USDA-ARS?s Scientific Manuscript database

Eighty years ago, Alexander Fleming described the antibiotic effects of a fungus that had contaminated his bacterial culture, kick starting the antimicrobial revolution. The fungus was later ascribed to a globally distributed asexual species, Penicillium chrysogenum. Recently, the species has been...

Mating and Progeny Isolation in The Corn Smut Fungus Ustilago maydis

USDA-ARS?s Scientific Manuscript database

The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos, Mims and Blackwell, 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cy...

Chronicles of Fibroporia radiculosa (= Antrodia radiculosa) TFFH 294

Treesearch

Carol A. Clausen; Katie M. Jenkins

2011-01-01

The brown-rot fungus, Fibroporia radiculosa, has been included in numerous research studies because many isolates of this fungus demonstrate an unusually high tolerance to copper. This fungus has undergone several recognized changes in taxonomic nomenclature, and through DNA technology, scientists have correctly identified isolates that had been misidentified...

Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus

Treesearch

Bryn H. Daisy; Gary A. Strobel; Uvidelio Castillo; David Ezra; Joe Sears; David K. Weaver; Justin B. Runyon

2002-01-01

Muscodor vitigenus is a recently described endophytic fungus of Paullinia paullinioides, a liana growing in the understorey of the rainforests of the Peruvian Amazon. This fungus produces naphthalene under certain cultural conditions. Naphthalene produced by M. vitigenus was identified by gas chromatography/mass...

Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

PubMed

Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

2015-09-01

A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

Specific, non-nutritional association between an ascomycete fungus and Allomerus plant-ants.

PubMed

Ruiz-González, Mario X; Malé, Pierre-Jean G; Leroy, Céline; Dejean, Alain; Gryta, Hervé; Jargeat, Patricia; Quilichini, Angélique; Orivel, Jérôme

2011-06-23

Ant-fungus associations are well known from attine ants, whose nutrition is based on a symbiosis with basidiomycete fungi. Otherwise, only a few non-nutritional ant-fungus associations have been recorded to date. Here we focus on one of these associations involving Allomerus plant-ants that build galleried structures on their myrmecophytic hosts in order to ambush prey. We show that this association is not opportunistic because the ants select from a monophyletic group of closely related fungal haplotypes of an ascomycete species from the order Chaetothyriales that consistently grows on and has been isolated from the galleries. Both the ants' behaviour and an analysis of the genetic population structure of the ants and the fungus argue for host specificity in this interaction. The ants' behaviour reveals a major investment in manipulating, growing and cleaning the fungus. A molecular analysis of the fungus demonstrates the widespread occurrence of one haplotype and many other haplotypes with a lower occurrence, as well as significant variation in the presence of these fungal haplotypes between areas and ant species. Altogether, these results suggest that such an interaction might represent an as-yet undescribed type of specific association between ants and fungus in which the ants cultivate fungal mycelia to strengthen their hunting galleries.

Pathogenic nature of Syncephalastrum in Atta sexdens rubropilosa fungus gardens.

PubMed

Barcoto, Mariana O; Pedrosa, Felipe; Bueno, Odair C; Rodrigues, Andre

2017-05-01

Leaf-cutter ants are considered to be a major herbivore and agricultural pest in the Neotropics. They are often controlled by environmentally persistent insecticides. Biological control using pathogenic fungi is regarded as an alternative for the management of these insects. Here, we assess whether the filamentous fungus Syncephalastrum sp. is a pathogenic microorganism responsible for a characteristic disease in fungus gardens. We also characterise the damage caused by this fungus by evaluating physiological and behavioural responses of Atta sexdens rubropilosa subcolonies infected with Syncephalastrum sp. Syncephalastrum sp. fulfils Koch's postulates characterising it as a pathogenic microorganism. Ant workers recognise the infection and remove contaminated fragments from the fungus garden. Syncephalastrum sp. infection causes an interruption of foraging activity, an increase in ant mortality, subcolony deterioration and an increase in the amount of waste generated, all resulting in subcolony death. Syncephalastrum sp. also inhibits the ant fungal cultivar in vitro. The pathogenic effect of Syncephalastrum sp. does not depend on host morbidity or stress (e.g. worker mortality caused by an entomopathogenic fungus). Syncephalastrum sp. treatment resulted in progressive damage in subcolonies. The interactions among Syncephalastrum sp., fungus garden and ants offer new opportunities in integrated pest management of leaf-cutter ants. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Biological control of cyathostomin (Nematoda: Cyathostominae) with nematophagous fungus Monacrosporium thaumasium in tropical southeastern Brazil.

PubMed

Tavela, Alexandre de Oliveira; Araújo, Jackson Victor; Braga, Fábio Ribeiro; Silva, André Ricardo; Carvalho, Rogério Oliva; Araujo, Juliana Milani; Ferreira, Sebastião Rodrigo; Carvalho, Giovanni Ribeiro

2011-01-10

Horses are hosts to a wide variety of helminthes; the most important are the cyathostomin, or small strongyles. The viability of a fungal formulation (pellets) using the nematode-trapping fungus Monacrosporium thaumasium was assessed in biological control of horse cyathostomin. Two groups (fungus-treated and control) consisted of six mares in each group, crossbred (ages of 2.5 and 3.5 years), were placed in pastures of Cynodon sp. naturally infected with horse cyathostomin larvae. In the treated group, each animal received 1g/10 kg body weight (0.2g/10 kg live weight of fungus) of pellets of sodium alginate matrix containing the fungus M. thaumasium orally, twice a week for 6 months. In the control group, animals received (1g/10 kg body weight) of pellets without fungus. The egg count per gram of feces showed difference (p<0.01) in the animals treated with the fungus in relation to the control animals during all months of the experiment. The EPG percentage decrease were 87.5%, 89.7%, 68.3%, 58.7%, 52.5% and 35.2% during June, July, August, September, October and November, respectively. In faecal cultures, there was difference (p<0.05) among animals treated with fungus was found in relation to the control animals during all the experiment month, with percentage reduction of 67.5%, 61.4% and 31.8% in September, October and November, respectively. Difference (p<0.01) was observed in the recovery of infective larvae from pastures that were collected up to 20 cm from the dung pats in pastures in the group treated with the fungus in relation to the control group with a reduction of 60.9% and between 0-20 and 0-40 cm from the faecal pat reduction (p<0.01) was about 56% in the group treated with the fungus M. thaumasium in relation to the control group pasture. There was no difference (p>0.05) between the average weight gains in both animal groups. The treatment of horses with pellets containing the nematophagous fungus M. thaumasium can be effective in controlling cyathostomin in the tropical region of southeastern Brazil. Copyright © 2010 Elsevier B.V. All rights reserved.

The Marine Fungal Metabolite, Dicitrinone B, Induces A375 Cell Apoptosis through the ROS-Related Caspase Pathway

PubMed Central

Chen, Li; Gong, Mei-Wei; Peng, Zhen-Fei; Zhou, Tong; Ying, Min-Gang; Zheng, Qiu-Hong; Liu, Qin-Ying; Zhang, Qi-Qing

2014-01-01

Dicitrinone B, a rare carbon-bridged citrinin dimer, was isolated from the marine-derived fungus, Penicillium citrinum. It was reported to have antitumor effects on tumor cells previously; however, the details of the mechanism remain unclear. In this study, we found that dicitrinone B inhibited the proliferation of multiple tumor types. Among them, the human malignant melanoma cell, A375, was confirmed to be the most sensitive. Morphologic evaluation, cell cycle arrest and apoptosis rate analysis results showed that dicitrinone B significantly induced A375 cell apoptosis. Subsequent observation of reactive oxygen species (ROS) accumulation and mitochondrial membrane potential (MMP) reduction revealed that the apoptosis induced by dicitrinone B may be triggered by over-producing ROS. Further studies indicated that the apoptosis was associated with both intrinsic and extrinsic apoptosis pathways under the regulation of Bcl-2 family proteins. Caspase-9, caspase-8 and caspase-3 were activated during the process, leading to PARP cleavage. The pan-caspase inhibitor, Z-VAD-FMK, could reverse dicitrinone B-induced apoptosis, suggesting that it is a caspase-dependent pathway. Our data for the first time showed that dicitrinone B inhibits the proliferation of tumor cells by inducing cell apoptosis. Moreover, compared with the first-line chemotherapy drug, 5-fluorouracil (5-Fu), dicitrinone B showed much more potent anticancer efficacy, suggesting that it might serve as a potential antitumor agent. PMID:24699111

Establishing the Secondary Metabolite Profile of the Marine Fungus: Tolypocladium geodes sp. MF458 and Subsequent Optimisation of Bioactive Secondary Metabolite Production

PubMed Central

Kebede, Bethlehem; Wrigley, Stephen K.; Prashar, Anjali; Rahlff, Janina; Wolf, Markus; Reinshagen, Jeanette; Gribbon, Philip; Imhoff, Johannes F.; Silber, Johanna; Labes, Antje; Ellinger, Bernhard

2017-01-01

As part of an international research project, the marine fungal strain collection of the Helmholtz Centre for Ocean Research (GEOMAR) research centre was analysed for secondary metabolite profiles associated with anticancer activity. Strain MF458 was identified as Tolypocladium geodes, by internal transcribed spacer region (ITS) sequence similarity and its natural product production profile. By using five different media in two conditions and two time points, we were able to identify eight natural products produced by MF458. As well as cyclosporin A (1), efrapeptin D (2), pyridoxatin (3), terricolin A (4), malettinins B and E (5 and 6), and tolypocladenols A1/A2 (8), we identified a new secondary metabolite which we termed tolypocladenol C (7). All compounds were analysed for their anticancer potential using a selection of the NCI60 cancer cell line panel, with malettinins B and E (5 and 6) being the most promising candidates. In order to obtain sufficient quantities of these compounds to start preclinical development, their production was transferred from a static flask culture to a stirred tank reactor, and fermentation medium development resulted in a nearly eight-fold increase in compound production. The strain MF458 is therefore a producer of a number of interesting and new secondary metabolites and their production levels can be readily improved to achieve higher yields. PMID:28333084

Anatomically and morphologically unique dark septate endophytic association in the roots of the Mediterranean endemic seagrass Posidonia oceanica.

PubMed

Vohník, Martin; Borovec, Ondřej; Župan, Ivan; Vondrášek, David; Petrtýl, Miloslav; Sudová, Radka

2015-11-01

Roots of terrestrial plants host a wide spectrum of soil fungi that form various parasitic, neutral and mutualistic associations. A similar trend is evident in freshwater aquatic plants and plants inhabiting salt marshes or mangroves. Marine vascular plants (seagrasses), by contrast, seem to lack specific root-fungus symbioses. We examined roots of two Mediterranean seagrasses, Posidonia oceanica and Cymodocea nodosa, in the northwestern Mediterranean Sea for fungal colonization using light and scanning and transmission electron microscopy. We found that P. oceanica, but not C. nodosa, is regularly associated with melanized septate hyphae in a manner resembling colonization by the ubiquitous dark septate endophytes (DSE) in roots of most terrestrial plants. P. oceanica roots were found to be colonized by sparse dematiaceous running hyphae as well as dense parenchymatous nets/hyphal sheaths on the root surface, intracellular melanized microsclerotia and occasionally also intra- and intercellular hyphae. The colonization was most prominent in the thick-walled hypodermis of the thinnest healthy looking roots, and the mycobiont seemed to colonize both living and dead host cells. Dark septate hyphae infrequently occurred also inside rhizodermal cells, but never colonized vascular tissues. The biological significance of this overlooked marine symbiosis remains unknown, but its morphology, extent, distribution across the NW Mediterranean Sea and absence in C. nodosa indicate an intriguing relationship between the dominant Mediterranean seagrass and its dark septate root mycobionts.

Screening and production of ligninolytic enzyme by a marine-derived fungal Pestalotiopsis sp. J63.

PubMed

Chen, Hui-Ying; Xue, Dong-Sheng; Feng, Xiao-Yu; Yao, Shan-Jing

2011-12-01

Marine-derived fungi are prone to produce structurally unique secondary metabolites, a considerable number of which display the promising biological properties and/or industrial applications. Among those, ligninolytic enzymes have attracted great interest in recent years. In this work, about 20 strains were isolated from sea mud samples collected in the East China Sea and then screened for their capacity to produce lignin-degrading enzymes. The results showed that a strain, named J63, had a great potential to secrete a considerable amount of laccase. Using molecular method, it was identified as an endophytic fungus, Pestalotiopsis sp. which was rarely reported as ligninolytic enzyme producer in the literature. The production of laccase by Pestalotiopsis sp. J63 was investigated under submerged fermentation (SF) and solid state fermentation (SSF) with various lignocellulosic by-products as substrates. The SSF of rice straw powder accumulated the highest level of laccase activity (10,700 IU/g substrate), whereas the SF of untreated sugarcane bagasse provided the maximum amount of laccase activity (2,000 IU/ml). The value was far higher than those reported by other reports. In addition, it produced 0.11 U/ml cellulase when alkaline-pretreated sugarcane bagasse was used as growth substrate under SF. Meanwhile, the growth of fungi and laccase production under different salinity conditions were also studied. It appeared to be a moderately halo-tolerant organism.

First Total Syntheses and Antimicrobial Evaluation of Penicimonoterpene, a Marine-Derived Monoterpenoid, and Its Various Derivatives

PubMed Central

Zhao, Jian-Chun; Li, Xiao-Ming; Gloer, James B.; Wang, Bin-Gui

2014-01-01

The first total synthesis of marine-derived penicimonoterpene (±)-1 has been achieved in four steps from 6-methylhept-5-en-2-one using a Reformatsky reaction as the key step to construct the basic carbon skeleton. A total of 24 new derivatives of 1 have also been designed and synthesized. Their structures were characterized by analysis of their 1H NMR, 13C NMR and HRESIMS data. Some of them showed significant antibacterial activity against Aeromonas hydrophila, Escherichia coli, Micrococcus luteus, Staphylococcus aureus, Vibrio anguillarum, V. harveyi and/or V. parahaemolyticus, and some showed activity against plant-pathogenic fungi (Alternaria brassicae, Colletotrichum gloeosporioides and/or Fusarium graminearum). Some of the derivatives exhibited antimicrobial MIC values ranging from 0.25 to 4 μg/mL, which were stronger than those of the positive control. Notably, Compounds 3b and 10 showed extremely high selectively against plant-pathogenic fungus F. graminearum (MIC 0.25 μg/mL) and pathogenic bacteria E. coli (MIC 1 μg/mL), implying their potential as antimicrobial agents. SAR analysis of 1 and its derivatives indicated that modification of the carbon-carbon double bond at C-6/7, of groups on the allylic methylene unit and of the carbonyl group at C-1, effectively enhanced the antimicrobial activity. PMID:24897384

Biochemical Characterization of Fungus Isolated during In vitro Propagation of Bambusa balcooa.

PubMed

Tyagi, Bhawna; Tewari, Salil; Dubey, Ashutosh

2018-01-01

Bambusa balcooa ( Poaceae: Bambusoideae ) is a multipurpose bamboo species, which is native of the Indian subcontinent. B. balcooa is regarded as one of the best species for scaffolding and building purposes because of its strong culm. Other uses include paper pulp, handicrafts, and products of the wood chip industry. Due to these various uses in industries, this species has been identified as one of the priority bamboos by the National Bamboo Mission. This study is designed to analyze the identification of fungus and develop the strategy to eliminate the contamination during in vitro establishment of B. balcooa through nodal part. Fungus contamination is a problem which is encountered during in vitro establishment of B. balcooa cultures. In the present study, fungus contamination from in vitro cultured plant has been isolated and subjected to partial sequence analysis of the 18S rRNA gene to identify the fungus strain. Experiments were designed to develop a strategy for removal of the fungus contamination with the help of antifungal compounds and commercial antimicrobial supplement supplied by HiMedia. Fusarium equiseti was identified as endophytic fungus. It was observed that antimicrobial supplement at concentration of 500 μl/l was more effective concentration to remove fungus contamination and not showed any detrimental effect on growth parameters of shoot. This experiment would help in identification and to get rid of fungal contamination and improve the in vitro establishment of B. balcooa cultures for large-scale propagation. Endogenous fungus was isolated from contaminated culture of B. balcooa , and it was identified as Fusarium equiseti and submitted to NCBI under accession no. KP274872. The endophytic fungus had shown substantial production of amylase, cellulase, and protease media. Gibberellic acid (GA 3 ) production by F. equiseti was maximum on the 7 th day on inoculation. Abbreviations used: B. balcooa : Bambusa balcooa , F. equiseti : Fusarium equiseti , PDA: Potato dextrose agar, PCR: Polymerase chain reaction, MS: Murashige and Skoog's, BAP: 6-Benzylaminopurine, ITS1/4: Internal transcribed spacer region 1/4, GA 3 : Gibberellic acid.

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae)

PubMed Central

2014-01-01

Background Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Methods Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Results Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12–17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18–23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). Conclusions The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month. PMID:24766705

Monitoring persistence of the entomopathogenic fungus Metarhizium anisopliae under simulated field conditions with the aim of controlling adult Aedes aegypti (Diptera: Culicidae).

PubMed

Carolino, Aline T; Paula, Adriano R; Silva, Carlos P; Butt, Tariq M; Samuels, Richard I

2014-04-25

Entomopathogenic fungi are potential candidates for use in integrated vector management, with recent emphasis aimed at developing adult mosquito control methods. Here we investigated the persistence of the fungus Metarhizium anisopliae when tested against female A. aegypti under field conditions. Black cotton cloths impregnated with M. anisopliae conidia, formulated in vegetable oil + isoparaffin, were maintained on a covered veranda for up to 30 days. At specific times, pieces of the cloths were removed, placed in Tween 80 and the resuspended conidia were sprayed directly onto mosquitoes. The persistence of conidia impregnated on black cloths using three different carriers was evaluated in test rooms. Fifty mosquitoes were released into each room and after a 5 day period, the surviving insects were captured. Another 50 insects were then released into each room. The capacity of the fungus at reducing mosquito survival was evaluated over a total of 35 days. Conidia extracted from cloths maintained on the veranda for 2 to 18 days remained virulent, with 28 to 60% mosquito survival observed. Mosquito survival following exposure to fungus impregnated cloths showed that fungus + Tween caused similar reductions to that of fungus + vegetable oil. Mosquitoes exposed to the formulation fungus + vegetable oil had survival rates of 36% over the first 5 days of the experiment. Following the release of the second cohort of mosquitoes (6-11days), survival increased to 50%. The survival of the 12-17 day cohort (78%) was statistically equal to that of the controls (84%). Formulation of the fungus in vegetable oil + isoparaffin increased the persistence of the fungus, with the 18-23 day cohort (64% survival) still showing statistical differences to that of the controls (87% survival). The potential of entomopathogenic fungi for the control of adult A. aegypti was confirmed under field conditions. Vegetable oil + isoparaffin formulations of M. anisopliae significantly increased the effectiveness of the fungus, thus reducing the need for frequent changes of black cloths in residences. Our future aim is to obtain effective control of mosquito populations, with cloths only needing to being replaced once a month.

Leaf-Cutter Ant Fungus Gardens Are Biphasic Mixed Microbial Bioreactors That Convert Plant Biomass to Polyols with Biotechnological Applications

PubMed Central

Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.

2015-01-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490

Leaf-cutter ant fungus gardens are biphasic mixed microbial bioreactors that convert plant biomass to polyols with biotechnological applications.

PubMed

Somera, Alexandre F; Lima, Adriel M; Dos Santos-Neto, Álvaro J; Lanças, Fernando M; Bacci, Maurício

2015-07-01

Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Phomalactone from a phytopathogenic fungus infecting Zinnia elegans (Asteraceae) leaves

USDA-ARS?s Scientific Manuscript database

Zinnia elegans plants are infected by a fungus that causes necrosis with dark red spots particularly in late spring to the middle of summer in the Mid-South part of the United States. This fungal disease when untreated causes the leaves to wilt and eventually kills the plant. The fungus was isolated...

White-Nose Syndrome Fungus in a 1918 Bat Specimen from France.

PubMed

Campana, Michael G; Kurata, Naoko P; Foster, Jeffrey T; Helgen, Lauren E; Reeder, DeeAnn M; Fleischer, Robert C; Helgen, Kristofer M

2017-09-01

White-nose syndrome, first diagnosed in North America in 2006, causes mass deaths among bats in North America. We found the causative fungus, Pseudogymnoascus destructans, in a 1918 sample collected in Europe, where bats have now adapted to the fungus. These results are consistent with a Eurasian origin of the pathogen.

Contents and Structure Atta texana Nest in Summer

Treesearch

John C. Moser

1963-01-01

A large nest of Atta texana (Buckley) in central Louisiana was partially excavated in August 1960. Twelve dormancy, 5 detritus, and 93 fungus-garden cavities were found. Fungus-garden cavities near the surface outnumbered those at lower depths and contained most of the fungus material and brood. Inquilines were most numerous in detritus cavities....

Complete Genome of Enterobacteriaceae Bacterium Strain FGI 57, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Bruce, David C.; Chain, Patrick; Chen, Amy; Walston Davenport, Karen; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

The Enterobacteriaceae bacterium strain FGI 57 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its single 4.76-Mbp chromosome will shed light on community dynamics and plant biomass degradation in ant fungus gardens. PMID:23469353

Complete Genome of Serratia sp. Strain FGI 94, a Strain Associated with Leaf-Cutter Ant Fungus Gardens

PubMed Central

Aylward, Frank O.; Tremmel, Daniel M.; Starrett, Gabriel J.; Bruce, David C.; Chain, Patrick; Chen, Amy; Davenport, Karen W.; Detter, Chris; Han, Cliff S.; Han, James; Huntemann, Marcel; Ivanova, Natalia N.; Kyrpides, Nikos C.; Markowitz, Victor; Mavrommatis, Kostas; Nolan, Matt; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Teshima, Hazuki; Deshpande, Shweta; Goodwin, Lynne; Woyke, Tanja

2013-01-01

Serratia sp. strain FGI 94 was isolated from a fungus garden of the leaf-cutter ant Atta colombica. Analysis of its 4.86-Mbp chromosome will help advance our knowledge of symbiotic interactions and plant biomass degradation in this ancient ant-fungus mutualism. PMID:23516234

Comparison of radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa forel in two culture media

PubMed Central

Miyashira, C.H.; Tanigushi, D.G.; Gugliotta, A.M.; Santos, D.Y.A.C.

2010-01-01

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier. PMID:24031524

Does co-inoculation of Lactuca serriola with endophytic and arbuscular mycorrhizal fungi improve plant growth in a polluted environment?

PubMed

Ważny, Rafał; Rozpądek, Piotr; Jędrzejczyk, Roman J; Śliwa, Marta; Stojakowska, Anna; Anielska, Teresa; Turnau, Katarzyna

2018-04-01

Phytoremediation of polluted sites can be improved by co-inoculation with mycorrhizal and endophytic fungi. In this study, the effects of single- and co-inoculation of Lactuca serriola with an arbuscular mycorrhizal (AM) fungus, Rhizoglomus intraradices, and endophytic fungi, Mucor sp. or Trichoderma asperellum, on plant growth, vitality, toxic metal accumulation, sesquiterpene lactone production and flavonoid concentration in the presence of toxic metals were evaluated. Inoculation with the AM fungus increased biomass yield of the plants grown on non-polluted and polluted substrate. Co-inoculation with the AM fungus and Mucor sp. resulted in increased biomass yield of plants cultivated on the polluted substrate, whereas co-inoculation with T. asperellum and the AM fungus increased plant biomass on the non-polluted substrate. In the presence of Mucor sp., mycorrhizal colonization and arbuscule richness were increased in the non-polluted substrate. Co-inoculation with the AM fungus and Mucor sp. increased Zn concentration in leaves and roots. The concentration of sesquiterpene lactones in plant leaves was decreased by AM fungus inoculation in both substrates. Despite enhanced host plant costs caused by maintaining symbiosis with numerous microorganisms, interaction of wild lettuce with both mycorrhizal and endophytic fungi was more beneficial than that with a single fungus. The study shows the potential of double inoculation in unfavourable environments, including agricultural areas and toxic metal-polluted areas.

The Dynamics of Plant Cell-Wall Polysaccharide Decomposition in Leaf-Cutting Ant Fungus Gardens

PubMed Central

Harholt, Jesper; Willats, William G. T.; Boomsma, Jacobus J.

2011-01-01

The degradation of live plant biomass in fungus gardens of leaf-cutting ants is poorly characterised but fundamental for understanding the mutual advantages and efficiency of this obligate nutritional symbiosis. Controversies about the extent to which the garden-symbiont Leucocoprinus gongylophorus degrades cellulose have hampered our understanding of the selection forces that induced large scale herbivory and of the ensuing ecological footprint of these ants. Here we use a recently established technique, based on polysaccharide microarrays probed with antibodies and carbohydrate binding modules, to map the occurrence of cell wall polymers in consecutive sections of the fungus garden of the leaf-cutting ant Acromyrmex echinatior. We show that pectin, xyloglucan and some xylan epitopes are degraded, whereas more highly substituted xylan and cellulose epitopes remain as residuals in the waste material that the ants remove from their fungus garden. These results demonstrate that biomass entering leaf-cutting ant fungus gardens is only partially utilized and explain why disproportionally large amounts of plant material are needed to sustain colony growth. They also explain why substantial communities of microbial and invertebrate symbionts have evolved associations with the dump material from leaf-cutting ant nests, to exploit decomposition niches that the ant garden-fungus does not utilize. Our approach thus provides detailed insight into the nutritional benefits and shortcomings associated with fungus-farming in ants. PMID:21423735

Fungus-Specific Sirtuin HstD Coordinates Secondary Metabolism and Development through Control of LaeA

PubMed Central

Kawauchi, Moriyuki; Nishiura, Mika

2013-01-01

The sirtuins are members of the NAD+-dependent histone deacetylase family that contribute to various cellular functions that affect aging, disease, and cancer development in metazoans. However, the physiological roles of the fungus-specific sirtuin family are still poorly understood. Here, we determined a novel function of the fungus-specific sirtuin HstD/Aspergillus oryzae Hst4 (AoHst4), which is a homolog of Hst4 in A. oryzae yeast. The deletion of all histone deacetylases in A. oryzae demonstrated that the fungus-specific sirtuin HstD/AoHst4 is required for the coordination of fungal development and secondary metabolite production. We also show that the expression of the laeA gene, which is the most studied fungus-specific coordinator for the regulation of secondary metabolism and fungal development, was induced in a ΔhstD strain. Genetic interaction analysis of hstD/Aohst4 and laeA clearly indicated that HstD/AoHst4 works upstream of LaeA to coordinate secondary metabolism and fungal development. The hstD/Aohst4 and laeA genes are fungus specific but conserved in the vast family of filamentous fungi. Thus, we conclude that the fungus-specific sirtuin HstD/AoHst4 coordinates fungal development and secondary metabolism via the regulation of LaeA in filamentous fungi. PMID:23729383

Biological control of Ascaris suum eggs by Pochonia chlamydosporia fungus.

PubMed

Ferreira, Sebastião Rodrigo; de Araújo, Jackson Victor; Braga, Fábio Ribeiro; Araujo, Juliana Milani; Frassy, Luiza Neme; Ferreira, Aloízio Soares

2011-12-01

Ascaris suum is a gastrointestinal nematode parasite of swines. The aim of this study was to observe Pochonia chlamydosporia fungus on biological control of A. suum eggs after fungus passage through swines gastrointestinal tract. Eighteen pigs, previously dewormed, were randomly divided into three groups: group 1, treated with the fungus isolate VC4; group 2, treated with the fungus isolate VC1 and group 3 did not receive fungus (control). In the treated groups, each animal received a 9 g single dose of mycelium mass containing P. chlamydosporia (VC1 or VC4). Thereafter, animal fecal samples were collected at the following intervals: 8, 12, 24, 36, 48, 72 and 96 h after treatment beginning and these were poured in Petri dishes containing 2% water-agar culture medium. Then, 1,000 A. suum eggs were poured into each dish and kept in an incubator at 26 °C and in the dark for 30 days. After this period, approximately 100 eggs were removed from each Petri dish and morphologically analyzed under light microscopy following the ovicidal activity parameters. The higher percentage observed for isolated VC4 eggs destruction was 57.5% (36 h) after fungus administration and for isolate VC1 this percentage was 45.8% (24 h and 72 h) (p > 0.01). P. chlamydosporia remained viable after passing through the gastrointestinal tract of swines, maintaining its ability of destroying A. suum eggs.

The fungus gardens of leaf-cutter ants undergo a distinct physiological transition during biomass degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Eric L.; Aylward, Frank O.; Kim, Young-Mo

Leaf-cutter ants are dominant herbivores in ecosystems throughout the Neotropics. Rather than directly consuming the fresh foliar biomass they harvest, these ants use it to cultivate specialized fungus gardens. Although recent investigations have shed light on how plant biomass is degraded in fungus gardens, the cycling of nutrients that takes place in these specialized microbial ecosystems is still not well understood. Here, using metametabolomics and metaproteomics techniques, we examine the dynamics of nutrient turnover and biosynthesis in these gardens. Our results reveal that numerous free amino acids and sugars are depleted throughout the process of biomass degradation, indicating that easilymore » accessible nutrients from plant material are readily consumed by microbes in these ecosystems. Accumulation of cellobiose and lignin derivatives near the end of the degradation process is consistent with previous findings of cellulases and laccases produced by Leucoagaricus gongylophorus, the fungus cultivated by leaf-cutter ants. Our results also suggest that ureides may be an important source of nitrogen in fungus gardens, especially during nitrogen-limiting conditions. No free arginine was detected in our metametabolomics experiments despite evidence that the host ants cannot produce this amino acid, suggesting that biosynthesis of this metabolite may be tightly regulated in the fungus garden. These results provide new insights into the dynamics of nutrient cycling that underlie this important ant-fungus symbiosis.« less

Development of Army Fire-Resistant Diesel Fuel.

DTIC Science & Technology

1979-12-01

45 C C Service Station Fuel Semple 85 A 75B AB C C 95 95 Service Station Fuel Sample 8 00 A -7B\\ A -7s C Refiney Fu UNMODIFIED* MODIFIED* SURFACTANT...Change in Brake Power, % -11.2 Change in Brake Specific Volumetric Fuel Consumption, % +17.7 Change in Thermal Efficiency of Work Cycle, abs % - 1.6...and unmodified surfactant) 2. Cladosporium resinae . 3. ASTM mixed fungal spore inoculum (only with item A5 and with item A4 made with deionized water

Do novel genotypes drive the success of an invasive bark beetle–fungus complex? Implications for potential reinvasion

Treesearch

Min Lu; Michael J. Wingfield; Nancy Gillette; Jiang-Hua Sun

2011-01-01

Novel genotypes often arise during biological invasions, but their role in invasion success has rarely been elucidated. Here we examined the population genetics and behavior of the fungus, Leptographium procerum, vectored by a highly invasive bark beetle, Dendroctonus valens, to determine whether genetic changes in the fungus...

Association of the Pitch Canker Fungus with Cones and Seeds of Pines

Treesearch

L. David Dwinell

1998-01-01

The pitch canker fungus, Fusarium subglutinans f. sp.pini, causes the mortality of female flowers and mature cones, and can infect and destroy gametophyte tissues of seeds of several pine species in the southeastern U.S. The fungus can also be associated with the seed coats of apparently healthy, viable pine seeds. The pitch canker...

Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

ERIC Educational Resources Information Center

Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

1997-01-01

Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

Treesearch

Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

2018-01-01

Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

Mosquitocidal activity of a naturally occurring isochroman and synthetic analogs from the plant pathogenic fungus, Diaporthe eres against Aedes aegypti ( Diptera: Culicidae)

USDA-ARS?s Scientific Manuscript database

The culture filtrate of a plant pathogenic fungus that infects English ivy (Hegera helix) was investigated for mosquitocidal constituents by bioassay guided isolation. The fungus responsible for pathogenic effects on the plant Hegera helix has been identified as Diaporthe eres by molecular technique...

Reproduction of a woodwasp, Urocerus japonicus (Hymenoptera: Siricidae) using no maternal symbiotic fungus

Treesearch

Hideshi Fukuda

2003-01-01

Most woodwasps (Siricidae) are symbiotically associated with the specific fungus, Amylostereum spp. Female adults inoculate the fungus during their oviposition in sapwood of the host trees (Morgan 1968). Woodwasp larvae can digest sapwood with low nutritional quality with the aid of symbiosis (Kukor and Martin 1983). In the earlier study, we...

Using copper sulfate to control egg fungus at Keo Fish Farm

USDA-ARS?s Scientific Manuscript database

Keo Fish Farm is the biggest producer of hybrid striped bass fry in the world. The hatchery manager asked about treatments to control fungus on eggs which occurred fairly often. Our lab has been working on gaining FDA-approval to use copper sulfate to control fungus on catfish eggs, so we were con...

Mucormycosis (Mucor fungus ball) of the maxillary sinus.

PubMed

Cho, Hang Sun; Yang, Hoon Shik; Kim, Kyung Soo

2014-01-01

A fungus ball is an extramucosal fungal proliferation that completely fills one or more paranasal sinuses and usually occurs as a unilateral infection. It is mainly caused by Aspergillus spp in an immunocompetent host, but some cases of paranasal fungal balls reportedly have been caused by Mucor spp. A Mucor fungus ball is usually found in the maxillary sinus and/or the sphenoid sinus and may be black in color. Patients with mucormycosis, or a Mucor fungal ball infection, usually present with facial pain or headache. On computed tomography, there are no pathognomonic findings that are conclusive for a diagnosis of mucormycosis. In this article we report a case of mucormycosis in a 56-year-old woman and provide a comprehensive review of the literature on the "Mucor fungus ball." To the best of our knowledge, 5 case reports (8 patients) have been published in which the fungus ball was thought to be caused by Mucor spp.

Biosynthesis of size-controlled gold nanoparticles using fungus, Penicillium sp.

PubMed

Zhang, Xiaorong; He, Xiaoxiao; Wang, Kemin; Wang, Yonghong; Li, Huimin; Tan, Weihong

2009-10-01

The unique optoelectronic and physicochemical properties of gold nanoparticles are significantly dependent on the particle size, shape and structure. In this paper, biosynthesis of size-controlled gold nanoparticles using fungus Penicillium sp. is reported. Fungus Penicillium sp. could successfully bioreduce and nucleate AuCl4(-) ions, and lead to the assembly and formation of intracellular Au nanoparticles with spherical morphology and good monodispersity after exposure to HAuCl4 solution. Reaction temperature, as an important physiological parameter for fungus Penicillium sp. growth, could significantly control the size of the biosynthesized Au nanoparticles. The biological compositions and FTIR spectra analysis of fungus Penicillium sp. exposed to HAuCl4 solution indicated the intracellular reducing sugar played an important role in the occurrence of intracellular reduction of AuCl4(-) ions and the growth of gold nanoparticles. Furthermore, the intracellular gold nanoparticles could be easily separated from the fungal cell lysate by ultrasonication and centrifugation.

Chytrid fungus parasitizing the wild amphibian Leptodactylus ocellatus (Anura: Leptodactylidae) in Argentina.

PubMed

Herrera, Raúl A; Steciow, Mónica M; Natale, Guillermo S

2005-05-20

The present contribution is the first report of parasitosis by a chytrid fungus in wild anuran amphibians in Argentina, as well as the first case of amphibian mortality documented to date in Argentina. We report the presence of the chytrid fungus in dead adult Leptodactylus ocellatus. It has been suggested that chytridiomycosis is the main cause of death in several amphibian populations worldwide. Our study demonstrates that chytridiomycosis afflicts L. ocellatus, a common widespread amphibian species, and is the first report of chytridiomycosis in the Argentinian lowlands. The occurrence at this latitude would indicate an extended distribution of this fungus in wildlife populations. It is also the first report of amphibian mortality due to chytrid fungus in our country. It is noteworthy that the site of collection is situated very close to sea level in a temperate climate zone and that this represents the southern most record for South American wild amphibians.

Biodegradation of hazardous waste using white rot fungus: Project planning and concept development document

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luey, J.; Brouns, T.M.; Elliott, M.L.

1990-11-01

The white rot fungus Phanerochaete chrysosporium has been shown to effectively degrade pollutants such as trichlorophenol, polychlorinated biphenyls (PCBs), dioxins and other halogenated aromatic compounds. These refractory organic compounds and many others have been identified in the tank waste, groundwater and soil of various US Department of Energy (DOE) sites. The treatment of these refractory organic compounds has been identified as a high priority for DOE's Research, Development, Demonstration, Testing, and Evaluation (RDDT E) waste treatment programs. Unlike many bacteria, the white rot fungus P. chrysosporium is capable of degrading these types of refractory organics and may be valuable formore » the treatment of wastes containing multiple pollutants. The objectives of this project are to identify DOE waste problems amenable to white rot fungus treatment and to develop and demonstrate white rot fungus treatment process for these hazardous organic compounds. 32 refs., 6 figs., 7 tabs.« less

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica.

PubMed

Torii, Masato; Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-Ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-06-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven.

The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants

PubMed Central

Aylward, Frank O.; Currie, Cameron R.; Suen, Garret

2012-01-01

Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis. PMID:26467948

Deciphering the molecular mechanisms behind cellulase production in Trichoderma reesei, the hyper-cellulolytic filamentous fungus.

PubMed

Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru

2016-09-01

The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus.

Fungal decay resistance of wood reacted with phosphorus pentoxide-amine system

Treesearch

Hong-Lin Lee; George C. Chen; Roger M. Rowell

2004-01-01

Resistance of wood reacted in situ with phosphorus pentoxide-amine to the brown-rot fungus Gloeophyllum trabeum and white-rot fungus Trametes versicolor was examined. Wood reacted with either octyl, tribromo, or nitro derivatives were more resistant to both fungi. Threshold retention values of phosphoramide-reacted wood to white-rot fungus T. versicolor ranged from 2.9...

Serpula lacrymans, the dry rot fungus and tolerance towards copper-based wood preservatives

Treesearch

Anne Christine Steenkjaer Hastrup; Frederick Green; Carol Clausen; Bo Jensen

2005-01-01

Serpula lacrymans (Wulfen : Fries) Schröter, the dry rot fungus, is considered the most economically important wood decay fungus in temperate regions of the world i.e. northern Europe, Japan and Australia. Previously copper based wood preservatives were the most commonly used preservatives for pressure treatment of wood for building constructions. Because of a...

Arbuscular mycorrhizal fungus inoculation reduces the drought-resistance advantage of endophyte-infected versus endophyte-free Leymus chinensis.

PubMed

Liu, Hui; Chen, Wei; Wu, Man; Wu, Rihan; Zhou, Yong; Gao, Yubao; Ren, Anzhi

2017-11-01

Grasses can be infected simultaneously by endophytic fungi and arbuscular mycorrhizal (AM) fungi. In this study, we tested the hypothesis that endophyte-associated drought resistance of a native grass was affected by an AM fungus. In a greenhouse experiment, we compared the performance of endophyte-infected (EI) and endophyte-free (EF) Leymus chinensis, a dominant species native to the Inner Mongolia steppe, under altered water and AM fungus availability. The results showed that endophyte infection significantly increased drought resistance of the host grass, but the beneficial effects were reduced by AM fungus inoculation. In the mycorrhizal-non-inoculated (MF) treatment, EI plants accumulated significantly more biomass, had greater proline and total phenolic concentration, and lower malondialdehyde concentration than EF plants. In the mycorrhizal-inoculation (MI) treatment, however, no significant difference occurred in either growth or physiological characters measured between EI and EF plants. AM fungus inoculation enhanced drought resistance of EF plants but had no significant effect on drought resistance of EI plants, thus AM fungus inoculation reduced the difference between EI and EF plants. Our findings highlight the importance of interactions among multiple microorganisms for plant performance under drought stress.

Improving Efficacy of Beauveria bassiana against Stored Grain Beetles with a Synergistic Co-Formulant

PubMed Central

Storm, Clare; Scoates, Freya; Nunn, Adam; Potin, Olivier; Dillon, Aoife

2016-01-01

The potential of a dry powder co-formulant, kaolin, to improve the control of storage beetles by the entomopathogenic fungus Beauveria bassiana, isolate IMI389521, was investigated. The response of Oryzaephilus surinamensis adults to the fungus when applied to wheat at 1 × 1010 conidia per kg with and without kaolin at 1.74 g per kg wheat was assessed. Addition of kaolin increased control from 46% to 88% at day 7 and from 81% to 99% at day 14 post-treatment. Following this the dose response of O. surinamensis and Tribolium confusum to both kaolin and the fungus was investigated. Synergistic effects were evident against O. surinamensis at ≥0.96 g of kaolin per kg of wheat when combined with the fungus at all concentrations tested. For T. confusum, adult mortality did not exceed 55%, however, the larvae were extremely susceptible with almost complete suppression of adult emergence at the lowest fungal rate tested even without the addition of kaolin. Finally, the dose response of Sitophilus granarius to the fungus at 15 and 25 °C, with and without kaolin at 1 g per kg of wheat, was examined. Improvements in efficacy were achieved by including kaolin at every fungal rate tested and by increasing the temperature. Kaolin by itself was not effective, only when combined with the fungus was an effect observed, indicating that kaolin was having a synergistic effect on the fungus. PMID:27571107

Nature of the interactions between hypocrealean fungi and the mutualistic fungus of leaf-cutter ants.

PubMed

Varanda-Haifig, Sadala Schmidt; Albarici, Tatiane Regina; Nunes, Pablo Henrique; Haifig, Ives; Vieira, Paulo Cezar; Rodrigues, Andre

2017-04-01

Leaf-cutter ants cultivate and feed on the mutualistic fungus, Leucoagaricus gongylophorus, which is threatened by parasitic fungi of the genus Escovopsis. The mechanism of Escovopsis parasitism is poorly understood. Here, we assessed the nature of the antagonism of different Escovopsis species against its host. We also evaluated the potential antagonism of Escovopsioides, a recently described fungal genus from the attine ant environment whose role in the colonies of these insects is unknown. We performed dual-culture assays to assess the interactions between L. gongylophorus and both fungi. We also evaluated the antifungal activity of compounds secreted by the latter on L. gongylophorus growth using crude extracts of Escovopsis spp. and Escovopsioides nivea obtained either in (1) absence or (2) presence of the mutualistic fungus. The physical interaction between these fungi and the mutualistic fungus was examined under scanning electron microscopy (SEM). Escovopsis spp. and E. nivea negatively affected the growth of L. gongylophorus, which was also significantly inhibited by both types of crude extract. These results indicate that Escovopsis spp. and E. nivea produce antifungal metabolites against the mutualistic fungus. SEM showed that Escovopsis spp. and E. nivea maintained physical contact with the mutualistic fungus, though no specialised structures related to mycoparasitism were observed. These results showed that Escovopsis is a destructive mycoparasite that needs physical contact for the death of the mutualistic fungus to occur. Also, our findings suggest that E. nivea is an antagonist of the ant fungal cultivar.

Efficacy of the nematode-trapping fungus Duddingtonia flagrans against three species of gastro-intestinal nematodes in laboratory faecal cultures from sheep and goats.

PubMed

Waghorn, T S; Leathwick, D M; Chen, L-Y; Skipp, R A

2003-12-30

The ability of the nematode-killing fungus Duddingtonia flagrans to reduce number of infective larvae of three species of gastro-intestinal parasitic nematodes developing in dung was investigated in both goats and sheep. Groups of lambs and kids (12-20 weeks old) were given mono-specific infections of Haemonchus contortus, Ostertagia (Teladorsagia) circumcincta or Trichostrongylus colubriformis. Following patency of the infections (t1) faecal samples were collected for determination of faecal nematode egg count (FEC) and culture of parasite larvae. Groups of animals were then dosed on 2 consecutive days with one of the two dose rates of the fungus (250,000 or 500,000 spores/kg liveweight). One (t2) and 5 (t3) days after the second dose of fungus samples were again collected for FEC and culture. The number of larvae recovered from the faecal cultures at t1 and t3 were used as controls to assess the efficacy of the experimental treatment at t2. Average efficacy was 78% with group means ranging from 40 to 93%. Dose rate of fungus appeared to influence efficacy against O. circumcincta but not against H. contortus or T. colubriformis. Overall, there were no differences in the efficacy of the fungus against any of the parasite species or in either host animal. The results of this trial indicate the potential use of this fungus as a broad spectrum anti-parasite agent for use in both goats and sheep.

Diversity of endophytic fungi associated with the foliar tissue of a hemi-parasitic plant Macrosolen cochinchinensis.

PubMed

Zhou, Sheng-Liang; Yan, Shu-Zhen; Liu, Qi-Sha; Chen, Shuang-Lin

2015-01-01

Foliar fungal endophytes are an important plant-associated fungal group. However, little is known about these fungi in hemi-parasitic plants, a unique plant group which derive nutrients from living plants of its hosts by haustoria while are photosynthetic to some degree. In this paper, the endophytic fungi in the leaves of a species of hemi-parasitic plant, Macrosolen cochinchinensis, were studied by both culture-dependent and culture-independent methods. By culture-dependent method, a total of 511 isolates were recovered from 452 of 600 leaf fragments (colonization rate = 75.3 %) and were identified to be 51 taxa. Valsa sp. was the most abundant (relative abundance = 38.4 %), followed by Cladosporium sp. 1 (13.5 %), Ulocladium sp. (4.3 %), Phomopsis sp. 2 (3.7 %), Hendersonia sp. (3.5 %), and Diaporthe sp. 4 (3.5 %). The Shannon index (H') of the isolated endophytic fungi was 2.628, indicating a moderate diversity. By culture-independent method, Aspergillus spp., Cladosporium sp., Mycosphaerella sp., Acremonium strictum, and Tremella sp. were detected. To our knowledge, the Tremella species have never been detected as endophytes so far. In addition, a cloned sequence was not similar with any current sequence in the Genbank, which may represent a novel species. Altogether, this study documented endophytic fungal assemble in the leaves of M. cochinchinensis which was worthy of our attention, and may expand our knowledge about endophytic fungi within the photosynthetic tissues of plants.

The preliminary assessment and isolation of entomopathogenic fungi to be used in biological control with twospotted spider mite [Tetranychus urticae (acari, tetranychidae)] from East Anatolia

NASA Astrophysics Data System (ADS)

Örtücü, Serkan; Algur, Ömer Faruk

2017-04-01

This study was conducted to isolation entomopathogenic fungi for possible use in biocontrol of two-spotted spider mite Tetranychus urticae Koch. and to determine their pathogenicity. For this purpose, plant leaves infected with T. urticae were collected from Erzurum, Kars and Ardahan. At laboratory, the internal and external mycoflora of T.urticae individuals on plant leaves were determined. As a result of isolation, twenty-five different fungi species belonging to the genera Acremonium, Alternaria, Aspergillus, Beauveria, Cladosporium, Gliocladium, Humicola, Penicillium, Trichoderma, Isaria, Ulocladium and Verticillium were obtained. Pathogenicity of this forty-five isolate belonging to twenty-five species were evaluated. As a test organism, T. urticae was used and suspensions (1 × 108conidia ml-1) were prepared in Tween 80. 2ml suspension of a single dose was sprayed onto down side of bean leaf discs using hand sprayer. Mortality was recorded daily for 7 days. A total of twelve isolates belonging to three species were determined to be pathogen against T.urticae. According to scale used: AT020 Isaria farinosa and AT025 Cladosporium cladosporioides were determined as least pathogen, AT037 and AT101 Beauveria bassiana, and AT019 and AT026 C. cladosporioides, and AT035 and AT036 I. farinosa as moderate pathogen, AT007, AT021, AT034 and AT076 B. bassiana as highly pathogen. The other thirty-three isolates found that not pathogenic against T.urticae.

The effects of meteorological factors on airborne fungal spore concentration in two areas differing in urbanisation level

NASA Astrophysics Data System (ADS)

Oliveira, M.; Ribeiro, H.; Delgado, J. L.; Abreu, I.

2009-01-01

Although fungal spores are an ever-present component of the atmosphere throughout the year, their concentration oscillates widely. This work aims to establish correlations between fungal spore concentrations in Porto and Amares and meteorological data. The seasonal distribution of fungal spores was studied continuously (2005-2007) using volumetric spore traps. To determine the effect of meteorological factors (temperature, relative humidity and rainfall) on spore concentration, the Spearman rank correlation test was used. In both locations, the most abundant fungal spores were Cladosporium, Agaricus, Agrocybe, Alternaria and Aspergillus/Penicillium, the highest concentrations being found during summer and autumn. In the present study, with the exception of Coprinus and Pleospora, spore concentrations were higher in the rural area than in the urban location. Among the selected spore types, spring-autumn spores ( Coprinus, Didymella, Leptosphaeria and Pleospora) exhibited negative correlations with temperature and positive correlations both with relative humidity and rainfall level. On the contrary, late spring-early summer (Smuts) and summer spores ( Alternaria, Cladosporium, Epicoccum, Ganoderma, Stemphylium and Ustilago) exhibited positive correlations with temperature and negative correlations both with relative humidity and rainfall level. Rust, a frequent spore type during summer, had a positive correlation with temperature. Aspergillus/Penicillium, showed no correlation with the meteorological factors analysed. This knowledge can be useful for agriculture, allowing more efficient and reliable application of pesticides, and for human health, by improving the diagnosis and treatment of respiratory allergic disease.

Purification, characterization and kinetic properties of extracellular L-asparaginase produced by Cladosporium sp.

PubMed

Mohan Kumar, N S; Manonmani, H K

2013-04-01

L-asparaginase from Cladosporium sp. grown on wheat bran by SSF was purified. Enzyme appeared to be a trimer with homodimer of 37 kDa and another 47 kDa amounting to total mass of 121 kDa as estimated by SDS-PAGE and 120 kDa on gel filtration column. The optimum temperature and pH of the enzyme were 30 °C and 6.3, respectively with Vmax of 4.44 μmol/mL/min and Km of 0.1 M. Substrate specificity studies indicated that, L-asparaginase has greater affinity towards L-asparagine with substrate hydrolysis efficiency (Vmax/Km ratio) eightfold higher than that of L-glutamine. L-asparaginase activity in presence of thiols studied showed decrease in Vmax and increase in Km, indicating nonessential mode of inactivation. Among the thiols tested, β-mercaptomethanol, exerted inhibitory effect, suggesting a critical role of disulphide linkages in maintaining a suitable conformation of the enzyme. Metal ions such as Ca(2+), Co(2+), Cu(2+), Mg(2+), Na(+), K(+) and Zn(2+) significantly affected enzyme activity whereas presence of Fe(3+), Pb(2+) and KI stimulated the activity. Detergents studied also enhanced L-asparaginase activity. In-vitro half-life of purified L-asparaginase in mammalian blood serum was 93.69 h. The enzyme inhibited acrylamide formation in potato chips by 96 % making it a potential candidate for food industry to reduce acrylamide content in starchy fried food commodities.

[Variations of soil microbial community composition and enzyme activities with different salinities on Yuyao coast, Zhejiang, China].

PubMed

Sun, Hui; Zhang, Jian Feng; Xu, Hua Sen; Chen, Guang Cai; Wang, Li Ping

2016-10-01

In October 2015, soil samples with different salinity were collected in a coast area in Yuyao, Zhejiang, and soil microbial community composition, soil catalase, urease activities, as well as soil physical and chemical properties were studied. The results showed that Nitrospira took absolute advantage in the bacterial community, and showed good correlations to total potassium. Cladosporium and Fusarium were predominant in the fungal community. Meanwhile, Cladosporium was related to soil urease and total nitrogen, and same correlation was found between Fusarium and soil urease. Catalase activity ranged from 3.52 to 4.56 mL·g -1 , 3.08 to 4.61 mL·g -1 and 5.81 to 6.91 mL·g -1 for soils with heavy, medium and weak salinity, respectively. Catalase activity increased with the soil layer deepening, which was directly related to soil total potassium, and indirectly related to pH, organic matter, total nitrogen and total phosphorus through total potassium. Soil urease activity ranged among 0.04 to 0.52 mg·g -1 , 0.08 to 1.07 mg·g -1 and 0.27 to 8.21 mg·g -1 for each saline soil, respectively. Urease activity decreased with soil layer deepening which was directly related to soil total nitrogen, and was indirectly related to pH, organic matter and total potassium through total nitrogen. The total phosphorus was the largest effect factor on the bacterial community CCA ordination, and the urease was on fungal community.

Potential of pure and mixed cultures of Cladosporium cladosporioides and Geotrichum candidum for application in bioremediation and detergent industry.

PubMed

Jakovljević, Violeta D; Vrvić, Miroslav M

2018-03-01

The effect of ethoxylated oleyl-cetyl alcohol (Henkel, "Merima", Serbia) on the growth and metabolic activity of Cladosporium cladosporioides , Geotrichum candidum and their mixed culture was in the focus of this paper. The cultures were grown in Czapek-Dox liquid nutrient medium with the addition of 0.5% pollutant and without it. The physico-chemical and biochemical changes of pH, the total biomass dry weight, the quantity of free and total organic acids, proteolytic activity and the quality of carbohydrates were evaluated from 4th to 19th day of fungal growth. The pollutant caused an inhibitory effect on biomass dry weight of C. cladosporioides and G. candidum for 10.36% and 4.65% respectively, and stimulatory effect on biomass of mixed culture for 3.80%. The pollutant had influence on the decrease in pH value of the media in the phase of culture growth, and pH changes were correlated with the amount of excreted total organic acids. The highest quantity of free and total organic acids was noted in media with pollutant of mixed culture and C. cladosporioides , respectively. The alkaline protease activities of C. cladosporioides , G. candidum and mixed culture were enhanced by addition of pollutant for 56.88%, 55.84% and 30.94% respectively. The obtained results indicate the potential of both pure and mixed cultures in mycoremediation environment contaminated by alcohol ethoxylated and detergent industry.

Draft genome sequence of the fungus associated with oak-wilt mortality in South Korea, Raffaelea quercus-mongolicae KACC44405

Treesearch

Jongbum Jeon; Ki-Tae Kim; Hyeunjeong Song; Gir-Won Lee; Kyeongchae Cheong; Hyunbin Kim; Gobong Choi; Yong-Hwan Lee; Jane E. Stewart; Ned B. Klopfenstein; Mee-Sook Kim

2017-01-01

The fungus Raffaelea quercus-mongolicae is the causal agent of Korean oak wilt, a disease associated with mass mortality of oak trees (e.g., Quercus spp.). The fungus is vectored and dispersed by the ambrosia beetle, Platypus koryoensis. Here, we present the 27.0-Mb draft genome sequence of R. quercus-mongolicae strain KACC44405.

Characteristics of a newly isolated fungus Geotrichum candidum Dec 1 with broad degradation spectrum of xenobiotic compounds.

PubMed

Shoda, M

2003-01-01

A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.

Cutinase in Cryphonectria parasitica, the chestnut blight fungus: suppression of cutinase gene expression in isogenic hypovirulent strains containing double-stranded RNAs

Treesearch

D.A. ​Varley; G.K. Podila; S.T. Hiremath

1992-01-01

Plant-pathogenic fungi produce cutinase, an enzyme required to degrade plant cuticles and facilitate penetration into the host. The absence of cutinase or a decrease in its production has been associated with a decrease in pathogenicity of the fungus. A set of isogenic strains of Cryphonectria parasitica, the chestnut blight fungus, was tested for...

First unusual case of keratitis in Europe due to the rare fungus Metarhizium anisopliae.

PubMed

Dorin, Josephine; Debourgogne, Anne; Zaïdi, Mohamed; Bazard, Marie-Christine; Machouart, Marie

2015-05-01

Metarhizium anisopliae is a fungus utilized worldwide for insect-pest biocontrol. Few M. anisopliae infections have been reported previously. Here, M. anisopliae was isolated from a corneal ulcer in a healthy man. It is the first ocular case in France and Europe of this extremely rare fungus in humans. Copyright © 2015 Elsevier GmbH. All rights reserved.

Symbiosis-regulated expression of an acetyl-CoA acetyltransferase gene in the ectomycorrhizal fungus Laccaria bicolor

Treesearch

Shiv T. Hiremath; Sujata Balasubramanian; Jun Zheng; Gopi K. Podila

2006-01-01

The ectomycorrhiza is a symbiotic organ generated from the intricate association of fungal hyphae and plant root. The establishment of the ectomycorrhiza is a coordinated process of cross-talk between plant and fungus, followed by metabolic, developmental, and structural changes in the fungus, resulting in its growth toward the root. The initial stages of the symbiotic...

Genetic diversity and population structure of Raffaelea quercus-mongolicae, a fungus associated with oak mortality in South Korea

Treesearch

M. -S. Kim; P. A. Hohenlohe; K. -H. Kim; S. -T. Seo; Ned Klopfenstein

2016-01-01

Raffaelea quercus-mongolicae is a fungus associated with oak wilt and deemed to cause extensive oak mortality in South Korea. Since the discovery of this fungus on a dead Mongolian oak (Quercus mongolica) in 2004, the mortality continued to spread southwards in South Korea. Despite continued expansion of the disease and associated significant impacts on forest...

[Scytalidium dimidiatum an opportunistic fungus for both man and Mangifera indica trees in Venezuela].

PubMed

Padin, Carmiña; Fernández-Zeppenfeldt, Guillermo; Yegres, Francisco; Richard-Yegres, Nicole

2005-09-01

The purpose of this study was to confirm the presence of Scytalidium dimidiatum on Mangifera indica (mango) trees, in a plantation managed by a diabetic patient with a white grain mycetoma of the foot caused by the same fungus. Samples from necrotic apices, roots, burned leaves and rotten stems from eight trees were processed by the Smith and Furcolow's mineral oil technique (modified). Several isolates from the apex material and clinical samples from the diabetic patient isolated in pure culture a fungus with the macroscopic and microscopic characteristics of that in S. dimidiatum. This fungus should be considered as an opportunistic microorganism for both humans and M. indica.

Isocoumarin Derivatives from the Sea Squirt-derived Fungus Penicillium stoloniferum QY2-10 and the Halotolerant Fungus Penicillium notatum B-52.

PubMed

Xin, Zhi-Hong; Tian, Li; Zhu, Tian-Jiao; Wang, Wen-Liang; Du, Lin; Fang, Yu-Chun; Gu, Qian-Qun; Zhu, Wei-Ming

2007-07-01

Two isocoumarin derivatives, stoloniferol A (1) and B (2), a known 5alpha, 8alpha-epidioxy-23-methyl-(22E, 24R)-ergosta-6, 22-dien-3beta-ol (3), and a known dihydrocitrinone (4) were isolated from the ethyl acetate extract of the sea squirt-derived fungus, Penicillium stoloniferum QY2-10, and a halophilic fungus, Penicillium notatum B-52, respectively. Their structures were elucidated by spectroscopic methods and optical rotation. The stereochemistry of 2 was determined on the basis of different NOE experiments and chemical transformation. Compound 3 showed cytotoxicity against P388 cells, with an IC50 value of 4.07 microM.

The chestnut blight fungus for studies on virus/host and virus/virus interactions: from a natural to a model host.

PubMed

Eusebio-Cope, Ana; Sun, Liying; Tanaka, Toru; Chiba, Sotaro; Kasahara, Shin; Suzuki, Nobuhiro

2015-03-01

The chestnut blight fungus, Cryphonectria parasitica, is an important plant pathogenic ascomycete. The fungus hosts a wide range of viruses and now has been established as a model filamentous fungus for studying virus/host and virus/virus interactions. This is based on the development of methods for artificial virus introduction and elimination, host genome manipulability, available host genome sequence with annotations, host mutant strains, and molecular tools. Molecular tools include sub-cellular distribution markers, gene expression reporters, and vectors with regulatable promoters that have been long available for unicellular organisms, cultured cells, individuals of animals and plants, and certain filamentous fungi. A comparison with other filamentous fungi such as Neurospora crassa has been made to establish clear advantages and disadvantages of C. parasitica as a virus host. In addition, a few recent studies on RNA silencing vs. viruses in this fungus are introduced. Copyright © 2014 Elsevier Inc. All rights reserved.

Greater taxol yield of fungus Pestalotiopsis hainanensis from dermatitic scurf of the giant panda (Ailuropoda melanoleuca).

PubMed

Gu, Yu; Wang, Yanlin; Ma, Xiaoping; Wang, Chengdong; Yue, Guizhou; Zhang, Yuetian; Zhang, Yunyan; Li, Shanshan; Ling, Shanshan; Liu, Xiaomin; Wen, Xintian; Cao, Sanjie; Huang, Xiaobo; Deng, Junliang; Zuo, Zhicai; Yu, Shumin; Shen, Liuhong; Wu, Rui

2015-01-01

While taxol yields of fungi from non-animal sources are still low, whether Pestalotiopsis hainanensis isolated from the scurf of a dermatitic giant panda, Ailuropoda melanoleuca, provides a greater taxol yield remains unknown. The objective of the study was to determine the corresponding taxol yield. The structure of the taxol produced by the fungus was evaluated by thin layer chromatography (TLC), ultraviolet (UV) spectroscopy, high-performance liquid chromatography (HPLC), (1)H and (13)C nuclear magnetic resonance spectroscopy ((1)H-NMR and (13)C-NMR), and time-of-flight mass spectrometry (TOF-MS), with standard taxol as a control. The results demonstrated that the P. hainanensis fungus produced taxol, which had the same structure as the standard taxol and yield of 1,466.87 μg/L. This fungal taxol yield from the dermatitic giant panda was significantly greater than those of fungus from non-animal sources. The taxol-producing fungus may be a potential candidate for the production of taxol on an industrial scale.

The Effect of Raffaelea quercus-mongolicae Inoculations on the Formation of Non-conductive Sapwood of Quercus mongolica

PubMed Central

Matsuda, Yosuke; Seo, Sang Tae; Kim, Kyung Hee; Ito, Shin-ichiro; Moon, Myung Jin; Kim, Seong Hwan; Yamada, Toshihiro

2014-01-01

In Korea, mass mortality of Quercus mongolica trees has become obvious since 2004. Raffaelea quercus-mongolicae is believed to be a causal fungus contributing the mortality. To evaluate the pathogenicity of the fungus to the trees, the fungus was multiple- and single-inoculated to the seedlings and twigs of the mature trees, respectively. In both the inoculations, the fungus was reisolated from more than 50% of inoculated twigs and seedlings. In the single inoculations, proportions of the transverse area of non-conductive sapwood at inoculation points and vertical lengths of discoloration expanded from the points were significantly different between the inoculation treatment and the control. In the multiple inoculations, no mortality was confirmed among the seedlings examined. These results showed that R. quercus-mongolicae can colonize sapwood, contribute to sapwood discoloration and disrupt sap flows around inoculation sites of Q. mongolica, although the pathogenicity of the fungus was not proven. PMID:25071395

Another possible risk for the Mediterranean Sea? Aspergillus sydowii discovered in the Port of Genoa (Ligurian Sea, Italy).

PubMed

Greco, G; Capello, M; Cecchi, G; Cutroneo, L; Di Piazza, S; Zotti, M

2017-09-15

Aspergillus sydowii is a cosmopolitan fungus that has been responsible for the mass destruction of coral in the Caribbean Sea over the last 15years. To our knowledge, this study has found the first case of A. sydowii in the Mediterranean Sea, in marine-bottom sediments, water and calcareous shells of bivalve molluscs sampled during a campaign to characterise the mycobiota in the Port of Genoa (Italy). The area is characterised by adverse environmental conditions (high turbidity, organic pollution and high concentrations of phosphorus and nitrogen compounds). These parameters, in combination with a rising temperature, could contribute to A. sydowii bloom and dispersal. This fungal strain may have been imported into the Port of Genoa in the bilge water of vessels or by torrent input. This work represents the first step in the implementation of a monitoring programme to safeguard calcareous sponges and sea fan corals endemic in the Mediterranean Sea. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biological activities of organic extracts of four Aureobasidium pullulans varieties isolated from extreme marine and terrestrial habitats.

PubMed

Botić, Tanja; Kralj-Kunčič, Marjetka; Sepčić, Kristina; Batista, Urška; Zalar, Polona; Knez, Željko; Gunde-Cimerman, Nina

2014-01-01

We report on the screening for biological activities of organic extracts from seven strains that represent four varieties of the fungus Aureobasidium pullulans, that is A. pullulans var. melanogenum, A. pullulans var. pullulans, A. pullulans var. subglaciale and A. pullulans var. namibiae. We monitored haemolysis, cytotoxicity, antioxidant capacity and growth inhibition against three bacterial species. The haemolytic activity of A. pullulans var. pullulans EXF-150 strain was due to five different haemolytically active fractions. Extracts from all of the other varieties contained at least one haemolytically active fraction. Short-term exposure of cell lines to these haemolytically active organic extracts resulted in more than 95% cytotoxicity. Strong antioxidant capacity, corresponding to 163.88 μg ascorbic acid equivalent per gram of total solid, was measured in the organic extract of the strain EXF-3382, obtained from A. pullulans var. melanogenum, isolated from the deep sea. Organic extracts from selected varieties of A. pullulans exhibited weak antibacterial activities.

Interaction of fructose with other medium components to affect bioproduction of docosahexaenoic acid (DHA) by Aurantiochytrium sp. SW1

NASA Astrophysics Data System (ADS)

Manikan, Vidyah; Kalil, Mohd. Sahaid; Shuib, Shuwahida; Hamid, Aidil Abdul

2018-04-01

Thraustochytrids are a group of marine fungus-like microheterotrophs of which some can accumulate considerable amounts of the high valued omega-3 oil, docosahexaenoic acid (DHA). In this study, a local thraustochytrid isolate, Aurantiochytrium sp. SW1, was cultivated in a medium containing fructose as the major carbon source. The effects of this carbon source in interaction with yeast extract, monosodium glutamate (MSG) and sea salt were studied using a software-based two level full factorial design. Results showed that fructose as a single factor, has significant positive effect on the volumetric DHA content of SW1. Similarly, its interaction with yeast extract has profound positive effect. However, interactions of fructose with MSG and sea salt were significant negative effects. These results indicate that manipulation of the concentration of fructose in the culture medium may serve as a simple and useful strategy to help achieve preferred amount of DHA.

A novel cysteine-rich antimicrobial peptide from the mucus of the snail of Achatina fulica.

PubMed

Zhong, Jian; Wang, Wenhong; Yang, Xiaomei; Yan, Xiuwen; Liu, Rui

2013-01-01

Antimicrobial peptides (AMPs) are important components of the innate immunity. Many antimicrobial peptides have been found from marine mollusks. Little information about AMPs of mollusks living on land is available. A novel cysteine-rich antimicrobial peptide (mytimacin-AF) belonging to the peptide family of mytimacins was purified and characterized from the mucus of the snail of Achatina fulica. Its cDNA was also cloned from the cDNA library. Mytimacin-AF is composed of 80 amino acid residues including 10 cysteines. Mytimacin-AF showed potent antimicrobial activity against Gram-negative and Gram-positive bacteria and the fungus Candida albicans. Among tested microorganisms, it exerted strongest antimicrobial activity against Staphylococcus aureus with a minimal peptide concentration (MIC) of 1.9 μg/ml. Mytimacin-AF had little hemolytic activity against human blood red cells. The current work confirmed the presence of mytimacin-like antimicrobial peptide in land-living mollusks. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

Genome Sequence of the Mucoromycotina Fungus Umbelopsis isabellina, an Effective Producer of Lipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takeda, Itaru; Tamano, Koichi; Yamane, Noriko

2014-02-27

Umbelopsis isabellina is a fungus in the subdivision Mucoromycotina, many members of which have been shown to be oleaginous and have become important organisms for producing oil because of their high level of intracellular lipid accumulation from various feedstocks. The genome sequence of U. isabellina NBRC 7884 was determined and annotated, and this information might provide insights into the oleaginous properties of this fungus.

Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the Apterostigma pilosum group ant-fungus mutualism

Treesearch

Bryn T.M. Dentinger; D.Jean Lodge; Andrew B. Munkacsi; Dennis E. Desjardin; David J. McLaughlin

2009-01-01

The ~50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus ...

Fingerprints of a forest fungus: Swiss needle cast, carbon isotopes, carbohydrates, and growth in Douglas-fir

Treesearch

Andrea Watts; Frederick Meinzer; Brandy J. Saffell

2014-01-01

Swiss needle cast is caused by a fungus native to the Pacific Northwest. Its host is Douglas-fir, an iconic evergreen tree in the region. The fungus does not kill its host, but it adversely affects the tree's growth. The fungal fruiting bodies block the stomata, small openings on the underside of the needle where carbon dioxide, water vapor, and other gases are...

The genome of an industrial workhorse : sequencing of the filamentous fungus Aspergillus niger offers new opportunities for the production of specialty chemicals and enzymes

Treesearch

Dan Cullen

2007-01-01

Few microbes compare with the filamentous fungus Aspergillus niger in its ability to produce prodigious amounts of useful chemicals and enzymes. This fungus is the principal source of citric acid for food, beverages and pharmaceuticals and of several important commercial enzymes, including glucoamylase, which is widely used for the conversion of starch to food syrups...

Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.

PubMed

Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira

2011-01-01

Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.

Comparative effects of native filamentous and arbuscular mycorrhizal fungi in the establishment of an autochthonous, leguminous shrub growing in a metal-contaminated soil.

PubMed

Carrasco, L; Azcón, R; Kohler, J; Roldán, A; Caravaca, F

2011-02-15

The aim of this study was to assess the effectiveness of inoculation with a native arbuscular mycorrhizal (AM) fungus, Glomus mosseae (Nicol. and Gerd.) Gerd. and Trappe, or a filamentous fungus, Penicillium aurantiogriseum Dierckx 1901, on the establishment of Coronilla juncea L. seedlings grown in a polluted, semiarid soil. For that, root and shoot biomass, nutrient uptake, mycorrhizal colonisation and nitrate reductase (NR) and phosphatase activities were analysed. Six months after planting, the shoot biomass of C. juncea was increased only by the inoculation with G. mosseae (by about 62% compared with non-mycorrhizal plants). The shoot NR and root acid phosphatase activities were increased more by inoculation with G. mosseae than with P. aurantiogriseum inoculation. The root NR activity and foliar nutrient contents were increased only by the inoculation with the AM fungus. The root Zn and Cu decreased with the AM fungus. In conclusion, the autochthonous AM fungus was an effective inoculant with regard to stimulating growth and alleviating heavy metal toxicity for plants growing on a soil contaminated by multiple heavy metals. Inoculation with an autochthonous, filamentous fungus does not seem to be a good strategy for phytoremediation of such problematic sites. Copyright © 2011 Elsevier B.V. All rights reserved.

Synergistic interaction between the fungus Beauveria bassiana and desiccant dusts applied against poultry red mites (Dermanyssus gallinae).

PubMed

Steenberg, Tove; Kilpinen, Ole

2014-04-01

The poultry red mite, Dermanyssus gallinae, is a major pest in egg production, feeding on laying hens. Widely used non-chemical control methods include desiccant dusts, although their persistence under field conditions is often short. Entomopathogenic fungi may also hold potential for mite control, but these fungi often take several days to kill mites. Laboratory experiments were carried out to study the efficacy of 3 types of desiccant dusts, the fungus Beauveria bassiana and combinations of the two control agents against D. gallinae. There was significant synergistic interaction between each of the desiccant dusts and the fungus, with observed levels of mite mortality significantly higher than those expected for an additive effect (up to 38 % higher). Synergistic interaction between desiccant dust and fungus was found also when different application methods were used for the fungus and at different levels of relative humidity. Although increased levels of mortality were reached due to the synergistic interaction, the speed of lethal action was not influenced by combining the two components. The persistence of the control agents applied separately or in combination did not change over a period of 4 weeks. Overall, combinations of desiccant dusts and fungus conidia seem to hold considerable promise for future non-chemical control of poultry red mites.

Phomalactone from a Phytopathogenic Fungus Infecting ZINNIA elegans (ASTERACEAE) Leaves.

PubMed

Meepagala, Kumudini M; Johnson, Robert D; Techen, Natascha; Wedge, David E; Duke, Stephen O

2015-07-01

Zinnia elegans Jacq. plants are infected by a fungus that causes dark red spots with necrosis on leaves, particularly in late spring to the middle of summer in the Mid-South of the United States. This fungal disease causes the leaves to wilt and eventually kills the plant. The fungus was isolated, cultured in potato dextrose broth, and identified as Nigrospora sphaerica by molecular techniques. Two major lactone metabolites (phomalactone and catenioblin A) were isolated from liquid culture of N. sphaerica isolated from Z. elegans. When injected into leaves of Z. elegans, phomalactone caused lesions similar to those of the fungus. The lesion sizes were proportional to the concentration of the phomalactone. Phomalactone, but not catenioblin A, was phytotoxic to Z. elegans and other plant species by inhibition of seedling growth and by causing electrolyte leakage from photosynthetic tissues of both Z. elegans leaves and cucumber cotyledons. This latter effect may be related to the wilting caused by the fungus in mature Z. elegans plants. Phomalactone was moderately fungicidal to Coletotrichum fragariae and two Phomopsis species, indicating that the compound may keep certain other fungi from encroaching into plant tissue that N. sphaerica has infected. Production of large amounts of phomalactone by N. sphaerica contributes to the pathogenic behavior of this fungus, and may have other ecological functions in the interaction of N. sphaerica with other fungi. This is the first report of isolation of catenioblin A from a plant pathogenic fungus. The function of catenioblin A is unclear, as it was neither significantly phyto- nor fungitoxic.

Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.

PubMed

Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi

2011-07-01

Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.

Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum-Johnson, Kristin E.; Tringe, Susannah G.

Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass ismore » degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.« less

Species-specific ant brain manipulation by a specialized fungal parasite.

PubMed

de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

2014-08-29

A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation by this specialized fungus and therefore represent a major advancement towards an understanding of the molecular mechanisms underlying this phenomenon.

Rapid and pervasive occupation of fallen mangrove leaves by a marine zoosporic fungus.

PubMed

Newell, S Y; Miller, J D; Fell, J W

1987-10-01

Samples of leaves of red mangrove (Rhizophora mangle) were incubated on an agar medium selective for pythiaceous oomycetes. Leaves on trees above the water did not contain oomycetes. Marine oomycetes, principally Phytophthora vesicula, had colonized leaves within 2 h of leaf submergence, probably finding them by chemotaxis. The frequency of occurrence of P. vesicula in submerged leaves reached 100% within 30 h of submergence. By 43 h most, if not all, parts of leaves were occupied, and surface treatment with a biocide indicated that leaves were occupied internally. Frequencies of P. vesicula remained near 100% through about 2 weeks of submergence and then declined to about 60% in older (>/=4 weeks) leaves. Leaves of white mangrove (Laguncularia racemosa) were also extensively occupied by P. vesicula after falling into the water column, but decaying leaves of turtlegrass (Thalassia testudinum) were not colonized by oomycetes. Ergosterol analysis indicated that the standing crop of living, non-oomycete (ergosterol-containing) fungal mass in submerged red-mangrove leaves did not rise above that which had been present in senescent leaves on the tree; decaying turtlegrass leaves had an ergosterol content that was only about 2% of the maximum concentration detected for red-mangrove leaves. These results suggest that oomycetes are the predominant mycelial eucaryotic saprotrophs of mangrove leaves that fall into the water column and that for turtlegrass leaves which live, die, and decompose under submerged conditions, mycelial eucaryotes make no substantial contribution to decomposition.

Three New and Eleven Known Unusual C25 Steroids: Activated Production of Silent Metabolites in a Marine-Derived Fungus by Chemical Mutagenesis Strategy using Diethyl Sulphate

PubMed Central

Xia, Ming-Wen; Cui, Cheng-Bin; Li, Chang-Wei; Wu, Chang-Jing

2014-01-01

Three new (1–3) and 11 known (4–14) C25 steroids with an unusual bicyclo[4.4.1]A/B ring system were isolated by tracing newly produced metabolites in the EtOAc extract of an antitumor mutant AD-1-2 obtained by the diethyl sulphate (DES) mutagenesis of a marine-derived Penicillium purpurogenum G59. HPLC-PDAD-UV and HPLC-ESI-MS analyses indicated that the G59 strain did not produce these metabolites and the production of 1–14 in the mutant AD-1-2 extract was caused by the activation of silent metabolites in the original G59 strain by DES mutagenesis. The structures of the new compounds, named antineocyclocitrinols A (1) and B (2) and 23-O-methylantineocyclocitrinol (3), including their absolute configurations were determined by various spectroscopic methods, especially the NMR and Mo2-induced CD analyses. Compounds 1–3 provide the first examples of the C25 bicyclo[4.4.1]A/B ring steroids with the Z-configuration of 20,22-double bond. All of 1–14 weakly inhibited several human cancer cell lines to varying extents. These results provided additional examples for the successful application of the chemical mutagenesis strategy using DES to discover new compounds by activating silent metabolites in fungal isolates and supported also the effectiveness and usefulness of this new strategy. PMID:24633254

Heliotropamide, a novel oxopyrrolidine-3-carboxamide from Heliotropium ovalifolium.

PubMed

Guntern, A; Ioset, J-R; Queiroz, E F; Sándor, P; Foggin, C M; Hostettmann, K

2003-12-01

Heliotropamide (1), a new alkaloid with a novel oxopyrrolidine-3-carboxamide central moiety, has been isolated as the major product of the dicholoromethane extract of Heliotropium ovalifolium aerial parts. Its structure was elucidated by spectrometric methods including ESI-HR, EI, D/CI mass spectrometry, (1)H, (13)C, and 2D NMR experiments, and chemical derivatization. Neither heliotropamide nor its acetylated derivative (1a) showed any antifungal activity against Cladosporium cucumerinum and Candida albicans, antibacterial activity against Bacillus subtilis, radical-scavenging properties in the DPPH test, or inhibitory potential toward acetylcholinesterase.

Pneumocystis jiroveci pneumonia

MedlinePlus

Pneumocystis pneumonia; Pneumocystosis; PCP; Pneumocystis carinii ... This type of pneumonia is caused by the fungus Pneumocystis jiroveci . This fungus is common in the environment and rarely causes illness in ...

A specialized fungal parasite (Massospora cicadina) hijacks the sexual signals of periodical cicadas (Hemiptera: Cicadidae: Magicicada).

PubMed

Cooley, John R; Marshall, David C; Hill, Kathy B R

2018-01-23

Male periodical cicadas (Magicicada spp.) infected with conidiospore-producing ("Stage I") infections of the entomopathogenic fungus Massospora cicadina exhibit precisely timed wing-flick signaling behavior normally seen only in sexually receptive female cicadas. Male wing-flicks attract copulation attempts from conspecific males in the chorus; close contact apparently spreads the infective conidiospores. In contrast, males with "Stage II" infections that produce resting spores that wait for the next cicada generation do not produce female-specific signals. We propose that these complex fungus-induced behavioral changes, which resemble apparently independently derived changes in other cicada-Massospora systems, represent a fungus "extended phenotype" that hijacks cicadas, turning them into vehicles for fungus transmission at the expense of the cicadas' own interests.

Patterns of functional enzyme activity in fungus farming ambrosia beetles.

PubMed

De Fine Licht, Henrik H; Biedermann, Peter H W

2012-06-06

In wood-dwelling fungus-farming weevils, the so-called ambrosia beetles (Curculionidae: Scolytinae and Platypodinae), wood in the excavated tunnels is used as a medium for cultivating fungi by the combined action of digging larvae (which create more space for the fungi to grow) and of adults sowing and pruning the fungus. The beetles are obligately dependent on the fungus that provides essential vitamins, amino acids and sterols. However, to what extent microbial enzymes support fungus farming in ambrosia beetles is unknown. Here we measure (i) 13 plant cell-wall degrading enzymes in the fungus garden microbial consortium of the ambrosia beetle Xyleborinus saxesenii, including its primary fungal symbionts, in three compartments of laboratory maintained nests, at different time points after gallery foundation and (ii) four specific enzymes that may be either insect or microbially derived in X. saxesenii adult and larval individuals. We discovered that the activity of cellulases in ambrosia fungus gardens is relatively small compared to the activities of other cellulolytic enzymes. Enzyme activity in all compartments of the garden was mainly directed towards hemicellulose carbohydrates such as xylan, glucomannan and callose. Hemicellulolytic enzyme activity within the brood chamber increased with gallery age, whereas irrespective of the age of the gallery, the highest overall enzyme activity were detected in the gallery dump material expelled by the beetles. Interestingly endo-β-1,3(4)-glucanase activity capable of callose degradation was identified in whole-body extracts of both larvae and adult X. saxesenii, whereas endo-β-1,4-xylanase activity was exclusively detected in larvae. Similar to closely related fungi associated with bark beetles in phloem, the microbial symbionts of ambrosia beetles hardly degrade cellulose. Instead, their enzyme activity is directed mainly towards comparatively more easily accessible hemicellulose components of the ray-parenchyma cells in the wood xylem. Furthermore, the detection of xylanolytic enzymes exclusively in larvae (which feed on fungus colonized wood) and not in adults (which feed only on fungi) indicates that only larvae (pre-) digest plant cell wall structures. This implies that in X. saxesenii and likely also in many other ambrosia beetles, adults and larvae do not compete for the same food within their nests - in contrast, larvae increase colony fitness by facilitating enzymatic wood degradation and fungus cultivation.

Fungal arthritis

MedlinePlus

... examine you. Tests that may be ordered include: Culture of joint fluid that grows fungus Joint x-ray showing joint changes Positive antibody test (serology) for fungal disease Synovial biopsy showing fungus

Colonization by the arbuscular mycorrhizal fungus Glomus versiforme induces a defense response against the root-knot nematode Meloidogyne incognita in the grapevine (Vitis amurensis Rupr.), which includes transcriptional activation of the class III chitinase gene VCH3.

PubMed

Li, Hai-Yan; Yang, Guo-Dong; Shu, Huai-Rui; Yang, Yu-Tao; Ye, Bao-Xing; Nishida, Ikuo; Zheng, Cheng-Chao

2006-01-01

Inoculation of the grapevine (Vitis amurensis Rupr.) with the arbuscular mycorrhizal (AM) fungus Glomus versiforme significantly increased resistance against the root-knot nematode (RKN) Meloidogyne incognita. Studies using relative quantitative reverse transcription-PCR (RQRT-PCR) analysis of grapevine root inoculation with the AM fungus revealed an up-regulation of VCH3 transcripts. This increase was greater than that observed following infection with RKN. However, inoculation of the mycorrhizal grapevine roots with RKN was able to enhance VCH3 transcript expression further. Moreover, the increase in VCH3 transcripts appeared to result in a higher level of resistance against subsequent RKN infection. Constitutive expression of VCH3 cDNA in transgenic tobacco under the control of the cauliflower mosaic virus 35S promoter also conferred resistance against RKN, but had no significant effect on the growth of the AM fungus. We analyzed beta-glucuronidase (GUS) activity directed by a 1,216 bp VCH3 promoter in transgenic tobacco following inoculation with both the AM fungus and RKN. GUS activity was negligible in the root tissues before inoculation, and was more effectively induced after inoculation with the AM fungus than with RKN. Moreover, GUS staining in the mycorrhizal transgenic tobacco roots was enhanced by subsequent RKN infection, and was found ubiquitously throughout the whole root tissue. Together, these results suggest that AM fungus induced a defense response against RKN in the mycorrhizal grapevine roots, which appeared to involve transcriptional control of VCH3 expression throughout the whole root tissue.

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Mucor indicus: biology and industrial application perspectives: a review.

PubMed

Karimi, Keikhosro; Zamani, Akram

2013-01-01

Mucor indicus, one of the most important strains of zygomycetes fungi, has been the subject of several studies since a couple of hundred years ago. This fungus, regarded as a non-pathogenic dimorphic microorganism, is used for production of several beers and foods. Morphology of the fungus can be manipulated and well controlled by changing a number of parameters. Furthermore, M. indicus can grow on a variety of substrates including lignocellulosic hydrolysates which are mixtures of hexoses, pentoses, and different severe fermentation inhibitors. Indeed, high yield ethanol production is among the most important features of this strain. Presence of considerable amounts of chitosan in the cell wall is another important aspect of the fungus. Besides production of ethanol and chitosan, the biomass of this fungus has shown a great potential to be used as a rich nutritional source, e.g. fish feed. The fungus is also among the oleaginous fungi and produces high amounts of polyunsaturated fatty acids particularly γ-linolenic acid. Furthermore, the biomass autolysate has a high potential for yeast extract replacement in fermentation by the fungus. Additionally, the strain has shown promising results in heavy metal removal from wastewaters. This review discusses different aspects of biology and industrial application perspectives of M. indicus. Furthermore, open areas for the future basic and applied levels of research are also presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Biological control of trichostrongyles in beef cattle by the nematophagous fungus Duddingtonia flagrans in tropical southeastern Brazil.

PubMed

Assis, R C L; Luns, F D; Araújo, J V; Braga, F R

2012-11-01

The efficacy of a fungal formulation based on the nematophagous fungus Duddingtonia flagrans was assessed in the control of cattle trichostrongyles. Twenty male Nellore calves, six-month-old, divided in two groups (fungus-treated and control without fungus) were fed on a pasture of Brachiaria decumbens naturally infected with larvae of bovine trichostrongyles. Animals of the treated group received doses of sodium alginate mycelial pellets orally (1 g/10 kg live weight, twice a week), for 12 months. Feces samples were collected for egg count (eggs per gram of feces-EPG) and coprocultures during 12 months. There was a significant reduction in EPG (56.7%) and infective larvae (L3) in coprocultures (60.5%) for animals of the treated group in relation to the control group at the end of the study. There was a significant reduction of L3 (64.5%) in herbage samples collected up to 0-20 cm from fecal pats and 73.2% in distant samples (20-40 cm) between the fungus-treated group and the control group. The treatment with sodium alginate pellets containing the nematode trapping fungus D. flagrans reduced trichostrongylid in tropical southeastern Brazil and could be an effective tool for biological control of this parasitic nematode in beef cattle. Copyright © 2012 Elsevier Inc. All rights reserved.

The nematophagous fungus Monacrosporium thaumasium and its nematicidal activity on Angiostrongylus vasorum.

PubMed

Soares, Filippe Elias de Freitas; Braga, Fabio Ribeiro; de Araújo, Jackson Victor; Lima, Walter dos Santos; de Queiroz, José Humberto

2015-01-01

The dog acts as a reservoir and environmental disseminator of potentially zoonotic parasites. The objective of this work was to study the fungus Monacrosporium thaumasium regarding its nematicidal potential in laboratory trials and its proteolytic profile. The in vitro test was carried out through two assays (A and B). In assay A, conidia of the fungus N34a were added in positive coprocultures for Angiostrongylus vasorum. In assay B, crude extract (treated group) and distilled water (control group) were added to coprocultures. Next, the proteolytic profile of crude extract of the nematophagous fungus M. thaumasium (NF34a) was revealed by performing a zymogram. There was a reduction (p<0.01) in the averages of larvae recovered from the treated groups (conidia and crude extract) in relation to control groups. The zymogram suggested that the nematophagous fungus M. thaumasium produces a protease of approximately 40 kDa. The results of this work confirm that the conidia as well as the crude extract of the fungus M. thaumasium may be used to control A. vasorum L1. The proteolytic profile suggested the presence of one protease (Mt1) of approximately 40 kDa that in the future may be used in biological control of L1 of this nematode. Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Paracoccidioidomycosis

MedlinePlus

... brasiliensis . Spores of the fungus, which grow in soil, may be inhaled. Most people have no symptoms, ... inhaling spores of the fungus, which grow in soil. Paracoccidioidomycosis usually involves the lungs, skin, mouth, throat, ...

Histoplasmosis

MedlinePlus

... by the fungus. Soil that contains bird or bat droppings may have larger amounts of this fungus. ... by reducing exposure to dust in chicken coops, bat caves, and other high-risk locations. Wear masks ...

Histoplasmosis

MedlinePlus

... is a disease caused by a fungus (or mold) called Histoplasma. The fungus is common in the eastern and central United States. It grows in soil and material contaminated with bat or bird droppings. ...

Approaches for monitoring the release of Pochonia chlamydosporia var. catenulata, a biocontrol agent of root-knot nematodes.

PubMed

Atkins, Simon D; Hidalgo-Diaz, Leopoldo; Clark, Ian M; Morton, C Oliver; de Oca, Nivian Montes; Gray, Paul A; Kerry, Brian R

2003-02-01

Pochonia chlamydosporia var. catenulata is a potential biocontrol agent against root-knot nematodes. Diagnosis of isolates has relied on morphological identification, and is both time-consuming and difficult. beta-tubulin primers have been developed for the identification of this fungus that were specific enough to distinguish between varieties of the fungus within the same species. Separate primers have been developed for the specific detection of P. chlamydosporia var. catenulata based on ITS sequences, which were able to detect the fungus in soil from various sites in Cuba where the biocontrol agent had been added. When the PCR diagnosis was combined with serial dilution of soil samples on selective medium, colonies were rapidly identified. The fungus was still present, albeit at low densities, in soils inoculated five years previously. The development of a baiting method allowed quick in situ screening of the isolates' ability to infect nematode eggs, and when combined with PCR diagnosis both varieties of the fungus could be detected in infected eggs. RFLP analysis of ITS sequences from P. chlamydosporia provided an extra level of discrimination between isolates.

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2013 CFR

2013-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

50 CFR Appendix A to Part 622 - Species Tables

Code of Federal Regulations, 2014 CFR

2014-10-01

... michelinii, Blushing star Family Caryophylliidae Eusmilia fastigiata, Flower coral Tubastrea aurea, Cup coral... cactus Mussa angulosa, Large flower coral Mycetophyllia aliciae, Thin fungus coral M. danae, Fat fungus...

First report of Albizia lebbeck dieback caused by Scytalidium dimidiatum in Oman.

PubMed

Elshafie, Abdulkadir E; Ba-Omar, Taher

2002-01-01

Over 200 Albizia lebbeck trees at Sultan Qaboos University campus wilted and died. The symptoms were dieback of large branches due to infection by Scytalidium dimidiatum. The fungus has also infected Ficus benghalensis, F. carica, F. retusa, Thespesia populnea, Delonix regia and Peltophorum petrocarpum. This is the first report of the fungus in Oman and on A. lebbeck, T. populnea, D. regia and P. petrocarpum. The strain of this fungus has not been found to cause human disease in Oman.

Detoxification of Toxic Phorbol Esters from Malaysian Jatropha curcas Linn. Kernel by Trichoderma spp. and Endophytic Fungi

PubMed Central

Najjar, Azhar; Abdullah, Norhani; Saad, Wan Zuhainis; Ahmad, Syahida; Oskoueian, Ehsan; Abas, Faridah; Gherbawy, Youssuf

2014-01-01

The presence of phorbol esters (PEs) with toxic properties limits the use of Jatropha curcas kernel in the animal feed industry. Therefore, suitable methods to detoxify PEs have to be developed to render the material safe as a feed ingredient. In the present study, the biological treatment of the extracted PEs-rich fraction with non-pathogenic fungi (Trichoderma harzianum JQ350879.1, T. harzianum JQ517493.1, Paecilomyces sinensis JQ350881.1, Cladosporium cladosporioides JQ517491.1, Fusarium chlamydosporum JQ350882.1, F. chlamydosporum JQ517492.1 and F. chlamydosporum JQ350880.1) was conducted by fermentation in broth cultures. The PEs were detected by liquid chromatography-diode array detector-electrospray ionization mass spectrometry (LC-DAD-ESIMS) and quantitatively monitored by HPLC using phorbol-12-myristate 13-acetate as the standard. At day 30 of incubation, two T. harzianum spp., P. sinensis and C. cladosporioides significantly (p < 0.05) removed PEs with percentage losses of 96.9%–99.7%, while F. chlamydosporum strains showed percentage losses of 88.9%–92.2%. All fungal strains could utilize the PEs-rich fraction for growth. In the cytotoxicity assay, cell viabilities of Chang liver and NIH 3T3 fibroblast cell lines were less than 1% with the untreated PEs-rich fraction, but 84.3%–96.5% with the fungal treated PEs-rich fraction. There was no inhibition on cell viability for normal fungal growth supernatants. To conclude, Trichoderma spp., Paecilomyces sp. and Cladosporium sp. are potential microbes for the detoxification of PEs. PMID:24504029

Fungal diversity in adult date palm (Phoenix dactylifera L.) revealed by culture-dependent and culture-independent approaches*

PubMed Central

Ben Chobba, Ines; Elleuch, Amine; Ayadi, Imen; Khannous, Lamia; Namsi, Ahmed; Cerqueira, Frederique; Drira, Noureddine; Gharsallah, Néji; Vallaeys, Tatiana

2013-01-01

Endophytic flora plays a vital role in the colonization and survival of host plants, especially in harsh environments, such as arid regions. This flora may, however, contain pathogenic species responsible for various troublesome host diseases. The present study is aimed at investigating the diversity of both cultivable and non-cultivable endophytic fungal floras in the internal tissues (roots and leaves) of Tunisian date palm trees (Phoenix dactylifera). Accordingly, 13 isolates from both root and leaf samples, exhibiting distinct colony morphology, were selected from potato dextrose agar (PDA) medium and identified by a sequence match search wherein their 18S–28S internal transcribed spacer (ITS) sequences were compared to those available in public databases. These findings revealed that the cultivable root and leaf isolates fell into two groups, namely Nectriaceae and Pleosporaceae. Additionally, total DNA from palm roots and leaves was further extracted and ITS fragments were amplified. Restriction fragment length polymorphism (RFLP) analysis of the ITS from 200 fungal clones (leaves: 100; roots: 100) using HaeIII restriction enzyme revealed 13 distinct patterns that were further sequenced and led to the identification of Alternaria, Cladosporium, Davidiella (Cladosporium teleomorph), Pythium, Curvularia, and uncharacterized fungal endophytes. Both approaches confirmed that while the roots were predominantly colonized by Fusaria (members of the Nectriaceae family), the leaves were essentially colonized by Alternaria (members of the Pleosporaceae family). Overall, the findings of the present study constitute, to the authors’ knowledge, the first extensive report on the diversity of endophytic fungal flora associated with date palm trees (P. dactylifera). PMID:24302709

Detoxification of toxic phorbol esters from Malaysian Jatropha curcas Linn. kernel by Trichoderma spp. and endophytic fungi.

PubMed

Najjar, Azhar; Abdullah, Norhani; Saad, Wan Zuhainis; Ahmad, Syahida; Oskoueian, Ehsan; Abas, Faridah; Gherbawy, Youssuf

2014-02-05

The presence of phorbol esters (PEs) with toxic properties limits the use of Jatropha curcas kernel in the animal feed industry. Therefore, suitable methods to detoxify PEs have to be developed to render the material safe as a feed ingredient. In the present study, the biological treatment of the extracted PEs-rich fraction with non-pathogenic fungi (Trichoderma harzianum JQ350879.1, T. harzianum JQ517493.1, Paecilomyces sinensis JQ350881.1, Cladosporium cladosporioides JQ517491.1, Fusarium chlamydosporum JQ350882.1, F. chlamydosporum JQ517492.1 and F. chlamydosporum JQ350880.1) was conducted by fermentation in broth cultures. The PEs were detected by liquid chromatography-diode array detector-electrospray ionization mass spectrometry (LC-DAD-ESIMS) and quantitatively monitored by HPLC using phorbol-12-myristate 13-acetate as the standard. At day 30 of incubation, two T. harzianum spp., P. sinensis and C. cladosporioides significantly (p < 0.05) removed PEs with percentage losses of 96.9%-99.7%, while F. chlamydosporum strains showed percentage losses of 88.9%-92.2%. All fungal strains could utilize the PEs-rich fraction for growth. In the cytotoxicity assay, cell viabilities of Chang liver and NIH 3T3 fibroblast cell lines were less than 1% with the untreated PEs-rich fraction, but 84.3%-96.5% with the fungal treated PEs-rich fraction. There was no inhibition on cell viability for normal fungal growth supernatants. To conclude, Trichoderma spp., Paecilomyces sp. and Cladosporium sp. are potential microbes for the detoxification of PEs.

Viability of Cladosporium herbarum spores under 157 nm laser and vacuum ultraviolet irradiation, low temperature (10 K) and vacuum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarantopoulou, E., E-mail: esarant@eie.gr; Stefi, A.; Kollia, Z.

Ultraviolet photons can damage microorganisms, which rarely survive prolonged irradiation. In addition to the need for intact DNA, cell viability is directly linked to the functionality of the cell wall and membrane. In this work, Cladosporium herbarum spore monolayers exhibit high viability (7%) when exposed to 157 nm laser irradiation (412 kJm⁻²) or vacuum-ultraviolet irradiation (110–180 nm) under standard pressure and temperature in a nitrogen atmosphere. Spore viability can be determined by atomic-force microscopy, nano-indentation, mass, μ-Raman and attenuated reflectance Fourier-transform far-infrared spectroscopies and DNA electrophoresis. Vacuum ultraviolet photons cause molecular damage to the cell wall, but radiation resistance inmore » spores arises from the activation of a photon-triggered signaling reaction, expressed via the exudation of intracellular substances, which, in combination with the low penetration depth of vacuum-ultraviolet photons, shields DNA from radiation. Resistance to phototoxicity under standard conditions was assessed, as was resistance to additional environmental stresses, including exposure in a vacuum, under different rates of change of pressure during pumping time and low (10 K) temperatures. Vacuum conditions were far more destructive to spores than vacuum-ultraviolet irradiation, and UV-B photons were two orders of magnitude more damaging than vacuum-ultraviolet photons. The viability of irradiated spores was also enhanced at 10 K. This work, in addition to contributing to the photonic control of the viability of microorganisms exposed under extreme conditions, including decontamination of biological warfare agents, outlines the basis for identifying bio-signaling in vivo using physical methodologies.« less

Microbial diversity in biodeteriorated Greek historical documents dating back to the 19th and 20th century: A case study.

PubMed

Karakasidou, Kiriaki; Nikolouli, Katerina; Amoutzias, Grigoris D; Pournou, Anastasia; Manassis, Christos; Tsiamis, George; Mossialos, Dimitris

2018-02-27

Paper documents in archives, libraries, and museums often undergo biodeterioration by microorganisms. Fungi and less often bacteria have been described to advance paper staining, so called "foxing" and degradation of paper substrates. In this study, for the first time, the fungal and bacterial diversity in biodeteriorated paper documents of Hellenic General State Archives dating back to the 19th and 20th century has been assessed by culture-dependent and independent methods. The internally transcribed spacer (ITS) region and 16S rRNA gene were amplified by PCR from fungal and bacterial isolates and amplicons were sequenced. Sequence analysis and phylogeny revealed fungal phylotypes like Penicillium sp., Cladosporium sp., Penicillium citrinum, Alternaria infectoria, Alternaria alternata, Epicoccum nigrum, and Penicillium chrysogenum which are often implicated in paper deterioration. Bacterial phylotypes closely related to known biodeteriogenic bacteria such as Bacillus spp., Micrococcus spp., Kocuria sp. in accordance with previous studies were characterized. Among the fungal phylotypes described in this study are included well-known allergens such as Penicillium spp., Alternaria spp., and Cladosporium spp. that impose a serious health threat on staff members and scholars. Furthermore, fungal isolates such as Chalastospora gossypii and Trametes ochracea have been identified and implicated in biodeterioration of historical paper manuscripts in this study for the first time. Certain new or less known fungi and bacteria implicated in paper degradation were retrieved, indicating that particular ambient conditions, substrate chemistry, or even location might influence the composition of colonizing microbiota. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Use of the selective agar medium CREAD for monitoring the level of airborne spoilage moulds in cheese production.

PubMed

Kure, Cathrine Finne; Borch, Elisabeth; Karlsson, Ingela; Homleid, Jens Petter; Langsrud, Solveig

2008-02-29

It was investigated if a selective medium for common cheese spoiling moulds (CREAD) could give more relevant information than a general mould medium in hygienic air-sampling in cheese factories. A total of 126 air-samples were taken in six Nordic cheese factories using the general mould medium DG18 and CREAD. The level and genera of air-borne mould was determined. Identification to species-level was performed for a selection of samples. In five cheese factories the mycobiota was dominated by Penicillium spp. and in one cheese factory by Cladosporium spp. The concentration of air-borne moulds varied between the cheese factories ranging from 1 to 270 cfu/m3 on DG18 with a median value of 17. The number of mould colonies was in general lower at CREAD. Identification indicated that CREAD supported growth of common spoilage moulds for cheese, such as Penicillium palitans and P. commune. The mycobiota on DG18 also consisted of moulds not commonly associated with spoilage of cheese, such as Cladosporium spp., P. brevicompactum and P. chrysogenum. Contamination of cheese with mould is periodically a problem in production of semi-hard cheese and the level of air-borne mould is therefore routinely monitored in cheese factories. A clear correlation between the total number of moulds in air and mould growth on products is not always found. The conclusion from the investigation is that it is recommended to use a selective medium for cheese spoilage moulds, such as CREAD in hygienic monitoring.

Quantitative evaluation of protocorm growth and fungal colonization in Bletilla striata (Orchidaceae) reveals less-productive symbiosis with a non-native symbiotic fungus.

PubMed

Yamamoto, Tatsuki; Miura, Chihiro; Fuji, Masako; Nagata, Shotaro; Otani, Yuria; Yagame, Takahiro; Yamato, Masahide; Kaminaka, Hironori

2017-02-21

In nature, orchid plants depend completely on symbiotic fungi for their nutrition at the germination and the subsequent seedling (protocorm) stages. However, only limited quantitative methods for evaluating the orchid-fungus interactions at the protocorm stage are currently available, which greatly constrains our understanding of the symbiosis. Here, we aimed to improve and integrate quantitative evaluations of the growth and fungal colonization in the protocorms of a terrestrial orchid, Blettila striata, growing on a plate medium. We achieved both symbiotic and asymbiotic germinations for the terrestrial orchid B. striata. The protocorms produced by the two germination methods grew almost synchronously for the first three weeks. At week four, however, the length was significantly lower in the symbiotic protocorms. Interestingly, the dry weight of symbiotic protocorms did not significantly change during the growth period, which implies that there was only limited transfer of carbon compounds from the fungus to the protocorms in this relationship. Next, to evaluate the orchid-fungus interactions, we developed an ink-staining method to observe the hyphal coils in protocorms without preparing thin sections. Crushing the protocorm under the coverglass enables us to observe all hyphal coils in the protocorms with high resolution. For this observation, we established a criterion to categorize the stages of hyphal coils, depending on development and degradation. By counting the symbiotic cells within each stage, it was possible to quantitatively evaluate the orchid-fungus symbiosis. We describe a method for quantitative evaluation of orchid-fungus symbiosis by integrating the measurements of plant growth and fungal colonization. The current study revealed that although fungal colonization was observed in the symbiotic protocorms, the weight of the protocorm did not significantly increase, which is probably due to the incompatibility of the fungus in this symbiosis. These results suggest that fungal colonization and nutrition transfer can be differentially regulated in the symbiosis. The evaluation methods developed in this study can be used to study various quantitative aspects of the orchid-fungus symbiosis.

FLUORESCENT-SERIOLOGICAL INVESTIGATIONS OF A PATHOGENIC FUNGUS (SPOROTRICHUM SCHENCKII),

DTIC Science & Technology

coloration of numerous other species of fungus no cross reactions with Sporotrichum schenkii were found. The use of this fluorescent coloring method for the diagnosis of Sporotrichosis is suggested. (Author)

Athlete's Foot

MedlinePlus

... this page. Please enable Javascript in your browser. Athlete's Foot Athlete's foot is a skin infection caused by fungus. A ... the body; on the foot, it is called athlete’s foot, or tinea pedis. Fungus commonly attacks the feet ...

The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

PubMed

Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

2010-03-01

The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

The Hidden Habit of the Entomopathogenic Fungus Beauveria bassiana: First Demonstration of Vertical Plant Transmission

PubMed Central

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120–140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum. PMID:24551242

Distribution and environmental persistence of the causative agent of white-nose syndrome, Geomyces destructans, in bat hibernacula of the eastern United States

USGS Publications Warehouse

Lorch, Jeffrey M.; Muller, Laura K.; Russell, Robin E.; O'Connor, Michael; Lindner, Daniel L.; Blehert, David S.

2013-01-01

White-nose syndrome (WNS) is an emerging disease of hibernating bats caused by the recently described fungus Geomyces destructans. First isolated in 2008, the origins of this fungus in North America and its ability to persist in the environment remain undefined. To investigate the correlation between manifestation of WNS and distribution of G. destructans in the U.S., we analyzed sediment samples collected from 55 bat hibernacula (caves and mines) both within and outside the known range of WNS using a newly developed real-time PCR assay. Geomyces destructans was detected in 17 of 21 sites within the known range of WNS at the time the samples were collected; the fungus was not found in 28 sites beyond the known range of the disease at the time that environmental samples were collected. These data indicate that distribution of G. destructans is correlated with disease in hibernating bats and support the hypothesis that the fungus is likely an exotic species in North America. Additionally, we examined whether G. destructans persists in infested bat hibernacula when bats are absent. Sediment samples were collected from 14 WNS-positive hibernacula, and the samples were screened for viable fungus using a culture technique. Viable G. destructans was cultivated from 7 of the 14 sites sampled during late summer when bats were no longer in hibernation, suggesting the fungus can persist in the environment in the absence of bat hosts for long periods of time.

The hidden habit of the entomopathogenic fungus Beauveria bassiana: first demonstration of vertical plant transmission.

PubMed

Quesada-Moraga, Enrique; López-Díaz, Cristina; Landa, Blanca Beatriz

2014-01-01

Beauveria bassiana strain 04/01-Tip, obtained from a larva of the opium poppy stem gall wasp Iraella luteipes (Hymenoptera; Cynipidae), endophytically colonizes opium poppy (Papaver somniferum L.) plants and protects them against this pest. The goal of this study was to monitor the dynamics of endophytic colonization of opium poppy by B. bassiana after the fungus was applied to the seed and to ascertain whether the fungus is transmitted vertically via seeds. Using a species-specific nested PCR protocol and DNA extracted from surface-sterilised leaf pieces or seeds of B. bassiana-inoculated opium poppy plants, the fungus was detected within the plant beginning at the growth stage of rosette building and them throughout the entire plant growth cycle (about 120-140 days after sowing). The fungus was also detected in seeds from 50% of the capsules sampled. Seeds that showed positive amplification for B. bassiana were planted in sterile soil and the endophyte was again detected in more than 42% of the plants sampled during all plant growth stages. Beauveria bassiana was transmitted to seeds in 25% of the plants from the second generation that formed a mature capsule. These results demonstrate for the first time the vertical transmission of an entomopathogenic fungus from endophytically colonised maternal plants. This information is crucial to better understand the ecological role of entomopathogenic fungi as plant endophytes and may allow development of a sustainable and cost effective strategy for I. luteipes management in P. somniferum.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence andmore » three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.« less

Trichoderma virens as a biocontrol of Toxocara canis: In vivo evaluation.

PubMed

de Souza Maia Filho, Fernando; da Silva Fonseca, Anelise Oliveira; Persici, Beatriz Maroneze; de Souza Silveira, Julia; Braga, Caroline Quintana; Pötter, Luciana; de Avila Botton, Sônia; Brayer Pereira, Daniela Isabel

Microorganisms have been widely studied as biological control agents of parasites of medical and veterinary importance. Coprophagous arthropods, bacteria and fungi are among the different organisms evaluated as potential biological control agents. Nematophagous fungi capture and digest the free forms of nematodes in the soil. Due to its zoonotic potential, Toxocara canis have been brought to the attention of researchers. The aim of the present study was to determine whether the administration of embryonated T. canis eggs exposed to the nematophagous fungus Trichoderma virens reduces parasite infection in experimental animals. Embryonated T. canis eggs were exposed to T. virens mycelium for 15 days at 25°C. Subsequently, 100 fungus-exposed eggs were orally administered to 20 Swiss mice. As a positive control, another 20 mice received 100 embryonated eggs that were not exposed to the fungus. After 48h, the animals were killed, and heart, lungs and liver were harvested for the recovery of larvae. The organs of the animals that received embryonated T. canis eggs exposed to the fungus showed a lower mean larval recovery when compared with the animals that received embryonated eggs without fungus exposure (p<0.05). The exposure of T. canis eggs to T. virens reduces the experimental infection, demonstrating the potential of this nematophagous fungus as a biocontrol agent. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Fungus-insect gall of Phlebopus portentosus.

PubMed

Zhang, Chun-Xia; He, Ming-Xia; Cao, Yang; Liu, Jing; Gao, Feng; Wang, Wen-Bing; Ji, Kai-Ping; Shao, Shi-Cheng; Wang, Yun

2015-01-01

Phlebopus portentosus is a popular edible wild mushroom found in the tropical Yunnan, China, and northern Thailand. In its natural habitats, a gall often has been found on some plant roots, around which fungal fruiting bodies are produced. The galls are different from common insect galls in that their cavity walls are not made from plant tissue but rather from the hyphae of P. portentosus. Therefore we have termed this phenomenon "fungus-insect gall". Thus far six root mealy bug species in the family Pseudococcidae that form fungus-insect galls with P. portentosus have been identified: Formicococcus polysperes, Geococcus satellitum, Planococcus minor, Pseudococcus cryptus, Paraputo banzigeri and Rastrococcus invadens. Fungus-insect galls were found on the roots of more than 21 plant species, including Delonix regia, Citrus maxima, Coffea arabica and Artocarpus heterophyllus. Greenhouse inoculation trials showed that fungus-insect galls were found on the roots of A. heterophyllus 1 mo after inoculation. The galls were subglobose to globose, fulvous when young and became dark brown at maturation. Each gall harbored one or more mealy bugs and had a chimney-like vent for ventilation and access to the gall. The cavity wall had three layers. Various shaped mealy bug wax deposits were found inside the wall. Fungal hyphae invaded the epidermis of plant roots and sometimes even the cortical cells during the late stage of gall development. The identity of the fungus inside the cavity was confirmed by molecular methods. © 2015 by The Mycological Society of America.

Viral repression of fungal pheromone precursor gene expression.

PubMed

Zhang, L; Baasiri, R A; Van Alfen, N K

1998-02-01

Biological control of chestnut blight caused by the filamentous ascomycete Cryphonectria parasitica can be achieved with a virus that infects this fungus. This hypovirus causes a perturbation of fungal development that results in low virulence (hypovirulence), poor asexual sporulation, and female infertility without affecting fungal growth in culture. At the molecular level, the virus is known to affect the transcription of a number of fungal genes. Two of these genes, Vir1 and Vir2, produce abundant transcripts in noninfected strains of the fungus, but the transcripts are not detectable in virus-infected strains. We report here that these two genes encode the pheromone precursors of the Mat-2 mating type of the fungus; consequently, these genes have been renamed Mf2/1 and Mf2/2. To determine if the virus affects the mating systems of both mating types of this fungus, the pheromone precursor gene, Mf1/1, of a Mat-1 strain was cloned and likewise was found to be repressed in virus-infected strains. The suppression of transcription of the pheromone precursor genes of this fungus could be the cause of the mating defect of infected strains of the fungus. Although published reports suggest that a G alpha(i) subunit may be involved in this regulation, our results do not support this hypothesis. The prepropheromone encoded by Mf1/1 is structurally similar to that of the prepro-p-factor of Schizosaccharomyces pombe. This is the first description of the complete set of pheromone precursor genes encoded by a filamentous ascomycete.

Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens.

PubMed

Aylward, Frank O; Burnum, Kristin E; Scott, Jarrod J; Suen, Garret; Tringe, Susannah G; Adams, Sandra M; Barry, Kerrie W; Nicora, Carrie D; Piehowski, Paul D; Purvine, Samuel O; Starrett, Gabriel J; Goodwin, Lynne A; Smith, Richard D; Lipton, Mary S; Currie, Cameron R

2012-09-01

Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant neotropical herbivores cultivate symbiotic fungus gardens on large quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers. Using metagenomic and metaproteomic techniques, we characterize the bacterial diversity and physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter and Escherichia. We show that these bacterial communities possess genes associated with lignocellulose degradation and diverse biosynthetic pathways, suggesting that they play a role in nutrient cycling by converting the nitrogen-poor forage of the ants into B-vitamins, amino acids and other cellular components. Our metaproteomic analysis confirms that bacterial glycosyl hydrolases and proteins with putative biosynthetic functions are produced in both field-collected and laboratory-reared colonies. These results are consistent with the hypothesis that fungus gardens are specialized fungus-bacteria communities that convert plant material into energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities in the ecology and evolution of herbivorous metazoans.

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat

PubMed Central

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L.; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F.; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A.; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici. Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei. Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus. PMID:28018377

An LRR/Malectin Receptor-Like Kinase Mediates Resistance to Non-adapted and Adapted Powdery Mildew Fungi in Barley and Wheat.

PubMed

Rajaraman, Jeyaraman; Douchkov, Dimitar; Hensel, Götz; Stefanato, Francesca L; Gordon, Anna; Ereful, Nelzo; Caldararu, Octav F; Petrescu, Andrei-Jose; Kumlehn, Jochen; Boyd, Lesley A; Schweizer, Patrick

2016-01-01

Pattern recognition receptors (PRRs) belonging to the multigene family of receptor-like kinases (RLKs) are the sensing devices of plants for microbe- or pathogen-associated molecular patterns released from microbial organisms. Here we describe Rnr8 (for Required for non-host resistance 8 ) encoding HvLEMK1, a LRR-malectin domain-containing transmembrane RLK that mediates non-host resistance of barley to the non-adapted wheat powdery mildew fungus Blumeria graminis f.sp. tritici . Transgenic barley lines with silenced HvLEMK1 allow entry and colony growth of the non-adapted pathogen, although sporulation was reduced and final colony size did not reach that of the adapted barley powdery mildew fungus B. graminis f.sp. hordei . Transient expression of the barley or wheat LEMK1 genes enhanced resistance in wheat to the adapted wheat powdery mildew fungus while expression of the same genes did not protect barley from attack by the barley powdery mildew fungus. The results suggest that HvLEMK1 is a factor mediating non-host resistance in barley and quantitative host resistance in wheat to the wheat powdery mildew fungus.

Unintentional ingestion of Cordyceps fungus-infected cicada nymphs causing ibotenic acid poisoning in Southern Vietnam.

PubMed

Doan, Uyen Vy; Mendez Rojas, Bomar; Kirby, Ralph

2017-09-01

Cordyceps fungus found in infected cicada nymphs ("cicada flowers") is utilized in traditional Chinese medicine. Cordyceps fungus toxicity in humans has not been previously reported. We report 60 cases of apparent Cordyceps poisoning in Southern Vietnam. We retrospectively collected demographic and clinical data from the medical records (21 cases) and by telephone interview (39 cases) of patients admitted to seven hospitals in Southern Vietnam following ingestion of cicada flowers between 2008 and 2015. We also determined the species of Cordyceps present in the cicada flowers and performed a partial chemical analysis of the fungus. Sixty cases of toxic effects following ingestion of cicada flowers were documented. Symptom onset occurred within 60 minutes following ingestion. Symptoms included dizziness, vomiting, salivation, mydriasis, jaw stiffness, urinary retention, seizures, agitated delirium, hallucinations, somnolence and coma. None of the patients suffered liver or kidney injury. There was one fatality. The Cordyceps fungus involved in these poisoning was identified as Ophiocordyceps heteropoda. The presence of ibotenic acid was confirmed, but musimol and muscarine were absent. Cicada infected with Ophiocordyceps heteropoda in Vietnam contain ibotenic acid and are associated with a clinical syndrome consistent with its effects.

Fabrication of a superhydrophobic surface with fungus-cleaning properties on brazed aluminum for industrial application in heat exchangers

NASA Astrophysics Data System (ADS)

Lee, Jeong-Won; Hwang, Woonbong

2018-06-01

Extensive research has been carried out concerning the application of superhydrophobic coating in heat exchangers, but little is known about the application of this technique to brazed aluminum heat exchangers (BAHEs). In this work, we describe a new superhydrophobic coating method, which is suitable for BAHE use on an industrial scale. We first render the BAHE superhydrophobic by fabricating micro/nanostructures using solution dipping followed by fluorination. After the complete removal of the silicon residue, we verify using surface analysis that the BAHE surface is perfectly superhydrophobic. We also studied the fungus-cleaning properties of the superhydrophobic surface by growing fungus for 4 weeks in a moist environment on BAHE fins with and without superhydrophobic coating. We observed that, whereas the fungus grown on the untreated fins is extremely difficult to remove, the fungus on the fins with the superhydrophobic coating can be removed easily with only a modest amount of water. We also found that the coated BAHE fins exhibit excellent resistance to moisture. The superhydrophobic coating method that we propose is therefore expected to have a major impact in the heating, ventilating and air conditioning industry market.

Vertical transmission as the key to the colonization of Madagascar by fungus-growing termites?

PubMed Central

Nobre, T.; Eggleton, P.; Aanen, D. K.

2010-01-01

The mutualism between fungus-growing termites (Macrotermitinae) and their mutualistic fungi (Termitomyces) began in Africa. The fungus-growing termites have secondarily colonized Madagascar and only a subset of the genera found in Africa is found on this isolated island. Successful long-distance colonization may have been severely constrained by the obligate interaction of the termites with fungal symbionts and the need to acquire these symbionts secondarily from the environment for most species (horizontal symbiont transmission). Consistent with this hypothesis, we show that all extant species of fungus-growing termites of Madagascar are the result of a single colonization event of termites belonging to one of the only two groups with vertical symbiont transmission, and we date this event at approximately 13 Mya (Middle/Upper Miocene). Vertical symbiont transmission may therefore have facilitated long-distance dispersal since both partners disperse together. In contrast to their termite hosts, the fungal symbionts have colonized Madagascar multiple times, suggesting that the presence of fungus-growing termites may have facilitated secondary colonizations of the symbiont. Our findings indicate that the absence of the right symbionts in a new environment can prevent long-distance dispersal of symbioses relying on horizontal symbiont acquisition. PMID:19828546

Serine proteases activity is important for the interaction of nematophagous fungus Duddingtonia flagrans with infective larvae of trichostrongylides and free-living nematodes Panagrellus spp.

PubMed

Cruz, Daniela G; Costa, Luana M; Rocha, Letícia O; Retamal, Claudio A; Vieira, Ricardo A M; Seabra, Sergio H; Silva, Carlos P; DaMatta, Renato A; Santos, Clóvis P

2015-08-01

The nematode-trapping fungus Duddingtonia flagrans has been studied as a possible control method for gastrointestinal nematodes of livestock animals. These fungi capture and infect the nematode by cuticle penetration, immobilization, and digestion of the internal contents. It has been suggested that this sequence of events occurs by a combination of physical and enzymatical activities. The aim of this study was to investigate the participation of proteolytic enzymatic activity during the interaction of the nematophagous fungus D. flagrans with infective larvae of trichostrongylides and the free-living nematode Panagrellus spp. Protease inhibitors used interfered in the predatory activity of D. flagrans. However, only PMSF significantly reduced the mean number of Panagrellus spp. captured by D. flagrans in comparison with the control. The experiment with fluorogenic substrate showed that maximum urokinase activity during the interaction of the fungus with the infective larvae of trichostrongylides or Panagrellus spp. occurred within 7 or 1 h of incubation, respectively. The protease activity, especially of the serine class, may be important during the interaction between the fungus and nematodes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

[Biochemical basis of tolerance to osmotic stress in phytopathogenic fungus: The case of Macrophomina phaseolina (Tassi) Goid.

PubMed

Martínez-Villarreal, Rodolfo; Garza-Romero, Tamar S; Moreno-Medina, Víctor R; Hernández-Delgado, Sanjuana; Mayek-Pérez, Netzahualcoyotl

Fungus Macrophomina phaseolina (Tassi) Goid. is the causative agent of charcoal rot disease which causes significant yield losses in major crops such as maize, sorghum, soybean and common beans in Mexico. This fungus is a facultative parasite which shows broad ability to adapt itself to stressed environments where water deficits and/or high temperature stresses commonly occur. These environmental conditions are common for most cultivable lands throughout Mexico. Here we describe some basic facts related to the etiology and epidemiology of the fungus as well as to the importance of responses to stressed environments, particularly to water deficits, based on morphology and growth traits, as well as on physiology, biochemistry and pathogenicity of fungus M. phaseolina. To conclude, we show some perspectives related to future research into the genus, which emphasize the increasing need to improve the knowledge based on the application of both traditional and biotechnological tools in order to elucidate the mechanisms of resistance to environmental stress which can be extrapolated to other useful organisms to man. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Ethanol Production from Various Sugars and Cellulosic Biomass by White Rot Fungus Lenzites betulinus.

PubMed

Im, Kyung Hoan; Nguyen, Trung Kien; Choi, Jaehyuk; Lee, Tae Soo

2016-03-01

Lenzites betulinus, known as gilled polypore belongs to Basidiomycota was isolated from fruiting body on broadleaf dead trees. It was found that the mycelia of white rot fungus Lenzites betulinus IUM 5468 produced ethanol from various sugars, including glucose, mannose, galactose, and cellobiose with a yield of 0.38, 0.26, 0.07, and 0.26 g of ethanol per gram of sugar consumed, respectively. This fungus relatively exhibited a good ethanol production from xylose at 0.26 g of ethanol per gram of sugar consumed. However, the ethanol conversion rate of arabinose was relatively low (at 0.07 g of ethanol per gram sugar). L. betulinus was capable of producing ethanol directly from rice straw and corn stalks at 0.22 g and 0.16 g of ethanol per gram of substrates, respectively, when this fungus was cultured in a basal medium containing 20 g/L rice straw or corn stalks. These results indicate that L. betulinus can produce ethanol efficiently from glucose, mannose, and cellobiose and produce ethanol very poorly from galactose and arabinose. Therefore, it is suggested that this fungus can ferment ethanol from various sugars and hydrolyze cellulosic materials to sugars and convert them to ethanol simultaneously.

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2012 CFR

2012-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2013 CFR

2013-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

46 CFR 164.018-9 - Design requirements.

Code of Federal Regulations, 2011 CFR

2011-10-01

... with the “fungus resistance” test method listed in § 164.018-11, retroreflective material must not support fungus growth, and the reflective intensity of the material must be equal to or greater than the...

Genetic Recombination

ERIC Educational Resources Information Center

Whitehouse, H. L. K.

1973-01-01

Discusses the mechanisms of genetic recombination with particular emphasis on the study of the fungus Sordaria brevicollis. The study of recombination is facilitated by the use of mutants of this fungus in which the color of the ascospores is affected. (JR)

Chemical constituents of the mangrove-associated fungus Capnodium sp. SZ-F22. A new eremophilane sesquiterpene.

PubMed

He, Haibing; Ma, Zhongjun; Wang, Qianqian; Liu, Yu; Xu, Hualin

2016-07-01

A new eremophilane sesquiterpene, capnodiumone (1), along with five known eremophilane sesquiterpenes (2-6) and eight other compounds (7-14), have been isolated from a mangrove-associated fungus Capnodium sp. SZ-F22. The chemical structures were elucidated on the basis of extensive spectroscopic analysis. The broth extract of the fungus exhibited a good inhibitory effect on the mycelium growth against Fusarium graminearum at 100 μg/mL, however, all the 14 compounds showed no expected antifungal activity. The probable reasons were discussed.

The research of using Co-60 γ ray to sterilize different mediums for edible fungus

NASA Astrophysics Data System (ADS)

Guozhu, Li; Zhenqian, Guan; Hengshou, Zhao

1993-10-01

The present experiment has been carried out by using different dosage of Co—60 γ ray for radiation sterilization of five kinds of cultural materials of edible fungus, The results indicated that sterilization dosage of sawdust is 22 kGy. that of cotton—seed shell and the rest are 26 kGy. We conclude that using Co-60 γ ray to sterilize the cultura 1 materials of edible fungus is a secure and saving labor and energy new method which could sterilize thoroughly.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Colonization of soil by Histoplasma capsulatum: II. Effect of bat guano added to an area of reduced colonization.

PubMed

Hasenclever, H F; Piggott, W R

1976-07-01

Application of bat guano to an area with reduced but detectable colonization by Histoplasma capsulatum had no quantitative effect on the fungus. After seeding the guano treated area and an untreated area with a soil culture of the fungus, a quantitative effect was noted in the treated area but the period of survival did not appear to be extended. Twenty-four months after seeding, the fungus was no longer detectable in the study areas and they have remained negative for more than a year.

Process for producing ethanol from plant biomass using the fungus paecilomyces sp.

DOEpatents

Wu, Jung Fu

1989-01-01

A process for producing ethanol from plant biomass is disclosed. The process in cludes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces, which has the ability to ferment both cellobiose and xylose to ethanol, is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate.

Process for producing ethanol from plant biomass using the fungus Paecilomyces sp

DOEpatents

Wu, J.F.

1985-08-08

A process for producing ethanol from plant biomass is disclosed. The process includes forming a substrate from the biomass with the substrate including hydrolysates of cellulose and hemicellulose. A species of the fungus Paecilomyces which has the ability to ferment both cellobiose and xylose to ethanol is then selected and isolated. The substrate is inoculated with this fungus, and the inoculated substrate is then fermented under conditions favorable for cell viability and conversion of hydrolysates to ethanol. Finally, ethanol is recovered from the fermented substrate. 5 figs., 3 tabs.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia.

PubMed

Gabriel, Frédéric; D'Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-02-09

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries.

A disseminated infection with the antifungal-multiresistant teleomorphic fungus Neocosmospora vasinfecta in a patient with acute B-lymphoblastic leukemia

PubMed Central

Gabriel, Frédéric; D’Almeida, Mahussi; Albert, Olivier; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2013-01-01

We report on a fatal invasive infection due to the ascomycetous fungus Neocosmospora vasinfecta, in a 20-year-old European patient suffering from an acute lymphoblastic leukemia. The infection could not be controlled by a bitherapy combining liposomal amphotericin B and voriconazole. This is the second case of disseminated infection reported with this unusual fungus, which develops under its teleomorphic state, is fully resistant to all systemic antifungals, and which is known to live in tropical countries. PMID:24432214

Triterpenes and saponins from Rudgea viburnioides.

PubMed

Young, M C; Araújo, A R; da Silva, C A; Lopes, M N; Trevisan, L M; Bolzani, V S

1998-07-01

A novel triterpene, viburgenin (1), has been isolated from an extract of the ripe fruit rinds of Rudgea viburnioides, together with the known saponins, arjunglucoside I and trachelosperosides B-1 and E-1, and the triterpenes trachelosperogenin B (2) and arjungenin. Compound 2 was previously obtained as a product from enzymatic hydrolysis, and it is reported for the first time as a natural product. The structure of compound 1 was determined as 2alpha,3beta, 19alpha,23,24-pentahydroxyurs-12-ene by extensive use of 1D and 2D NMR spectroscopic methods. Compound 1 exhibited moderate antifungal activity against Cladosporium cladosporioides.

Endoglucanase production by paper-degrading mycoflora.

PubMed

Das, M K; Prasad, J S; Ahmad, S K

1997-11-01

Fourteen fungal species, namely Aspergillus flavus, A. fumigatus, A. niger, A. ustus, Penicillium islandicum, P. wortmannii, Memnoniella echinata, Cladosporium herbarum, Stachybotrys atra, Chaetomium globosum, Fusarium oxysporum, Torula herbarum, Alternaria alternata and Curvularia uncinata were isolated from different grades of paper. They differ in their distribution on various kinds of paper and also in relative occurrence. While seasonal influence on mycoflora was observed, most of the moulds were capable of growing in all three seasons examined (summer, winter, rainy season). The moulds were cellulolytic in nature and endoglucanase activity was greatest in Aspergillus flavus, A. niger, A. fumigatus, P. wortmannii and P. islandicum.

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites

PubMed Central

Pedersen, Kristine S. K.; Aanen, Duur K.

2017-01-01

ABSTRACT Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ. Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. PMID:29269491

Enzyme Activities at Different Stages of Plant Biomass Decomposition in Three Species of Fungus-Growing Termites.

PubMed

da Costa, Rafael R; Hu, Haofu; Pilgaard, Bo; Vreeburg, Sabine M E; Schückel, Julia; Pedersen, Kristine S K; Kračun, Stjepan K; Busk, Peter K; Harholt, Jesper; Sapountzis, Panagiotis; Lange, Lene; Aanen, Duur K; Poulsen, Michael

2018-03-01

Fungus-growing termites rely on mutualistic fungi of the genus Termitomyces and gut microbes for plant biomass degradation. Due to a certain degree of symbiont complementarity, this tripartite symbiosis has evolved as a complex bioreactor, enabling decomposition of nearly any plant polymer, likely contributing to the success of the termites as one of the main plant decomposers in the Old World. In this study, we evaluated which plant polymers are decomposed and which enzymes are active during the decomposition process in two major genera of fungus-growing termites. We found a diversity of active enzymes at different stages of decomposition and a consistent decrease in plant components during the decomposition process. Furthermore, our findings are consistent with the hypothesis that termites transport enzymes from the older mature parts of the fungus comb through young worker guts to freshly inoculated plant substrate. However, preliminary fungal RNA sequencing (RNA-seq) analyses suggest that this likely transport is supplemented with enzymes produced in situ Our findings support that the maintenance of an external fungus comb, inoculated with an optimal mixture of plant material, fungal spores, and enzymes, is likely the key to the extraordinarily efficient plant decomposition in fungus-growing termites. IMPORTANCE Fungus-growing termites have a substantial ecological footprint in the Old World (sub)tropics due to their ability to decompose dead plant material. Through the establishment of an elaborate plant biomass inoculation strategy and through fungal and bacterial enzyme contributions, this farming symbiosis has become an efficient and versatile aerobic bioreactor for plant substrate conversion. Since little is known about what enzymes are expressed and where they are active at different stages of the decomposition process, we used enzyme assays, transcriptomics, and plant content measurements to shed light on how this decomposition of plant substrate is so effectively accomplished. Copyright © 2018 da Costa et al.

76 FR 7095 - Avocados Grown in South Florida; Increased Assessment Rate

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-09

... Red Bay Ambrosia beetle. The beetle carries the Laurel Wilt fungus which can infect and kill avocado trees. Research into the beetle and fungus had been funded by the University of Florida. However, the...

Focus on Fungi

ERIC Educational Resources Information Center

Flannery, Maura C.

2004-01-01

A mention of "The Fungus Fighters: Two Women Scientists and Their Discovery" by Richard Baldwin and discovery of a huge fungus of the species Armillaria bulbosa and A. ostoyae are presented. Other aspects like fungal infections and shifting relationships are discussed.

Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.

PubMed

Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C

2018-03-01

An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.