Sample records for matrix model based

  1. Assessment of Matrix Multiplication Learning with a Rule-Based Analytical Model--"A Bayesian Network Representation"

    ERIC Educational Resources Information Center

    Zhang, Zhidong

    2016-01-01

    This study explored an alternative assessment procedure to examine learning trajectories of matrix multiplication. It took rule-based analytical and cognitive task analysis methods specifically to break down operation rules for a given matrix multiplication. Based on the analysis results, a hierarchical Bayesian network, an assessment model,…

  2. Interval-valued intuitionistic fuzzy matrix games based on Archimedean t-conorm and t-norm

    NASA Astrophysics Data System (ADS)

    Xia, Meimei

    2018-04-01

    Fuzzy game theory has been applied in many decision-making problems. The matrix game with interval-valued intuitionistic fuzzy numbers (IVIFNs) is investigated based on Archimedean t-conorm and t-norm. The existing matrix games with IVIFNs are all based on Algebraic t-conorm and t-norm, which are special cases of Archimedean t-conorm and t-norm. In this paper, the intuitionistic fuzzy aggregation operators based on Archimedean t-conorm and t-norm are employed to aggregate the payoffs of players. To derive the solution of the matrix game with IVIFNs, several mathematical programming models are developed based on Archimedean t-conorm and t-norm. The proposed models can be transformed into a pair of primal-dual linear programming models, based on which, the solution of the matrix game with IVIFNs is obtained. It is proved that the theorems being valid in the exiting matrix game with IVIFNs are still true when the general aggregation operator is used in the proposed matrix game with IVIFNs. The proposed method is an extension of the existing ones and can provide more choices for players. An example is given to illustrate the validity and the applicability of the proposed method.

  3. Estimation of Covariance Matrix on Bi-Response Longitudinal Data Analysis with Penalized Spline Regression

    NASA Astrophysics Data System (ADS)

    Islamiyati, A.; Fatmawati; Chamidah, N.

    2018-03-01

    The correlation assumption of the longitudinal data with bi-response occurs on the measurement between the subjects of observation and the response. It causes the auto-correlation of error, and this can be overcome by using a covariance matrix. In this article, we estimate the covariance matrix based on the penalized spline regression model. Penalized spline involves knot points and smoothing parameters simultaneously in controlling the smoothness of the curve. Based on our simulation study, the estimated regression model of the weighted penalized spline with covariance matrix gives a smaller error value compared to the error of the model without covariance matrix.

  4. A robust method of computing finite difference coefficients based on Vandermonde matrix

    NASA Astrophysics Data System (ADS)

    Zhang, Yijie; Gao, Jinghuai; Peng, Jigen; Han, Weimin

    2018-05-01

    When the finite difference (FD) method is employed to simulate the wave propagation, high-order FD method is preferred in order to achieve better accuracy. However, if the order of FD scheme is high enough, the coefficient matrix of the formula for calculating finite difference coefficients is close to be singular. In this case, when the FD coefficients are computed by matrix inverse operator of MATLAB, inaccuracy can be produced. In order to overcome this problem, we have suggested an algorithm based on Vandermonde matrix in this paper. After specified mathematical transformation, the coefficient matrix is transformed into a Vandermonde matrix. Then the FD coefficients of high-order FD method can be computed by the algorithm of Vandermonde matrix, which prevents the inverse of the singular matrix. The dispersion analysis and numerical results of a homogeneous elastic model and a geophysical model of oil and gas reservoir demonstrate that the algorithm based on Vandermonde matrix has better accuracy compared with matrix inverse operator of MATLAB.

  5. The Development of Multicultural Counselling Competencies (MCC) Training Module Based on MCC Matrix Model by Sue et al. (1992)

    ERIC Educational Resources Information Center

    Anuar, Azad Athahiri; Rozubi, Norsayyidatina Che; Abdullah, Haslee Sharil

    2015-01-01

    The aims of this study were to develop and validate a MCC training module for trainee counselor based on MCC matrix model by Sue et al. (1992). This module encompassed five sub modules and 11 activities developed along the concepts and components of the MCC matrix model developed by Sue, Arredondo dan McDavis (1992). The design method used in this…

  6. Statistical Analysis of Q-matrix Based Diagnostic Classification Models

    PubMed Central

    Chen, Yunxiao; Liu, Jingchen; Xu, Gongjun; Ying, Zhiliang

    2014-01-01

    Diagnostic classification models have recently gained prominence in educational assessment, psychiatric evaluation, and many other disciplines. Central to the model specification is the so-called Q-matrix that provides a qualitative specification of the item-attribute relationship. In this paper, we develop theories on the identifiability for the Q-matrix under the DINA and the DINO models. We further propose an estimation procedure for the Q-matrix through the regularized maximum likelihood. The applicability of this procedure is not limited to the DINA or the DINO model and it can be applied to essentially all Q-matrix based diagnostic classification models. Simulation studies are conducted to illustrate its performance. Furthermore, two case studies are presented. The first case is a data set on fraction subtraction (educational application) and the second case is a subsample of the National Epidemiological Survey on Alcohol and Related Conditions concerning the social anxiety disorder (psychiatric application). PMID:26294801

  7. A micromechanics-based strength prediction methodology for notched metal matrix composites

    NASA Technical Reports Server (NTRS)

    Bigelow, C. A.

    1992-01-01

    An analytical micromechanics based strength prediction methodology was developed to predict failure of notched metal matrix composites. The stress-strain behavior and notched strength of two metal matrix composites, boron/aluminum (B/Al) and silicon-carbide/titanium (SCS-6/Ti-15-3), were predicted. The prediction methodology combines analytical techniques ranging from a three dimensional finite element analysis of a notched specimen to a micromechanical model of a single fiber. In the B/Al laminates, a fiber failure criteria based on the axial and shear stress in the fiber accurately predicted laminate failure for a variety of layups and notch-length to specimen-width ratios with both circular holes and sharp notches when matrix plasticity was included in the analysis. For the SCS-6/Ti-15-3 laminates, a fiber failure based on the axial stress in the fiber correlated well with experimental results for static and post fatigue residual strengths when fiber matrix debonding and matrix cracking were included in the analysis. The micromechanics based strength prediction methodology offers a direct approach to strength prediction by modeling behavior and damage on a constituent level, thus, explicitly including matrix nonlinearity, fiber matrix debonding, and matrix cracking.

  8. A micromechanics-based strength prediction methodology for notched metal-matrix composites

    NASA Technical Reports Server (NTRS)

    Bigelow, C. A.

    1993-01-01

    An analytical micromechanics-based strength prediction methodology was developed to predict failure of notched metal matrix composites. The stress-strain behavior and notched strength of two metal matrix composites, boron/aluminum (B/Al) and silicon-carbide/titanium (SCS-6/Ti-15-3), were predicted. The prediction methodology combines analytical techniques ranging from a three-dimensional finite element analysis of a notched specimen to a micromechanical model of a single fiber. In the B/Al laminates, a fiber failure criteria based on the axial and shear stress in the fiber accurately predicted laminate failure for a variety of layups and notch-length to specimen-width ratios with both circular holes and sharp notches when matrix plasticity was included in the analysis. For the SCS-6/Ti-15-3 laminates, a fiber failure based on the axial stress in the fiber correlated well with experimental results for static and postfatigue residual strengths when fiber matrix debonding and matrix cracking were included in the analysis. The micromechanics-based strength prediction methodology offers a direct approach to strength prediction by modeling behavior and damage on a constituent level, thus, explicitly including matrix nonlinearity, fiber matrix debonding, and matrix cracking.

  9. Unified continuum damage model for matrix cracking in composite rotor blades

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pollayi, Hemaraju; Harursampath, Dineshkumar

    This paper deals with modeling of the first damage mode, matrix micro-cracking, in helicopter rotor/wind turbine blades and how this effects the overall cross-sectional stiffness. The helicopter/wind turbine rotor system operates in a highly dynamic and unsteady environment leading to severe vibratory loads present in the system. Repeated exposure to this loading condition can induce damage in the composite rotor blades. These rotor/turbine blades are generally made of fiber-reinforced laminated composites and exhibit various competing modes of damage such as matrix micro-cracking, delamination, and fiber breakage. There is a need to study the behavior of the composite rotor system undermore » various key damage modes in composite materials for developing Structural Health Monitoring (SHM) system. Each blade is modeled as a beam based on geometrically non-linear 3-D elasticity theory. Each blade thus splits into 2-D analyzes of cross-sections and non-linear 1-D analyzes along the beam reference curves. Two different tools are used here for complete 3-D analysis: VABS for 2-D cross-sectional analysis and GEBT for 1-D beam analysis. The physically-based failure models for matrix in compression and tension loading are used in the present work. Matrix cracking is detected using two failure criterion: Matrix Failure in Compression and Matrix Failure in Tension which are based on the recovered field. A strain variable is set which drives the damage variable for matrix cracking and this damage variable is used to estimate the reduced cross-sectional stiffness. The matrix micro-cracking is performed in two different approaches: (i) Element-wise, and (ii) Node-wise. The procedure presented in this paper is implemented in VABS as matrix micro-cracking modeling module. Three examples are presented to investigate the matrix failure model which illustrate the effect of matrix cracking on cross-sectional stiffness by varying the applied cyclic load.« less

  10. Micro-mechanics modelling of smart materials

    NASA Astrophysics Data System (ADS)

    Shah, Syed Asim Ali

    Metal Matrix ceramic-reinforced composites are rapidly becoming strong candidates as structural materials for many high temperature and engineering applications. Metal matrix composites (MMC) combine the ductile properties of the matrix with a brittle phase of the reinforcement, leading to high stiffness and strength with a reduction in structural weight. The main objective of using a metal matrix composite system is to increase service temperature or improve specific mechanical properties of structural components by replacing existing super alloys.The purpose of the study is to investigate, develop and implement second phase reinforcement alloy strengthening empirical model with SiCp reinforced A359 aluminium alloy composites on the particle-matrix interface and the overall mechanical properties of the material.To predict the interfacial fracture strength of aluminium, in the presence of silicon segregation, an empirical model has been modified. This model considers the interfacial energy caused by segregation of impurities at the interface and uses Griffith crack type arguments to predict the formation energies of impurities at the interface. Based on this, model simulations were conducted at nano scale specifically at the interface and the interfacial strengthening behaviour of reinforced aluminium alloy system was expressed in terms of elastic modulus.The numerical model shows success in making prediction possible of trends in relation to segregation and interfacial fracture strength behaviour in SiC particle-reinforced aluminium matrix composites. The simulation models using various micro scale modelling techniques to the aluminum alloy matrix composite, strengthenedwith varying amounts of silicon carbide particulate were done to predict the material state at critical points with properties of Al-SiC which had been heat treated.In this study an algorithm is developed to model a hard ceramic particle in a soft matrix with a clear distinct interface and a strain based relationship has been proposed for the strengthening behaviour of the MMC at the interface rather than stress based, by successfully completing the numerical modelling of particulate reinforced metal matrix composites.

  11. Mathematical model of water transport in Bacon and alkaline matrix-type hydrogen-oxygen fuel cells

    NASA Technical Reports Server (NTRS)

    Prokopius, P. R.; Easter, R. W.

    1972-01-01

    Based on general mass continuity and diffusive transport equations, a mathematical model was developed that simulates the transport of water in Bacon and alkaline-matrix fuel cells. The derived model was validated by using it to analytically reproduce various Bacon and matrix-cell experimental water transport transients.

  12. Computational Modeling of Single-Cell Migration: The Leading Role of Extracellular Matrix Fibers

    PubMed Central

    Schlüter, Daniela K.; Ramis-Conde, Ignacio; Chaplain, Mark A.J.

    2012-01-01

    Cell migration is vitally important in a wide variety of biological contexts ranging from embryonic development and wound healing to malignant diseases such as cancer. It is a very complex process that is controlled by intracellular signaling pathways as well as the cell’s microenvironment. Due to its importance and complexity, it has been studied for many years in the biomedical sciences, and in the last 30 years it also received an increasing amount of interest from theoretical scientists and mathematical modelers. Here we propose a force-based, individual-based modeling framework that links single-cell migration with matrix fibers and cell-matrix interactions through contact guidance and matrix remodelling. With this approach, we can highlight the effect of the cell’s environment on its migration. We investigate the influence of matrix stiffness, matrix architecture, and cell speed on migration using quantitative measures that allow us to compare the results to experiments. PMID:22995486

  13. Micromechanical modeling of damage growth in titanium based metal-matrix composites

    NASA Technical Reports Server (NTRS)

    Sherwood, James A.; Quimby, Howard M.

    1994-01-01

    The thermomechanical behavior of continuous-fiber reinforced titanium based metal-matrix composites (MMC) is studied using the finite element method. A thermoviscoplastic unified state variable constitutive theory is employed to capture inelastic and strain-rate sensitive behavior in the Timetal-21s matrix. The SCS-6 fibers are modeled as thermoplastic. The effects of residual stresses generated during the consolidation process on the tensile response of the composites are investigated. Unidirectional and cross-ply geometries are considered. Differences between the tensile responses in composites with perfectly bonded and completely debonded fiber/matrix interfaces are discussed. Model simulations for the completely debonded-interface condition are shown to correlate well with experimental results.

  14. Comparison Of Models Of Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Bigelow, C. A.; Johnson, W. S.; Naik, R. A.

    1994-01-01

    Report presents comparative review of four mathematical models of micromechanical behaviors of fiber/metal-matrix composite materials. Models differ in various details, all based on properties of fiber and matrix constituent materials, all involve square arrays of fibers continuous and parallel and all assume complete bonding between constituents. Computer programs implementing models used to predict properties and stress-vs.-strain behaviors of unidirectional- and cross-ply laminated composites made of boron fibers in aluminum matrices and silicon carbide fibers in titanium matrices. Stresses in fiber and matrix constituent materials also predicted.

  15. Matched field localization based on CS-MUSIC algorithm

    NASA Astrophysics Data System (ADS)

    Guo, Shuangle; Tang, Ruichun; Peng, Linhui; Ji, Xiaopeng

    2016-04-01

    The problem caused by shortness or excessiveness of snapshots and by coherent sources in underwater acoustic positioning is considered. A matched field localization algorithm based on CS-MUSIC (Compressive Sensing Multiple Signal Classification) is proposed based on the sparse mathematical model of the underwater positioning. The signal matrix is calculated through the SVD (Singular Value Decomposition) of the observation matrix. The observation matrix in the sparse mathematical model is replaced by the signal matrix, and a new concise sparse mathematical model is obtained, which means not only the scale of the localization problem but also the noise level is reduced; then the new sparse mathematical model is solved by the CS-MUSIC algorithm which is a combination of CS (Compressive Sensing) method and MUSIC (Multiple Signal Classification) method. The algorithm proposed in this paper can overcome effectively the difficulties caused by correlated sources and shortness of snapshots, and it can also reduce the time complexity and noise level of the localization problem by using the SVD of the observation matrix when the number of snapshots is large, which will be proved in this paper.

  16. Fast Low-Rank Bayesian Matrix Completion With Hierarchical Gaussian Prior Models

    NASA Astrophysics Data System (ADS)

    Yang, Linxiao; Fang, Jun; Duan, Huiping; Li, Hongbin; Zeng, Bing

    2018-06-01

    The problem of low rank matrix completion is considered in this paper. To exploit the underlying low-rank structure of the data matrix, we propose a hierarchical Gaussian prior model, where columns of the low-rank matrix are assumed to follow a Gaussian distribution with zero mean and a common precision matrix, and a Wishart distribution is specified as a hyperprior over the precision matrix. We show that such a hierarchical Gaussian prior has the potential to encourage a low-rank solution. Based on the proposed hierarchical prior model, a variational Bayesian method is developed for matrix completion, where the generalized approximate massage passing (GAMP) technique is embedded into the variational Bayesian inference in order to circumvent cumbersome matrix inverse operations. Simulation results show that our proposed method demonstrates superiority over existing state-of-the-art matrix completion methods.

  17. Large-N and Bethe Ansatz

    NASA Astrophysics Data System (ADS)

    Jurčo, Branislav

    We describe an integrable model, related to the Gaudin magnet, and its relation to the matrix model of Brézin, Itzykson, Parisi and Zuber. Relation is based on Bethe ansatz for the integrable model and its interpretation using orthogonal polynomials and saddle point approximation. Large-N limit of the matrix model corresponds to the thermodynamic limit of the integrable system. In this limit (functional) Bethe ansatz is the same as the generating function for correlators of the matrix models.

  18. A Deep Stochastic Model for Detecting Community in Complex Networks

    NASA Astrophysics Data System (ADS)

    Fu, Jingcheng; Wu, Jianliang

    2017-01-01

    Discovering community structures is an important step to understanding the structure and dynamics of real-world networks in social science, biology and technology. In this paper, we develop a deep stochastic model based on non-negative matrix factorization to identify communities, in which there are two sets of parameters. One is the community membership matrix, of which the elements in a row correspond to the probabilities of the given node belongs to each of the given number of communities in our model, another is the community-community connection matrix, of which the element in the i-th row and j-th column represents the probability of there being an edge between a randomly chosen node from the i-th community and a randomly chosen node from the j-th community. The parameters can be evaluated by an efficient updating rule, and its convergence can be guaranteed. The community-community connection matrix in our model is more precise than the community-community connection matrix in traditional non-negative matrix factorization methods. Furthermore, the method called symmetric nonnegative matrix factorization, is a special case of our model. Finally, based on the experiments on both synthetic and real-world networks data, it can be demonstrated that our algorithm is highly effective in detecting communities.

  19. Modeling food matrix effects on chemical reactivity: Challenges and perspectives.

    PubMed

    Capuano, Edoardo; Oliviero, Teresa; van Boekel, Martinus A J S

    2017-06-29

    The same chemical reaction may be different in terms of its position of the equilibrium (i.e., thermodynamics) and its kinetics when studied in different foods. The diversity in the chemical composition of food and in its structural organization at macro-, meso-, and microscopic levels, that is, the food matrix, is responsible for this difference. In this viewpoint paper, the multiple, and interconnected ways the food matrix can affect chemical reactivity are summarized. Moreover, mechanistic and empirical approaches to explain and predict the effect of food matrix on chemical reactivity are described. Mechanistic models aim to quantify the effect of food matrix based on a detailed understanding of the chemical and physical phenomena occurring in food. Their applicability is limited at the moment to very simple food systems. Empirical modeling based on machine learning combined with data-mining techniques may represent an alternative, useful option to predict the effect of the food matrix on chemical reactivity and to identify chemical and physical properties to be further tested. In such a way the mechanistic understanding of the effect of the food matrix on chemical reactions can be improved.

  20. Orthonormal vector general polynomials derived from the Cartesian gradient of the orthonormal Zernike-based polynomials.

    PubMed

    Mafusire, Cosmas; Krüger, Tjaart P J

    2018-06-01

    The concept of orthonormal vector circle polynomials is revisited by deriving a set from the Cartesian gradient of Zernike polynomials in a unit circle using a matrix-based approach. The heart of this model is a closed-form matrix equation of the gradient of Zernike circle polynomials expressed as a linear combination of lower-order Zernike circle polynomials related through a gradient matrix. This is a sparse matrix whose elements are two-dimensional standard basis transverse Euclidean vectors. Using the outer product form of the Cholesky decomposition, the gradient matrix is used to calculate a new matrix, which we used to express the Cartesian gradient of the Zernike circle polynomials as a linear combination of orthonormal vector circle polynomials. Since this new matrix is singular, the orthonormal vector polynomials are recovered by reducing the matrix to its row echelon form using the Gauss-Jordan elimination method. We extend the model to derive orthonormal vector general polynomials, which are orthonormal in a general pupil by performing a similarity transformation on the gradient matrix to give its equivalent in the general pupil. The outer form of the Gram-Schmidt procedure and the Gauss-Jordan elimination method are then applied to the general pupil to generate the orthonormal vector general polynomials from the gradient of the orthonormal Zernike-based polynomials. The performance of the model is demonstrated with a simulated wavefront in a square pupil inscribed in a unit circle.

  1. A virtual surgical training system that simulates cutting of soft tissue using a modified pre-computed elastic model.

    PubMed

    Toe, Kyaw Kyar; Huang, Weimin; Yang, Tao; Duan, Yuping; Zhou, Jiayin; Su, Yi; Teo, Soo-Kng; Kumar, Selvaraj Senthil; Lim, Calvin Chi-Wan; Chui, Chee Kong; Chang, Stephen

    2015-08-01

    This work presents a surgical training system that incorporates cutting operation of soft tissue simulated based on a modified pre-computed linear elastic model in the Simulation Open Framework Architecture (SOFA) environment. A precomputed linear elastic model used for the simulation of soft tissue deformation involves computing the compliance matrix a priori based on the topological information of the mesh. While this process may require a few minutes to several hours, based on the number of vertices in the mesh, it needs only to be computed once and allows real-time computation of the subsequent soft tissue deformation. However, as the compliance matrix is based on the initial topology of the mesh, it does not allow any topological changes during simulation, such as cutting or tearing of the mesh. This work proposes a way to modify the pre-computed data by correcting the topological connectivity in the compliance matrix, without re-computing the compliance matrix which is computationally expensive.

  2. Characteristic analysis on UAV-MIMO channel based on normalized correlation matrix.

    PubMed

    Gao, Xi jun; Chen, Zi li; Hu, Yong Jiang

    2014-01-01

    Based on the three-dimensional GBSBCM (geometrically based double bounce cylinder model) channel model of MIMO for unmanned aerial vehicle (UAV), the simple form of UAV space-time-frequency channel correlation function which includes the LOS, SPE, and DIF components is presented. By the methods of channel matrix decomposition and coefficient normalization, the analytic formula of UAV-MIMO normalized correlation matrix is deduced. This formula can be used directly to analyze the condition number of UAV-MIMO channel matrix, the channel capacity, and other characteristic parameters. The simulation results show that this channel correlation matrix can be applied to describe the changes of UAV-MIMO channel characteristics under different parameter settings comprehensively. This analysis method provides a theoretical basis for improving the transmission performance of UAV-MIMO channel. The development of MIMO technology shows practical application value in the field of UAV communication.

  3. Characteristic Analysis on UAV-MIMO Channel Based on Normalized Correlation Matrix

    PubMed Central

    Xi jun, Gao; Zi li, Chen; Yong Jiang, Hu

    2014-01-01

    Based on the three-dimensional GBSBCM (geometrically based double bounce cylinder model) channel model of MIMO for unmanned aerial vehicle (UAV), the simple form of UAV space-time-frequency channel correlation function which includes the LOS, SPE, and DIF components is presented. By the methods of channel matrix decomposition and coefficient normalization, the analytic formula of UAV-MIMO normalized correlation matrix is deduced. This formula can be used directly to analyze the condition number of UAV-MIMO channel matrix, the channel capacity, and other characteristic parameters. The simulation results show that this channel correlation matrix can be applied to describe the changes of UAV-MIMO channel characteristics under different parameter settings comprehensively. This analysis method provides a theoretical basis for improving the transmission performance of UAV-MIMO channel. The development of MIMO technology shows practical application value in the field of UAV communication. PMID:24977185

  4. A Numerical Method for Simulating the Microscopic Damage Evolution in Composites Under Uniaxial Transverse Tension

    NASA Astrophysics Data System (ADS)

    Zhi, Jie; Zhao, Libin; Zhang, Jianyu; Liu, Zhanli

    2016-06-01

    In this paper, a new numerical method that combines a surface-based cohesive model and extended finite element method (XFEM) without predefining the crack paths is presented to simulate the microscopic damage evolution in composites under uniaxial transverse tension. The proposed method is verified to accurately capture the crack kinking into the matrix after fiber/matrix debonding. A statistical representative volume element (SRVE) under periodic boundary conditions is used to approximate the microstructure of the composites. The interface parameters of the cohesive models are investigated, in which the initial interface stiffness has a great effect on the predictions of the fiber/matrix debonding. The detailed debonding states of SRVE with strong and weak interfaces are compared based on the surface-based and element-based cohesive models. The mechanism of damage in composites under transverse tension is described as the appearance of the interface cracks and their induced matrix micro-cracking, both of which coalesce into transversal macro-cracks. Good agreement is found between the predictions of the model and the in situ experimental observations, demonstrating the efficiency of the presented model for simulating the microscopic damage evolution in composites.

  5. Three-dimensional finite element modeling of pericellular matrix and cell mechanics in the nucleus pulposus of the intervertebral disk based on in situ morphology.

    PubMed

    Cao, Li; Guilak, Farshid; Setton, Lori A

    2011-02-01

    Nucleus pulposus (NP) cells of the intervertebral disk (IVD) have unique morphological characteristics and biologic responses to mechanical stimuli that may regulate maintenance and health of the IVD. NP cells reside as single cell, paired or multiple cells in a contiguous pericellular matrix (PCM), whose structure and properties may significantly influence cell and extracellular matrix mechanics. In this study, a computational model was developed to predict the stress-strain, fluid pressure and flow fields for cells and their surrounding PCM in the NP using three-dimensional (3D) finite element models based on the in situ morphology of cell-PCM regions of the mature rat NP, measured using confocal microscopy. Three-dimensional geometries of the extracellular matrix and representative cell-matrix units were used to construct 3D finite element models of the structures as isotropic and biphasic materials. In response to compressive strain of the extracellular matrix, NP cells and PCM regions were predicted to experience volumetric strains that were 1.9-3.7 and 1.4-2.1 times greater than the extracellular matrix, respectively. Volumetric and deviatoric strain concentrations were generally found at the cell/PCM interface, while von Mises stress concentrations were associated with the PCM/extracellular matrix interface. Cell-matrix units containing greater cell numbers were associated with higher peak cell strains and lower rates of fluid pressurization upon loading. These studies provide new model predictions for micromechanics of NP cells that can contribute to an understanding of mechanotransduction in the IVD and its changes with aging and degeneration.

  6. An Application of Semi-parametric Estimator with Weighted Matrix of Data Depth in Variance Component Estimation

    NASA Astrophysics Data System (ADS)

    Pan, X. G.; Wang, J. Q.; Zhou, H. Y.

    2013-05-01

    The variance component estimation (VCE) based on semi-parametric estimator with weighted matrix of data depth has been proposed, because the coupling system model error and gross error exist in the multi-source heterogeneous measurement data of space and ground combined TT&C (Telemetry, Tracking and Command) technology. The uncertain model error has been estimated with the semi-parametric estimator model, and the outlier has been restrained with the weighted matrix of data depth. On the basis of the restriction of the model error and outlier, the VCE can be improved and used to estimate weighted matrix for the observation data with uncertain model error or outlier. Simulation experiment has been carried out under the circumstance of space and ground combined TT&C. The results show that the new VCE based on the model error compensation can determine the rational weight of the multi-source heterogeneous data, and restrain the outlier data.

  7. State-Space System Realization with Input- and Output-Data Correlation

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan

    1997-01-01

    This paper introduces a general version of the information matrix consisting of the autocorrelation and cross-correlation matrices of the shifted input and output data. Based on the concept of data correlation, a new system realization algorithm is developed to create a model directly from input and output data. The algorithm starts by computing a special type of correlation matrix derived from the information matrix. The special correlation matrix provides information on the system-observability matrix and the state-vector correlation. A system model is then developed from the observability matrix in conjunction with other algebraic manipulations. This approach leads to several different algorithms for computing system matrices for use in representing the system model. The relationship of the new algorithms with other realization algorithms in the time and frequency domains is established with matrix factorization of the information matrix. Several examples are given to illustrate the validity and usefulness of these new algorithms.

  8. Invariant operators, orthogonal bases and correlators in general tensor models

    NASA Astrophysics Data System (ADS)

    Diaz, Pablo; Rey, Soo-Jong

    2018-07-01

    We study invariant operators in general tensor models. We show that representation theory provides an efficient framework to count and classify invariants in tensor models of (gauge) symmetry Gd = U (N1) ⊗ ⋯ ⊗ U (Nd). As a continuation and completion of our earlier work, we present two natural ways of counting invariants, one for arbitrary Gd and another valid for large rank of Gd. We construct bases of invariant operators based on the counting, and compute correlators of their elements. The basis associated with finite rank of Gd diagonalizes the two-point function of the free theory. It is analogous to the restricted Schur basis used in matrix models. We show that the constructions get almost identical as we swap the Littlewood-Richardson numbers in multi-matrix models with Kronecker coefficients in general tensor models. We explore the parallelism between matrix model and tensor model in depth from the perspective of representation theory and comment on several ideas for future investigation.

  9. A creep cavity growth model for creep-fatigue life prediction of a unidirectional W/Cu composite

    NASA Astrophysics Data System (ADS)

    Kim, Young-Suk; Verrilli, Michael J.; Halford, Gary R.

    1992-05-01

    A microstructural model was developed to predict creep-fatigue life in a (0)(sub 4), 9 volume percent tungsten fiber-reinforced copper matrix composite at the temperature of 833 K. The mechanism of failure of the composite is assumed to be governed by the growth of quasi-equilibrium cavities in the copper matrix of the composite, based on the microscopically observed failure mechanisms. The methodology uses a cavity growth model developed for prediction of creep fracture. Instantaneous values of strain rate and stress in the copper matrix during fatigue cycles were calculated and incorporated in the model to predict cyclic life. The stress in the copper matrix was determined by use of a simple two-bar model for the fiber and matrix during cyclic loading. The model successfully predicted the composite creep-fatigue life under tension-tension cyclic loading through the use of this instantaneous matrix stress level. Inclusion of additional mechanisms such as cavity nucleation, grain boundary sliding, and the effect of fibers on matrix-stress level would result in more generalized predictions of creep-fatigue life.

  10. Temperature dependent nonlinear metal matrix laminae behavior

    NASA Technical Reports Server (NTRS)

    Barrett, D. J.; Buesking, K. W.

    1986-01-01

    An analytical method is described for computing the nonlinear thermal and mechanical response of laminated plates. The material model focuses upon the behavior of metal matrix materials by relating the nonlinear composite response to plasticity effects in the matrix. The foundation of the analysis is the unidirectional material model which is used to compute the instantaneous properties of the lamina based upon the properties of the fibers and matrix. The unidirectional model assumes that the fibers properties are constant with temperature and assumes that the matrix can be modelled as a temperature dependent, bilinear, kinematically hardening material. An incremental approach is used to compute average stresses in the fibers and matrix caused by arbitrary mechanical and thermal loads. The layer model is incorporated in an incremental laminated plate theory to compute the nonlinear response of laminated metal matrix composites of general orientation and stacking sequence. The report includes comparisons of the method with other analytical approaches and compares theoretical calculations with measured experimental material behavior. A section is included which describes the limitations of the material model.

  11. A creep cavity growth model for creep-fatigue life prediction of a unidirectional W/Cu composite

    NASA Technical Reports Server (NTRS)

    Kim, Young-Suk; Verrilli, Michael J.; Halford, Gary R.

    1992-01-01

    A microstructural model was developed to predict creep-fatigue life in a (0)(sub 4), 9 volume percent tungsten fiber-reinforced copper matrix composite at the temperature of 833 K. The mechanism of failure of the composite is assumed to be governed by the growth of quasi-equilibrium cavities in the copper matrix of the composite, based on the microscopically observed failure mechanisms. The methodology uses a cavity growth model developed for prediction of creep fracture. Instantaneous values of strain rate and stress in the copper matrix during fatigue cycles were calculated and incorporated in the model to predict cyclic life. The stress in the copper matrix was determined by use of a simple two-bar model for the fiber and matrix during cyclic loading. The model successfully predicted the composite creep-fatigue life under tension-tension cyclic loading through the use of this instantaneous matrix stress level. Inclusion of additional mechanisms such as cavity nucleation, grain boundary sliding, and the effect of fibers on matrix-stress level would result in more generalized predictions of creep-fatigue life.

  12. Efficient system modeling for a small animal PET scanner with tapered DOI detectors.

    PubMed

    Zhang, Mengxi; Zhou, Jian; Yang, Yongfeng; Rodríguez-Villafuerte, Mercedes; Qi, Jinyi

    2016-01-21

    A prototype small animal positron emission tomography (PET) scanner for mouse brain imaging has been developed at UC Davis. The new scanner uses tapered detector arrays with depth of interaction (DOI) measurement. In this paper, we present an efficient system model for the tapered PET scanner using matrix factorization and a virtual scanner geometry. The factored system matrix mainly consists of two components: a sinogram blurring matrix and a geometrical matrix. The geometric matrix is based on a virtual scanner geometry. The sinogram blurring matrix is estimated by matrix factorization. We investigate the performance of different virtual scanner geometries. Both simulation study and real data experiments are performed in the fully 3D mode to study the image quality under different system models. The results indicate that the proposed matrix factorization can maintain image quality while substantially reduce the image reconstruction time and system matrix storage cost. The proposed method can be also applied to other PET scanners with DOI measurement.

  13. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

    PubMed

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

    2013-03-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

    PubMed Central

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

    2012-01-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

  15. Interdisciplinary matrix in economics: two applications to the transition from socialism to capitalism.

    PubMed

    Jakimowicz, Aleksander

    2009-10-01

    The 7-fold interdisciplinary matrix is introduced. This integrated methodological point of view is original, although it is based on ideas of others in various ways. The name for this new approach draws on the Kuhnian notion of a disciplinary matrix. There are four components of the Kuhnian matrix on which the existence of scientific communities hinges: symbolic generalizations, models, values, and exemplars. In this context the term "paradigm" should refer to exemplars. The interdisciplinary matrix is composed of seven elements: cybernetics, catastrophe theory, fractal geometry, deterministic chaos, artificial intelligence, theory of complexity, and humanistic values. Scientific developments have recently brought substantial changes in the structure of scientific communities. Transferability of ideas and thoughts contributed to the creation of scientific communities, which unite representatives of various professions. When researching into certain phenomena we no longer need to develop theories for them from scratch, as we can draw on the achievements in other disciplines. Two examples of the employment of the interdisciplinary matrix in macroeconomics are elaborated here: the investment cycle model in socialist economy, and the model of economic transformation based on chaotic hysteresis.

  16. Teaching Improvement Model Designed with DEA Method and Management Matrix

    ERIC Educational Resources Information Center

    Montoneri, Bernard

    2014-01-01

    This study uses student evaluation of teachers to design a teaching improvement matrix based on teaching efficiency and performance by combining management matrix and data envelopment analysis. This matrix is designed to formulate suggestions to improve teaching. The research sample consists of 42 classes of freshmen following a course of English…

  17. Exploring multicollinearity using a random matrix theory approach.

    PubMed

    Feher, Kristen; Whelan, James; Müller, Samuel

    2012-01-01

    Clustering of gene expression data is often done with the latent aim of dimension reduction, by finding groups of genes that have a common response to potentially unknown stimuli. However, what is poorly understood to date is the behaviour of a low dimensional signal embedded in high dimensions. This paper introduces a multicollinear model which is based on random matrix theory results, and shows potential for the characterisation of a gene cluster's correlation matrix. This model projects a one dimensional signal into many dimensions and is based on the spiked covariance model, but rather characterises the behaviour of the corresponding correlation matrix. The eigenspectrum of the correlation matrix is empirically examined by simulation, under the addition of noise to the original signal. The simulation results are then used to propose a dimension estimation procedure of clusters from data. Moreover, the simulation results warn against considering pairwise correlations in isolation, as the model provides a mechanism whereby a pair of genes with `low' correlation may simply be due to the interaction of high dimension and noise. Instead, collective information about all the variables is given by the eigenspectrum.

  18. HIGH DIMENSIONAL COVARIANCE MATRIX ESTIMATION IN APPROXIMATE FACTOR MODELS.

    PubMed

    Fan, Jianqing; Liao, Yuan; Mincheva, Martina

    2011-01-01

    The variance covariance matrix plays a central role in the inferential theories of high dimensional factor models in finance and economics. Popular regularization methods of directly exploiting sparsity are not directly applicable to many financial problems. Classical methods of estimating the covariance matrices are based on the strict factor models, assuming independent idiosyncratic components. This assumption, however, is restrictive in practical applications. By assuming sparse error covariance matrix, we allow the presence of the cross-sectional correlation even after taking out common factors, and it enables us to combine the merits of both methods. We estimate the sparse covariance using the adaptive thresholding technique as in Cai and Liu (2011), taking into account the fact that direct observations of the idiosyncratic components are unavailable. The impact of high dimensionality on the covariance matrix estimation based on the factor structure is then studied.

  19. Matrix approaches to assess terrestrial nitrogen scheme in CLM4.5

    NASA Astrophysics Data System (ADS)

    Du, Z.

    2017-12-01

    Terrestrial carbon (C) and nitrogen (N) cycles have been commonly represented by a series of balance equations to track their influxes into and effluxes out of individual pools in earth system models (ESMs). This representation matches our understanding of C and N cycle processes well but makes it difficult to track model behaviors. To overcome these challenges, we developed a matrix approach, which reorganizes the series of terrestrial C and N balance equations in the CLM4.5 into two matrix equations based on original representation of C and N cycle processes and mechanisms. The matrix approach would consequently help improve the comparability of models and data, evaluate impacts of additional model components, facilitate benchmark analyses, model intercomparisons, and data-model fusion, and improve model predictive power.

  20. Development of a hybrid wave based-transfer matrix model for sound transmission analysis.

    PubMed

    Dijckmans, A; Vermeir, G

    2013-04-01

    In this paper, a hybrid wave based-transfer matrix model is presented that allows for the investigation of the sound transmission through finite multilayered structures placed between two reverberant rooms. The multilayered structure may consist of an arbitrary configuration of fluid, elastic, or poro-elastic layers. The field variables (structural displacements and sound pressures) are expanded in terms of structural and acoustic wave functions. The boundary and continuity conditions in the rooms determine the participation factors in the pressure expansions. The displacement of the multilayered structure is determined by the mechanical impedance matrix, which gives a relation between the pressures and transverse displacements at both sides of the structure. The elements of this matrix are calculated with the transfer matrix method. First, the hybrid model is numerically validated. Next a comparison is made with sound transmission loss measurements of a hollow brick wall and a sandwich panel. Finally, numerical simulations show the influence of structural damping, room dimensions and plate dimensions on the sound transmission loss of multilayered structures.

  1. Investigation into Text Classification With Kernel Based Schemes

    DTIC Science & Technology

    2010-03-01

    Document Matrix TDMs Term-Document Matrices TMG Text to Matrix Generator TN True Negative TP True Positive VSM Vector Space Model xxii THIS PAGE...are represented as a term-document matrix, common evaluation metrics, and the software package Text to Matrix Generator ( TMG ). The classifier...AND METRICS This chapter introduces the indexing capabilities of the Text to Matrix Generator ( TMG ) Toolbox. Specific attention is placed on the

  2. A methodology to predict damage initiation, damage growth and residual strength in titanium matrix composites

    NASA Technical Reports Server (NTRS)

    Bakuckas, J. G., Jr.; Johnson, W. S.

    1994-01-01

    In this research, a methodology to predict damage initiation, damage growth, fatigue life, and residual strength in titanium matrix composites (TMC) is outlined. Emphasis was placed on micromechanics-based engineering approaches. Damage initiation was predicted using a local effective strain approach. A finite element analysis verified the prevailing assumptions made in the formulation of this model. Damage growth, namely, fiber-bridged matrix crack growth, was evaluated using a fiber bridging (FB) model which accounts for thermal residual stresses. This model combines continuum fracture mechanics and micromechanics analyses yielding stress-intensity factor solutions for fiber-bridged matrix cracks. It is assumed in the FB model that fibers in the wake of the matrix crack are idealized as a closure pressure, and an unknown constant frictional shear stress is assumed to act along the debond length of the bridging fibers. This frictional shear stress was used as a curve fitting parameter to the available experimental data. Fatigue life and post-fatigue residual strength were predicted based on the axial stress in the first intact 0 degree fiber calculated using the FB model and a three-dimensional finite element analysis.

  3. Near-lossless multichannel EEG compression based on matrix and tensor decompositions.

    PubMed

    Dauwels, Justin; Srinivasan, K; Reddy, M Ramasubba; Cichocki, Andrzej

    2013-05-01

    A novel near-lossless compression algorithm for multichannel electroencephalogram (MC-EEG) is proposed based on matrix/tensor decomposition models. MC-EEG is represented in suitable multiway (multidimensional) forms to efficiently exploit temporal and spatial correlations simultaneously. Several matrix/tensor decomposition models are analyzed in view of efficient decorrelation of the multiway forms of MC-EEG. A compression algorithm is built based on the principle of “lossy plus residual coding,” consisting of a matrix/tensor decomposition-based coder in the lossy layer followed by arithmetic coding in the residual layer. This approach guarantees a specifiable maximum absolute error between original and reconstructed signals. The compression algorithm is applied to three different scalp EEG datasets and an intracranial EEG dataset, each with different sampling rate and resolution. The proposed algorithm achieves attractive compression ratios compared to compressing individual channels separately. For similar compression ratios, the proposed algorithm achieves nearly fivefold lower average error compared to a similar wavelet-based volumetric MC-EEG compression algorithm.

  4. Global Futures: a multithreaded execution model for Global Arrays-based applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chavarría-Miranda, Daniel; Krishnamoorthy, Sriram; Vishnu, Abhinav

    2012-05-31

    We present Global Futures (GF), an execution model extension to Global Arrays, which is based on a PGAS-compatible Active Message-based paradigm. We describe the design and implementation of Global Futures and illustrate its use in a computational chemistry application benchmark (Hartree-Fock matrix construction using the Self-Consistent Field method). Our results show how we used GF to increase the scalability of the Hartree-Fock matrix build to up to 6,144 cores of an Infiniband cluster. We also show how GF's multithreaded execution has comparable performance to the traditional process-based SPMD model.

  5. Translucent Radiosity: Efficiently Combining Diffuse Inter-Reflection and Subsurface Scattering.

    PubMed

    Sheng, Yu; Shi, Yulong; Wang, Lili; Narasimhan, Srinivasa G

    2014-07-01

    It is hard to efficiently model the light transport in scenes with translucent objects for interactive applications. The inter-reflection between objects and their environments and the subsurface scattering through the materials intertwine to produce visual effects like color bleeding, light glows, and soft shading. Monte-Carlo based approaches have demonstrated impressive results but are computationally expensive, and faster approaches model either only inter-reflection or only subsurface scattering. In this paper, we present a simple analytic model that combines diffuse inter-reflection and isotropic subsurface scattering. Our approach extends the classical work in radiosity by including a subsurface scattering matrix that operates in conjunction with the traditional form factor matrix. This subsurface scattering matrix can be constructed using analytic, measurement-based or simulation-based models and can capture both homogeneous and heterogeneous translucencies. Using a fast iterative solution to radiosity, we demonstrate scene relighting and dynamically varying object translucencies at near interactive rates.

  6. A new surface-potential-based compact model for the MoS2 field effect transistors in active matrix display applications

    NASA Astrophysics Data System (ADS)

    Cao, Jingchen; Peng, Songang; Liu, Wei; Wu, Quantan; Li, Ling; Geng, Di; Yang, Guanhua; Ji, Zhouyu; Lu, Nianduan; Liu, Ming

    2018-02-01

    We present a continuous surface-potential-based compact model for molybdenum disulfide (MoS2) field effect transistors based on the multiple trapping release theory and the variable-range hopping theory. We also built contact resistance and velocity saturation models based on the analytical surface potential. This model is verified with experimental data and is able to accurately predict the temperature dependent behavior of the MoS2 field effect transistor. Our compact model is coded in Verilog-A, which can be implemented in a computer-aided design environment. Finally, we carried out an active matrix display simulation, which suggested that the proposed model can be successfully applied to circuit design.

  7. Fast iterative image reconstruction using sparse matrix factorization with GPU acceleration

    NASA Astrophysics Data System (ADS)

    Zhou, Jian; Qi, Jinyi

    2011-03-01

    Statistically based iterative approaches for image reconstruction have gained much attention in medical imaging. An accurate system matrix that defines the mapping from the image space to the data space is the key to high-resolution image reconstruction. However, an accurate system matrix is often associated with high computational cost and huge storage requirement. Here we present a method to address this problem by using sparse matrix factorization and parallel computing on a graphic processing unit (GPU).We factor the accurate system matrix into three sparse matrices: a sinogram blurring matrix, a geometric projection matrix, and an image blurring matrix. The sinogram blurring matrix models the detector response. The geometric projection matrix is based on a simple line integral model. The image blurring matrix is to compensate for the line-of-response (LOR) degradation due to the simplified geometric projection matrix. The geometric projection matrix is precomputed, while the sinogram and image blurring matrices are estimated by minimizing the difference between the factored system matrix and the original system matrix. The resulting factored system matrix has much less number of nonzero elements than the original system matrix and thus substantially reduces the storage and computation cost. The smaller size also allows an efficient implement of the forward and back projectors on GPUs, which have limited amount of memory. Our simulation studies show that the proposed method can dramatically reduce the computation cost of high-resolution iterative image reconstruction. The proposed technique is applicable to image reconstruction for different imaging modalities, including x-ray CT, PET, and SPECT.

  8. HIGH DIMENSIONAL COVARIANCE MATRIX ESTIMATION IN APPROXIMATE FACTOR MODELS

    PubMed Central

    Fan, Jianqing; Liao, Yuan; Mincheva, Martina

    2012-01-01

    The variance covariance matrix plays a central role in the inferential theories of high dimensional factor models in finance and economics. Popular regularization methods of directly exploiting sparsity are not directly applicable to many financial problems. Classical methods of estimating the covariance matrices are based on the strict factor models, assuming independent idiosyncratic components. This assumption, however, is restrictive in practical applications. By assuming sparse error covariance matrix, we allow the presence of the cross-sectional correlation even after taking out common factors, and it enables us to combine the merits of both methods. We estimate the sparse covariance using the adaptive thresholding technique as in Cai and Liu (2011), taking into account the fact that direct observations of the idiosyncratic components are unavailable. The impact of high dimensionality on the covariance matrix estimation based on the factor structure is then studied. PMID:22661790

  9. Multi-energy CT based on a prior rank, intensity and sparsity model (PRISM).

    PubMed

    Gao, Hao; Yu, Hengyong; Osher, Stanley; Wang, Ge

    2011-11-01

    We propose a compressive sensing approach for multi-energy computed tomography (CT), namely the prior rank, intensity and sparsity model (PRISM). To further compress the multi-energy image for allowing the reconstruction with fewer CT data and less radiation dose, the PRISM models a multi-energy image as the superposition of a low-rank matrix and a sparse matrix (with row dimension in space and column dimension in energy), where the low-rank matrix corresponds to the stationary background over energy that has a low matrix rank, and the sparse matrix represents the rest of distinct spectral features that are often sparse. Distinct from previous methods, the PRISM utilizes the generalized rank, e.g., the matrix rank of tight-frame transform of a multi-energy image, which offers a way to characterize the multi-level and multi-filtered image coherence across the energy spectrum. Besides, the energy-dependent intensity information can be incorporated into the PRISM in terms of the spectral curves for base materials, with which the restoration of the multi-energy image becomes the reconstruction of the energy-independent material composition matrix. In other words, the PRISM utilizes prior knowledge on the generalized rank and sparsity of a multi-energy image, and intensity/spectral characteristics of base materials. Furthermore, we develop an accurate and fast split Bregman method for the PRISM and demonstrate the superior performance of the PRISM relative to several competing methods in simulations.

  10. Application of fiber bridging models to fatigue crack growth in unidirectional titanium matrix composites

    NASA Technical Reports Server (NTRS)

    Bakuckas, J. G., Jr.; Johnson, W. S.

    1992-01-01

    Several fiber bridging models were reviewed and applied to study the matrix fatigue crack growth behavior in center notched (0)(sub 8) SCS-6/Ti-15-3 and (0)(sub 4) SCS-6/Ti-6Al-4V laminates. Observations revealed that fatigue damage consisted primarily of matrix cracks and fiber matrix interfacial failure in the (0)(sub 8) SCS-6/Ti-15-3 laminates. Fiber-matrix interface failure included fracture of the brittle reaction zone and cracking between the two carbon rich fiber coatings. Intact fibers in the wake of the matrix cracks reduce the stress intensity factor range. Thus, an applied stress intensity factor range is inappropriate to characterize matrix crack growth behavior. Fiber bridging models were used to determine the matrix stress intensity factor range in titanium metal matrix composites. In these models, the fibers in the wake of the crack are idealized as a closure pressure. An unknown constant frictional shear stress is assumed to act along the debond or slip length of the bridging fibers. The frictional shear stress was used as a curve fitting parameter to available data (crack growth data, crack opening displacement data, and debond length data). Large variations in the frictional shear stress required to fit the experimental data indicate that the fiber bridging models in their present form lack predictive capabilities. However, these models provide an efficient and relatively simple engineering method for conducting parametric studies of the matrix growth behavior based on constituent properties.

  11. Time-dependent deformation of titanium metal matrix composites

    NASA Technical Reports Server (NTRS)

    Bigelow, C. A.; Bahei-El-din, Y. A.; Mirdamadi, M.

    1995-01-01

    A three-dimensional finite element program called VISCOPAC was developed and used to conduct a micromechanics analysis of titanium metal matrix composites. The VISCOPAC program uses a modified Eisenberg-Yen thermo-viscoplastic constitutive model to predict matrix behavior under thermomechanical fatigue loading. The analysis incorporated temperature-dependent elastic properties in the fiber and temperature-dependent viscoplastic properties in the matrix. The material model was described and the necessary material constants were determined experimentally. Fiber-matrix interfacial behavior was analyzed using a discrete fiber-matrix model. The thermal residual stresses due to the fabrication cycle were predicted with a failed interface, The failed interface resulted in lower thermal residual stresses in the matrix and fiber. Stresses due to a uniform transverse load were calculated at two temperatures, room temperature and an elevated temperature of 650 C. At both temperatures, a large stress concentration was calculated when the interface had failed. The results indicate the importance of accuracy accounting for fiber-matrix interface failure and the need for a micromechanics-based analytical technique to understand and predict the behavior of titanium metal matrix composites.

  12. A Micromechanics-Based Damage Model for [+/- Theta/90n]s Composite Laminates

    NASA Technical Reports Server (NTRS)

    Mayugo, Joan-Andreu; Camanho, Pedro P.; Maimi, Pere; Davila, Carlos G.

    2006-01-01

    A new damage model based on a micromechanical analysis of cracked [+/- Theta/90n]s laminates subjected to multiaxial loads is proposed. The model predicts the onset and accumulation of transverse matrix cracks in uniformly stressed laminates, the effect of matrix cracks on the stiffness of the laminate, as well as the ultimate failure of the laminate. The model also accounts for the effect of the ply thickness on the ply strength. Predictions relating the elastic properties of several laminates and multiaxial loads are presented.

  13. Thermal stress effects in intermetallic matrix composites

    NASA Technical Reports Server (NTRS)

    Wright, P. K.; Sensmeier, M. D.; Kupperman, D. S.; Wadley, H. N. G.

    1993-01-01

    Intermetallic matrix composites develop residual stresses from the large thermal expansion mismatch (delta-alpha) between the fibers and matrix. This work was undertaken to: establish improved techniques to measure these thermal stresses in IMC's; determine residual stresses in a variety of IMC systems by experiments and modeling; and, determine the effect of residual stresses on selected mechanical properties of an IMC. X ray diffraction (XRD), neutron diffraction (ND), synchrotron XRD (SXRD), and ultrasonics (US) techniques for measuring thermal stresses in IMC were examined and ND was selected as the most promising technique. ND was demonstrated on a variety of IMC systems encompassing Ti- and Ni-base matrices, SiC, W, and Al2O3 fibers, and different fiber fractions (Vf). Experimental results on these systems agreed with predictions of a concentric cylinder model. In SiC/Ti-base systems, little yielding was found and stresses were controlled primarily by delta-alpha and Vf. In Ni-base matrix systems, yield strength of the matrix and Vf controlled stress levels. The longitudinal residual stresses in SCS-6/Ti-24Al-llNb composite were modified by thermomechanical processing. Increasing residual stress decreased ultimate tensile strength in agreement with model predictions. Fiber pushout strength showed an unexpected inverse correlation with residual stress. In-plane shear yield strength showed no dependence on residual stress. Higher levels of residual tension led to higher fatigue crack growth rates, as suggested by matrix mean stress effects.

  14. The performance evaluation model of mining project founded on the weight optimization entropy value method

    NASA Astrophysics Data System (ADS)

    Mao, Chao; Chen, Shou

    2017-01-01

    According to the traditional entropy value method still have low evaluation accuracy when evaluating the performance of mining projects, a performance evaluation model of mineral project founded on improved entropy is proposed. First establish a new weight assignment model founded on compatible matrix analysis of analytic hierarchy process (AHP) and entropy value method, when the compatibility matrix analysis to achieve consistency requirements, if it has differences between subjective weights and objective weights, moderately adjust both proportions, then on this basis, the fuzzy evaluation matrix for performance evaluation. The simulation experiments show that, compared with traditional entropy and compatible matrix analysis method, the proposed performance evaluation model of mining project based on improved entropy value method has higher accuracy assessment.

  15. Modeling the Nonlinear, Strain Rate Dependent Deformation of Woven Ceramic Matrix Composites With Hydrostatic Stress Effects Included

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Carney, Kelly S.

    2004-01-01

    An analysis method based on a deformation (as opposed to damage) approach has been developed to model the strain rate dependent, nonlinear deformation of woven ceramic matrix composites with a plain weave fiber architecture. In the developed model, the differences in the tension and compression response have also been considered. State variable based viscoplastic equations originally developed for metals have been modified to analyze the ceramic matrix composites. To account for the tension/compression asymmetry in the material, the effective stress and effective inelastic strain definitions have been modified. The equations have also been modified to account for the fact that in an orthotropic composite the in-plane shear stiffness is independent of the stiffness in the normal directions. The developed equations have been implemented into a commercially available transient dynamic finite element code, LS-DYNA, through the use of user defined subroutines (UMATs). The tensile, compressive, and shear deformation of a representative plain weave woven ceramic matrix composite are computed and compared to experimental results. The computed values correlate well to the experimental data, demonstrating the ability of the model to accurately compute the deformation response of woven ceramic matrix composites.

  16. Stress and Damage in Polymer Matrix Composite Materials Due to Material Degradation at High Temperatures

    NASA Technical Reports Server (NTRS)

    McManus, Hugh L.; Chamis, Christos C.

    1996-01-01

    This report describes analytical methods for calculating stresses and damage caused by degradation of the matrix constituent in polymer matrix composite materials. Laminate geometry, material properties, and matrix degradation states are specified as functions of position and time. Matrix shrinkage and property changes are modeled as functions of the degradation states. The model is incorporated into an existing composite mechanics computer code. Stresses, strains, and deformations at the laminate, ply, and micro levels are calculated, and from these calculations it is determined if there is failure of any kind. The rationale for the model (based on published experimental work) is presented, its integration into the laminate analysis code is outlined, and example results are given, with comparisons to existing material and structural data. The mechanisms behind the changes in properties and in surface cracking during long-term aging of polyimide matrix composites are clarified. High-temperature-material test methods are also evaluated.

  17. The Effect of Fiber Architecture on Matrix Cracking in Sic/sic Cmc's

    NASA Technical Reports Server (NTRS)

    Morscher, Gregory N.

    2005-01-01

    Applications incorporating silicon carbide fiber reinforced silicon carbide matrix composites (CMC's) will require a wide range of fiber architectures in order to fabricate complex shape. The stress-strain response of a given SiC/SiC system for different architectures and orientations will be required in order to design and effectively life-model future components. The mechanism for non-linear stress-strain behavior in CMC's is the formation and propagation of bridged-matrix cracks throughout the composite. A considerable amount of understanding has been achieved for the stress-dependent matrix cracking behavior of SiC fiber reinforced SiC matrix systems containing melt-infiltrated Si. This presentation will outline the effect of 2D and 3D architectures and orientation on stress-dependent matrix-cracking and how this information can be used to model material behavior and serve as the starting point foe mechanistic-based life-models.

  18. Fast and accurate computation of system matrix for area integral model-based algebraic reconstruction technique

    NASA Astrophysics Data System (ADS)

    Zhang, Shunli; Zhang, Dinghua; Gong, Hao; Ghasemalizadeh, Omid; Wang, Ge; Cao, Guohua

    2014-11-01

    Iterative algorithms, such as the algebraic reconstruction technique (ART), are popular for image reconstruction. For iterative reconstruction, the area integral model (AIM) is more accurate for better reconstruction quality than the line integral model (LIM). However, the computation of the system matrix for AIM is more complex and time-consuming than that for LIM. Here, we propose a fast and accurate method to compute the system matrix for AIM. First, we calculate the intersection of each boundary line of a narrow fan-beam with pixels in a recursive and efficient manner. Then, by grouping the beam-pixel intersection area into six types according to the slopes of the two boundary lines, we analytically compute the intersection area of the narrow fan-beam with the pixels in a simple algebraic fashion. Overall, experimental results show that our method is about three times faster than the Siddon algorithm and about two times faster than the distance-driven model (DDM) in computation of the system matrix. The reconstruction speed of our AIM-based ART is also faster than the LIM-based ART that uses the Siddon algorithm and DDM-based ART, for one iteration. The fast reconstruction speed of our method was accomplished without compromising the image quality.

  19. Automatic segmentation of right ventricle on ultrasound images using sparse matrix transform and level set

    NASA Astrophysics Data System (ADS)

    Qin, Xulei; Cong, Zhibin; Halig, Luma V.; Fei, Baowei

    2013-03-01

    An automatic framework is proposed to segment right ventricle on ultrasound images. This method can automatically segment both epicardial and endocardial boundaries from a continuous echocardiography series by combining sparse matrix transform (SMT), a training model, and a localized region based level set. First, the sparse matrix transform extracts main motion regions of myocardium as eigenimages by analyzing statistical information of these images. Second, a training model of right ventricle is registered to the extracted eigenimages in order to automatically detect the main location of the right ventricle and the corresponding transform relationship between the training model and the SMT-extracted results in the series. Third, the training model is then adjusted as an adapted initialization for the segmentation of each image in the series. Finally, based on the adapted initializations, a localized region based level set algorithm is applied to segment both epicardial and endocardial boundaries of the right ventricle from the whole series. Experimental results from real subject data validated the performance of the proposed framework in segmenting right ventricle from echocardiography. The mean Dice scores for both epicardial and endocardial boundaries are 89.1%+/-2.3% and 83.6+/-7.3%, respectively. The automatic segmentation method based on sparse matrix transform and level set can provide a useful tool for quantitative cardiac imaging.

  20. A differential CDM model for fatigue of unidirectional metal matrix composites

    NASA Technical Reports Server (NTRS)

    Arnold, S. M.; Kruch, S.

    1992-01-01

    A multiaxial, isothermal, continuum damage mechanics (CDM) model for fatigue of a unidirectional metal matrix composite volume element is presented. The model is phenomenological, stress based, and assumes a single scalar internal damage variable, the evolution of which is anisotropic. The development of the fatigue damage model, (i.e., evolutionary law) is based on the definition of an initially transversely isotropic fatigue limit surface, a static fracture surface, and a normalized stress amplitude function. The anisotropy of these surfaces and function, and therefore the model, is defined through physically meaningful invariants reflecting the local stress and material orientation. This transversely isotropic model is shown, when taken to it's isotropic limit, to directly simplify to a previously developed and validated isotropic fatigue continuum damage model. Results of a nondimensional parametric study illustrate (1) the flexibility of the present formulation in attempting to characterize a class of composite materials, and (2) the capability of the formulation in predicting anticipated qualitative trends in the fatigue behavior of unidirectional metal matrix composites. Also, specific material parameters representing an initial characterization of the composite system SiC/Ti 15-3 and the matrix material (Ti 15-3) are reported.

  1. Multi-allelic haplotype model based on genetic partition for genomic prediction and variance component estimation using SNP markers.

    PubMed

    Da, Yang

    2015-12-18

    The amount of functional genomic information has been growing rapidly but remains largely unused in genomic selection. Genomic prediction and estimation using haplotypes in genome regions with functional elements such as all genes of the genome can be an approach to integrate functional and structural genomic information for genomic selection. Towards this goal, this article develops a new haplotype approach for genomic prediction and estimation. A multi-allelic haplotype model treating each haplotype as an 'allele' was developed for genomic prediction and estimation based on the partition of a multi-allelic genotypic value into additive and dominance values. Each additive value is expressed as a function of h - 1 additive effects, where h = number of alleles or haplotypes, and each dominance value is expressed as a function of h(h - 1)/2 dominance effects. For a sample of q individuals, the limit number of effects is 2q - 1 for additive effects and is the number of heterozygous genotypes for dominance effects. Additive values are factorized as a product between the additive model matrix and the h - 1 additive effects, and dominance values are factorized as a product between the dominance model matrix and the h(h - 1)/2 dominance effects. Genomic additive relationship matrix is defined as a function of the haplotype model matrix for additive effects, and genomic dominance relationship matrix is defined as a function of the haplotype model matrix for dominance effects. Based on these results, a mixed model implementation for genomic prediction and variance component estimation that jointly use haplotypes and single markers is established, including two computing strategies for genomic prediction and variance component estimation with identical results. The multi-allelic genetic partition fills a theoretical gap in genetic partition by providing general formulations for partitioning multi-allelic genotypic values and provides a haplotype method based on the quantitative genetics model towards the utilization of functional and structural genomic information for genomic prediction and estimation.

  2. Modeling the Stress Strain Behavior of Woven Ceramic Matrix Composites

    NASA Technical Reports Server (NTRS)

    Morscher, Gregory N.

    2006-01-01

    Woven SiC fiber reinforced SiC matrix composites represent one of the most mature composite systems to date. Future components fabricated out of these woven ceramic matrix composites are expected to vary in shape, curvature, architecture, and thickness. The design of future components using woven ceramic matrix composites necessitates a modeling approach that can account for these variations which are physically controlled by local constituent contents and architecture. Research over the years supported primarily by NASA Glenn Research Center has led to the development of simple mechanistic-based models that can describe the entire stress-strain curve for composite systems fabricated with chemical vapor infiltrated matrices and melt-infiltrated matrices for a wide range of constituent content and architecture. Several examples will be presented that demonstrate the approach to modeling which incorporates a thorough understanding of the stress-dependent matrix cracking properties of the composite system.

  3. Thermal shock fracture in cross-ply fibre-reinforced ceramic-matrix composites

    NASA Astrophysics Data System (ADS)

    Kastritseas, C.; Smith, P. A.; Yeomans, J. A.

    2010-11-01

    The onset of matrix cracking due to thermal shock in a range of simple and multi-layer cross-ply laminates comprising a calcium aluminosilicate (CAS) matrix reinforced with Nicalon® fibres is investigated analytically. A comprehensive stress analysis under conditions of thermal shock, ignoring transient effects, is performed and fracture criteria based on either a recently derived model for the thermal shock resistance of unidirectional Nicalon®/glass ceramic-matrix composites or fracture mechanics considerations are formulated. The effect of material thickness on the apparent thermal shock resistance is also modelled. Comparison with experimental results reveals that the accuracy of the predictions is satisfactory and the reasons for some discrepancies are discussed. In addition, a theoretical argument based on thermal shock theory is formulated to explain the observed cracking patterns.

  4. Considering Horn's Parallel Analysis from a Random Matrix Theory Point of View.

    PubMed

    Saccenti, Edoardo; Timmerman, Marieke E

    2017-03-01

    Horn's parallel analysis is a widely used method for assessing the number of principal components and common factors. We discuss the theoretical foundations of parallel analysis for principal components based on a covariance matrix by making use of arguments from random matrix theory. In particular, we show that (i) for the first component, parallel analysis is an inferential method equivalent to the Tracy-Widom test, (ii) its use to test high-order eigenvalues is equivalent to the use of the joint distribution of the eigenvalues, and thus should be discouraged, and (iii) a formal test for higher-order components can be obtained based on a Tracy-Widom approximation. We illustrate the performance of the two testing procedures using simulated data generated under both a principal component model and a common factors model. For the principal component model, the Tracy-Widom test performs consistently in all conditions, while parallel analysis shows unpredictable behavior for higher-order components. For the common factor model, including major and minor factors, both procedures are heuristic approaches, with variable performance. We conclude that the Tracy-Widom procedure is preferred over parallel analysis for statistically testing the number of principal components based on a covariance matrix.

  5. Tensor-GMRES method for large sparse systems of nonlinear equations

    NASA Technical Reports Server (NTRS)

    Feng, Dan; Pulliam, Thomas H.

    1994-01-01

    This paper introduces a tensor-Krylov method, the tensor-GMRES method, for large sparse systems of nonlinear equations. This method is a coupling of tensor model formation and solution techniques for nonlinear equations with Krylov subspace projection techniques for unsymmetric systems of linear equations. Traditional tensor methods for nonlinear equations are based on a quadratic model of the nonlinear function, a standard linear model augmented by a simple second order term. These methods are shown to be significantly more efficient than standard methods both on nonsingular problems and on problems where the Jacobian matrix at the solution is singular. A major disadvantage of the traditional tensor methods is that the solution of the tensor model requires the factorization of the Jacobian matrix, which may not be suitable for problems where the Jacobian matrix is large and has a 'bad' sparsity structure for an efficient factorization. We overcome this difficulty by forming and solving the tensor model using an extension of a Newton-GMRES scheme. Like traditional tensor methods, we show that the new tensor method has significant computational advantages over the analogous Newton counterpart. Consistent with Krylov subspace based methods, the new tensor method does not depend on the factorization of the Jacobian matrix. As a matter of fact, the Jacobian matrix is never needed explicitly.

  6. Modeling cometary photopolarimetric characteristics with Sh-matrix method

    NASA Astrophysics Data System (ADS)

    Kolokolova, L.; Petrov, D.

    2017-12-01

    Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

  7. Three-dimensional prostate tumor model based on a hyaluronic acid-alginate hydrogel for evaluation of anti-cancer drug efficacy.

    PubMed

    Tang, Yadong; Huang, Boxin; Dong, Yuqin; Wang, Wenlong; Zheng, Xi; Zhou, Wei; Zhang, Kun; Du, Zhiyun

    2017-10-01

    In vitro cell-based assays are widely applied to evaluate anti-cancer drug efficacy. However, the conventional approaches are mostly based on two-dimensional (2D) culture systems, making it difficult to recapitulate the in vivo tumor scenario because of spatial limitations. Here, we develop an in vitro three-dimensional (3D) prostate tumor model based on a hyaluronic acid (HA)-alginate hybrid hydrogel to bridge the gap between in vitro and in vivo anticancer drug evaluations. In situ encapsulation of PCa cells was achieved by mixing HA and alginate aqueous solutions in the presence of cells and then crosslinking with calcium ions. Unlike in 2D culture, cells were found to aggregate into spheroids in a 3D matrix. The expression of epithelial to mesenchyme transition (EMT) biomarkers was found to be largely enhanced, indicating an increased invasion and metastasis potential in the hydrogel matrix. A significant up-regulation of proangiogenic growth factors (IL-8, VEGF) and matrix metalloproteinases (MMPs) was observed in 3D-cultured PCa cells. The results of anti-cancer drug evaluation suggested a higher drug tolerance within the 3D tumor model compared to conventional 2D-cultured cells. Finally, we found that the drug effect within the in vitro 3D cancer model based on HA-alginate matrix exhibited better predictability for in vivo drug efficacy.

  8. Efficient Storage Scheme of Covariance Matrix during Inverse Modeling

    NASA Astrophysics Data System (ADS)

    Mao, D.; Yeh, T. J.

    2013-12-01

    During stochastic inverse modeling, the covariance matrix of geostatistical based methods carries the information about the geologic structure. Its update during iterations reflects the decrease of uncertainty with the incorporation of observed data. For large scale problem, its storage and update cost too much memory and computational resources. In this study, we propose a new efficient storage scheme for storage and update. Compressed Sparse Column (CSC) format is utilized to storage the covariance matrix, and users can assign how many data they prefer to store based on correlation scales since the data beyond several correlation scales are usually not very informative for inverse modeling. After every iteration, only the diagonal terms of the covariance matrix are updated. The off diagonal terms are calculated and updated based on shortened correlation scales with a pre-assigned exponential model. The correlation scales are shortened by a coefficient, i.e. 0.95, every iteration to show the decrease of uncertainty. There is no universal coefficient for all the problems and users are encouraged to try several times. This new scheme is tested with 1D examples first. The estimated results and uncertainty are compared with the traditional full storage method. In the end, a large scale numerical model is utilized to validate this new scheme.

  9. Estimation of genetic connectedness diagnostics based on prediction errors without the prediction error variance-covariance matrix.

    PubMed

    Holmes, John B; Dodds, Ken G; Lee, Michael A

    2017-03-02

    An important issue in genetic evaluation is the comparability of random effects (breeding values), particularly between pairs of animals in different contemporary groups. This is usually referred to as genetic connectedness. While various measures of connectedness have been proposed in the literature, there is general agreement that the most appropriate measure is some function of the prediction error variance-covariance matrix. However, obtaining the prediction error variance-covariance matrix is computationally demanding for large-scale genetic evaluations. Many alternative statistics have been proposed that avoid the computational cost of obtaining the prediction error variance-covariance matrix, such as counts of genetic links between contemporary groups, gene flow matrices, and functions of the variance-covariance matrix of estimated contemporary group fixed effects. In this paper, we show that a correction to the variance-covariance matrix of estimated contemporary group fixed effects will produce the exact prediction error variance-covariance matrix averaged by contemporary group for univariate models in the presence of single or multiple fixed effects and one random effect. We demonstrate the correction for a series of models and show that approximations to the prediction error matrix based solely on the variance-covariance matrix of estimated contemporary group fixed effects are inappropriate in certain circumstances. Our method allows for the calculation of a connectedness measure based on the prediction error variance-covariance matrix by calculating only the variance-covariance matrix of estimated fixed effects. Since the number of fixed effects in genetic evaluation is usually orders of magnitudes smaller than the number of random effect levels, the computational requirements for our method should be reduced.

  10. Fracture-Based Mesh Size Requirements for Matrix Cracks in Continuum Damage Mechanics Models

    NASA Technical Reports Server (NTRS)

    Leone, Frank A.; Davila, Carlos G.; Mabson, Gerald E.; Ramnath, Madhavadas; Hyder, Imran

    2017-01-01

    This paper evaluates the ability of progressive damage analysis (PDA) finite element (FE) models to predict transverse matrix cracks in unidirectional composites. The results of the analyses are compared to closed-form linear elastic fracture mechanics (LEFM) solutions. Matrix cracks in fiber-reinforced composite materials subjected to mode I and mode II loading are studied using continuum damage mechanics and zero-thickness cohesive zone modeling approaches. The FE models used in this study are built parametrically so as to investigate several model input variables and the limits associated with matching the upper-bound LEFM solutions. Specifically, the sensitivity of the PDA FE model results to changes in strength and element size are investigated.

  11. The concept and use of elasticity in population viability models [Exercise 13

    Treesearch

    Carolyn Hull Sieg; Rudy M. King; Fred Van Dyke

    2003-01-01

    As you have seen in exercise 12, plants, such as the western prairie fringed orchid, typically have distinct life stages and complex life cycles that require the matrix analyses associated with a stage-based population model. Some statistics that can be generated from such matrix analyses can be very informative in determining which variables in the model have the...

  12. Numerical modelling of transdermal delivery from matrix systems: parametric study and experimental validation with silicone matrices.

    PubMed

    Snorradóttir, Bergthóra S; Jónsdóttir, Fjóla; Sigurdsson, Sven Th; Másson, Már

    2014-08-01

    A model is presented for transdermal drug delivery from single-layered silicone matrix systems. The work is based on our previous results that, in particular, extend the well-known Higuchi model. Recently, we have introduced a numerical transient model describing matrix systems where the drug dissolution can be non-instantaneous. Furthermore, our model can describe complex interactions within a multi-layered matrix and the matrix to skin boundary. The power of the modelling approach presented here is further illustrated by allowing the possibility of a donor solution. The model is validated by a comparison with experimental data, as well as validating the parameter values against each other, using various configurations with donor solution, silicone matrix and skin. Our results show that the model is a good approximation to real multi-layered delivery systems. The model offers the ability of comparing drug release for ibuprofen and diclofenac, which cannot be analysed by the Higuchi model because the dissolution in the latter case turns out to be limited. The experiments and numerical model outlined in this study could also be adjusted to more general formulations, which enhances the utility of the numerical model as a design tool for the development of drug-loaded matrices for trans-membrane and transdermal delivery. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  13. Matrix approach to land carbon cycle modeling: A case study with the Community Land Model.

    PubMed

    Huang, Yuanyuan; Lu, Xingjie; Shi, Zheng; Lawrence, David; Koven, Charles D; Xia, Jianyang; Du, Zhenggang; Kluzek, Erik; Luo, Yiqi

    2018-03-01

    The terrestrial carbon (C) cycle has been commonly represented by a series of C balance equations to track C influxes into and effluxes out of individual pools in earth system models (ESMs). This representation matches our understanding of C cycle processes well but makes it difficult to track model behaviors. It is also computationally expensive, limiting the ability to conduct comprehensive parametric sensitivity analyses. To overcome these challenges, we have developed a matrix approach, which reorganizes the C balance equations in the original ESM into one matrix equation without changing any modeled C cycle processes and mechanisms. We applied the matrix approach to the Community Land Model (CLM4.5) with vertically-resolved biogeochemistry. The matrix equation exactly reproduces litter and soil organic carbon (SOC) dynamics of the standard CLM4.5 across different spatial-temporal scales. The matrix approach enables effective diagnosis of system properties such as C residence time and attribution of global change impacts to relevant processes. We illustrated, for example, the impacts of CO 2 fertilization on litter and SOC dynamics can be easily decomposed into the relative contributions from C input, allocation of external C into different C pools, nitrogen regulation, altered soil environmental conditions, and vertical mixing along the soil profile. In addition, the matrix tool can accelerate model spin-up, permit thorough parametric sensitivity tests, enable pool-based data assimilation, and facilitate tracking and benchmarking of model behaviors. Overall, the matrix approach can make a broad range of future modeling activities more efficient and effective. © 2017 John Wiley & Sons Ltd.

  14. Scale-Dependent Fracture-Matrix Interactions And Their Impact on Radionuclide Transport - Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Detwiler, Russell

    Matrix diffusion and adsorption within a rock matrix are widely regarded as important mechanisms for retarding the transport of radionuclides and other solutes in fractured rock (e.g., Neretnieks, 1980; Tang et al., 1981; Maloszewski and Zuber, 1985; Novakowski and Lapcevic, 1994; Jardine et al., 1999; Zhou and Xie, 2003; Reimus et al., 2003a,b). When remediation options are being evaluated for old sources of contamination, where a large fraction of contaminants reside within the rock matrix, slow diffusion out of the matrix greatly increases the difficulty and timeframe of remediation. Estimating the rates of solute exchange between fractures and the adjacentmore » rock matrix is a critical factor in quantifying immobilization and/or remobilization of DOE-relevant contaminants within the subsurface. In principle, the most rigorous approach to modeling solute transport with fracture-matrix interaction would be based on local-scale coupled advection-diffusion/dispersion equations for the rock matrix and in discrete fractures that comprise the fracture network (Discrete Fracture Network and Matrix approach, hereinafter referred to as DFNM approach), fully resolving aperture variability in fractures and matrix property heterogeneity. However, such approaches are computationally demanding, and thus, many predictive models rely upon simplified models. These models typically idealize fracture rock masses as a single fracture or system of parallel fractures interacting with slabs of porous matrix or as a mobile-immobile or multi-rate mass transfer system. These idealizations provide tractable approaches for interpreting tracer tests and predicting contaminant mobility, but rely upon a fitted effective matrix diffusivity or mass-transfer coefficients. However, because these fitted parameters are based upon simplified conceptual models, their effectiveness at predicting long-term transport processes remains uncertain. Evidence of scale dependence of effective matrix diffusion coefficients obtained from tracer tests highlights this point and suggests that the underlying mechanisms and relationship between rock and fracture properties are not fully understood in large complex fracture networks. In this project, we developed a high-resolution DFN model of solute transport in fracture networks to explore and quantify the mechanisms that control transport in complex fracture networks and how these may give rise to observed scale-dependent matrix diffusion coefficients. Results demonstrate that small scale heterogeneity in the flow field caused by local aperture variability within individual fractures can lead to long-tailed breakthrough curves indicative of matrix diffusion, even in the absence of interactions with the fracture matrix. Furthermore, the temporal and spatial scale dependence of these processes highlights the inability of short-term tracer tests to estimate transport parameters that will control long-term fate and transport of contaminants in fractured aquifers.« less

  15. A coupled/uncoupled deformation and fatigue damage algorithm utilizing the finite element method

    NASA Technical Reports Server (NTRS)

    Wilt, Thomas E.; Arnold, Steven M.

    1994-01-01

    A fatigue damage computational algorithm utilizing a multiaxial, isothermal, continuum based fatigue damage model for unidirectional metal matrix composites has been implemented into the commercial finite element code MARC using MARC user subroutines. Damage is introduced into the finite element solution through the concept of effective stress which fully couples the fatigue damage calculations with the finite element deformation solution. An axisymmetric stress analysis was performed on a circumferentially reinforced ring, wherein both the matrix cladding and the composite core were assumed to behave elastic-perfectly plastic. The composite core behavior was represented using Hill's anisotropic continuum based plasticity model, and similarly, the matrix cladding was represented by an isotropic plasticity model. Results are presented in the form of S-N curves and damage distribution plots.

  16. Generating Nonnormal Multivariate Data Using Copulas: Applications to SEM.

    PubMed

    Mair, Patrick; Satorra, Albert; Bentler, Peter M

    2012-07-01

    This article develops a procedure based on copulas to simulate multivariate nonnormal data that satisfy a prespecified variance-covariance matrix. The covariance matrix used can comply with a specific moment structure form (e.g., a factor analysis or a general structural equation model). Thus, the method is particularly useful for Monte Carlo evaluation of structural equation models within the context of nonnormal data. The new procedure for nonnormal data simulation is theoretically described and also implemented in the widely used R environment. The quality of the method is assessed by Monte Carlo simulations. A 1-sample test on the observed covariance matrix based on the copula methodology is proposed. This new test for evaluating the quality of a simulation is defined through a particular structural model specification and is robust against normality violations.

  17. Prediction on the inhibition ratio of pyrrolidine derivatives on matrix metalloproteinase based on gene expression programming.

    PubMed

    Li, Yuqin; You, Guirong; Jia, Baoxiu; Si, Hongzong; Yao, Xiaojun

    2014-01-01

    Quantitative structure-activity relationships (QSAR) were developed to predict the inhibition ratio of pyrrolidine derivatives on matrix metalloproteinase via heuristic method (HM) and gene expression programming (GEP). The descriptors of 33 pyrrolidine derivatives were calculated by the software CODESSA, which can calculate quantum chemical, topological, geometrical, constitutional, and electrostatic descriptors. HM was also used for the preselection of 5 appropriate molecular descriptors. Linear and nonlinear QSAR models were developed based on the HM and GEP separately and two prediction models lead to a good correlation coefficient (R (2)) of 0.93 and 0.94. The two QSAR models are useful in predicting the inhibition ratio of pyrrolidine derivatives on matrix metalloproteinase during the discovery of new anticancer drugs and providing theory information for studying the new drugs.

  18. A nonequilibrium model for reactive contaminant transport through fractured porous media: Model development and semianalytical solution

    NASA Astrophysics Data System (ADS)

    Joshi, Nitin; Ojha, C. S. P.; Sharma, P. K.

    2012-10-01

    In this study a conceptual model that accounts for the effects of nonequilibrium contaminant transport in a fractured porous media is developed. Present model accounts for both physical and sorption nonequilibrium. Analytical solution was developed using the Laplace transform technique, which was then numerically inverted to obtain solute concentration in the fracture matrix system. The semianalytical solution developed here can incorporate both semi-infinite and finite fracture matrix extent. In addition, the model can account for flexible boundary conditions and nonzero initial condition in the fracture matrix system. The present semianalytical solution was validated against the existing analytical solutions for the fracture matrix system. In order to differentiate between various sorption/transport mechanism different cases of sorption and mass transfer were analyzed by comparing the breakthrough curves and temporal moments. It was found that significant differences in the signature of sorption and mass transfer exists. Applicability of the developed model was evaluated by simulating the published experimental data of Calcium and Strontium transport in a single fracture. The present model simulated the experimental data reasonably well in comparison to the model based on equilibrium sorption assumption in fracture matrix system, and multi rate mass transfer model.

  19. A Framework to Debug Diagnostic Matrices

    NASA Technical Reports Server (NTRS)

    Kodal, Anuradha; Robinson, Peter; Patterson-Hine, Ann

    2013-01-01

    Diagnostics is an important concept in system health and monitoring of space operations. Many of the existing diagnostic algorithms utilize system knowledge in the form of diagnostic matrix (D-matrix, also popularly known as diagnostic dictionary, fault signature matrix or reachability matrix) gleaned from physical models. But, sometimes, this may not be coherent to obtain high diagnostic performance. In such a case, it is important to modify this D-matrix based on knowledge obtained from other sources such as time-series data stream (simulated or maintenance data) within the context of a framework that includes the diagnostic/inference algorithm. A systematic and sequential update procedure, diagnostic modeling evaluator (DME) is proposed to modify D-matrix and wrapper logic considering least expensive solution first. This iterative procedure includes conditions ranging from modifying 0s and 1s in the matrix, or adding/removing the rows (failure sources) columns (tests). We will experiment this framework on datasets from DX challenge 2009.

  20. Implementation of the SU(2) Hamiltonian Symmetry for the DMRG Algorithm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alvarez, Gonzalo

    2012-01-01

    In the Density Matrix Renormalization Group (DMRG) algorithm (White, 1992, 1993) and Hamiltonian symmetries play an important role. Using symmetries, the matrix representation of the Hamiltonian can be blocked. Diagonalizing each matrix block is more efficient than diagonalizing the original matrix. This paper explains how the the DMRG++ code (Alvarez, 2009) has been extended to handle the non-local SU(2) symmetry in a model independent way. Improvements in CPU times compared to runs with only local symmetries are discussed for the one-orbital Hubbard model, and for a two-orbital Hubbard model for iron-based superconductors. The computational bottleneck of the algorithm and themore » use of shared memory parallelization are also addressed.« less

  1. Micromechanical Modeling of Woven Metal Matrix Composites

    NASA Technical Reports Server (NTRS)

    Bednarcyk, Brett A.; Pindera, Marek-Jerzy

    1997-01-01

    This report presents the results of an extensive micromechanical modeling effort for woven metal matrix composites. The model is employed to predict the mechanical response of 8-harness (8H) satin weave carbon/copper (C/Cu) composites. Experimental mechanical results for this novel high thermal conductivity material were recently reported by Bednarcyk et al. along with preliminary model results. The micromechanics model developed herein is based on an embedded approach. A micromechanics model for the local (micro-scale) behavior of the woven composite, the original method of cells (Aboudi), is embedded in a global (macro-scale) micromechanics model (the three-dimensional generalized method of cells (GMC-3D) (Aboudi). This approach allows representation of true repeating unit cells for woven metal matrix composites via GMC-3D, and representation of local effects, such as matrix plasticity, yarn porosity, and imperfect fiber-matrix bonding. In addition, the equations of GMC-3D were reformulated to significantly reduce the number of unknown quantities that characterize the deformation fields at the microlevel in order to make possible the analysis of actual microstructures of woven composites. The resulting micromechanical model (WCGMC) provides an intermediate level of geometric representation, versatility, and computational efficiency with respect to previous analytical and numerical models for woven composites, but surpasses all previous modeling work by allowing the mechanical response of a woven metal matrix composite, with an elastoplastic matrix, to be examined for the first time. WCGMC is employed to examine the effects of composite microstructure, porosity, residual stresses, and imperfect fiber-matrix bonding on the predicted mechanical response of 8H satin C/Cu. The previously reported experimental results are summarized, and the model predictions are compared to monotonic and cyclic tensile and shear test data. By considering appropriate levels of porosity, residual stresses, and imperfect fiber-matrix debonding, reasonably good qualitative and quantitative correlation is achieved between model and experiment.

  2. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  3. Numerical simulation of elasto-plastic deformation of composites: evolution of stress microfields and implications for homogenization models

    NASA Astrophysics Data System (ADS)

    González, C.; Segurado, J.; LLorca, J.

    2004-07-01

    The deformation of a composite made up of a random and homogeneous dispersion of elastic spheres in an elasto-plastic matrix was simulated by the finite element analysis of three-dimensional multiparticle cubic cells with periodic boundary conditions. "Exact" results (to a few percent) in tension and shear were determined by averaging 12 stress-strain curves obtained from cells containing 30 spheres, and they were compared with the predictions of secant homogenization models. In addition, the numerical simulations supplied detailed information of the stress microfields, which was used to ascertain the accuracy and the limitations of the homogenization models to include the nonlinear deformation of the matrix. It was found that secant approximations based on the volume-averaged second-order moment of the matrix stress tensor, combined with a highly accurate linear homogenization model, provided excellent predictions of the composite response when the matrix strain hardening rate was high. This was not the case, however, in composites which exhibited marked plastic strain localization in the matrix. The analysis of the evolution of the matrix stresses revealed that better predictions of the composite behavior can be obtained with new homogenization models which capture the essential differences in the stress carried by the elastic and plastic regions in the matrix at the onset of plastic deformation.

  4. Computational Simulation of the High Strain Rate Tensile Response of Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.

    2002-01-01

    A research program is underway to develop strain rate dependent deformation and failure models for the analysis of polymer matrix composites subject to high strain rate impact loads. Under these types of loading conditions, the material response can be highly strain rate dependent and nonlinear. State variable constitutive equations based on a viscoplasticity approach have been developed to model the deformation of the polymer matrix. The constitutive equations are then combined with a mechanics of materials based micromechanics model which utilizes fiber substructuring to predict the effective mechanical and thermal response of the composite. To verify the analytical model, tensile stress-strain curves are predicted for a representative composite over strain rates ranging from around 1 x 10(exp -5)/sec to approximately 400/sec. The analytical predictions compare favorably to experimentally obtained values both qualitatively and quantitatively. Effective elastic and thermal constants are predicted for another composite, and compared to finite element results.

  5. Modeling extracellular matrix degradation balance with proteinase/transglutaminase cycle.

    PubMed

    Larreta-Garde, Veronique; Berry, Hugues

    2002-07-07

    Extracellular matrix mass balance is implied in many physiological and pathological events, such as metastasis dissemination. Widely studied, its destructive part is mainly catalysed by extracellular proteinases. Conversely, the properties of the constructive part are less obvious, cellular neo-synthesis being usually considered as its only element. In this paper, we introduce the action of transglutaminase in a mathematical model for extracellular matrix remodeling. This extracellular enzyme, catalysing intermolecular protein cross-linking, is considered here as a reverse proteinase as far as the extracellular matrix physical state is concerned. The model is based on a proteinase/transglutaminase cycle interconverting insoluble matrix and soluble proteolysis fragments, with regulation of cellular proteinase expression by the fragments. Under "closed" (batch) conditions, i.e. neglecting matrix influx and fragment efflux from the system, the model is bistable, with reversible hysteresis. Extracellular matrix proteins concentration abruptly switches from low to high levels when transglutaminase activity exceeds a threshold value. Proteinase concentration usually follows the reverse complementary kinetics, but can become apparently uncoupled from extracellular matrix concentration for some parameter values. When matrix production by the cells and fragment degradation are taken into account, the dynamics change to sustained oscillations because of the emergence of a stable limit cycle. Transitions out of and into oscillation areas are controlled by the model parameters. Biological interpretation indicates that these oscillations could represent the normal homeostatic situation, whereas the other exhibited dynamics can be related to pathologies such as tumor invasion or fibrosis. These results allow to discuss the insights that the model could contribute to the comprehension of these complex biological events.

  6. Heading-vector navigation based on head-direction cells and path integration.

    PubMed

    Kubie, John L; Fenton, André A

    2009-05-01

    Insect navigation is guided by heading vectors that are computed by path integration. Mammalian navigation models, on the other hand, are typically based on map-like place representations provided by hippocampal place cells. Such models compute optimal routes as a continuous series of locations that connect the current location to a goal. We propose a "heading-vector" model in which head-direction cells or their derivatives serve both as key elements in constructing the optimal route and as the straight-line guidance during route execution. The model is based on a memory structure termed the "shortcut matrix," which is constructed during the initial exploration of an environment when a set of shortcut vectors between sequential pairs of visited waypoint locations is stored. A mechanism is proposed for calculating and storing these vectors that relies on a hypothesized cell type termed an "accumulating head-direction cell." Following exploration, shortcut vectors connecting all pairs of waypoint locations are computed by vector arithmetic and stored in the shortcut matrix. On re-entry, when local view or place representations query the shortcut matrix with a current waypoint and goal, a shortcut trajectory is retrieved. Since the trajectory direction is in head-direction compass coordinates, navigation is accomplished by tracking the firing of head-direction cells that are tuned to the heading angle. Section 1 of the manuscript describes the properties of accumulating head-direction cells. It then shows how accumulating head-direction cells can store local vectors and perform vector arithmetic to perform path-integration-based homing. Section 2 describes the construction and use of the shortcut matrix for computing direct paths between any pair of locations that have been registered in the shortcut matrix. In the discussion, we analyze the advantages of heading-based navigation over map-based navigation. Finally, we survey behavioral evidence that nonhippocampal, heading-based navigation is used in small mammals and humans. Copyright 2008 Wiley-Liss, Inc.

  7. Multi-ray-based system matrix generation for 3D PET reconstruction

    NASA Astrophysics Data System (ADS)

    Moehrs, Sascha; Defrise, Michel; Belcari, Nicola; DelGuerra, Alberto; Bartoli, Antonietta; Fabbri, Serena; Zanetti, Gianluigi

    2008-12-01

    Iterative image reconstruction algorithms for positron emission tomography (PET) require a sophisticated system matrix (model) of the scanner. Our aim is to set up such a model offline for the YAP-(S)PET II small animal imaging tomograph in order to use it subsequently with standard ML-EM (maximum-likelihood expectation maximization) and OSEM (ordered subset expectation maximization) for fully three-dimensional image reconstruction. In general, the system model can be obtained analytically, via measurements or via Monte Carlo simulations. In this paper, we present the multi-ray method, which can be considered as a hybrid method to set up the system model offline. It incorporates accurate analytical (geometric) considerations as well as crystal depth and crystal scatter effects. At the same time, it has the potential to model seamlessly other physical aspects such as the positron range. The proposed method is based on multiple rays which are traced from/to the detector crystals through the image volume. Such a ray-tracing approach itself is not new; however, we derive a novel mathematical formulation of the approach and investigate the positioning of the integration (ray-end) points. First, we study single system matrix entries and show that the positioning and weighting of the ray-end points according to Gaussian integration give better results compared to equally spaced integration points (trapezoidal integration), especially if only a small number of integration points (rays) are used. Additionally, we show that, for a given variance of the single matrix entries, the number of rays (events) required to calculate the whole matrix is a factor of 20 larger when using a pure Monte-Carlo-based method. Finally, we analyse the quality of the model by reconstructing phantom data from the YAP-(S)PET II scanner.

  8. Stress and Damage in Polymer Matrix Composite Materials Due to Material Degradation at High Temperatures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mcmanus, H.L.; Chamis, C.C.

    1996-01-01

    This report describes analytical methods for calculating stresses and damage caused by degradation of the matrix constituent in polymer matrix composite materials. Laminate geometry, material properties, and matrix degradation states are specified as functions of position and time. Matrix shrinkage and property changes are modeled as functions of the degradation states. The model is incorporated into an existing composite mechanics computer code. Stresses, strains, and deformations at the laminate, ply, and micro levels are calculated, and from these calculations it is determined if there is failure of any kind. The rationale for the model (based on published experimental work) ismore » presented, its integration into the laminate analysis code is outlined, and example results are given, with comparisons to existing material and structural data. The mechanisms behind the changes in properties and in surface cracking during long-term aging of polyimide matrix composites are clarified. High-temperature-material test methods are also evaluated.« less

  9. LS-DYNA Implementation of Polymer Matrix Composite Model Under High Strain Rate Impact

    NASA Technical Reports Server (NTRS)

    Zheng, Xia-Hua; Goldberg, Robert K.; Binienda, Wieslaw K.; Roberts, Gary D.

    2003-01-01

    A recently developed constitutive model is implemented into LS-DYNA as a user defined material model (UMAT) to characterize the nonlinear strain rate dependent behavior of polymers. By utilizing this model within a micromechanics technique based on a laminate analogy, an algorithm to analyze the strain rate dependent, nonlinear deformation of a fiber reinforced polymer matrix composite is then developed as a UMAT to simulate the response of these composites under high strain rate impact. The models are designed for shell elements in order to ensure computational efficiency. Experimental and numerical stress-strain curves are compared for two representative polymers and a representative polymer matrix composite, with the analytical model predicting the experimental response reasonably well.

  10. A Method of Q-Matrix Validation for the Linear Logistic Test Model

    PubMed Central

    Baghaei, Purya; Hohensinn, Christine

    2017-01-01

    The linear logistic test model (LLTM) is a well-recognized psychometric model for examining the components of difficulty in cognitive tests and validating construct theories. The plausibility of the construct model, summarized in a matrix of weights, known as the Q-matrix or weight matrix, is tested by (1) comparing the fit of LLTM with the fit of the Rasch model (RM) using the likelihood ratio (LR) test and (2) by examining the correlation between the Rasch model item parameters and LLTM reconstructed item parameters. The problem with the LR test is that it is almost always significant and, consequently, LLTM is rejected. The drawback of examining the correlation coefficient is that there is no cut-off value or lower bound for the magnitude of the correlation coefficient. In this article we suggest a simulation method to set a minimum benchmark for the correlation between item parameters from the Rasch model and those reconstructed by the LLTM. If the cognitive model is valid then the correlation coefficient between the RM-based item parameters and the LLTM-reconstructed item parameters derived from the theoretical weight matrix should be greater than those derived from the simulated matrices. PMID:28611721

  11. Recovering hidden diagonal structures via non-negative matrix factorization with multiple constraints.

    PubMed

    Yang, Xi; Han, Guoqiang; Cai, Hongmin; Song, Yan

    2017-03-31

    Revealing data with intrinsically diagonal block structures is particularly useful for analyzing groups of highly correlated variables. Earlier researches based on non-negative matrix factorization (NMF) have been shown to be effective in representing such data by decomposing the observed data into two factors, where one factor is considered to be the feature and the other the expansion loading from a linear algebra perspective. If the data are sampled from multiple independent subspaces, the loading factor would possess a diagonal structure under an ideal matrix decomposition. However, the standard NMF method and its variants have not been reported to exploit this type of data via direct estimation. To address this issue, a non-negative matrix factorization with multiple constraints model is proposed in this paper. The constraints include an sparsity norm on the feature matrix and a total variational norm on each column of the loading matrix. The proposed model is shown to be capable of efficiently recovering diagonal block structures hidden in observed samples. An efficient numerical algorithm using the alternating direction method of multipliers model is proposed for optimizing the new model. Compared with several benchmark models, the proposed method performs robustly and effectively for simulated and real biological data.

  12. Oxygen Diffusion and Reaction Kinetics in Continuous Fiber Ceramic Matrix Composites

    NASA Technical Reports Server (NTRS)

    Halbig, Michael C.; Eckel, Andrew J.; Cawley, James D.

    1999-01-01

    Previous stressed oxidation tests of C/SiC composites at elevated temperatures (350 C to 1500 C) and sustained stresses (69 MPa and 172 MPa) have led to the development of a finite difference cracked matrix model. The times to failure in the samples suggest oxidation occurred in two kinetic regimes defined by the rate controlling mechanisms (i.e. diffusion controlled and reaction controlled kinetics). Microstructural analysis revealed preferential oxidation along as-fabricated, matrix microcracks and also suggested two regimes of oxidation kinetics dependent on the oxidation temperature. Based on experimental results, observation, and theory, a finite difference model was developed. The model simulates the diffusion of oxygen into a matrix crack bridged by carbon fibers. The model facilitates the study of the relative importance of temperature, the reaction rate constant, and the diffusion coefficient on the overall oxidation kinetics.

  13. Coulomb matrix elements in multi-orbital Hubbard models.

    PubMed

    Bünemann, Jörg; Gebhard, Florian

    2017-04-26

    Coulomb matrix elements are needed in all studies in solid-state theory that are based on Hubbard-type multi-orbital models. Due to symmetries, the matrix elements are not independent. We determine a set of independent Coulomb parameters for a d-shell and an f-shell and all point groups with up to 16 elements (O h , O, T d , T h , D 6h , and D 4h ). Furthermore, we express all other matrix elements as a function of the independent Coulomb parameters. Apart from the solution of the general point-group problem we investigate in detail the spherical approximation and first-order corrections to the spherical approximation.

  14. Electronic implementation of associative memory based on neural network models

    NASA Technical Reports Server (NTRS)

    Moopenn, A.; Lambe, John; Thakoor, A. P.

    1987-01-01

    An electronic embodiment of a neural network based associative memory in the form of a binary connection matrix is described. The nature of false memory errors, their effect on the information storage capacity of binary connection matrix memories, and a novel technique to eliminate such errors with the help of asymmetrical extra connections are discussed. The stability of the matrix memory system incorporating a unique local inhibition scheme is analyzed in terms of local minimization of an energy function. The memory's stability, dynamic behavior, and recall capability are investigated using a 32-'neuron' electronic neural network memory with a 1024-programmable binary connection matrix.

  15. Micromechanical Fatigue Visco-Damage Model for Short Glass Fiber Reinforced Polyamide-66

    NASA Astrophysics Data System (ADS)

    Despringre, N.; Chemisky, Y.; Robert, G.; Meraghni, F.

    This work presents a micromechanical fatigue damage model developed for short glass fiber reinforced PA66. It has been developed to predict the high cycle fatigue behavior of PA66/GF30. The model is based on an extended Mori-Tanaka method which includes coated inclusions, matrix viscoelasticity and the evolution of micro-scale damage. The developed model accounts for the nonlinear matrix viscoelasticity and the reinforcement orientation. The description of the damage processes is based on the experimental investigation of damage mechanisms previously performed through in-situ SEM tests and X-ray micro-computed tomography observations. Damage chronologies have been proposed involving three different processes: interface debonding/coating, matrix micro-cracking and fiber breakages. Their occurrence strongly depends on the microstructure and the relative humidity. Each damage mechanism is introduced through an evolution law coupled to local stress fields. The developed model is implemented using a UMAT subroutine. Its experimental validation is achieved under stress or strain controlled fatigue tests.

  16. Hypergraph partitioning implementation for parallelizing matrix-vector multiplication using CUDA GPU-based parallel computing

    NASA Astrophysics Data System (ADS)

    Murni, Bustamam, A.; Ernastuti, Handhika, T.; Kerami, D.

    2017-07-01

    Calculation of the matrix-vector multiplication in the real-world problems often involves large matrix with arbitrary size. Therefore, parallelization is needed to speed up the calculation process that usually takes a long time. Graph partitioning techniques that have been discussed in the previous studies cannot be used to complete the parallelized calculation of matrix-vector multiplication with arbitrary size. This is due to the assumption of graph partitioning techniques that can only solve the square and symmetric matrix. Hypergraph partitioning techniques will overcome the shortcomings of the graph partitioning technique. This paper addresses the efficient parallelization of matrix-vector multiplication through hypergraph partitioning techniques using CUDA GPU-based parallel computing. CUDA (compute unified device architecture) is a parallel computing platform and programming model that was created by NVIDIA and implemented by the GPU (graphics processing unit).

  17. Robust Image Regression Based on the Extended Matrix Variate Power Exponential Distribution of Dependent Noise.

    PubMed

    Luo, Lei; Yang, Jian; Qian, Jianjun; Tai, Ying; Lu, Gui-Fu

    2017-09-01

    Dealing with partial occlusion or illumination is one of the most challenging problems in image representation and classification. In this problem, the characterization of the representation error plays a crucial role. In most current approaches, the error matrix needs to be stretched into a vector and each element is assumed to be independently corrupted. This ignores the dependence between the elements of error. In this paper, it is assumed that the error image caused by partial occlusion or illumination changes is a random matrix variate and follows the extended matrix variate power exponential distribution. This has the heavy tailed regions and can be used to describe a matrix pattern of l×m dimensional observations that are not independent. This paper reveals the essence of the proposed distribution: it actually alleviates the correlations between pixels in an error matrix E and makes E approximately Gaussian. On the basis of this distribution, we derive a Schatten p -norm-based matrix regression model with L q regularization. Alternating direction method of multipliers is applied to solve this model. To get a closed-form solution in each step of the algorithm, two singular value function thresholding operators are introduced. In addition, the extended Schatten p -norm is utilized to characterize the distance between the test samples and classes in the design of the classifier. Extensive experimental results for image reconstruction and classification with structural noise demonstrate that the proposed algorithm works much more robustly than some existing regression-based methods.

  18. Theory and implementation of H-matrix based iterative and direct solvers for Helmholtz and elastodynamic oscillatory kernels

    NASA Astrophysics Data System (ADS)

    Chaillat, Stéphanie; Desiderio, Luca; Ciarlet, Patrick

    2017-12-01

    In this work, we study the accuracy and efficiency of hierarchical matrix (H-matrix) based fast methods for solving dense linear systems arising from the discretization of the 3D elastodynamic Green's tensors. It is well known in the literature that standard H-matrix based methods, although very efficient tools for asymptotically smooth kernels, are not optimal for oscillatory kernels. H2-matrix and directional approaches have been proposed to overcome this problem. However the implementation of such methods is much more involved than the standard H-matrix representation. The central questions we address are twofold. (i) What is the frequency-range in which the H-matrix format is an efficient representation for 3D elastodynamic problems? (ii) What can be expected of such an approach to model problems in mechanical engineering? We show that even though the method is not optimal (in the sense that more involved representations can lead to faster algorithms) an efficient solver can be easily developed. The capabilities of the method are illustrated on numerical examples using the Boundary Element Method.

  19. A composites-based hyperelastic constitutive model for soft tissue with application to the human annulus fibrosus

    NASA Astrophysics Data System (ADS)

    Guo, Z. Y.; Peng, X. Q.; Moran, B.

    2006-09-01

    This paper presents a composites-based hyperelastic constitutive model for soft tissue. Well organized soft tissue is treated as a composite in which the matrix material is embedded with a single family of aligned fibers. The fiber is modeled as a generalized neo-Hookean material in which the stiffness depends on fiber stretch. The deformation gradient is decomposed multiplicatively into two parts: a uniaxial deformation along the fiber direction and a subsequent shear deformation. This permits the fiber-matrix interaction caused by inhomogeneous deformation to be estimated by using effective properties from conventional composites theory based on small strain linear elasticity and suitably generalized to the present large deformation case. A transversely isotropic hyperelastic model is proposed to describe the mechanical behavior of fiber-reinforced soft tissue. This model is then applied to the human annulus fibrosus. Because of the layered anatomical structure of the annulus fibrosus, an orthotropic hyperelastic model of the annulus fibrosus is developed. Simulations show that the model reproduces the stress-strain response of the human annulus fibrosus accurately. We also show that the expression for the fiber-matrix shear interaction energy used in a previous phenomenological model is compatible with that derived in the present paper.

  20. A Two-Time Scale Decentralized Model Predictive Controller Based on Input and Output Model

    PubMed Central

    Niu, Jian; Zhao, Jun; Xu, Zuhua; Qian, Jixin

    2009-01-01

    A decentralized model predictive controller applicable for some systems which exhibit different dynamic characteristics in different channels was presented in this paper. These systems can be regarded as combinations of a fast model and a slow model, the response speeds of which are in two-time scale. Because most practical models used for control are obtained in the form of transfer function matrix by plant tests, a singular perturbation method was firstly used to separate the original transfer function matrix into two models in two-time scale. Then a decentralized model predictive controller was designed based on the two models derived from the original system. And the stability of the control method was proved. Simulations showed that the method was effective. PMID:19834542

  1. Research on Radar Importance with Decision Matrix

    NASA Astrophysics Data System (ADS)

    Meng, Lingjie; Du, Yu; Wang, Liuheng

    2017-12-01

    Considering the characteristic of radar, constructed the evaluation index system of radar importance, established the comprehensive evaluation model based on decision matrix. Finally, by means of an example, the methods of this evaluation on radar importance was right and feasibility.

  2. Category-theoretic models of algebraic computer systems

    NASA Astrophysics Data System (ADS)

    Kovalyov, S. P.

    2016-01-01

    A computer system is said to be algebraic if it contains nodes that implement unconventional computation paradigms based on universal algebra. A category-based approach to modeling such systems that provides a theoretical basis for mapping tasks to these systems' architecture is proposed. The construction of algebraic models of general-purpose computations involving conditional statements and overflow control is formally described by a reflector in an appropriate category of algebras. It is proved that this reflector takes the modulo ring whose operations are implemented in the conventional arithmetic processors to the Łukasiewicz logic matrix. Enrichments of the set of ring operations that form bases in the Łukasiewicz logic matrix are found.

  3. Hybrid-dimensional modelling of two-phase flow through fractured porous media with enhanced matrix fracture transmission conditions

    NASA Astrophysics Data System (ADS)

    Brenner, Konstantin; Hennicker, Julian; Masson, Roland; Samier, Pierre

    2018-03-01

    In this work, we extend, to two-phase flow, the single-phase Darcy flow model proposed in [26], [12] in which the (d - 1)-dimensional flow in the fractures is coupled with the d-dimensional flow in the matrix. Three types of so called hybrid-dimensional two-phase Darcy flow models are proposed. They all account for fractures acting either as drains or as barriers, since they allow pressure jumps at the matrix-fracture interfaces. The models also permit to treat gravity dominated flow as well as discontinuous capillary pressure at the material interfaces. The three models differ by their transmission conditions at matrix fracture interfaces: while the first model accounts for the nonlinear two-phase Darcy flux conservations, the second and third ones are based on the linear single phase Darcy flux conservations combined with different approximations of the mobilities. We adapt the Vertex Approximate Gradient (VAG) scheme to this problem, in order to account for anisotropy and heterogeneity aspects as well as for applicability on general meshes. Several test cases are presented to compare our hybrid-dimensional models to the generic equi-dimensional model, in which fractures have the same dimension as the matrix, leading to deep insight about the quality of the proposed reduced models.

  4. Development of a validation model for the defense meteorological satellite program's special sensor microwave imager

    NASA Technical Reports Server (NTRS)

    Swift, C. T.; Goodberlet, M. A.; Wilkerson, J. C.

    1990-01-01

    The Defence Meteorological Space Program's (DMSP) Special Sensor Microwave/Imager (SSM/I), an operational wind speed algorithm was developed. The algorithm is based on the D-matrix approach which seeks a linear relationship between measured SSM/I brightness temperatures and environmental parameters. D-matrix performance was validated by comparing algorithm derived wind speeds with near-simultaneous and co-located measurements made by off-shore ocean buoys. Other topics include error budget modeling, alternate wind speed algorithms, and D-matrix performance with one or more inoperative SSM/I channels.

  5. Modeling creep behavior of fiber composites

    NASA Technical Reports Server (NTRS)

    Chen, J. L.; Sun, C. T.

    1988-01-01

    A micromechanical model for the creep behavior of fiber composites is developed based on a typical cell consisting of a fiber and the surrounding matrix. The fiber is assumed to be linearly elastic and the matrix nonlinearly viscous. The creep strain rate in the matrix is assumed to be a function of stress. The nominal stress-strain relations are derived in the form of differential equations which are solved numerically for off-axis specimens under uniaxial loading. A potential function and the associated effective stress and effective creep strain rates are introduced to simplify the orthotropic relations.

  6. Risk Management using Dependency Stucture Matrix

    NASA Astrophysics Data System (ADS)

    Petković, Ivan

    2011-09-01

    An efficient method based on dependency structure matrix (DSM) analysis is given for ranking risks in a complex system or process whose entities are mutually dependent. This rank is determined according to the element's values of the unique positive eigenvector which corresponds to the matrix spectral radius modeling the considered engineering system. For demonstration, the risk problem of NASA's robotic spacecraft is analyzed.

  7. Factorial Design Based Multivariate Modeling and Optimization of Tunable Bioresponsive Arginine Grafted Poly(cystaminebis(acrylamide)-diaminohexane) Polymeric Matrix Based Nanocarriers.

    PubMed

    Yang, Rongbing; Nam, Kihoon; Kim, Sung Wan; Turkson, James; Zou, Ye; Zuo, Yi Y; Haware, Rahul V; Chougule, Mahavir B

    2017-01-03

    Desired characteristics of nanocarriers are crucial to explore its therapeutic potential. This investigation aimed to develop tunable bioresponsive newly synthesized unique arginine grafted poly(cystaminebis(acrylamide)-diaminohexane) [ABP] polymeric matrix based nanocarriers by using L9 Taguchi factorial design, desirability function, and multivariate method. The selected formulation and process parameters were ABP concentration, acetone concentration, the volume ratio of acetone to ABP solution, and drug concentration. The measured nanocarrier characteristics were particle size, polydispersity index, zeta potential, and percentage drug loading. Experimental validation of nanocarrier characteristics computed from initially developed predictive model showed nonsignificant differences (p > 0.05). The multivariate modeling based optimized cationic nanocarrier formulation of <100 nm loaded with hydrophilic acetaminophen was readapted for a hydrophobic etoposide loading without significant changes (p > 0.05) except for improved loading percentage. This is the first study focusing on ABP polymeric matrix based nanocarrier development. Nanocarrier particle size was stable in PBS 7.4 for 48 h. The increase of zeta potential at lower pH 6.4, compared to the physiological pH, showed possible endosomal escape capability. The glutathione triggered release at the physiological conditions indicated the competence of cytosolic targeting delivery of the loaded drug from bioresponsive nanocarriers. In conclusion, this unique systematic approach provides rational evaluation and prediction of a tunable bioresponsive ABP based matrix nanocarrier, which was built on selected limited number of smart experimentation.

  8. Tension-Tension Fatigue Behavior of Unidirectional C/Sic Ceramic-Matrix Composite at Room Temperature and 800 °C in Air Atmosphere

    PubMed Central

    Li, Longbiao

    2015-01-01

    The tension-tension fatigue behavior of unidirectional C/SiC ceramic-matrix composite at room temperature and 800 °C under air has been investigated. The fatigue hysteresis modulus and fatigue hysteresis loss energy corresponding to different number of applied cycles have been analyzed. The fatigue hysteresis loops models for different interface slip cases have been derived based on the fatigue damage mechanism of fiber slipping relative to matrix in the interface debonded region upon unloading and subsequent reloading. The fiber/matrix interface shear stress has been estimated for different numbers of applied cycles. By combining the interface shear stress degradation model and fibers strength degradation model with fibers failure model, the tension-tension fatigue life S-N curves of unidirectional C/SiC composite at room temperature and 800 °C under air have been predicted.

  9. 3D tensor-based blind multispectral image decomposition for tumor demarcation

    NASA Astrophysics Data System (ADS)

    Kopriva, Ivica; Peršin, Antun

    2010-03-01

    Blind decomposition of multi-spectral fluorescent image for tumor demarcation is formulated exploiting tensorial structure of the image. First contribution of the paper is identification of the matrix of spectral responses and 3D tensor of spatial distributions of the materials present in the image from Tucker3 or PARAFAC models of 3D image tensor. Second contribution of the paper is clustering based estimation of the number of the materials present in the image as well as matrix of their spectral profiles. 3D tensor of the spatial distributions of the materials is recovered through 3-mode multiplication of the multi-spectral image tensor and inverse of the matrix of spectral profiles. Tensor representation of the multi-spectral image preserves its local spatial structure that is lost, due to vectorization process, when matrix factorization-based decomposition methods (such as non-negative matrix factorization and independent component analysis) are used. Superior performance of the tensor-based image decomposition over matrix factorization-based decompositions is demonstrated on experimental red-green-blue (RGB) image with known ground truth as well as on RGB fluorescent images of the skin tumor (basal cell carcinoma).

  10. Research on the recycling industry development model for typical exterior plastic components of end-of-life passenger vehicle based on the SWOT method.

    PubMed

    Zhang, Hongshen; Chen, Ming

    2013-11-01

    In-depth studies on the recycling of typical automotive exterior plastic parts are significant and beneficial for environmental protection, energy conservation, and sustainable development of China. In the current study, several methods were used to analyze the recycling industry model for typical exterior parts of passenger vehicles in China. The strengths, weaknesses, opportunities, and challenges of the current recycling industry for typical exterior parts of passenger vehicles were analyzed comprehensively based on the SWOT method. The internal factor evaluation matrix and external factor evaluation matrix were used to evaluate the internal and external factors of the recycling industry. The recycling industry was found to respond well to all the factors and it was found to face good developing opportunities. Then, the cross-link strategies analysis for the typical exterior parts of the passenger car industry of China was conducted based on the SWOT analysis strategies and established SWOT matrix. Finally, based on the aforementioned research, the recycling industry model led by automobile manufacturers was promoted. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Distorted Born iterative T-matrix method for inversion of CSEM data in anisotropic media

    NASA Astrophysics Data System (ADS)

    Jakobsen, Morten; Tveit, Svenn

    2018-05-01

    We present a direct iterative solutions to the nonlinear controlled-source electromagnetic (CSEM) inversion problem in the frequency domain, which is based on a volume integral equation formulation of the forward modelling problem in anisotropic conductive media. Our vectorial nonlinear inverse scattering approach effectively replaces an ill-posed nonlinear inverse problem with a series of linear ill-posed inverse problems, for which there already exist efficient (regularized) solution methods. The solution update the dyadic Green's function's from the source to the scattering-volume and from the scattering-volume to the receivers, after each iteration. The T-matrix approach of multiple scattering theory is used for efficient updating of all dyadic Green's functions after each linearized inversion step. This means that we have developed a T-matrix variant of the Distorted Born Iterative (DBI) method, which is often used in the acoustic and electromagnetic (medical) imaging communities as an alternative to contrast-source inversion. The main advantage of using the T-matrix approach in this context, is that it eliminates the need to perform a full forward simulation at each iteration of the DBI method, which is known to be consistent with the Gauss-Newton method. The T-matrix allows for a natural domain decomposition, since in the sense that a large model can be decomposed into an arbitrary number of domains that can be treated independently and in parallel. The T-matrix we use for efficient model updating is also independent of the source-receiver configuration, which could be an advantage when performing fast-repeat modelling and time-lapse inversion. The T-matrix is also compatible with the use of modern renormalization methods that can potentially help us to reduce the sensitivity of the CSEM inversion results on the starting model. To illustrate the performance and potential of our T-matrix variant of the DBI method for CSEM inversion, we performed a numerical experiments based on synthetic CSEM data associated with 2D VTI and 3D orthorombic model inversions. The results of our numerical experiment suggest that the DBIT method for inversion of CSEM data in anisotropic media is both accurate and efficient.

  12. Physically Based Failure Criteria for Transverse Matrix Cracking

    NASA Technical Reports Server (NTRS)

    Davila, Carlos G.; Camanho, Pedro P.

    2003-01-01

    A criterion for matrix failure of laminated composite plies in transverse tension and in-plane shear is developed by examining the mechanics of transverse matrix crack growth. Matrix cracks are assumed to initiate from manufacturing defects and can propagate within planes parallel to the fiber direction and normal to the ply mid-plane. Fracture mechanics models of cracks in unidirectional laminates, embedded plies and outer plies are developed to determine the onset and direction of propagation for unstable crack growth. The models for each ply configuration relate ply thickness and ply toughness to the corresponding in-situ ply strength. Calculated results for several materials are shown to correlate well with experimental results.

  13. Acoustic 3D modeling by the method of integral equations

    NASA Astrophysics Data System (ADS)

    Malovichko, M.; Khokhlov, N.; Yavich, N.; Zhdanov, M.

    2018-02-01

    This paper presents a parallel algorithm for frequency-domain acoustic modeling by the method of integral equations (IE). The algorithm is applied to seismic simulation. The IE method reduces the size of the problem but leads to a dense system matrix. A tolerable memory consumption and numerical complexity were achieved by applying an iterative solver, accompanied by an effective matrix-vector multiplication operation, based on the fast Fourier transform (FFT). We demonstrate that, the IE system matrix is better conditioned than that of the finite-difference (FD) method, and discuss its relation to a specially preconditioned FD matrix. We considered several methods of matrix-vector multiplication for the free-space and layered host models. The developed algorithm and computer code were benchmarked against the FD time-domain solution. It was demonstrated that, the method could accurately calculate the seismic field for the models with sharp material boundaries and a point source and receiver located close to the free surface. We used OpenMP to speed up the matrix-vector multiplication, while MPI was used to speed up the solution of the system equations, and also for parallelizing across multiple sources. The practical examples and efficiency tests are presented as well.

  14. Possible world based consistency learning model for clustering and classifying uncertain data.

    PubMed

    Liu, Han; Zhang, Xianchao; Zhang, Xiaotong

    2018-06-01

    Possible world has shown to be effective for handling various types of data uncertainty in uncertain data management. However, few uncertain data clustering and classification algorithms are proposed based on possible world. Moreover, existing possible world based algorithms suffer from the following issues: (1) they deal with each possible world independently and ignore the consistency principle across different possible worlds; (2) they require the extra post-processing procedure to obtain the final result, which causes that the effectiveness highly relies on the post-processing method and the efficiency is also not very good. In this paper, we propose a novel possible world based consistency learning model for uncertain data, which can be extended both for clustering and classifying uncertain data. This model utilizes the consistency principle to learn a consensus affinity matrix for uncertain data, which can make full use of the information across different possible worlds and then improve the clustering and classification performance. Meanwhile, this model imposes a new rank constraint on the Laplacian matrix of the consensus affinity matrix, thereby ensuring that the number of connected components in the consensus affinity matrix is exactly equal to the number of classes. This also means that the clustering and classification results can be directly obtained without any post-processing procedure. Furthermore, for the clustering and classification tasks, we respectively derive the efficient optimization methods to solve the proposed model. Experimental results on real benchmark datasets and real world uncertain datasets show that the proposed model outperforms the state-of-the-art uncertain data clustering and classification algorithms in effectiveness and performs competitively in efficiency. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. A Comparison of Surface Acoustic Wave Modeling Methods

    NASA Technical Reports Server (NTRS)

    Wilson, W. c.; Atkinson, G. M.

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method a first order model, and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices.

  16. Matrix completion by deep matrix factorization.

    PubMed

    Fan, Jicong; Cheng, Jieyu

    2018-02-01

    Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Inelastic response of metal matrix composites under biaxial loading

    NASA Technical Reports Server (NTRS)

    Lissenden, C. J.; Mirzadeh, F.; Pindera, M.-J.; Herakovich, C. T.

    1991-01-01

    Theoretical predictions and experimental results were obtained for inelastic response of unidirectional and angle ply composite tubes subjected to axial and torsional loading. The composite material consist of silicon carbide fibers in a titanium alloy matrix. This material is known to be susceptible to fiber matrix interfacial damage. A method to distinguish between matrix yielding and fiber matrix interfacial damage is suggested. Biaxial tests were conducted on the two different layup configurations using an MTS Axial/Torsional load frame with a PC based data acquisition system. The experimentally determined elastic moduli of the SiC/Ti system are compared with those predicted by a micromechanics model. The test results indicate that fiber matrix interfacial damage occurs at relatively low load levels and is a local phenomenon. The micromechanics model used is the method of cells originally proposed by Aboudi. Finite element models using the ABACUS finite element program were used to study end effects and fixture specimen interactions. The results to date have shown good correlation between theory and experiment for response prior to damage initiation.

  18. How to deal with the high condition number of the noise covariance matrix of gravity field functionals synthesised from a satellite-only global gravity field model?

    NASA Astrophysics Data System (ADS)

    Klees, R.; Slobbe, D. C.; Farahani, H. H.

    2018-03-01

    The posed question arises for instance in regional gravity field modelling using weighted least-squares techniques if the gravity field functionals are synthesised from the spherical harmonic coefficients of a satellite-only global gravity model (GGM), and are used as one of the noisy datasets. The associated noise covariance matrix, appeared to be extremely ill-conditioned with a singular value spectrum that decayed gradually to zero without any noticeable gap. We analysed three methods to deal with the ill-conditioned noise covariance matrix: Tihonov regularisation of the noise covariance matrix in combination with the standard formula for the weighted least-squares estimator, a formula of the weighted least-squares estimator, which does not involve the inverse noise covariance matrix, and an estimator based on Rao's unified theory of least-squares. Our analysis was based on a numerical experiment involving a set of height anomalies synthesised from the GGM GOCO05s, which is provided with a full noise covariance matrix. We showed that the three estimators perform similar, provided that the two regularisation parameters each method knows were chosen properly. As standard regularisation parameter choice rules do not apply here, we suggested a new parameter choice rule, and demonstrated its performance. Using this rule, we found that the differences between the three least-squares estimates were within noise. For the standard formulation of the weighted least-squares estimator with regularised noise covariance matrix, this required an exceptionally strong regularisation, much larger than one expected from the condition number of the noise covariance matrix. The preferred method is the inversion-free formulation of the weighted least-squares estimator, because of its simplicity with respect to the choice of the two regularisation parameters.

  19. Finite Element Model for Failure Study of Two-Dimensional Triaxially Braided Composite

    NASA Technical Reports Server (NTRS)

    Li, Xuetao; Binienda, Wieslaw K.; Goldberg, Robert K.

    2010-01-01

    A new three-dimensional finite element model of two-dimensional triaxially braided composites is presented in this paper. This meso-scale modeling technique is used to examine and predict the deformation and damage observed in tests of straight sided specimens. A unit cell based approach is used to take into account the braiding architecture as well as the mechanical properties of the fiber tows, the matrix and the fiber tow-matrix interface. A 0 deg / plus or minus 60 deg. braiding configuration has been investigated by conducting static finite element analyses. Failure initiation and progressive degradation has been simulated in the fiber tows by use of the Hashin failure criteria and a damage evolution law. The fiber tow-matrix interface was modeled by using a cohesive zone approach to capture any fiber-matrix debonding. By comparing the analytical results to those obtained experimentally, the applicability of the developed model was assessed and the failure process was investigated.

  20. SparRec: An effective matrix completion framework of missing data imputation for GWAS

    NASA Astrophysics Data System (ADS)

    Jiang, Bo; Ma, Shiqian; Causey, Jason; Qiao, Linbo; Hardin, Matthew Price; Bitts, Ian; Johnson, Daniel; Zhang, Shuzhong; Huang, Xiuzhen

    2016-10-01

    Genome-wide association studies present computational challenges for missing data imputation, while the advances of genotype technologies are generating datasets of large sample sizes with sample sets genotyped on multiple SNP chips. We present a new framework SparRec (Sparse Recovery) for imputation, with the following properties: (1) The optimization models of SparRec, based on low-rank and low number of co-clusters of matrices, are different from current statistics methods. While our low-rank matrix completion (LRMC) model is similar to Mendel-Impute, our matrix co-clustering factorization (MCCF) model is completely new. (2) SparRec, as other matrix completion methods, is flexible to be applied to missing data imputation for large meta-analysis with different cohorts genotyped on different sets of SNPs, even when there is no reference panel. This kind of meta-analysis is very challenging for current statistics based methods. (3) SparRec has consistent performance and achieves high recovery accuracy even when the missing data rate is as high as 90%. Compared with Mendel-Impute, our low-rank based method achieves similar accuracy and efficiency, while the co-clustering based method has advantages in running time. The testing results show that SparRec has significant advantages and competitive performance over other state-of-the-art existing statistics methods including Beagle and fastPhase.

  1. Colorimetric characterization models based on colorimetric characteristics evaluation for active matrix organic light emitting diode panels.

    PubMed

    Gong, Rui; Xu, Haisong; Tong, Qingfen

    2012-10-20

    The colorimetric characterization of active matrix organic light emitting diode (AMOLED) panels suffers from their poor channel independence. Based on the colorimetric characteristics evaluation of channel independence and chromaticity constancy, an accurate colorimetric characterization method, namely, the polynomial compensation model (PC model) considering channel interactions was proposed for AMOLED panels. In this model, polynomial expressions are employed to calculate the relationship between the prediction errors of XYZ tristimulus values and the digital inputs to compensate the XYZ prediction errors of the conventional piecewise linear interpolation assuming the variable chromaticity coordinates (PLVC) model. The experimental results indicated that the proposed PC model outperformed other typical characterization models for the two tested AMOLED smart-phone displays and for the professional liquid crystal display monitor as well.

  2. Detection and identification of concealed weapons using matrix pencil

    NASA Astrophysics Data System (ADS)

    Adve, Raviraj S.; Thayaparan, Thayananthan

    2011-06-01

    The detection and identification of concealed weapons is an extremely hard problem due to the weak signature of the target buried within the much stronger signal from the human body. This paper furthers the automatic detection and identification of concealed weapons by proposing the use of an effective approach to obtain the resonant frequencies in a measurement. The technique, based on Matrix Pencil, a scheme for model based parameter estimation also provides amplitude information, hence providing a level of confidence in the results. Of specific interest is the fact that Matrix Pencil is based on a singular value decomposition, making the scheme robust against noise.

  3. Retardation of mobile radionuclides in granitic rock fractures by matrix diffusion

    NASA Astrophysics Data System (ADS)

    Hölttä, P.; Poteri, A.; Siitari-Kauppi, M.; Huittinen, N.

    Transport of iodide and sodium has been studied by means of block fracture and core column experiments to evaluate the simplified radionuclide transport concept. The objectives were to examine the processes causing retention in solute transport, especially matrix diffusion, and to estimate their importance during transport in different scales and flow conditions. Block experiments were performed using a Kuru Grey granite block having a horizontally planar natural fracture. Core columns were constructed from cores drilled orthogonal to the fracture of the granite block. Several tracer tests were performed using uranine, 131I and 22Na as tracers at water flow rates 0.7-50 μL min -1. Transport of tracers was modelled by applying the advection-dispersion model based on the generalized Taylor dispersion added with matrix diffusion. Scoping calculations were combined with experiments to test the model concepts. Two different experimental configurations could be modelled applying consistent transport processes and parameters. The processes, advection-dispersion and matrix diffusion, were conceptualized with sufficient accuracy to replicate the experimental results. The effects of matrix diffusion were demonstrated on the slightly sorbing sodium and mobile iodine breakthrough curves.

  4. Factorized three-body S-matrix restrained by the Yang–Baxter equation and quantum entanglements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Li-Wei, E-mail: NKyulw@gmail.com; Zhao, Qing, E-mail: qzhaoyuping@bit.edu.cn; Ge, Mo-Lin, E-mail: geml@nankai.edu.cn

    2014-09-15

    This paper investigates the physical effects of the Yang–Baxter equation (YBE) to quantum entanglements through the 3-body S-matrix in entangling parameter space. The explicit form of 3-body S-matrix Ř{sub 123}(θ,φ) based on the 2-body S-matrices is given due to the factorization condition of YBE. The corresponding chain Hamiltonian has been obtained and diagonalized, also the Berry phase for 3-body system is given. It turns out that by choosing different spectral parameters the Ř(θ,φ)-matrix gives GHZ and W states respectively. The extended 1-D Kitaev toy model has been derived. Examples of the role of the model in entanglement transfer are discussed.more » - Highlights: • We give the relation between 3-body S-matrix and 3-qubit entanglement. • The relation between 3-qubit and 2-qubit entanglements is investigated via YBE. • 1D Kitaev toy model is derived by the Type-II solution of YBE. • The condition of YBE kills the “Zero boundary mode” in our chain model.« less

  5. Beam-tracing model for predicting sound fields in rooms with multilayer bounding surfaces

    NASA Astrophysics Data System (ADS)

    Wareing, Andrew; Hodgson, Murray

    2005-10-01

    This paper presents the development of a wave-based room-prediction model for predicting steady-state sound fields in empty rooms with specularly reflecting, multilayer surfaces. A triangular beam-tracing model with phase, and a transfer-matrix approach to model the surfaces, were involved. Room surfaces were modeled as multilayers of fluid, solid, or porous materials. Biot theory was used in the transfer-matrix formulation of the porous layer. The new model consisted of the transfer-matrix model integrated into the beam-tracing algorithm. The transfer-matrix model was validated by comparing predictions with those by theory, and with experiment. The test surfaces were a glass plate, double drywall panels, double steel panels, a carpeted floor, and a suspended-acoustical ceiling. The beam-tracing model was validated in the cases of three idealized room configurations-a small office, a corridor, and a small industrial workroom-with simple boundary conditions. The number of beams, the reflection order, and the frequency resolution required to obtain accurate results were investigated. Beam-tracing predictions were compared with those by a method-of-images model with phase. The model will be used to study sound fields in rooms with local- or extended-reaction multilayer surfaces.

  6. Influence of matrix and filler fraction on biofilm formation on the surface of experimental resin-based composites.

    PubMed

    Ionescu, Andrei; Brambilla, Eugenio; Wastl, Daniel S; Giessibl, Franz J; Cazzaniga, Gloria; Schneider-Feyrer, Sibylle; Hahnel, Sebastian

    2015-01-01

    The aim of this study was to investigate the impact of resin matrix chemistry and filler fraction on biofilm formation on the surface of experimental resin-based composites (RBCs). Specimens were prepared from eight experimental RBC formulations differing in resin matrix blend (BisGMA/TEGDMA in a 7:3 wt% ratio or UDMA/aliphatic dimethacrylate in a 1:1 wt% ratio) and filler fraction (no fillers; 65 wt% dental glass with an average diameter of 7 or 0.7 µm or 65 wt% SiO2 with an average diameter of 20 nm). Surface roughness, surface free energy, and chemical surface composition were determined; surface topography was visualized using atomic force microscopy. Biofilm formation was simulated under continuous flow conditions for a 48 h period using a monospecies Streptococcus mutans and a multispecies biofilm model. In the monospecies biofilm model, the impact of the filler fraction overruled the influence of the resin matrix, indicating lowest biofilm formation on RBCs with nano-scaled filler particles and those manufactured from the neat resin blends. The multispecies model suggested a more pronounced effect of the resin matrix blend, as significantly higher biofilm formation was identified on RBCs with a UDMA/dimethacrylate matrix blend than on those including a BisGMA/TEGDMA matrix blend but analogous filler fractions. Although significant differences in surface properties between the various materials were identified, correlations between the surface properties and biofilm formation were poor, which highlights the relevance of surface topography and chemistry. These results may help to tailor novel RBC formulations which feature reduced biofilm formation on their surface.

  7. A sparse matrix-vector multiplication based algorithm for accurate density matrix computations on systems of millions of atoms

    NASA Astrophysics Data System (ADS)

    Ghale, Purnima; Johnson, Harley T.

    2018-06-01

    We present an efficient sparse matrix-vector (SpMV) based method to compute the density matrix P from a given Hamiltonian in electronic structure computations. Our method is a hybrid approach based on Chebyshev-Jackson approximation theory and matrix purification methods like the second order spectral projection purification (SP2). Recent methods to compute the density matrix scale as O(N) in the number of floating point operations but are accompanied by large memory and communication overhead, and they are based on iterative use of the sparse matrix-matrix multiplication kernel (SpGEMM), which is known to be computationally irregular. In addition to irregularity in the sparse Hamiltonian H, the nonzero structure of intermediate estimates of P depends on products of H and evolves over the course of computation. On the other hand, an expansion of the density matrix P in terms of Chebyshev polynomials is straightforward and SpMV based; however, the resulting density matrix may not satisfy the required constraints exactly. In this paper, we analyze the strengths and weaknesses of the Chebyshev-Jackson polynomials and the second order spectral projection purification (SP2) method, and propose to combine them so that the accurate density matrix can be computed using the SpMV computational kernel only, and without having to store the density matrix P. Our method accomplishes these objectives by using the Chebyshev polynomial estimate as the initial guess for SP2, which is followed by using sparse matrix-vector multiplications (SpMVs) to replicate the behavior of the SP2 algorithm for purification. We demonstrate the method on a tight-binding model system of an oxide material containing more than 3 million atoms. In addition, we also present the predicted behavior of our method when applied to near-metallic Hamiltonians with a wide energy spectrum.

  8. Modified multiblock partial least squares path modeling algorithm with backpropagation neural networks approach

    NASA Astrophysics Data System (ADS)

    Yuniarto, Budi; Kurniawan, Robert

    2017-03-01

    PLS Path Modeling (PLS-PM) is different from covariance based SEM, where PLS-PM use an approach based on variance or component, therefore, PLS-PM is also known as a component based SEM. Multiblock Partial Least Squares (MBPLS) is a method in PLS regression which can be used in PLS Path Modeling which known as Multiblock PLS Path Modeling (MBPLS-PM). This method uses an iterative procedure in its algorithm. This research aims to modify MBPLS-PM with Back Propagation Neural Network approach. The result is MBPLS-PM algorithm can be modified using the Back Propagation Neural Network approach to replace the iterative process in backward and forward step to get the matrix t and the matrix u in the algorithm. By modifying the MBPLS-PM algorithm using Back Propagation Neural Network approach, the model parameters obtained are relatively not significantly different compared to model parameters obtained by original MBPLS-PM algorithm.

  9. An efficient matrix product operator representation of the quantum chemical Hamiltonian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keller, Sebastian, E-mail: sebastian.keller@phys.chem.ethz.ch; Reiher, Markus, E-mail: markus.reiher@phys.chem.ethz.ch; Dolfi, Michele, E-mail: dolfim@phys.ethz.ch

    We describe how to efficiently construct the quantum chemical Hamiltonian operator in matrix product form. We present its implementation as a density matrix renormalization group (DMRG) algorithm for quantum chemical applications. Existing implementations of DMRG for quantum chemistry are based on the traditional formulation of the method, which was developed from the point of view of Hilbert space decimation and attained higher performance compared to straightforward implementations of matrix product based DMRG. The latter variationally optimizes a class of ansatz states known as matrix product states, where operators are correspondingly represented as matrix product operators (MPOs). The MPO construction schememore » presented here eliminates the previous performance disadvantages while retaining the additional flexibility provided by a matrix product approach, for example, the specification of expectation values becomes an input parameter. In this way, MPOs for different symmetries — abelian and non-abelian — and different relativistic and non-relativistic models may be solved by an otherwise unmodified program.« less

  10. Model Predictive Control of A Matrix-Converter Based Solid State Transformer for Utility Grid Interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xue, Yaosuo

    The matrix converter solid state transformer (MC-SST), formed from the back-to-back connection of two three-to-single-phase matrix converters, is studied for use in the interconnection of two ac grids. The matrix converter topology provides a light weight and low volume single-stage bidirectional ac-ac power conversion without the need for a dc link. Thus, the lifetime limitations of dc-bus storage capacitors are avoided. However, space vector modulation of this type of MC-SST requires to compute vectors for each of the two MCs, which must be carefully coordinated to avoid commutation failure. An additional controller is also required to control power exchange betweenmore » the two ac grids. In this paper, model predictive control (MPC) is proposed for an MC-SST connecting two different ac power grids. The proposed MPC predicts the circuit variables based on the discrete model of MC-SST system and the cost function is formulated so that the optimal switch vector for the next sample period is selected, thereby generating the required grid currents for the SST. Simulation and experimental studies are carried out to demonstrate the effectiveness and simplicity of the proposed MPC for such MC-SST-based grid interfacing systems.« less

  11. Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling

    NASA Technical Reports Server (NTRS)

    Wilson, William; Atkinson, Gary

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

  12. Cluster structure in the correlation coefficient matrix can be characterized by abnormal eigenvalues

    NASA Astrophysics Data System (ADS)

    Nie, Chun-Xiao

    2018-02-01

    In a large number of previous studies, the researchers found that some of the eigenvalues of the financial correlation matrix were greater than the predicted values of the random matrix theory (RMT). Here, we call these eigenvalues as abnormal eigenvalues. In order to reveal the hidden meaning of these abnormal eigenvalues, we study the toy model with cluster structure and find that these eigenvalues are related to the cluster structure of the correlation coefficient matrix. In this paper, model-based experiments show that in most cases, the number of abnormal eigenvalues of the correlation matrix is equal to the number of clusters. In addition, empirical studies show that the sum of the abnormal eigenvalues is related to the clarity of the cluster structure and is negatively correlated with the correlation dimension.

  13. An Efficient Local Correlation Matrix Decomposition Approach for the Localization Implementation of Ensemble-Based Assimilation Methods

    NASA Astrophysics Data System (ADS)

    Zhang, Hongqin; Tian, Xiangjun

    2018-04-01

    Ensemble-based data assimilation methods often use the so-called localization scheme to improve the representation of the ensemble background error covariance (Be). Extensive research has been undertaken to reduce the computational cost of these methods by using the localized ensemble samples to localize Be by means of a direct decomposition of the local correlation matrix C. However, the computational costs of the direct decomposition of the local correlation matrix C are still extremely high due to its high dimension. In this paper, we propose an efficient local correlation matrix decomposition approach based on the concept of alternating directions. This approach is intended to avoid direct decomposition of the correlation matrix. Instead, we first decompose the correlation matrix into 1-D correlation matrices in the three coordinate directions, then construct their empirical orthogonal function decomposition at low resolution. This procedure is followed by the 1-D spline interpolation process to transform the above decompositions to the high-resolution grid. Finally, an efficient correlation matrix decomposition is achieved by computing the very similar Kronecker product. We conducted a series of comparison experiments to illustrate the validity and accuracy of the proposed local correlation matrix decomposition approach. The effectiveness of the proposed correlation matrix decomposition approach and its efficient localization implementation of the nonlinear least-squares four-dimensional variational assimilation are further demonstrated by several groups of numerical experiments based on the Advanced Research Weather Research and Forecasting model.

  14. Modulation of drug release kinetics of shellac-based matrix tablets by in-situ polymerization through annealing process.

    PubMed

    Limmatvapirat, Sontaya; Limmatvapirat, Chutima; Puttipipatkhachorn, Satit; Nunthanid, Jurairat; Luangtana-anan, Manee; Sriamornsak, Pornsak

    2008-08-01

    A new oral-controlled release matrix tablet based on shellac polymer was designed and developed, using metronidazole (MZ) as a model drug. The shellac-based matrix tablets were prepared by wet granulation using different amounts of shellac and lactose. The effect of annealing temperature and pH of medium on drug release from matrix tablets was investigated. The increased amount of shellac and increased annealing temperature significantly affected the physical properties (i.e., tablet hardness and tablet disintegration) and MZ release from the matrix tablets. The in-situ polymerization played a major role on the changes in shellac properties during annealing process. Though the shellac did not dissolve in acid medium, the MZ release in 0.1N HCl was faster than in pH 7.3 buffer, resulting from a higher solubility of MZ in acid medium. The modulation of MZ release kinetics from shellac-based matrix tablets could be accomplished by varying the amount of shellac or annealing temperature. The release kinetics was shifted from relaxation-controlled release to diffusion-controlled release when the amount of shellac or the annealing temperature was increased.

  15. A new model for simulating spring discharge recession and estimating effective porosity of karst aquifers

    NASA Astrophysics Data System (ADS)

    Xu, Bin; Ye, Ming; Dong, Shuning; Dai, Zhenxue; Pei, Yongzhen

    2018-07-01

    Quantitative analysis of recession curves of karst spring hydrographs is a vital tool for understanding karst hydrology and inferring hydraulic properties of karst aquifers. This paper presents a new model for simulating karst spring recession curves. The new model has the following characteristics: (1) the model considers two separate but hydraulically connected reservoirs: matrix reservoir and conduit reservoir; (2) the model separates karst spring hydrograph recession into three stages: conduit-drainage stage, mixed-drainage stage (with both conduit drainage and matrix drainage), and matrix-drainage stage; and (3) in the mixed-drainage stage, the model uses multiple conduit layers to present different levels of conduit development. The new model outperforms the classical Mangin model and the recently developed Fiorillo model for simulating observed discharge at the Madison Blue Spring located in northern Florida. This is attributed to the latter two characteristics of the new model. Based on the new model, a method is developed for estimating effective porosity of the matrix and conduit reservoirs for the three drainage stages. The estimated porosity values are consistent with measured matrix porosity at the study site and with estimated conduit porosity reported in literature. The new model for simulating karst spring hydrograph recession is mathematically general, and can be applied to a wide range of karst spring hydrographs to understand groundwater flow in karst aquifers. The limitations of the model are discussed at the end of this paper.

  16. Background recovery via motion-based robust principal component analysis with matrix factorization

    NASA Astrophysics Data System (ADS)

    Pan, Peng; Wang, Yongli; Zhou, Mingyuan; Sun, Zhipeng; He, Guoping

    2018-03-01

    Background recovery is a key technique in video analysis, but it still suffers from many challenges, such as camouflage, lighting changes, and diverse types of image noise. Robust principal component analysis (RPCA), which aims to recover a low-rank matrix and a sparse matrix, is a general framework for background recovery. The nuclear norm is widely used as a convex surrogate for the rank function in RPCA, which requires computing the singular value decomposition (SVD), a task that is increasingly costly as matrix sizes and ranks increase. However, matrix factorization greatly reduces the dimension of the matrix for which the SVD must be computed. Motion information has been shown to improve low-rank matrix recovery in RPCA, but this method still finds it difficult to handle original video data sets because of its batch-mode formulation and implementation. Hence, in this paper, we propose a motion-assisted RPCA model with matrix factorization (FM-RPCA) for background recovery. Moreover, an efficient linear alternating direction method of multipliers with a matrix factorization (FL-ADM) algorithm is designed for solving the proposed FM-RPCA model. Experimental results illustrate that the method provides stable results and is more efficient than the current state-of-the-art algorithms.

  17. Matrix cracking in laminated composites under monotonic and cyclic loadings

    NASA Technical Reports Server (NTRS)

    Allen, David H.; Lee, Jong-Won

    1991-01-01

    An analytical model based on the internal state variable (ISV) concept and the strain energy method is proposed for characterizing the monotonic and cyclic response of laminated composites containing matrix cracks. A modified constitution is formulated for angle-ply laminates under general in-plane mechanical loading and constant temperature change. A monotonic matrix cracking criterion is developed for predicting the crack density in cross-ply laminates as a function of the applied laminate axial stress. An initial formulation for a cyclic matrix cracking criterion for cross-ply laminates is also discussed. For the monotonic loading case, a number of experimental data and well-known models are compared with the present study for validating the practical applicability of the ISV approach.

  18. Predicting drug-target interactions by dual-network integrated logistic matrix factorization

    NASA Astrophysics Data System (ADS)

    Hao, Ming; Bryant, Stephen H.; Wang, Yanli

    2017-01-01

    In this work, we propose a dual-network integrated logistic matrix factorization (DNILMF) algorithm to predict potential drug-target interactions (DTI). The prediction procedure consists of four steps: (1) inferring new drug/target profiles and constructing profile kernel matrix; (2) diffusing drug profile kernel matrix with drug structure kernel matrix; (3) diffusing target profile kernel matrix with target sequence kernel matrix; and (4) building DNILMF model and smoothing new drug/target predictions based on their neighbors. We compare our algorithm with the state-of-the-art method based on the benchmark dataset. Results indicate that the DNILMF algorithm outperforms the previously reported approaches in terms of AUPR (area under precision-recall curve) and AUC (area under curve of receiver operating characteristic) based on the 5 trials of 10-fold cross-validation. We conclude that the performance improvement depends on not only the proposed objective function, but also the used nonlinear diffusion technique which is important but under studied in the DTI prediction field. In addition, we also compile a new DTI dataset for increasing the diversity of currently available benchmark datasets. The top prediction results for the new dataset are confirmed by experimental studies or supported by other computational research.

  19. Spatial Pattern of Cell Damage in Tissue from Heavy Ions

    NASA Technical Reports Server (NTRS)

    Ponomarev, Artem L.; Huff, Janice L.; Cucinotta, Francis A.

    2007-01-01

    A new Monte Carlo algorithm was developed that can model passage of heavy ions in a tissue, and their action on the cellular matrix for 2- or 3-dimensional cases. The build-up of secondaries such as projectile fragments, target fragments, other light fragments, and delta-rays was simulated. Cells were modeled as a cell culture monolayer in one example, where the data were taken directly from microscopy (2-d cell matrix). A simple model of tissue was given as abstract spheres with close approximation to real cell geometries (3-d cell matrix), as well as a realistic model of tissue was proposed based on microscopy images. Image segmentation was used to identify cells in an irradiated cell culture monolayer, or slices of tissue. The cells were then inserted into the model box pixel by pixel. In the case of cell monolayers (2-d), the image size may exceed the modeled box size. Such image was is moved with respect to the box in order to sample as many cells as possible. In the case of the simple tissue (3-d), the tissue box is modeled with periodic boundary conditions, which extrapolate the technique to macroscopic volumes of tissue. For real tissue, specific spatial patterns for cell apoptosis and necrosis are expected. The cell patterns were modeled based on action cross sections for apoptosis and necrosis estimated based on BNL data, and other experimental data.

  20. An Initial Non-Equilibrium Porous-Media Model for CFD Simulation of Stirling Regenerators

    NASA Technical Reports Server (NTRS)

    Tew, Roy C.; Simon, Terry; Gedeon, David; Ibrahim, Mounir; Rong, Wei

    2006-01-01

    The objective of this paper is to define empirical parameters for an initial thermal non-equilibrium porous-media model for use in Computational Fluid Dynamics (CFD) codes for simulation of Stirling regenerators. The two codes currently used at Glenn Research Center for Stirling modeling are Fluent and CFD-ACE. The codes porous-media models are equilibrium models, which assume solid matrix and fluid are in thermal equilibrium. This is believed to be a poor assumption for Stirling regenerators; Stirling 1-D regenerator models, used in Stirling design, use non-equilibrium regenerator models and suggest regenerator matrix and gas average temperatures can differ by several degrees at a given axial location and time during the cycle. Experimentally based information was used to define: hydrodynamic dispersion, permeability, inertial coefficient, fluid effective thermal conductivity, and fluid-solid heat transfer coefficient. Solid effective thermal conductivity was also estimated. Determination of model parameters was based on planned use in a CFD model of Infinia's Stirling Technology Demonstration Converter (TDC), which uses a random-fiber regenerator matrix. Emphasis is on use of available data to define empirical parameters needed in a thermal non-equilibrium porous media model for Stirling regenerator simulation. Such a model has not yet been implemented by the authors or their associates.

  1. High-Strain-Rate Constitutive Characterization and Modeling of Metal Matrix Composites

    DTIC Science & Technology

    2014-03-07

    protective coatings. Even though most MMCs studied to date are aluminum matrix composites, magnesium and its alloys have also been considered to be... plastic response of the matrix. Based on a simple analysis of the effect of misalignments of microscale kinks, Argon estimated that the compressive... deformations ; if the fibers break into small enough pieces, their stiffening effect could be reduced. We are examining both possibilities to explain

  2. Fatigue Life Prediction of Fiber-Reinforced Ceramic-Matrix Composites with Different Fiber Preforms at Room and Elevated Temperatures

    PubMed Central

    Li, Longbiao

    2016-01-01

    In this paper, the fatigue life of fiber-reinforced ceramic-matrix composites (CMCs) with different fiber preforms, i.e., unidirectional, cross-ply, 2D (two dimensional), 2.5D and 3D CMCs at room and elevated temperatures in air and oxidative environments, has been predicted using the micromechanics approach. An effective coefficient of the fiber volume fraction along the loading direction (ECFL) was introduced to describe the fiber architecture of preforms. The statistical matrix multicracking model and fracture mechanics interface debonding criterion were used to determine the matrix crack spacing and interface debonded length. Under cyclic fatigue loading, the fiber broken fraction was determined by combining the interface wear model and fiber statistical failure model at room temperature, and interface/fiber oxidation model, interface wear model and fiber statistical failure model at elevated temperatures, based on the assumption that the fiber strength is subjected to two-parameter Weibull distribution and the load carried by broken and intact fibers satisfies the Global Load Sharing (GLS) criterion. When the broken fiber fraction approaches the critical value, the composites fatigue fracture. PMID:28773332

  3. Application of Transfer Matrix Approach to Modeling and Decentralized Control of Lattice-Based Structures

    NASA Technical Reports Server (NTRS)

    Cramer, Nick; Swei, Sean Shan-Min; Cheung, Kenny; Teodorescu, Mircea

    2015-01-01

    This paper presents a modeling and control of aerostructure developed by lattice-based cellular materials/components. The proposed aerostructure concept leverages a building block strategy for lattice-based components which provide great adaptability to varying ight scenarios, the needs of which are essential for in- ight wing shaping control. A decentralized structural control design is proposed that utilizes discrete-time lumped mass transfer matrix method (DT-LM-TMM). The objective is to develop an e ective reduced order model through DT-LM-TMM that can be used to design a decentralized controller for the structural control of a wing. The proposed approach developed in this paper shows that, as far as the performance of overall structural system is concerned, the reduced order model can be as e ective as the full order model in designing an optimal stabilizing controller.

  4. Prediction of U-Mo dispersion nuclear fuels with Al-Si alloy using artificial neural network

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Susmikanti, Mike, E-mail: mike@batan.go.id; Sulistyo, Jos, E-mail: soj@batan.go.id

    2014-09-30

    Dispersion nuclear fuels, consisting of U-Mo particles dispersed in an Al-Si matrix, are being developed as fuel for research reactors. The equilibrium relationship for a mixture component can be expressed in the phase diagram. It is important to analyze whether a mixture component is in equilibrium phase or another phase. The purpose of this research it is needed to built the model of the phase diagram, so the mixture component is in the stable or melting condition. Artificial neural network (ANN) is a modeling tool for processes involving multivariable non-linear relationships. The objective of the present work is to developmore » code based on artificial neural network models of system equilibrium relationship of U-Mo in Al-Si matrix. This model can be used for prediction of type of resulting mixture, and whether the point is on the equilibrium phase or in another phase region. The equilibrium model data for prediction and modeling generated from experimentally data. The artificial neural network with resilient backpropagation method was chosen to predict the dispersion of nuclear fuels U-Mo in Al-Si matrix. This developed code was built with some function in MATLAB. For simulations using ANN, the Levenberg-Marquardt method was also used for optimization. The artificial neural network is able to predict the equilibrium phase or in the phase region. The develop code based on artificial neural network models was built, for analyze equilibrium relationship of U-Mo in Al-Si matrix.« less

  5. Modeling the modified drug release from curved shape drug delivery systems - Dome Matrix®.

    PubMed

    Caccavo, D; Barba, A A; d'Amore, M; De Piano, R; Lamberti, G; Rossi, A; Colombo, P

    2017-12-01

    The controlled drug release from hydrogel-based drug delivery systems is a topic of large interest for research in pharmacology. The mathematical modeling of the behavior of these systems is a tool of emerging relevance, since the simulations can be of use in the design of novel systems, in particular for complex shaped tablets. In this work a model, previously developed, was applied to complex-shaped oral drug delivery systems based on hydrogels (Dome Matrix®). Furthermore, the model was successfully adopted in the description of drug release from partially accessible Dome Matrix® systems (systems with some surfaces coated). In these simulations, the erosion rate was used asa fitting parameter, and its dependence upon the surface area/volume ratio and upon the local fluid dynamics was discussed. The model parameters were determined by comparison with the drug release profile from a cylindrical tablet, then the model was successfully used for the prediction of the drug release from a Dome Matrix® system, for simple module configuration and for module assembled (void and piled) configurations. It was also demonstrated that, given the same initial S/V ratio, the drug release is independent upon the shape of the tablets but it is only influenced by the S/V evolution. The model reveals itself able to describe the observed phenomena, and thus it can be of use for the design of oral drug delivery systems, even if complex shaped. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Diagnosis of the Ill-condition of the RFM Based on Condition Index and Variance Decomposition Proportion (CIVDP)

    NASA Astrophysics Data System (ADS)

    Qing, Zhou; Weili, Jiao; Tengfei, Long

    2014-03-01

    The Rational Function Model (RFM) is a new generalized sensor model. It does not need the physical parameters of sensors to achieve a high accuracy that is compatible to the rigorous sensor models. At present, the main method to solve RPCs is the Least Squares Estimation. But when coefficients has a large number or the distribution of the control points is not even, the classical least square method loses its superiority due to the ill-conditioning problem of design matrix. Condition Index and Variance Decomposition Proportion (CIVDP) is a reliable method for diagnosing the multicollinearity among the design matrix. It can not only detect the multicollinearity, but also can locate the parameters and show the corresponding columns in the design matrix. In this paper, the CIVDP method is used to diagnose the ill-condition problem of the RFM and to find the multicollinearity in the normal matrix.

  7. Method and system to estimate variables in an integrated gasification combined cycle (IGCC) plant

    DOEpatents

    Kumar, Aditya; Shi, Ruijie; Dokucu, Mustafa

    2013-09-17

    System and method to estimate variables in an integrated gasification combined cycle (IGCC) plant are provided. The system includes a sensor suite to measure respective plant input and output variables. An extended Kalman filter (EKF) receives sensed plant input variables and includes a dynamic model to generate a plurality of plant state estimates and a covariance matrix for the state estimates. A preemptive-constraining processor is configured to preemptively constrain the state estimates and covariance matrix to be free of constraint violations. A measurement-correction processor may be configured to correct constrained state estimates and a constrained covariance matrix based on processing of sensed plant output variables. The measurement-correction processor is coupled to update the dynamic model with corrected state estimates and a corrected covariance matrix. The updated dynamic model may be configured to estimate values for at least one plant variable not originally sensed by the sensor suite.

  8. Floating Node Method and Virtual Crack Closure Technique for Modeling Matrix Cracking-Delamination Interaction

    NASA Technical Reports Server (NTRS)

    DeCarvalho, N. V.; Chen, B. Y.; Pinho, S. T.; Baiz, P. M.; Ratcliffe, J. G.; Tay, T. E.

    2013-01-01

    A novel approach is proposed for high-fidelity modeling of progressive damage and failure in composite materials that combines the Floating Node Method (FNM) and the Virtual Crack Closure Technique (VCCT) to represent multiple interacting failure mechanisms in a mesh-independent fashion. In this study, the approach is applied to the modeling of delamination migration in cross-ply tape laminates. Delamination, matrix cracking, and migration are all modeled using fracture mechanics based failure and migration criteria. The methodology proposed shows very good qualitative and quantitative agreement with experiments.

  9. Floating Node Method and Virtual Crack Closure Technique for Modeling Matrix Cracking-Delamination Migration

    NASA Technical Reports Server (NTRS)

    DeCarvalho, Nelson V.; Chen, B. Y.; Pinho, Silvestre T.; Baiz, P. M.; Ratcliffe, James G.; Tay, T. E.

    2013-01-01

    A novel approach is proposed for high-fidelity modeling of progressive damage and failure in composite materials that combines the Floating Node Method (FNM) and the Virtual Crack Closure Technique (VCCT) to represent multiple interacting failure mechanisms in a mesh-independent fashion. In this study, the approach is applied to the modeling of delamination migration in cross-ply tape laminates. Delamination, matrix cracking, and migration are all modeled using fracture mechanics based failure and migration criteria. The methodology proposed shows very good qualitative and quantitative agreement with experiments.

  10. Crack Extension and Possibility of Debonding in Encapsulation-Based Self-Healing Materials.

    PubMed

    Li, Wenting; Jiang, Zhengwu; Yang, Zhenghong

    2017-05-27

    The breakage of capsules upon crack propagation is crucial for achieving crack healing in encapsulation-based self-healing materials. A mesomechanical model was developed in this study to simulate the process of crack propagation in a matrix and the potential of debonding. The model used the extended finite element method (XFEM) combined with a cohesive zone model (CZM) in a two-dimensional (2D) configuration. The configuration consisted of an infinite matrix with an embedded crack and a capsule nearby, all subjected to a uniaxial remote tensile load. A parametric study was performed to investigate the effect of geometry, elastic parameters and fracture properties on the fracture response of the system. The results indicated that the effect of the capsule wall on the fracture behavior of the matrix is insignificant for t c / R c ≤ 0.05. The matrix strength influenced the ultimate crack length, while the Young's modulus ratio E c / E m only affected the rate of crack propagation. The potential for capsule breakage or debonding was dependent on the comparative strength between capsule and interface (S c /S int ), provided the crack could reach the capsule. The critical value of S c ,cr /S int,cr was obtained using this model for materials design.

  11. Inelastic deformation of metal matrix composites

    NASA Technical Reports Server (NTRS)

    Lissenden, C. J.; Herakovich, C. T.; Pindera, M-J.

    1993-01-01

    A theoretical model capable of predicting the thermomechanical response of continuously reinforced metal matrix composite laminates subjected to multiaxial loading was developed. A micromechanical model is used in conjunction with nonlinear lamination theory to determine inelastic laminae response. Matrix viscoplasticity, residual stresses, and damage to the fiber/matrix interfacial zone are explicitly included in the model. The representative cell of the micromechanical model is considered to be in a state of generalized plane strain, enabling a quasi two-dimensional analysis to be performed. Constant strain finite elements are formulated with elastic-viscoplastic constitutive equations. Interfacial debonding is incorporated into the model through interface elements based on the interfacial debonding theory originally presented by Needleman, and modified by Tvergaard. Nonlinear interfacial constitutive equations relate interfacial tractions to displacement discontinuities at the interface. Theoretical predictions are compared with the results of an experimental program conducted on silicon carbide/titanium (SiC/Ti) unidirectional, (O4), and angle-ply, (+34)(sub s), tubular specimens. Multiaxial loading included increments of axial tension, compression, torque, and internal pressure. Loadings were chosen in an effort to distinguish inelastic deformation due to damage from matrix plasticity and separate time-dependent effects from time-independent effects. Results show that fiber/matrix debonding is nonuniform throughout the composite and is a major factor in the effective response. Also, significant creep behavior occurs at relatively low applied stress levels at room temperature.

  12. Ceramic matrix composite behavior -- Computational simulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamis, C.C.; Murthy, P.L.N.; Mital, S.K.

    Development of analytical modeling and computational capabilities for the prediction of high temperature ceramic matrix composite behavior has been an ongoing research activity at NASA-Lewis Research Center. These research activities have resulted in the development of micromechanics based methodologies to evaluate different aspects of ceramic matrix composite behavior. The basis of the approach is micromechanics together with a unique fiber substructuring concept. In this new concept the conventional unit cell (the smallest representative volume element of the composite) of micromechanics approach has been modified by substructuring the unit cell into several slices and developing the micromechanics based equations at themore » slice level. Main advantage of this technique is that it can provide a much greater detail in the response of composite behavior as compared to a conventional micromechanics based analysis and still maintains a very high computational efficiency. This methodology has recently been extended to model plain weave ceramic composites. The objective of the present paper is to describe the important features of the modeling and simulation and illustrate with select examples of laminated as well as woven composites.« less

  13. A study of fiber volume fraction effects in notched unidirectional SCS-6/Ti-15V-3Cr-3Al-3Sn composite. Ph.D. Thesis Final Report

    NASA Technical Reports Server (NTRS)

    Covey, Steven J.

    1993-01-01

    Notched unidirectional SCS-6/Ti-15-3 composite of three different fiber volume fractions (vf = 0.15, 0.37, and 0.41) was investigated for various room temperature microstructural and material properties including: fatigue crack initiation, fatigue crack growth, and fracture toughness. While the matrix hardness is similar for all fiber volume fractions, the fiber/matrix interfacial shear strength and matrix residual stress increases with fiber volume fraction. The composite fatigue crack initiation stress is shown to be matrix controlled and occurs when the net maximum matrix stress approaches the endurance limit stress of the matrix. A model is presented which includes residual stresses and presents the composite initiation stress as a function of fiber volume fraction. This model predicts a maximum composite initiation stress at vf approximately 0.15 which agrees with the experimental data. The applied composite stress levels were increased as necessary for continued crack growth. The applied Delta(K) values at crack arrest increase with fiber volume fraction by an amount better approximated using an energy based formulation rather than when scaled linear with modulus. After crack arrest, the crack growth rate exponents for vf37 and vf41 were much lower and toughness much higher, when compared to the unreinforced matrix, because of the bridged region which parades with the propagating fatigue crack. However, the vf15 material exhibited a higher crack growth rate exponent and lower toughness than the unreinforced matrix because once the bridged fibers nearest the crack mouth broke, the stress redistribution broke all bridged fibers, leaving an unbridged crack. Degraded, unbridged behavior is modeled using the residual stress state in the matrix ahead of the crack tip. Plastic zone sizes were directly measured using a metallographic technique and allow prediction of an effective matrix stress intensity which agrees with the fiber pressure model if residual stresses are considered. The sophisticated macro/micro finite element models of the 0.15 and 0.37 fiber volume fractions presented show good agreement with experimental data and the fiber pressure model when an estimated effective fiber/matrix debond length is used.

  14. Disassemblability modeling technology of configurable product based on disassembly constraint relation weighted design structure matrix(DSM)

    NASA Astrophysics Data System (ADS)

    Qiu, Lemiao; Liu, Xiaojian; Zhang, Shuyou; Sun, Liangfeng

    2014-05-01

    The current research of configurable product disassemblability focuses on disassemblability evaluation and disassembly sequence planning. Little work has been done on quantitative analysis of configurable product disassemblability. The disassemblability modeling technology for configurable product based on disassembly constraint relation weighted design structure matrix (DSM) is proposed. Major factors affecting the disassemblability of configurable product are analyzed, and the disassembling degrees between components in configurable product are obtained by calculating disassembly entropies such as joint type, joint quantity, disassembly path, disassembly accessibility and material compatibility. The disassembly constraint relation weighted DSM of configurable product is constructed and configuration modules are formed by matrix decomposition and tearing operations. The disassembly constraint relation in configuration modules is strong coupling, and the disassembly constraint relation between modules is weak coupling, and the disassemblability configuration model is constructed based on configuration module. Finally, taking a hydraulic forging press as an example, the decomposed weak coupling components are used as configuration modules alone, components with a strong coupling are aggregated into configuration modules, and the disassembly sequence of components inside configuration modules is optimized by tearing operation. A disassemblability configuration model of the hydraulic forging press is constructed. By researching the disassemblability modeling technology of product configuration design based on disassembly constraint relation weighted DSM, the disassembly property in maintenance, recycling and reuse of configurable product are optimized.

  15. Tissue Anisotropy Modeling Using Soft Composite Materials.

    PubMed

    Chanda, Arnab; Callaway, Christian

    2018-01-01

    Soft tissues in general exhibit anisotropic mechanical behavior, which varies in three dimensions based on the location of the tissue in the body. In the past, there have been few attempts to numerically model tissue anisotropy using composite-based formulations (involving fibers embedded within a matrix material). However, so far, tissue anisotropy has not been modeled experimentally. In the current work, novel elastomer-based soft composite materials were developed in the form of experimental test coupons, to model the macroscopic anisotropy in tissue mechanical properties. A soft elastomer matrix was fabricated, and fibers made of a stiffer elastomer material were embedded within the matrix material to generate the test coupons. The coupons were tested on a mechanical testing machine, and the resulting stress-versus-stretch responses were studied. The fiber volume fraction (FVF), fiber spacing, and orientations were varied to estimate the changes in the mechanical responses. The mechanical behavior of the soft composites was characterized using hyperelastic material models such as Mooney-Rivlin's, Humphrey's, and Veronda-Westmann's model and also compared with the anisotropic mechanical behavior of the human skin, pelvic tissues, and brain tissues. This work lays the foundation for the experimental modelling of tissue anisotropy, which combined with microscopic studies on tissues can lead to refinements in the simulation of localized fiber distribution and orientations, and enable the development of biofidelic anisotropic tissue phantom materials for various tissue engineering and testing applications.

  16. Tissue Anisotropy Modeling Using Soft Composite Materials

    PubMed Central

    Callaway, Christian

    2018-01-01

    Soft tissues in general exhibit anisotropic mechanical behavior, which varies in three dimensions based on the location of the tissue in the body. In the past, there have been few attempts to numerically model tissue anisotropy using composite-based formulations (involving fibers embedded within a matrix material). However, so far, tissue anisotropy has not been modeled experimentally. In the current work, novel elastomer-based soft composite materials were developed in the form of experimental test coupons, to model the macroscopic anisotropy in tissue mechanical properties. A soft elastomer matrix was fabricated, and fibers made of a stiffer elastomer material were embedded within the matrix material to generate the test coupons. The coupons were tested on a mechanical testing machine, and the resulting stress-versus-stretch responses were studied. The fiber volume fraction (FVF), fiber spacing, and orientations were varied to estimate the changes in the mechanical responses. The mechanical behavior of the soft composites was characterized using hyperelastic material models such as Mooney-Rivlin's, Humphrey's, and Veronda-Westmann's model and also compared with the anisotropic mechanical behavior of the human skin, pelvic tissues, and brain tissues. This work lays the foundation for the experimental modelling of tissue anisotropy, which combined with microscopic studies on tissues can lead to refinements in the simulation of localized fiber distribution and orientations, and enable the development of biofidelic anisotropic tissue phantom materials for various tissue engineering and testing applications. PMID:29853996

  17. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    PubMed

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  18. Elucidation of release characteristics of highly soluble drug trimetazidine hydrochloride from chitosan-carrageenan matrix tablets.

    PubMed

    Li, Liang; Wang, Linlin; Shao, Yang; Tian, Ye; Li, Conghao; Li, Ying; Mao, Shirui

    2013-08-01

    The aim of this study was to better understand the underlying drug release characteristics from matrix tablets based on the combination of chitosan (CS) and different types of carrageenans [kappa (κ)-CG, iota (ι)-CG, and lambda (λ)-CG]. Highly soluble trimetazidine hydrochloride (TH) was used as a model drug. First, characteristics of drug release from different formulations were investigated, and then in situ complexation capacity of CG with TH and CS was studied by differential scanning calorimetry and Fourier transform infrared spectroscopy. Erosion and swelling of matrix were also characterized to better understand the drug-release mechanisms. Effects of pH and ionic strength on drug release were also studied. It was found that not only ι-CG and λ-CG could reduce the burst release of TH by the effect of TH-CG interaction, CS-ι-CG- and CS-λ-CG-based polyelectrolyte film could further modify the controlled-release behavior, but not CS-κ-CG. High pH and high ionic strength resulted in faster drug release from CS-κ-CG- and CS-ι-CG-based matrix, but drug release from CS-λ-CG-based matrix was less sensitive to pH and ionic strength. In conclusion, CS-λ-CG-based matrix tablets are quite promising as controlled-release drug carrier based on multiple mechanisms. Copyright © 2013 Wiley Periodicals, Inc.

  19. Simulation of Complex Cracking in Plain Weave C/SiC Composite under Biaxial Loading

    NASA Technical Reports Server (NTRS)

    Cheng, Ron-Bin; Hsu, Su-Yuen

    2012-01-01

    Finite element analysis is performed on a mesh, based on computed geometry of a plain weave C/SiC composite with assumed internal stacking, to reveal the pattern of internal damage due to biaxial normal cyclic loading. The simulation encompasses intertow matrix cracking, matrix cracking inside the tows, and separation at the tow-intertow matrix and tow-tow interfaces. All these dissipative behaviors are represented by traction-separation cohesive laws. Not aimed at quantitatively predicting the overall stress-strain relation, the simulation, however, does not take the actual process of fiber debonding into account. The fiber tows are represented by a simple rule-of-mixture model where the reinforcing phase is a hypothetical one-dimensional material. Numerical results indicate that for the plain weave C/SiC composite, 1) matrix-crack initiation sites are primarily determined by large intertow matrix voids and interlayer tow-tow contacts, 2) the pattern of internal damage strongly depends on the loading path and initial stress, 3) compressive loading inflicts virtually no damage evolution. KEY WORDS: ceramic matrix composite, plain weave, cohesive model, brittle failure, smeared crack model, progressive damage, meso-mechanical analysis, finite element.

  20. A Gaussian random field model for similarity-based smoothing in Bayesian disease mapping.

    PubMed

    Baptista, Helena; Mendes, Jorge M; MacNab, Ying C; Xavier, Miguel; Caldas-de-Almeida, José

    2016-08-01

    Conditionally specified Gaussian Markov random field (GMRF) models with adjacency-based neighbourhood weight matrix, commonly known as neighbourhood-based GMRF models, have been the mainstream approach to spatial smoothing in Bayesian disease mapping. In the present paper, we propose a conditionally specified Gaussian random field (GRF) model with a similarity-based non-spatial weight matrix to facilitate non-spatial smoothing in Bayesian disease mapping. The model, named similarity-based GRF, is motivated for modelling disease mapping data in situations where the underlying small area relative risks and the associated determinant factors do not vary systematically in space, and the similarity is defined by "similarity" with respect to the associated disease determinant factors. The neighbourhood-based GMRF and the similarity-based GRF are compared and accessed via a simulation study and by two case studies, using new data on alcohol abuse in Portugal collected by the World Mental Health Survey Initiative and the well-known lip cancer data in Scotland. In the presence of disease data with no evidence of positive spatial correlation, the simulation study showed a consistent gain in efficiency from the similarity-based GRF, compared with the adjacency-based GMRF with the determinant risk factors as covariate. This new approach broadens the scope of the existing conditional autocorrelation models. © The Author(s) 2016.

  1. A Time Integration Algorithm Based on the State Transition Matrix for Structures with Time Varying and Nonlinear Properties

    NASA Technical Reports Server (NTRS)

    Bartels, Robert E.

    2003-01-01

    A variable order method of integrating the structural dynamics equations that is based on the state transition matrix has been developed. The method has been evaluated for linear time variant and nonlinear systems of equations. When the time variation of the system can be modeled exactly by a polynomial it produces nearly exact solutions for a wide range of time step sizes. Solutions of a model nonlinear dynamic response exhibiting chaotic behavior have been computed. Accuracy of the method has been demonstrated by comparison with solutions obtained by established methods.

  2. Mathematical model of unmanned aerial vehicle used for endurance autonomous monitoring

    NASA Astrophysics Data System (ADS)

    Chelaru, Teodor-Viorel; Chelaru, Adrian

    2014-12-01

    The paper purpose is to present some aspects regarding the control system of unmanned aerial vehicle - UAV, used to local observations, surveillance and monitoring interest area. The calculus methodology allows a numerical simulation of UAV evolution in bad atmospheric conditions by using nonlinear model, as well as a linear one for obtaining guidance command. The UAV model which will be presented has six DOF (degrees of freedom), and autonomous control system. This theoretical development allows us to build stability matrix, command matrix and control matrix and finally to analyse the stability of autonomous UAV flight. A robust guidance system, based on uncoupled state will be evaluated for different fly conditions and the results will be presented. The flight parameters and guidance will be analysed.

  3. Analytical Modelling of Transverse Matrix Cracking of [plus or minus Theta/90(sub n)](sub s) Composite Laminates Under Multiaxial Loading

    NASA Technical Reports Server (NTRS)

    Mayugo, J A.; Camanho, P. P.; Maimi, P.; Davila, C. G.

    2010-01-01

    An analytical model based on the analysis of a cracked unit cell of a composite laminate subjected to multiaxial loads is proposed to predict the onset and accumulation of transverse matrix cracks in the 90(sub n) plies of uniformly stressed [plus or minus Theta/90(sub n)](sub s) laminates. The model predicts the effect of matrix cracks on the stiffness of the laminate, as well as the ultimate failure of the laminate, and it accounts for the effect of the ply thickness on the ply strength. Several examples describing the predictions of laminate response, from damage onset up to final failure under both uniaxial and multiaxial loads, are presented.

  4. ED leadership competency matrix: an administrative management tool.

    PubMed

    Propp, Douglas A; Glickman, Seth; Uehara, Dennis T

    2003-10-01

    A successful ED relies on its leaders to master and demonstrate core competencies to be effective in the many arenas in which they interact and are responsible. A unique matrix model for the assessment of an ED leadership's key administrative skill sets is presented. The model incorporates capabilities related to the individual's cognitive aptitude, experience, acquired technical skills, behavioral characteristics, as well as the ability to manage relationships effectively. Based on the personnel inventory using the matrix, focused evaluation, development, and recruitment of ED key leaders occurs. This dynamic tool has provided a unique perspective for the evaluation and enhancement of overall ED leadership performance. It is hoped that incorporation of such a model will similarly improve the accomplishments of EDs at other institutions.

  5. Finding a Hadamard matrix by simulated annealing of spin vectors

    NASA Astrophysics Data System (ADS)

    Bayu Suksmono, Andriyan

    2017-05-01

    Reformulation of a combinatorial problem into optimization of a statistical-mechanics system enables finding a better solution using heuristics derived from a physical process, such as by the simulated annealing (SA). In this paper, we present a Hadamard matrix (H-matrix) searching method based on the SA on an Ising model. By equivalence, an H-matrix can be converted into a seminormalized Hadamard (SH) matrix, whose first column is unit vector and the rest ones are vectors with equal number of -1 and +1 called SH-vectors. We define SH spin vectors as representation of the SH vectors, which play a similar role as the spins on Ising model. The topology of the lattice is generalized into a graph, whose edges represent orthogonality relationship among the SH spin vectors. Starting from a randomly generated quasi H-matrix Q, which is a matrix similar to the SH-matrix without imposing orthogonality, we perform the SA. The transitions of Q are conducted by random exchange of {+, -} spin-pair within the SH-spin vectors that follow the Metropolis update rule. Upon transition toward zeroth energy, the Q-matrix is evolved following a Markov chain toward an orthogonal matrix, at which the H-matrix is said to be found. We demonstrate the capability of the proposed method to find some low-order H-matrices, including the ones that cannot trivially be constructed by the Sylvester method.

  6. Implementation of Fiber Substructuring Into Strain Rate Dependent Micromechanics Analysis of Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.

    2001-01-01

    A research program is in progress to develop strain rate dependent deformation and failure models for the analysis of polymer matrix composites subject to impact loads. Previously, strain rate dependent inelastic constitutive equations developed to model the polymer matrix were incorporated into a mechanics of materials based micromechanics method. In the current work, the micromechanics method is revised such that the composite unit cell is divided into a number of slices. Micromechanics equations are then developed for each slice, with laminate theory applied to determine the elastic properties, effective stresses and effective inelastic strains for the unit cell. Verification studies are conducted using two representative polymer matrix composites with a nonlinear, strain rate dependent deformation response. The computed results compare well to experimentally obtained values.

  7. Intelligent Decisions Need Intelligent Choice of Models and Data - a Bayesian Justifiability Analysis for Models with Vastly Different Complexity

    NASA Astrophysics Data System (ADS)

    Nowak, W.; Schöniger, A.; Wöhling, T.; Illman, W. A.

    2016-12-01

    Model-based decision support requires justifiable models with good predictive capabilities. This, in turn, calls for a fine adjustment between predictive accuracy (small systematic model bias that can be achieved with rather complex models), and predictive precision (small predictive uncertainties that can be achieved with simpler models with fewer parameters). The implied complexity/simplicity trade-off depends on the availability of informative data for calibration. If not available, additional data collection can be planned through optimal experimental design. We present a model justifiability analysis that can compare models of vastly different complexity. It rests on Bayesian model averaging (BMA) to investigate the complexity/performance trade-off dependent on data availability. Then, we disentangle the complexity component from the performance component. We achieve this by replacing actually observed data by realizations of synthetic data predicted by the models. This results in a "model confusion matrix". Based on this matrix, the modeler can identify the maximum model complexity that can be justified by the available (or planned) amount and type of data. As a side product, the matrix quantifies model (dis-)similarity. We apply this analysis to aquifer characterization via hydraulic tomography, comparing four models with a vastly different number of parameters (from a homogeneous model to geostatistical random fields). As a testing scenario, we consider hydraulic tomography data. Using subsets of these data, we determine model justifiability as a function of data set size. The test case shows that geostatistical parameterization requires a substantial amount of hydraulic tomography data to be justified, while a zonation-based model can be justified with more limited data set sizes. The actual model performance (as opposed to model justifiability), however, depends strongly on the quality of prior geological information.

  8. Genetic algorithm and graph theory based matrix factorization method for online friend recommendation.

    PubMed

    Li, Qu; Yao, Min; Yang, Jianhua; Xu, Ning

    2014-01-01

    Online friend recommendation is a fast developing topic in web mining. In this paper, we used SVD matrix factorization to model user and item feature vector and used stochastic gradient descent to amend parameter and improve accuracy. To tackle cold start problem and data sparsity, we used KNN model to influence user feature vector. At the same time, we used graph theory to partition communities with fairly low time and space complexity. What is more, matrix factorization can combine online and offline recommendation. Experiments showed that the hybrid recommendation algorithm is able to recommend online friends with good accuracy.

  9. Modeling the two-way feedback between contractility and matrix realignment reveals a nonlinear mode of cancer cell invasion

    PubMed Central

    Ahmadzadeh, Hossein; Webster, Marie R.; Behera, Reeti; Jimenez Valencia, Angela M.; Wirtz, Denis; Weeraratna, Ashani T.; Shenoy, Vivek B.

    2017-01-01

    Cancer cell invasion from primary tumors is mediated by a complex interplay between cellular adhesions, actomyosin-driven contractility, and the physical characteristics of the extracellular matrix (ECM). Here, we incorporate a mechanochemical free-energy–based approach to elucidate how the two-way feedback loop between cell contractility (induced by the activity of chemomechanical interactions such as Ca2+ and Rho signaling pathways) and matrix fiber realignment and strain stiffening enables the cells to polarize and develop contractile forces to break free from the tumor spheroids and invade into the ECM. Interestingly, through this computational model, we are able to identify a critical stiffness that is required by the matrix to break intercellular adhesions and initiate cell invasion. Also, by considering the kinetics of the cell movement, our model predicts a biphasic invasiveness with respect to the stiffness of the matrix. These predictions are validated by analyzing the invasion of melanoma cells in collagen matrices of varying concentration. Our model also predicts a positive correlation between the elongated morphology of the invading cells and the alignment of fibers in the matrix, suggesting that cell polarization is directly proportional to the stiffness and alignment of the matrix. In contrast, cells in nonfibrous matrices are found to be rounded and not polarized, underscoring the key role played by the nonlinear mechanics of fibrous matrices. Importantly, our model shows that mechanical principles mediated by the contractility of the cells and the nonlinearity of the ECM behavior play a crucial role in determining the phenotype of the cell invasion. PMID:28196892

  10. Model-Based Fatigue Prognosis of Fiber-Reinforced Laminates Exhibiting Concurrent Damage Mechanisms

    NASA Technical Reports Server (NTRS)

    Corbetta, M.; Sbarufatti, C.; Saxena, A.; Giglio, M.; Goebel, K.

    2016-01-01

    Prognostics of large composite structures is a topic of increasing interest in the field of structural health monitoring for aerospace, civil, and mechanical systems. Along with recent advancements in real-time structural health data acquisition and processing for damage detection and characterization, model-based stochastic methods for life prediction are showing promising results in the literature. Among various model-based approaches, particle-filtering algorithms are particularly capable in coping with uncertainties associated with the process. These include uncertainties about information on the damage extent and the inherent uncertainties of the damage propagation process. Some efforts have shown successful applications of particle filtering-based frameworks for predicting the matrix crack evolution and structural stiffness degradation caused by repetitive fatigue loads. Effects of other damage modes such as delamination, however, are not incorporated in these works. It is well established that delamination and matrix cracks not only co-exist in most laminate structures during the fatigue degradation process but also affect each other's progression. Furthermore, delamination significantly alters the stress-state in the laminates and accelerates the material degradation leading to catastrophic failure. Therefore, the work presented herein proposes a particle filtering-based framework for predicting a structure's remaining useful life with consideration of multiple co-existing damage-mechanisms. The framework uses an energy-based model from the composite modeling literature. The multiple damage-mode model has been shown to suitably estimate the energy release rate of cross-ply laminates as affected by matrix cracks and delamination modes. The model is also able to estimate the reduction in stiffness of the damaged laminate. This information is then used in the algorithms for life prediction capabilities. First, a brief summary of the energy-based damage model is provided. Then, the paper describes how the model is embedded within the prognostic framework and how the prognostics performance is assessed using observations from run-to-failure experiments

  11. Integrating Nonadditive Genomic Relationship Matrices into the Study of Genetic Architecture of Complex Traits.

    PubMed

    Nazarian, Alireza; Gezan, Salvador A

    2016-03-01

    The study of genetic architecture of complex traits has been dramatically influenced by implementing genome-wide analytical approaches during recent years. Of particular interest are genomic prediction strategies which make use of genomic information for predicting phenotypic responses instead of detecting trait-associated loci. In this work, we present the results of a simulation study to improve our understanding of the statistical properties of estimation of genetic variance components of complex traits, and of additive, dominance, and genetic effects through best linear unbiased prediction methodology. Simulated dense marker information was used to construct genomic additive and dominance matrices, and multiple alternative pedigree- and marker-based models were compared to determine if including a dominance term into the analysis may improve the genetic analysis of complex traits. Our results showed that a model containing a pedigree- or marker-based additive relationship matrix along with a pedigree-based dominance matrix provided the best partitioning of genetic variance into its components, especially when some degree of true dominance effects was expected to exist. Also, we noted that the use of a marker-based additive relationship matrix along with a pedigree-based dominance matrix had the best performance in terms of accuracy of correlations between true and estimated additive, dominance, and genetic effects. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Effect of matrix elasticity on the continuous foaming of food models.

    PubMed

    Narchi, I; Vial, Ch; Djelveh, G

    2008-12-01

    The aim is to understand the effect of matrix elasticity on continuous foaming using food models based on glucose syrup. This was modified by adding polyacrylamide (PAA) with 2% whey protein isolate (WPI) or Tween 80 as foaming agents. Foaming was conducted in a stirred column. Rotation speed N and gas-to-liquid flow ratio (G/L) were varied. Overrun, average bubble size d (32), texture and stability were measured using densimetry, image analysis, and rheometry, respectively. Experimental results showed that 0.01% PAA did not modify the viscosity of 2% WPI models, but conferred low elastic behavior. PAA (0.05%) doubled matrix viscosity and drastically increased elasticity. The increase of elasticity became slower for further PAA addition. Foaming experiments demonstrated that theoretical overrun could not be achieved for inelastic WPI models in two cases: for high viscosity and low N, as dispersion effectiveness was reduced; for high G/L and N because of enhanced coalescence. Matrix elasticity was shown to increase overrun at constant viscosity for high G/L by enhancing interface stabilization. However, in elastic models, gas dispersion was more difficult and d (32) was higher than in inelastic fluids of similar viscosity. Finally, when the limiting step was dispersion, foaming was shown to be negatively affected by matrix elasticity.

  13. Vapor-liquid phase behavior of a size-asymmetric model of ionic fluids confined in a disordered matrix: The collective-variables-based approach

    NASA Astrophysics Data System (ADS)

    Patsahan, O. V.; Patsahan, T. M.; Holovko, M. F.

    2018-02-01

    We develop a theory based on the method of collective variables to study the vapor-liquid equilibrium of asymmetric ionic fluids confined in a disordered porous matrix. The approach allows us to formulate the perturbation theory using an extension of the scaled particle theory for a description of a reference system presented as a two-component hard-sphere fluid confined in a hard-sphere matrix. Treating an ionic fluid as a size- and charge-asymmetric primitive model (PM) we derive an explicit expression for the relevant chemical potential of a confined ionic system which takes into account the third-order correlations between ions. Using this expression, the phase diagrams for a size-asymmetric PM are calculated for different matrix porosities as well as for different sizes of matrix and fluid particles. It is observed that general trends of the coexistence curves with the matrix porosity are similar to those of simple fluids under disordered confinement, i.e., the coexistence region gets narrower with a decrease of porosity and, simultaneously, the reduced critical temperature Tc* and the critical density ρi,c * become lower. At the same time, our results suggest that an increase in size asymmetry of oppositely charged ions considerably affects the vapor-liquid diagrams leading to a faster decrease of Tc* and ρi,c * and even to a disappearance of the phase transition, especially for the case of small matrix particles.

  14. A Truncated Nuclear Norm Regularization Method Based on Weighted Residual Error for Matrix Completion.

    PubMed

    Qing Liu; Zhihui Lai; Zongwei Zhou; Fangjun Kuang; Zhong Jin

    2016-01-01

    Low-rank matrix completion aims to recover a matrix from a small subset of its entries and has received much attention in the field of computer vision. Most existing methods formulate the task as a low-rank matrix approximation problem. A truncated nuclear norm has recently been proposed as a better approximation to the rank of matrix than a nuclear norm. The corresponding optimization method, truncated nuclear norm regularization (TNNR), converges better than the nuclear norm minimization-based methods. However, it is not robust to the number of subtracted singular values and requires a large number of iterations to converge. In this paper, a TNNR method based on weighted residual error (TNNR-WRE) for matrix completion and its extension model (ETNNR-WRE) are proposed. TNNR-WRE assigns different weights to the rows of the residual error matrix in an augmented Lagrange function to accelerate the convergence of the TNNR method. The ETNNR-WRE is much more robust to the number of subtracted singular values than the TNNR-WRE, TNNR alternating direction method of multipliers, and TNNR accelerated proximal gradient with Line search methods. Experimental results using both synthetic and real visual data sets show that the proposed TNNR-WRE and ETNNR-WRE methods perform better than TNNR and Iteratively Reweighted Nuclear Norm (IRNN) methods.

  15. Differentiating characteristic microstructural features of cancerous tissues using Mueller matrix microscope.

    PubMed

    Wang, Ye; He, Honghui; Chang, Jintao; Zeng, Nan; Liu, Shaoxiong; Li, Migao; Ma, Hui

    2015-12-01

    Polarized light imaging can provide rich microstructural information of samples, and has been applied to the detections of various abnormal tissues. In this paper, we report a polarized light microscope based on Mueller matrix imaging by adding the polarization state generator and analyzer (PSG and PSA) to a commercial transmission optical microscope. The maximum errors for the absolute values of Mueller matrix elements are reduced to 0.01 after calibration. This Mueller matrix microscope has been used to examine human cervical and liver cancerous tissues with fibrosis. Images of the transformed Mueller matrix parameters provide quantitative assessment on the characteristic features of the pathological tissues. Contrast mechanism of the experimental results are backed up by Monte Carlo simulations based on the sphere-cylinder birefringence model, which reveal the relationship between the pathological features in the cancerous tissues at the cellular level and the polarization parameters. Both the experimental and simulated data indicate that the microscopic transformed Mueller matrix parameters can distinguish the breaking down of birefringent normal tissues for cervical cancer, or the formation of birefringent surrounding structures accompanying the inflammatory reaction for liver cancer. With its simple structure, fast measurement and high precision, polarized light microscope based on Mueller matrix shows a good diagnosis application prospect. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Observation-Based Dissipation and Input Terms for Spectral Wave Models, with End-User Testing

    DTIC Science & Technology

    2014-09-30

    scale influence of the Great barrier reef matrix on wave attenuation, Coral Reefs [published, refereed] Ghantous, M., and A.V. Babanin, 2014: One...Observation-Based Dissipation and Input Terms for Spectral Wave Models...functions, based on advanced understanding of physics of air-sea interactions, wave breaking and swell attenuation, in wave - forecast models. OBJECTIVES The

  17. Artificial Neural Identification and LMI Transformation for Model Reduction-Based Control of the Buck Switch-Mode Regulator

    NASA Astrophysics Data System (ADS)

    Al-Rabadi, Anas N.

    2009-10-01

    This research introduces a new method of intelligent control for the control of the Buck converter using newly developed small signal model of the pulse width modulation (PWM) switch. The new method uses supervised neural network to estimate certain parameters of the transformed system matrix [Ã]. Then, a numerical algorithm used in robust control called linear matrix inequality (LMI) optimization technique is used to determine the permutation matrix [P] so that a complete system transformation {[B˜], [C˜], [Ẽ]} is possible. The transformed model is then reduced using the method of singular perturbation, and state feedback control is applied to enhance system performance. The experimental results show that the new control methodology simplifies the model in the Buck converter and thus uses a simpler controller that produces the desired system response for performance enhancement.

  18. Thermal form-factor approach to dynamical correlation functions of integrable lattice models

    NASA Astrophysics Data System (ADS)

    Göhmann, Frank; Karbach, Michael; Klümper, Andreas; Kozlowski, Karol K.; Suzuki, Junji

    2017-11-01

    We propose a method for calculating dynamical correlation functions at finite temperature in integrable lattice models of Yang-Baxter type. The method is based on an expansion of the correlation functions as a series over matrix elements of a time-dependent quantum transfer matrix rather than the Hamiltonian. In the infinite Trotter-number limit the matrix elements become time independent and turn into the thermal form factors studied previously in the context of static correlation functions. We make this explicit with the example of the XXZ model. We show how the form factors can be summed utilizing certain auxiliary functions solving finite sets of nonlinear integral equations. The case of the XX model is worked out in more detail leading to a novel form-factor series representation of the dynamical transverse two-point function.

  19. Three-Dimensional Electromagnetic Scattering from Layered Media with Rough Interfaces for Subsurface Radar Remote Sensing

    NASA Astrophysics Data System (ADS)

    Duan, Xueyang

    The objective of this dissertation is to develop forward scattering models for active microwave remote sensing of natural features represented by layered media with rough interfaces. In particular, soil profiles are considered, for which a model of electromagnetic scattering from multilayer rough surfaces with or without buried random media is constructed. Starting from a single rough surface, radar scattering is modeled using the stabilized extended boundary condition method (SEBCM). This method solves the long-standing instability issue of the classical EBCM, and gives three-dimensional full wave solutions over large ranges of surface roughnesses with higher computational efficiency than pure numerical solutions, e.g., method of moments (MoM). Based on this single surface solution, multilayer rough surface scattering is modeled using the scattering matrix approach and the model is used for a comprehensive sensitivity analysis of the total ground scattering as a function of layer separation, subsurface statistics, and sublayer dielectric properties. The buried inhomogeneities such as rocks and vegetation roots are considered for the first time in the forward scattering model. Radar scattering from buried random media is modeled by the aggregate transition matrix using either the recursive transition matrix approach for spherical or short-length cylindrical scatterers, or the generalized iterative extended boundary condition method we developed for long cylinders or root-like cylindrical clusters. These approaches take the field interactions among scatterers into account with high computational efficiency. The aggregate transition matrix is transformed to a scattering matrix for the full solution to the layered-medium problem. This step is based on the near-to-far field transformation of the numerical plane wave expansion of the spherical harmonics and the multipole expansion of plane waves. This transformation consolidates volume scattering from the buried random medium with the scattering from layered structure in general. Combined with scattering from multilayer rough surfaces, scattering contributions from subsurfaces and vegetation roots can be then simulated. Solutions of both the rough surface scattering and random media scattering are validated numerically, experimentally, or both. The experimental validations have been carried out using a laboratory-based transmit-receive system for scattering from random media and a new bistatic tower-mounted radar system for field-based surface scattering measurements.

  20. Hydration, erosion, and release behavior of guar-based hydrophilic matrix tablets containing total alkaloids of Sophora alopecuroides.

    PubMed

    Zhao, Wenchang; Song, Lijun; Deng, Hongzhu; Yao, Hui

    2009-05-01

    It is a challenge to deliver water-soluble drug based on hydrophilic matrix to colon because of swelling and erosion of polysaccharides in contact with media. In our study, guar-based hydrophilic matrix tablets containing water-soluble total alkaloids of Sophora alopecuroides prepared by wet granulation technique were evaluated. A novel method was established to investigate the changes of swelling and volume for guar-based tablets in undynamic state, which generally showed a rapid swelling and volume change in the first 9 h, then the hydrated speed slowed down. On the other hand, the influence of different pH of the media on water uptake and erosion of various guar-based formulations in dynamic state indicated that the hydrated constants in simulated gastric fluid (SGF) was higher than that in SIF, which followed varied mechanism of water penetration by fitting Davidson and Peppas model. The extent of erosion was between 22.4 and 32.6% in SIF within 360 min. In vitro sophoridine release studies in successive different mimicking media showed that the guar matrix tablets released 13.5-25.6% of sophoridine in the first 6 h; therefore it was necessary to develop the bilayer matrix tablet by direct-compressing coating 100 mg guar granula on core tablet. The initial release of coated tablet was retarded and the bilayer matrix tablet was suitable for colon target.

  1. Adjustment of Pesticide Concentrations for Temporal Changes in Analytical Recovery, 1992-2006

    USGS Publications Warehouse

    Martin, Jeffrey D.; Stone, Wesley W.; Wydoski, Duane S.; Sandstrom, Mark W.

    2009-01-01

    Recovery is the proportion of a target analyte that is quantified by an analytical method and is a primary indicator of the analytical bias of a measurement. Recovery is measured by analysis of quality-control (QC) water samples that have known amounts of target analytes added ('spiked' QC samples). For pesticides, recovery is the measured amount of pesticide in the spiked QC sample expressed as percentage of the amount spiked, ideally 100 percent. Temporal changes in recovery have the potential to adversely affect time-trend analysis of pesticide concentrations by introducing trends in environmental concentrations that are caused by trends in performance of the analytical method rather than by trends in pesticide use or other environmental conditions. This report examines temporal changes in the recovery of 44 pesticides and 8 pesticide degradates (hereafter referred to as 'pesticides') that were selected for a national analysis of time trends in pesticide concentrations in streams. Water samples were analyzed for these pesticides from 1992 to 2006 by gas chromatography/mass spectrometry. Recovery was measured by analysis of pesticide-spiked QC water samples. Temporal changes in pesticide recovery were investigated by calculating robust, locally weighted scatterplot smooths (lowess smooths) for the time series of pesticide recoveries in 5,132 laboratory reagent spikes; 1,234 stream-water matrix spikes; and 863 groundwater matrix spikes. A 10-percent smoothing window was selected to show broad, 6- to 12-month time scale changes in recovery for most of the 52 pesticides. Temporal patterns in recovery were similar (in phase) for laboratory reagent spikes and for matrix spikes for most pesticides. In-phase temporal changes among spike types support the hypothesis that temporal change in method performance is the primary cause of temporal change in recovery. Although temporal patterns of recovery were in phase for most pesticides, recovery in matrix spikes was greater than recovery in reagent spikes for nearly every pesticide. Models of recovery based on matrix spikes are deemed more appropriate for adjusting concentrations of pesticides measured in groundwater and stream-water samples than models based on laboratory reagent spikes because (1) matrix spikes are expected to more closely match the matrix of environmental water samples than are reagent spikes and (2) method performance is often matrix dependent, as was shown by higher recovery in matrix spikes for most of the pesticides. Models of recovery, based on lowess smooths of matrix spikes, were developed separately for groundwater and stream-water samples. The models of recovery can be used to adjust concentrations of pesticides measured in groundwater or stream-water samples to 100 percent recovery to compensate for temporal changes in the performance (bias) of the analytical method.

  2. Distance learning in discriminative vector quantization.

    PubMed

    Schneider, Petra; Biehl, Michael; Hammer, Barbara

    2009-10-01

    Discriminative vector quantization schemes such as learning vector quantization (LVQ) and extensions thereof offer efficient and intuitive classifiers based on the representation of classes by prototypes. The original methods, however, rely on the Euclidean distance corresponding to the assumption that the data can be represented by isotropic clusters. For this reason, extensions of the methods to more general metric structures have been proposed, such as relevance adaptation in generalized LVQ (GLVQ) and matrix learning in GLVQ. In these approaches, metric parameters are learned based on the given classification task such that a data-driven distance measure is found. In this letter, we consider full matrix adaptation in advanced LVQ schemes. In particular, we introduce matrix learning to a recent statistical formalization of LVQ, robust soft LVQ, and we compare the results on several artificial and real-life data sets to matrix learning in GLVQ, a derivation of LVQ-like learning based on a (heuristic) cost function. In all cases, matrix adaptation allows a significant improvement of the classification accuracy. Interestingly, however, the principled behavior of the models with respect to prototype locations and extracted matrix dimensions shows several characteristic differences depending on the data sets.

  3. Functionalizing graphene by embedded boron clusters

    NASA Astrophysics Data System (ADS)

    Quandt, Alexander; Özdoğan, Cem; Kunstmann, Jens; Fehske, Holger

    2008-08-01

    We present a model system that might serve as a blueprint for the controlled layout of graphene based nanodevices. The systems consists of chains of B7 clusters implanted in a graphene matrix, where the boron clusters are not directly connected. We show that the graphene matrix easily accepts these alternating B7-C6 chains and that the implanted boron components may dramatically modify the electronic properties of graphene based nanomaterials. This suggests a functionalization of graphene nanomaterials, where the semiconducting properties might be supplemented by parts of the graphene matrix itself, but the basic wiring will be provided by alternating chains of implanted boron clusters that connect these areas.

  4. Development of a microwave 20 x 20 switch matrix for 30/20 GHz SS-TDMA application

    NASA Technical Reports Server (NTRS)

    Cory, B. J.; Berkowitz, M.; Wallis, R.; Schiavone, A.; Shieh, D.; Campbell, J.

    1982-01-01

    The design and fabrication of a 3-8 GHz, 20 x 20 Satellite Switched-Time Division Multiple Access IF switch matrix applicable to a 30/20 GHz communications satellite are described. An assessment of switch architecture in 1980 concluded that the GaAs FET-based coupled crossbar switch matrix, incorporating high speed CMOS LSI logic for switch crosspoint addressing, would be the optimum technology available for communications satellite switching by 1982. This assessment was based on such factors as switching speed, bandwidth, off-state isolation, and reliability, over a 10-year mission life. A proof-of-concept model's construction and testing are presented.

  5. Topological Distances Between Brain Networks

    PubMed Central

    Lee, Hyekyoung; Solo, Victor; Davidson, Richard J.; Pollak, Seth D.

    2018-01-01

    Many existing brain network distances are based on matrix norms. The element-wise differences may fail to capture underlying topological differences. Further, matrix norms are sensitive to outliers. A few extreme edge weights may severely affect the distance. Thus it is necessary to develop network distances that recognize topology. In this paper, we introduce Gromov-Hausdorff (GH) and Kolmogorov-Smirnov (KS) distances. GH-distance is often used in persistent homology based brain network models. The superior performance of KS-distance is contrasted against matrix norms and GH-distance in random network simulations with the ground truths. The KS-distance is then applied in characterizing the multimodal MRI and DTI study of maltreated children.

  6. Biointerface dynamics--Multi scale modeling considerations.

    PubMed

    Pajic-Lijakovic, Ivana; Levic, Steva; Nedovic, Viktor; Bugarski, Branko

    2015-08-01

    Irreversible nature of matrix structural changes around the immobilized cell aggregates caused by cell expansion is considered within the Ca-alginate microbeads. It is related to various effects: (1) cell-bulk surface effects (cell-polymer mechanical interactions) and cell surface-polymer surface effects (cell-polymer electrostatic interactions) at the bio-interface, (2) polymer-bulk volume effects (polymer-polymer mechanical and electrostatic interactions) within the perturbed boundary layers around the cell aggregates, (3) cumulative surface and volume effects within the parts of the microbead, and (4) macroscopic effects within the microbead as a whole based on multi scale modeling approaches. All modeling levels are discussed at two time scales i.e. long time scale (cell growth time) and short time scale (cell rearrangement time). Matrix structural changes results in the resistance stress generation which have the feedback impact on: (1) single and collective cell migrations, (2) cell deformation and orientation, (3) decrease of cell-to-cell separation distances, and (4) cell growth. Herein, an attempt is made to discuss and connect various multi scale modeling approaches on a range of time and space scales which have been proposed in the literature in order to shed further light to this complex course-consequence phenomenon which induces the anomalous nature of energy dissipation during the structural changes of cell aggregates and matrix quantified by the damping coefficients (the orders of the fractional derivatives). Deeper insight into the matrix partial disintegration within the boundary layers is useful for understanding and minimizing the polymer matrix resistance stress generation within the interface and on that base optimizing cell growth. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Clinical nurse specialist practice domains and evidence-based practice competencies: a matrix of influence.

    PubMed

    Kring, Daria L

    2008-01-01

    The purpose of this article is to describe master's-level evidence-based practice (EBP) competencies as determined by a national consensus panel and present an EBP matrix that illustrates the influence that the clinical nurse specialist (CNS) practice can have on driving EBP change. Evidence-based practice is a growing and necessary paradigm for nursing care. The ACE Star Model conceptualizes the knowledge transformation that must occur in an EBP environment as 5 distinct points: discovery, summary, translation, integration, and evaluation. Master's-level EBP competencies based on these 5 steps were established by a national consensus panel. The CNS's practice can be organized around 5 domains: expert practitioner, researcher, consultant, educator, and leader. The master's-level EBP competencies can be transposed on a crosswalk of the ACE Star Model and the 5 CNS practice domains to form a matrix representing the influence that CNSs can have over the EBP process. Each competency falls well within the practice domains of the CNS, making the CNS an ideal person to lead the EBP movement forward, providing tangible outcomes to further demonstrate the need for the CNS role.

  8. Statistical analysis of latent generalized correlation matrix estimation in transelliptical distribution.

    PubMed

    Han, Fang; Liu, Han

    2017-02-01

    Correlation matrix plays a key role in many multivariate methods (e.g., graphical model estimation and factor analysis). The current state-of-the-art in estimating large correlation matrices focuses on the use of Pearson's sample correlation matrix. Although Pearson's sample correlation matrix enjoys various good properties under Gaussian models, its not an effective estimator when facing heavy-tail distributions with possible outliers. As a robust alternative, Han and Liu (2013b) advocated the use of a transformed version of the Kendall's tau sample correlation matrix in estimating high dimensional latent generalized correlation matrix under the transelliptical distribution family (or elliptical copula). The transelliptical family assumes that after unspecified marginal monotone transformations, the data follow an elliptical distribution. In this paper, we study the theoretical properties of the Kendall's tau sample correlation matrix and its transformed version proposed in Han and Liu (2013b) for estimating the population Kendall's tau correlation matrix and the latent Pearson's correlation matrix under both spectral and restricted spectral norms. With regard to the spectral norm, we highlight the role of "effective rank" in quantifying the rate of convergence. With regard to the restricted spectral norm, we for the first time present a "sign subgaussian condition" which is sufficient to guarantee that the rank-based correlation matrix estimator attains the optimal rate of convergence. In both cases, we do not need any moment condition.

  9. Manifold regularized matrix completion for multi-label learning with ADMM.

    PubMed

    Liu, Bin; Li, Yingming; Xu, Zenglin

    2018-05-01

    Multi-label learning is a common machine learning problem arising from numerous real-world applications in diverse fields, e.g, natural language processing, bioinformatics, information retrieval and so on. Among various multi-label learning methods, the matrix completion approach has been regarded as a promising approach to transductive multi-label learning. By constructing a joint matrix comprising the feature matrix and the label matrix, the missing labels of test samples are regarded as missing values of the joint matrix. With the low-rank assumption of the constructed joint matrix, the missing labels can be recovered by minimizing its rank. Despite its success, most matrix completion based approaches ignore the smoothness assumption of unlabeled data, i.e., neighboring instances should also share a similar set of labels. Thus they may under exploit the intrinsic structures of data. In addition, the matrix completion problem can be less efficient. To this end, we propose to efficiently solve the multi-label learning problem as an enhanced matrix completion model with manifold regularization, where the graph Laplacian is used to ensure the label smoothness over it. To speed up the convergence of our model, we develop an efficient iterative algorithm, which solves the resulted nuclear norm minimization problem with the alternating direction method of multipliers (ADMM). Experiments on both synthetic and real-world data have shown the promising results of the proposed approach. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Dynamic imaging in electrical impedance tomography of the human chest with online transition matrix identification.

    PubMed

    Moura, Fernando Silva; Aya, Julio Cesar Ceballos; Fleury, Agenor Toledo; Amato, Marcelo Britto Passos; Lima, Raul Gonzalez

    2010-02-01

    One of the electrical impedance tomography objectives is to estimate the electrical resistivity distribution in a domain based only on electrical potential measurements at its boundary generated by an imposed electrical current distribution into the boundary. One of the methods used in dynamic estimation is the Kalman filter. In biomedical applications, the random walk model is frequently used as evolution model and, under this conditions, poor tracking ability of the extended Kalman filter (EKF) is achieved. An analytically developed evolution model is not feasible at this moment. The paper investigates the identification of the evolution model in parallel to the EKF and updating the evolution model with certain periodicity. The evolution model transition matrix is identified using the history of the estimated resistivity distribution obtained by a sensitivity matrix based algorithm and a Newton-Raphson algorithm. To numerically identify the linear evolution model, the Ibrahim time-domain method is used. The investigation is performed by numerical simulations of a domain with time-varying resistivity and by experimental data collected from the boundary of a human chest during normal breathing. The obtained dynamic resistivity values lie within the expected values for the tissues of a human chest. The EKF results suggest that the tracking ability is significantly improved with this approach.

  11. Nonlinear integral equations for the sausage model

    NASA Astrophysics Data System (ADS)

    Ahn, Changrim; Balog, Janos; Ravanini, Francesco

    2017-08-01

    The sausage model, first proposed by Fateev, Onofri, and Zamolodchikov, is a deformation of the O(3) sigma model preserving integrability. The target space is deformed from the sphere to ‘sausage’ shape by a deformation parameter ν. This model is defined by a factorizable S-matrix which is obtained by deforming that of the O(3) sigma model by a parameter λ. Clues for the deformed sigma model are provided by various UV and IR information through the thermodynamic Bethe ansatz (TBA) analysis based on the S-matrix. Application of TBA to the sausage model is, however, limited to the case of 1/λ integer where the coupled integral equations can be truncated to a finite number. In this paper, we propose a finite set of nonlinear integral equations (NLIEs), which are applicable to generic value of λ. Our derivation is based on T-Q relations extracted from the truncated TBA equations. For a consistency check, we compute next-leading order corrections of the vacuum energy and extract the S-matrix information in the IR limit. We also solved the NLIE both analytically and numerically in the UV limit to get the effective central charge and compared with that of the zero-mode dynamics to obtain exact relation between ν and λ. Dedicated to the memory of Petr Petrovich Kulish.

  12. Generating Nonnormal Multivariate Data Using Copulas: Applications to SEM

    ERIC Educational Resources Information Center

    Mair, Patrick; Satorra, Albert; Bentler, Peter M.

    2012-01-01

    This article develops a procedure based on copulas to simulate multivariate nonnormal data that satisfy a prespecified variance-covariance matrix. The covariance matrix used can comply with a specific moment structure form (e.g., a factor analysis or a general structural equation model). Thus, the method is particularly useful for Monte Carlo…

  13. Improvement of structural models using covariance analysis and nonlinear generalized least squares

    NASA Technical Reports Server (NTRS)

    Glaser, R. J.; Kuo, C. P.; Wada, B. K.

    1992-01-01

    The next generation of large, flexible space structures will be too light to support their own weight, requiring a system of structural supports for ground testing. The authors have proposed multiple boundary-condition testing (MBCT), using more than one support condition to reduce uncertainties associated with the supports. MBCT would revise the mass and stiffness matrix, analytically qualifying the structure for operation in space. The same procedure is applicable to other common test conditions, such as empty/loaded tanks and subsystem/system level tests. This paper examines three techniques for constructing the covariance matrix required by nonlinear generalized least squares (NGLS) to update structural models based on modal test data. The methods range from a complicated approach used to generate the simulation data (i.e., the correct answer) to a diagonal matrix based on only two constants. The results show that NGLS is very insensitive to assumptions about the covariance matrix, suggesting that a workable NGLS procedure is possible. The examples also indicate that the multiple boundary condition procedure more accurately reduces errors than individual boundary condition tests alone.

  14. On the matrix Fourier filtering problem for a class of models of nonlinear optical systems with a feedback

    NASA Astrophysics Data System (ADS)

    Razgulin, A. V.; Sazonova, S. V.

    2017-09-01

    A novel statement of the Fourier filtering problem based on the use of matrix Fourier filters instead of conventional multiplier filters is considered. The basic properties of the matrix Fourier filtering for the filters in the Hilbert-Schmidt class are established. It is proved that the solutions with a finite energy to the periodic initial boundary value problem for the quasi-linear functional differential diffusion equation with the matrix Fourier filtering Lipschitz continuously depend on the filter. The problem of optimal matrix Fourier filtering is formulated, and its solvability for various classes of matrix Fourier filters is proved. It is proved that the objective functional is differentiable with respect to the matrix Fourier filter, and the convergence of a version of the gradient projection method is also proved.

  15. Unitarity of the Cabibbo-Kobayashi-Maskawa matrix and a nonuniversal gauge interaction model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Kang Young

    2007-12-01

    Recent measurements of |V{sub us}| from kaon decays strongly support the unitarity of the Cabibbo-Kobayashi-Maskawa matrix. The unitarity provides a stringent constraint on the parameter space of the nonuniversal gauge interaction model based on the separate SU(2){sub L} gauge group acting on the third generation fermions. I show that this constraint is stronger than those from the CERN LEP and SLC data and low-energy experiment data.

  16. Diagonalization of transfer matrix of supersymmetry U{sub q}(sl-caret(M+1|N+1)) chain with a boundary

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kojima, Takeo

    2013-04-15

    We study the supersymmetry U{sub q}(sl-caret(M+1|N+1)) analogue of the supersymmetric t-J model with a boundary. Our approach is based on the algebraic analysis method of solvable lattice models. We diagonalize the commuting transfer matrix by using the bosonizations of the vertex operators associated with the quantum affine supersymmetry U{sub q}(sl-caret(M+1|N+1)).

  17. Dynamic SPECT reconstruction from few projections: a sparsity enforced matrix factorization approach

    NASA Astrophysics Data System (ADS)

    Ding, Qiaoqiao; Zan, Yunlong; Huang, Qiu; Zhang, Xiaoqun

    2015-02-01

    The reconstruction of dynamic images from few projection data is a challenging problem, especially when noise is present and when the dynamic images are vary fast. In this paper, we propose a variational model, sparsity enforced matrix factorization (SEMF), based on low rank matrix factorization of unknown images and enforced sparsity constraints for representing both coefficients and bases. The proposed model is solved via an alternating iterative scheme for which each subproblem is convex and involves the efficient alternating direction method of multipliers (ADMM). The convergence of the overall alternating scheme for the nonconvex problem relies upon the Kurdyka-Łojasiewicz property, recently studied by Attouch et al (2010 Math. Oper. Res. 35 438) and Attouch et al (2013 Math. Program. 137 91). Finally our proof-of-concept simulation on 2D dynamic images shows the advantage of the proposed method compared to conventional methods.

  18. Quantitative analysis of ultrasonic images of fibrotic liver using co-occurrence matrix based on multi-Rayleigh model

    NASA Astrophysics Data System (ADS)

    Isono, Hiroshi; Hirata, Shinnosuke; Hachiya, Hiroyuki

    2015-07-01

    In medical ultrasonic images of liver disease, a texture with a speckle pattern indicates a microscopic structure such as nodules surrounded by fibrous tissues in hepatitis or cirrhosis. We have been applying texture analysis based on a co-occurrence matrix to ultrasonic images of fibrotic liver for quantitative tissue characterization. A co-occurrence matrix consists of the probability distribution of brightness of pixel pairs specified with spatial parameters and gives new information on liver disease. Ultrasonic images of different types of fibrotic liver were simulated and the texture-feature contrast was calculated to quantify the co-occurrence matrices generated from the images. The results show that the contrast converges with a value that can be theoretically estimated using a multi-Rayleigh model of echo signal amplitude distribution. We also found that the contrast value increases as liver fibrosis progresses and fluctuates depending on the size of fibrotic structure.

  19. Multi-cut solutions in Chern-Simons matrix models

    NASA Astrophysics Data System (ADS)

    Morita, Takeshi; Sugiyama, Kento

    2018-04-01

    We elaborate the Chern-Simons (CS) matrix models at large N. The saddle point equations of these matrix models have a curious structure which cannot be seen in the ordinary one matrix models. Thanks to this structure, an infinite number of multi-cut solutions exist in the CS matrix models. Particularly we exactly derive the two-cut solutions at finite 't Hooft coupling in the pure CS matrix model. In the ABJM matrix model, we argue that some of multi-cut solutions might be interpreted as a condensation of the D2-brane instantons.

  20. On the Numerical Formulation of Parametric Linear Fractional Transformation (LFT) Uncertainty Models for Multivariate Matrix Polynomial Problems

    NASA Technical Reports Server (NTRS)

    Belcastro, Christine M.

    1998-01-01

    Robust control system analysis and design is based on an uncertainty description, called a linear fractional transformation (LFT), which separates the uncertain (or varying) part of the system from the nominal system. These models are also useful in the design of gain-scheduled control systems based on Linear Parameter Varying (LPV) methods. Low-order LFT models are difficult to form for problems involving nonlinear parameter variations. This paper presents a numerical computational method for constructing and LFT model for a given LPV model. The method is developed for multivariate polynomial problems, and uses simple matrix computations to obtain an exact low-order LFT representation of the given LPV system without the use of model reduction. Although the method is developed for multivariate polynomial problems, multivariate rational problems can also be solved using this method by reformulating the rational problem into a polynomial form.

  1. Model Development for Risk Assessment of Driving on Freeway under Rainy Weather Conditions

    PubMed Central

    Cai, Xiaonan; Wang, Chen; Chen, Shengdi; Lu, Jian

    2016-01-01

    Rainy weather conditions could result in significantly negative impacts on driving on freeways. However, due to lack of enough historical data and monitoring facilities, many regions are not able to establish reliable risk assessment models to identify such impacts. Given the situation, this paper provides an alternative solution where the procedure of risk assessment is developed based on drivers’ subjective questionnaire and its performance is validated by using actual crash data. First, an ordered logit model was developed, based on questionnaire data collected from Freeway G15 in China, to estimate the relationship between drivers’ perceived risk and factors, including vehicle type, rain intensity, traffic volume, and location. Then, weighted driving risk for different conditions was obtained by the model, and further divided into four levels of early warning (specified by colors) using a rank order cluster analysis. After that, a risk matrix was established to determine which warning color should be disseminated to drivers, given a specific condition. Finally, to validate the proposed procedure, actual crash data from Freeway G15 were compared with the safety prediction based on the risk matrix. The results show that the risk matrix obtained in the study is able to predict driving risk consistent with actual safety implications, under rainy weather conditions. PMID:26894434

  2. Optimization of Residual Stresses in MMC's through Process Parameter Control and the use of Heterogeneous Compensating/Compliant Interfacial Layers. OPTCOMP2 User's Guide

    NASA Technical Reports Server (NTRS)

    Pindera, Marek-Jerzy; Salzar, Robert S.

    1996-01-01

    A user's guide for the computer program OPTCOMP2 is presented in this report. This program provides a capability to optimize the fabrication or service-induced residual stresses in unidirectional metal matrix composites subjected to combined thermomechanical axisymmetric loading by altering the processing history, as well as through the microstructural design of interfacial fiber coatings. The user specifies the initial architecture of the composite and the load history, with the constituent materials being elastic, plastic, viscoplastic, or as defined by the 'user-defined' constitutive model, in addition to the objective function and constraints, through a user-friendly data input interface. The optimization procedure is based on an efficient solution methodology for the inelastic response of a fiber/interface layer(s)/matrix concentric cylinder model where the interface layers can be either homogeneous or heterogeneous. The response of heterogeneous layers is modeled using Aboudi's three-dimensional method of cells micromechanics model. The commercial optimization package DOT is used for the nonlinear optimization problem. The solution methodology for the arbitrarily layered cylinder is based on the local-global stiffness matrix formulation and Mendelson's iterative technique of successive elastic solutions developed for elastoplastic boundary-value problems. The optimization algorithm employed in DOT is based on the method of feasible directions.

  3. Study on the noncoincidence effect phenomenon using matrix isolated Raman spectra and the proposed structural organization model of acetone in condense phase

    NASA Astrophysics Data System (ADS)

    Xu, Wenwen; Wu, Fengqi; Zhao, Yanying; Zhou, Ran; Wang, Huigang; Zheng, Xuming; Ni, Bukuo

    2017-03-01

    The isotropic and anisotropic Raman spectra of acetone and deuterated acetone isolated in an argon matrix have been recorded for the understanding of noncoincidence effect (NCE) phenomenon. According to the matrix isolated Raman spectra and DFT calculations, we proposed aggregated model for the explanations of the acetone C=O vibration NCE phenomenon and its concentration effect. The experimental data were in consistence with the DFT calculations performed at the B3LYP-D3/6-311 G (d,p) levels based on the proposed model. The experimental identification of the monomer, dimer and trimer are reported here, and the dynamic of the transformation from monomer to aggregated structure can be easily controlled by tuning annealing temperature.

  4. Study of laser cooling in deep optical lattice: two-level quantum model

    NASA Astrophysics Data System (ADS)

    Prudnikov, O. N.; Il'enkov, R. Ya.; Taichenachev, A. V.; Yudin, V. I.; Rasel, E. M.

    2018-01-01

    We study a possibility of laser cooling of 24Mg atoms in deep optical lattice formed by intense off-resonant laser field in a presence of cooling field resonant to narrow (3s3s) 1 S 0 → (3s3p)3 P 1 (λ = 457 nm) optical transition. For description of laser cooling with taking into account quantum recoil effects we consider two quantum models. The first one is based on direct numerical solution of quantum kinetic equation for atom density matrix and the second one is simplified model based on decomposition of atom density matrix over vibration states in the lattice wells. We search cooling field intensity and detuning for minimum cooling energy and fast laser cooling.

  5. A new fast direct solver for the boundary element method

    NASA Astrophysics Data System (ADS)

    Huang, S.; Liu, Y. J.

    2017-09-01

    A new fast direct linear equation solver for the boundary element method (BEM) is presented in this paper. The idea of the new fast direct solver stems from the concept of the hierarchical off-diagonal low-rank matrix. The hierarchical off-diagonal low-rank matrix can be decomposed into the multiplication of several diagonal block matrices. The inverse of the hierarchical off-diagonal low-rank matrix can be calculated efficiently with the Sherman-Morrison-Woodbury formula. In this paper, a more general and efficient approach to approximate the coefficient matrix of the BEM with the hierarchical off-diagonal low-rank matrix is proposed. Compared to the current fast direct solver based on the hierarchical off-diagonal low-rank matrix, the proposed method is suitable for solving general 3-D boundary element models. Several numerical examples of 3-D potential problems with the total number of unknowns up to above 200,000 are presented. The results show that the new fast direct solver can be applied to solve large 3-D BEM models accurately and with better efficiency compared with the conventional BEM.

  6. UTOPIAN: user-driven topic modeling based on interactive nonnegative matrix factorization.

    PubMed

    Choo, Jaegul; Lee, Changhyun; Reddy, Chandan K; Park, Haesun

    2013-12-01

    Topic modeling has been widely used for analyzing text document collections. Recently, there have been significant advancements in various topic modeling techniques, particularly in the form of probabilistic graphical modeling. State-of-the-art techniques such as Latent Dirichlet Allocation (LDA) have been successfully applied in visual text analytics. However, most of the widely-used methods based on probabilistic modeling have drawbacks in terms of consistency from multiple runs and empirical convergence. Furthermore, due to the complicatedness in the formulation and the algorithm, LDA cannot easily incorporate various types of user feedback. To tackle this problem, we propose a reliable and flexible visual analytics system for topic modeling called UTOPIAN (User-driven Topic modeling based on Interactive Nonnegative Matrix Factorization). Centered around its semi-supervised formulation, UTOPIAN enables users to interact with the topic modeling method and steer the result in a user-driven manner. We demonstrate the capability of UTOPIAN via several usage scenarios with real-world document corpuses such as InfoVis/VAST paper data set and product review data sets.

  7. A new estimation of equivalent matrix block sizes in fractured media with two-phase flow applications in dual porosity models

    NASA Astrophysics Data System (ADS)

    Jerbi, Chahir; Fourno, André; Noetinger, Benoit; Delay, Frederick

    2017-05-01

    Single and multiphase flows in fractured porous media at the scale of natural reservoirs are often handled by resorting to homogenized models that avoid the heavy computations associated with a complete discretization of both fractures and matrix blocks. For example, the two overlapping continua (fractures and matrix) of a dual porosity system are coupled by way of fluid flux exchanges that deeply condition flow at the large scale. This characteristic is a key to realistic flow simulations, especially for multiphase flow as capillary forces and contrasts of fluid mobility compete in the extraction of a fluid from a capacitive matrix then conveyed through the fractures. The exchange rate between fractures and matrix is conditioned by the so-called mean matrix block size which can be viewed as the size of a single matrix block neighboring a single fracture within a mesh of a dual porosity model. We propose a new evaluation of this matrix block size based on the analysis of discrete fracture networks. The fundaments rely upon establishing at the scale of a fractured block the equivalence between the actual fracture network and a Warren and Root network only made of three regularly spaced fracture families parallel to the facets of the fractured block. The resulting matrix block sizes are then compared via geometrical considerations and two-phase flow simulations to the few other available methods. It is shown that the new method is stable in the sense it provides accurate sizes irrespective of the type of fracture network investigated. The method also results in two-phase flow simulations from dual porosity models very close to that from references calculated in finely discretized networks. Finally, calculations of matrix block sizes by this new technique reveal very rapid, which opens the way to cumbersome applications such as preconditioning a dual porosity approach applied to regional fractured reservoirs.

  8. Dissolution behavior of MgO based inert matrix fuel for the transmutation of minor actinides

    NASA Astrophysics Data System (ADS)

    Mühr-Ebert, E. L.; Lichte, E.; Bukaemskiy, A.; Finkeldei, S.; Klinkenberg, M.; Brandt, F.; Bosbach, D.; Modolo, G.

    2018-07-01

    This study explores the dissolution properties of magnesia-based inert matrix nuclear fuel (IMF) containing transuranium elements (TRU). Pure MgO pellets as well as MgO pellets containing CeO2, as surrogate for TRU oxides, and are considered as model systems for genuine magnesia based inert matrix fuel were fabricated. The aim of this study is to identify conditions at which the matrix material can be selectively dissolved during the head-end reprocessing step, allowing a separation of MgO from the actinides, whereas the actinides remain undissolved. The dissolution behavior was studied in macroscopic batch experiments as a function of nitric acid concentration, dissolution medium volume, temperature, stirring velocity, and pellet density (85, 90, 96, and 99%TD). To mimic pellets with various burn-ups the density of the here fabricated pellets was varied. MgO is soluble even under mild conditions (RT, 2.5 mol/L HNO3). The dissolution rates of MgO at different acid concentrations are rather similar, whereas the dissolution rate is strongly dependent on the temperature. Via a microscopic approach, a model was developed to describe the evolution of the pellet surface area during dissolution and determine a surface normalized dissolution rate. Moreover, dissolution rates of the inert matrix fuel containing CeO2 were determined as a function of the acid concentration and temperature. During the dissolution of MgO/CeO2 pellets the MgO dissolves completely, while CeO2 (>99%) remains undissolved. This study intends to provide a profound understanding of the chemical performance of magnesia based IMF containing fissile material. The feasibility of the dissolution of magnesia based IMF with nitric acid is discussed.

  9. Observability Analysis of a Matrix Kalman Filter-Based Navigation System Using Visual/Inertial/Magnetic Sensors

    PubMed Central

    Feng, Guohu; Wu, Wenqi; Wang, Jinling

    2012-01-01

    A matrix Kalman filter (MKF) has been implemented for an integrated navigation system using visual/inertial/magnetic sensors. The MKF rearranges the original nonlinear process model in a pseudo-linear process model. We employ the observability rank criterion based on Lie derivatives to verify the conditions under which the nonlinear system is observable. It has been proved that such observability conditions are: (a) at least one degree of rotational freedom is excited, and (b) at least two linearly independent horizontal lines and one vertical line are observed. Experimental results have validated the correctness of these observability conditions. PMID:23012523

  10. Suspension parameter estimation in the frequency domain using a matrix inversion approach

    NASA Astrophysics Data System (ADS)

    Thite, A. N.; Banvidi, S.; Ibicek, T.; Bennett, L.

    2011-12-01

    The dynamic lumped parameter models used to optimise the ride and handling of a vehicle require base values of the suspension parameters. These parameters are generally experimentally identified. The accuracy of identified parameters can depend on the measurement noise and the validity of the model used. The existing publications on suspension parameter identification are generally based on the time domain and use a limited degree of freedom. Further, the data used are either from a simulated 'experiment' or from a laboratory test on an idealised quarter or a half-car model. In this paper, a method is developed in the frequency domain which effectively accounts for the measurement noise. Additional dynamic constraining equations are incorporated and the proposed formulation results in a matrix inversion approach. The nonlinearities in damping are estimated, however, using a time-domain approach. Full-scale 4-post rig test data of a vehicle are used. The variations in the results are discussed using the modal resonant behaviour. Further, a method is implemented to show how the results can be improved when the matrix inverted is ill-conditioned. The case study shows a good agreement between the estimates based on the proposed frequency-domain approach and measurable physical parameters.

  11. Modeling stiffness loss in boron/aluminum below the fatigue limit

    NASA Technical Reports Server (NTRS)

    Johnson, W. S.

    1982-01-01

    Boron/aluminum can develop significant internal matrix cracking when fatigued. These matrix cracks can result in a 40 percent secant modulus loss in some laminates, even when fatigued below the fatigue limit. It is shown that the same amount of fatigue damage will develop during stress or strain-controlled tests. Stacking sequence has little influence on secant modulus loss. The secant modulus loss in unidirectional composites is small, whereas the losses are substantial in laminates containing off-axis plies. A simple analysis is presented that predicts unnotched laminate secant modulus loss due to fatigue. The analysis is based upon the elastic modulus and Poisson's ratio of the fiber and matrix, fiber volume fraction, fiber orientations, and the cyclic-hardened yield stress of the matrix material. Excellent agreement was achieved between model predictions and experimental results. With this model, designers can project the material stiffness loss for design load or strain levels and assess the feasibility of its use in stiffness-critical parts.

  12. Overcoming Challenges in Kinetic Modeling of Magnetized Plasmas and Vacuum Electronic Devices

    NASA Astrophysics Data System (ADS)

    Omelchenko, Yuri; Na, Dong-Yeop; Teixeira, Fernando

    2017-10-01

    We transform the state-of-the art of plasma modeling by taking advantage of novel computational techniques for fast and robust integration of multiscale hybrid (full particle ions, fluid electrons, no displacement current) and full-PIC models. These models are implemented in 3D HYPERS and axisymmetric full-PIC CONPIC codes. HYPERS is a massively parallel, asynchronous code. The HYPERS solver does not step fields and particles synchronously in time but instead executes local variable updates (events) at their self-adaptive rates while preserving fundamental conservation laws. The charge-conserving CONPIC code has a matrix-free explicit finite-element (FE) solver based on a sparse-approximate inverse (SPAI) algorithm. This explicit solver approximates the inverse FE system matrix (``mass'' matrix) using successive sparsity pattern orders of the original matrix. It does not reduce the set of Maxwell's equations to a vector-wave (curl-curl) equation of second order but instead utilizes the standard coupled first-order Maxwell's system. We discuss the ability of our codes to accurately and efficiently account for multiscale physical phenomena in 3D magnetized space and laboratory plasmas and axisymmetric vacuum electronic devices.

  13. Quantification of 2D elemental distribution maps of intermediate-thick biological sections by low energy synchrotron μ-X-ray fluorescence spectrometry

    NASA Astrophysics Data System (ADS)

    Kump, P.; Vogel-Mikuš, K.

    2018-05-01

    Two fundamental-parameter (FP) based models for quantification of 2D elemental distribution maps of intermediate-thick biological samples by synchrotron low energy μ-X-ray fluorescence spectrometry (SR-μ-XRF) are presented and applied to the elemental analysis in experiments with monochromatic focused photon beam excitation at two low energy X-ray fluorescence beamlines—TwinMic, Elettra Sincrotrone Trieste, Italy, and ID21, ESRF, Grenoble, France. The models assume intermediate-thick biological samples composed of measured elements, the sources of the measurable spectral lines, and by the residual matrix, which affects the measured intensities through absorption. In the first model a fixed residual matrix of the sample is assumed, while in the second model the residual matrix is obtained by the iteration refinement of elemental concentrations and an adjusted residual matrix. The absorption of the incident focused beam in the biological sample at each scanned pixel position, determined from the output of a photodiode or a CCD camera, is applied as a control in the iteration procedure of quantification.

  14. Kernel analysis of partial least squares (PLS) regression models.

    PubMed

    Shinzawa, Hideyuki; Ritthiruangdej, Pitiporn; Ozaki, Yukihiro

    2011-05-01

    An analytical technique based on kernel matrix representation is demonstrated to provide further chemically meaningful insight into partial least squares (PLS) regression models. The kernel matrix condenses essential information about scores derived from PLS or principal component analysis (PCA). Thus, it becomes possible to establish the proper interpretation of the scores. A PLS model for the total nitrogen (TN) content in multiple Thai fish sauces is built with a set of near-infrared (NIR) transmittance spectra of the fish sauce samples. The kernel analysis of the scores effectively reveals that the variation of the spectral feature induced by the change in protein content is substantially associated with the total water content and the protein hydration. Kernel analysis is also carried out on a set of time-dependent infrared (IR) spectra representing transient evaporation of ethanol from a binary mixture solution of ethanol and oleic acid. A PLS model to predict the elapsed time is built with the IR spectra and the kernel matrix is derived from the scores. The detailed analysis of the kernel matrix provides penetrating insight into the interaction between the ethanol and the oleic acid.

  15. Stochastic-Strength-Based Damage Simulation Tool for Ceramic Matrix and Polymer Matrix Composite Structures

    NASA Technical Reports Server (NTRS)

    Nemeth, Noel N.; Bednarcyk, Brett A.; Pineda, Evan J.; Walton, Owen J.; Arnold, Steven M.

    2016-01-01

    Stochastic-based, discrete-event progressive damage simulations of ceramic-matrix composite and polymer matrix composite material structures have been enabled through the development of a unique multiscale modeling tool. This effort involves coupling three independently developed software programs: (1) the Micromechanics Analysis Code with Generalized Method of Cells (MAC/GMC), (2) the Ceramics Analysis and Reliability Evaluation of Structures Life Prediction Program (CARES/ Life), and (3) the Abaqus finite element analysis (FEA) program. MAC/GMC contributes multiscale modeling capabilities and micromechanics relations to determine stresses and deformations at the microscale of the composite material repeating unit cell (RUC). CARES/Life contributes statistical multiaxial failure criteria that can be applied to the individual brittle-material constituents of the RUC. Abaqus is used at the global scale to model the overall composite structure. An Abaqus user-defined material (UMAT) interface, referred to here as "FEAMAC/CARES," was developed that enables MAC/GMC and CARES/Life to operate seamlessly with the Abaqus FEA code. For each FEAMAC/CARES simulation trial, the stochastic nature of brittle material strength results in random, discrete damage events, which incrementally progress and lead to ultimate structural failure. This report describes the FEAMAC/CARES methodology and discusses examples that illustrate the performance of the tool. A comprehensive example problem, simulating the progressive damage of laminated ceramic matrix composites under various off-axis loading conditions and including a double notched tensile specimen geometry, is described in a separate report.

  16. An analysis of fiber-matrix interface failure stresses for a range of ply stress states

    NASA Technical Reports Server (NTRS)

    Crews, J. H.; Naik, R. A.; Lubowinski, S. J.

    1993-01-01

    A graphite/bismaleimide laminate was prepared without the usual fiber treatment and was tested over a wide range of stress states to measure its ply cracking strength. These tests were conducted using off-axis flexure specimens and produced fiber-matrix interface failure data over a correspondingly wide range of interface stress states. The absence of fiber treatment, weakened the fiber-matrix interfaces and allowed these tests to be conducted at load levels that did not yield the matrix. An elastic micromechanics computer code was used to calculate the fiber-matrix interface stresses at failure. Two different fiber-array models (square and diamond) were used in these calculations to analyze the effects of fiber arrangement as well as stress state on the critical interface stresses at failure. This study showed that both fiber-array models were needed to analyze interface stresses over the range of stress states. A linear equation provided a close fit to these critical stress combinations and, thereby, provided a fiber-matrix interface failure criterion. These results suggest that prediction procedures for laminate ply cracking can be based on micromechanics stress analyses and appropriate fiber-matrix interface failure criteria. However, typical structural laminates may require elastoplastic stress analysis procedures that account for matrix yielding, especially for shear-dominated ply stress states.

  17. Influence of yield surface curvature on the macroscopic yielding and ductile failure of isotropic porous plastic materials

    NASA Astrophysics Data System (ADS)

    Dæhli, Lars Edvard Bryhni; Morin, David; Børvik, Tore; Hopperstad, Odd Sture

    2017-10-01

    Numerical unit cell models of an approximative representative volume element for a porous ductile solid are utilized to investigate differences in the mechanical response between a quadratic and a non-quadratic matrix yield surface. A Hershey equivalent stress measure with two distinct values of the yield surface exponent is employed as the matrix description. Results from the unit cell calculations are further used to calibrate a heuristic extension of the Gurson model which incorporates effects of the third deviatoric stress invariant. An assessment of the porous plasticity model reveals its ability to describe the unit cell response to some extent, however underestimating the effect of the Lode parameter for the lower triaxiality ratios imposed in this study when compared to unit cell simulations. Ductile failure predictions by means of finite element simulations using a unit cell model that resembles an imperfection band are then conducted to examine how the non-quadratic matrix yield surface influences the failure strain as compared to the quadratic matrix yield surface. Further, strain localization predictions based on bifurcation analyses and imperfection band analyses are undertaken using the calibrated porous plasticity model. These simulations are then compared to the unit cell calculations in order to elucidate the differences between the various modelling strategies. The current study reveals that strain localization analyses using an imperfection band model and a spatially discretized unit cell are in reasonable agreement, while the bifurcation analyses predict higher strain levels at localization. Imperfection band analyses are finally used to calculate failure loci for the quadratic and the non-quadratic matrix yield surface under a wide range of loading conditions. The underlying matrix yield surface is demonstrated to have a pronounced influence on the onset of strain localization.

  18. Assessing the performance of regional landslide early warning models: the EDuMaP method

    NASA Astrophysics Data System (ADS)

    Calvello, M.; Piciullo, L.

    2016-01-01

    A schematic of the components of regional early warning systems for rainfall-induced landslides is herein proposed, based on a clear distinction between warning models and warning systems. According to this framework an early warning system comprises a warning model as well as a monitoring and warning strategy, a communication strategy and an emergency plan. The paper proposes the evaluation of regional landslide warning models by means of an original approach, called the "event, duration matrix, performance" (EDuMaP) method, comprising three successive steps: identification and analysis of the events, i.e., landslide events and warning events derived from available landslides and warnings databases; definition and computation of a duration matrix, whose elements report the time associated with the occurrence of landslide events in relation to the occurrence of warning events, in their respective classes; evaluation of the early warning model performance by means of performance criteria and indicators applied to the duration matrix. During the first step the analyst identifies and classifies the landslide and warning events, according to their spatial and temporal characteristics, by means of a number of model parameters. In the second step, the analyst computes a time-based duration matrix with a number of rows and columns equal to the number of classes defined for the warning and landslide events, respectively. In the third step, the analyst computes a series of model performance indicators derived from a set of performance criteria, which need to be defined by considering, once again, the features of the warning model. The applicability, potentialities and limitations of the EDuMaP method are tested and discussed using real landslides and warning data from the municipal early warning system operating in Rio de Janeiro (Brazil).

  19. A continuum model for damage evolution in laminated composites

    NASA Technical Reports Server (NTRS)

    Lo, D. C.; Allen, D. H.; Harris, C. E.

    1991-01-01

    The accumulation of matrix cracking is examined using continuum damage mechanics lamination theory. A phenomenologically based damage evolutionary relationship is proposed for matrix cracking in continuous fiber reinforced laminated composites. The use of material dependent properties and damage dependent laminate averaged ply stresses in this evolutionary relationship permits its application independently of the laminate stacking sequence. Several load histories are applied to crossply laminates using this model, and the results are compared to published experimental data. The stress redistribution among the plies during the accumulation of matrix damage is also examined. It is concluded that characteristics of the stress redistribution process could assist in the analysis of the progressive failure process in laminated composites.

  20. Mueller-matrix mapping of biological tissues in differential diagnosis of optical anisotropy mechanisms of protein networks

    NASA Astrophysics Data System (ADS)

    Ushenko, V. A.; Sidor, M. I.; Marchuk, Yu F.; Pashkovskaya, N. V.; Andreichuk, D. R.

    2015-03-01

    We report a model of Mueller-matrix description of optical anisotropy of protein networks in biological tissues with allowance for the linear birefringence and dichroism. The model is used to construct the reconstruction algorithms of coordinate distributions of phase shifts and the linear dichroism coefficient. In the statistical analysis of such distributions, we have found the objective criteria of differentiation between benign and malignant tissues of the female reproductive system. From the standpoint of evidence-based medicine, we have determined the operating characteristics (sensitivity, specificity and accuracy) of the Mueller-matrix reconstruction method of optical anisotropy parameters and demonstrated its effectiveness in the differentiation of benign and malignant tumours.

  1. Azimuth-invariant mueller-matrix differentiation of the optical anisotropy of biological tissues

    NASA Astrophysics Data System (ADS)

    Ushenko, V. A.; Sidor, M. I.; Marchuk, Yu. F.; Pashkovskaya, N. V.; Andreichuk, D. R.

    2014-07-01

    A Mueller-matrix model is proposed for analysis of the optical anisotropy of protein networks of optically thin nondepolarizing layers of biological tissues with allowance for birefringence and dichroism. The model is used to construct algorithms for reconstruction of coordinate distributions of phase shifts and coefficient of linear dichroism. Objective criteria for differentiation of benign and malignant tissues of female genitals are formulated in the framework of the statistical analysis of such distributions. Approaches of evidence-based medicine are used to determine the working characteristics (sensitivity, specificity, and accuracy) of the Mueller-matrix method for the reconstruction of the parameters of optical anisotropy and show its efficiency in the differentiation of benign and malignant tumors.

  2. Thermotropic phase transitions in model membranes of the outer skin layer based on ceramide 6

    NASA Astrophysics Data System (ADS)

    Gruzinov, A. Yu.; Kiselev, M. A.; Ermakova, E. V.; Zabelin, A. V.

    2014-01-01

    The lipid intercellular matrix stratum corneum of the outer skin layer is a multilayer membrane consisting of a complex mixture of different lipids: ceramides, fatty acids, cholesterol, and its derivatives. The basis of the multilayer membrane is the lipid bilayer, i.e., a two-dimensional liquid crystal. Currently, it is known that the main way of substance penetration through the skin is the lipid matrix. The complexity of the actual biological system does not allow reliable direct study of its properties; therefore, system modeling is often used. Phase transitions in the lipid system whose composition simulates the native lipid matrix are studied by the X-ray synchrotron radiation diffraction method.

  3. Modeling Geometry and Progressive Failure of Material Interfaces in Plain Weave Composites

    NASA Technical Reports Server (NTRS)

    Hsu, Su-Yuen; Cheng, Ron-Bin

    2010-01-01

    A procedure combining a geometrically nonlinear, explicit-dynamics contact analysis, computer aided design techniques, and elasticity-based mesh adjustment is proposed to efficiently generate realistic finite element models for meso-mechanical analysis of progressive failure in textile composites. In the procedure, the geometry of fiber tows is obtained by imposing a fictitious expansion on the tows. Meshes resulting from the procedure are conformal with the computed tow-tow and tow-matrix interfaces but are incongruent at the interfaces. The mesh interfaces are treated as cohesive contact surfaces not only to resolve the incongruence but also to simulate progressive failure. The method is employed to simulate debonding at the material interfaces in a ceramic-matrix plain weave composite with matrix porosity and in a polymeric matrix plain weave composite without matrix porosity, both subject to uniaxial cyclic loading. The numerical results indicate progression of the interfacial damage during every loading and reverse loading event in a constant strain amplitude cyclic process. However, the composites show different patterns of damage advancement.

  4. Effect of Magnetic Inclusions on the Effective Magnetostriction of Bulk Superconductors

    NASA Astrophysics Data System (ADS)

    Zhao, Yufeng; Pan, Baocai; Liu, Zhiguo

    2018-07-01

    A simple model is presented based on the Kim-Anderson model to further investigate the dependence of the effective magnetostriction of magnetic inclusion-superconducting matrix system on both the elastic and magnetic parameters including the elastic modulus, permeability, and volume fraction. The effect of the permeability on the magnetostriction is also obtained by implementing the continuity conditions of displacement and strain at the interface between the inclusion and the matrix through the magnetostriction loop. The results indicate that a stiffer inclusion can decrease the effective magnetostriction no matter whether the inclusion is magnetic or not and a larger effective magnetostriction can be obtained by choosing the matrix with a higher permeability, which gives an explanation about why the composite made from a matrix with a high permeability but a negligibly small magnetostriction yields unexpectedly low magnetostriction. Of particular interest is that in a certain range the effective magnetostriction of composites can be enhanced until it is saturated by increasing the permeability of matrix.

  5. Effects of fiber and interfacial layer architectures on the thermoplastic response of metal matrix composites

    NASA Technical Reports Server (NTRS)

    Pindera, Marek-Jerzy; Freed, Alan D.; Arnold, Steven M.

    1992-01-01

    Examined here is the effect of fiber and interfacial layer morphologies on thermal fields in metal matrix composites (MMCs). A micromechanics model based on an arbitrarily layered concentric cylinder configuration is used to calculate thermal stress fields in MMCs subjected to spatially uniform temperature changes. The fiber is modelled as a layered material with isotropic or orthotropic elastic layers, whereas the surrounding matrix, including interfacial layers, is treated as a strain-hardening, elastoplastic, von Mises solid with temperature-dependent parameters. The solution to the boundary-value problem of an arbitrarily layered concentric cylinder under the prescribed thermal loading is obtained using the local/global stiffness matrix formulation originally developed for stress analysis of multilayered elastic media. Examples are provided that illustrate how the morphology of the SCS6 silicon carbide fiber and the use of multiple compliant layers at the fiber/matrix interface affect the evolution of residual stresses in SiC/Ti composites during fabrication cool-down.

  6. A Hybrid Algorithm for Non-negative Matrix Factorization Based on Symmetric Information Divergence

    PubMed Central

    Devarajan, Karthik; Ebrahimi, Nader; Soofi, Ehsan

    2017-01-01

    The objective of this paper is to provide a hybrid algorithm for non-negative matrix factorization based on a symmetric version of Kullback-Leibler divergence, known as intrinsic information. The convergence of the proposed algorithm is shown for several members of the exponential family such as the Gaussian, Poisson, gamma and inverse Gaussian models. The speed of this algorithm is examined and its usefulness is illustrated through some applied problems. PMID:28868206

  7. Centralized PI control for high dimensional multivariable systems based on equivalent transfer function.

    PubMed

    Luan, Xiaoli; Chen, Qiang; Liu, Fei

    2014-09-01

    This article presents a new scheme to design full matrix controller for high dimensional multivariable processes based on equivalent transfer function (ETF). Differing from existing ETF method, the proposed ETF is derived directly by exploiting the relationship between the equivalent closed-loop transfer function and the inverse of open-loop transfer function. Based on the obtained ETF, the full matrix controller is designed utilizing the existing PI tuning rules. The new proposed ETF model can more accurately represent the original processes. Furthermore, the full matrix centralized controller design method proposed in this paper is applicable to high dimensional multivariable systems with satisfactory performance. Comparison with other multivariable controllers shows that the designed ETF based controller is superior with respect to design-complexity and obtained performance. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  8. Report of the LSPI/NASA Workshop on Lunar Base Methodology Development

    NASA Technical Reports Server (NTRS)

    Nozette, Stewart; Roberts, Barney

    1985-01-01

    Groundwork was laid for computer models which will assist in the design of a manned lunar base. The models, herein described, will provide the following functions for the successful conclusion of that task: strategic planning; sensitivity analyses; impact analyses; and documentation. Topics addressed include: upper level model description; interrelationship matrix; user community; model features; model descriptions; system implementation; model management; and plans for future action.

  9. Stage-Structured Population Dynamics of AEDES AEGYPTI

    NASA Astrophysics Data System (ADS)

    Yusoff, Nuraini; Budin, Harun; Ismail, Salemah

    Aedes aegypti is the main vector in the transmission of dengue fever, a vector-borne disease affecting world population living in tropical and sub-tropical countries. Better understanding of the dynamics of its population growth will help in the efforts of controlling the spread of this disease. In looking at the population dynamics of Aedes aegypti, this paper explored the stage-structured modeling of the population growth of the mosquito using the matrix population model. The life cycle of the mosquito was divided into five stages: eggs, larvae, pupae, adult1 and adult2. Developmental rates were obtained for the average Malaysian temperature and these were used in constructing the transition matrix for the matrix model. The model, which was based only on temperature, projected that the population of Aedes aegypti will blow up with time, which is not realistic. For further work, other factors need to be taken into account to obtain a more realistic result.

  10. An efficient hydro-mechanical model for coupled multi-porosity and discrete fracture porous media

    NASA Astrophysics Data System (ADS)

    Yan, Xia; Huang, Zhaoqin; Yao, Jun; Li, Yang; Fan, Dongyan; Zhang, Kai

    2018-02-01

    In this paper, a numerical model is developed for coupled analysis of deforming fractured porous media with multiscale fractures. In this model, the macro-fractures are modeled explicitly by the embedded discrete fracture model, and the supporting effects of fluid and fillings in these fractures are represented explicitly in the geomechanics model. On the other hand, matrix and micro-fractures are modeled by a multi-porosity model, which aims to accurately describe the transient matrix-fracture fluid exchange process. A stabilized extended finite element method scheme is developed based on the polynomial pressure projection technique to address the displacement oscillation along macro-fracture boundaries. After that, the mixed space discretization and modified fixed stress sequential implicit methods based on non-matching grids are applied to solve the coupling model. Finally, we demonstrate the accuracy and application of the proposed method to capture the coupled hydro-mechanical impacts of multiscale fractures on fractured porous media.

  11. The accuracy of matrix population model projections for coniferous trees in the Sierra Nevada, California

    USGS Publications Warehouse

    van Mantgem, P.J.; Stephenson, N.L.

    2005-01-01

    1 We assess the use of simple, size-based matrix population models for projecting population trends for six coniferous tree species in the Sierra Nevada, California. We used demographic data from 16 673 trees in 15 permanent plots to create 17 separate time-invariant, density-independent population projection models, and determined differences between trends projected from initial surveys with a 5-year interval and observed data during two subsequent 5-year time steps. 2 We detected departures from the assumptions of the matrix modelling approach in terms of strong growth autocorrelations. We also found evidence of observation errors for measurements of tree growth and, to a more limited degree, recruitment. Loglinear analysis provided evidence of significant temporal variation in demographic rates for only two of the 17 populations. 3 Total population sizes were strongly predicted by model projections, although population dynamics were dominated by carryover from the previous 5-year time step (i.e. there were few cases of recruitment or death). Fractional changes to overall population sizes were less well predicted. Compared with a null model and a simple demographic model lacking size structure, matrix model projections were better able to predict total population sizes, although the differences were not statistically significant. Matrix model projections were also able to predict short-term rates of survival, growth and recruitment. Mortality frequencies were not well predicted. 4 Our results suggest that simple size-structured models can accurately project future short-term changes for some tree populations. However, not all populations were well predicted and these simple models would probably become more inaccurate over longer projection intervals. The predictive ability of these models would also be limited by disturbance or other events that destabilize demographic rates. ?? 2005 British Ecological Society.

  12. Recent results and persisting problems in modeling flow induced coalescence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fortelný, I., E-mail: fortelny@imc.cas.cz, E-mail: juza@imc.cas.cz; Jza, J., E-mail: fortelny@imc.cas.cz, E-mail: juza@imc.cas.cz

    2014-05-15

    The contribution summarizes recent results of description of the flow induced coalescence in immiscible polymer blends and addresses problems that call for which solving. The theory of coalescence based on the switch between equations for matrix drainage between spherical or deformed droplets provides a good agreement with more complicated modeling and available experimental data for probability, P{sub c}, that the collision of droplets will be followed by their fusion. A new equation for description of the matrix drainage between deformed droplets, applicable to the whole range of viscosity ratios, p, of the droplets and matrixes, is proposed. The theory facilitatesmore » to consider the effect of the matrix elasticity on coalescence. P{sub c} decreases with the matrix relaxation time but this decrease is not pronounced for relaxation times typical of most commercial polymers. Modeling of the flow induced coalescence in concentrated systems is needed for prediction of the dependence of coalescence rate on volume fraction of droplets. The effect of the droplet anisometry on P{sub c} should be studied for better understanding the coalescence in flow field with high and moderate deformation rates. A reliable description of coalescence in mixing and processing devices requires proper modeling of complex flow fields.« less

  13. Assessment of a hybrid finite element-transfer matrix model for flat structures with homogeneous acoustic treatments.

    PubMed

    Alimonti, Luca; Atalla, Noureddine; Berry, Alain; Sgard, Franck

    2014-05-01

    Modeling complex vibroacoustic systems including poroelastic materials using finite element based methods can be unfeasible for practical applications. For this reason, analytical approaches such as the transfer matrix method are often preferred to obtain a quick estimation of the vibroacoustic parameters. However, the strong assumptions inherent within the transfer matrix method lead to a lack of accuracy in the description of the geometry of the system. As a result, the transfer matrix method is inherently limited to the high frequency range. Nowadays, hybrid substructuring procedures have become quite popular. Indeed, different modeling techniques are typically sought to describe complex vibroacoustic systems over the widest possible frequency range. As a result, the flexibility and accuracy of the finite element method and the efficiency of the transfer matrix method could be coupled in a hybrid technique to obtain a reduction of the computational burden. In this work, a hybrid methodology is proposed. The performances of the method in predicting the vibroacoutic indicators of flat structures with attached homogeneous acoustic treatments are assessed. The results prove that, under certain conditions, the hybrid model allows for a reduction of the computational effort while preserving enough accuracy with respect to the full finite element solution.

  14. A matrix for the qualitative evaluation of nursing tasks.

    PubMed

    Durosaiye, Isaiah O; Hadjri, Karim; Liyanage, Champika L; Bennett, Kina

    2018-04-01

    To formulate a model for patient-nurse interaction; to compile a comprehensive list of nursing tasks on hospital wards; and to construct a nursing tasks demand matrix. The physical demands associated with nursing profession are of growing interest among researchers. Yet, it is the complexity of nursing tasks that defines the demands of ward nurses' role. This study explores nursing tasks, based on patient-nurse interaction on hospital wards. Extant literature was reviewed to formulate a patient-nurse interaction model. Twenty ward nurses were interviewed to compile a list of nursing tasks. These nursing tasks were mapped against the patient-nurse interaction model. A patient-nurse interaction model was created, consisting of: (1) patient care, (2) patient surveillance and (3) patient support. Twenty-three nursing tasks were identified. The nursing tasks demand matrix was constructed. Ward managers may use a nursing tasks demand matrix to determine the demands of nursing tasks on ward nurses. While many studies have explored either the physical or the psychosocial aspects of nursing tasks separately, this study suggests that the physicality of nursing tasks must be evaluated in tandem with their complexity. Ward managers may take a holistic approach to nursing tasks evaluation by using a nursing tasks demand matrix. © 2017 John Wiley & Sons Ltd.

  15. A new fracture mechanics model for multiple matrix cracks of SiC fiber reinforced brittle-matrix composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okabe, T.; Takeda, N.; Komotori, J.

    1999-11-26

    A new model is proposed for multiple matrix cracking in order to take into account the role of matrix-rich regions in the cross section in initiating crack growth. The model is used to predict the matrix cracking stress and the total number of matrix cracks. The model converts the matrix-rich regions into equivalent penny shape crack sizes and predicts the matrix cracking stress with a fracture mechanics crack-bridging model. The estimated distribution of matrix cracking stresses is used as statistical input to predict the number of matrix cracks. The results show good agreement with the experimental results by replica observations.more » Therefore, it is found that the matrix cracking behavior mainly depends on the distribution of matrix-rich regions in the composite.« less

  16. Automatic annotation of histopathological images using a latent topic model based on non-negative matrix factorization

    PubMed Central

    Cruz-Roa, Angel; Díaz, Gloria; Romero, Eduardo; González, Fabio A.

    2011-01-01

    Histopathological images are an important resource for clinical diagnosis and biomedical research. From an image understanding point of view, the automatic annotation of these images is a challenging problem. This paper presents a new method for automatic histopathological image annotation based on three complementary strategies, first, a part-based image representation, called the bag of features, which takes advantage of the natural redundancy of histopathological images for capturing the fundamental patterns of biological structures, second, a latent topic model, based on non-negative matrix factorization, which captures the high-level visual patterns hidden in the image, and, third, a probabilistic annotation model that links visual appearance of morphological and architectural features associated to 10 histopathological image annotations. The method was evaluated using 1,604 annotated images of skin tissues, which included normal and pathological architectural and morphological features, obtaining a recall of 74% and a precision of 50%, which improved a baseline annotation method based on support vector machines in a 64% and 24%, respectively. PMID:22811960

  17. Investigations on the Impact of Material-Integrated Sensors with the Help of FEM-Based Modeling

    PubMed Central

    Dumstorff, Gerrit; Lang, Walter

    2015-01-01

    We present investigations on the impact of material-integrated sensors with the help of finite element-based modeling. A sensor (inlay) integrated with a material (matrix) is always a foreign body in the material, which can lead to a “wound effect”, that is degradation of the macroscopic behavior of a material. By analyzing the inlay's impact on the material in terms of mechanical load, heat conduction, stress during integration and other impacts of integration, this wound effect is analyzed. For the mechanical load, we found out that the inlay has to be at least as stretchable and bendable as the matrix. If there is a high thermal load during integration, the coefficients of the thermal expansion of the inlay have to be matched to the matrix. In the case of a high thermal load during operation, the inlay has to be as thin as possible or its thermal conductivity has to be adapted to the thermal conductivity of the matrix. To have a general view of things, the results are dimensionless and independent of the geometry. In each section, the results are illustrated by examples. Based on all of the results, we present our idea for the fabrication of future material-integrated sensors. PMID:25621607

  18. Model Determined for Predicting Fatigue Lives of Metal Matrix Composites Under Mean Stresses

    NASA Technical Reports Server (NTRS)

    Lerch, Bradley

    1997-01-01

    Aircraft engine components invariably are subjected to mean stresses over and above the cyclic loads. In monolithic materials, it has been observed that tensile mean stresses are detrimental and compressive mean stresses are beneficial to fatigue life in comparison to a base of zero mean stress. Several mean stress models exist for monolithic metals, but each differ quantitatively in the extent to which detrimental or beneficial effects are ascribed. There have been limited attempts to apply these models to metal matrix composites. At the NASA Lewis Research Center, several mean stress models--the Smith-Watson- Topper, Walker, Normalized Goodman, and Soderberg models--were examined for applicability to this class of composite materials. The Soderberg approach, which normalizes the mean stress to a 0.02-percent yield strength, was shown to best represent the effect of mean stresses over the range covered. The other models varied significantly in their predictability and often failed to predict the composite behavior at very high tensile mean stresses. This work is the first to systematically demonstrate the influence of mean stresses on metal matrix composites and model their effects. Attention also was given to fatigue-cracking mechanisms in the Ti-15-3 matrix and to micromechanics analyses of mean stress effects.

  19. Multivariate Granger causality: an estimation framework based on factorization of the spectral density matrix

    PubMed Central

    Wen, Xiaotong; Rangarajan, Govindan; Ding, Mingzhou

    2013-01-01

    Granger causality is increasingly being applied to multi-electrode neurophysiological and functional imaging data to characterize directional interactions between neurons and brain regions. For a multivariate dataset, one might be interested in different subsets of the recorded neurons or brain regions. According to the current estimation framework, for each subset, one conducts a separate autoregressive model fitting process, introducing the potential for unwanted variability and uncertainty. In this paper, we propose a multivariate framework for estimating Granger causality. It is based on spectral density matrix factorization and offers the advantage that the estimation of such a matrix needs to be done only once for the entire multivariate dataset. For any subset of recorded data, Granger causality can be calculated through factorizing the appropriate submatrix of the overall spectral density matrix. PMID:23858479

  20. First Human Brain Imaging by the jPET-D4 Prototype With a Pre-Computed System Matrix

    NASA Astrophysics Data System (ADS)

    Yamaya, Taiga; Yoshida, Eiji; Obi, Takashi; Ito, Hiroshi; Yoshikawa, Kyosan; Murayama, Hideo

    2008-10-01

    The jPET-D4 is a novel brain PET scanner which aims to achieve not only high spatial resolution but also high scanner sensitivity by using 4-layer depth-of-interaction (DOI) information. The dimensions of a system matrix for the jPET-D4 are 3.3 billion (lines-of-response) times 5 million (image elements) when a standard field-of-view (FOV) of 25 cm diameter is sampled with a (1.5 mm)3 voxel . The size of the system matrix is estimated as 117 petabytes (PB) with the accuracy of 8 bytes per element. An on-the-fly calculation is usually used to deal with such a huge system matrix. However we cannot avoid extension of the calculation time when we improve the accuracy of system modeling. In this work, we implemented an alternative approach based on pre-calculation of the system matrix. A histogram-based 3D OS-EM algorithm was implemented on a desktop workstation with 32 GB memory installed. The 117 PB system matrix was compressed under the limited amount of computer memory by (1) eliminating zero elements, (2) applying the DOI compression (DOIC) method and (3) applying rotational symmetry and an axial shift property of the crystal arrangement. Spanning, which degrades axial resolution, was not applied. The system modeling and the DOIC method, which had been validated in 2D image reconstruction, were expanded into 3D implementation. In particular, a new system model including the DOIC transformation was introduced to suppress resolution loss caused by the DOIC method. Experimental results showed that the jPET-D4 has almost uniform spatial resolution of better than 3 mm over the FOV. Finally the first human brain images were obtained with the jPET-D4.

  1. A hybrid mathematical model of solid tumour invasion: the importance of cell adhesion.

    PubMed

    Anderson, Alexander R A

    2005-06-01

    In this paper we present a hybrid mathematical model of the invasion of healthy tissue by a solid tumour. In particular we consider early vascular growth, just after angiogenesis has occurred. We examine how the geometry of the growing tumour is affected by tumour cell heterogeneity caused by genetic mutations. As the tumour grows, mutations occur leading to a heterogeneous tumour cell population with some cells having a greater ability to migrate, proliferate or degrade the surrounding tissue. All of these cell properties are closely controlled by cell-cell and cell-matrix interactions and as such the physical geometry of the whole tumour will be dependent on these individual cell interactions. The hybrid model we develop focuses on four key variables implicated in the invasion process: tumour cells, host tissue (extracellular matrix), matrix-degradative enzymes and oxygen. The model is considered to be hybrid since the latter three variables are continuous (i.e. concentrations) and the tumour cells are discrete (i.e. individuals). With this hybrid model we examine how individual-based cell interactions (with one another and the matrix) can affect the tumour shape and discuss which of these interactions is perhaps most crucial in influencing the tumour's final structure.

  2. Recognition and defect detection of dot-matrix text via variation-model based learning

    NASA Astrophysics Data System (ADS)

    Ohyama, Wataru; Suzuki, Koushi; Wakabayashi, Tetsushi

    2017-03-01

    An algorithm for recognition and defect detection of dot-matrix text printed on products is proposed. Extraction and recognition of dot-matrix text contains several difficulties, which are not involved in standard camera-based OCR, that the appearance of dot-matrix characters is corrupted and broken by illumination, complex texture in the background and other standard characters printed on product packages. We propose a dot-matrix text extraction and recognition method which does not require any user interaction. The method employs detected location of corner points and classification score. The result of evaluation experiment using 250 images shows that recall and precision of extraction are 78.60% and 76.03%, respectively. Recognition accuracy of correctly extracted characters is 94.43%. Detecting printing defect of dot-matrix text is also important in the production scene to avoid illegal productions. We also propose a detection method for printing defect of dot-matrix characters. The method constructs a feature vector of which elements are classification scores of each character class and employs support vector machine to classify four types of printing defect. The detection accuracy of the proposed method is 96.68 %.

  3. Ballistic Performance of Alimina/S-2 Glass-Reinforced Polymer-Matrix Composite Hybrid Lightweight Armor Against Armor Piercing (AP) and Non-AP Projectiles

    DTIC Science & Technology

    2007-01-01

    and a phenolic -resin based polymeric matrix. Such armor panels offer superior protection against fragmented ballistic threats when compared to...database does not contain a material model for the HJ1 composite but provides a model for a Kevlar Fiber Reinforced Polymer (KFRP) containing 53 vol... phenolic resin and epoxy yield stresses and then with a ratio of the S-2 glass and aramid fibers volume fractions. To test the validity of the

  4. Matrix Models and A Proof of the Open Analog of Witten's Conjecture

    NASA Astrophysics Data System (ADS)

    Buryak, Alexandr; Tessler, Ran J.

    2017-08-01

    In a recent work, R. Pandharipande, J. P. Solomon and the second author have initiated a study of the intersection theory on the moduli space of Riemann surfaces with boundary. They conjectured that the generating series of the intersection numbers satisfies the open KdV equations. In this paper we prove this conjecture. Our proof goes through a matrix model and is based on a Kontsevich type combinatorial formula for the intersection numbers that was found by the second author.

  5. OOMM--Object-Oriented Matrix Modelling: an instrument for the integration of the Brasilia Regional Health Information System.

    PubMed

    Cammarota, M; Huppes, V; Gaia, S; Degoulet, P

    1998-01-01

    The development of Health Information Systems is widely determined by the establishment of the underlying information models. An Object-Oriented Matrix Model (OOMM) is described which target is to facilitate the integration of the overall health system. The model is based on information modules named micro-databases that are structured in a three-dimensional network: planning, health structures and information systems. The modelling tool has been developed as a layer on top of a relational database system. A visual browser facilitates the development and maintenance of the information model. The modelling approach has been applied to the Brasilia University Hospital since 1991. The extension of the modelling approach to the Brasilia regional health system is considered.

  6. RELAP-7 Software Verification and Validation Plan: Requirements Traceability Matrix (RTM) Part 1 – Physics and numerical methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Yong Joon; Yoo, Jun Soo; Smith, Curtis Lee

    2015-09-01

    This INL plan comprehensively describes the Requirements Traceability Matrix (RTM) on main physics and numerical method of the RELAP-7. The plan also describes the testing-based software verification and validation (SV&V) process—a set of specially designed software models used to test RELAP-7.

  7. Fabric defect detection based on visual saliency using deep feature and low-rank recovery

    NASA Astrophysics Data System (ADS)

    Liu, Zhoufeng; Wang, Baorui; Li, Chunlei; Li, Bicao; Dong, Yan

    2018-04-01

    Fabric defect detection plays an important role in improving the quality of fabric product. In this paper, a novel fabric defect detection method based on visual saliency using deep feature and low-rank recovery was proposed. First, unsupervised training is carried out by the initial network parameters based on MNIST large datasets. The supervised fine-tuning of fabric image library based on Convolutional Neural Networks (CNNs) is implemented, and then more accurate deep neural network model is generated. Second, the fabric images are uniformly divided into the image block with the same size, then we extract their multi-layer deep features using the trained deep network. Thereafter, all the extracted features are concentrated into a feature matrix. Third, low-rank matrix recovery is adopted to divide the feature matrix into the low-rank matrix which indicates the background and the sparse matrix which indicates the salient defect. In the end, the iterative optimal threshold segmentation algorithm is utilized to segment the saliency maps generated by the sparse matrix to locate the fabric defect area. Experimental results demonstrate that the feature extracted by CNN is more suitable for characterizing the fabric texture than the traditional LBP, HOG and other hand-crafted features extraction method, and the proposed method can accurately detect the defect regions of various fabric defects, even for the image with complex texture.

  8. Understanding the drug release mechanism from a montmorillonite matrix and its binary mixture with a hydrophilic polymer using a compartmental modelling approach

    NASA Astrophysics Data System (ADS)

    Choiri, S.; Ainurofiq, A.

    2018-03-01

    Drug release from a montmorillonite (MMT) matrix is a complex mechanism controlled by swelling mechanism of MMT and an interaction of drug and MMT. The aim of this research was to explain a suitable model of the drug release mechanism from MMT and its binary mixture with a hydrophilic polymer in the controlled release formulation based on a compartmental modelling approach. Theophylline was used as a drug model and incorporated into MMT and a binary mixture with hydroxyl propyl methyl cellulose (HPMC) as a hydrophilic polymer, by a kneading method. The dissolution test was performed and the modelling of drug release was assisted by a WinSAAM software. A 2 model was purposed based on the swelling capability and basal spacing of MMT compartments. The model evaluation was carried out to goodness of fit and statistical parameters and models were validated by a cross-validation technique. The drug release from MMT matrix regulated by a burst release mechanism of unloaded drug, swelling ability, basal spacing of MMT compartment, and equilibrium between basal spacing and swelling compartments. Furthermore, the addition of HPMC in MMT system altered the presence of swelling compartment and equilibrium between swelling and basal spacing compartment systems. In addition, a hydrophilic polymer reduced the burst release mechanism of unloaded drug.

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. A microwave backscattering model for precipitation

    NASA Astrophysics Data System (ADS)

    Ermis, Seda

    A geophysical microwave backscattering model for space borne and ground-based remote sensing of precipitation is developed and used to analyze backscattering measurements from rain and snow type precipitation. Vector Radiative Transfer (VRT) equations for a multilayered inhomogeneous medium are applied to the precipitation region for calculation of backscattered intensity. Numerical solution of the VRT equation for multiple layers is provided by the matrix doubling method to take into account close range interactions between particles. In previous studies, the VRT model was used to calculate backscattering from a rain column on a sea surface. In the model, Mie scattering theory for closely spaced scatterers was used to determine the phase matrix for each sublayer characterized by a set of parameters. The scatterers i.e. rain drops within the sublayers were modelled as spheres with complex permittivities. The rain layer was bounded by rough boundaries; the interface between the cloud and the rain column as well as the interface between the sea surface and the rain were all analyzed by using the integral equation model (IEM). Therefore, the phase matrix for the entire rain column was generated by the combination of surface and volume scattering. Besides Mie scattering, in this study, we use T-matrix approach to examine the effect of the shape to the backscattered intensities since larger raindrops are most likely oblique in shape. Analyses show that the effect of obliquity of raindrops to the backscattered wave is related with size of the scatterers and operated frequency. For the ground-based measurement system, the VRT model is applied to simulate the precipitation column on horizontal direction. Therefore, the backscattered reflectivities for each unit range of volume are calculated from the backscattering radar cross sections by considering radar range and effective illuminated area of the radar beam. The volume scattering phase matrices for each range interval are calculated by Mie scattering theory. VRT equations are solved by matrix doubling method to compute phase matrix for entire radar beam. Model results are validated with measured data by X-band dual polarization Phase Tilt Weather Radar (PTWR) for snow, rain, wet hail type precipitation. The geophysical parameters given the best fit with measured reflectivities are used in previous models i.e. Rayleigh Approximation and Mie scattering and compared with the VRT model. Results show that reflectivities calculated by VRT models are differed up to 10 dB from the Rayleigh approximation model and up to 5 dB from the Mie Scattering theory due to both multiple scattering and attenuation losses for the rain rates as high as 80 mm/h.

  11. Statistical analysis of latent generalized correlation matrix estimation in transelliptical distribution

    PubMed Central

    Han, Fang; Liu, Han

    2016-01-01

    Correlation matrix plays a key role in many multivariate methods (e.g., graphical model estimation and factor analysis). The current state-of-the-art in estimating large correlation matrices focuses on the use of Pearson’s sample correlation matrix. Although Pearson’s sample correlation matrix enjoys various good properties under Gaussian models, its not an effective estimator when facing heavy-tail distributions with possible outliers. As a robust alternative, Han and Liu (2013b) advocated the use of a transformed version of the Kendall’s tau sample correlation matrix in estimating high dimensional latent generalized correlation matrix under the transelliptical distribution family (or elliptical copula). The transelliptical family assumes that after unspecified marginal monotone transformations, the data follow an elliptical distribution. In this paper, we study the theoretical properties of the Kendall’s tau sample correlation matrix and its transformed version proposed in Han and Liu (2013b) for estimating the population Kendall’s tau correlation matrix and the latent Pearson’s correlation matrix under both spectral and restricted spectral norms. With regard to the spectral norm, we highlight the role of “effective rank” in quantifying the rate of convergence. With regard to the restricted spectral norm, we for the first time present a “sign subgaussian condition” which is sufficient to guarantee that the rank-based correlation matrix estimator attains the optimal rate of convergence. In both cases, we do not need any moment condition. PMID:28337068

  12. Neutrino CP violation and sign of baryon asymmetry in the minimal seesaw model

    NASA Astrophysics Data System (ADS)

    Shimizu, Yusuke; Takagi, Kenta; Tanimoto, Morimitsu

    2018-03-01

    We discuss the correlation between the CP violating Dirac phase of the lepton mixing matrix and the cosmological baryon asymmetry based on the leptogenesis in the minimal seesaw model with two right-handed Majorana neutrinos and the trimaximal mixing for neutrino flavors. The sign of the CP violating Dirac phase at low energy is fixed by the observed cosmological baryon asymmetry since there is only one phase parameter in the model. According to the recent T2K and NOνA data of the CP violation, the Dirac neutrino mass matrix of our model is fixed only for the normal hierarchy of neutrino masses.

  13. Multiscale Static Analysis of Notched and Unnotched Laminates Using the Generalized Method of Cells

    NASA Technical Reports Server (NTRS)

    Naghipour Ghezeljeh, Paria; Arnold, Steven M.; Pineda, Evan J.; Stier, Bertram; Hansen, Lucas; Bednarcyk, Brett A.; Waas, Anthony M.

    2016-01-01

    The generalized method of cells (GMC) is demonstrated to be a viable micromechanics tool for predicting the deformation and failure response of laminated composites, with and without notches, subjected to tensile and compressive static loading. Given the axial [0], transverse [90], and shear [+45/-45] response of a carbon/epoxy (IM7/977-3) system, the unnotched and notched behavior of three multidirectional layups (Layup 1: [0,45,90,-45](sub 2S), Layup 2: [0,60,0](sub 3S), and Layup 3: [30,60,90,-30, -60](sub 2S)) are predicted under both tensile and compressive static loading. Matrix nonlinearity is modeled in two ways. The first assumes all nonlinearity is due to anisotropic progressive damage of the matrix only, which is modeled, using the multiaxial mixed-mode continuum damage model (MMCDM) within GMC. The second utilizes matrix plasticity coupled with brittle final failure based on the maximum principle strain criteria to account for matrix nonlinearity and failure within the Finite Element Analysis--Micromechanics Analysis Code (FEAMAC) software multiscale framework. Both MMCDM and plasticity models incorporate brittle strain- and stress-based failure criteria for the fiber. Upon satisfaction of these criteria, the fiber properties are immediately reduced to a nominal value. The constitutive response for each constituent (fiber and matrix) is characterized using a combination of vendor data and the axial, transverse, and shear responses of unnotched laminates. Then, the capability of the multiscale methodology is assessed by performing blind predictions of the mentioned notched and unnotched composite laminates response under tensile and compressive loading. Tabulated data along with the detailed results (i.e., stress-strain curves as well as damage evolution states at various ratios of strain to failure) for all laminates are presented.

  14. A computational model of in vitro angiogenesis based on extracellular matrix fibre orientation.

    PubMed

    Edgar, Lowell T; Sibole, Scott C; Underwood, Clayton J; Guilkey, James E; Weiss, Jeffrey A

    2013-01-01

    Recent interest in the process of vascularisation within the biomedical community has motivated numerous new research efforts focusing on the process of angiogenesis. Although the role of chemical factors during angiogenesis has been well documented, the role of mechanical factors, such as the interaction between angiogenic vessels and the extracellular matrix, remains poorly understood. In vitro methods for studying angiogenesis exist; however, measurements available using such techniques often suffer from limited spatial and temporal resolutions. For this reason, computational models have been extensively employed to investigate various aspects of angiogenesis. This paper outlines the formulation and validation of a simple and robust computational model developed to accurately simulate angiogenesis based on length, branching and orientation morphometrics collected from vascularised tissue constructs. Microvessels were represented as a series of connected line segments. The morphology of the vessels was determined by a linear combination of the collagen fibre orientation, the vessel density gradient and a random walk component. Excellent agreement was observed between computational and experimental morphometric data over time. Computational predictions of microvessel orientation within an anisotropic matrix correlated well with experimental data. The accuracy of this modelling approach makes it a valuable platform for investigating the role of mechanical interactions during angiogenesis.

  15. A structure-based extracellular matrix expansion mechanism of fibrous tissue growth.

    PubMed

    Kalson, Nicholas S; Lu, Yinhui; Taylor, Susan H; Starborg, Tobias; Holmes, David F; Kadler, Karl E

    2015-05-20

    Embryonic growth occurs predominately by an increase in cell number; little is known about growth mechanisms later in development when fibrous tissues account for the bulk of adult vertebrate mass. We present a model for fibrous tissue growth based on 3D-electron microscopy of mouse tendon. We show that the number of collagen fibrils increases during embryonic development and then remains constant during postnatal growth. Embryonic growth was explained predominately by increases in fibril number and length. Postnatal growth arose predominately from increases in fibril length and diameter. A helical crimp structure was established in embryogenesis, and persisted postnatally. The data support a model where the shape and size of tendon is determined by the number and position of embryonic fibroblasts. The collagen fibrils that these cells synthesise provide a template for postnatal growth by structure-based matrix expansion. The model has important implications for growth of other fibrous tissues and fibrosis.

  16. Statistical analysis of effective singular values in matrix rank determination

    NASA Technical Reports Server (NTRS)

    Konstantinides, Konstantinos; Yao, Kung

    1988-01-01

    A major problem in using SVD (singular-value decomposition) as a tool in determining the effective rank of a perturbed matrix is that of distinguishing between significantly small and significantly large singular values to the end, conference regions are derived for the perturbed singular values of matrices with noisy observation data. The analysis is based on the theories of perturbations of singular values and statistical significance test. Threshold bounds for perturbation due to finite-precision and i.i.d. random models are evaluated. In random models, the threshold bounds depend on the dimension of the matrix, the noisy variance, and predefined statistical level of significance. Results applied to the problem of determining the effective order of a linear autoregressive system from the approximate rank of a sample autocorrelation matrix are considered. Various numerical examples illustrating the usefulness of these bounds and comparisons to other previously known approaches are given.

  17. Microscopic Scale Simulation of the Ablation of Fibrous Materials

    NASA Technical Reports Server (NTRS)

    Lachaud, Jean Romain; Mansour, Nagi N.

    2010-01-01

    Ablation by oxidation of carbon-fiber preforms impregnated in carbonized phenolic matrix is modeled at microscopic scale. Direct numerical simulations show that the carbonized phenolic matrix ablates in volume leaving the carbon fibers exposed. This is due to the fact that the reactivity of carbonized phenolic is higher than the reactivity of carbon fibers. After the matrix is depleted, the fibers ablate showing progressive reduction of their diameter. The overall material recession occurs when the fibers are consumed. Two materials with the same carbon-fiber preform, density and chemical composition, but with different matrix distributions are studied. These studies show that at moderate temperatures (< 1000 K) the microstructure of the material influences its recession rate; a fact that is not captured by current models that are based on chemical composition only. Surprisingly, the response of these impregnated-fiber materials is weakly dependent on the microstructure at very high temperatures (e.g., Stardust peak heating conditions: 3360K).

  18. Matrix-assisted relaxation in Fe(phen)2(NCS)2 spin-crossover microparticles, experimental and theoretical investigations

    NASA Astrophysics Data System (ADS)

    Enachescu, Cristian; Tanasa, Radu; Stancu, Alexandru; Tissot, Antoine; Laisney, Jérôme; Boillot, Marie-Laure

    2016-07-01

    In this study, we present the influence of the embedding matrix on the relaxation of Fe(phen)2(NCS)2 (phen = 1,10-phenanthroline) spin-transition microparticles as revealed by experiments and provide an explanation within the framework of an elastic model based on a Monte-Carlo method. Experiments show that the shape of the high-spin → low-spin relaxation curves is drastically changed when the particles are dispersed in glycerol. This effect was considered in the model by means of interactions between the microparticles and the matrix. A faster start of the relaxation for microparticles embedded in glycerol is due to an initial positive local pressure acting on the edge spin-crossover molecules from the matrix side. This local pressure diminishes and eventually becomes negative during relaxation, as an effect of the decrease of the volume of spin-crossover microparticles from high-spin to low-spin.

  19. Matrix polyelectrolyte capsules based on polysaccharide/MnCO₃ hybrid microparticle templates.

    PubMed

    Wei, Qingrong; Ai, Hua; Gu, Zhongwei

    2011-06-15

    An efficient strategy for biomacromolecule encapsulation based on spontaneous deposition into polysaccharide matrix-containing capsules is introduced in this study. First, hybrid microparticles composed of manganese carbonate and ionic polysaccharides including sodium hyaluronate (HA), sodium alginate (SA) and dextran sulfate sodium (DS) with narrow size distribution were synthesized to provide monodisperse templates. Incorporation of polysaccharide into the hybrid templates was successful as verified by thermogravimetric analysis (TGA) and confocal laser scanning microscopy (CLSM). Matrix polyelectrolyte microcapsules were fabricated through layer-by-layer (LbL) self-assembly of oppositely charged polyelectrolytes (PEs) onto the hybrid particles, followed by removal of the inorganic part of the cores, leaving polysaccharide matrix inside the capsules. The loading and release properties of the matrix microcapsules were investigated using myoglobin as a model biomacromolecule. Compared to matrix-free capsules, the matrix capsules had a much higher loading capacity up to four times; the driving force is mostly due to electrostatic interactions between myoglobin and the polysaccharide matrix. From our observations, for the same kind of polysaccharide, a higher amount of polysaccharide inside the capsules usually led to better loading capacity. The release behavior of the loaded myoglobin could be readily controlled by altering the environmental pH. These matrix microcapsules may be used as efficient delivery systems for various charged water-soluble macromolecules with applications in biomedical fields. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Modelling of End Milling of AA6061-TiCp Metal Matrix Composite

    NASA Astrophysics Data System (ADS)

    Vijay Kumar, S.; Cheepu, Muralimohan; Venkateswarlu, D.; Asohan, P.; Senthil Kumar, V.

    2018-03-01

    The metal-matrix composites (MMCs) are used in various applications hence lot of research has been carried out on MMCs. To increase the properties of Al-based MMCs many ceramic reinforcements have been identified, among which TiC is played vital role because of its properties like high hardness, stiffness and wear resistance. In the present work, a neural network and statistical modelling approach is going to use for the prediction of surface roughness (Ra) and cutting forces in computerised numerical control milling machine. Experiments conducted on a CNC milling machine based on the full factorial design and resulted data used to train and checking the network performance. The sample prepared from in-situ technique and heat treated to get uniform properties. The ANN model has shown satisfactory performance comparatively.

  1. A numerical identifiability test for state-space models--application to optimal experimental design.

    PubMed

    Hidalgo, M E; Ayesa, E

    2001-01-01

    This paper describes a mathematical tool for identifiability analysis, easily applicable to high order non-linear systems modelled in state-space and implementable in simulators with a time-discrete approach. This procedure also permits a rigorous analysis of the expected estimation errors (average and maximum) in calibration experiments. The methodology is based on the recursive numerical evaluation of the information matrix during the simulation of a calibration experiment and in the setting-up of a group of information parameters based on geometric interpretations of this matrix. As an example of the utility of the proposed test, the paper presents its application to an optimal experimental design of ASM Model No. 1 calibration, in order to estimate the maximum specific growth rate microH and the concentration of heterotrophic biomass XBH.

  2. Modeling and simulation of the debonding process of composite solid propellants

    NASA Astrophysics Data System (ADS)

    Feng, Tao; Xu, Jin-sheng; Han, Long; Chen, Xiong

    2017-07-01

    In order to study the damage evolution law of composite solid propellants, the molecular dynamics particle filled algorithm was used to establish the mesoscopic structure model of HTPB(Hydroxyl-terminated polybutadiene) propellants. The cohesive element method was employed for the adhesion interface between AP(Ammonium perchlorate) particle and HTPB matrix and the bilinear cohesive zone model was used to describe the mechanical response of the interface elements. The inversion analysis method based on Hooke-Jeeves optimization algorithm was employed to identify the parameters of cohesive zone model(CZM) of the particle/binder interface. Then, the optimized parameters were applied to the commercial finite element software ABAQUS to simulate the damage evolution process for AP particle and HTPB matrix, including the initiation, development, gathering and macroscopic crack. Finally, the stress-strain simulation curve was compared with the experiment curves. The result shows that the bilinear cohesive zone model can accurately describe the debonding and fracture process between the AP particles and HTPB matrix under the uniaxial tension loading.

  3. Elastic and Piezoelectric Properties of Boron Nitride Nanotube Composites. Part II; Finite Element Model

    NASA Technical Reports Server (NTRS)

    Kim, H. Alicia; Hardie, Robert; Yamakov, Vesselin; Park, Cheol

    2015-01-01

    This paper is the second part of a two-part series where the first part presents a molecular dynamics model of a single Boron Nitride Nanotube (BNNT) and this paper scales up to multiple BNNTs in a polymer matrix. This paper presents finite element (FE) models to investigate the effective elastic and piezoelectric properties of (BNNT) nanocomposites. The nanocomposites studied in this paper are thin films of polymer matrix with aligned co-planar BNNTs. The FE modelling approach provides a computationally efficient way to gain an understanding of the material properties. We examine several FE models to identify the most suitable models and investigate the effective properties with respect to the BNNT volume fraction and the number of nanotube walls. The FE models are constructed to represent aligned and randomly distributed BNNTs in a matrix of resin using 2D and 3D hollow and 3D filled cylinders. The homogenisation approach is employed to determine the overall elastic and piezoelectric constants for a range of volume fractions. These models are compared with an analytical model based on Mori-Tanaka formulation suitable for finite length cylindrical inclusions. The model applies to primarily single-wall BNNTs but is also extended to multi-wall BNNTs, for which preliminary results will be presented. Results from the Part 1 of this series can help to establish a constitutive relationship for input into the finite element model to enable the modeling of multiple BNNTs in a polymer matrix.

  4. Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation

    PubMed Central

    Kong, Zehui; Liu, Teng

    2017-01-01

    To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control. PMID:28671967

  5. Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation.

    PubMed

    Kong, Zehui; Zou, Yuan; Liu, Teng

    2017-01-01

    To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control.

  6. Parameters Identification of Interface Friction Model for Ceramic Matrix Composites Based on Stress-Strain Response

    NASA Astrophysics Data System (ADS)

    Han, Xiao; Gao, Xiguang; Song, Yingdong

    2017-10-01

    An approach to identify parameters of interface friction model for Ceramic Matrix composites based on stress-strain response was developed. The stress distribution of fibers in the interface slip region and intact region of the damaged composite was determined by adopting the interface friction model. The relation between maximum strain, secant moduli of hysteresis loop and interface shear stress, interface de-bonding stress was established respectively with the method of symbolic-graphic combination. By comparing the experimental strain, secant moduli of hysteresis loop with computation values, the interface shear stress and interface de-bonding stress corresponding to first cycle were identified. Substituting the identification of parameters into interface friction model, the stress-strain curves were predicted and the predicted results fit experiments well. Besides, the influence of number of data points on identifying the value of interface parameters was discussed. And the approach was compared with the method based on the area of hysteresis loop.

  7. A novel mathematical model considering change of diffusion coefficient for predicting dissolution behavior of acetaminophen from wax matrix dosage form.

    PubMed

    Nitanai, Yuta; Agata, Yasuyoshi; Iwao, Yasunori; Itai, Shigeru

    2012-05-30

    From wax matrix dosage forms, drug and water-soluble polymer are released into the external solvent over time. As a consequence, the pore volume inside the wax matrix particles is increased and the diffusion coefficient of the drug is altered. In the present study, we attempted to derive a novel empirical mathematical model, namely, a time-dependent diffusivity (TDD) model, that assumes the change in the drug's diffusion coefficient can be used to predict the drug release from spherical wax matrix particles. Wax matrix particles were prepared by using acetaminophen (APAP), a model drug; glyceryl monostearate (GM), a wax base; and aminoalkyl methacrylate copolymer E (AMCE), a functional polymer that dissolves below pH 5.0 and swells over pH 5.0. A three-factor, three-level (3(3)) Box-Behnken design was used to evaluate the effects of several of the variables in the model formulation, and the release of APAP from wax matrix particles was evaluated by the paddle method at pH 4.0 and pH 6.5. When comparing the goodness of fit to the experimental data between the proposed TDD model and the conventional pure diffusion model, a better correspondence was observed for the TDD model in all cases. Multiple regression analysis revealed that an increase in AMCE loading enhanced the diffusion coefficient with time, and that this increase also had a significant effect on drug release behavior. Furthermore, from the results of the multiple regression analysis, a formulation with desired drug release behavior was found to satisfy the criteria of the bitter taste masking of APAP without lowering the bioavailability. That is to say, the amount of APAP released remains below 15% for 10 min at pH 6.5 and exceeds 90% within 30 min at pH 4.0. The predicted formulation was 15% APAP loading, 8.25% AMCE loading, and 400 μm mean particle diameter. When wax matrix dosage forms were prepared accordingly, the predicted drug release behavior agreed well with experimental values at each pH level. Therefore, the proposed model is feasible as a useful tool for predicting drug release behavior, as well as for designing the formulation of wax matrix dosage forms. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. On Theoretical Limits of Dynamic Model Updating Using a Sensitivity-Based Approach

    NASA Astrophysics Data System (ADS)

    GOLA, M. M.; SOMÀ, A.; BOTTO, D.

    2001-07-01

    The present work deals with the determination of the newly discovered conditions necessary for model updating with the eigensensitivity approach. The treatment concerns the maximum number of identifiable parameters regarding the structure of the eigenvectors derivatives. A mathematical demonstration is based on the evaluation of the rank of the least-squares matrix and produces the algebraic limiting conditions. Numerical application to a lumped parameter structure is employed to validate the mathematical limits taking into account different subsets of mode shapes. The demonstration is extended to the calculation of the eigenvector derivatives with both the Fox and Kapoor, and Nelson methods. III conditioning of the least-squares sensitivity matrix is revealed through the covariance jump.

  9. Modeling damage evolution in a hybrid ceramic matrix composite under static tensile load

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bonora, N.; Newaz, G.

    In this investigation, damage evolution in a unidirectional hybrid ceramic composite made from Nicalon and SiC fibers in a Lithium Aluminosilicate (LAS) glass matrix was studied. The static stress-strain response of the composite exhibited a linear response followed by load drop in a progressive manner. Careful experiments were conducted stopping the tests at various strain levels and using replication technique, scanning and optical microscopy to monitor the evolution of damage in these composites. It was observed that the constituents of the composite failed in a sequential manner at increasing strain levels. The matrix cracks were followed by SiC fiber failuresmore » near ultimate tensile stress. After that, the load drop was associated with progressive failure of the Nicalon fibers. Identification of these failure modes were critical to the development of a concentric cylinder model representing all three constituent phases to predict the constitutive response of the CMC computationally. The strain-to-failure of the matrix and fibers were used to progressively fail the constituents in the model and the overall experimental constitutive response of the CMC was recovered. A strain based analytical representation was developed relating stiffness loss to applied strain. Based on this formulation, damage evolution and its consequence on tensile stress-strain response was predicted for room temperature behavior of hybrid CMCs. The contribution of the current work is that the proposed strain-damage phenomenological model can capture the damage evolution and the corresponding material response for continuous fiber-reinforced CMCs. The modeling approach shows much promise for the complex damage processes observed in hybrid CMCs.« less

  10. Modeling of leachate generation from MSW landfills by a 2-dimensional 2-domain approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fellner, Johann, E-mail: j.fellner@tuwien.ac.a; Brunner, Paul H., E-mail: paul.h.brunner@tuwien.ac.a

    2010-11-15

    The flow of water through Municipal Solid Waste (MSW) landfills is highly non-uniform and dominated by preferential pathways. Thus, concepts to simulate landfill behavior require that a heterogeneous flow regime is considered. Recent models are based on a 2-domain approach, differentiating between channel domain with high hydraulic conductivity, and matrix domain of slow water movement with high water retention capacity. These models focus on the mathematical description of rapid water flow in channel domain. The present paper highlights the importance of water exchange between the two domains, and expands the 1-dimensional, 2-domain flow model by taking into account water flowsmore » in two dimensions. A flow field consisting of a vertical path (channel domain) surrounded by the waste mass (matrix domain) is defined using the software HYDRUS-2D. When the new model is calibrated using data sets from a MSW-landfill site the predicted leachate generation corresponds well with the observed leachate discharge. An overall model efficiency in terms of r{sup 2} of 0.76 was determined for a simulation period of almost 4 years. The results confirm that water in landfills follows a preferential path way characterized by high permeability (K{sub s} = 300 m/d) and zero retention capacity, while the bulk of the landfill (matrix domain) is characterized by low permeability (K{sub s} = 0.1 m/d) and high retention capacity. The most sensitive parameters of the model are the hydraulic conductivities of the channel domain and the matrix domain, and the anisotropy of the matrix domain.« less

  11. ECM remodeling and its plasticity

    NASA Astrophysics Data System (ADS)

    Feng, Jingchen; Jones, Christopher A. R.; Cibula, Matthew; Mao, Xiaoming; Sander, Leonard M.; Levine, Herbert; Sun, Bo

    The mechanical interactions between cells and Extracellular Matrix (ECM) are of great importance in many cellular processes. These interactions are reciprocal, i.e. contracting cells pull and reorganize the surrounding matrix, while the remodeled matrix feeds back to regulate cell activities. Recent experiments show in collagen gels with densely distributed cells, aligned fiber bundles are formed in the direction between neighboring cells. Fibers flow into the center region between contracting cell pairs in this process, which causes the concentration of fibers in the fiber bundles to become significantly enhanced. Using an extended lattice-based model, we show that viscoelasticity plays an essential role in ECM remodeling and contributes to the enhanced concentration in fiber bundles. We further characterize ECM plasticity within our model and verify our results with rheometer experiments.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chelaru, Teodor-Viorel, E-mail: teodor.chelaru@upb.ro; Chelaru, Adrian, E-mail: achelaru@incas.ro

    The paper purpose is to present some aspects regarding the control system of unmanned aerial vehicle - UAV, used to local observations, surveillance and monitoring interest area. The calculus methodology allows a numerical simulation of UAV evolution in bad atmospheric conditions by using nonlinear model, as well as a linear one for obtaining guidance command. The UAV model which will be presented has six DOF (degrees of freedom), and autonomous control system. This theoretical development allows us to build stability matrix, command matrix and control matrix and finally to analyse the stability of autonomous UAV flight. A robust guidance system,more » based on uncoupled state will be evaluated for different fly conditions and the results will be presented. The flight parameters and guidance will be analysed.« less

  13. Derivation of stiffness matrix in constitutive modeling of magnetorheological elastomer

    NASA Astrophysics Data System (ADS)

    Leng, D.; Sun, L.; Sun, J.; Lin, Y.

    2013-02-01

    Magnetorheological elastomers (MREs) are a class of smart materials whose mechanical properties change instantly by the application of a magnetic field. Based on the specially orthotropic, transversely isotropic stress-strain relationships and effective permeability model, the stiffness matrix of constitutive equations for deformable chain-like MRE is considered. To valid the components of shear modulus in this stiffness matrix, the magnetic-structural simulations with finite element method (FEM) are presented. An acceptable agreement is illustrated between analytical equations and numerical simulations. For the specified magnetic field, sphere particle radius, distance between adjacent particles in chains and volume fractions of ferrous particles, this constitutive equation is effective to engineering application to estimate the elastic behaviour of chain-like MRE in an external magnetic field.

  14. Testability analysis on a hydraulic system in a certain equipment based on simulation model

    NASA Astrophysics Data System (ADS)

    Zhang, Rui; Cong, Hua; Liu, Yuanhong; Feng, Fuzhou

    2018-03-01

    Aiming at the problem that the complicated structure and the shortage of fault statistics information in hydraulic systems, a multi value testability analysis method based on simulation model is proposed. Based on the simulation model of AMESim, this method injects the simulated faults and records variation of test parameters ,such as pressure, flow rate, at each test point compared with those under normal conditions .Thus a multi-value fault-test dependency matrix is established. Then the fault detection rate (FDR) and fault isolation rate (FIR) are calculated based on the dependency matrix. Finally the system of testability and fault diagnosis capability are analyzed and evaluated, which can only reach a lower 54%(FDR) and 23%(FIR). In order to improve testability performance of the system,. number and position of the test points are optimized on the system. Results show the proposed test placement scheme can be used to solve the problems that difficulty, inefficiency and high cost in the system maintenance.

  15. Automatic segmentation of right ventricular ultrasound images using sparse matrix transform and a level set

    NASA Astrophysics Data System (ADS)

    Qin, Xulei; Cong, Zhibin; Fei, Baowei

    2013-11-01

    An automatic segmentation framework is proposed to segment the right ventricle (RV) in echocardiographic images. The method can automatically segment both epicardial and endocardial boundaries from a continuous echocardiography series by combining sparse matrix transform, a training model, and a localized region-based level set. First, the sparse matrix transform extracts main motion regions of the myocardium as eigen-images by analyzing the statistical information of the images. Second, an RV training model is registered to the eigen-images in order to locate the position of the RV. Third, the training model is adjusted and then serves as an optimized initialization for the segmentation of each image. Finally, based on the initializations, a localized, region-based level set algorithm is applied to segment both epicardial and endocardial boundaries in each echocardiograph. Three evaluation methods were used to validate the performance of the segmentation framework. The Dice coefficient measures the overall agreement between the manual and automatic segmentation. The absolute distance and the Hausdorff distance between the boundaries from manual and automatic segmentation were used to measure the accuracy of the segmentation. Ultrasound images of human subjects were used for validation. For the epicardial and endocardial boundaries, the Dice coefficients were 90.8 ± 1.7% and 87.3 ± 1.9%, the absolute distances were 2.0 ± 0.42 mm and 1.79 ± 0.45 mm, and the Hausdorff distances were 6.86 ± 1.71 mm and 7.02 ± 1.17 mm, respectively. The automatic segmentation method based on a sparse matrix transform and level set can provide a useful tool for quantitative cardiac imaging.

  16. Linearized T-Matrix and Mie Scattering Computations

    NASA Technical Reports Server (NTRS)

    Spurr, R.; Wang, J.; Zeng, J.; Mishchenko, M. I.

    2011-01-01

    We present a new linearization of T-Matrix and Mie computations for light scattering by non-spherical and spherical particles, respectively. In addition to the usual extinction and scattering cross-sections and the scattering matrix outputs, the linearized models will generate analytical derivatives of these optical properties with respect to the real and imaginary parts of the particle refractive index, and (for non-spherical scatterers) with respect to the ''shape'' parameter (the spheroid aspect ratio, cylinder diameter/height ratio, Chebyshev particle deformation factor). These derivatives are based on the essential linearity of Maxwell's theory. Analytical derivatives are also available for polydisperse particle size distribution parameters such as the mode radius. The T-matrix formulation is based on the NASA Goddard Institute for Space Studies FORTRAN 77 code developed in the 1990s. The linearized scattering codes presented here are in FORTRAN 90 and will be made publicly available.

  17. Sparse Matrix Motivated Reconstruction of Far-Field Radiation Patterns

    DTIC Science & Technology

    2015-03-01

    method for base - station antenna radiation patterns. IEEE Antennas Propagation Magazine. 2001;43(2):132. 4. Vasiliadis TG, Dimitriou D, Sergiadis JD...algorithm based on sparse representations of radiation patterns using the inverse Discrete Fourier Transform (DFT) and the inverse Discrete Cosine...patterns using a Model- Based Parameter Estimation (MBPE) technique that reduces the computational time required to model radiation patterns. Another

  18. Effect of nano-SiO{sub 2} particles and curing time on development of fiber-matrix bond properties and microstructure of ultra-high strength concrete

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Zemei; Department of Civil, Architectural and Environmental Engineering, Missouri University of Science and Technology, Rolla 65409, MO; Khayat, Kamal Henri, E-mail: khayatk@mst.edu

    Bond properties between fibers and cementitious matrix have significant effect on the mechanical behavior of composite materials. In this study, the development of steel fiber-matrix interfacial bond properties in ultra-high strength concrete (UHSC) proportioned with nano-SiO{sub 2} varying between 0 and 2%, by mass of cementitious materials, was investigated. A statistical model relating either bond strength or pullout energy to curing time and nano-SiO{sub 2} content was proposed by using the response surface methodology. Mercury intrusion porosimetry (MIP) and backscatter scanning electron microscopy (BSEM) were used to characterize the microstructure of the matrix and the fiber-matrix interface, respectively. Micro-hardness aroundmore » the embedded fiber and hydration products of the matrix were evaluated as well. Test results indicated that the optimal nano-SiO{sub 2} dosage was 1% in terms of the bond properties and the microstructure. The proposed quadratic model efficiently predicted the bond strength and pullout energy with consideration of curing time and nano-SiO{sub 2} content. The improvement in bond properties associated with nano-silica was correlated with denser matrix and/or interface and stronger bond and greater strength of hydration products based on microstructural analysis.« less

  19. 3D model of a matrix source of negative ions: RF driving by a large area planar coil

    NASA Astrophysics Data System (ADS)

    Demerdzhiev, A.; Lishev, St.; Tarnev, Kh.; Shivarova, A.

    2015-04-01

    Based on three-dimensional (3D) modeling, different manners of a planar-coil inductive discharge driving of a plasma source completed as a matrix of small-radius hydrogen discharges are studied regarding a proper choice of an efficient and alike rf power deposition into the separate discharges of the matrix. Driving the whole matrix by a single coil and splitting it to blocks of discharge tubes, with single coil driving of each block, are the two cases considered. The results from the self-consistent model presented for a block of discharge tubes show its reliability in ensuring the same spatial distribution of the plasma parameters in the discharges completing the block. Since regarding the construction of the matrix, its driving as a whole by a single coil is the most reasonable decision, three modifications of the coil design have been tested: two zigzag coils with straight conductors passing, respectively, between and through the bottoms of the discharge tubes and a coil with an "omega" shaped conductor on the bottom of each tube. Among these three configurations, the latter ‒ a coil with an Ω-shaped conductor on the bottom of each tube ‒ shows up with the highest rf efficiency of an inductive discharge driving, shown by results for the rf current induced in the discharges obtained from an electrodynamical description. In all the cases considered the spatial distribution of the induced current density is analysed based on the manner of the penetration into the plasma of the wave field sustaining the inductive discharges.

  20. Cause and cure of sloppiness in ordinary differential equation models.

    PubMed

    Tönsing, Christian; Timmer, Jens; Kreutz, Clemens

    2014-08-01

    Data-based mathematical modeling of biochemical reaction networks, e.g., by nonlinear ordinary differential equation (ODE) models, has been successfully applied. In this context, parameter estimation and uncertainty analysis is a major task in order to assess the quality of the description of the system by the model. Recently, a broadened eigenvalue spectrum of the Hessian matrix of the objective function covering orders of magnitudes was observed and has been termed as sloppiness. In this work, we investigate the origin of sloppiness from structures in the sensitivity matrix arising from the properties of the model topology and the experimental design. Furthermore, we present strategies using optimal experimental design methods in order to circumvent the sloppiness issue and present nonsloppy designs for a benchmark model.

  1. Cause and cure of sloppiness in ordinary differential equation models

    NASA Astrophysics Data System (ADS)

    Tönsing, Christian; Timmer, Jens; Kreutz, Clemens

    2014-08-01

    Data-based mathematical modeling of biochemical reaction networks, e.g., by nonlinear ordinary differential equation (ODE) models, has been successfully applied. In this context, parameter estimation and uncertainty analysis is a major task in order to assess the quality of the description of the system by the model. Recently, a broadened eigenvalue spectrum of the Hessian matrix of the objective function covering orders of magnitudes was observed and has been termed as sloppiness. In this work, we investigate the origin of sloppiness from structures in the sensitivity matrix arising from the properties of the model topology and the experimental design. Furthermore, we present strategies using optimal experimental design methods in order to circumvent the sloppiness issue and present nonsloppy designs for a benchmark model.

  2. A novel physical eco-hydrological model concept for preferential flow based on experimental applications.

    NASA Astrophysics Data System (ADS)

    Jackisch, Conrad; van Schaik, Loes; Graeff, Thomas; Zehe, Erwin

    2014-05-01

    Preferential flow through macropores often determines hydrological characteristics - especially regarding runoff generation and fast transport of solutes. Macropore settings may yet be very different in nature and dynamics, depending on their origin. While biogenic structures follow activity cycles (e.g. earth worms) and population conditions (e.g. roots), pedogenic and geogenic structures may depend on water stress (e.g. cracks) or large events (e.g. flushed voids between skeleton and soil pipes) or simply persist (e.g. bedrock interface). On the one hand, such dynamic site characteristics can be observed in seasonal changes in its reaction to precipitation. On the other hand, sprinkling experiments accompanied by tracers or time-lapse 3D Ground-Penetrating-Radar are suitable tools to determine infiltration patterns and macropore configuration. However, model representation of the macropore-matrix system is still problematic, because models either rely on effective parameters (assuming well-mixed state) or on explicit advection strongly simplifying or neglecting interaction with the diffusive flow domain. Motivated by the dynamic nature of macropores, we present a novel model approach for interacting diffusive and advective water, solutes and energy transport in structured soils. It solely relies on scale- and process-aware observables. A representative set of macropores (data from sprinkling experiments) determines the process model scale through 1D advective domains. These are connected to a 2D matrix domain which is defined by pedo-physical retention properties. Water is represented as particles. Diffusive flow is governed by a 2D random walk of these particles while advection may take place in the macropore domain. Macropore-matrix interaction is computed as dissipation of the advective momentum of a particle by its experienced drag from the matrix domain. Through a representation of matrix and macropores as connected diffusive and advective domains for water transport we open up double domain concepts linking porescale physics to preferential macroscale fingerprints without effective parameterisation or mixing assumptions. Moreover, solute transport, energy balance aspects and lateral heterogeneity in soil moisture distribution are intrinsically captured. In addition, macropore and matrix domain settings may change over time based on physical and stochastic observations. The representativity concept allows scaleability from plotscale to the lower mesoscale.

  3. Development of controlled drug release systems based on thiolated polymers.

    PubMed

    Bernkop-Schnürch, A; Scholler, S; Biebel, R G

    2000-05-03

    The purpose of the present study was to generate mucoadhesive matrix-tablets based on thiolated polymers. Mediated by a carbodiimide, L-cysteine was thereby covalently linked to polycarbophil (PCP) and sodium carboxymethylcellulose (CMC). The resulting thiolated polymers displayed 100+/-8 and 1280+/-84 micromol thiol groups per gram, respectively (means+/-S.D.; n=6-8). In aqueous solutions these modified polymers were capable of forming inter- and/or intramolecular disulfide bonds. The velocity of this process augmented with increase of the polymer- and decrease of the proton-concentration. The oxidation proceeded more rapidly within thiolated PCP than within thiolated CMC. Due to the formation of disulfide bonds within thiol-containing polymers, the stability of matrix-tablets based on such polymers could be strongly improved. Whereas tablets based on the corresponding unmodified polymer disintegrated within 2 h, the swollen carrier matrix of thiolated CMC and PCP remained stable for 6.2 h (mean, n=4) and more than 48 h, respectively. Release studies of the model drug rifampicin demonstrated that a controlled release can be provided by thiolated polymer tablets. The combination of high stability, controlled drug release and mucoadhesive properties renders matrix-tablets based on thiolated polymers useful as novel drug delivery systems.

  4. A Transfer Hamiltonian Model for Devices Based on Quantum Dot Arrays

    PubMed Central

    Illera, S.; Prades, J. D.; Cirera, A.; Cornet, A.

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide. PMID:25879055

  5. A transfer hamiltonian model for devices based on quantum dot arrays.

    PubMed

    Illera, S; Prades, J D; Cirera, A; Cornet, A

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide.

  6. Investigate the plant biomass response to climate warming in permafrost ecosystem using matrix-based data assimilation

    NASA Astrophysics Data System (ADS)

    Lu, X.; Du, Z.; Schuur, E.; Luo, Y.

    2017-12-01

    Permafrost is one of the most vulnerable regions on the earth with over 40% world soil C represented in this region. Future climate warming potentially has a great impact on this region. On one hand, rising temperature accelerates permafrost soil thaw and release more C from land. On the other hand, warming may also increase the plant growing season length and therefore negatively feedback to climate change by increasing annual land C uptake. However, whether permafrost vegetation biomass change in response to warming can sequester more C has not been well understood. Manipulated air warming experiments reported that air warming has very limited impacts on grass land productivity and biomass growth in permafrost region [Mauritz et al., 2017]. It is hard to reveal the mechanisms behind the limited air warming response directly from experiment data. We employ a vegetation C cycle matrix model based on Community land model 4.5 (CLM4.5) and data assimilation technique to investigate how much do phenology and physiology processes contribute to the response respectively. Our results indicate phenology contributes the most in response to warming. The shift of vegetation parameter distributions after 2012 indicate vegetation acclimation may explain the modest response in plant biomass to air warming. The results suggest future model development need to take vegetation acclimation more seriously. The novel matrix-based model allows data assimilation to be conducted more efficiently. It provides more functional understanding of the models as well as the mechanism behind experiment data.

  7. Estimation and Q-Matrix Validation for Diagnostic Classification Models

    ERIC Educational Resources Information Center

    Feng, Yuling

    2013-01-01

    Diagnostic classification models (DCMs) are structured latent class models widely discussed in the field of psychometrics. They model subjects' underlying attribute patterns and classify subjects into unobservable groups based on their mastery of attributes required to answer the items correctly. The effective implementation of DCMs depends…

  8. Observer-Based Discrete-Time Nonnegative Edge Synchronization of Networked Systems.

    PubMed

    Su, Housheng; Wu, Han; Chen, Xia

    2017-10-01

    This paper studies the multi-input and multi-output discrete-time nonnegative edge synchronization of networked systems based on neighbors' output information. The communication relationship among the edges of networked systems is modeled by well-known line graph. Two observer-based edge synchronization algorithms are designed, for which some necessary and sufficient synchronization conditions are derived. Moreover, some computable sufficient synchronization conditions are obtained, in which the feedback matrix and the observer matrix are computed by solving the linear programming problems. We finally design several simulation examples to demonstrate the validity of the given nonnegative edge synchronization algorithms.

  9. Tests of conformal field theory at the Yang-Lee singularity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wydro, Tomasz; McCabe, John F.

    2009-12-14

    This paper studies the Yang-Lee edge singularity of 2-dimensional (2D) Ising model based on a quantum spin chain and transfer matrix measurements on the cylinder. Based on finite-size scaling, the low-lying excitation spectrum is found at the Yang-Lee edge singularity. Based on transfer matrix techniques, the single structure constant is evaluated at the Yang-Lee edge singularity. The results of both types of measurements are found to be fully consistent with the predictions for the (A{sub 4}, A{sub 1}) minimal conformal field theory, which was previously identified with this critical point.

  10. Efficient and robust compositional two-phase reservoir simulation in fractured media

    NASA Astrophysics Data System (ADS)

    Zidane, A.; Firoozabadi, A.

    2015-12-01

    Compositional and compressible two-phase flow in fractured media has wide applications including CO2 injection. Accurate simulations are currently based on the discrete fracture approach using the cross-flow equilibrium model. In this approach the fractures and a small part of the matrix blocks are combined to form a grid cell. The major drawback is low computational efficiency. In this work we use the discrete-fracture approach to model the fractures where the fracture entities are described explicitly in the computational domain. We use the concept of cross-flow equilibrium in the fractures (FCFE). This allows using large matrix elements in the neighborhood of the fractures. We solve the fracture transport equations implicitly to overcome the Courant-Freidricks-Levy (CFL) condition in the small fracture elements. Our implicit approach is based on calculation of the derivative of the molar concentration of component i in phase (cαi ) with respect to the total molar concentration (ci ) at constant volume V and temperature T. This contributes to significant speed up of the code. The hybrid mixed finite element method (MFE) is used to solve for the velocity in both the matrix and the fractures coupled with the discontinuous Galerkin (DG) method to solve the species transport equations in the matrix, and a finite volume (FV) discretization in the fractures. In large scale problems the proposed approach is orders of magnitude faster than the existing models.

  11. Theoretic aspects of the identification of the parameters in the optimal control model

    NASA Technical Reports Server (NTRS)

    Vanwijk, R. A.; Kok, J. J.

    1977-01-01

    The identification of the parameters of the optimal control model from input-output data of the human operator is considered. Accepting the basic structure of the model as a cascade of a full-order observer and a feedback law, and suppressing the inherent optimality of the human controller, the parameters to be identified are the feedback matrix, the observer gain matrix, and the intensity matrices of the observation noise and the motor noise. The identification of the parameters is a statistical problem, because the system and output are corrupted by noise, and therefore the solution must be based on the statistics (probability density function) of the input and output data of the human operator. However, based on the statistics of the input-output data of the human operator, no distinction can be made between the observation and the motor noise, which shows that the model suffers from overparameterization.

  12. A numerical scheme based on radial basis function finite difference (RBF-FD) technique for solving the high-dimensional nonlinear Schrödinger equations using an explicit time discretization: Runge-Kutta method

    NASA Astrophysics Data System (ADS)

    Dehghan, Mehdi; Mohammadi, Vahid

    2017-08-01

    In this research, we investigate the numerical solution of nonlinear Schrödinger equations in two and three dimensions. The numerical meshless method which will be used here is RBF-FD technique. The main advantage of this method is the approximation of the required derivatives based on finite difference technique at each local-support domain as Ωi. At each Ωi, we require to solve a small linear system of algebraic equations with a conditionally positive definite matrix of order 1 (interpolation matrix). This scheme is efficient and its computational cost is same as the moving least squares (MLS) approximation. A challengeable issue is choosing suitable shape parameter for interpolation matrix in this way. In order to overcome this matter, an algorithm which was established by Sarra (2012), will be applied. This algorithm computes the condition number of the local interpolation matrix using the singular value decomposition (SVD) for obtaining the smallest and largest singular values of that matrix. Moreover, an explicit method based on Runge-Kutta formula of fourth-order accuracy will be applied for approximating the time variable. It also decreases the computational costs at each time step since we will not solve a nonlinear system. On the other hand, to compare RBF-FD method with another meshless technique, the moving kriging least squares (MKLS) approximation is considered for the studied model. Our results demonstrate the ability of the present approach for solving the applicable model which is investigated in the current research work.

  13. Modeling and life prediction methodology for Titanium Matrix Composites subjected to mission profiles

    NASA Technical Reports Server (NTRS)

    Mirdamadi, M.; Johnson, W. S.

    1994-01-01

    Titanium matrix composites (TMC) are being evaluated as structural materials for elevated temperature applications in future generation hypersonic vehicles. In such applications, TMC components are subjected to complex thermomechanical loading profiles at various elevated temperatures. Therefore, thermomechanical fatigue (TMF) testing, using a simulated mission profile, is essential for evaluation and development of life prediction methodologies. The objective of the research presented in this paper was to evaluate the TMF response of the (0/90)2s SCS-6/Timetal-21S subjected to a generic hypersonic flight profile and its portions with a temperature ranging from -130 C to 816 C. It was found that the composite modulus, prior to rapid degradation, had consistent values for all the profiles tested. A micromechanics based analysis was used to predict the stress-strain response of the laminate and of the constituents in each ply during thermomechanical loading conditions by using only constituent properties as input. The fiber was modeled as elastic with transverse orthotropic and temperature dependent properties. The matrix was modeled using a thermoviscoplastic constitutive relation. In the analysis, the composite modulus degradation was assumed to result from matrix cracking and was modeled by reducing the matrix modulus. Fatigue lives of the composite subjected to the complex generic hypersonic flight profile were well correlated using the predicted stress in 0 degree fibers.

  14. T-matrix modeling of linear depolarization by morphologically complex soot and soot-containing aerosols

    NASA Astrophysics Data System (ADS)

    Mishchenko, Michael I.; Liu, Li; Mackowski, Daniel W.

    2013-07-01

    We use state-of-the-art public-domain Fortran codes based on the T-matrix method to calculate orientation and ensemble averaged scattering matrix elements for a variety of morphologically complex black carbon (BC) and BC-containing aerosol particles, with a special emphasis on the linear depolarization ratio (LDR). We explain theoretically the quasi-Rayleigh LDR peak at side-scattering angles typical of low-density soot fractals and conclude that the measurement of this feature enables one to evaluate the compactness state of BC clusters and trace the evolution of low-density fluffy fractals into densely packed aggregates. We show that small backscattering LDRs measured with ground-based, airborne, and spaceborne lidars for fresh smoke generally agree with the values predicted theoretically for fluffy BC fractals and densely packed near-spheroidal BC aggregates. To reproduce higher lidar LDRs observed for aged smoke, one needs alternative particle models such as shape mixtures of BC spheroids or cylinders.

  15. Tracer Movement in a Single Fissure in Granitic Rock: Some Experimental Results and Their Interpretation

    NASA Astrophysics Data System (ADS)

    Neretnieks, Ivars; Eriksen, Tryggve; TäHtinen, PäIvi

    1982-08-01

    Radionuclide migration was studied in a natural fissure in a granite core. The fissure was oriented parallel to the axis in a cylindrical core 30 cm long and 20 cm in diameter. The traced solution was injected at one end of the core and collected at the other. Breakthrough curves were obtained for the nonsorbing tracers, tritiated water, and a large-molecular-weight lignosulphonate molecule and for the sorbing tracers, cesium and strontium. From the breakthrough curves for the nonsorbing tracers it could be concluded that channeling occurs in the single fissure. A `dispersion' model based on channeling is presented. The results from the sorbing tracers indicate that there is substantial diffusion into and sorption in the rock matrix. Sorption on the surface of the fissure also accounts for a part of the retardation effect of the sorbing species. A model which includes the mechanisms of channeling, surface sorption, matrix diffusion, and matrix sorption is presented. The experimental breakthrough curves can be fitted fairly well by this model by use of independently obtained data on diffusivities and matrix sorption.

  16. Micromechanics Modeling of Composites Subjected to Multiaxial Progressive Damage in the Constituents

    NASA Technical Reports Server (NTRS)

    Bednarcyk, Brett A.; Aboudi, Jacob; Amold, Steven M.

    2010-01-01

    The high-fidelity generalized method of cells composite micromechanics model is extended to include constituent-scale progressive damage via a proposed damage model. The damage model assumes that all material nonlinearity is due to damage in the form of reduced stiffness, and it uses six scalar damage variables (three for tension and three for compression) to track the damage. Damage strains are introduced that account for interaction among the strain components and that also allow the development of the damage evolution equations based on the constituent material uniaxial stress strain response. Local final-failure criteria are also proposed based on mode-specific strain energy release rates and total dissipated strain energy. The coupled micromechanics-damage model described herein is applied to a unidirectional E-glass/epoxy composite and a proprietary polymer matrix composite. Results illustrate the capability of the coupled model to capture the vastly different character of the monolithic (neat) resin matrix and the composite in response to far-field tension, compression, and shear loading.

  17. H∞ memory feedback control with input limitation minimization for offshore jacket platform stabilization

    NASA Astrophysics Data System (ADS)

    Yang, Jia Sheng

    2018-06-01

    In this paper, we investigate a H∞ memory controller with input limitation minimization (HMCIM) for offshore jacket platforms stabilization. The main objective of this study is to reduce the control consumption as well as protect the actuator when satisfying the requirement of the system performance. First, we introduce a dynamic model of offshore platform with low order main modes based on mode reduction method in numerical analysis. Then, based on H∞ control theory and matrix inequality techniques, we develop a novel H∞ memory controller with input limitation. Furthermore, a non-convex optimization model to minimize input energy consumption is proposed. Since it is difficult to solve this non-convex optimization model by optimization algorithm, we use a relaxation method with matrix operations to transform this non-convex optimization model to be a convex optimization model. Thus, it could be solved by a standard convex optimization solver in MATLAB or CPLEX. Finally, several numerical examples are given to validate the proposed models and methods.

  18. Integrated modeling and heat treatment simulation of austempered ductile iron

    NASA Astrophysics Data System (ADS)

    Hepp, E.; Hurevich, V.; Schäfer, W.

    2012-07-01

    The integrated modeling and simulation of the casting and heat treatment processes for producing austempered ductile iron (ADI) castings is presented. The focus is on describing different models to simulate the austenitization, quenching and austempering steps during ADI heat treatment. The starting point for the heat treatment simulation is the simulated microstructure after solidification and cooling. The austenitization model considers the transformation of the initial ferrite-pearlite matrix into austenite as well as the dissolution of graphite in austenite to attain a uniform carbon distribution. The quenching model is based on measured CCT diagrams. Measurements have been carried out to obtain these diagrams for different alloys with varying Cu, Ni and Mo contents. The austempering model includes nucleation and growth kinetics of the ADI matrix. The model of ADI nucleation is based on experimental measurements made for varied Cu, Ni, Mo contents and austempering temperatures. The ADI kinetic model uses a diffusion controlled approach to model the growth. The models have been integrated in a tool for casting process simulation. Results are shown for the optimization of the heat treatment process of a planetary carrier casting.

  19. Third generation biosensing matrix based on Fe-implanted ZnO thin film

    NASA Astrophysics Data System (ADS)

    Saha, Shibu; Gupta, Vinay; Sreenivas, K.; Tan, H. H.; Jagadish, C.

    2010-09-01

    Third generation biosensor based on Fe-implanted ZnO (Fe-ZnO) thin film has been demonstrated. Implantation of Fe in rf-sputtered ZnO thin film introduces redox center along with shallow donor level and thereby enhance its electron transfer property. Glucose oxidase (GOx), chosen as model enzyme, has been immobilized on the surface of the matrix. Cyclic voltammetry and photometric assay show that the prepared bioelectrode, GOx/Fe-ZnO/ITO/Glass is sensitive to the glucose concentration with enhanced response of 0.326 μA mM-1 cm-2 and low Km of 2.76 mM. The results show promising application of Fe-implanted ZnO thin film as an attractive matrix for third generation biosensing.

  20. Stochastic optimal operation of reservoirs based on copula functions

    NASA Astrophysics Data System (ADS)

    Lei, Xiao-hui; Tan, Qiao-feng; Wang, Xu; Wang, Hao; Wen, Xin; Wang, Chao; Zhang, Jing-wen

    2018-02-01

    Stochastic dynamic programming (SDP) has been widely used to derive operating policies for reservoirs considering streamflow uncertainties. In SDP, there is a need to calculate the transition probability matrix more accurately and efficiently in order to improve the economic benefit of reservoir operation. In this study, we proposed a stochastic optimization model for hydropower generation reservoirs, in which 1) the transition probability matrix was calculated based on copula functions; and 2) the value function of the last period was calculated by stepwise iteration. Firstly, the marginal distribution of stochastic inflow in each period was built and the joint distributions of adjacent periods were obtained using the three members of the Archimedean copulas, based on which the conditional probability formula was derived. Then, the value in the last period was calculated by a simple recursive equation with the proposed stepwise iteration method and the value function was fitted with a linear regression model. These improvements were incorporated into the classic SDP and applied to the case study in Ertan reservoir, China. The results show that the transition probability matrix can be more easily and accurately obtained by the proposed copula function based method than conventional methods based on the observed or synthetic streamflow series, and the reservoir operation benefit can also be increased.

  1. Partially coherent electron transport in terahertz quantum cascade lasers based on a Markovian master equation for the density matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jonasson, O.; Karimi, F.; Knezevic, I.

    2016-08-01

    We derive a Markovian master equation for the single-electron density matrix, applicable to quantum cascade lasers (QCLs). The equation conserves the positivity of the density matrix, includes off-diagonal elements (coherences) as well as in-plane dynamics, and accounts for electron scattering with phonons and impurities. We use the model to simulate a terahertz-frequency QCL, and compare the results with both experiment and simulation via nonequilibrium Green's functions (NEGF). We obtain very good agreement with both experiment and NEGF when the QCL is biased for optimal lasing. For the considered device, we show that the magnitude of coherences can be a significantmore » fraction of the diagonal matrix elements, which demonstrates their importance when describing THz QCLs. We show that the in-plane energy distribution can deviate far from a heated Maxwellian distribution, which suggests that the assumption of thermalized subbands in simplified density-matrix models is inadequate. As a result, we also show that the current density and subband occupations relax towards their steady-state values on very different time scales.« less

  2. Density matrix approach to the hot-electron stimulated photodesorption

    NASA Astrophysics Data System (ADS)

    Kühn, Oliver; May, Volkhard

    1996-07-01

    The dissipative dynamics of the laser-induced nonthermal desorption of small molecules from a metal surface is investigated here. Based on the density matrix formalism a multi-state model is introduced which explicitly takes into account the continuum of electronic states in the metal. Various relaxation mechanisms for the electronic degrees of freedom are shown to govern the desorption dynamics and hence the desorption probability. Particular attention is paid to the modeling of the time dependence of the electron energy distribution in the metal which reflects different excitation conditions.

  3. Implementation of Laminate Theory Into Strain Rate Dependent Micromechanics Analysis of Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.

    2000-01-01

    A research program is in progress to develop strain rate dependent deformation and failure models for the analysis of polymer matrix composites subject to impact loads. Previously, strain rate dependent inelastic constitutive equations developed to model the polymer matrix were implemented into a mechanics of materials based micromechanics method. In the current work, the computation of the effective inelastic strain in the micromechanics model was modified to fully incorporate the Poisson effect. The micromechanics equations were also combined with classical laminate theory to enable the analysis of symmetric multilayered laminates subject to in-plane loading. A quasi-incremental trapezoidal integration method was implemented to integrate the constitutive equations within the laminate theory. Verification studies were conducted using an AS4/PEEK composite using a variety of laminate configurations and strain rates. The predicted results compared well with experimentally obtained values.

  4. Probing the Structure of {sup 74}Ge Nucleus with Coupled-channels Analysis of {sup 74}Ge+{sup 74}Ge Fusion Reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zamrun F, Muhammad; Jurusan Fisika FMIPA, Universitas Haluoleo, Kendari, Sulawesi Tenggara, 93232; Kasim, Hasan Abu

    2010-12-23

    We study the fusion reaction of the {sup 74}Ge+{sup 74}Ge system in term of the full order coupled-channels formalism. We especially calculated the fusion cross section as well as the fusion barrier distribution of this reaction using transition matrix suggested by recent Coulomb excitation experiment. We compare the results with the one obtained by coupling matrix based on pure vibrational and rotational models. The present coupled-channels calculations for the barrier distributions obtained using experiment coupling matrix is in good agreement with the one obtained with vibrational model, in contrast to the rotational model. This is indicates that {sup 74}Ge nucleusmore » favor a spherical shape than a deformed shape in its ground state. Our results will resolve the debates concerning the structure of this nucleus.« less

  5. Geostatistical borehole image-based mapping of karst-carbonate aquifer pores

    USGS Publications Warehouse

    Michael Sukop,; Cunningham, Kevin J.

    2016-01-01

    Quantification of the character and spatial distribution of porosity in carbonate aquifers is important as input into computer models used in the calculation of intrinsic permeability and for next-generation, high-resolution groundwater flow simulations. Digital, optical, borehole-wall image data from three closely spaced boreholes in the karst-carbonate Biscayne aquifer in southeastern Florida are used in geostatistical experiments to assess the capabilities of various methods to create realistic two-dimensional models of vuggy megaporosity and matrix-porosity distribution in the limestone that composes the aquifer. When the borehole image data alone were used as the model training image, multiple-point geostatistics failed to detect the known spatial autocorrelation of vuggy megaporosity and matrix porosity among the three boreholes, which were only 10 m apart. Variogram analysis and subsequent Gaussian simulation produced results that showed a realistic conceptualization of horizontal continuity of strata dominated by vuggy megaporosity and matrix porosity among the three boreholes.

  6. Probabilistic micromechanics for metal matrix composites

    NASA Astrophysics Data System (ADS)

    Engelstad, S. P.; Reddy, J. N.; Hopkins, Dale A.

    A probabilistic micromechanics-based nonlinear analysis procedure is developed to predict and quantify the variability in the properties of high temperature metal matrix composites. Monte Carlo simulation is used to model the probabilistic distributions of the constituent level properties including fiber, matrix, and interphase properties, volume and void ratios, strengths, fiber misalignment, and nonlinear empirical parameters. The procedure predicts the resultant ply properties and quantifies their statistical scatter. Graphite copper and Silicon Carbide Titanlum Aluminide (SCS-6 TI15) unidirectional plies are considered to demonstrate the predictive capabilities. The procedure is believed to have a high potential for use in material characterization and selection to precede and assist in experimental studies of new high temperature metal matrix composites.

  7. Effects of Adiabatic Heating on the High Strain Rate Deformation of Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Sorini, Chris; Chattopadhyay, Aditi; Goldberg, Robert K.

    2017-01-01

    Polymer matrix composites (PMCs) are increasingly being used in aerospace structures that are expected to experience complex dynamic loading conditions throughout their lifetime. As such, a detailed understanding of the high strain rate behavior of the constituents, particularly the strain rate, temperature, and pressure dependent polymer matrix, is paramount. In this paper, preliminary efforts in modeling experimentally observed temperature rises due to plastic deformation in PMCs subjected to dynamic loading are presented. To this end, an existing isothermal viscoplastic polymer constitutive formulation is extended to model adiabatic conditions by incorporating temperature dependent elastic properties and modifying the components of the inelastic strain rate tensor to explicitly depend on temperature. It is demonstrated that the modified polymer constitutive model is capable of capturing strain rate and temperature dependent yield as well as thermal softening associated with the conversion of plastic work to heat at high rates of strain. The modified constitutive model is then embedded within a strength of materials based micromechanics framework to investigate the manifestation of matrix thermal softening, due to the conversion of plastic work to heat, on the high strain rate response of a T700Epon 862 (T700E862) unidirectional composite. Adiabatic model predictions for high strain rate composite longitudinal tensile, transverse tensile, and in-plane shear loading are presented. Results show a substantial deviation from isothermal conditions; significant thermal softening is observed for matrix dominated deformation modes (transverse tension and in-plane shear), highlighting the importance of accounting for the conversion of plastic work to heat in the polymer matrix in the high strain rate analysis of PMC structures.

  8. Modeling extracellular matrix (ECM) alterations in ovarian cancer by multiphoton excited fabrication of stromal models (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Campagnola, Paul J.; Ajeti, Visar; Lara, Jorge; Eliceiri, Kevin W.; Patankar, Mansh

    2016-04-01

    A profound remodeling of the extracellular matrix (ECM) occurs in human ovarian cancer but it unknown how this affects tumor growth, where this understanding could lead to better diagnostics and therapeutic approaches. We investigate the role of these ECM alterations by using multiphoton excited (MPE) polymerization to fabricate biomimetic models to investigate operative cell-matrix interactions in invasion/metastasis. First, we create nano/microstructured gradients mimicking the basal lamina to study adhesion/migration dynamics of ovarian cancer cells of differing metastatic potential. We find a strong haptotactic response that depends on both contact guidance and ECM binding cues. While we found enhanced migration for more invasive cells, the specifics of alignment and directed migration also depend on cell polarity. We further use MPE fabrication to create collagen scaffolds with complex, 3D submicron morphology. The stromal scaffold designs are derived directly from "blueprints" based on SHG images of normal, high risk, and malignant ovarian tissues. The models are seeded with different cancer cell lines and this allows decoupling of the roles of cell characteristics (metastatic potential) and ECM structure and composition (normal vs cancer) on adhesion/migration dynamics. We found the malignant stroma structure promotes enhanced migration and proliferation and also cytoskeletal alignment. Creating synthetic models based on fibers patterns further allows decoupling the topographic roles of the fibers themselves vs their alignment within the tissue. These models cannot be synthesized by other conventional fabrication methods and we suggest the MPE image-based fabrication method will enable a variety of studies in cancer biology.

  9. Sulfur Solubility In Silicate Melts: A Thermochemical Model

    NASA Astrophysics Data System (ADS)

    Moretti, R.; Ottonello, G.

    A termochemical model for calculating sulfur solubility of simple and complex silicate melts has been developed in the framework of the Toop-Samis polymeric approach combined with a Flood - Grjotheim theoretical treatment of silicate slags [1,2]. The model allows one to compute sulfide and sulfate content of silicate melts whenever fugacity of gaseous sulphur is provided. "Electrically equivalent ion fractions" are needed to weigh the contribution of the various disproportion reactions of the type: MOmelt + 1/2S2 ,gas MSmelt+1/2O2 ,gas (1) MOmelt + 1/2S2 ,gas + 3/2O2 ,gas MSO4 ,melt (2) Eqs. 1 and 2 account for the oxide-sulfide and the oxide-sulfate disproportiona- tion in silicate melt. Electrically equivalent ion fractions are computed, in a fused salt Temkin notation, over the appropriate matrixes (anionic and cationic). The extension of such matrixes is calculated in the framework of a polymeric model previously developed [1,2,3] and based on a parameterization of acid-base properties of melts. No adjustable parameters are used and model activities follow the raoultian behavior implicit in the ion matrix solution of the Temkin notation. The model is based on a huge amount of data available in literature and displays a high heuristic capability with virtually no compositional limits, as long as the structural role assigned to each oxide holds. REFERENCES: [1] Ottonello G., Moretti R., Marini L. and Vetuschi Zuccolini M. (2001), Chem. Geol., 174, 157-179. [2] Moretti R. (2002) PhD Thesis, University of Pisa. [3] Ottonello G. (2001) J. Non-Cryst. Solids, 282, 72-85.

  10. An improved ray theory and transfer matrix method-based model for lightning electromagnetic pulses propagating in Earth-ionosphere waveguide and its applications

    NASA Astrophysics Data System (ADS)

    Qin, Zilong; Chen, Mingli; Zhu, Baoyou; Du, Ya-ping

    2017-01-01

    An improved ray theory and transfer matrix method-based model for a lightning electromagnetic pulse (LEMP) propagating in Earth-ionosphere waveguide (EIWG) is proposed and tested. The model involves the presentation of a lightning source, parameterization of the lower ionosphere, derivation of a transfer function representing all effects of EIWG on LEMP sky wave, and determination of attenuation mode of the LEMP ground wave. The lightning source is simplified as an electric point dipole standing on Earth surface with finite conductance. The transfer function for the sky wave is derived based on ray theory and transfer matrix method. The attenuation mode for the ground wave is solved from Fock's diffraction equations. The model is then applied to several lightning sferics observed in central China during day and night times within 1000 km. The results show that the model can precisely predict the time domain sky wave for all these observed lightning sferics. Both simulations and observations show that the lightning sferics in nighttime has a more complicated waveform than in daytime. Particularly, when a LEMP propagates from east to west (Φ = 270°) and in nighttime, its sky wave tends to be a double-peak waveform (dispersed sky wave) rather than a single peak one. Such a dispersed sky wave in nighttime may be attributed to the magneto-ionic splitting phenomenon in the lower ionosphere. The model provides us an efficient way for retrieving the electron density profile of the lower ionosphere and hence to monitor its spatial and temporal variations via lightning sferics.

  11. Realizing three generations of the Standard Model fermions in the type IIB matrix model

    NASA Astrophysics Data System (ADS)

    Aoki, Hajime; Nishimura, Jun; Tsuchiya, Asato

    2014-05-01

    We discuss how the Standard Model particles appear from the type IIB matrix model, which is considered to be a nonperturbative formulation of superstring theory. In particular, we are concerned with a constructive definition of the theory, in which we start with finite- N matrices and take the large- N limit afterwards. In that case, it was pointed out recently that realizing chiral fermions in the model is more difficult than it had been thought from formal arguments at N = ∞ and that introduction of a matrix version of the warp factor is necessary. Based on this new insight, we show that two generations of the Standard Model fermions can be realized by considering a rather generic configuration of fuzzy S2 and fuzzy S2 × S2 in the extra dimensions. We also show that three generations can be obtained by squashing one of the S2's that appear in the configuration. Chiral fermions appear at the intersections of the fuzzy manifolds with nontrivial Yukawa couplings to the Higgs field, which can be calculated from the overlap of their wave functions.

  12. Topological and kinetic determinants of the modal matrices of dynamic models of metabolism

    PubMed Central

    2017-01-01

    Large-scale kinetic models of metabolism are becoming increasingly comprehensive and accurate. A key challenge is to understand the biochemical basis of the dynamic properties of these models. Linear analysis methods are well-established as useful tools for characterizing the dynamic response of metabolic networks. Central to linear analysis methods are two key matrices: the Jacobian matrix (J) and the modal matrix (M-1) arising from its eigendecomposition. The modal matrix M-1 contains dynamically independent motions of the kinetic model near a reference state, and it is sparse in practice for metabolic networks. However, connecting the structure of M-1 to the kinetic properties of the underlying reactions is non-trivial. In this study, we analyze the relationship between J, M-1, and the kinetic properties of the underlying network for kinetic models of metabolism. Specifically, we describe the origin of mode sparsity structure based on features of the network stoichiometric matrix S and the reaction kinetic gradient matrix G. First, we show that due to the scaling of kinetic parameters in real networks, diagonal dominance occurs in a substantial fraction of the rows of J, resulting in simple modal structures with clear biological interpretations. Then, we show that more complicated modes originate from topologically-connected reactions that have similar reaction elasticities in G. These elasticities represent dynamic equilibrium balances within reactions and are key determinants of modal structure. The work presented should prove useful towards obtaining an understanding of the dynamics of kinetic models of metabolism, which are rooted in the network structure and the kinetic properties of reactions. PMID:29267329

  13. A neural network detection model of spilled oil based on the texture analysis of SAR image

    NASA Astrophysics Data System (ADS)

    An, Jubai; Zhu, Lisong

    2006-01-01

    A Radial Basis Function Neural Network (RBFNN) Model is investigated for the detection of spilled oil based on the texture analysis of SAR imagery. In this paper, to take the advantage of the abundant texture information of SAR imagery, the texture features are extracted by both wavelet transform and the Gray Level Co-occurrence matrix. The RBFNN Model is fed with a vector of these texture features. The RBFNN Model is trained and tested by the sample data set of the feature vectors. Finally, a SAR image is classified by this model. The classification results of a spilled oil SAR image show that the classification accuracy for oil spill is 86.2 by the RBFNN Model using both wavelet texture and gray texture, while the classification accuracy for oil spill is 78.0 by same RBFNN Model using only wavelet texture as the input of this RBFNN model. The model using both wavelet transform and the Gray Level Co-occurrence matrix is more effective than that only using wavelet texture. Furthermore, it keeps the complicated proximity and has a good performance of classification.

  14. The impact of different aperture distribution models and critical stress criteria on equivalent permeability in fractured rocks

    NASA Astrophysics Data System (ADS)

    Bisdom, Kevin; Bertotti, Giovanni; Nick, Hamidreza M.

    2016-05-01

    Predicting equivalent permeability in fractured reservoirs requires an understanding of the fracture network geometry and apertures. There are different methods for defining aperture, based on outcrop observations (power law scaling), fundamental mechanics (sublinear length-aperture scaling), and experiments (Barton-Bandis conductive shearing). Each method predicts heterogeneous apertures, even along single fractures (i.e., intrafracture variations), but most fractured reservoir models imply constant apertures for single fractures. We compare the relative differences in aperture and permeability predicted by three aperture methods, where permeability is modeled in explicit fracture networks with coupled fracture-matrix flow. Aperture varies along single fractures, and geomechanical relations are used to identify which fractures are critically stressed. The aperture models are applied to real-world large-scale fracture networks. (Sub)linear length scaling predicts the largest average aperture and equivalent permeability. Barton-Bandis aperture is smaller, predicting on average a sixfold increase compared to matrix permeability. Application of critical stress criteria results in a decrease in the fraction of open fractures. For the applied stress conditions, Coulomb predicts that 50% of the network is critically stressed, compared to 80% for Barton-Bandis peak shear. The impact of the fracture network on equivalent permeability depends on the matrix hydraulic properties, as in a low-permeable matrix, intrafracture connectivity, i.e., the opening along a single fracture, controls equivalent permeability, whereas for a more permeable matrix, absolute apertures have a larger impact. Quantification of fracture flow regimes using only the ratio of fracture versus matrix permeability is insufficient, as these regimes also depend on aperture variations within fractures.

  15. Molecular surface area based predictive models for the adsorption and diffusion of disperse dyes in polylactic acid matrix.

    PubMed

    Xu, Suxin; Chen, Jiangang; Wang, Bijia; Yang, Yiqi

    2015-11-15

    Two predictive models were presented for the adsorption affinities and diffusion coefficients of disperse dyes in polylactic acid matrix. Quantitative structure-sorption behavior relationship would not only provide insights into sorption process, but also enable rational engineering for desired properties. The thermodynamic and kinetic parameters for three disperse dyes were measured. The predictive model for adsorption affinity was based on two linear relationships derived by interpreting the experimental measurements with molecular structural parameters and compensation effect: ΔH° vs. dye size and ΔS° vs. ΔH°. Similarly, the predictive model for diffusion coefficient was based on two derived linear relationships: activation energy of diffusion vs. dye size and logarithm of pre-exponential factor vs. activation energy of diffusion. The only required parameters for both models are temperature and solvent accessible surface area of the dye molecule. These two predictive models were validated by testing the adsorption and diffusion properties of new disperse dyes. The models offer fairly good predictive ability. The linkage between structural parameter of disperse dyes and sorption behaviors might be generalized and extended to other similar polymer-penetrant systems. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Fully Associative, Nonisothermal, Potential-Based Unified Viscoplastic Model for Titanium-Based Matrices

    NASA Technical Reports Server (NTRS)

    2005-01-01

    A number of titanium matrix composite (TMC) systems are currently being investigated for high-temperature air frame and propulsion system applications. As a result, numerous computational methodologies for predicting both deformation and life for this class of materials are under development. An integral part of these methodologies is an accurate and computationally efficient constitutive model for the metallic matrix constituent. Furthermore, because these systems are designed to operate at elevated temperatures, the required constitutive models must account for both time-dependent and time-independent deformations. To accomplish this, the NASA Lewis Research Center is employing a recently developed, complete, potential-based framework. This framework, which utilizes internal state variables, was put forth for the derivation of reversible and irreversible constitutive equations. The framework, and consequently the resulting constitutive model, is termed complete because the existence of the total (integrated) form of the Gibbs complementary free energy and complementary dissipation potentials are assumed a priori. The specific forms selected here for both the Gibbs and complementary dissipation potentials result in a fully associative, multiaxial, nonisothermal, unified viscoplastic model with nonlinear kinematic hardening. This model constitutes one of many models in the Generalized Viscoplasticity with Potential Structure (GVIPS) class of inelastic constitutive equations.

  17. A Probabilistic Graphical Model to Detect Chromosomal Domains

    NASA Astrophysics Data System (ADS)

    Heermann, Dieter; Hofmann, Andreas; Weber, Eva

    To understand the nature of a cell, one needs to understand the structure of its genome. For this purpose, experimental techniques such as Hi-C detecting chromosomal contacts are used to probe the three-dimensional genomic structure. These experiments yield topological information, consistently showing a hierarchical subdivision of the genome into self-interacting domains across many organisms. Current methods for detecting these domains using the Hi-C contact matrix, i.e. a doubly-stochastic matrix, are mostly based on the assumption that the domains are distinct, thus non-overlapping. For overcoming this simplification and for being able to unravel a possible nested domain structure, we developed a probabilistic graphical model that makes no a priori assumptions on the domain structure. Within this approach, the Hi-C contact matrix is analyzed using an Ising like probabilistic graphical model whose coupling constant is proportional to each lattice point (entry in the contact matrix). The results show clear boundaries between identified domains and the background. These domain boundaries are dependent on the coupling constant, so that one matrix yields several clusters of different sizes, which show the self-interaction of the genome on different scales. This work was supported by a Grant from the International Human Frontier Science Program Organization (RGP0014/2014).

  18. Buses of Cuernavaca—an agent-based model for universal random matrix behavior minimizing mutual information

    NASA Astrophysics Data System (ADS)

    Warchoł, Piotr

    2018-06-01

    The public transportation system of Cuernavaca, Mexico, exhibits random matrix theory statistics. In particular, the fluctuation of times between the arrival of buses on a given bus stop, follows the Wigner surmise for the Gaussian unitary ensemble. To model this, we propose an agent-based approach in which each bus driver tries to optimize his arrival time to the next stop with respect to an estimated arrival time of his predecessor. We choose a particular form of the associated utility function and recover the appropriate distribution in numerical experiments for a certain value of the only parameter of the model. We then investigate whether this value of the parameter is otherwise distinguished within an information theoretic approach and give numerical evidence that indeed it is associated with a minimum of averaged pairwise mutual information.

  19. Damage Mechanics Model Development for Monocrystalline Superalloys (PREPRINT)

    DTIC Science & Technology

    2010-02-01

    ferrite , austenite, martensite , and pearlite) colonies in alloy steels [17-20]  the structure of pitch-based carbon foams [21]  the γ-γ...reinforced metal-matrix composites [15, 16]  microstructure (cementite, ferrite , austenite, martensite , and pearlite) colonies in alloy steels [17-20... alloys [11, 12], and Pb-Sn alloys [13, 14]  reinforcement particle for particle -reinforced metal-matrix composites [15, 16] 

  20. Information matrix estimation procedures for cognitive diagnostic models.

    PubMed

    Liu, Yanlou; Xin, Tao; Andersson, Björn; Tian, Wei

    2018-03-06

    Two new methods to estimate the asymptotic covariance matrix for marginal maximum likelihood estimation of cognitive diagnosis models (CDMs), the inverse of the observed information matrix and the sandwich-type estimator, are introduced. Unlike several previous covariance matrix estimators, the new methods take into account both the item and structural parameters. The relationships between the observed information matrix, the empirical cross-product information matrix, the sandwich-type covariance matrix and the two approaches proposed by de la Torre (2009, J. Educ. Behav. Stat., 34, 115) are discussed. Simulation results show that, for a correctly specified CDM and Q-matrix or with a slightly misspecified probability model, the observed information matrix and the sandwich-type covariance matrix exhibit good performance with respect to providing consistent standard errors of item parameter estimates. However, with substantial model misspecification only the sandwich-type covariance matrix exhibits robust performance. © 2018 The British Psychological Society.

  1. Matrix factorization-based data fusion for the prediction of lncRNA-disease associations.

    PubMed

    Fu, Guangyuan; Wang, Jun; Domeniconi, Carlotta; Yu, Guoxian

    2018-05-01

    Long non-coding RNAs (lncRNAs) play crucial roles in complex disease diagnosis, prognosis, prevention and treatment, but only a small portion of lncRNA-disease associations have been experimentally verified. Various computational models have been proposed to identify lncRNA-disease associations by integrating heterogeneous data sources. However, existing models generally ignore the intrinsic structure of data sources or treat them as equally relevant, while they may not be. To accurately identify lncRNA-disease associations, we propose a Matrix Factorization based LncRNA-Disease Association prediction model (MFLDA in short). MFLDA decomposes data matrices of heterogeneous data sources into low-rank matrices via matrix tri-factorization to explore and exploit their intrinsic and shared structure. MFLDA can select and integrate the data sources by assigning different weights to them. An iterative solution is further introduced to simultaneously optimize the weights and low-rank matrices. Next, MFLDA uses the optimized low-rank matrices to reconstruct the lncRNA-disease association matrix and thus to identify potential associations. In 5-fold cross validation experiments to identify verified lncRNA-disease associations, MFLDA achieves an area under the receiver operating characteristic curve (AUC) of 0.7408, at least 3% higher than those given by state-of-the-art data fusion based computational models. An empirical study on identifying masked lncRNA-disease associations again shows that MFLDA can identify potential associations more accurately than competing models. A case study on identifying lncRNAs associated with breast, lung and stomach cancers show that 38 out of 45 (84%) associations predicted by MFLDA are supported by recent biomedical literature and further proves the capability of MFLDA in identifying novel lncRNA-disease associations. MFLDA is a general data fusion framework, and as such it can be adopted to predict associations between other biological entities. The source code for MFLDA is available at: http://mlda.swu.edu.cn/codes.php? name = MFLDA. gxyu@swu.edu.cn. Supplementary data are available at Bioinformatics online.

  2. Exact representation of the asymptotic drift speed and diffusion matrix for a class of velocity-jump processes

    NASA Astrophysics Data System (ADS)

    Mascia, Corrado

    2016-01-01

    This paper examines a class of linear hyperbolic systems which generalizes the Goldstein-Kac model to an arbitrary finite number of speeds vi with transition rates μij. Under the basic assumptions that the transition matrix is symmetric and irreducible, and the differences vi -vj generate all the space, the system exhibits a large-time behavior described by a parabolic advection-diffusion equation. The main contribution is to determine explicit formulas for the asymptotic drift speed and diffusion matrix in term of the kinetic parameters vi and μij, establishing a complete connection between microscopic and macroscopic coefficients. It is shown that the drift speed is the arithmetic mean of the velocities vi. The diffusion matrix has a more complicate representation, based on the graph with vertices the velocities vi and arcs weighted by the transition rates μij. The approach is based on an exhaustive analysis of the dispersion relation and on the application of a variant of the Kirchoff's matrix tree Theorem from graph theory.

  3. Significance Testing in Confirmatory Factor Analytic Models.

    ERIC Educational Resources Information Center

    Khattab, Ali-Maher; Hocevar, Dennis

    Traditionally, confirmatory factor analytic models are tested against a null model of total independence. Using randomly generated factors in a matrix of 46 aptitude tests, this approach is shown to be unlikely to reject even random factors. An alternative null model, based on a single general factor, is suggested. In addition, an index of model…

  4. Computational Implementation of a Thermodynamically Based Work Potential Model For Progressive Microdamage and Transverse Cracking in Fiber-Reinforced Laminates

    NASA Technical Reports Server (NTRS)

    Pineda, Evan J.; Waas, Anthony M.; Bednarcyk, Brett A.; Collier, Craig S.

    2012-01-01

    A continuum-level, dual internal state variable, thermodynamically based, work potential model, Schapery Theory, is used capture the effects of two matrix damage mechanisms in a fiber-reinforced laminated composite: microdamage and transverse cracking. Matrix microdamage accrues primarily in the form of shear microcracks between the fibers of the composite. Whereas, larger transverse matrix cracks typically span the thickness of a lamina and run parallel to the fibers. Schapery Theory uses the energy potential required to advance structural changes, associated with the damage mechanisms, to govern damage growth through a set of internal state variables. These state variables are used to quantify the stiffness degradation resulting from damage growth. The transverse and shear stiffness of the lamina are related to the internal state variables through a set of measurable damage functions. Additionally, the damage variables for a given strain state can be calculated from a set of evolution equations. These evolution equations and damage functions are implemented into the finite element method and used to govern the constitutive response of the material points in the model. Additionally, an axial failure criterion is included in the model. The response of a center-notched, buffer strip-stiffened panel subjected to uniaxial tension is investigated and results are compared to experiment.

  5. Fatigue Life Prediction of 2D Woven Ceramic-Matrix Composites at Room and Elevated Temperatures

    NASA Astrophysics Data System (ADS)

    Longbiao, Li

    2017-03-01

    In this paper, the fatigue life of 2D woven ceramic-matrix composites, i.e., SiC/SiC, SiC/Si-N-C, SiC/Si-B4C, and Nextel 610™/Aluminosilicate, at room and elevated temperatures has been predicted using the micromechanics approach. An effective coefficient of the fiber volume fraction along the loading direction (ECFL) was introduced to describe the fiber architecture of preforms. The Budiansky-Hutchinson-Evans shear-lag model was used to describe the microstress field of the damaged composite considering fibers failure. The statistical matrix multicracking model and fracture mechanics interface debonding criterion were used to determine the matrix crack spacing and interface debonded length. The interface shear stress and fibers strength degradation model and oxidation region propagation model have been adopted to analyze the fatigue and oxidation effects on fatigue life of the composite, which is controlled by interface frictional slip and diffusion of oxygen gas through matrix multicrackings. Under cyclic fatigue loading, the fibers broken fraction was determined by combining the interface/fiber oxidation model, interface wear model and fibers statistical failure model at elevated temperatures, based on the assumption that the fiber strength is subjected to two-parameter Weibull distribution and the load carried by broken and intact fibers satisfy the Global Load Sharing (GLS) criterion. When the broken fibers fraction approaches to the critical value, the composites fatigue fractures. The fatigue life S- N curves of 2D SiC/SiC, SiC/Si-N-C, SiC/Si-B4C, and Nextel 610™/Aluminosilicate composites at room temperature and 800, 1000 and 1200 °C in air and steam have been predicted.

  6. Failure Models and Criteria for FRP Under In-Plane or Three-Dimensional Stress States Including Shear Non-Linearity

    NASA Technical Reports Server (NTRS)

    Pinho, Silvestre T.; Davila, C. G.; Camanho, P. P.; Iannucci, L.; Robinson, P.

    2005-01-01

    A set of three-dimensional failure criteria for laminated fiber-reinforced composites, denoted LaRC04, is proposed. The criteria are based on physical models for each failure mode and take into consideration non-linear matrix shear behaviour. The model for matrix compressive failure is based on the Mohr-Coulomb criterion and it predicts the fracture angle. Fiber kinking is triggered by an initial fiber misalignment angle and by the rotation of the fibers during compressive loading. The plane of fiber kinking is predicted by the model. LaRC04 consists of 6 expressions that can be used directly for design purposes. Several applications involving a broad range of load combinations are presented and compared to experimental data and other existing criteria. Predictions using LaRC04 correlate well with the experimental data, arguably better than most existing criteria. The good correlation seems to be attributable to the physical soundness of the underlying failure models.

  7. Algorithms for Performance, Dependability, and Performability Evaluation using Stochastic Activity Networks

    NASA Technical Reports Server (NTRS)

    Deavours, Daniel D.; Qureshi, M. Akber; Sanders, William H.

    1997-01-01

    Modeling tools and technologies are important for aerospace development. At the University of Illinois, we have worked on advancing the state of the art in modeling by Markov reward models in two important areas: reducing the memory necessary to numerically solve systems represented as stochastic activity networks and other stochastic Petri net extensions while still obtaining solutions in a reasonable amount of time, and finding numerically stable and memory-efficient methods to solve for the reward accumulated during a finite mission time. A long standing problem when modeling with high level formalisms such as stochastic activity networks is the so-called state space explosion, where the number of states increases exponentially with size of the high level model. Thus, the corresponding Markov model becomes prohibitively large and solution is constrained by the the size of primary memory. To reduce the memory necessary to numerically solve complex systems, we propose new methods that can tolerate such large state spaces that do not require any special structure in the model (as many other techniques do). First, we develop methods that generate row and columns of the state transition-rate-matrix on-the-fly, eliminating the need to explicitly store the matrix at all. Next, we introduce a new iterative solution method, called modified adaptive Gauss-Seidel, that exhibits locality in its use of data from the state transition-rate-matrix, permitting us to cache portions of the matrix and hence reduce the solution time. Finally, we develop a new memory and computationally efficient technique for Gauss-Seidel based solvers that avoids the need for generating rows of A in order to solve Ax = b. This is a significant performance improvement for on-the-fly methods as well as other recent solution techniques based on Kronecker operators. Taken together, these new results show that one can solve very large models without any special structure.

  8. The pearl oyster Pinctada fucata martensii genome and multi-omic analyses provide insights into biomineralization

    PubMed Central

    Fan, Guangyi; Jiao, Yu; Zhang, He; Huang, Ronglian; Zheng, Zhe; Bian, Chao; Deng, Yuewen; Wang, Qingheng; Wang, Zhongduo; Liang, Xinming; Liang, Haiying; Shi, Chengcheng; Zhao, Xiaoxia; Sun, Fengming; Hao, Ruijuan; Bai, Jie; Liu, Jialiang; Chen, Wenbin; Liang, Jinlian; Liu, Weiqing; Xu, Zhe; Shi, Qiong; Xu, Xun

    2017-01-01

    Abstract Nacre, the iridescent material found in pearls and shells of molluscs, is formed through an extraordinary process of matrix-assisted biomineralization. Despite recent advances, many aspects of the biomineralization process and its evolutionary origin remain unknown. The pearl oyster Pinctada fucata martensii is a well-known master of biomineralization, but the molecular mechanisms that underlie its production of shells and pearls are not fully understood. We sequenced the highly polymorphic genome of the pearl oyster and conducted multi-omic and biochemical studies to probe nacre formation. We identified a large set of novel proteins participating in matrix-framework formation, many in expanded families, including components similar to that found in vertebrate bones such as collagen-related VWA-containing proteins, chondroitin sulfotransferases, and regulatory elements. Considering that there are only collagen-based matrices in vertebrate bones and chitin-based matrices in most invertebrate skeletons, the presence of both chitin and elements of collagen-based matrices in nacre suggests that elements of chitin- and collagen-based matrices have deep roots and might be part of an ancient biomineralizing matrix. Our results expand the current shell matrix-framework model and provide new insights into the evolution of diverse biomineralization systems. PMID:28873964

  9. Design of distributed PID-type dynamic matrix controller for fractional-order systems

    NASA Astrophysics Data System (ADS)

    Wang, Dawei; Zhang, Ridong

    2018-01-01

    With the continuous requirements for product quality and safety operation in industrial production, it is difficult to describe the complex large-scale processes with integer-order differential equations. However, the fractional differential equations may precisely represent the intrinsic characteristics of such systems. In this paper, a distributed PID-type dynamic matrix control method based on fractional-order systems is proposed. First, the high-order approximate model of integer order is obtained by utilising the Oustaloup method. Then, the step response model vectors of the plant is obtained on the basis of the high-order model, and the online optimisation for multivariable processes is transformed into the optimisation of each small-scale subsystem that is regarded as a sub-plant controlled in the distributed framework. Furthermore, the PID operator is introduced into the performance index of each subsystem and the fractional-order PID-type dynamic matrix controller is designed based on Nash optimisation strategy. The information exchange among the subsystems is realised through the distributed control structure so as to complete the optimisation task of the whole large-scale system. Finally, the control performance of the designed controller in this paper is verified by an example.

  10. An uncertainty analysis of wildfire modeling [Chapter 13

    Treesearch

    Karin Riley; Matthew Thompson

    2017-01-01

    Before fire models can be understood, evaluated, and effectively applied to support decision making, model-based uncertainties must be analyzed. In this chapter, we identify and classify sources of uncertainty using an established analytical framework, and summarize results graphically in an uncertainty matrix. Our analysis facilitates characterization of the...

  11. Three-Dimensional High Fidelity Progressive Failure Damage Modeling of NCF Composites

    NASA Technical Reports Server (NTRS)

    Aitharaju, Venkat; Aashat, Satvir; Kia, Hamid G.; Satyanarayana, Arunkumar; Bogert, Philip B.

    2017-01-01

    Performance prediction of off-axis laminates is of significant interest in designing composite structures for energy absorption. Phenomenological models available in most of the commercial programs, where the fiber and resin properties are smeared, are very efficient for large scale structural analysis, but lack the ability to model the complex nonlinear behavior of the resin and fail to capture the complex load transfer mechanisms between the fiber and the resin matrix. On the other hand, high fidelity mesoscale models, where the fiber tows and matrix regions are explicitly modeled, have the ability to account for the complex behavior in each of the constituents of the composite. However, creating a finite element model of a larger scale composite component could be very time consuming and computationally very expensive. In the present study, a three-dimensional mesoscale model of non-crimp composite laminates was developed for various laminate schemes. The resin material was modeled as an elastic-plastic material with nonlinear hardening. The fiber tows were modeled with an orthotropic material model with brittle failure. In parallel, new stress based failure criteria combined with several damage evolution laws for matrix stresses were proposed for a phenomenological model. The results from both the mesoscale and phenomenological models were compared with the experiments for a variety of off-axis laminates.

  12. Water-based preparation of spider silk films as drug delivery matrices.

    PubMed

    Agostini, Elisa; Winter, Gerhard; Engert, Julia

    2015-09-10

    The main focus of this work was to obtain a drug delivery matrix characterized by biocompatibility, water insolubility and good mechanical properties. Moreover the preparation process has to be compatible with protein encapsulation and the obtained matrix should be able to sustain release a model protein. Spider silk proteins represent exceptional natural polymers due to their mechanical properties in combination with biocompatibility. As both hydrophobic and slowly biodegrading biopolymers, recombinant spider silk proteins fulfill the required properties for a drug delivery system. In this work, we present the preparation of eADF4(C16) films as drug delivery matrices without the use of any organic solvent. Water-based spider silk films were characterized in terms of protein secondary structure, thermal stability, zeta-potential, solubility, mechanical properties, and water absorption and desorption. Additionally, this study includes an evaluation of their application as a drug delivery system for both small molecular weight drugs and high molecular weight molecules such as proteins. Our investigation focused on possible improvements in the film's mechanical properties including plasticizers in the film matrix. Furthermore, different film designs were prepared, such as: monolayer, coated monolayer, multilayer (sandwich), and coated multilayer. The release of the model protein BSA from these new systems was studied. Results indicated that spider silk films are a promising protein drug delivery matrix, capable of releasing the model protein over 90 days with a release profile close to zero order kinetic. Such films could be used for several pharmaceutical and medical purposes, especially when mechanical strength of a drug eluting matrix is of high importance. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Matrix product algorithm for stochastic dynamics on networks applied to nonequilibrium Glauber dynamics

    NASA Astrophysics Data System (ADS)

    Barthel, Thomas; De Bacco, Caterina; Franz, Silvio

    2018-01-01

    We introduce and apply an efficient method for the precise simulation of stochastic dynamical processes on locally treelike graphs. Networks with cycles are treated in the framework of the cavity method. Such models correspond, for example, to spin-glass systems, Boolean networks, neural networks, or other technological, biological, and social networks. Building upon ideas from quantum many-body theory, our approach is based on a matrix product approximation of the so-called edge messages—conditional probabilities of vertex variable trajectories. Computation costs and accuracy can be tuned by controlling the matrix dimensions of the matrix product edge messages (MPEM) in truncations. In contrast to Monte Carlo simulations, the algorithm has a better error scaling and works for both single instances as well as the thermodynamic limit. We employ it to examine prototypical nonequilibrium Glauber dynamics in the kinetic Ising model. Because of the absence of cancellation effects, observables with small expectation values can be evaluated accurately, allowing for the study of decay processes and temporal correlations.

  14. Modeling of Different Fiber Type and Content SiC/SiC Minicomposites Creep Behavior

    NASA Technical Reports Server (NTRS)

    Almansour, Amjad S.; Morscher, Gregory N.

    2017-01-01

    Silicon Carbide based Ceramic Matrix Composites (CMCs) are attractive materials for use in high-temperature applications in the aerospace and nuclear industries. However, creep damage mechanism in CMCs is the most dominant mechanism at elevated temperatures. Consequently, the tensile creep behavior of Hi-Nicalon, Hi-Nicalon Type S SiC fibers and Chemical vapor infiltrated Silicon Carbide matrix (CVI-SiC) were characterized and creep parameters were extracted from creep experiments. Some fiber creep tests were performed in inert environment at 1200 C on individual fibers. Creep behavior of different fiber content pristine and precracked Hi-Nicalon and Hi-Nicalon Type S reinforced minicomposites with BN interphases and CVI-SiC matrix were then modelled using the creep data found in this study and the literature and compared with creep experiments results for the pristine and precracked Hi-Nicalon and Hi-Nicalon Type S minicomposites. Finally, the effects of load-sharing and matrix cracking on CMC creep behavior will be discussed.

  15. Matrix-assisted relaxation in Fe(phen){sub 2}(NCS){sub 2} spin-crossover microparticles, experimental and theoretical investigations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Enachescu, Cristian, E-mail: cristian.enachescu@uaic.ro; Stancu, Alexandru; Tanasa, Radu

    2016-07-18

    In this study, we present the influence of the embedding matrix on the relaxation of Fe(phen){sub 2}(NCS){sub 2} (phen = 1,10-phenanthroline) spin-transition microparticles as revealed by experiments and provide an explanation within the framework of an elastic model based on a Monte-Carlo method. Experiments show that the shape of the high-spin → low-spin relaxation curves is drastically changed when the particles are dispersed in glycerol. This effect was considered in the model by means of interactions between the microparticles and the matrix. A faster start of the relaxation for microparticles embedded in glycerol is due to an initial positive local pressure actingmore » on the edge spin-crossover molecules from the matrix side. This local pressure diminishes and eventually becomes negative during relaxation, as an effect of the decrease of the volume of spin-crossover microparticles from high-spin to low-spin.« less

  16. The spectrum of a vertex model and related spin one chain sitting in a genus five curve

    NASA Astrophysics Data System (ADS)

    Martins, M. J.

    2017-11-01

    We derive the transfer matrix eigenvalues of a three-state vertex model whose weights are based on a R-matrix not of difference form with spectral parameters lying on a genus five curve. We have shown that the basic building blocks for both the transfer matrix eigenvalues and Bethe equations can be expressed in terms of meromorphic functions on an elliptic curve. We discuss the properties of an underlying spin one chain originated from a particular choice of the R-matrix second spectral parameter. We present numerical and analytical evidences that the respective low-energy excitations can be gapped or massless depending on the strength of the interaction coupling. In the massive phase we provide analytical and numerical evidences in favor of an exact expression for the lowest energy gap. We point out that the critical point separating these two distinct physical regimes coincides with the one in which the weights geometry degenerate into union of genus one curves.

  17. Table-sized matrix model in fractional learning

    NASA Astrophysics Data System (ADS)

    Soebagyo, J.; Wahyudin; Mulyaning, E. C.

    2018-05-01

    This article provides an explanation of the fractional learning model i.e. a Table-Sized Matrix model in which fractional representation and its operations are symbolized by the matrix. The Table-Sized Matrix are employed to develop problem solving capabilities as well as the area model. The Table-Sized Matrix model referred to in this article is used to develop an understanding of the fractional concept to elementary school students which can then be generalized into procedural fluency (algorithm) in solving the fractional problem and its operation.

  18. Discontinuities in effective permeability due to fracture percolation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyman, Jeffrey De'Haven; Karra, Satish; Carey, James William

    Motivated by a triaxial coreflood experiment with a sample of Utica shale where an abrupt jump in permeability was observed, possibly due to the creation of a percolating fracture network through the sample, we perform numerical simulations based on the experiment to characterize how the effective permeability of otherwise low-permeability porous media depends on fracture formation, connectivity, and the contrast between the fracture and matrix permeabilities. While a change in effective permeability due to fracture formation is expected, the dependence of its magnitude upon the contrast between the matrix permeability and fracture permeability and the fracture network structure is poorlymore » characterized. We use two different high-fidelity fracture network models to characterize how effective permeability changes as percolation occurs. The first is a dynamic two-dimensional fracture propagation model designed to mimic the laboratory settings of the experiment. The second is a static three-dimensional discrete fracture network (DFN) model, whose fracture and network statistics are based on the fractured sample of Utica shale. Once the network connects the inflow and outflow boundaries, the effective permeability increases non-linearly with network density. In most networks considered, a jump in the effective permeability was observed when the embedded fracture network percolated. We characterize how the magnitude of the jump, should it occur, depends on the contrast between the fracture and matrix permeabilities. For small contrasts between the matrix and fracture permeabilities the change is insignificant. However, for larger contrasts, there is a substantial jump whose magnitude depends non-linearly on the difference between matrix and fracture permeabilities. A power-law relationship between the size of the jump and the difference between the matrix and fracture permeabilities is observed. In conclusion, the presented results underscore the importance of fracture network topology on the upscaled properties of the porous medium in which it is embedded.« less

  19. Discontinuities in effective permeability due to fracture percolation

    DOE PAGES

    Hyman, Jeffrey De'Haven; Karra, Satish; Carey, James William; ...

    2018-01-31

    Motivated by a triaxial coreflood experiment with a sample of Utica shale where an abrupt jump in permeability was observed, possibly due to the creation of a percolating fracture network through the sample, we perform numerical simulations based on the experiment to characterize how the effective permeability of otherwise low-permeability porous media depends on fracture formation, connectivity, and the contrast between the fracture and matrix permeabilities. While a change in effective permeability due to fracture formation is expected, the dependence of its magnitude upon the contrast between the matrix permeability and fracture permeability and the fracture network structure is poorlymore » characterized. We use two different high-fidelity fracture network models to characterize how effective permeability changes as percolation occurs. The first is a dynamic two-dimensional fracture propagation model designed to mimic the laboratory settings of the experiment. The second is a static three-dimensional discrete fracture network (DFN) model, whose fracture and network statistics are based on the fractured sample of Utica shale. Once the network connects the inflow and outflow boundaries, the effective permeability increases non-linearly with network density. In most networks considered, a jump in the effective permeability was observed when the embedded fracture network percolated. We characterize how the magnitude of the jump, should it occur, depends on the contrast between the fracture and matrix permeabilities. For small contrasts between the matrix and fracture permeabilities the change is insignificant. However, for larger contrasts, there is a substantial jump whose magnitude depends non-linearly on the difference between matrix and fracture permeabilities. A power-law relationship between the size of the jump and the difference between the matrix and fracture permeabilities is observed. In conclusion, the presented results underscore the importance of fracture network topology on the upscaled properties of the porous medium in which it is embedded.« less

  20. Matrix Transfer Function Design for Flexible Structures: An Application

    NASA Technical Reports Server (NTRS)

    Brennan, T. J.; Compito, A. V.; Doran, A. L.; Gustafson, C. L.; Wong, C. L.

    1985-01-01

    The application of matrix transfer function design techniques to the problem of disturbance rejection on a flexible space structure is demonstrated. The design approach is based on parameterizing a class of stabilizing compensators for the plant and formulating the design specifications as a constrained minimization problem in terms of these parameters. The solution yields a matrix transfer function representation of the compensator. A state space realization of the compensator is constructed to investigate performance and stability on the nominal and perturbed models. The application is made to the ACOSSA (Active Control of Space Structures) optical structure.

  1. A theoretical approach to evaluate the release rate of acetaminophen from erosive wax matrix dosage forms.

    PubMed

    Agata, Yasuyoshi; Iwao, Yasunori; Shiino, Kai; Miyagishima, Atsuo; Itai, Shigeru

    2011-07-29

    To predict drug dissolution and understand the mechanisms of drug release from wax matrix dosage forms containing glyceryl monostearate (GM; a wax base), aminoalkyl methacrylate copolymer E (AMCE; a pH-dependent functional polymer), and acetaminophen (APAP; a model drug), we tried to derive a novel mathematical model with respect to erosion and diffusion theory. Our model exhibited good agreement with the whole set of experimentally obtained values pertaining to APAP release at pH 4.0 and pH 6.5. In addition, this model revealed that the eroding speed of wax matrices was strongly influenced by the loading content of AMCE, but not that of APAP, and that the diffusion coefficient increased as APAP loading decreased and AMCE loading increased, thus directly defining the physicochemical properties of erosion and diffusion. Therefore, this model might prove a useful equation for the precise prediction of dissolution and for understanding the mechanisms of drug release from wax matrix dosage forms. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Fisher Scoring Method for Parameter Estimation of Geographically Weighted Ordinal Logistic Regression (GWOLR) Model

    NASA Astrophysics Data System (ADS)

    Widyaningsih, Purnami; Retno Sari Saputro, Dewi; Nugrahani Putri, Aulia

    2017-06-01

    GWOLR model combines geographically weighted regression (GWR) and (ordinal logistic reression) OLR models. Its parameter estimation employs maximum likelihood estimation. Such parameter estimation, however, yields difficult-to-solve system of nonlinear equations, and therefore numerical approximation approach is required. The iterative approximation approach, in general, uses Newton-Raphson (NR) method. The NR method has a disadvantage—its Hessian matrix is always the second derivatives of each iteration so it does not always produce converging results. With regard to this matter, NR model is modified by substituting its Hessian matrix into Fisher information matrix, which is termed Fisher scoring (FS). The present research seeks to determine GWOLR model parameter estimation using Fisher scoring method and apply the estimation on data of the level of vulnerability to Dengue Hemorrhagic Fever (DHF) in Semarang. The research concludes that health facilities give the greatest contribution to the probability of the number of DHF sufferers in both villages. Based on the number of the sufferers, IR category of DHF in both villages can be determined.

  3. An entropy-variables-based formulation of residual distribution schemes for non-equilibrium flows

    NASA Astrophysics Data System (ADS)

    Garicano-Mena, Jesús; Lani, Andrea; Degrez, Gérard

    2018-06-01

    In this paper we present an extension of Residual Distribution techniques for the simulation of compressible flows in non-equilibrium conditions. The latter are modeled by means of a state-of-the-art multi-species and two-temperature model. An entropy-based variable transformation that symmetrizes the projected advective Jacobian for such a thermophysical model is introduced. Moreover, the transformed advection Jacobian matrix presents a block diagonal structure, with mass-species and electronic-vibrational energy being completely decoupled from the momentum and total energy sub-system. The advantageous structure of the transformed advective Jacobian can be exploited by contour-integration-based Residual Distribution techniques: established schemes that operate on dense matrices can be substituted by the same scheme operating on the momentum-energy subsystem matrix and repeated application of scalar scheme to the mass-species and electronic-vibrational energy terms. Finally, the performance gain of the symmetrizing-variables formulation is quantified on a selection of representative testcases, ranging from subsonic to hypersonic, in inviscid or viscous conditions.

  4. A structure-based extracellular matrix expansion mechanism of fibrous tissue growth

    PubMed Central

    Kalson, Nicholas S; Lu, Yinhui; Taylor, Susan H; Starborg, Tobias; Holmes, David F; Kadler, Karl E

    2015-01-01

    Embryonic growth occurs predominately by an increase in cell number; little is known about growth mechanisms later in development when fibrous tissues account for the bulk of adult vertebrate mass. We present a model for fibrous tissue growth based on 3D-electron microscopy of mouse tendon. We show that the number of collagen fibrils increases during embryonic development and then remains constant during postnatal growth. Embryonic growth was explained predominately by increases in fibril number and length. Postnatal growth arose predominately from increases in fibril length and diameter. A helical crimp structure was established in embryogenesis, and persisted postnatally. The data support a model where the shape and size of tendon is determined by the number and position of embryonic fibroblasts. The collagen fibrils that these cells synthesise provide a template for postnatal growth by structure-based matrix expansion. The model has important implications for growth of other fibrous tissues and fibrosis. DOI: http://dx.doi.org/10.7554/eLife.05958.001 PMID:25992598

  5. Density-matrix based determination of low-energy model Hamiltonians from ab initio wavefunctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Changlani, Hitesh J.; Zheng, Huihuo; Wagner, Lucas K.

    2015-09-14

    We propose a way of obtaining effective low energy Hubbard-like model Hamiltonians from ab initio quantum Monte Carlo calculations for molecular and extended systems. The Hamiltonian parameters are fit to best match the ab initio two-body density matrices and energies of the ground and excited states, and thus we refer to the method as ab initio density matrix based downfolding. For benzene (a finite system), we find good agreement with experimentally available energy gaps without using any experimental inputs. For graphene, a two dimensional solid (extended system) with periodic boundary conditions, we find the effective on-site Hubbard U{sup ∗}/t tomore » be 1.3 ± 0.2, comparable to a recent estimate based on the constrained random phase approximation. For molecules, such parameterizations enable calculation of excited states that are usually not accessible within ground state approaches. For solids, the effective Hamiltonian enables large-scale calculations using techniques designed for lattice models.« less

  6. Incorporating structure from motion uncertainty into image-based pose estimation

    NASA Astrophysics Data System (ADS)

    Ludington, Ben T.; Brown, Andrew P.; Sheffler, Michael J.; Taylor, Clark N.; Berardi, Stephen

    2015-05-01

    A method for generating and utilizing structure from motion (SfM) uncertainty estimates within image-based pose estimation is presented. The method is applied to a class of problems in which SfM algorithms are utilized to form a geo-registered reference model of a particular ground area using imagery gathered during flight by a small unmanned aircraft. The model is then used to form camera pose estimates in near real-time from imagery gathered later. The resulting pose estimates can be utilized by any of the other onboard systems (e.g. as a replacement for GPS data) or downstream exploitation systems, e.g., image-based object trackers. However, many of the consumers of pose estimates require an assessment of the pose accuracy. The method for generating the accuracy assessment is presented. First, the uncertainty in the reference model is estimated. Bundle Adjustment (BA) is utilized for model generation. While the high-level approach for generating a covariance matrix of the BA parameters is straightforward, typical computing hardware is not able to support the required operations due to the scale of the optimization problem within BA. Therefore, a series of sparse matrix operations is utilized to form an exact covariance matrix for only the parameters that are needed at a particular moment. Once the uncertainty in the model has been determined, it is used to augment Perspective-n-Point pose estimation algorithms to improve the pose accuracy and to estimate the resulting pose uncertainty. The implementation of the described method is presented along with results including results gathered from flight test data.

  7. Molecular-Level Computational Investigation of Mechanical Transverse Behavior of p-Phenylene Terephthalamide (PPTA) Fibers

    DTIC Science & Technology

    2013-01-01

    fabricated today are based on polymer matrix composites containing Kevlarw KM2 reinforcements , the present work will deal with generic PPTA fibers . In...Multi-length scale enriched continuum-level material model for Kevlarw- fiber reinforced polymer-matrix composites”, Journal of Materials...mechanical transverse behavior of p-phenylene terephthalamide (PPTA) fibers Purpose – A series of all-atom molecular-level computational analyses is

  8. Deghosting based on the transmission matrix method

    NASA Astrophysics Data System (ADS)

    Wang, Benfeng; Wu, Ru-Shan; Chen, Xiaohong

    2017-12-01

    As the developments of seismic exploration and subsequent seismic exploitation advance, marine acquisition systems with towed streamers become an important seismic data acquisition method. But the existing air-water reflective interface can generate surface related multiples, including ghosts, which can affect the accuracy and performance of the following seismic data processing algorithms. Thus, we derive a deghosting method from a new perspective, i.e. using the transmission matrix (T-matrix) method instead of inverse scattering series. The T-matrix-based deghosting algorithm includes all scattering effects and is convergent absolutely. Initially, the effectiveness of the proposed method is demonstrated using synthetic data obtained from a designed layered model, and its noise-resistant property is also illustrated using noisy synthetic data contaminated by random noise. Numerical examples on complicated data from the open SMAART Pluto model and field marine data further demonstrate the validity and flexibility of the proposed method. After deghosting, low frequency components are recovered reasonably and the fake high frequency components are attenuated, and the recovered low frequency components will be useful for the subsequent full waveform inversion. The proposed deghosting method is currently suitable for two-dimensional towed streamer cases with accurate constant depth information and its extension into variable-depth streamers in three-dimensional cases will be studied in the future.

  9. Where Does Water Go During Hydraulic Fracturing?

    PubMed

    O'Malley, D; Karra, S; Currier, R P; Makedonska, N; Hyman, J D; Viswanathan, H S

    2016-07-01

    During hydraulic fracturing millions of gallons of water are typically injected at high pressure into deep shale formations. This water can be housed in fractures, within the shale matrix, and can potentially migrate beyond the shale formation via fractures and/or faults raising environmental concerns. We describe a generic framework for producing estimates of the volume available in fractures and undamaged shale matrix where water injected into a representative shale site could reside during hydraulic fracturing, and apply it to a representative site that incorporates available field data. The amount of water that can be stored in the fractures is estimated by calculating the volume of all the fractures associated with a discrete fracture network (DFN) based on real data and using probability theory to estimate the volume of smaller fractures that are below the lower cutoff for the fracture radius in the DFN. The amount of water stored in the matrix is estimated utilizing two distinct methods-one using a two-phase model at the pore-scale and the other using a single-phase model at the continuum scale. Based on these calculations, it appears that most of the water resides in the matrix with a lesser amount in the fractures. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  10. Analysis of metal-matrix composite structures. I - Micromechanics constitutive theory. II - Laminate analyses

    NASA Technical Reports Server (NTRS)

    Arenburg, R. T.; Reddy, J. N.

    1991-01-01

    The micromechanical constitutive theory is used to examine the nonlinear behavior of continuous-fiber-reinforced metal-matrix composite structures. Effective lamina constitutive relations based on the Abouli micromechanics theory are presented. The inelastic matrix behavior is modeled by the unified viscoplasticity theory of Bodner and Partom. The laminate constitutive relations are incorporated into a first-order deformation plate theory. The resulting boundary value problem is solved by utilizing the finite element method. Attention is also given to computational aspects of the numerical solution, including the temporal integration of the inelastic strains and the spatial integration of bending moments. Numerical results the nonlinear response of metal matrix composites subjected to extensional and bending loads are presented.

  11. Thermo-mechanical response predictions for metal matrix composite laminates

    NASA Technical Reports Server (NTRS)

    Aboudi, J.; Hidde, J. S.; Herakovich, C. T.

    1991-01-01

    An analytical micromechanical model is employed for prediction of the stress-strain response of metal matrix composite laminates subjected to thermomechanical loading. The predicted behavior of laminates is based upon knowledge of the thermomechanical response of the transversely isotropic, elastic fibers and the elastic-viscoplastic, work-hardening matrix. The method is applied to study the behavior of silicon carbide/titanium metal matrix composite laminates. The response of laminates is compared with that of unidirectional lamina. The results demonstrate the effect of cooling from a stress-free temperature and the mismatch of thermal and mechanical properties of the constituent phases on the laminate's subsequent mechanical response. Typical results are presented for a variety of laminates subjected to monotonic tension, monotonic shear and cyclic tensile/compressive loadings.

  12. Effects of phase vector and history extension on prediction power of adaptive-network based fuzzy inference system (ANFIS) model for a real scale anaerobic wastewater treatment plant operating under unsteady state.

    PubMed

    Perendeci, Altinay; Arslan, Sever; Tanyolaç, Abdurrahman; Celebi, Serdar S

    2009-10-01

    A conceptual neural fuzzy model based on adaptive-network based fuzzy inference system, ANFIS, was proposed using available input on-line and off-line operational variables for a sugar factory anaerobic wastewater treatment plant operating under unsteady state to estimate the effluent chemical oxygen demand, COD. The predictive power of the developed model was improved as a new approach by adding the phase vector and the recent values of COD up to 5-10 days, longer than overall retention time of wastewater in the system. History of last 10 days for COD effluent with two-valued phase vector in the input variable matrix including all parameters had more predictive power. History of 7 days with two-valued phase vector in the matrix comprised of only on-line variables yielded fairly well estimations. The developed ANFIS model with phase vector and history extension has been able to adequately represent the behavior of the treatment system.

  13. Modelling the diffusion-available pore space of an unaltered granitic rock matrix using a micro-DFN approach

    NASA Astrophysics Data System (ADS)

    Svensson, Urban; Löfgren, Martin; Trinchero, Paolo; Selroos, Jan-Olof

    2018-04-01

    In sparsely fractured rock, the ubiquitous heterogeneity of the matrix, which has been observed in different laboratory and in situ experiments, has been shown to have a significant influence on retardation mechanisms that are of importance for the safety of deep geological repositories for nuclear waste. Here, we propose a conceptualisation of a typical heterogeneous granitic rock matrix based on micro-Discrete Fracture Networks (micro-DFN). Different sets of fractures are used to represent grain-boundary pores as well as micro fractures that transect different mineral grains. The micro-DFN model offers a great flexibility in the way inter- and intra-granular space is represented as the different parameters that characterise each fracture set can be fine tuned to represent samples of different characteristics. Here, the parameters of the model have been calibrated against experimental observations from granitic rock samples taken at Forsmark (Sweden) and different variant cases have been used to illustrate how the model can be tied to rock samples with different attributes. Numerical through-diffusion simulations have been carried out to infer the bulk properties of the model as well as to compare the computed mass flux with the experimental data from an analogous laboratory experiment. The general good agreement between the model results and the experimental observations shows that the model presented here is a reliable tool for the understanding of retardation mechanisms occurring at the mm-scale in the matrix.

  14. Mars Mission Analysis Trades Based on Legacy and Future Nuclear Propulsion Options

    NASA Astrophysics Data System (ADS)

    Joyner, Russell; Lentati, Andrea; Cichon, Jaclyn

    2007-01-01

    The purpose of this paper is to discuss the results of mission-based system trades when using a nuclear thermal propulsion (NTP) system for Solar System exploration. The results are based on comparing reactor designs that use a ceramic-metallic (CERMET), graphite matrix, graphite composite matrix, or carbide matrix fuel element designs. The composite graphite matrix and CERMET designs have been examined for providing power as well as propulsion. Approaches to the design of the NTP to be discussed will include an examination of graphite, composite, carbide, and CERMET core designs and the attributes of each in regards to performance and power generation capability. The focus is on NTP approaches based on tested fuel materials within a prismatic fuel form per the Argonne National Laboratory testing and the ROVER/NERVA program. NTP concepts have been examined for several years at Pratt & Whitney Rocketdyne for use as the primary propulsion for human missions beyond earth. Recently, an approach was taken to examine the design trades between specific NTP concepts; NERVA-based (UC)C-Graphite, (UC,ZrC)C-Composite, (U,Zr)C-Solid Carbide and UO2-W CERMET. Using Pratt & Whitney Rocketdyne's multidisciplinary design analysis capability, a detailed mission and vehicle model has been used to examine how several of these NTP designs impact a human Mars mission. Trends for the propulsion system mass as a function of power level (i.e. thrust size) for the graphite-carbide and CERMET designs were established and correlated against data created over the past forty years. These were used for the mission trade study. The resulting mission trades presented in this paper used a comprehensive modeling approach that captures the mission, vehicle subsystems, and NTP sizing.

  15. High and low frequency unfolded partial least squares regression based on empirical mode decomposition for quantitative analysis of fuel oil samples.

    PubMed

    Bian, Xihui; Li, Shujuan; Lin, Ligang; Tan, Xiaoyao; Fan, Qingjie; Li, Ming

    2016-06-21

    Accurate prediction of the model is fundamental to the successful analysis of complex samples. To utilize abundant information embedded over frequency and time domains, a novel regression model is presented for quantitative analysis of hydrocarbon contents in the fuel oil samples. The proposed method named as high and low frequency unfolded PLSR (HLUPLSR), which integrates empirical mode decomposition (EMD) and unfolded strategy with partial least squares regression (PLSR). In the proposed method, the original signals are firstly decomposed into a finite number of intrinsic mode functions (IMFs) and a residue by EMD. Secondly, the former high frequency IMFs are summed as a high frequency matrix and the latter IMFs and residue are summed as a low frequency matrix. Finally, the two matrices are unfolded to an extended matrix in variable dimension, and then the PLSR model is built between the extended matrix and the target values. Coupled with Ultraviolet (UV) spectroscopy, HLUPLSR has been applied to determine hydrocarbon contents of light gas oil and diesel fuels samples. Comparing with single PLSR and other signal processing techniques, the proposed method shows superiority in prediction ability and better model interpretation. Therefore, HLUPLSR method provides a promising tool for quantitative analysis of complex samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Modeling CO2 Storage in Fractured Reservoirs: Fracture-Matrix Interactions of Free-Phase and Dissolved CO2

    NASA Astrophysics Data System (ADS)

    Oldenburg, C. M.; Zhou, Q.; Birkholzer, J. T.

    2017-12-01

    The injection of supercritical CO2 (scCO2) in fractured reservoirs has been conducted at several storage sites. However, no site-specific dual-continuum modeling for fractured reservoirs has been reported and modeling studies have generally underestimated the fracture-matrix interactions. We developed a conceptual model for enhanced CO2 storage to take into account global scCO2 migration in the fracture continuum, local storage of scCO2 and dissolved CO2 (dsCO2) in the matrix continuum, and driving forces for scCO2 invasion and dsCO2 diffusion from fractures. High-resolution discrete fracture-matrix models were developed for a column of idealized matrix blocks bounded by vertical and horizontal fractures and for a km-scale fractured reservoir. The column-scale simulation results show that equilibrium storage efficiency strongly depends on matrix entry capillary pressure and matrix-matrix connectivity while the time scale to reach equilibrium is sensitive to fracture spacing and matrix flow properties. The reservoir-scale modeling results shows that the preferential migration of scCO2 through fractures is coupled with bulk storage in the rock matrix that in turn retards the fracture scCO2 plume. We also developed unified-form diffusive flux equations to account for dsCO2 storage in brine-filled matrix blocks and found solubility trapping is significant in fractured reservoirs with low-permeability matrix.

  17. Towards an acoustic model-based poroelastic imaging method: I. Theoretical foundation.

    PubMed

    Berry, Gearóid P; Bamber, Jeffrey C; Armstrong, Cecil G; Miller, Naomi R; Barbone, Paul E

    2006-04-01

    The ultrasonic measurement and imaging of tissue elasticity is currently under wide investigation and development as a clinical tool for the assessment of a broad range of diseases, but little account in this field has yet been taken of the fact that soft tissue is porous and contains mobile fluid. The ability to squeeze fluid out of tissue may have implications for conventional elasticity imaging, and may present opportunities for new investigative tools. When a homogeneous, isotropic, fluid-saturated poroelastic material with a linearly elastic solid phase and incompressible solid and fluid constituents is subjected to stress, the behaviour of the induced internal strain field is influenced by three material constants: the Young's modulus (E(s)) and Poisson's ratio (nu(s)) of the solid matrix and the permeability (k) of the solid matrix to the pore fluid. New analytical expressions were derived and used to model the time-dependent behaviour of the strain field inside simulated homogeneous cylindrical samples of such a poroelastic material undergoing sustained unconfined compression. A model-based reconstruction technique was developed to produce images of parameters related to the poroelastic material constants (E(s), nu(s), k) from a comparison of the measured and predicted time-dependent spatially varying radial strain. Tests of the method using simulated noisy strain data showed that it is capable of producing three unique parametric images: an image of the Poisson's ratio of the solid matrix, an image of the axial strain (which was not time-dependent subsequent to the application of the compression) and an image representing the product of the aggregate modulus E(s)(1-nu(s))/(1+nu(s))(1-2nu(s)) of the solid matrix and the permeability of the solid matrix to the pore fluid. The analytical expressions were further used to numerically validate a finite element model and to clarify previous work on poroelastography.

  18. Scattering matrix analysis for evaluating the photocurrent in hydrogenated-amorphous-silicon-based thin film solar cells.

    PubMed

    Shin, Myunghun; Lee, Seong Hyun; Lim, Jung Wook; Yun, Sun Jin

    2014-11-01

    A scattering matrix (S-matrix) analysis method was developed for evaluating hydrogenated amorphous silicon (a-Si:H)-based thin film solar cells. In this approach, light wave vectors A and B represent the incoming and outgoing behaviors of the incident solar light, respectively, in terms of coherent wave and incoherent intensity components. The S-matrix determines the relation between A and B according to optical effects such as reflection and transmission, as described by the Fresnel equations, scattering at the boundary surfaces, or scattering within the propagation medium, as described by the Beer-Lambert law and the change in the phase of the propagating light wave. This matrix can be used to evaluate the behavior of angle-incident coherent and incoherent light simultaneously, and takes into account not only the light scattering process at material boundaries (haze effects) but also nonlinear optical processes within the material. The optical parameters in the S-matrix were determined by modeling both a 2%-gallium-doped zinc oxide transparent conducting oxide and germanium-compounded a-Si:H (a-SiGe:H). Using the S-matrix equations, the photocurrent for an a-Si:H/a-SiGe:H tandem cell and the optical loss in semitransparent a-Si:H solar cells for use in building-integrated photovoltaic applications were analyzed. The developed S-matrix method can also be used as a general analysis tool for various thin film solar cells.

  19. Adaptive mixed finite element methods for Darcy flow in fractured porous media

    NASA Astrophysics Data System (ADS)

    Chen, Huangxin; Salama, Amgad; Sun, Shuyu

    2016-10-01

    In this paper, we propose adaptive mixed finite element methods for simulating the single-phase Darcy flow in two-dimensional fractured porous media. The reduced model that we use for the simulation is a discrete fracture model coupling Darcy flows in the matrix and the fractures, and the fractures are modeled by one-dimensional entities. The Raviart-Thomas mixed finite element methods are utilized for the solution of the coupled Darcy flows in the matrix and the fractures. In order to improve the efficiency of the simulation, we use adaptive mixed finite element methods based on novel residual-based a posteriori error estimators. In addition, we develop an efficient upscaling algorithm to compute the effective permeability of the fractured porous media. Several interesting examples of Darcy flow in the fractured porous media are presented to demonstrate the robustness of the algorithm.

  20. Removing flicker based on sparse color correspondences in old film restoration

    NASA Astrophysics Data System (ADS)

    Huang, Xi; Ding, Youdong; Yu, Bing; Xia, Tianran

    2018-04-01

    In the long history of human civilization, archived film is an indispensable part of it, and using digital method to repair damaged film is also a mainstream trend nowadays. In this paper, we propose a sparse color correspondences based technique to remove fading flicker for old films. Our model, combined with multi frame images to establish a simple correction model, includes three key steps. Firstly, we recover sparse color correspondences in the input frames to build a matrix with many missing entries. Secondly, we present a low-rank matrix factorization approach to estimate the unknown parameters of this model. Finally, we adopt a two-step strategy that divide the estimated parameters into reference frame parameters for color recovery correction and other frame parameters for color consistency correction to remove flicker. Our method combined multi-frames takes continuity of the input sequence into account, and the experimental results show the method can remove fading flicker efficiently.

  1. A fast Monte Carlo EM algorithm for estimation in latent class model analysis with an application to assess diagnostic accuracy for cervical neoplasia in women with AGC

    PubMed Central

    Kang, Le; Carter, Randy; Darcy, Kathleen; Kauderer, James; Liao, Shu-Yuan

    2013-01-01

    In this article we use a latent class model (LCM) with prevalence modeled as a function of covariates to assess diagnostic test accuracy in situations where the true disease status is not observed, but observations on three or more conditionally independent diagnostic tests are available. A fast Monte Carlo EM (MCEM) algorithm with binary (disease) diagnostic data is implemented to estimate parameters of interest; namely, sensitivity, specificity, and prevalence of the disease as a function of covariates. To obtain standard errors for confidence interval construction of estimated parameters, the missing information principle is applied to adjust information matrix estimates. We compare the adjusted information matrix based standard error estimates with the bootstrap standard error estimates both obtained using the fast MCEM algorithm through an extensive Monte Carlo study. Simulation demonstrates that the adjusted information matrix approach estimates the standard error similarly with the bootstrap methods under certain scenarios. The bootstrap percentile intervals have satisfactory coverage probabilities. We then apply the LCM analysis to a real data set of 122 subjects from a Gynecologic Oncology Group (GOG) study of significant cervical lesion (S-CL) diagnosis in women with atypical glandular cells of undetermined significance (AGC) to compare the diagnostic accuracy of a histology-based evaluation, a CA-IX biomarker-based test and a human papillomavirus (HPV) DNA test. PMID:24163493

  2. Network analysis of a financial market based on genuine correlation and threshold method

    NASA Astrophysics Data System (ADS)

    Namaki, A.; Shirazi, A. H.; Raei, R.; Jafari, G. R.

    2011-10-01

    A financial market is an example of an adaptive complex network consisting of many interacting units. This network reflects market’s behavior. In this paper, we use Random Matrix Theory (RMT) notion for specifying the largest eigenvector of correlation matrix as the market mode of stock network. For a better risk management, we clean the correlation matrix by removing the market mode from data and then construct this matrix based on the residuals. We show that this technique has an important effect on correlation coefficient distribution by applying it for Dow Jones Industrial Average (DJIA). To study the topological structure of a network we apply the removing market mode technique and the threshold method to Tehran Stock Exchange (TSE) as an example. We show that this network follows a power-law model in certain intervals. We also show the behavior of clustering coefficients and component numbers of this network for different thresholds. These outputs are useful for both theoretical and practical purposes such as asset allocation and risk management.

  3. Predictions of Poisson's ratio in cross-ply laminates containing matrix cracks and delaminations

    NASA Technical Reports Server (NTRS)

    Harris, Charles E.; Allen, David H.; Nottorf, Eric W.

    1989-01-01

    A damage-dependent constitutive model for laminated composites has been developed for the combined damage modes of matrix cracks and delaminations. The model is based on the concept of continuum damage mechanics and uses second-order tensor valued internal state variables to represent each mode of damage. The internal state variables are defined as the local volume average of the relative crack face displacements. Since the local volume for delaminations is specified at the laminate level, the constitutive model takes the form of laminate analysis equations modified by the internal state variables. Model implementation is demonstrated for the laminate engineering modulus E(x) and Poisson's ratio nu(xy) of quasi-isotropic and cross-ply laminates. The model predictions are in close agreement to experimental results obtained for graphite/epoxy laminates.

  4. Silicone Polymer Composites for Thermal Protection System: Fiber Reinforcements and Microstructures

    DTIC Science & Technology

    2010-01-01

    angles were tested. Detailed microstructural, mass loss, and peak erosion analyses were conducted on the phenolic -based matrix composite (control) and...silicone-based matrix composites to understand their protective mechanisms. Keywords silicone polymer matrix composites, phenolic polymer matrix...erosion analyses were conducted on the phenolic -based matrix composite (control) and silicone-based matrix composites to understand their protective

  5. Understanding the solidification and microstructure evolution during CSC-MIG welding of Fe–Cr–B-based alloy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sorour, A.A., E-mail: ahmad.sorour@mail.mcgill.ca; Chromik, R.R., E-mail: richard.chromik@mcgill.ca; Gauvin, R., E-mail: raynald.gauvin@mcgill.ca

    2013-12-15

    The present is a study of the solidification and microstructure of Fe–28.2%Cr–3.8%B–1.5%Si–1.5%Mn (wt.%) alloy deposited onto a 1020 plain carbon steel substrate using the controlled short-circuit metal inert gas welding process. The as-solidified alloy was a metal matrix composite with a hypereutectic microstructure. Thermodynamic calculation based on the Scheil–Gulliver model showed that a primary (Cr,Fe){sub 2}B phase formed first during solidification, followed by an eutectic formation of the (Cr,Fe){sub 2}B phase and a body-centered cubic Fe-based solid solution matrix, which contained Cr, Mn and Si. Microstructure analysis confirmed the formation of these phases and showed that the shape of themore » (Cr,Fe){sub 2}B phase was irregular plate. As the welding heat input increased, the weld dilution increased and thus the volume fraction of the (Cr,Fe){sub 2}B plates decreased while other microstructural characteristics were similar. - Highlights: • We deposit Fe–Cr–B-based alloy onto plain carbon steel using the CSC-MIG process. • We model the solidification behavior using thermodynamic calculation. • As deposited alloy consists of (Cr,Fe){sub 2}B plates embedded in Fe-based matrix. • We study the effect of the welding heat input on the microstructure.« less

  6. Micromechanical Modeling of the Thermal Expansion of Graphite/copper Composites with Nonuniform Microstructure

    NASA Technical Reports Server (NTRS)

    Bednarcyk, Brett A.; Pindera, Marek-Jerzy

    1994-01-01

    Two micromechanical models were developed to investigate the thermal expansion of graphite/copper (Gr/Cu) composites. The models incorporate the effects of temperature-dependent material properties, matrix inelasticity, initial residual stresses due to processing history, and nonuniform fiber distribution. The first model is based on the multiple concentric cylinder geometry, with each cylinder treated as a two-phase composite with a characteristic fiber volume fractions. By altering the fiber volume fraction of the individual cylinders, unidirectional composites with radially nonuniform fiber distributions can be investigated using this model. The second model is based on the inelastic lamination theory. By varying the fiber content in the individual laminae, composites with nonuniform fiber distribution in the thickness direction can be investigated. In both models, the properties of the individual regions (cylinders or laminae) are calculated using the method of cells micromechanical model. Classical incremental plasticity theory is used to model the inelastic response of the copper matrix at the microlevel. The models were used to characterize the effects of nonuniform fiber distribution on the thermal expansion of Gr/Cu. These effects were compared to the effects of matrix plasticity, choice of stress-free temperature, and slight fiber misalignment. It was found that the radially nonuniform fiber distribution has little effect on the thermal expansion of Gr/Cu but could become significant for composites with large fiber-matrix transverse CTE and Young's modulus mismatch. The effect of nonuniform fiber distribution in the through-thickness direction of a laminate was more significant, but only approached that of the stress-free temperature for the most extreme cases that include large amounts of bending. Subsequent comparison with experimental thermal expansion data indicated the need for more accurate characterization of the graphite fiber thermomechanical properties. Correlation with cyclic data revealed the presence of a mechanism not considered in the developed models. The predicted response did, however, exhibit ratcheting behavior that has been observed experimentally in Gr/Cu. Finally, simulation of the actual fiber distribution of particular specimens had little effect on the predicted thermal expansion.

  7. Simulation of radioelement volatility during the vitrification of radioactive wastes by arc plasma.

    PubMed

    Ghiloufi, Imed

    2009-04-15

    A computer model is used to simulate the volatility of some radioelements cesium ((137)Cs), cobalt ((60)Co), and ruthenium ((106)Ru) during the radioactive wastes vitrification by thermal plasma. This model is based on the calculation of system composition using the free enthalpy minimization method, coupled with the equation of mass transfer at the reactional interface. The model enables the determination of the effects of various parameters (e.g., temperature, plasma current, and matrix composition) on the radioelement volatility. The obtained results indicate that any increase in molten bath temperature causes an increase in the cobalt volatility; while ruthenium has a less obvious behavior. It is also found that the oxygen flux in the carrier gas supports the radioelement incorporations in the containment matrix, except in the case of the ruthenium which is more volatile under an oxidizing atmosphere. For electrolyses effects, an increase in the plasma current considerably increases both the vaporization speed and the vaporized quantities of (137)Cs and (60)Co. The increase of silicon percentage in the containment matrix supports the incorporation of (60)Co and (137)Cs in the matrix. The simulation results are compared favorably to the experimental measurements obtained by emission spectroscopy.

  8. A quasi-likelihood approach to non-negative matrix factorization

    PubMed Central

    Devarajan, Karthik; Cheung, Vincent C.K.

    2017-01-01

    A unified approach to non-negative matrix factorization based on the theory of generalized linear models is proposed. This approach embeds a variety of statistical models, including the exponential family, within a single theoretical framework and provides a unified view of such factorizations from the perspective of quasi-likelihood. Using this framework, a family of algorithms for handling signal-dependent noise is developed and its convergence proven using the Expectation-Maximization algorithm. In addition, a measure to evaluate the goodness-of-fit of the resulting factorization is described. The proposed methods allow modeling of non-linear effects via appropriate link functions and are illustrated using an application in biomedical signal processing. PMID:27348511

  9. Elastic K-means using posterior probability.

    PubMed

    Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

    2017-01-01

    The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model.

  10. Calculating Path-Dependent Travel Time Prediction Variance and Covariance fro a Global Tomographic P-Velocity Model

    NASA Astrophysics Data System (ADS)

    Ballard, S.; Hipp, J. R.; Encarnacao, A.; Young, C. J.; Begnaud, M. L.; Phillips, W. S.

    2012-12-01

    Seismic event locations can be made more accurate and precise by computing predictions of seismic travel time through high fidelity 3D models of the wave speed in the Earth's interior. Given the variable data quality and uneven data sampling associated with this type of model, it is essential that there be a means to calculate high-quality estimates of the path-dependent variance and covariance associated with the predicted travel times of ray paths through the model. In this paper, we describe a methodology for accomplishing this by exploiting the full model covariance matrix and show examples of path-dependent travel time prediction uncertainty computed from SALSA3D, our global, seamless 3D tomographic P-velocity model. Typical global 3D models have on the order of 1/2 million nodes, so the challenge in calculating the covariance matrix is formidable: 0.9 TB storage for 1/2 of a symmetric matrix, necessitating an Out-Of-Core (OOC) blocked matrix solution technique. With our approach the tomography matrix (G which includes Tikhonov regularization terms) is multiplied by its transpose (GTG) and written in a blocked sub-matrix fashion. We employ a distributed parallel solution paradigm that solves for (GTG)-1 by assigning blocks to individual processing nodes for matrix decomposition update and scaling operations. We first find the Cholesky decomposition of GTG which is subsequently inverted. Next, we employ OOC matrix multiplication methods to calculate the model covariance matrix from (GTG)-1 and an assumed data covariance matrix. Given the model covariance matrix, we solve for the travel-time covariance associated with arbitrary ray-paths by summing the model covariance along both ray paths. Setting the paths equal and taking the square root yields the travel prediction uncertainty for the single path.

  11. Voltage-Load Sensitivity Matrix Based Demand Response for Voltage Control in High Solar Penetration Distribution Feeders

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Xiangqi; Wang, Jiyu; Mulcahy, David

    This paper presents a voltage-load sensitivity matrix (VLSM) based voltage control method to deploy demand response resources for controlling voltage in high solar penetration distribution feeders. The IEEE 123-bus system in OpenDSS is used for testing the performance of the preliminary VLSM-based voltage control approach. A load disaggregation process is applied to disaggregate the total load profile at the feeder head to each load nodes along the feeder so that loads are modeled at residential house level. Measured solar generation profiles are used in the simulation to model the impact of solar power on distribution feeder voltage profiles. Different casemore » studies involving various PV penetration levels and installation locations have been performed. Simulation results show that the VLSM algorithm performance meets the voltage control requirements and is an effective voltage control strategy.« less

  12. Synergistic Effects of Temperature and Oxidation on Matrix Cracking in Fiber-Reinforced Ceramic-Matrix Composites

    NASA Astrophysics Data System (ADS)

    Longbiao, Li

    2017-06-01

    In this paper, the synergistic effects of temperatrue and oxidation on matrix cracking in fiber-reinforced ceramic-matrix composites (CMCs) has been investigated using energy balance approach. The shear-lag model cooperated with damage models, i.e., the interface oxidation model, interface debonding model, fiber strength degradation model and fiber failure model, has been adopted to analyze microstress field in the composite. The relationships between matrix cracking stress, interface debonding and slipping, fiber fracture, oxidation temperatures and time have been established. The effects of fiber volume fraction, interface properties, fiber strength and oxidation temperatures on the evolution of matrix cracking stress versus oxidation time have been analyzed. The matrix cracking stresses of C/SiC composite with strong and weak interface bonding after unstressed oxidation at an elevated temperature of 700 °C in air condition have been predicted for different oxidation time.

  13. Meso-Scale Progressive Damage Behavior Characterization of Triaxial Braided Composites under Quasi-Static Tensile Load

    NASA Astrophysics Data System (ADS)

    Ren, Yiru; Zhang, Songjun; Jiang, Hongyong; Xiang, Jinwu

    2018-04-01

    Based on continuum damage mechanics (CDM), a sophisticated 3D meso-scale finite element (FE) model is proposed to characterize the progressive damage behavior of 2D Triaxial Braided Composites (2DTBC) with 60° braiding angle under quasi-static tensile load. The modified Von Mises strength criterion and 3D Hashin failure criterion are used to predict the damage initiation of the pure matrix and fiber tows. A combining interface damage and friction constitutive model is applied to predict the interface damage behavior. Murakami-Ohno stiffness degradation scheme is employed to predict the damage evolution process of each constituent. Coupling with the ordinary and translational symmetry boundary conditions, the tensile elastic response including tensile strength and failure strain of 2DTBC are in good agreement with the available experiment data. The numerical results show that the main failure modes of the composites under axial tensile load are pure matrix cracking, fiber and matrix tension failure in bias fiber tows, matrix tension failure in axial fiber tows and interface debonding; the main failure modes of the composites subjected to transverse tensile load are free-edge effect, matrix tension failure in bias fiber tows and interface debonding.

  14. Multiple Concentric Cylinder Model (MCCM) user's guide

    NASA Technical Reports Server (NTRS)

    Williams, Todd O.; Pindera, Marek-Jerzy

    1994-01-01

    A user's guide for the computer program mccm.f is presented. The program is based on a recently developed solution methodology for the inelastic response of an arbitrarily layered, concentric cylinder assemblage under thermomechanical loading which is used to model the axisymmetric behavior of unidirectional metal matrix composites in the presence of various microstructural details. These details include the layered morphology of certain types of ceramic fibers, as well as multiple fiber/matrix interfacial layers recently proposed as a means of reducing fabrication-induced, and in-service, residual stress. The computer code allows efficient characterization and evaluation of new fibers and/or new coating systems on existing fibers with a minimum of effort, taking into account inelastic and temperature-dependent properties and different morphologies of the fiber and the interfacial region. It also facilitates efficient design of engineered interfaces for unidirectional metal matrix composites.

  15. Investigation of Thermal Hardening of the FCC Material Containing Strengthening Particles with an L12 Superstructure

    NASA Astrophysics Data System (ADS)

    Daneyko, O. I.; Kulaeva, N. A.; Kovalevskaya, C. A.; Kolupaeva, S. N.

    2015-07-01

    A mathematical model of plastic deformation of dispersion-hardened materials with an fcc matrix containing strengthening particles with an L12 superstructure having a coherent relationship with the matrix is presented. The model is based on the balance equations of deformation defects of different types with taking into account their transformation during plastic deformation. The influence of scale characteristics of the hardening phase, temperature, and deformation rate on the evolution of the dislocation subsystem and strain hardening of an alloy with an fcc matrix hardened by particles with an L12 super structure is studied. A temperature anomaly of mechanical properties is found for the materials with different fcc matrices (Al,Cu, Ni). It is shown that the temperature anomaly is more pronounced for the material with larger volume fraction of the hardening phase.

  16. Constitutive Modeling and Testing of Polymer Matrix Composites Incorporating Physical Aging at Elevated Temperatures

    NASA Technical Reports Server (NTRS)

    Veazie, David R.

    1998-01-01

    Advanced polymer matrix composites (PMC's) are desirable for structural materials in diverse applications such as aircraft, civil infrastructure and biomedical implants because of their improved strength-to-weight and stiffness-to-weight ratios. For example, the next generation military and commercial aircraft requires applications for high strength, low weight structural components subjected to elevated temperatures. A possible disadvantage of polymer-based composites is that the physical and mechanical properties of the matrix often change significantly over time due to the exposure of elevated temperatures and environmental factors. For design, long term exposure (i.e. aging) of PMC's must be accounted for through constitutive models in order to accurately assess the effects of aging on performance, crack initiation and remaining life. One particular aspect of this aging process, physical aging, is considered in this research.

  17. Proteomic analysis of sea urchin (Strongylocentrotus purpuratus) spicule matrix

    PubMed Central

    2010-01-01

    Background The sea urchin embryo has been an important model organism in developmental biology for more than a century. This is due to its relatively simple construction, translucent appearance, and the possibility to follow the fate of individual cells as development to the pluteus larva proceeds. Because the larvae contain tiny calcitic skeletal elements, the spicules, they are also important model organisms for biomineralization research. Similar to other biominerals the spicule contains an organic matrix, which is thought to play an important role in its formation. However, only few spicule matrix proteins were identified previously. Results Using mass spectrometry-based methods we have identified 231 proteins in the matrix of the S. purpuratus spicule matrix. Approximately two thirds of the identified proteins are either known or predicted to be extracellular proteins or transmembrane proteins with large ectodomains. The ectodomains may have been solubilized by partial proteolysis and subsequently integrated into the growing spicule. The most abundant protein of the spicule matrix is SM50. SM50-related proteins, SM30-related proteins, MSP130 and related proteins, matrix metalloproteases and carbonic anhydrase are among the most abundant components. Conclusions The spicule matrix is a relatively complex mixture of proteins not only containing matrix-specific proteins with a function in matrix assembly or mineralization, but also: 1) proteins possibly important for the formation of the continuous membrane delineating the mineralization space; 2) proteins for secretory processes delivering proteinaceous or non-proteinaceous precursors; 3) or proteins reflecting signaling events at the cell/matrix interface. Comparison of the proteomes of different skeletal matrices allows prediction of proteins of general importance for mineralization in sea urchins, such as SM50, SM30-E, SM29 or MSP130. The comparisons also help point out putative tissue-specific proteins, such as tooth phosphodontin or specific spicule matrix metalloproteases of the MMP18/19 group. Furthermore, the direct sequence analysis of peptides by MS/MS validates many predicted genes and confirms the existence of the corresponding proteins. PMID:20565753

  18. L70 life prediction for solid state lighting using Kalman Filter and Extended Kalman Filter based models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lall, Pradeep; Wei, Junchao; Davis, Lynn

    2013-08-08

    Solid-state lighting (SSL) luminaires containing light emitting diodes (LEDs) have the potential of seeing excessive temperatures when being transported across country or being stored in non-climate controlled warehouses. They are also being used in outdoor applications in desert environments that see little or no humidity but will experience extremely high temperatures during the day. This makes it important to increase our understanding of what effects high temperature exposure for a prolonged period of time will have on the usability and survivability of these devices. Traditional light sources “burn out” at end-of-life. For an incandescent bulb, the lamp life is definedmore » by B50 life. However, the LEDs have no filament to “burn”. The LEDs continually degrade and the light output decreases eventually below useful levels causing failure. Presently, the TM-21 test standard is used to predict the L70 life of LEDs from LM-80 test data. Several failure mechanisms may be active in a LED at a single time causing lumen depreciation. The underlying TM-21 Model may not capture the failure physics in presence of multiple failure mechanisms. Correlation of lumen maintenance with underlying physics of degradation at system-level is needed. In this paper, Kalman Filter (KF) and Extended Kalman Filters (EKF) have been used to develop a 70-percent Lumen Maintenance Life Prediction Model for LEDs used in SSL luminaires. Ten-thousand hour LM-80 test data for various LEDs have been used for model development. System state at each future time has been computed based on the state space at preceding time step, system dynamics matrix, control vector, control matrix, measurement matrix, measured vector, process noise and measurement noise. The future state of the lumen depreciation has been estimated based on a second order Kalman Filter model and a Bayesian Framework. The measured state variable has been related to the underlying damage using physics-based models. Life prediction of L70 life for the LEDs used in SSL luminaires from KF and EKF based models have been compared with the TM-21 model predictions and experimental data.« less

  19. Force Project Technology Presentation to the NRCC

    DTIC Science & Technology

    2014-02-04

    Functional Bridge components Smart Odometer Adv Pretreatment Smart Bridge Multi-functional Gap Crossing Fuel Automated Tracking System Adv...comprehensive matrix of candidate composite material systems and textile reinforcement architectures via modeling/analyses and testing. Product(s...Validated Dynamic Modeling tool based on parametric study using material models to reliably predict the textile mechanics of the hose

  20. Transverse Tensile Properties of 3 Dimension-4 Directional Braided Cf/SiC Composite Based on Double-Scale Model

    NASA Astrophysics Data System (ADS)

    Niu, Xuming; Sun, Zhigang; Song, Yingdong

    2017-11-01

    In this thesis, a double-scale model for 3 Dimension-4 directional(3D-4d) braided C/SiC composites(CMCs) has been proposed to investigate mechanical properties of it. The double-scale model involves micro-scale which takes fiber/matrix/porosity in fibers tows into consideration and the unit cell scale which considers the 3D-4d braiding structure. Basing on the Micro-optical photographs of composite, we can build a parameterized finite element model that reflects structure of 3D-4d braided composites. The mechanical properties of fiber tows in transverse direction are studied by combining the crack band theory for matrix cracking and cohesive zone model for interface debonding. Transverse tensile process of 3D-4d CMCs can be simulated by introducing mechanical properties of fiber tows into finite element of 3D-4d braided CMCs. Quasi-static tensile tests of 3D-4d braided CMCs have been performed with PWS-100 test system. The predicted tensile stress-strain curve by the double scale model finds good agreement with the experimental results.

  1. Stochastic damage evolution in textile laminates

    NASA Technical Reports Server (NTRS)

    Dzenis, Yuris A.; Bogdanovich, Alexander E.; Pastore, Christopher M.

    1993-01-01

    A probabilistic model utilizing random material characteristics to predict damage evolution in textile laminates is presented. Model is based on a division of each ply into two sublaminas consisting of cells. The probability of cell failure is calculated using stochastic function theory and maximal strain failure criterion. Three modes of failure, i.e. fiber breakage, matrix failure in transverse direction, as well as matrix or interface shear cracking, are taken into account. Computed failure probabilities are utilized in reducing cell stiffness based on the mesovolume concept. A numerical algorithm is developed predicting the damage evolution and deformation history of textile laminates. Effect of scatter of fiber orientation on cell properties is discussed. Weave influence on damage accumulation is illustrated with the help of an example of a Kevlar/epoxy laminate.

  2. Numerical modeling of coupled variably saturated fluid flow and reactive transport with fast and slow chemical reactions

    NASA Astrophysics Data System (ADS)

    Yeh, Gour-Tsyh (George); Siegel, Malcolm D.; Li, Ming-Hsu

    2001-02-01

    The couplings among chemical reaction rates, advective and diffusive transport in fractured media or soils, and changes in hydraulic properties due to precipitation and dissolution within fractures and in rock matrix are important for both nuclear waste disposal and remediation of contaminated sites. This paper describes the development and application of LEHGC2.0, a mechanistically based numerical model for simulation of coupled fluid flow and reactive chemical transport, including both fast and slow reactions in variably saturated media. Theoretical bases and numerical implementations are summarized, and two example problems are demonstrated. The first example deals with the effect of precipitation/dissolution on fluid flow and matrix diffusion in a two-dimensional fractured media. Because of the precipitation and decreased diffusion of solute from the fracture into the matrix, retardation in the fractured medium is not as large as the case wherein interactions between chemical reactions and transport are not considered. The second example focuses on a complicated but realistic advective-dispersive-reactive transport problem. This example exemplifies the need for innovative numerical algorithms to solve problems involving stiff geochemical reactions.

  3. Models of ventricular structure and function reviewed for clinical cardiologists.

    PubMed

    Lunkenheimer, Paul P; Niederer, Peter; Sanchez-Quintana, Damian; Murillo, Margarita; Smerup, Morten

    2013-04-01

    The architectural arrangement of cardiomyocytes aggregated together within the ventricular walls remains controversial. Two models currently attract clinical attention, with neither model standing rigorous anatomical scrutiny. The first is based on the notion that ventricular mass can be unraveled consistently to produce a unique myocardial band. The second model was initially based on the notion that cardiomyocytes were bundled together in uniform fashion, with fibrous shelves interposed in transmural fashion. This concept was subsequently modified to accept the fact that the fibrous matrix supporting the cardiomyocytes within the ventricular walls does not form transmural sheets. Current observations demonstrate that not all cardiomyocytes are aggregated together in tangential fashion. A significant netting component is aligned in obliquely intruding and transversal fashion. The interaction between the tangential and transversal chains of cardiomyocytes with the fibrous matrix produces antagonistic forces, with both unloading and auxotonic forces necessary to explain normal and abnormal cardiodynamics. This article is part of a JCTR special issue on Cardiac Anatomy.

  4. Radiative Transfer Model for Operational Retrieval of Cloud Parameters from DSCOVR-EPIC Measurements

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Molina Garcia, V.; Doicu, A.; Loyola, D. G.

    2016-12-01

    The Earth Polychromatic Imaging Camera (EPIC) onboard the Deep Space Climate Observatory (DSCOVR) measures the radiance in the backscattering region. To make sure that all details in the backward glory are covered, a large number of streams is required by a standard radiative transfer model based on the discrete ordinates method. Even the use of the delta-M scaling and the TMS correction do not substantially reduce the number of streams. The aim of this work is to analyze the capability of a fast radiative transfer model to retrieve operationally cloud parameters from EPIC measurements. The radiative transfer model combines the discrete ordinates method with matrix exponential for the computation of radiances and the matrix operator method for the calculation of the reflection and transmission matrices. Standard acceleration techniques as, for instance, the use of the normalized right and left eigenvectors, telescoping technique, Pade approximation and successive-order-of-scattering approximation are implemented. In addition, the model may compute the reflection matrix of the cloud by means of the asymptotic theory, and may use the equivalent Lambertian cloud model. The various approximations are analyzed from the point of view of efficiency and accuracy.

  5. Biomechanically based simulation of brain deformations for intraoperative image correction: coupling of elastic and fluid models

    NASA Astrophysics Data System (ADS)

    Hagemann, Alexander; Rohr, Karl; Stiehl, H. Siegfried

    2000-06-01

    In order to improve the accuracy of image-guided neurosurgery, different biomechanical models have been developed to correct preoperative images w.r.t. intraoperative changes like brain shift or tumor resection. All existing biomechanical models simulate different anatomical structures by using either appropriate boundary conditions or by spatially varying material parameter values, while assuming the same physical model for all anatomical structures. In general, this leads to physically implausible results, especially in the case of adjacent elastic and fluid structures. Therefore, we propose a new approach which allows to couple different physical models. In our case, we simulate rigid, elastic, and fluid regions by using the appropriate physical description for each material, namely either the Navier equation or the Stokes equation. To solve the resulting differential equations, we derive a linear matrix system for each region by applying the finite element method (FEM). Thereafter, the linear matrix systems are linked together, ending up with one overall linear matrix system. Our approach has been tested using synthetic as well as tomographic images. It turns out from experiments, that the integrated treatment of rigid, elastic, and fluid regions significantly improves the prediction results in comparison to a pure linear elastic model.

  6. Rephasing invariants of the Cabibbo-Kobayashi- Maskawa matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pérez R, H.; Kielanowski, P., E-mail: kiel@fis.cinvestav.mx; Juárez W, S. R., E-mail: rebeca@esfm.ipn.mx

    2016-03-15

    The paper is motivated by the importance of the rephasing invariance of the CKM (Cabibbo-Kobayashi-Maskawa) matrix observables. These observables appear in the discussion of the CP violation in the standard model (Jarlskog invariant) and also in the renormalization group equations for the quark Yukawa couplings. Our discussion is based on the general phase invariant monomials built out of the CKM matrix elements and their conjugates. We show that there exist 30 fundamental phase invariant monomials and 18 of them are a product of 4 CKM matrix elements and 12 are a product of 6 CKM matrix elements. In the mainmore » theorem we show that a general rephasing invariant monomial can be expressed as a product of at most five factors: four of them are fundamental phase invariant monomials and the fifth factor consists of powers of squares of absolute values of the CKM matrix elements. We also show that the imaginary part of any rephasing invariant monomial is proportional to the Jarlskog’s invariant J or is 0.« less

  7. Recursive flexible multibody system dynamics using spatial operators

    NASA Technical Reports Server (NTRS)

    Jain, A.; Rodriguez, G.

    1992-01-01

    This paper uses spatial operators to develop new spatially recursive dynamics algorithms for flexible multibody systems. The operator description of the dynamics is identical to that for rigid multibody systems. Assumed-mode models are used for the deformation of each individual body. The algorithms are based on two spatial operator factorizations of the system mass matrix. The first (Newton-Euler) factorization of the mass matrix leads to recursive algorithms for the inverse dynamics, mass matrix evaluation, and composite-body forward dynamics for the systems. The second (innovations) factorization of the mass matrix, leads to an operator expression for the mass matrix inverse and to a recursive articulated-body forward dynamics algorithm. The primary focus is on serial chains, but extensions to general topologies are also described. A comparison of computational costs shows that the articulated-body, forward dynamics algorithm is much more efficient than the composite-body algorithm for most flexible multibody systems.

  8. Stochastic determination of matrix determinants

    NASA Astrophysics Data System (ADS)

    Dorn, Sebastian; Enßlin, Torsten A.

    2015-07-01

    Matrix determinants play an important role in data analysis, in particular when Gaussian processes are involved. Due to currently exploding data volumes, linear operations—matrices—acting on the data are often not accessible directly but are only represented indirectly in form of a computer routine. Such a routine implements the transformation a data vector undergoes under matrix multiplication. While efficient probing routines to estimate a matrix's diagonal or trace, based solely on such computationally affordable matrix-vector multiplications, are well known and frequently used in signal inference, there is no stochastic estimate for its determinant. We introduce a probing method for the logarithm of a determinant of a linear operator. Our method rests upon a reformulation of the log-determinant by an integral representation and the transformation of the involved terms into stochastic expressions. This stochastic determinant determination enables large-size applications in Bayesian inference, in particular evidence calculations, model comparison, and posterior determination.

  9. Stochastic determination of matrix determinants.

    PubMed

    Dorn, Sebastian; Ensslin, Torsten A

    2015-07-01

    Matrix determinants play an important role in data analysis, in particular when Gaussian processes are involved. Due to currently exploding data volumes, linear operations-matrices-acting on the data are often not accessible directly but are only represented indirectly in form of a computer routine. Such a routine implements the transformation a data vector undergoes under matrix multiplication. While efficient probing routines to estimate a matrix's diagonal or trace, based solely on such computationally affordable matrix-vector multiplications, are well known and frequently used in signal inference, there is no stochastic estimate for its determinant. We introduce a probing method for the logarithm of a determinant of a linear operator. Our method rests upon a reformulation of the log-determinant by an integral representation and the transformation of the involved terms into stochastic expressions. This stochastic determinant determination enables large-size applications in Bayesian inference, in particular evidence calculations, model comparison, and posterior determination.

  10. Organism and population-level ecological models for ...

    EPA Pesticide Factsheets

    Ecological risk assessment typically focuses on animal populations as endpoints for regulatory ecotoxicology. Scientists at USEPA are developing models for animal populations exposed to a wide range of chemicals from pesticides to emerging contaminants. Modeled taxa include aquatic and terrestrial invertebrates, fish, amphibians, and birds, and employ a wide range of methods, from matrix-based projection models to mechanistic bioenergetics models and spatially explicit population models. not applicable

  11. High Strain Rate Deformation Modeling of a Polymer Matrix Composite. Part 1; Matrix Constitutive Equations

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Stouffer, Donald C.

    1998-01-01

    Recently applications have exposed polymer matrix composite materials to very high strain rate loading conditions, requiring an ability to understand and predict the material behavior under these extreme conditions. In this first paper of a two part report, background information is presented, along with the constitutive equations which will be used to model the rate dependent nonlinear deformation response of the polymer matrix. Strain rate dependent inelastic constitutive models which were originally developed to model the viscoplastic deformation of metals have been adapted to model the nonlinear viscoelastic deformation of polymers. The modified equations were correlated by analyzing the tensile/ compressive response of both 977-2 toughened epoxy matrix and PEEK thermoplastic matrix over a variety of strain rates. For the cases examined, the modified constitutive equations appear to do an adequate job of modeling the polymer deformation response. A second follow-up paper will describe the implementation of the polymer deformation model into a composite micromechanical model, to allow for the modeling of the nonlinear, rate dependent deformation response of polymer matrix composites.

  12. A method for assigning species into groups based on generalized Mahalanobis distance between habitat model coefficients

    USGS Publications Warehouse

    Williams, C.J.; Heglund, P.J.

    2009-01-01

    Habitat association models are commonly developed for individual animal species using generalized linear modeling methods such as logistic regression. We considered the issue of grouping species based on their habitat use so that management decisions can be based on sets of species rather than individual species. This research was motivated by a study of western landbirds in northern Idaho forests. The method we examined was to separately fit models to each species and to use a generalized Mahalanobis distance between coefficient vectors to create a distance matrix among species. Clustering methods were used to group species from the distance matrix, and multidimensional scaling methods were used to visualize the relations among species groups. Methods were also discussed for evaluating the sensitivity of the conclusions because of outliers or influential data points. We illustrate these methods with data from the landbird study conducted in northern Idaho. Simulation results are presented to compare the success of this method to alternative methods using Euclidean distance between coefficient vectors and to methods that do not use habitat association models. These simulations demonstrate that our Mahalanobis-distance- based method was nearly always better than Euclidean-distance-based methods or methods not based on habitat association models. The methods used to develop candidate species groups are easily explained to other scientists and resource managers since they mainly rely on classical multivariate statistical methods. ?? 2008 Springer Science+Business Media, LLC.

  13. A Nonlinear Three-Dimensional Micromechanics Model for Fiber-Reinforced Laminated Composites

    DTIC Science & Technology

    1993-11-01

    Interfacial Properties Employed for the SCS6/Ti-15-3 Composite ......................... 150 11. Constants Employed for the LLFM Predictions of Quasi...Region m Matrix Property or Mean of the Interfacial Stress Distribution ml, m2, m3 Signifies Matrix Region n Normal to Interface r Signifies Equation...usage of the new class of titanium based com- posites in advanced aerospace structures and engines such as are targeted for the advanced tactical fighter

  14. A Hybrid Cellular Automaton Model of Clonal Evolution in Cancer: The Emergence of the Glycolytic Phenotype

    PubMed Central

    Gerlee, P.; Anderson, A.R.A.

    2009-01-01

    We present a cellular automaton model of clonal evolution in cancer aimed at investigating the emergence of the glycolytic phenotype. In the model each cell is equipped with a micro-environment response network that determines the behaviour or phenotype of the cell based on the local environment. The response network is modelled using a feed-forward neural network, which is subject to mutations when the cells divide. This implies that cells might react differently to the environment and when space and nutrients are limited only the fittest cells will survive. With this model we have investigated the impact of the environment on the growth dynamics of the tumour. In particular we have analysed the influence of the tissue oxygen concentration and extra-cellular matrix density on the dynamics of the model. We found that the environment influences both the growth and evolutionary dynamics of the tumour. For low oxygen concentration we observe tumours with a fingered morphology, while increasing the matrix density gives rise to more compact tumours with wider fingers. The distribution of phenotypes in the tumour is also affected, and we observe that the glycolytic phenotype is most likely to emerge in a poorly oxygenated tissue with a high matrix density. Our results suggest that it is the combined effect of the oxygen concentration and matrix density that creates an environment where the glycolytic phenotype has a growth advantage and consequently is most likely to appear. PMID:18068192

  15. Differential continuum damage mechanics models for creep and fatigue of unidirectional metal matrix composites

    NASA Technical Reports Server (NTRS)

    Arnold, S. M.; Kruch, S.

    1991-01-01

    Three multiaxial isothermal continuum damage mechanics models for creep, fatigue, and creep/fatigue interaction of a unidirectional metal matrix composite volume element are presented, only one of which will be discussed in depth. Each model is phenomenological and stress based, with varying degrees of complexity to accurately predict the initiation and propagation of intergranular and transgranular defects over a wide range of loading conditions. The development of these models is founded on the definition of an initially transversely isotropic fatigue limit surface, static fracture surface, normalized stress amplitude function and isochronous creep damage failure surface, from which both fatigue and creep damage evolutionary laws can be obtained. The anisotropy of each model is defined through physically meaningful invariants reflecting the local stress and material orientation. All three transversely isotropic models have been shown, when taken to their isotropic limit, to directly simplify to previously developed and validated creep and fatigue continuum damage theories. Results of a nondimensional parametric study illustrate (1) the flexibility of the present formulation when attempting to characterize a large class of composite materials, and (2) its ability to predict anticipated qualitative trends in the fatigue behavior of unidirectional metal matrix composites. Additionally, the potential for the inclusion of various micromechanical effects (e.g., fiber/matrix bond strength, fiber volume fraction, etc.), into the phenomenological anisotropic parameters is noted, as well as a detailed discussion regarding the necessary exploratory and characterization experiments needed to utilize the featured damage theories.

  16. Person Re-Identification via Distance Metric Learning With Latent Variables.

    PubMed

    Sun, Chong; Wang, Dong; Lu, Huchuan

    2017-01-01

    In this paper, we propose an effective person re-identification method with latent variables, which represents a pedestrian as the mixture of a holistic model and a number of flexible models. Three types of latent variables are introduced to model uncertain factors in the re-identification problem, including vertical misalignments, horizontal misalignments and leg posture variations. The distance between two pedestrians can be determined by minimizing a given distance function with respect to latent variables, and then be used to conduct the re-identification task. In addition, we develop a latent metric learning method for learning the effective metric matrix, which can be solved via an iterative manner: once latent information is specified, the metric matrix can be obtained based on some typical metric learning methods; with the computed metric matrix, the latent variables can be determined by searching the state space exhaustively. Finally, extensive experiments are conducted on seven databases to evaluate the proposed method. The experimental results demonstrate that our method achieves better performance than other competing algorithms.

  17. Geostatistical Borehole Image-Based Mapping of Karst-Carbonate Aquifer Pores.

    PubMed

    Sukop, Michael C; Cunningham, Kevin J

    2016-03-01

    Quantification of the character and spatial distribution of porosity in carbonate aquifers is important as input into computer models used in the calculation of intrinsic permeability and for next-generation, high-resolution groundwater flow simulations. Digital, optical, borehole-wall image data from three closely spaced boreholes in the karst-carbonate Biscayne aquifer in southeastern Florida are used in geostatistical experiments to assess the capabilities of various methods to create realistic two-dimensional models of vuggy megaporosity and matrix-porosity distribution in the limestone that composes the aquifer. When the borehole image data alone were used as the model training image, multiple-point geostatistics failed to detect the known spatial autocorrelation of vuggy megaporosity and matrix porosity among the three boreholes, which were only 10 m apart. Variogram analysis and subsequent Gaussian simulation produced results that showed a realistic conceptualization of horizontal continuity of strata dominated by vuggy megaporosity and matrix porosity among the three boreholes. © 2015, National Ground Water Association.

  18. Modeling the Nonlinear, Strain Rate Dependent Deformation of Shuttle Leading Edge Materials with Hydrostatic Stress Effects Included

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Carney, Kelly S.

    2004-01-01

    An analysis method based on a deformation (as opposed to damage) approach has been developed to model the strain rate dependent, nonlinear deformation of woven ceramic matrix composites, such as the Reinforced Carbon Carbon (RCC) material used on the leading edges of the Space Shuttle. In the developed model, the differences in the tension and compression deformation behaviors have also been accounted for. State variable viscoplastic equations originally developed for metals have been modified to analyze the ceramic matrix composites. To account for the tension/compression asymmetry in the material, the effective stress and effective inelastic strain definitions have been modified. The equations have also been modified to account for the fact that in an orthotropic composite the in-plane shear response is independent of the stiffness in the normal directions. The developed equations have been implemented into LS-DYNA through the use of user defined subroutines (UMATs). Several sample qualitative calculations have been conducted, which demonstrate the ability of the model to qualitatively capture the features of the deformation response present in woven ceramic matrix composites.

  19. Quantitative framework for preferential flow initiation and partitioning

    USGS Publications Warehouse

    Nimmo, John R.

    2016-01-01

    A model for preferential flow in macropores is based on the short-range spatial distribution of soil matrix infiltrability. It uses elementary areas at two different scales. One is the traditional representative elementary area (REA), which includes a sufficient heterogeneity to typify larger areas, as for measuring field-scale infiltrability. The other, called an elementary matrix area (EMA), is smaller, but large enough to represent the local infiltrability of soil matrix material, between macropores. When water is applied to the land surface, each EMA absorbs water up to the rate of its matrix infiltrability. Excess water flows into a macropore, becoming preferential flow. The land surface then can be represented by a mesoscale (EMA-scale) distribution of matrix infiltrabilities. Total preferential flow at a given depth is the sum of contributions from all EMAs. Applying the model, one case study with multi-year field measurements of both preferential and diffuse fluxes at a specific depth was used to obtain parameter values by inverse calculation. The results quantify the preferential–diffuse partition of flow from individual storms that differed in rainfall amount, intensity, antecedent soil water, and other factors. Another case study provided measured values of matrix infiltrability to estimate parameter values for comparison and illustrative predictions. These examples give a self-consistent picture from the combination of parameter values, directions of sensitivities, and magnitudes of differences caused by different variables. One major practical use of this model is to calculate the dependence of preferential flow on climate-related factors, such as varying soil wetness and rainfall intensity.

  20. CoCoa: a software tool for estimating the coefficient of coancestry from multilocus genotype data.

    PubMed

    Maenhout, Steven; De Baets, Bernard; Haesaert, Geert

    2009-10-15

    Phenotypic data collected in breeding programs and marker-trait association studies are often analyzed by means of linear mixed models. In these models, the covariance between the genetic background effects of all genotypes under study is modeled by means of pairwise coefficients of coancestry. Several marker-based coancestry estimation procedures allow to estimate this covariance matrix, but generally introduce a certain amount of bias when the examined genotypes are part of a breeding program. CoCoa implements the most commonly used marker-based coancestry estimation procedures and as such, allows to select the best fitting covariance structure for the phenotypic data at hand. This better model fit translates into an increased power and improved type I error control in association studies and an improved accuracy in phenotypic prediction studies. The presented software package also provides an implementation of the new Weighted Alikeness in State (WAIS) estimator for use in hybrid breeding programs. Besides several matrix manipulation tools, CoCoa implements two different bending heuristics, in case the inverse of an ill-conditioned coancestry matrix estimate is needed. The software package CoCoa is freely available at http://webs.hogent.be/cocoa. Source code, manual, binaries for 32 and 64-bit Linux systems and an installer for Microsoft Windows are provided. The core components of CoCoa are written in C++, while the graphical user interface is written in Java.

  1. Composite materials: Fatigue and fracture. Vol. 3

    NASA Technical Reports Server (NTRS)

    O'Brien, T. K. (Editor)

    1991-01-01

    The present volume discusses topics in the fields of matrix cracking and delamination, interlaminar fracture toughness, delamination analysis, strength and impact characteristics, and fatigue and fracture behavior. Attention is given to cooling rate effects in carbon-reinforced PEEK, the effect of porosity on flange-web corner strength, mode II delamination in toughened composites, the combined effect of matrix cracking and free edge delamination, and a 3D stress analysis of plain weave composites. Also discussed are the compression behavior of composites, damage-based notched-strength modeling, fatigue failure processes in aligned carbon-epoxy laminates, and the thermomechanical fatigue of a quasi-isotropic metal-matrix composite.

  2. Blind compressed sensing image reconstruction based on alternating direction method

    NASA Astrophysics Data System (ADS)

    Liu, Qinan; Guo, Shuxu

    2018-04-01

    In order to solve the problem of how to reconstruct the original image under the condition of unknown sparse basis, this paper proposes an image reconstruction method based on blind compressed sensing model. In this model, the image signal is regarded as the product of a sparse coefficient matrix and a dictionary matrix. Based on the existing blind compressed sensing theory, the optimal solution is solved by the alternative minimization method. The proposed method solves the problem that the sparse basis in compressed sensing is difficult to represent, which restrains the noise and improves the quality of reconstructed image. This method ensures that the blind compressed sensing theory has a unique solution and can recover the reconstructed original image signal from a complex environment with a stronger self-adaptability. The experimental results show that the image reconstruction algorithm based on blind compressed sensing proposed in this paper can recover high quality image signals under the condition of under-sampling.

  3. Convergence of Transition Probability Matrix in CLVMarkov Models

    NASA Astrophysics Data System (ADS)

    Permana, D.; Pasaribu, U. S.; Indratno, S. W.; Suprayogi, S.

    2018-04-01

    A transition probability matrix is an arrangement of transition probability from one states to another in a Markov chain model (MCM). One of interesting study on the MCM is its behavior for a long time in the future. The behavior is derived from one property of transition probabilty matrix for n steps. This term is called the convergence of the n-step transition matrix for n move to infinity. Mathematically, the convergence of the transition probability matrix is finding the limit of the transition matrix which is powered by n where n moves to infinity. The convergence form of the transition probability matrix is very interesting as it will bring the matrix to its stationary form. This form is useful for predicting the probability of transitions between states in the future. The method usually used to find the convergence of transition probability matrix is through the process of limiting the distribution. In this paper, the convergence of the transition probability matrix is searched using a simple concept of linear algebra that is by diagonalizing the matrix.This method has a higher level of complexity because it has to perform the process of diagonalization in its matrix. But this way has the advantage of obtaining a common form of power n of the transition probability matrix. This form is useful to see transition matrix before stationary. For example cases are taken from CLV model using MCM called Model of CLV-Markov. There are several models taken by its transition probability matrix to find its convergence form. The result is that the convergence of the matrix of transition probability through diagonalization has similarity with convergence with commonly used distribution of probability limiting method.

  4. Link predication based on matrix factorization by fusion of multi class organizations of the network.

    PubMed

    Jiao, Pengfei; Cai, Fei; Feng, Yiding; Wang, Wenjun

    2017-08-21

    Link predication aims at forecasting the latent or unobserved edges in the complex networks and has a wide range of applications in reality. Almost existing methods and models only take advantage of one class organization of the networks, which always lose important information hidden in other organizations of the network. In this paper, we propose a link predication framework which makes the best of the structure of networks in different level of organizations based on nonnegative matrix factorization, which is called NMF 3 here. We first map the observed network into another space by kernel functions, which could get the different order organizations. Then we combine the adjacency matrix of the network with one of other organizations, which makes us obtain the objective function of our framework for link predication based on the nonnegative matrix factorization. Third, we derive an iterative algorithm to optimize the objective function, which converges to a local optimum, and we propose a fast optimization strategy for large networks. Lastly, we test the proposed framework based on two kernel functions on a series of real world networks under different sizes of training set, and the experimental results show the feasibility, effectiveness, and competitiveness of the proposed framework.

  5. Path-Dependent Travel Time Prediction Variance and Covariance for a Global Tomographic P- and S-Velocity Model

    NASA Astrophysics Data System (ADS)

    Hipp, J. R.; Ballard, S.; Begnaud, M. L.; Encarnacao, A. V.; Young, C. J.; Phillips, W. S.

    2015-12-01

    Recently our combined SNL-LANL research team has succeeded in developing a global, seamless 3D tomographic P- and S-velocity model (SALSA3D) that provides superior first P and first S travel time predictions at both regional and teleseismic distances. However, given the variable data quality and uneven data sampling associated with this type of model, it is essential that there be a means to calculate high-quality estimates of the path-dependent variance and covariance associated with the predicted travel times of ray paths through the model. In this paper, we describe a methodology for accomplishing this by exploiting the full model covariance matrix and show examples of path-dependent travel time prediction uncertainty computed from our latest tomographic model. Typical global 3D SALSA3D models have on the order of 1/2 million nodes, so the challenge in calculating the covariance matrix is formidable: 0.9 TB storage for 1/2 of a symmetric matrix, necessitating an Out-Of-Core (OOC) blocked matrix solution technique. With our approach the tomography matrix (G which includes a prior model covariance constraint) is multiplied by its transpose (GTG) and written in a blocked sub-matrix fashion. We employ a distributed parallel solution paradigm that solves for (GTG)-1 by assigning blocks to individual processing nodes for matrix decomposition update and scaling operations. We first find the Cholesky decomposition of GTG which is subsequently inverted. Next, we employ OOC matrix multiplication methods to calculate the model covariance matrix from (GTG)-1 and an assumed data covariance matrix. Given the model covariance matrix, we solve for the travel-time covariance associated with arbitrary ray-paths by summing the model covariance along both ray paths. Setting the paths equal and taking the square root yields the travel prediction uncertainty for the single path.

  6. Inclusion-based effective medium models for the field-scale permeability of 3D fractured rock masses

    NASA Astrophysics Data System (ADS)

    Ebigbo, Anozie; Lang, Philipp S.; Paluszny, Adriana; Zimmerman, Robert W.

    2016-04-01

    Fractures that are more permeable than their host rock can act as preferential, or at least additional, pathways for fluid to flow through the rock. The additional transmissivity contributed by these fractures will be of great relevance in several areas of earth science and engineering, such as radioactive waste disposal in crystalline rock, exploitation of fractured hydrocarbon and geothermal reservoirs, or hydraulic fracturing. In describing or predicting flow through fractured rock, the effective permeability of the rock mass, comprising both the rock matrix and a network of fractures, is a crucial parameter, and will depend on several geometric properties of the fractures/networks, such as lateral extent, aperture, orientation, and fracture density. This study investigates the ability of classical inclusion-based effective medium models (following the work of Sævik et al., Transp. Porous Media, 2013) to predict this permeability. In these models, the fractures are represented as thin, spheroidal inclusions, the interiors of which are treated as porous media having a high (but finite) permeability. The predictions of various effective medium models, such as the symmetric and asymmetric self-consistent schemes, the differential scheme, and Maxwell's method, are tested against the results of explicit numerical simulations of mono- and polydisperse isotropic fracture networks embedded in a permeable rock matrix. Comparisons are also made with the Hashin-Shrikman bounds, Snow's model, and Mourzenko's heuristic model (Mourzenko et al., Phys. Rev. E, 2011). This problem is characterised mathematically by two small parameters, the aspect ratio of the spheroidal fractures, α, and the ratio between matrix and fracture permeability, κ. Two different regimes can be identified, corresponding to α/κ < 1 and α/κ > 1. The lower the value of α/κ, the more significant is flow through the matrix. Due to differing flow patterns, the dependence of effective permeability on fracture density differs in the two regimes. When α/κ > 1, a distinct percolation threshold is observed, whereas for α/κ < 1, the matrix is sufficiently transmissive that a percolation-like transition is not observed. The self-consistent effective medium methods show good accuracy for both mono- and polydisperse isotropic fracture networks. Mourzenko's equation is also found to be very accurate, particularly for monodisperse networks. Finally, it is shown that Snow's model essentially coincides with the Hashin-Shtrikman upper bound.

  7. Neuroprotective effects of collagen matrix in rats after traumatic brain injury.

    PubMed

    Shin, Samuel S; Grandhi, Ramesh; Henchir, Jeremy; Yan, Hong Q; Badylak, Stephen F; Dixon, C Edward

    2015-01-01

    In previous studies, collagen based matrices have been implanted into the site of lesion in different models of brain injury. We hypothesized that semisynthetic collagen matrix can have neuroprotective function in the setting of traumatic brain injury. Rats were subjected to sham injury or controlled cortical impact. They either received extracellular matrix graft (DuraGen) over the injury site or did not receive any graft and underwent beam balance/beam walking test at post injury days 1-5 and Morris water maze at post injury days 14-18. Animals were sacrificed at day 18 for tissue analysis. Collagen matrix implantation in injured rats did not affect motor function (beam balance test: p = 0.627, beam walking test: p = 0.921). However, injured group with collagen matrix had significantly better spatial memory acquisition (p < 0.05). There was a significant reduction in lesion volume, as well as neuronal loss in CA1 (p < 0.001) and CA3 (p < 0.05) regions of the hippocampus in injured group with collagen matrix (p < 0.05). Collagen matrix reduces contusional lesion volume, neuronal loss, and cognitive deficit after traumatic brain injury. Further studies are needed to demonstrate the mechanisms of neuroprotection by collagen matrix.

  8. Analytical development of disturbed matrix eigenvalue problem applied to mixed convection stability analysis in Darcy media

    NASA Astrophysics Data System (ADS)

    Hamed, Haikel Ben; Bennacer, Rachid

    2008-08-01

    This work consists in evaluating algebraically and numerically the influence of a disturbance on the spectral values of a diagonalizable matrix. Thus, two approaches will be possible; to use the theorem of disturbances of a matrix depending on a parameter, due to Lidskii and primarily based on the structure of Jordan of the no disturbed matrix. The second approach consists in factorizing the matrix system, and then carrying out a numerical calculation of the roots of the disturbances matrix characteristic polynomial. This problem can be a standard model in the equations of the continuous media mechanics. During this work, we chose to use the second approach and in order to illustrate the application, we choose the Rayleigh-Bénard problem in Darcy media, disturbed by a filtering through flow. The matrix form of the problem is calculated starting from a linear stability analysis by a finite elements method. We show that it is possible to break up the general phenomenon into other elementary ones described respectively by a disturbed matrix and a disturbance. A good agreement between the two methods was seen. To cite this article: H.B. Hamed, R. Bennacer, C. R. Mecanique 336 (2008).

  9. Analysis of the progressive failure of brittle matrix composites

    NASA Technical Reports Server (NTRS)

    Thomas, David J.

    1995-01-01

    This report investigates two of the most common modes of localized failures, namely, periodic fiber-bridged matrix cracks and transverse matrix cracks. A modification of Daniels' bundle theory is combined with Weibull's weakest link theory to model the statistical distribution of the periodic matrix cracking strength for an individual layer. Results of the model predictions are compared with experimental data from the open literature. Extensions to the model are made to account for possible imperfections within the layer (i.e., nonuniform fiber lengths, irregular crack spacing, and degraded in-situ fiber properties), and the results of these studies are presented. A generalized shear-lag analysis is derived which is capable of modeling the development of transverse matrix cracks in material systems having a general multilayer configuration and under states of full in-plane load. A method for computing the effective elastic properties for the damaged layer at the global level is detailed based upon the solution for the effects of the damage at the local level. This methodology is general in nature and is therefore also applicable to (0(sub m)/90(sub n))(sub s) systems. The characteristic stress-strain response for more general cases is shown to be qualitatively correct (experimental data is not available for a quantitative evaluation), and the damage evolution is recorded in terms of the matrix crack density as a function of the applied strain. Probabilistic effects are introduced to account for the statistical nature of the material strengths, thus allowing cumulative distribution curves for the probability of failure to be generated for each of the example laminates. Additionally, Oh and Finney's classic work on fracture location in brittle materials is extended and combined with the shear-lag analysis. The result is an analytical form for predicting the probability density function for the location of the next transverse crack occurrence within a crack bounded region. The results of this study verified qualitatively the validity of assuming a uniform crack spacing (as was done in the shear-lag model).

  10. Exact diagonalization library for quantum electron models

    NASA Astrophysics Data System (ADS)

    Iskakov, Sergei; Danilov, Michael

    2018-04-01

    We present an exact diagonalization C++ template library (EDLib) for solving quantum electron models, including the single-band finite Hubbard cluster and the multi-orbital impurity Anderson model. The observables that can be computed using EDLib are single particle Green's functions and spin-spin correlation functions. This code provides three different types of Hamiltonian matrix storage that can be chosen based on the model.

  11. Effects of sample size on estimates of population growth rates calculated with matrix models.

    PubMed

    Fiske, Ian J; Bruna, Emilio M; Bolker, Benjamin M

    2008-08-28

    Matrix models are widely used to study the dynamics and demography of populations. An important but overlooked issue is how the number of individuals sampled influences estimates of the population growth rate (lambda) calculated with matrix models. Even unbiased estimates of vital rates do not ensure unbiased estimates of lambda-Jensen's Inequality implies that even when the estimates of the vital rates are accurate, small sample sizes lead to biased estimates of lambda due to increased sampling variance. We investigated if sampling variability and the distribution of sampling effort among size classes lead to biases in estimates of lambda. Using data from a long-term field study of plant demography, we simulated the effects of sampling variance by drawing vital rates and calculating lambda for increasingly larger populations drawn from a total population of 3842 plants. We then compared these estimates of lambda with those based on the entire population and calculated the resulting bias. Finally, we conducted a review of the literature to determine the sample sizes typically used when parameterizing matrix models used to study plant demography. We found significant bias at small sample sizes when survival was low (survival = 0.5), and that sampling with a more-realistic inverse J-shaped population structure exacerbated this bias. However our simulations also demonstrate that these biases rapidly become negligible with increasing sample sizes or as survival increases. For many of the sample sizes used in demographic studies, matrix models are probably robust to the biases resulting from sampling variance of vital rates. However, this conclusion may depend on the structure of populations or the distribution of sampling effort in ways that are unexplored. We suggest more intensive sampling of populations when individual survival is low and greater sampling of stages with high elasticities.

  12. Model reduction of nonsquare linear MIMO systems using multipoint matrix continued-fraction expansions

    NASA Technical Reports Server (NTRS)

    Guo, Tong-Yi; Hwang, Chyi; Shieh, Leang-San

    1994-01-01

    This paper deals with the multipoint Cauer matrix continued-fraction expansion (MCFE) for model reduction of linear multi-input multi-output (MIMO) systems with various numbers of inputs and outputs. A salient feature of the proposed MCFE approach to model reduction of MIMO systems with square transfer matrices is its equivalence to the matrix Pade approximation approach. The Cauer second form of the ordinary MCFE for a square transfer function matrix is generalized in this paper to a multipoint and nonsquare-matrix version. An interesting connection of the multipoint Cauer MCFE method to the multipoint matrix Pade approximation method is established. Also, algorithms for obtaining the reduced-degree matrix-fraction descriptions and reduced-dimensional state-space models from a transfer function matrix via the multipoint Cauer MCFE algorithm are presented. Practical advantages of using the multipoint Cauer MCFE are discussed and a numerical example is provided to illustrate the algorithms.

  13. Assessment of the antireflection property of moth wings by three-dimensional transfer-matrix optical simulations

    NASA Astrophysics Data System (ADS)

    Deparis, Olivier; Khuzayim, Nadia; Parker, Andrew; Vigneron, Jean Pol

    2009-04-01

    The wings of the moth Cacostatia ossa (Ctenuchinae) are covered on both sides by non-close-packed nipple arrays which are known to act as broadband antireflection coatings. Experimental evaluation of the antireflection property of these biological structures is problematic because of the lack of a proper reference for reflectance measurements, i.e., a smooth surface made of the same material as the wing. Theoretical evaluation, on the other hand, is much more reliable provided that optical simulations are carried out on a realistic structural model of the wing. Based on detailed morphological characterizations, we established a three-dimensional (3D) model of the wing and used 3D transfer-matrix optical simulations in order to demonstrate the broadband antireflection property of the wings of Cacostatia ossa. Differences between hemispherical and specular reflectance spectra revealed that diffraction effects were not negligible for this structure although they did not jeopardize the antireflection efficiency. The influences of the backside corrugation and of the material’s absorption on the reflectance spectrum were also studied. In addition, simulations based on an effective-medium model of the wing were carried out using a multilayer thin-film code. In comparison with the latter simulations, the 3D transfer-matrix simulations were found to be more accurate for evaluating the antireflection property.

  14. Analysis and Characterization of Damage Utilizing an Orthotropic Generalized Composite Material Model Suitable for Use in Impact Problems

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Carney, Kelly S.; DuBois, Paul; Hoffarth, Canio; Rajan, Subramaniam; Blankenhorn, Gunther

    2016-01-01

    The need for accurate material models to simulate the deformation, damage and failure of polymer matrix composites under impact conditions is becoming critical as these materials are gaining increased usage in the aerospace and automotive communities. In order to address a series of issues identified by the aerospace community as being desirable to include in a next generation composite impact model, an orthotropic, macroscopic constitutive model incorporating both plasticity and damage suitable for implementation within the commercial LS-DYNA computer code is being developed. The plasticity model is based on extending the Tsai-Wu composite failure model into a strain hardening-based orthotropic plasticity model with a non-associative flow rule. The evolution of the yield surface is determined based on tabulated stress-strain curves in the various normal and shear directions and is tracked using the effective plastic strain. To compute the evolution of damage, a strain equivalent semi-coupled formulation is used in which a load in one direction results in a stiffness reduction in multiple material coordinate directions. A detailed analysis is carried out to ensure that the strain equivalence assumption is appropriate for the derived plasticity and damage formulations that are employed in the current model. Procedures to develop the appropriate input curves for the damage model are presented and the process required to develop an appropriate characterization test matrix is discussed

  15. Analysis and Characterization of Damage Utilizing an Orthotropic Generalized Composite Material Model Suitable for Use in Impact Problems

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Carney, Kelly S.; DuBois, Paul; Hoffarth, Canio; Rajan, Subramaniam; Blankenhorn, Gunther

    2016-01-01

    The need for accurate material models to simulate the deformation, damage and failure of polymer matrix composites under impact conditions is becoming critical as these materials are gaining increased usage in the aerospace and automotive communities. In order to address a series of issues identified by the aerospace community as being desirable to include in a next generation composite impact model, an orthotropic, macroscopic constitutive model incorporating both plasticity and damage suitable for implementation within the commercial LS-DYNA computer code is being developed. The plasticity model is based on extending the Tsai-Wu composite failure model into a strain hardening-based orthotropic plasticity model with a non-associative flow rule. The evolution of the yield surface is determined based on tabulated stress-strain curves in the various normal and shear directions and is tracked using the effective plastic strain. To compute the evolution of damage, a strain equivalent semi-coupled formulation is used in which a load in one direction results in a stiffness reduction in multiple material coordinate directions. A detailed analysis is carried out to ensure that the strain equivalence assumption is appropriate for the derived plasticity and damage formulations that are employed in the current model. Procedures to develop the appropriate input curves for the damage model are presented and the process required to develop an appropriate characterization test matrix is discussed.

  16. Modeling Passive Propagation of Malwares on the WWW

    NASA Astrophysics Data System (ADS)

    Chunbo, Liu; Chunfu, Jia

    Web-based malwares host in websites fixedly and download onto user's computers automatically while users browse. This passive propagation pattern is different from that of traditional viruses and worms. A propagation model based on reverse web graph is proposed. In this model, propagation of malwares is analyzed by means of random jump matrix which combines orderness and randomness of user browsing behaviors. Explanatory experiments, which has single or multiple propagation sources respectively, prove the validity of the model. Using this model, people can evaluate the hazardness of specified websites and take corresponding countermeasures.

  17. A stochastic Markov chain model to describe lung cancer growth and metastasis.

    PubMed

    Newton, Paul K; Mason, Jeremy; Bethel, Kelly; Bazhenova, Lyudmila A; Nieva, Jorge; Kuhn, Peter

    2012-01-01

    A stochastic Markov chain model for metastatic progression is developed for primary lung cancer based on a network construction of metastatic sites with dynamics modeled as an ensemble of random walkers on the network. We calculate a transition matrix, with entries (transition probabilities) interpreted as random variables, and use it to construct a circular bi-directional network of primary and metastatic locations based on postmortem tissue analysis of 3827 autopsies on untreated patients documenting all primary tumor locations and metastatic sites from this population. The resulting 50 potential metastatic sites are connected by directed edges with distributed weightings, where the site connections and weightings are obtained by calculating the entries of an ensemble of transition matrices so that the steady-state distribution obtained from the long-time limit of the Markov chain dynamical system corresponds to the ensemble metastatic distribution obtained from the autopsy data set. We condition our search for a transition matrix on an initial distribution of metastatic tumors obtained from the data set. Through an iterative numerical search procedure, we adjust the entries of a sequence of approximations until a transition matrix with the correct steady-state is found (up to a numerical threshold). Since this constrained linear optimization problem is underdetermined, we characterize the statistical variance of the ensemble of transition matrices calculated using the means and variances of their singular value distributions as a diagnostic tool. We interpret the ensemble averaged transition probabilities as (approximately) normally distributed random variables. The model allows us to simulate and quantify disease progression pathways and timescales of progression from the lung position to other sites and we highlight several key findings based on the model.

  18. A 3/D finite element approach for metal matrix composites based on micromechanical models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Svobodnik, A.J.; Boehm, H.J.; Rammerstorfer, F.G.

    Based on analytical considerations by Dvorak and Bahel-El-Din, a 3/D finite element material law has been developed for the elastic-plastic analysis of unidirectional fiber-reinforced metal matrix composites. The material law described in this paper has been implemented in the finite element code ABAQUS via the user subroutine UMAT. A constitutive law is described under the assumption that the fibers are linear-elastic and the matrix is of a von Mises-type with a Prager-Ziegler kinematic hardening rule. The uniaxial effective stress-strain relationship of the matrix in the plastic range is approximated by a Ramberg-Osgood law, a linear hardening rule or a nonhardeningmore » rule. Initial yield surface of the matrix material and for the fiber reinforced composite are compared to show the effect of reinforcement. Implementation of this material law in a finite element program is shown. Furthermore, the efficiency of substepping schemes and stress corrections for the numerical integration of the elastic-plastic stress-strain relations for anisotropic materials are investigated. The results of uniaxial monotonic tests of a boron/aluminum composite are compared to some finite element analyses based on micromechanical considerations. Furthermore a complete 3/D analysis of a tensile test specimen made of a silicon-carbide/aluminum MMC and the analysis of an MMC inlet inserted in a homogenous material are shown. 12 refs.« less

  19. Preparation and in vitro evaluation of guar gum based triple-layer matrix tablet of diclofenac sodium

    PubMed Central

    Chavda, H.V.; Patel, M.S.; Patel, C.N.

    2012-01-01

    The objective of the present study was to design an oral controlled drug delivery system for sparingly soluble diclofenac sodium (DCL) using guar gum as triple-layer matrix tablets. Matrix tablet granules containing 30% (D1), 40% (D2) or 50% (D3) of guar gum were prepared by the conventional wet granulation technique. Matrix tablets of diclofenac sodium were prepared by compressing three layers one by one. Centre layer of sandwich like structure was incorporated with matrix granules containing DCL which was covered on either side by guar gum granule layers containing either 70, 80 or 87% of guar gum as release retardant layers. The tablets were evaluated for hardness, thickness, drug content, and drug release studies. To ascertain the kinetics of drug release, the dissolution profiles were fitted to various mathematical models. The in vitro drug release from proposed system was best explained by the Hopfenberg model indicating that the release of drug from tablets displayed heterogeneous erosion. D3G3, containing 87% of guar gum in guar gum layers and 50% of guar gum in DCL matrix granule layer was found to provide the release rate for prolonged period of time. The results clearly indicate that guar gum could be a potential hydrophilic carrier in the development of oral controlled drug delivery systems. PMID:23181081

  20. Analytical Modeling of the High Strain Rate Deformation of Polymer Matrix Composites

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.; Roberts, Gary D.; Gilat, Amos

    2003-01-01

    The results presented here are part of an ongoing research program to develop strain rate dependent deformation and failure models for the analysis of polymer matrix composites subject to high strain rate impact loads. State variable constitutive equations originally developed for metals have been modified in order to model the nonlinear, strain rate dependent deformation of polymeric matrix materials. To account for the effects of hydrostatic stresses, which are significant in polymers, the classical 5 plasticity theory definitions of effective stress and effective plastic strain are modified by applying variations of the Drucker-Prager yield criterion. To verify the revised formulation, the shear and tensile deformation of a representative toughened epoxy is analyzed across a wide range of strain rates (from quasi-static to high strain rates) and the results are compared to experimentally obtained values. For the analyzed polymers, both the tensile and shear stress-strain curves computed using the analytical model correlate well with values obtained through experimental tests. The polymer constitutive equations are implemented within a strength of materials based micromechanics method to predict the nonlinear, strain rate dependent deformation of polymer matrix composites. In the micromechanics, the unit cell is divided up into a number of independently analyzed slices, and laminate theory is then applied to obtain the effective deformation of the unit cell. The composite mechanics are verified by analyzing the deformation of a representative polymer matrix composite (composed using the representative polymer analyzed for the correlation of the polymer constitutive equations) for several fiber orientation angles across a variety of strain rates. The computed values compare favorably to experimentally obtained results.

  1. A review on machine learning principles for multi-view biological data integration.

    PubMed

    Li, Yifeng; Wu, Fang-Xiang; Ngom, Alioune

    2018-03-01

    Driven by high-throughput sequencing techniques, modern genomic and clinical studies are in a strong need of integrative machine learning models for better use of vast volumes of heterogeneous information in the deep understanding of biological systems and the development of predictive models. How data from multiple sources (called multi-view data) are incorporated in a learning system is a key step for successful analysis. In this article, we provide a comprehensive review on omics and clinical data integration techniques, from a machine learning perspective, for various analyses such as prediction, clustering, dimension reduction and association. We shall show that Bayesian models are able to use prior information and model measurements with various distributions; tree-based methods can either build a tree with all features or collectively make a final decision based on trees learned from each view; kernel methods fuse the similarity matrices learned from individual views together for a final similarity matrix or learning model; network-based fusion methods are capable of inferring direct and indirect associations in a heterogeneous network; matrix factorization models have potential to learn interactions among features from different views; and a range of deep neural networks can be integrated in multi-modal learning for capturing the complex mechanism of biological systems.

  2. LES-based filter-matrix lattice Boltzmann model for simulating fully developed turbulent channel flow

    NASA Astrophysics Data System (ADS)

    Zhuo, Congshan; Zhong, Chengwen

    2016-11-01

    In this paper, a three-dimensional filter-matrix lattice Boltzmann (FMLB) model based on large eddy simulation (LES) was verified for simulating wall-bounded turbulent flows. The Vreman subgrid-scale model was employed in the present FMLB-LES framework, which had been proved to be capable of predicting turbulent near-wall region accurately. The fully developed turbulent channel flows were performed at a friction Reynolds number Reτ of 180. The turbulence statistics computed from the present FMLB-LES simulations, including mean stream velocity profile, Reynolds stress profile and root-mean-square velocity fluctuations greed well with the LES results of multiple-relaxation-time (MRT) LB model, and some discrepancies in comparison with those direct numerical simulation (DNS) data of Kim et al. was also observed due to the relatively low grid resolution. Moreover, to investigate the influence of grid resolution on the present LES simulation, a DNS simulation on a finer gird was also implemented by present FMLB-D3Q19 model. Comparisons of detailed computed various turbulence statistics with available benchmark data of DNS showed quite well agreement.

  3. The effect of interface properties on nickel base alloy composites

    NASA Technical Reports Server (NTRS)

    Groves, M.; Grossman, T.; Senemeier, M.; Wright, K.

    1995-01-01

    This program was performed to assess the extent to which mechanical behavior models can predict the properties of sapphire fiber/nickel aluminide matrix composites and help guide their development by defining improved combinations of matrix and interface coating. The program consisted of four tasks: 1) selection of the matrices and interface coating constituents using a modeling-based approach; 2) fabrication of the selected materials; 3) testing and evaluation of the materials; and 4) evaluation of the behavior models to develop recommendations. Ni-50Al and Ni-20AI-30Fe (a/o) matrices were selected which gave brittle and ductile behavior, respectively, and an interface coating of PVD YSZ was selected which provided strong bonding to the sapphire fiber. Significant fiber damage and strength loss was observed in the composites which made straightforward comparison of properties with models difficult. Nevertheless, the models selected generally provided property predictions which agreed well with results when fiber degradation was incorporated. The presence of a strong interface bond was felt to be detrimental in the NiAI MMC system where low toughness and low strength were observed.

  4. Difference-based ridge-type estimator of parameters in restricted partial linear model with correlated errors.

    PubMed

    Wu, Jibo

    2016-01-01

    In this article, a generalized difference-based ridge estimator is proposed for the vector parameter in a partial linear model when the errors are dependent. It is supposed that some additional linear constraints may hold to the whole parameter space. Its mean-squared error matrix is compared with the generalized restricted difference-based estimator. Finally, the performance of the new estimator is explained by a simulation study and a numerical example.

  5. 3D biomaterial matrix to support long term, full thickness, immuno-competent human skin equivalents with nervous system components.

    PubMed

    Vidal, Sarah E Lightfoot; Tamamoto, Kasey A; Nguyen, Hanh; Abbott, Rosalyn D; Cairns, Dana M; Kaplan, David L

    2018-04-24

    Current commercially available human skin equivalents (HSEs) are used for relatively short term studies (∼1 week) due in part to the time-dependent contraction of the collagen gel-based matrix and the limited cell types and skin tissue components utilized. In contrast, here we describe a new matrix consisting of a silk-collagen composite system that provides long term, stable cultivation with reduced contraction and degradation over time. This matrix supports full thickness skin equivalents which include nerves. The unique silk-collagen composite system preserves cell-binding domains of collagen while maintaining the stability and mechanics of the skin system for long-term culture with silk. The utility of this new composite protein-based biomaterial was demonstrated by bioengineering full thickness human skin systems using primary cells, including nerves and immune cells to establish an HSE with a neuro-immuno-cutaneous system. The HSEs with neurons and hypodermis, compared to in vitro skin-only HSEs controls, demonstrated higher secretion of pro-inflammatory cytokines. Proteomics analysis confirmed the presence of several proteins associated with inflammation across all sample groups, but HSEs with neurons had the highest amount of detected protein due to the complexity of the model. This improved, in vitro full thickness HSE model system utilizes cross-linked silk-collagen as the biomaterial and allows reduced reliance on animal models and provides a new in vitro tissue system for the assessment of chronic responses related to skin diseases and drug discovery. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. An analytical/numerical correlation study of the multiple concentric cylinder model for the thermoplastic response of metal matrix composites

    NASA Technical Reports Server (NTRS)

    Pindera, Marek-Jerzy; Salzar, Robert S.; Williams, Todd O.

    1993-01-01

    The utility of a recently developed analytical micromechanics model for the response of metal matrix composites under thermal loading is illustrated by comparison with the results generated using the finite-element approach. The model is based on the concentric cylinder assemblage consisting of an arbitrary number of elastic or elastoplastic sublayers with isotropic or orthotropic, temperature-dependent properties. The elastoplastic boundary-value problem of an arbitrarily layered concentric cylinder is solved using the local/global stiffness matrix formulation (originally developed for elastic layered media) and Mendelson's iterative technique of successive elastic solutions. These features of the model facilitate efficient investigation of the effects of various microstructural details, such as functionally graded architectures of interfacial layers, on the evolution of residual stresses during cool down. The available closed-form expressions for the field variables can readily be incorporated into an optimization algorithm in order to efficiently identify optimal configurations of graded interfaces for given applications. Comparison of residual stress distributions after cool down generated using finite-element analysis and the present micromechanics model for four composite systems with substantially different temperature-dependent elastic, plastic, and thermal properties illustrates the efficacy of the developed analytical scheme.

  7. An alternative derivation of the stationary distribution of the multivariate neutral Wright-Fisher model for low mutation rates with a view to mutation rate estimation from site frequency data.

    PubMed

    Schrempf, Dominik; Hobolth, Asger

    2017-04-01

    Recently, Burden and Tang (2016) provided an analytical expression for the stationary distribution of the multivariate neutral Wright-Fisher model with low mutation rates. In this paper we present a simple, alternative derivation that illustrates the approximation. Our proof is based on the discrete multivariate boundary mutation model which has three key ingredients. First, the decoupled Moran model is used to describe genetic drift. Second, low mutation rates are assumed by limiting mutations to monomorphic states. Third, the mutation rate matrix is separated into a time-reversible part and a flux part, as suggested by Burden and Tang (2016). An application of our result to data from several great apes reveals that the assumption of stationarity may be inadequate or that other evolutionary forces like selection or biased gene conversion are acting. Furthermore we find that the model with a reversible mutation rate matrix provides a reasonably good fit to the data compared to the one with a non-reversible mutation rate matrix. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Constant Switching Frequency DTC for Matrix Converter Fed Speed Sensorless Induction Motor Drive

    NASA Astrophysics Data System (ADS)

    Mir, Tabish Nazir; Singh, Bhim; Bhat, Abdul Hamid

    2018-05-01

    The paper presents a constant switching frequency scheme for speed sensorless Direct Torque Control (DTC) of Matrix Converter fed Induction Motor Drive. The use of matrix converter facilitates improved power quality on input as well as motor side, along with Input Power Factor control, besides eliminating the need for heavy passive elements. Moreover, DTC through Space Vector Modulation helps in achieving a fast control over the torque and flux of the motor, with added benefit of constant switching frequency. A constant switching frequency aids in maintaining desired power quality of AC mains current even at low motor speeds, and simplifies input filter design of the matrix converter, as compared to conventional hysteresis based DTC. Further, stator voltage estimation from sensed input voltage, and subsequent stator (and rotor) flux estimation is done. For speed sensorless operation, a Model Reference Adaptive System is used, which emulates the speed dependent rotor flux equations of the induction motor. The error between conventionally estimated rotor flux (reference model) and the rotor flux estimated through the adaptive observer is processed through PI controller to generate the rotor speed estimate.

  9. A study of the parallel algorithm for large-scale DC simulation of nonlinear systems

    NASA Astrophysics Data System (ADS)

    Cortés Udave, Diego Ernesto; Ogrodzki, Jan; Gutiérrez de Anda, Miguel Angel

    Newton-Raphson DC analysis of large-scale nonlinear circuits may be an extremely time consuming process even if sparse matrix techniques and bypassing of nonlinear models calculation are used. A slight decrease in the time required for this task may be enabled on multi-core, multithread computers if the calculation of the mathematical models for the nonlinear elements as well as the stamp management of the sparse matrix entries are managed through concurrent processes. This numerical complexity can be further reduced via the circuit decomposition and parallel solution of blocks taking as a departure point the BBD matrix structure. This block-parallel approach may give a considerable profit though it is strongly dependent on the system topology and, of course, on the processor type. This contribution presents the easy-parallelizable decomposition-based algorithm for DC simulation and provides a detailed study of its effectiveness.

  10. Creep of Refractory Fibers and Modeling of Metal and Ceramic Matrix Composite Creep Behavior

    NASA Technical Reports Server (NTRS)

    Tewari, S.N.

    1995-01-01

    Our concentration during this research was on the following subprograms. (1) Ultra high vacuum creep tests on 218, ST300 and WHfC tungsten and MoHfC molybdenum alloy wires, temperature range from 1100 K to 1500 K, creep time of 1 to 500 hours. (2) High temperature vacuum tensile tests on 218, ST300 and WHfC tungsten and MoHfC molybdenum alloy wires. (3) Air and vacuum tensile creep tests on polycrystalline and single crystal alumina fibers, such as alumina-mullite Nextel fiber, yttrium aluminum ganet (YAG) and Saphikon, temperature range from 1150 K to 1470 K, creep time of 2 to 200 hours. (4) Microstructural evaluation of crept fibers, TEM study on the crept metal wires, SEM study on the fracture surface of ceramic fibers. (5) Metal Matrix Composite creep models, based on the fiber creep properties and fiber-matrix interface zone formation.

  11. A revised version of the transfer matrix method to analyze one-dimensional structures

    NASA Technical Reports Server (NTRS)

    Nitzsche, F.

    1983-01-01

    A new and general method to analyze both free and forced vibration characteristics of one-dimensional structures is discussed in this paper. This scheme links for the first time the classical transfer matrix method with the recently developed integrating matrix technique to integrate systems of differential equations. Two alternative approaches to the problem are presented. The first is based upon the lumped parameter model to account for the inertia properties of the structure. The second releases that constraint allowing a more precise description of the physical system. The free vibration of a straight uniform beam under different support conditions is analyzed to test the accuracy of the two models. Finally some results for the free vibration of a 12th order system representing a curved, rotating beam prove that the present method is conveniently extended to more complicated structural dynamics problems.

  12. Moment inference from tomograms

    USGS Publications Warehouse

    Day-Lewis, F. D.; Chen, Y.; Singha, K.

    2007-01-01

    Time-lapse geophysical tomography can provide valuable qualitative insights into hydrologic transport phenomena associated with aquifer dynamics, tracer experiments, and engineered remediation. Increasingly, tomograms are used to infer the spatial and/or temporal moments of solute plumes; these moments provide quantitative information about transport processes (e.g., advection, dispersion, and rate-limited mass transfer) and controlling parameters (e.g., permeability, dispersivity, and rate coefficients). The reliability of moments calculated from tomograms is, however, poorly understood because classic approaches to image appraisal (e.g., the model resolution matrix) are not directly applicable to moment inference. Here, we present a semi-analytical approach to construct a moment resolution matrix based on (1) the classic model resolution matrix and (2) image reconstruction from orthogonal moments. Numerical results for radar and electrical-resistivity imaging of solute plumes demonstrate that moment values calculated from tomograms depend strongly on plume location within the tomogram, survey geometry, regularization criteria, and measurement error. Copyright 2007 by the American Geophysical Union.

  13. Moment inference from tomograms

    USGS Publications Warehouse

    Day-Lewis, Frederick D.; Chen, Yongping; Singha, Kamini

    2007-01-01

    Time-lapse geophysical tomography can provide valuable qualitative insights into hydrologic transport phenomena associated with aquifer dynamics, tracer experiments, and engineered remediation. Increasingly, tomograms are used to infer the spatial and/or temporal moments of solute plumes; these moments provide quantitative information about transport processes (e.g., advection, dispersion, and rate-limited mass transfer) and controlling parameters (e.g., permeability, dispersivity, and rate coefficients). The reliability of moments calculated from tomograms is, however, poorly understood because classic approaches to image appraisal (e.g., the model resolution matrix) are not directly applicable to moment inference. Here, we present a semi-analytical approach to construct a moment resolution matrix based on (1) the classic model resolution matrix and (2) image reconstruction from orthogonal moments. Numerical results for radar and electrical-resistivity imaging of solute plumes demonstrate that moment values calculated from tomograms depend strongly on plume location within the tomogram, survey geometry, regularization criteria, and measurement error.

  14. Signal Recovery and System Calibration from Multiple Compressive Poisson Measurements

    DOE PAGES

    Wang, Liming; Huang, Jiaji; Yuan, Xin; ...

    2015-09-17

    The measurement matrix employed in compressive sensing typically cannot be known precisely a priori and must be estimated via calibration. One may take multiple compressive measurements, from which the measurement matrix and underlying signals may be estimated jointly. This is of interest as well when the measurement matrix may change as a function of the details of what is measured. This problem has been considered recently for Gaussian measurement noise, and here we develop this idea with application to Poisson systems. A collaborative maximum likelihood algorithm and alternating proximal gradient algorithm are proposed, and associated theoretical performance guarantees are establishedmore » based on newly derived concentration-of-measure results. A Bayesian model is then introduced, to improve flexibility and generality. Connections between the maximum likelihood methods and the Bayesian model are developed, and example results are presented for a real compressive X-ray imaging system.« less

  15. Modeling the role of quorum sensing in interspecies competition in biofilms

    NASA Astrophysics Data System (ADS)

    Narla, Avaneesh V.; Wingreen, Ned S.; Borenstein, David B.

    Bacteria grow on surfaces in complex immobile communities known as biofilms, composed of cells embedded in an extracellular matrix. Within biofilms, bacteria often communicate, cooperate, and compete within their own species and with other species using Quorum Sensing (QS). QS refers to the process by which bacteria produce, secrete, and subsequently detect small molecules called autoinducers as a way to assess the local population density of their species, or of other species. QS is known to regulate the production of extracellular matrix. We investigated the possible benefit of QS in regulating matrix production to best gain access to a nutrient that diffuses from a source positioned away from the surface on which the biofilm grows. We employed Agent-Based Modeling (ABM), a form of simulation that allows cells to modify their behavior based on local inputs, e.g. nutrient and QS concentrations. We first determined the optimal fixed strategies (that do not use QS) for pairwise competitions, and then demonstrated that simple QS-based strategies can be superior to any fixed strategy. In nature, species can compete by sensing and/or interfering with each other's QS signals, and we explore approaches for targeting specific species via QS-interference. A.V.N. and N.S.W. contributed equally to this project.

  16. Triple collocation-based estimation of spatially correlated observation error covariance in remote sensing soil moisture data assimilation

    NASA Astrophysics Data System (ADS)

    Wu, Kai; Shu, Hong; Nie, Lei; Jiao, Zhenhang

    2018-01-01

    Spatially correlated errors are typically ignored in data assimilation, thus degenerating the observation error covariance R to a diagonal matrix. We argue that a nondiagonal R carries more observation information making assimilation results more accurate. A method, denoted TC_Cov, was proposed for soil moisture data assimilation to estimate spatially correlated observation error covariance based on triple collocation (TC). Assimilation experiments were carried out to test the performance of TC_Cov. AMSR-E soil moisture was assimilated with a diagonal R matrix computed using the TC and assimilated using a nondiagonal R matrix, as estimated by proposed TC_Cov. The ensemble Kalman filter was considered as the assimilation method. Our assimilation results were validated against climate change initiative data and ground-based soil moisture measurements using the Pearson correlation coefficient and unbiased root mean square difference metrics. These experiments confirmed that deterioration of diagonal R assimilation results occurred when model simulation is more accurate than observation data. Furthermore, nondiagonal R achieved higher correlation coefficient and lower ubRMSD values over diagonal R in experiments and demonstrated the effectiveness of TC_Cov to estimate richly structuralized R in data assimilation. In sum, compared with diagonal R, nondiagonal R may relieve the detrimental effects of assimilation when simulated model results outperform observation data.

  17. Mass balance modelling of contaminants in river basins: a flexible matrix approach.

    PubMed

    Warren, Christopher; Mackay, Don; Whelan, Mick; Fox, Kay

    2005-12-01

    A novel and flexible approach is described for simulating the behaviour of chemicals in river basins. A number (n) of river reaches are defined and their connectivity is described by entries in an n x n matrix. Changes in segmentation can be readily accommodated by altering the matrix entries, without the need for model revision. Two models are described. The simpler QMX-R model only considers advection and an overall loss due to the combined processes of volatilization, net transfer to sediment and degradation. The rate constant for the overall loss is derived from fugacity calculations for a single segment system. The more rigorous QMX-F model performs fugacity calculations for each segment and explicitly includes the processes of advection, evaporation, water-sediment exchange and degradation in both water and sediment. In this way chemical exposure in all compartments (including equilibrium concentrations in biota) can be estimated. Both models are designed to serve as intermediate-complexity exposure assessment tools for river basins with relatively low data requirements. By considering the spatially explicit nature of emission sources and the changes in concentration which occur with transport in the channel system, the approach offers significant advantages over simple one-segment simulations while being more readily applicable than more sophisticated, highly segmented, GIS-based models.

  18. Accurate quantification of PGE2 in the polyposis in rat colon (Pirc) model by surrogate analyte-based UPLC-MS/MS.

    PubMed

    Yun, Changhong; Dashwood, Wan-Mohaiza; Kwong, Lawrence N; Gao, Song; Yin, Taijun; Ling, Qinglan; Singh, Rashim; Dashwood, Roderick H; Hu, Ming

    2018-01-30

    An accurate and reliable UPLC-MS/MS method is reported for the quantification of endogenous Prostaglandin E2 (PGE 2 ) in rat colonic mucosa and polyps. This method adopted the "surrogate analyte plus authentic bio-matrix" approach, using two different stable isotopic labeled analogs - PGE 2 -d9 as the surrogate analyte and PGE 2 -d4 as the internal standard. A quantitative standard curve was constructed with the surrogate analyte in colonic mucosa homogenate, and the method was successfully validated with the authentic bio-matrix. Concentrations of endogenous PGE 2 in both normal and inflammatory tissue homogenates were back-calculated based on the regression equation. Because of no endogenous interference on the surrogate analyte determination, the specificity was particularly good. By using authentic bio-matrix for validation, the matrix effect and exaction recovery are identically same for the quantitative standard curve and actual samples - this notably increased the assay accuracy. The method is easy, fast, robust and reliable for colon PGE 2 determination. This "surrogate analyte" approach was applied to measure the Pirc (an Apc-mutant rat kindred that models human FAP) mucosa and polyps PGE 2 , one of the strong biomarkers of colorectal cancer. A similar concept could be applied to endogenous biomarkers in other tissues. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. An isometric muscle force estimation framework based on a high-density surface EMG array and an NMF algorithm

    NASA Astrophysics Data System (ADS)

    Huang, Chengjun; Chen, Xiang; Cao, Shuai; Qiu, Bensheng; Zhang, Xu

    2017-08-01

    Objective. To realize accurate muscle force estimation, a novel framework is proposed in this paper which can extract the input of the prediction model from the appropriate activation area of the skeletal muscle. Approach. Surface electromyographic (sEMG) signals from the biceps brachii muscle during isometric elbow flexion were collected with a high-density (HD) electrode grid (128 channels) and the external force at three contraction levels was measured at the wrist synchronously. The sEMG envelope matrix was factorized into a matrix of basis vectors with each column representing an activation pattern and a matrix of time-varying coefficients by a nonnegative matrix factorization (NMF) algorithm. The activation pattern with the highest activation intensity, which was defined as the sum of the absolute values of the time-varying coefficient curve, was considered as the major activation pattern, and its channels with high weighting factors were selected to extract the input activation signal of a force estimation model based on the polynomial fitting technique. Main results. Compared with conventional methods using the whole channels of the grid, the proposed method could significantly improve the quality of force estimation and reduce the electrode number. Significance. The proposed method provides a way to find proper electrode placement for force estimation, which can be further employed in muscle heterogeneity analysis, myoelectric prostheses and the control of exoskeleton devices.

  20. Processing of Antenna-Array Signals on the Basis of the Interference Model Including a Rank-Deficient Correlation Matrix

    NASA Astrophysics Data System (ADS)

    Rodionov, A. A.; Turchin, V. I.

    2017-06-01

    We propose a new method of signal processing in antenna arrays, which is called the Maximum-Likelihood Signal Classification. The proposed method is based on the model in which interference includes a component with a rank-deficient correlation matrix. Using numerical simulation, we show that the proposed method allows one to ensure variance of the estimated arrival angle of the plane wave, which is close to the Cramer-Rao lower boundary and more efficient than the best-known MUSIC method. It is also shown that the proposed technique can be efficiently used for estimating the time dependence of the useful signal.

  1. Waveform Based Acoustic Emission Detection and Location of Matrix Cracking in Composites

    NASA Technical Reports Server (NTRS)

    Prosser, W. H.

    1995-01-01

    The operation of damage mechanisms in a material or structure under load produces transient acoustic waves. These acoustic waves are known as acoustic emission (AE). In composites they can be caused by a variety of sources including matrix cracking, fiber breakage, and delamination. AE signals can be detected and analyzed to determine the location of the acoustic source by triangulation. Attempts are also made to analyze the signals to determine the type and severity of the damage mechanism. AE monitoring has been widely used for both laboratory studies of materials, and for testing the integrity of structures in the field. In this work, an advanced, waveform based AE system was used in a study of transverse matrix cracking in cross-ply graphite/epoxy laminates. This AE system featured broad band, high fidelity sensors, and high capture rate digital acquisition and storage of acoustic signals. In addition, analysis techniques based on plate wave propagation models were employed. These features provided superior source location and noise rejection capabilities.

  2. An empirical model for polarized and cross-polarized scattering from a vegetation layer

    NASA Technical Reports Server (NTRS)

    Liu, H. L.; Fung, A. K.

    1988-01-01

    An empirical model for scattering from a vegetation layer above an irregular ground surface is developed in terms of the first-order solution for like-polarized scattering and the second-order solution for cross-polarized scattering. The effects of multiple scattering within the layer and at the surface-volume boundary are compensated by using a correction factor based on the matrix doubling method. The major feature of this model is that all parameters in the model are physical parameters of the vegetation medium. There are no regression parameters. Comparisons of this empirical model with theoretical matrix-doubling method and radar measurements indicate good agreements in polarization, angular trends, and k sub a up to 4, where k is the wave number and a is the disk radius. The computational time is shortened by a factor of 8, relative to the theoretical model calculation.

  3. Preparation of a Three-Dimensional Full Thickness Skin Equivalent.

    PubMed

    Reuter, Christian; Walles, Heike; Groeber, Florian

    2017-01-01

    In vitro test systems are a promising alternative to animal models. Due to the use of human cells in a three-dimensional arrangement that allows cell-cell or cell-matrix interactions these models may be more predictive for the human situation compared to animal models or two-dimensional cell culture systems. Especially for dermatological research, skin models such as epidermal or full-thickness skin equivalents (FTSE) are used for different applications. Although epidermal models provide highly standardized conditions for risk assessment, FTSE facilitate a cellular crosstalk between the dermal and epidermal layer and thus can be used as more complex models for the investigation of processes such as wound healing, skin development, or infectious diseases. In this chapter, we describe the generation and culture of an FTSE, based on a collagen type I matrix and provide troubleshooting tips for commonly encountered technical problems.

  4. Elastic K-means using posterior probability

    PubMed Central

    Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

    2017-01-01

    The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model. PMID:29240756

  5. Predictive modelling of the dielectric response of plasmonic substrates: application to the interpretation of ellipsometric spectra

    NASA Astrophysics Data System (ADS)

    Pugliara, A.; Bayle, M.; Bonafos, C.; Carles, R.; Respaud, M.; Makasheva, K.

    2018-03-01

    A predictive modelling of plasmonic substrates appropriate to read ellipsometric spectra is presented in this work. We focus on plasmonic substrates containing a single layer of silver nanoparticles (AgNPs) embedded in silica matrices. The model uses the Abeles matrix formalism and is based on the quasistatic approximation of the classical Maxwell-Garnett mixing rule, however accounting for the electronic confinement effect through the damping parameter. It is applied on samples elaborated by: (i) RF-diode sputtering followed by Plasma Enhanced Chemical Vapor Deposition (PECVD) and (ii) Low Energy Ion Beam Synthesis (LE-IBS), and represents situations with increasing degree of complexity that can be accounted for by the model. It allows extraction of the main characteristics of the AgNPs population: average size, volume fraction and distance of the AgNPs layer from the matrix free surface. Model validation is achieved through comparison with results obtained from transmission electron microscopy approving for its applicability. The advantages and limitations of the proposed model are discussed after eccentricity-based statistical analysis along with further developments related to the quality of comparison between the model-generated spectra and the experimentally-recorded ellipsometric spectra.

  6. 3-D Magnetotelluric Forward Modeling And Inversion Incorporating Topography By Using Vector Finite-Element Method Combined With Divergence Corrections Based On The Magnetic Field (VFEH++)

    NASA Astrophysics Data System (ADS)

    Shi, X.; Utada, H.; Jiaying, W.

    2009-12-01

    The vector finite-element method combined with divergence corrections based on the magnetic field H, referred to as VFEH++ method, is developed to simulate the magnetotelluric (MT) responses of 3-D conductivity models. The advantages of the new VFEH++ method are the use of edge-elements to eliminate the vector parasites and the divergence corrections to explicitly guarantee the divergence-free conditions in the whole modeling domain. 3-D MT topographic responses are modeling using the new VFEH++ method, and are compared with those calculated by other numerical methods. The results show that MT responses can be modeled highly accurate using the VFEH+ +method. The VFEH++ algorithm is also employed for the 3-D MT data inversion incorporating topography. The 3-D MT inverse problem is formulated as a minimization problem of the regularized misfit function. In order to avoid the huge memory requirement and very long time for computing the Jacobian sensitivity matrix for Gauss-Newton method, we employ the conjugate gradient (CG) approach to solve the inversion equation. In each iteration of CG algorithm, the cost computation is the product of the Jacobian sensitivity matrix with a model vector x or its transpose with a data vector y, which can be transformed into two pseudo-forwarding modeling. This avoids the full explicitly Jacobian matrix calculation and storage which leads to considerable savings in the memory required by the inversion program in PC computer. The performance of CG algorithm will be illustrated by several typical 3-D models with horizontal earth surface and topographic surfaces. The results show that the VFEH++ and CG algorithms can be effectively employed to 3-D MT field data inversion.

  7. Error Modeling and Experimental Study of a Flexible Joint 6-UPUR Parallel Six-Axis Force Sensor.

    PubMed

    Zhao, Yanzhi; Cao, Yachao; Zhang, Caifeng; Zhang, Dan; Zhang, Jie

    2017-09-29

    By combining a parallel mechanism with integrated flexible joints, a large measurement range and high accuracy sensor is realized. However, the main errors of the sensor involve not only assembly errors, but also deformation errors of its flexible leg. Based on a flexible joint 6-UPUR (a kind of mechanism configuration where U-universal joint, P-prismatic joint, R-revolute joint) parallel six-axis force sensor developed during the prephase, assembly and deformation error modeling and analysis of the resulting sensors with a large measurement range and high accuracy are made in this paper. First, an assembly error model is established based on the imaginary kinematic joint method and the Denavit-Hartenberg (D-H) method. Next, a stiffness model is built to solve the stiffness matrix. The deformation error model of the sensor is obtained. Then, the first order kinematic influence coefficient matrix when the synthetic error is taken into account is solved. Finally, measurement and calibration experiments of the sensor composed of the hardware and software system are performed. Forced deformation of the force-measuring platform is detected by using laser interferometry and analyzed to verify the correctness of the synthetic error model. In addition, the first order kinematic influence coefficient matrix in actual circumstances is calculated. By comparing the condition numbers and square norms of the coefficient matrices, the conclusion is drawn theoretically that it is very important to take into account the synthetic error for design stage of the sensor and helpful to improve performance of the sensor in order to meet needs of actual working environments.

  8. Error Modeling and Experimental Study of a Flexible Joint 6-UPUR Parallel Six-Axis Force Sensor

    PubMed Central

    Zhao, Yanzhi; Cao, Yachao; Zhang, Caifeng; Zhang, Dan; Zhang, Jie

    2017-01-01

    By combining a parallel mechanism with integrated flexible joints, a large measurement range and high accuracy sensor is realized. However, the main errors of the sensor involve not only assembly errors, but also deformation errors of its flexible leg. Based on a flexible joint 6-UPUR (a kind of mechanism configuration where U-universal joint, P-prismatic joint, R-revolute joint) parallel six-axis force sensor developed during the prephase, assembly and deformation error modeling and analysis of the resulting sensors with a large measurement range and high accuracy are made in this paper. First, an assembly error model is established based on the imaginary kinematic joint method and the Denavit-Hartenberg (D-H) method. Next, a stiffness model is built to solve the stiffness matrix. The deformation error model of the sensor is obtained. Then, the first order kinematic influence coefficient matrix when the synthetic error is taken into account is solved. Finally, measurement and calibration experiments of the sensor composed of the hardware and software system are performed. Forced deformation of the force-measuring platform is detected by using laser interferometry and analyzed to verify the correctness of the synthetic error model. In addition, the first order kinematic influence coefficient matrix in actual circumstances is calculated. By comparing the condition numbers and square norms of the coefficient matrices, the conclusion is drawn theoretically that it is very important to take into account the synthetic error for design stage of the sensor and helpful to improve performance of the sensor in order to meet needs of actual working environments. PMID:28961209

  9. Strain Rate Dependent Deformation and Strength Modeling of a Polymer Matrix Composite Utilizing a Micromechanics Approach. Degree awarded by Cincinnati Univ.

    NASA Technical Reports Server (NTRS)

    Goldberg, Robert K.

    1999-01-01

    Potential gas turbine applications will expose polymer matrix composites to very high strain rate loading conditions, requiring an ability to understand and predict the material behavior under extreme conditions. Specifically, analytical methods designed for these applications must have the capability of properly capturing the strain rate sensitivities and nonlinearities that are present in the material response. The Ramaswamy-Stouffer constitutive equations, originally developed to analyze the viscoplastic deformation of metals, have been modified to simulate the nonlinear deformation response of ductile, crystalline polymers. The constitutive model is characterized and correlated for two representative ductile polymers. Fiberite 977-2 and PEEK, and the computed results correlate well with experimental values. The polymer constitutive equations are implemented in a mechanics of materials based composite micromechanics model to predict the nonlinear, rate dependent deformation response of a composite ply. Uniform stress and uniform strain assumptions are applied to compute the effective stresses of a composite unit cell from the applied strains. The micromechanics equations are successfully verified for two polymer matrix composites. IM7/977-2 and AS4/PEEK. The ultimate strength of a composite ply is predicted with the Hashin failure criteria that were implemented in the composite micromechanics model. The failure stresses of the two composite material systems are accurately predicted for a variety of fiber orientations and strain rates. The composite deformation model is implemented in LS-DYNA, a commercially available transient dynamic explicit finite element code. The matrix constitutive equations are converted into an incremental form, and the model is implemented into LS-DYNA through the use of a user defined material subroutine. The deformation response of a bulk polymer and a polymer matrix composite are predicted by finite element analyses. The results compare reasonably well to experimental values, with some discrepancies. The discrepancies are at least partially caused by the method used to integrate the rate equations in the polymer constitutive model.

  10. A Measurement and Simulation Based Methodology for Cache Performance Modeling and Tuning

    NASA Technical Reports Server (NTRS)

    Waheed, Abdul; Yan, Jerry; Saini, Subhash (Technical Monitor)

    1998-01-01

    We present a cache performance modeling methodology that facilitates the tuning of uniprocessor cache performance for applications executing on shared memory multiprocessors by accurately predicting the effects of source code level modifications. Measurements on a single processor are initially used for identifying parts of code where cache utilization improvements may significantly impact the overall performance. Cache simulation based on trace-driven techniques can be carried out without gathering detailed address traces. Minimal runtime information for modeling cache performance of a selected code block includes: base virtual addresses of arrays, virtual addresses of variables, and loop bounds for that code block. Rest of the information is obtained from the source code. We show that the cache performance predictions are as reliable as those obtained through trace-driven simulations. This technique is particularly helpful to the exploration of various "what-if' scenarios regarding the cache performance impact for alternative code structures. We explain and validate this methodology using a simple matrix-matrix multiplication program. We then apply this methodology to predict and tune the cache performance of two realistic scientific applications taken from the Computational Fluid Dynamics (CFD) domain.

  11. Simultaneous pre-concentration and separation on simple paper-based analytical device for protein analysis.

    PubMed

    Niu, Ji-Cheng; Zhou, Ting; Niu, Li-Li; Xie, Zhen-Sheng; Fang, Fang; Yang, Fu-Quan; Wu, Zhi-Yong

    2018-02-01

    In this work, fast isoelectric focusing (IEF) was successfully implemented on an open paper fluidic channel for simultaneous concentration and separation of proteins from complex matrix. With this simple device, IEF can be finished in 10 min with a resolution of 0.03 pH units and concentration factor of 10, as estimated by color model proteins by smartphone-based colorimetric detection. Fast detection of albumin from human serum and glycated hemoglobin (HBA1c) from blood cell was demonstrated. In addition, off-line identification of the model proteins from the IEF fractions with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) was also shown. This PAD IEF is potentially useful either for point of care test (POCT) or biomarker analysis as a cost-effective sample pretreatment method.

  12. Reduction of interferences in graphite furnace atomic absorption spectrometry by multiple linear regression modelling

    NASA Astrophysics Data System (ADS)

    Grotti, Marco; Abelmoschi, Maria Luisa; Soggia, Francesco; Tiberiade, Christian; Frache, Roberto

    2000-12-01

    The multivariate effects of Na, K, Mg and Ca as nitrates on the electrothermal atomisation of manganese, cadmium and iron were studied by multiple linear regression modelling. Since the models proved to efficiently predict the effects of the considered matrix elements in a wide range of concentrations, they were applied to correct the interferences occurring in the determination of trace elements in seawater after pre-concentration of the analytes. In order to obtain a statistically significant number of samples, a large volume of the certified seawater reference materials CASS-3 and NASS-3 was treated with Chelex-100 resin; then, the chelating resin was separated from the solution, divided into several sub-samples, each of them was eluted with nitric acid and analysed by electrothermal atomic absorption spectrometry (for trace element determinations) and inductively coupled plasma optical emission spectrometry (for matrix element determinations). To minimise any other systematic error besides that due to matrix effects, accuracy of the pre-concentration step and contamination levels of the procedure were checked by inductively coupled plasma mass spectrometric measurements. Analytical results obtained by applying the multiple linear regression models were compared with those obtained with other calibration methods, such as external calibration using acid-based standards, external calibration using matrix-matched standards and the analyte addition technique. Empirical models proved to efficiently reduce interferences occurring in the analysis of real samples, allowing an improvement of accuracy better than for other calibration methods.

  13. A micromechanical model to explain the mechanical properties of bovine cortical bone in tension: In vitro fluoride ion effects

    NASA Astrophysics Data System (ADS)

    Kotha, Shiva Prasad

    Bone mineral and bone organic are assumed to be a linearly elastic, brittle material. A simple micromechanical model based on the shear lag theory is developed to model the stress transfer between the mineral platelets of bone. The bone mineral platelets carry most of the applied load while the organic primarily serves to transfer load between the overlapped mineral platelets by shear. Experiments were done to elucidate the mechanism of failure in bovine cortical bone and to decrease the mineral content of control bone with in-vitro fluoride ion treatments. It was suggested that the failure at the ultrastructural level is due to the transverse failure of bonds between the collagen microfibrils in the organic matrix. However, the shear stress transfer and the axial load bearing capacity of the organic is not impaired. Hence, it is assumed that the shear strain in the matrix increases while the shear stress remains constant at the shear yield stress once the matrix starts yielding at the ends of the bone mineral. When the shear stress over the length of the mineral platelet reaches the shear yield stress, no more applied stress is carried by the bone mineral platelets while the organic matrix carries the increased axial load. The bone fails when the axial stress in the organic reaches its ultimate stress. The bone mineral is assumed to dissolve due to in-vitro fluoride ion treatments and precipitate calcium fluoride or fluoroapatite like material. The amount of dissolution is estimated based on 19F Nuclear Magnetic Resonance or a decrease in the carbonate content of bone. The dissolution of bone mineral is assumed to increase the porosity in the organic. We assume that the elastic modulus and the ultimate strength of the organic decrease due to the increased porosity. A simple empirical model is used to model the decrease in the elastic modulus. The strength is modeled to decrease based on an increase in the cross-sectional area occupied by the porosity. The precipitate is assumed to contribute to the mechanical properties of bone due to friction generated by the poisson's contraction of the organic as it carries axial loads. The resulting stress-strain curve predicted by the model resembles the stress-strain curves obtained in the experiments.

  14. Effects of damage and thermal residual stresses on the overall elastoplastic behavior of particle-reinforced metal matrix composites

    NASA Astrophysics Data System (ADS)

    Liu, Haitao

    The objective of the present study is to investigate damage mechanisms and thermal residual stresses of composites, and to establish the frameworks to model the particle-reinforced metal matrix composites with particle-matrix interfacial debonding, particle cracking or thermal residual stresses. An evolutionary interfacial debonding model is proposed for the composites with spheroidal particles. The construction of the equivalent stiffness is based on the fact that when debonding occurs in a certain direction, the load-transfer ability will lose in that direction. By using this equivalent method, the interfacial debonding problem can be converted into a composite problem with perfectly bonded inclusions. Considering the interfacial debonding is a progressive process in which the debonding area increases in proportion to external loading, a progressive interfacial debonding model is proposed. In this model, the relation between external loading and the debonding area is established using a normal stress controlled debonding criterion. Furthermore, an equivalent orthotropic stiffness tensor is constructed based on the debonding areas. This model is able to study the composites with randomly distributed spherical particles. The double-inclusion theory is recalled to model the particle cracking problems. Cracks inside particles are treated as penny-shape particles with zero stiffness. The disturbed stress field due to the existence of a double-inclusion is expressed explicitly. Finally, a thermal mismatch eigenstrain is introduced to simulate the inconsistent expansions of the matrix and the particles due to the difference of the coefficients of thermal expansion. Micromechanical stress and strain fields are calculated due to the combination of applied external loads and the prescribed thermal mismatch eigenstrains. For all of the above models, ensemble-volume averaging procedures are employed to derive the effective yield function of the composites. Numerical simulations are performed to analyze the effects of various parameters and several good agreements between our model's predictions and experimental results are obtained. It should be mentioned that all of expressions in the frameworks are explicitly derived and these analytical results are easy to be adopted in other related investigations.

  15. Data-Driven Learning of Q-Matrix

    PubMed Central

    Liu, Jingchen; Xu, Gongjun; Ying, Zhiliang

    2013-01-01

    The recent surge of interests in cognitive assessment has led to developments of novel statistical models for diagnostic classification. Central to many such models is the well-known Q-matrix, which specifies the item–attribute relationships. This article proposes a data-driven approach to identification of the Q-matrix and estimation of related model parameters. A key ingredient is a flexible T-matrix that relates the Q-matrix to response patterns. The flexibility of the T-matrix allows the construction of a natural criterion function as well as a computationally amenable algorithm. Simulations results are presented to demonstrate usefulness and applicability of the proposed method. Extension to handling of the Q-matrix with partial information is presented. The proposed method also provides a platform on which important statistical issues, such as hypothesis testing and model selection, may be formally addressed. PMID:23926363

  16. Predicting Stress vs. Strain Behaviors of Thin-Walled High Pressure Die Cast Magnesium Alloy with Actual Pore Distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Kyoo Sil; Barker, Erin; Cheng, Guang

    2016-01-06

    In this paper, a three-dimensional (3D) microstructure-based finite element modeling method (i.e., extrinsic modeling method) is developed, which can be used in examining the effects of porosity on the ductility/fracture of Mg castings. For this purpose, AM60 Mg tensile samples were generated under high-pressure die-casting in a specially-designed mold. Before the tensile test, the samples were CT-scanned to obtain the pore distributions within the samples. 3D microstructure-based finite element models were then developed based on the obtained actual pore distributions of the gauge area. The input properties for the matrix material were determined by fitting the simulation result to themore » experimental result of a selected sample, and then used for all the other samples’ simulation. The results show that the ductility and fracture locations predicted from simulations agree well with the experimental results. This indicates that the developed 3D extrinsic modeling method may be used to examine the influence of various aspects of pore sizes/distributions as well as intrinsic properties (i.e., matrix properties) on the ductility/fracture of Mg castings.« less

  17. Prediction of L70 lumen maintenance and chromaticity for LEDs using extended Kalman filter models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lall, Pradeep; Wei, Junchao; Davis, Lynn

    2013-09-30

    Solid-state lighting (SSL) luminaires containing light emitting diodes (LEDs) have the potential of seeing excessive temperatures when being transported across country or being stored in non-climate controlled warehouses. They are also being used in outdoor applications in desert environments that see little or no humidity but will experience extremely high temperatures during the day. This makes it important to increase our understanding of what effects high temperature exposure for a prolonged period of time will have on the usability and survivability of these devices. Traditional light sources “burn out” at end-of-life. For an incandescent bulb, the lamp life is definedmore » by B50 life. However, the LEDs have no filament to “burn”. The LEDs continually degrade and the light output decreases eventually below useful levels causing failure. Presently, the TM-21 test standard is used to predict the L70 life of LEDs from LM-80 test data. Several failure mechanisms may be active in a LED at a single time causing lumen depreciation. The underlying TM-21 Model may not capture the failure physics in presence of multiple failure mechanisms. Correlation of lumen maintenance with underlying physics of degradation at system-level is needed. In this paper, Kalman Filter (KF) and Extended Kalman Filters (EKF) have been used to develop a 70-percent Lumen Maintenance Life Prediction Model for LEDs used in SSL luminaires. Ten-thousand hour LM-80 test data for various LEDs have been used for model development. System state at each future time has been computed based on the state space at preceding time step, system dynamics matrix, control vector, control matrix, measurement matrix, measured vector, process noise and measurement noise. The future state of the lumen depreciation has been estimated based on a second order Kalman Filter model and a Bayesian Framework. The measured state variable has been related to the underlying damage using physics-based models. Life prediction of L70 life for the LEDs used in SSL luminaires from KF and EKF based models have been compared with the TM-21 model predictions and experimental data.« less

  18. Appendix 2: Risk-based framework and risk case studies. Risk Assessment for two bird species in northern Wisconsin.

    Treesearch

    Megan M. Friggens; Stephen N. Matthews

    2012-01-01

    Species distribution models for 147 bird species have been derived using climate, elevation, and distribution of current tree species as potential predictors (Matthews et al. 2011). In this case study, a risk matrix was developed for two bird species (fig. A2-5), with projected change in bird habitat (the x axis) based on models of changing suitable habitat resulting...

  19. Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules.

    PubMed

    Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo

    2010-11-01

    Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity/diversity analysis and drug discovery protocols.

  20. Calculating Path-Dependent Travel Time Prediction Variance and Covariance for the SALSA3D Global Tomographic P-Velocity Model with a Distributed Parallel Multi-Core Computer

    NASA Astrophysics Data System (ADS)

    Hipp, J. R.; Encarnacao, A.; Ballard, S.; Young, C. J.; Phillips, W. S.; Begnaud, M. L.

    2011-12-01

    Recently our combined SNL-LANL research team has succeeded in developing a global, seamless 3D tomographic P-velocity model (SALSA3D) that provides superior first P travel time predictions at both regional and teleseismic distances. However, given the variable data quality and uneven data sampling associated with this type of model, it is essential that there be a means to calculate high-quality estimates of the path-dependent variance and covariance associated with the predicted travel times of ray paths through the model. In this paper, we show a methodology for accomplishing this by exploiting the full model covariance matrix. Our model has on the order of 1/2 million nodes, so the challenge in calculating the covariance matrix is formidable: 0.9 TB storage for 1/2 of a symmetric matrix, necessitating an Out-Of-Core (OOC) blocked matrix solution technique. With our approach the tomography matrix (G which includes Tikhonov regularization terms) is multiplied by its transpose (GTG) and written in a blocked sub-matrix fashion. We employ a distributed parallel solution paradigm that solves for (GTG)-1 by assigning blocks to individual processing nodes for matrix decomposition update and scaling operations. We first find the Cholesky decomposition of GTG which is subsequently inverted. Next, we employ OOC matrix multiply methods to calculate the model covariance matrix from (GTG)-1 and an assumed data covariance matrix. Given the model covariance matrix we solve for the travel-time covariance associated with arbitrary ray-paths by integrating the model covariance along both ray paths. Setting the paths equal gives variance for that path. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  1. Limited-memory BFGS based least-squares pre-stack Kirchhoff depth migration

    NASA Astrophysics Data System (ADS)

    Wu, Shaojiang; Wang, Yibo; Zheng, Yikang; Chang, Xu

    2015-08-01

    Least-squares migration (LSM) is a linearized inversion technique for subsurface reflectivity estimation. Compared to conventional migration algorithms, it can improve spatial resolution significantly with a few iterative calculations. There are three key steps in LSM, (1) calculate data residuals between observed data and demigrated data using the inverted reflectivity model; (2) migrate data residuals to form reflectivity gradient and (3) update reflectivity model using optimization methods. In order to obtain an accurate and high-resolution inversion result, the good estimation of inverse Hessian matrix plays a crucial role. However, due to the large size of Hessian matrix, the inverse matrix calculation is always a tough task. The limited-memory BFGS (L-BFGS) method can evaluate the Hessian matrix indirectly using a limited amount of computer memory which only maintains a history of the past m gradients (often m < 10). We combine the L-BFGS method with least-squares pre-stack Kirchhoff depth migration. Then, we validate the introduced approach by the 2-D Marmousi synthetic data set and a 2-D marine data set. The results show that the introduced method can effectively obtain reflectivity model and has a faster convergence rate with two comparison gradient methods. It might be significant for general complex subsurface imaging.

  2. A review of experimental and modeling techniques to determine properties of biopolymer-based nanocomposites

    USDA-ARS?s Scientific Manuscript database

    The nonbiodegradable and nonrenewable nature of plastic packaging has led to a renewed interest in packaging materials based on bio-nanocomposites (biopolymer matrix reinforced with nanoparticles such as layered silicates). One of the reasons for unique properties of bio-nanocomposites is the differ...

  3. Second Generation Weather Impacts Decision Aid User’s Manual

    DTIC Science & Technology

    2013-09-01

    from the pulldown Base Reference Time menu. Most models start at times based on Coordinated Universal Time (UTC) or Zulu time (Z) with the selections...Effects Matrix Z Zulu time 31 No. of Copies Organization 1 DEFENSE TECHNICAL (PDF) INFORMATION CTR DTIC OCA 1 DIRECTOR (PDF) US

  4. Optically buffered Jones-matrix-based multifunctional optical coherence tomography with polarization mode dispersion correction

    PubMed Central

    Hong, Young-Joo; Makita, Shuichi; Sugiyama, Satoshi; Yasuno, Yoshiaki

    2014-01-01

    Polarization mode dispersion (PMD) degrades the performance of Jones-matrix-based polarization-sensitive multifunctional optical coherence tomography (JM-OCT). The problem is specially acute for optically buffered JM-OCT, because the long fiber in the optical buffering module induces a large amount of PMD. This paper aims at presenting a method to correct the effect of PMD in JM-OCT. We first mathematically model the PMD in JM-OCT and then derive a method to correct the PMD. This method is a combination of simple hardware modification and subsequent software correction. The hardware modification is introduction of two polarizers which transform the PMD into global complex modulation of Jones matrix. Subsequently, the software correction demodulates the global modulation. The method is validated with an experimentally obtained point spread function with a mirror sample, as well as by in vivo measurement of a human retina. PMID:25657888

  5. Research on propagation properties of controllable hollow flat-topped beams in turbulent atmosphere based on ABCD matrix

    NASA Astrophysics Data System (ADS)

    Liu, Huilong; Lü, Yanfei; Zhang, Jing; Xia, Jing; Pu, Xiaoyun; Dong, Yuan; Li, Shutao; Fu, Xihong; Zhang, Angfeng; Wang, Changjia; Tan, Yong; Zhang, Xihe

    2015-01-01

    This paper studies the propagation properties of controllable hollow flat-topped beams (CHFBs) in turbulent atmosphere based on ABCD matrix, sets up a propagation model and obtains an analytical expression for the propagation. With the help of numerical simulation, the propagation properties of CHFBs in different parameters are studied. Results indicate that in turbulent atmosphere, with the increase of propagation distance, the darkness of CHFBs gradually annihilate, and eventually evolve into Gaussian beams. Compared with the propagation properties in free space, the turbulent atmosphere enhances the diffraction effect of CHFBs and reduces the propagation distance for CHFBs to evolve into Gaussian beams. In strong turbulence atmospheric propagation, Airy disk phenomenon will disappear. The study on the propagation properties of CHFBs in turbulence atmosphere by using ABCD matrix is simple and convenient. This method can also be applied to study the propagation properties of other hollow laser beams in turbulent atmosphere.

  6. A nonlinear quality-related fault detection approach based on modified kernel partial least squares.

    PubMed

    Jiao, Jianfang; Zhao, Ning; Wang, Guang; Yin, Shen

    2017-01-01

    In this paper, a new nonlinear quality-related fault detection method is proposed based on kernel partial least squares (KPLS) model. To deal with the nonlinear characteristics among process variables, the proposed method maps these original variables into feature space in which the linear relationship between kernel matrix and output matrix is realized by means of KPLS. Then the kernel matrix is decomposed into two orthogonal parts by singular value decomposition (SVD) and the statistics for each part are determined appropriately for the purpose of quality-related fault detection. Compared with relevant existing nonlinear approaches, the proposed method has the advantages of simple diagnosis logic and stable performance. A widely used literature example and an industrial process are used for the performance evaluation for the proposed method. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

  7. Parallel synthesis of libraries of anodic and cathodic functionalized electrodeposition paints as immobilization matrix for amperometric biosensors.

    PubMed

    Ngounou, Bertrand; Aliyev, Elchin H; Guschin, Dmitrii A; Sultanov, Yusif M; Efendiev, Ayaz A; Schuhmann, Wolfgang

    2007-09-01

    The integration of flexible anchoring groups bearing imidazolyl or pyridyl substituents into the structure of electrodeposition paints (EDP) is the basis for the parallel synthesis of a library containing 107 members of different cathodic and anodic EDPs with a high variation in polymer properties. The obtained EDPs were used as immobilization matrix for biosensor fabrication using glucose oxidase as a model enzyme. Amperometric glucose sensors based on the different EDPs showed a wide variation in their sensor characteristics with respect to the apparent Michaelis-Menten constant (KM(app)) representing the linear measuring range and the maximum current (Imax(app)). Based on these results first assumptions concerning the impact of different side chains in the EDP on the expected biosensor properties could be obtained allowing for an improved rational optimization of EDPs used as immobilization matrix in amperometric biosensors.

  8. Mapping local anisotropy axis for scattering media using backscattering Mueller matrix imaging

    NASA Astrophysics Data System (ADS)

    He, Honghui; Sun, Minghao; Zeng, Nan; Du, E.; Guo, Yihong; He, Yonghong; Ma, Hui

    2014-03-01

    Mueller matrix imaging techniques can be used to detect the micro-structure variations of superficial biological tissues, including the sizes and shapes of cells, the structures in cells, and the densities of the organelles. Many tissues contain anisotropic fibrous micro-structures, such as collagen fibers, elastin fibers, and muscle fibers. Changes of these fibrous structures are potentially good indicators for some pathological variations. In this paper, we propose a quantitative analysis technique based on Mueller matrix for mapping local anisotropy axis of scattering media. By conducting both experiments on silk sample and Monte Carlo simulation based on the sphere-cylinder scattering model (SCSM), we extract anisotropy axis parameters from different backscattering Mueller matrix elements. Moreover, we testify the possible applications of these parameters for biological tissues. The preliminary experimental results of human cancerous samples show that, these parameters are capable to map the local axis of fibers. Since many pathological changes including early stage cancers affect the well aligned structures for tissues, the experimental results indicate that these parameters can be used as potential tools in clinical applications for biomedical diagnosis purposes.

  9. Damping mathematical modelling and dynamic responses for FRP laminated composite plates with polymer matrix

    NASA Astrophysics Data System (ADS)

    Liu, Qimao

    2018-02-01

    This paper proposes an assumption that the fibre is elastic material and polymer matrix is viscoelastic material so that the energy dissipation depends only on the polymer matrix in dynamic response process. The damping force vectors in frequency and time domains, of FRP (Fibre-Reinforced Polymer matrix) laminated composite plates, are derived based on this assumption. The governing equations of FRP laminated composite plates are formulated in both frequency and time domains. The direct inversion method and direct time integration method for nonviscously damped systems are employed to solve the governing equations and achieve the dynamic responses in frequency and time domains, respectively. The computational procedure is given in detail. Finally, dynamic responses (frequency responses with nonzero and zero initial conditions, free vibration, forced vibrations with nonzero and zero initial conditions) of a FRP laminated composite plate are computed using the proposed methodology. The proposed methodology in this paper is easy to be inserted into the commercial finite element analysis software. The proposed assumption, based on the theory of material mechanics, needs to be further proved by experiment technique in the future.

  10. Evidence of rock matrix back-diffusion and abiotic dechlorination using a field testing approach

    NASA Astrophysics Data System (ADS)

    Schaefer, Charles E.; Lippincott, David R.; Klammler, Harald; Hatfield, Kirk

    2018-02-01

    An in situ field demonstration was performed in fractured rock impacted with trichloroethene (TCE) and cis-1,2-dichloroethene (DCE) to assess the impacts of contaminant rebound after removing dissolved contaminants within hydraulically conductive fractures. Using a bedrock well pair spaced 2.4 m apart, TCE and DCE were first flushed with water to create a decrease in dissolved contaminant concentrations. While hydraulically isolating the well pair from upgradient contaminant impacts, contaminant rebound then was observed between the well pair over 151 days. The magnitude, but not trend, of TCE rebound was reasonably described by a matrix back-diffusion screening model that employed an effective diffusion coefficient and first-order abiotic TCE dechlorination rate constant that was based on bench-scale testing. Furthermore, a shift in the TCE:DCE ratio and carbon isotopic enrichment was observed during the rebound, suggesting that both biotic and abiotic dechlorination were occurring within the rock matrix. The isotopic data and back-diffusion model together served as a convincing argument that matrix back-diffusion was the mechanism responsible for the observed contaminant rebound. Results of this field demonstration highlight the importance and applicability of rock matrix parameters determined at the bench-scale, and suggest that carbon isotopic enrichment can be used as a line of evidence for abiotic dechlorination within rock matrices.

  11. Binary synaptic connections based on memory switching in a-Si:H for artificial neural networks

    NASA Technical Reports Server (NTRS)

    Thakoor, A. P.; Lamb, J. L.; Moopenn, A.; Khanna, S. K.

    1987-01-01

    A scheme for nonvolatile associative electronic memory storage with high information storage density is proposed which is based on neural network models and which uses a matrix of two-terminal passive interconnections (synapses). It is noted that the massive parallelism in the architecture would require the ON state of a synaptic connection to be unusually weak (highly resistive). Memory switching using a-Si:H along with ballast resistors patterned from amorphous Ge-metal alloys is investigated for a binary programmable read only memory matrix. The fabrication of a 1600 synapse test array of uniform connection strengths and a-Si:H switching elements is discussed.

  12. A Numerical Scheme for Ordinary Differential Equations Having Time Varying and Nonlinear Coefficients Based on the State Transition Matrix

    NASA Technical Reports Server (NTRS)

    Bartels, Robert E.

    2002-01-01

    A variable order method of integrating initial value ordinary differential equations that is based on the state transition matrix has been developed. The method has been evaluated for linear time variant and nonlinear systems of equations. While it is more complex than most other methods, it produces exact solutions at arbitrary time step size when the time variation of the system can be modeled exactly by a polynomial. Solutions to several nonlinear problems exhibiting chaotic behavior have been computed. Accuracy of the method has been demonstrated by comparison with an exact solution and with solutions obtained by established methods.

  13. Uncertainty Modeling for Structural Control Analysis and Synthesis

    NASA Technical Reports Server (NTRS)

    Campbell, Mark E.; Crawley, Edward F.

    1996-01-01

    The development of an accurate model of uncertainties for the control of structures that undergo a change in operational environment, based solely on modeling and experimentation in the original environment is studied. The application used throughout this work is the development of an on-orbit uncertainty model based on ground modeling and experimentation. A ground based uncertainty model consisting of mean errors and bounds on critical structural parameters is developed. The uncertainty model is created using multiple data sets to observe all relevant uncertainties in the system. The Discrete Extended Kalman Filter is used as an identification/parameter estimation method for each data set, in addition to providing a covariance matrix which aids in the development of the uncertainty model. Once ground based modal uncertainties have been developed, they are localized to specific degrees of freedom in the form of mass and stiffness uncertainties. Two techniques are presented: a matrix method which develops the mass and stiffness uncertainties in a mathematical manner; and a sensitivity method which assumes a form for the mass and stiffness uncertainties in macroelements and scaling factors. This form allows the derivation of mass and stiffness uncertainties in a more physical manner. The mass and stiffness uncertainties of the ground based system are then mapped onto the on-orbit system, and projected to create an analogous on-orbit uncertainty model in the form of mean errors and bounds on critical parameters. The Middeck Active Control Experiment is introduced as experimental verification for the localization and projection methods developed. In addition, closed loop results from on-orbit operations of the experiment verify the use of the uncertainty model for control analysis and synthesis in space.

  14. Area-averaged evapotranspiration over a heterogeneous land surface: aggregation of multi-point EC flux measurements with a high-resolution land-cover map and footprint analysis

    NASA Astrophysics Data System (ADS)

    Xu, Feinan; Wang, Weizhen; Wang, Jiemin; Xu, Ziwei; Qi, Yuan; Wu, Yueru

    2017-08-01

    The determination of area-averaged evapotranspiration (ET) at the satellite pixel scale/model grid scale over a heterogeneous land surface plays a significant role in developing and improving the parameterization schemes of the remote sensing based ET estimation models and general hydro-meteorological models. The Heihe Watershed Allied Telemetry Experimental Research (HiWATER) flux matrix provided a unique opportunity to build an aggregation scheme for area-averaged fluxes. On the basis of the HiWATER flux matrix dataset and high-resolution land-cover map, this study focused on estimating the area-averaged ET over a heterogeneous landscape with footprint analysis and multivariate regression. The procedure is as follows. Firstly, quality control and uncertainty estimation for the data of the flux matrix, including 17 eddy-covariance (EC) sites and four groups of large-aperture scintillometers (LASs), were carefully done. Secondly, the representativeness of each EC site was quantitatively evaluated; footprint analysis was also performed for each LAS path. Thirdly, based on the high-resolution land-cover map derived from aircraft remote sensing, a flux aggregation method was established combining footprint analysis and multiple-linear regression. Then, the area-averaged sensible heat fluxes obtained from the EC flux matrix were validated by the LAS measurements. Finally, the area-averaged ET of the kernel experimental area of HiWATER was estimated. Compared with the formerly used and rather simple approaches, such as the arithmetic average and area-weighted methods, the present scheme is not only with a much better database, but also has a solid grounding in physics and mathematics in the integration of area-averaged fluxes over a heterogeneous surface. Results from this study, both instantaneous and daily ET at the satellite pixel scale, can be used for the validation of relevant remote sensing models and land surface process models. Furthermore, this work will be extended to the water balance study of the whole Heihe River basin.

  15. QCD dirac operator at nonzero chemical potential: lattice data and matrix model.

    PubMed

    Akemann, Gernot; Wettig, Tilo

    2004-03-12

    Recently, a non-Hermitian chiral random matrix model was proposed to describe the eigenvalues of the QCD Dirac operator at nonzero chemical potential. This matrix model can be constructed from QCD by mapping it to an equivalent matrix model which has the same symmetries as QCD with chemical potential. Its microscopic spectral correlations are conjectured to be identical to those of the QCD Dirac operator. We investigate this conjecture by comparing large ensembles of Dirac eigenvalues in quenched SU(3) lattice QCD at a nonzero chemical potential to the analytical predictions of the matrix model. Excellent agreement is found in the two regimes of weak and strong non-Hermiticity, for several different lattice volumes.

  16. A fast reconstruction algorithm for fluorescence optical diffusion tomography based on preiteration.

    PubMed

    Song, Xiaolei; Xiong, Xiaoyun; Bai, Jing

    2007-01-01

    Fluorescence optical diffusion tomography in the near-infrared (NIR) bandwidth is considered to be one of the most promising ways for noninvasive molecular-based imaging. Many reconstructive approaches to it utilize iterative methods for data inversion. However, they are time-consuming and they are far from meeting the real-time imaging demands. In this work, a fast preiteration algorithm based on the generalized inverse matrix is proposed. This method needs only one step of matrix-vector multiplication online, by pushing the iteration process to be executed offline. In the preiteration process, the second-order iterative format is employed to exponentially accelerate the convergence. Simulations based on an analytical diffusion model show that the distribution of fluorescent yield can be well estimated by this algorithm and the reconstructed speed is remarkably increased.

  17. A Coupled/Uncoupled Computational Scheme for Deformation and Fatigue Damage Analysis of Unidirectional Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Wilt, Thomas E.; Arnold, Steven M.; Saleeb, Atef F.

    1997-01-01

    A fatigue damage computational algorithm utilizing a multiaxial, isothermal, continuum-based fatigue damage model for unidirectional metal-matrix composites has been implemented into the commercial finite element code MARC using MARC user subroutines. Damage is introduced into the finite element solution through the concept of effective stress that fully couples the fatigue damage calculations with the finite element deformation solution. Two applications using the fatigue damage algorithm are presented. First, an axisymmetric stress analysis of a circumferentially reinforced ring, wherein both the matrix cladding and the composite core were assumed to behave elastic-perfectly plastic. Second, a micromechanics analysis of a fiber/matrix unit cell using both the finite element method and the generalized method of cells (GMC). Results are presented in the form of S-N curves and damage distribution plots.

  18. A unique set of micromechanics equations for high temperature metal matrix composites

    NASA Technical Reports Server (NTRS)

    Hopkins, D. A.; Chamis, C. C.

    1985-01-01

    A unique set of micromechanic equations is presented for high temperature metal matrix composites. The set includes expressions to predict mechanical properties, thermal properties and constituent microstresses for the unidirectional fiber reinforced ply. The equations are derived based on a mechanics of materials formulation assuming a square array unit cell model of a single fiber, surrounding matrix and an interphase to account for the chemical reaction which commonly occurs between fiber and matrix. A three-dimensional finite element analysis was used to perform a preliminary validation of the equations. Excellent agreement between properties predicted using the micromechanics equations and properties simulated by the finite element analyses are demonstrated. Implementation of the micromechanics equations as part of an integrated computational capability for nonlinear structural analysis of high temperature multilayered fiber composites is illustrated.

  19. Efficient two-dimensional compressive sensing in MIMO radar

    NASA Astrophysics Data System (ADS)

    Shahbazi, Nafiseh; Abbasfar, Aliazam; Jabbarian-Jahromi, Mohammad

    2017-12-01

    Compressive sensing (CS) has been a way to lower sampling rate leading to data reduction for processing in multiple-input multiple-output (MIMO) radar systems. In this paper, we further reduce the computational complexity of a pulse-Doppler collocated MIMO radar by introducing a two-dimensional (2D) compressive sensing. To do so, we first introduce a new 2D formulation for the compressed received signals and then we propose a new measurement matrix design for our 2D compressive sensing model that is based on minimizing the coherence of sensing matrix using gradient descent algorithm. The simulation results show that our proposed 2D measurement matrix design using gradient decent algorithm (2D-MMDGD) has much lower computational complexity compared to one-dimensional (1D) methods while having better performance in comparison with conventional methods such as Gaussian random measurement matrix.

  20. Computer simulation of the matrix-inclusion interphase in bulk metallic glass based nanocomposites

    NASA Astrophysics Data System (ADS)

    Kokotin, V.; Hermann, H.; Eckert, J.

    2011-10-01

    Atomistic models for matrix-inclusion systems are generated. Analyses of the systems show that interphase layers of finite thickness appear interlinking the surface of the nanocrystalline inclusion and the embedding amorphous matrix. In a first approximation, the interphase is characterized as an amorphous structure with a density slightly reduced compared to that of the matrix. This result holds for both monatomic hard sphere systems and a Cu47.5Zr47.5Al5 alloy simulated by molecular dynamics (MD). The elastic shear and bulk modulus of the interphase are calculated by simulated deformation of the MD systems. Both moduli diminish with decreasing density but the shear modulus is more sensitive against density reduction by one order of magnitude. This result explains recent observations of shear band initiation at the amorphous-crystalline interface during plastic deformation.

  1. Damage development in titanium metal matrix composites subjected to cyclic loading

    NASA Technical Reports Server (NTRS)

    Johnson, W. S.

    1992-01-01

    Several layups of SCS-6/Ti-15-3 composites were investigated. Fatigue tests were conducted and analyzed for both notched and unnotched specimens at room temperature and elevated temperatures. Thermo-mechanical fatigue results were analyzed. Test results indicated that the stress in the 0 degree fibers is the controlling factor in fatigue life. The static and fatigue strength of these materials is shown to be strongly dependent on the level of residual stresses and the fiber/matrix interfacial strength. Fatigue tests of notched specimens showed that cracks can initiate and grow many fiber spacings in the matrix materials without breaking fibers. Fiber bridging models were applied to characterize the crack growth behavior. The matrix cracks are shown to significantly reduce the residual strength of notched composites. The notch strength of these composites was accurately predicted using a micromechanics based methodology.

  2. Damage development in titanium metal-matrix composites subjected to cyclic loading

    NASA Technical Reports Server (NTRS)

    Johnson, W. S.

    1993-01-01

    Several layups of SCS-6/Ti-15-3 composites were investigated. Fatigue tests were conducted and analyzed for both notched and unnotched specimens at room temperature and elevated temperatures. Thermo-mechanical fatigue results were analyzed. Test results indicated that the stress in the 0 degree fibers is the controlling factor in fatigue life. The static and fatigue strength of these materials is shown to be strongly dependent on the level of residual stresses and the fiber/matrix interfacial strength. Fatigue tests of notched specimens showed that cracks can initiate and grow many fiber spacings in the matrix materials without breaking fibers. Fiber bridging models were applied to characterize the crack growth behavior. The matrix cracks are shown to significantly reduce the residual strength of notched composites. The notch strength of these composites was accurately predicted using a micromechanics based methodology.

  3. Matrix form for the instrument line shape of Fourier-transform spectrometers yielding a fast integration algorithm to theoretical spectra.

    PubMed

    Desbiens, Raphaël; Tremblay, Pierre; Genest, Jérôme; Bouchard, Jean-Pierre

    2006-01-20

    The instrument line shape (ILS) of a Fourier-transform spectrometer is expressed in a matrix form. For all line shape effects that scale with wavenumber, the ILS matrix is shown to be transposed in the spectral and interferogram domains. The novel representation of the ILS matrix in the interferogram domain yields an insightful physical interpretation of the underlying process producing self-apodization. Working in the interferogram domain circumvents the problem of taking into account the effects of finite optical path difference and permits a proper discretization of the equations. A fast algorithm in O(N log2 N), based on the fractional Fourier transform, is introduced that permits the application of a constant resolving power line shape to theoretical spectra or forward models. The ILS integration formalism is validated with experimental data.

  4. An Empirical State Error Covariance Matrix Orbit Determination Example

    NASA Technical Reports Server (NTRS)

    Frisbee, Joseph H., Jr.

    2015-01-01

    State estimation techniques serve effectively to provide mean state estimates. However, the state error covariance matrices provided as part of these techniques suffer from some degree of lack of confidence in their ability to adequately describe the uncertainty in the estimated states. A specific problem with the traditional form of state error covariance matrices is that they represent only a mapping of the assumed observation error characteristics into the state space. Any errors that arise from other sources (environment modeling, precision, etc.) are not directly represented in a traditional, theoretical state error covariance matrix. First, consider that an actual observation contains only measurement error and that an estimated observation contains all other errors, known and unknown. Then it follows that a measurement residual (the difference between expected and observed measurements) contains all errors for that measurement. Therefore, a direct and appropriate inclusion of the actual measurement residuals in the state error covariance matrix of the estimate will result in an empirical state error covariance matrix. This empirical state error covariance matrix will fully include all of the errors in the state estimate. The empirical error covariance matrix is determined from a literal reinterpretation of the equations involved in the weighted least squares estimation algorithm. It is a formally correct, empirical state error covariance matrix obtained through use of the average form of the weighted measurement residual variance performance index rather than the usual total weighted residual form. Based on its formulation, this matrix will contain the total uncertainty in the state estimate, regardless as to the source of the uncertainty and whether the source is anticipated or not. It is expected that the empirical error covariance matrix will give a better, statistical representation of the state error in poorly modeled systems or when sensor performance is suspect. In its most straight forward form, the technique only requires supplemental calculations to be added to existing batch estimation algorithms. In the current problem being studied a truth model making use of gravity with spherical, J2 and J4 terms plus a standard exponential type atmosphere with simple diurnal and random walk components is used. The ability of the empirical state error covariance matrix to account for errors is investigated under four scenarios during orbit estimation. These scenarios are: exact modeling under known measurement errors, exact modeling under corrupted measurement errors, inexact modeling under known measurement errors, and inexact modeling under corrupted measurement errors. For this problem a simple analog of a distributed space surveillance network is used. The sensors in this network make only range measurements and with simple normally distributed measurement errors. The sensors are assumed to have full horizon to horizon viewing at any azimuth. For definiteness, an orbit at the approximate altitude and inclination of the International Space Station is used for the study. The comparison analyses of the data involve only total vectors. No investigation of specific orbital elements is undertaken. The total vector analyses will look at the chisquare values of the error in the difference between the estimated state and the true modeled state using both the empirical and theoretical error covariance matrices for each of scenario.

  5. Compression response of tri-axially braided textile composites

    NASA Astrophysics Data System (ADS)

    Song, Shunjun

    2007-12-01

    This thesis is concerned with characterizing the compression stiffness and compression strength of 2D tri-axially braided textile composites (2DTBC). Two types of 2DTBC are considered differing only on the resin type, while the textile fiber architecture is kept the same with bias tows at 45 degrees to the axial tows. Experimental, analytical and computational methods are described based on the results generated in this study. Since these composites are manufactured using resin transfer molding, the intended and as manufactured composite samples differ in their microstructure due to consolidation and thermal history effects in the manufacturing cycle. These imperfections are measured and the effect of these imperfections on the compression stiffness and strength are characterized. Since the matrix is a polymer material, the nonuniform thermal history undergone by the polymer at manufacturing (within the composite and in the presence of fibers) renders its properties to be non-homogenous. The effects of these non-homogeneities are captured through the definition of an equivalent in-situ matrix material. A method to characterize the mechanical properties of the in-situ matrix is also described. Fiber tow buckling, fiber tow kinking and matrix microcracking are all observed in the experiments. These failure mechanisms are captured through a computational model that uses the finite element (FE) technique to discretize the structure. The FE equations are solved using the commercial software ABAQUS version 6.5. The fiber tows are modeled as transversely isotropic elastic-plastic solids and the matrix is modeled as an isotropic elastic-plastic solid with and without microcracking damage. Because the 2DTBC is periodic, the question of how many repeat units are necessary to model the compression stiffness and strength are examined. Based on the computational results, the correct representative unit cell for this class of materials is identified. The computational models and results presented in the thesis provide a means to assess the compressive strength of 2DTBC and its dependence on various microstructural parameters. The essential features (for example, fiber kinking) of 2DTBC under compressive loading are captured accurately and the results are validated by the compression experiments. Due to the requirement of large computational resources for the unit cell studies, simplified models that use less computer resources but sacrifice some accuracy are presented for use in engineering design. A combination of the simplified models is shown to provide a good prediction of the salient features (peak strength and plateau strength) of these materials under compression loading. The incorporation of matrix strain rate effects, a study of the effect of the bias tow angle and the inclusion of viscoelastic/viscoplastic behavior for the study of fatigue are suggested as extensions to this work.

  6. SU-E-T-503: IMRT Optimization Using Monte Carlo Dose Engine: The Effect of Statistical Uncertainty.

    PubMed

    Tian, Z; Jia, X; Graves, Y; Uribe-Sanchez, A; Jiang, S

    2012-06-01

    With the development of ultra-fast GPU-based Monte Carlo (MC) dose engine, it becomes clinically realistic to compute the dose-deposition coefficients (DDC) for IMRT optimization using MC simulation. However, it is still time-consuming if we want to compute DDC with small statistical uncertainty. This work studies the effects of the statistical error in DDC matrix on IMRT optimization. The MC-computed DDC matrices are simulated here by adding statistical uncertainties at a desired level to the ones generated with a finite-size pencil beam algorithm. A statistical uncertainty model for MC dose calculation is employed. We adopt a penalty-based quadratic optimization model and gradient descent method to optimize fluence map and then recalculate the corresponding actual dose distribution using the noise-free DDC matrix. The impacts of DDC noise are assessed in terms of the deviation of the resulted dose distributions. We have also used a stochastic perturbation theory to theoretically estimate the statistical errors of dose distributions on a simplified optimization model. A head-and-neck case is used to investigate the perturbation to IMRT plan due to MC's statistical uncertainty. The relative errors of the final dose distributions of the optimized IMRT are found to be much smaller than those in the DDC matrix, which is consistent with our theoretical estimation. When history number is decreased from 108 to 106, the dose-volume-histograms are still very similar to the error-free DVHs while the error in DDC is about 3.8%. The results illustrate that the statistical errors in the DDC matrix have a relatively small effect on IMRT optimization in dose domain. This indicates we can use relatively small number of histories to obtain the DDC matrix with MC simulation within a reasonable amount of time, without considerably compromising the accuracy of the optimized treatment plan. This work is supported by Varian Medical Systems through a Master Research Agreement. © 2012 American Association of Physicists in Medicine.

  7. Modeling for Matrix Multicracking Evolution of Cross-ply Ceramic-Matrix Composites Using Energy Balance Approach

    NASA Astrophysics Data System (ADS)

    Longbiao, Li

    2015-12-01

    The matrix multicracking evolution of cross-ply ceramic-matrix composites (CMCs) has been investigated using energy balance approach. The multicracking of cross-ply CMCs was classified into five modes, i.e., (1) mode 1: transverse multicracking; (2) mode 2: transverse multicracking and matrix multicracking with perfect fiber/matrix interface bonding; (3) mode 3: transverse multicracking and matrix multicracking with fiber/matrix interface debonding; (4) mode 4: matrix multicracking with perfect fiber/matrix interface bonding; and (5) mode 5: matrix multicracking with fiber/matrix interface debonding. The stress distributions of four cracking modes, i.e., mode 1, mode 2, mode 3 and mode 5, are analysed using shear-lag model. The matrix multicracking evolution of mode 1, mode 2, mode 3 and mode 5, has been determined using energy balance approach. The effects of ply thickness and fiber volume fraction on matrix multicracking evolution of cross-ply CMCs have been investigated.

  8. Description of sorbing tracers transport in fractured media using the lattice model approach

    NASA Astrophysics Data System (ADS)

    Jiménez-Hornero, Francisco J.; Giráldez, Juan V.; Laguna, Ana

    2005-12-01

    The transport of contaminants in fractured media is a complex phenomenon with a great environmental impact. It has been described with several models, most of them based on complex partial differential equations, that are difficult to apply when equilibrium and nonequilibrium dynamics are considered in complex boundaries. With the aim of overcoming this limitation, a combination of two lattice Bathnagar, Gross and Krook (BGK) models, derived from the lattice Boltzmann model, is proposed in this paper. The fractured medium is assumed to be a single fissure in a porous rock matrix. The proposed approach permits us to deal with two processes with different length scales: advection-dispersion in the fissure and diffusion within the rock matrix. In addition to the mentioned phenomena, sorption reactions are also considered. The combined model has been tested using the experimental breakthrough curves obtained by Garnier et al. (Garnier, J.M., Crampon, N., Préaux, C., Porel, G., Vreulx, M., 1985. Traçage par 13C, 2H, I - et uranine dans la nappe de la craie sénonienne en écoulement radial convergent (Béthune, France). J. Hidrol. 78, 379-392.) giving acceptable results. A study on the influence of the lattice BGK models parameters controlling sorption and matrix diffusion on the breakthrough curves shape is included.

  9. Organizational Models and Mythologies of the American Research University. ASHE 1986 Annual Meeting Paper.

    ERIC Educational Resources Information Center

    Alpert, Daniel

    Features of the matrix model of the research university and myths about the academic enterprise are described, along with serious dissonances in the U.S. university system. The linear model, from which the matrix model evolved, describes the university's structure, perceived mission, and organizational behavior. A matrix model portrays in concise,…

  10. Normal response function method for mass and stiffness matrix updating using complex FRFs

    NASA Astrophysics Data System (ADS)

    Pradhan, S.; Modak, S. V.

    2012-10-01

    Quite often a structural dynamic finite element model is required to be updated so as to accurately predict the dynamic characteristics like natural frequencies and the mode shapes. Since in many situations undamped natural frequencies and mode shapes need to be predicted, it has generally been the practice in these situations to seek updating of only mass and stiffness matrix so as to obtain a reliable prediction model. Updating using frequency response functions (FRFs) has been one of the widely used approaches for updating, including updating of mass and stiffness matrices. However, the problem with FRF based methods, for updating mass and stiffness matrices, is that these methods are based on use of complex FRFs. Use of complex FRFs to update mass and stiffness matrices is not theoretically correct as complex FRFs are not only affected by these two matrices but also by the damping matrix. Therefore, in situations where updating of only mass and stiffness matrices using FRFs is required, the use of complex FRFs based updating formulation is not fully justified and would lead to inaccurate updated models. This paper addresses this difficulty and proposes an improved FRF based finite element model updating procedure using the concept of normal FRFs. The proposed method is a modified version of the existing response function method that is based on the complex FRFs. The effectiveness of the proposed method is validated through a numerical study of a simple but representative beam structure. The effect of coordinate incompleteness and robustness of method under presence of noise is investigated. The results of updating obtained by the improved method are compared with the existing response function method. The performance of the two approaches is compared for cases of light, medium and heavily damped structures. It is found that the proposed improved method is effective in updating of mass and stiffness matrices in all the cases of complete and incomplete data and with all levels and types of damping.

  11. Multi-Length Scale-Enriched Continuum-Level Material Model for Kevlar-Fiber-Reinforced Polymer-Matrix Composites

    DTIC Science & Technology

    2012-08-03

    is unlimited. Multi-Length Scale-Enriched Continuum-Level Material Model for Kevlar ®-Fiber-Reinforced Polymer-Matrix Composites The views, opinions...12211 Research Triangle Park, NC 27709-2211 ballistics, composites, Kevlar , material models, microstructural defects REPORT DOCUMENTATION PAGE 11... Kevlar ®-Fiber-Reinforced Polymer-Matrix Composites Report Title Fiber-reinforced polymer matrix composite materials display quite complex deformation

  12. Self-actuating and self-diagnosing plastically deforming piezo-composite flapping wing MAV

    NASA Astrophysics Data System (ADS)

    Harish, Ajay B.; Harursampath, Dineshkumar; Mahapatra, D. Roy

    2011-04-01

    In this work, we propose a constitutive model to describe the behavior of Piezoelectric Fiber Reinforced Composite (PFRC) material consisting of elasto-plastic matrix reinforced by strong elastic piezoelectric fibers. Computational efficiency is achieved using analytical solutions for elastic stifness matrix derived from Variational Asymptotic Methods (VAM). This is extended to provide Structural Health Monitoring (SHM) based on plasticity induced degradation of flapping frequency of PFRC. Overall this work provides an effective mathematical tool that can be used for structural self-health monitoring of plasticity induced flapping degradation of PFRC flapping wing MAVs. The developed tool can be re-calibrated to also provide SHM for other forms of failures like fatigue, matrix cracking etc.

  13. Self-Repairing Fatigue Damage in Metallic Structures for Aerospace Vehicles Using Shape Memory Alloy Self-healing (SMASH) Technology

    NASA Technical Reports Server (NTRS)

    Wright, M. Clara; Manuel, Michele; Wallace, Terryl; Newman, Andy; Brinson, Kate

    2015-01-01

    This DAA is for the Phase II webinar presentation of the ARMD-funded SMASH technology. A self-repairing aluminum-based composite system has been developed using liquid-assisted healing theory in conjunction with the shape memory effect of wire reinforcements. The metal matrix composite was thermodynamically designed to have a matrix with a relatively even dispersion of low-melting phase, allowing for repair of cracks at a pre-determined temperature. Shape memory alloy wire reinforcements were used within the composite to provide crack closure. Investigators focused the research on fatigue cracks propagating through the matrix in order to optimize and computer model the SMASH technology for aeronautical applications.

  14. Evaluation of hydrophobic materials as matrices for controlled-release drug delivery.

    PubMed

    Quadir, Mohiuddin Abdul; Rahman, M Sharifur; Karim, M Ziaul; Akter, Sanjida; Awkat, M Talat Bin; Reza, Md Selim

    2003-07-01

    The present study was undertaken to evaluate the effect of different insoluble and erodable wax-lipid based materials and their content level on the release profile of drug from matrix systems. Matrix tablets of theophylline were prepared using carnauba wax, bees wax, stearic acid, cetyl alcohol, cetostearyl alcohol and glyceryl monostearate as rate-retarding agents by direct compression process. The release of theophylline from these hydrophobic matrices was studied over 8-hours in buffer media of pH 6.8. Statistically significant difference was found among the drug release profile from different matrices. The release kinetics was found to be governed by the type and content of hydrophobic materials in the matrix. At lower level of wax matrices (25%), a potential burst release was observed with all the materials being studied. Bees wax could not exert any sustaining action while an extensive burst release was found with carnauba wax at this hydrophobic load. Increasing the concentration of fat-wax materials significantly decreased the burst effect of drug from the matrix. At higher hydrophobic level (50% of the matrix), the rate and extent of drug release was significantly reduced due to increased tortuosity and reduced porosity of the matrix. Cetostearyl alcohol imparted the strongest retardation of drug release irrespective of fat-wax level. Numerical fits indicate that the Higuchi square root of time model was the most appropriate one for describing the release profile of theophylline from hydrophobic matrices. The release mechanism was also explored and explained with biexponential equation. Application of this model indicates that Fickian or case I kinetics is the predominant mechanism of drug release from these wax-lipid matrices. The mean dissolution time (MDT) was calculated for all the formulations and the highest MDT value was obtained with cetostearyl matrix. The greater sustaining activity of cetostearyl alcohol can be attributed to some level of swelling and erosion within this matrix at lower fat-wax level which is also supported by release exponent values and Fickian fraction release against time profile of this agent. The results generated in this study showed that proper selection of these hydrophobic materials based on their physico-chemical properties is important in designing wax matrix tablets with desired dissolution profile.

  15. Numerically pricing American options under the generalized mixed fractional Brownian motion model

    NASA Astrophysics Data System (ADS)

    Chen, Wenting; Yan, Bowen; Lian, Guanghua; Zhang, Ying

    2016-06-01

    In this paper, we introduce a robust numerical method, based on the upwind scheme, for the pricing of American puts under the generalized mixed fractional Brownian motion (GMFBM) model. By using portfolio analysis and applying the Wick-Itô formula, a partial differential equation (PDE) governing the prices of vanilla options under the GMFBM is successfully derived for the first time. Based on this, we formulate the pricing of American puts under the current model as a linear complementarity problem (LCP). Unlike the classical Black-Scholes (B-S) model or the generalized B-S model discussed in Cen and Le (2011), the newly obtained LCP under the GMFBM model is difficult to be solved accurately because of the numerical instability which results from the degeneration of the governing PDE as time approaches zero. To overcome this difficulty, a numerical approach based on the upwind scheme is adopted. It is shown that the coefficient matrix of the current method is an M-matrix, which ensures its stability in the maximum-norm sense. Remarkably, we have managed to provide a sharp theoretic error estimate for the current method, which is further verified numerically. The results of various numerical experiments also suggest that this new approach is quite accurate, and can be easily extended to price other types of financial derivatives with an American-style exercise feature under the GMFBM model.

  16. Failure detection and correction for turbofan engines

    NASA Technical Reports Server (NTRS)

    Corley, R. C.; Spang, H. A., III

    1977-01-01

    In this paper, a failure detection and correction strategy for turbofan engines is discussed. This strategy allows continuing control of the engines in the event of a sensor failure. An extended Kalman filter is used to provide the best estimate of the state of the engine based on currently available sensor outputs. Should a sensor failure occur the control is based on the best estimate rather than the sensor output. The extended Kalman filter consists of essentially two parts, a nonlinear model of the engine and up-date logic which causes the model to track the actual engine. Details on the model and up-date logic are presented. To allow implementation, approximations are made to the feedback gain matrix which result in a single feedback matrix which is suitable for use over the entire flight envelope. The effect of these approximations on stability and response is discussed. Results from a detailed nonlinear simulation indicate that good control can be maintained even under multiple failures.

  17. Estimating and Identifying Unspecified Correlation Structure for Longitudinal Data

    PubMed Central

    Hu, Jianhua; Wang, Peng; Qu, Annie

    2014-01-01

    Identifying correlation structure is important to achieving estimation efficiency in analyzing longitudinal data, and is also crucial for drawing valid statistical inference for large size clustered data. In this paper, we propose a nonparametric method to estimate the correlation structure, which is applicable for discrete longitudinal data. We utilize eigenvector-based basis matrices to approximate the inverse of the empirical correlation matrix and determine the number of basis matrices via model selection. A penalized objective function based on the difference between the empirical and model approximation of the correlation matrices is adopted to select an informative structure for the correlation matrix. The eigenvector representation of the correlation estimation is capable of reducing the risk of model misspecification, and also provides useful information on the specific within-cluster correlation pattern of the data. We show that the proposed method possesses the oracle property and selects the true correlation structure consistently. The proposed method is illustrated through simulations and two data examples on air pollution and sonar signal studies. PMID:26361433

  18. A dislocation density based micromechanical constitutive model for Sn-Ag-Cu solder alloys

    NASA Astrophysics Data System (ADS)

    Liu, Lu; Yao, Yao; Zeng, Tao; Keer, Leon M.

    2017-10-01

    Based on the dislocation density hardening law, a micromechanical model considering the effects of precipitates is developed for Sn-Ag-Cu solder alloys. According to the microstructure of the Sn-3.0Ag-0.5Cu thin films, intermetallic compounds (IMCs) are assumed as sphere particles embedded in the polycrystalline β-Sn matrix. The mechanical behavior of polycrystalline β-Sn matrix is determined by the elastic-plastic self-consistent method. The existence of IMCs not only impedes the motion of dislocations but also increases the overall stiffness. Thus, a dislocation density based hardening law considering non-shearable precipitates is adopted locally for single β-Sn crystal, and the Mori-Tanaka scheme is applied to describe the overall viscoplastic behavior of solder alloys. The proposed model is incorporated into finite element analysis and the corresponding numerical implementation method is presented. The model can describe the mechanical behavior of Sn-3.0Ag-0.5Cu and Sn-1.0Ag-0.5Cu alloys under high strain rates at a wide range of temperatures. Furthermore, the overall Young’s modulus changes due to different contents of IMCs is predicted and compared with experimental data. Results show that the proposed model can describe both elastic and inelastic behavior of solder alloys with reasonable accuracy.

  19. Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

    NASA Astrophysics Data System (ADS)

    Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

    2018-05-01

    In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

  20. The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

    NASA Astrophysics Data System (ADS)

    Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

    2017-08-01

    The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

Top