Expansion of the peri-implant attached gingiva with a three-dimensional collagen matrix in head and neck cancer patients-results from a prospective clinical and histological study.

PubMed

Lorenz, Jonas; Blume, Maximilian; Barbeck, Mike; Teiler, Anna; Kirkpatrick, C James; Sader, Robert A; Ghanaati, Shahram

2017-05-01

Attached peri-implant gingiva has proven to have an influence on the long-term stability of dental implants. In patients with head and neck cancer, a functional peri-implant gingiva is even more of critical importance. The aim of the presented prospective study was to investigate a three-dimensional xenogeneic collagen matrix for augmentation around dental implants in patients with former head and neck cancer. Eight patients presenting with insufficient peri-implant gingiva underwent vestibuloplasty on 51 implants using a xenogeneic collagen matrix. The clinical performance and the shrinking tendency of the matrix were analyzed in a cohort study. Furthermore, eight biopsies from the augmented regions were examined histologically to determine the biomaterial-related tissue reaction. Initially after vestibuloplasty, a mean width of attached gingiva of 4.4 ± 0.94 mm could be achieved. At clinical follow up investigation 6 months after vestibuloplasty, a mean width of 3.9 ± 0.65 mm attached peri-implant gingiva with a mean shrinking tendency of 14 % could be detected. Histological analysis of the biopsies revealed a well integrated collagen22 matrix covered with epithelium. Within the compact layer, mononuclear cells were observed only, while the spongious layer was infiltrated with a cell-rich connective tissue. Within its limits, the presented study revealed that the investigated collagen matrix is suitable to enlarge the peri-implant attached gingiva in head and neck cancer patients without adverse reactions or a multinucleated giant cell-triggered tissue reaction. The application of the investigated three-dimensional collagen matrix in vestibuloplasty achieved a sufficient amount of peri-implant attached gingiva in head and neck cancer patients. The favorable tissue reaction and the low shrinking tendency make the collagen matrix a promising alternative to autologous tissue grafts.

A role for PVRL4-driven cell–cell interactions in tumorigenesis

PubMed Central

Pavlova, Natalya N; Pallasch, Christian; Elia, Andrew EH; Braun, Christian J; Westbrook, Thomas F; Hemann, Michael; Elledge, Stephen J

2013-01-01

During all stages of tumor progression, cancer cells are subjected to inappropriate extracellular matrix environments and must undergo adaptive changes in order to evade growth constraints associated with the loss of matrix attachment. A gain of function screen for genes that enable proliferation independently of matrix anchorage identified a cell adhesion molecule PVRL4 (poliovirus-receptor-like 4), also known as Nectin-4. PVRL4 promotes anchorage-independence by driving cell-to-cell attachment and matrix-independent integrin β4/SHP-2/c-Src activation. Solid tumors frequently have copy number gains of the PVRL4 locus and some have focal amplifications. We demonstrate that the transformation of breast cancer cells is dependent on PVRL4. Furthermore, growth of orthotopically implanted tumors in vivo is inhibited by blocking PVRL4-driven cell-to-cell attachment with monoclonal antibodies, demonstrating a novel strategy for targeted therapy of cancer. DOI: http://dx.doi.org/10.7554/eLife.00358.001 PMID:23682311

Cellular Response to a Novel Fetal Acellular Collagen Matrix: Implications for Tissue Regeneration

PubMed Central

Rennert, Robert C.; Garg, Ravi K.; Gurtner, Geoffrey C.

2013-01-01

Introduction. PriMatrix (TEI Biosciences Inc., Boston, MA, USA) is a novel acellular collagen matrix derived from fetal bovine dermis that is designed for use in partial- and full-thickness wounds. This study analyzes the cellular response to PriMatrix in vivo, as well as the ability of this matrix to facilitate normal tissue regeneration. Methods. Five by five mm squares of rehydrated PriMatrix were implanted in a subcutaneous fashion on the dorsum of wild-type mice. Implant site tissue was harvested for histology, immunohistochemistry (IHC), and flow cytometric analyses at multiple time points until day 28. Results. PriMatrix implants were found to go through a biological progression initiated by a transient infiltrate of inflammatory cells, followed by mesenchymal cell recruitment and vascular development. IHC analysis revealed that the majority of the implanted fetal dermal collagen fibers persisted through day 28 but underwent remodeling and cellular repopulation to form tissue with a density and morphology consistent with healthy dermis. Conclusions. PriMatrix implants undergo progressive in vivo remodeling, facilitating the regeneration of histologically normal tissue through a mild inflammatory and progenitor cell response. Regeneration of normal tissue is especially important in a wound environment, and these findings warrant further investigation of PriMatrix in this setting. PMID:23970899

Cellular response to a novel fetal acellular collagen matrix: implications for tissue regeneration.

PubMed

Rennert, Robert C; Sorkin, Michael; Garg, Ravi K; Januszyk, Michael; Gurtner, Geoffrey C

2013-01-01

Introduction. PriMatrix (TEI Biosciences Inc., Boston, MA, USA) is a novel acellular collagen matrix derived from fetal bovine dermis that is designed for use in partial- and full-thickness wounds. This study analyzes the cellular response to PriMatrix in vivo, as well as the ability of this matrix to facilitate normal tissue regeneration. Methods. Five by five mm squares of rehydrated PriMatrix were implanted in a subcutaneous fashion on the dorsum of wild-type mice. Implant site tissue was harvested for histology, immunohistochemistry (IHC), and flow cytometric analyses at multiple time points until day 28. Results. PriMatrix implants were found to go through a biological progression initiated by a transient infiltrate of inflammatory cells, followed by mesenchymal cell recruitment and vascular development. IHC analysis revealed that the majority of the implanted fetal dermal collagen fibers persisted through day 28 but underwent remodeling and cellular repopulation to form tissue with a density and morphology consistent with healthy dermis. Conclusions. PriMatrix implants undergo progressive in vivo remodeling, facilitating the regeneration of histologically normal tissue through a mild inflammatory and progenitor cell response. Regeneration of normal tissue is especially important in a wound environment, and these findings warrant further investigation of PriMatrix in this setting.

Articular cartilage tissue engineering: the role of signaling molecules

PubMed Central

Kwon, Heenam; Paschos, Nikolaos K.; Hu, Jerry C.; Athanasiou, Kyriacos

2017-01-01

Effective early disease modifying options for osteoarthritis remain lacking. Tissue engineering approach to generate cartilage in vitro has emerged as a promising option for articular cartilage repair and regeneration. Signaling molecules and matrix modifying agents, derived from knowledge of cartilage development and homeostasis, have been used as biochemical stimuli toward cartilage tissue engineering and have led to improvements in the functionality of engineered cartilage. Clinical translation of neocartilage faces challenges, such as phenotypic instability of the engineered cartilage, poor integration, inflammation, and catabolic factors in the arthritic environment; these can all contribute to failure of implanted neocartilage. A comprehensive understanding of signaling molecules involved in osteoarthritis pathogenesis and their actions on engineered cartilage will be crucial. Thus, while it is important to continue deriving inspiration from cartilage development and homeostasis, it has become increasing necessary to incorporate knowledge from osteoarthritis pathogenesis into cartilage tissue engineering. PMID:26811234

Facilitated receptor-recognition and enhanced bioactivity of bone morphogenetic protein-2 on magnesium-substituted hydroxyapatite surface

PubMed Central

Huang, Baolin; Yuan, Yuan; Li, Tong; Ding, Sai; Zhang, Wenjing; Gu, Yuantong; Liu, Changsheng

2016-01-01

Biomaterial surface functionalized with bone morphogenetic protein-2 (BMP-2) is a promising approach to fabricating successful orthopedic implants/scaffolds. However, the bioactivity of BMP-2 on material surfaces is still far from satisfactory and the mechanism of related protein-surface interaction remains elusive. Based on the most widely used bone-implants/scaffolds material, hydroxyapatite (HAP), we developed a matrix of magnesium-substituted HAP (Mg-HAP, 2.2 at% substitution) to address these issues. Further, we investigated the adsorption dynamics, BMPRs-recruitment, and bioactivity of recombinant human BMP-2 (rhBMP-2) on the HAP and Mg-HAP surfaces. To elucidate the mechanism, molecular dynamic simulations were performed to calculate the preferred orientations, conformation changes, and cysteine-knot stabilities of adsorbed BMP-2 molecules. The results showed that rhBMP-2 on the Mg-HAP surface exhibited greater bioactivity, evidenced by more facilitated BMPRs-recognition and higher ALP activity than on the HAP surface. Moreover, molecular simulations indicated that BMP-2 favoured distinct side-on orientations on the HAP and Mg-HAP surfaces. Intriguingly, BMP-2 on the Mg-HAP surface largely preserved the active protein structure evidenced by more stable cysteine-knots than on the HAP surface. These findings explicitly clarify the mechanism of BMP-2-HAP/Mg-HAP interactions and highlight the promising application of Mg-HAP/BMP-2 matrixes in bone regeneration implants/scaffolds. PMID:27075233

Facilitated receptor-recognition and enhanced bioactivity of bone morphogenetic protein-2 on magnesium-substituted hydroxyapatite surface

NASA Astrophysics Data System (ADS)

Huang, Baolin; Yuan, Yuan; Li, Tong; Ding, Sai; Zhang, Wenjing; Gu, Yuantong; Liu, Changsheng

2016-04-01

Biomaterial surface functionalized with bone morphogenetic protein-2 (BMP-2) is a promising approach to fabricating successful orthopedic implants/scaffolds. However, the bioactivity of BMP-2 on material surfaces is still far from satisfactory and the mechanism of related protein-surface interaction remains elusive. Based on the most widely used bone-implants/scaffolds material, hydroxyapatite (HAP), we developed a matrix of magnesium-substituted HAP (Mg-HAP, 2.2 at% substitution) to address these issues. Further, we investigated the adsorption dynamics, BMPRs-recruitment, and bioactivity of recombinant human BMP-2 (rhBMP-2) on the HAP and Mg-HAP surfaces. To elucidate the mechanism, molecular dynamic simulations were performed to calculate the preferred orientations, conformation changes, and cysteine-knot stabilities of adsorbed BMP-2 molecules. The results showed that rhBMP-2 on the Mg-HAP surface exhibited greater bioactivity, evidenced by more facilitated BMPRs-recognition and higher ALP activity than on the HAP surface. Moreover, molecular simulations indicated that BMP-2 favoured distinct side-on orientations on the HAP and Mg-HAP surfaces. Intriguingly, BMP-2 on the Mg-HAP surface largely preserved the active protein structure evidenced by more stable cysteine-knots than on the HAP surface. These findings explicitly clarify the mechanism of BMP-2-HAP/Mg-HAP interactions and highlight the promising application of Mg-HAP/BMP-2 matrixes in bone regeneration implants/scaffolds.

Lumbar spine intervertebral disc gene delivery: a pilot study in lewis rats.

PubMed

Damle, Sheela R; Rawlins, Bernard A; Boachie-Adjei, Oheneba; Crystal, Ronald G; Hidaka, Chisa; Cunningham, Matthew E

2013-02-01

Basic research toward understanding and treating disc pathology in the spine has utilized numerous animal models, with delivery of small molecules, purified factors, and genes of interest. To date, gene delivery to the rat lumbar spine has only been described utilizing genetically programmed cells in a matrix which has required partial disc excision, and expected limitation of treatment diffusion into the disc. This study was designed to develop and describe a surgical technique for lumbar spine exposure and disc space preparation, and use of a matrix-free method for gene delivery. Naïve or genetically programmed isogeneic bone marrow stromal cells were surgically delivered to adolescent male Lewis rat lumbar discs, and utilizing quantitative biochemical and qualitative immunohistological assessments, the implanted cells were detected 3 days post-procedure. Statistically significant differences were noted for recovery of the β-galactosidase marker gene comparing delivery of naïve or labeled cells (10(5) cells per disc) from the site of implantation, and between delivery of 10(5) or 10(6) labeled cells per disc at the site of implantation and the adjacent vertebral body. Immunohistology confirmed that the β-galactosidase marker was detected in the adjacent vertebra bone in the zone of surgical implantation. The model requires further testing in larger cohorts and with biologically active genes of interest, but the observations from the pilot experiments are very encouraging that this will be a useful comparative model for basic spine research involving gene or cell delivery, or other locally delivered therapies to the intervertebral disc or adjacent vertebral bodies in rats.

Full-Thickness Skin Wound Healing Using Human Placenta-Derived Extracellular Matrix Containing Bioactive Molecules

PubMed Central

Choi, Ji Suk; Kim, Jae Dong; Yoon, Hyun Soo

2013-01-01

The human placenta, a complex organ, which facilitates exchange between the fetus and the mother, contains abundant extracellular matrix (ECM) components and well-preserved endogenous growth factors. In this study, we designed a new dermal substitute from human placentas for full-thickness wound healing. Highly porous, decellularized ECM sheets were fabricated from human placentas via homogenization, centrifugation, chemical and enzymatic treatments, molding, and freeze-drying. The physical structure and biological composition of human placenta-derived ECM sheets dramatically supported the regeneration of full-thickness wound in vivo. At the early stage, the ECM sheet efficiently absorbed wound exudates and tightly attached to the wound surface. Four weeks after implantation, the wound was completely closed, epidermic cells were well arranged and the bilayer structure of the epidermis and dermis was restored. Moreover, hair follicles and microvessels were newly formed in the ECM sheet-implanted wounds. Overall, the ECM sheet produced a dermal substitute with similar cellular organization to that of normal skin. These results suggest that human placenta-derived ECM sheets provide a microenvironment favorable to the growth and differentiation of cells, and positive modulate the healing of full-thickness wounds. PMID:22891853

Kinetics and mechanism of release from glyceryl monostearate-based implants: evaluation of release in a gel simulating in vivo implantation.

PubMed

Allababidi, S; Shah, J C

1998-06-01

The overall objective of the study was to design an implantable delivery system based on glyceryl monostearate (GMS) for the site-specific delivery of antibiotics for the prevention of surgical wound infection. To design the implant, a release method had to be developed that simulate the in vivo implantation conditions to be able to predict the release characteristics from the implants when they are actually used in vivo. Also, identifying the release kinetics and mechanism and evaluating the factors that influence the release of drugs from the GMS-based matrix were necessary to allow further design of implants that could yield a desired release rate. The release of cefazolin was monitored from GMS matrixes implanted into agar gel, simulating subcutaneous tissues with respect to viscosity and water content. The gel method resulted in observation of spatial and temporal concentration profiles in the immediate vicinity of the implants, indicating the benefits of local drug delivery; however, there was no significant difference between the cumulative release profiles by the gel method or the vial release method. The release of cefazolin from the GMS-based matrix with the vial method followed Higuchi's square root of time kinetics. The release rate was found to be directly proportional to cefazolin load (A) and the surface area (SA) of the matrix as expressed by the following equation: = 0.24ASA. On the basis of this equation, one can design a variety of GMS matrixes that would result in a desired release rate or release duration. This also indicated that cefazolin release followed the release kinetics of a freely soluble drug from an insoluble matrix and hence it is a diffusion-controlled process. The effect of drug solubility on the release kinetics was determined by comparing the release kinetics of the poorly water soluble ciprofloxacin (0.16 mg/mL) to that of the highly water soluble cefazolin (325 mg/mL). The release duration of ciprofloxacin (80 h) was longer than that of cefazolin (25 h) from identical GMS matrixes. Although ciprofloxacin release was initially controlled by the matrix, agitation accelerated disintegration of the matrix and release due to its poor solubility, and ciprofloxacin release appeared to be a dissolution-controlled process following zero-order release kinetics.

In vivo and in vitro investigations of a nanostructured coating material – a preclinical study

PubMed Central

Adam, Martin; Ganz, Cornelia; Xu, Weiguo; Sarajian, Hamid-Reza; Götz, Werner; Gerber, Thomas

2014-01-01

Immediate loading of dental implants is only possible if a firm bone-implant anchorage at early stages is developed. This implies early and high bone apposition onto the implant surface. A nanostructured coating material based on an osseoinductive bone grafting is investigated in relation to the osseointegration at early stages. The goal is to transmit the structure (silica matrix with embedded hydroxyapatite) and the properties of the bone grafting into a coating material. The bone grafting substitute offers an osseoinductive potential caused by an exchange of the silica matrix in vivo accompanied by vascularization. X-ray diffraction and transmission electron microscopy analysis show that the coating material consists of a high porous silica matrix with embedded nanocrystalline hydroxyapatite with the same morphology as human hydroxyapatite. An in vitro investigation shows the early interaction between coating and human blood. Energy-dispersive X-ray analysis showed that the silica matrix was replaced by an organic matrix within a few minutes. Uncoated and coated titanium implants were inserted into the femora of New Zealand White rabbits. The bone-to-implant contact (BIC) was measured after 2, 4, and 6 weeks. The BIC of the coated implants was increased significantly at 2 and 4 weeks. After 6 weeks, the BIC was decreased to the level of the control group. A histological analysis revealed high bone apposition on the coated implant surface after 2 and 4 weeks. Osteoblastic and osteoclastic activities on the coating material indicated that the coating participates in the bone-remodeling process. The nanostructure of the coating material led to an exchange of the silica matrix by an autologous, organic matrix without delamination of the coating. This is the key issue in understanding initial bone formation on a coated surface. PMID:24627631

Bone Formation is Affected by Matrix Advanced Glycation End Products (AGEs) In Vivo.

PubMed

Yang, Xiao; Mostafa, Ahmed Jenan; Appleford, Mark; Sun, Lian-Wen; Wang, Xiaodu

2016-10-01

Advanced glycation end products (AGEs) accumulate in bone extracellular matrix as people age. Although previous evidence shows that the accumulation of AGEs in bone matrix may impose significant effects on bone cells, the effect of matrix AGEs on bone formation in vivo is still poorly understood. To address this issue, this study used a unique rat model with autograft implant to investigate the in vivo response of bone formation to matrix AGEs. Fluorochrome biomarkers were sequentially injected into rats to label the dynamic bone formation in the presence of elevated levels of matrix AGEs. After sacrificing animals, dynamic histomorphometry was performed to determine mineral apposition rate (MAR), mineralized surface per bone surface (MS/BS), and bone formation rate (BFR). Finally, nanoindentation tests were performed to assess mechanical properties of newly formed bone tissues. The results showed that MAR, MS/BS, and BFR were significantly reduced in the vicinity of implant cores with high concentration of matrix AGEs, suggesting that bone formation activities by osteoblasts were suppressed in the presence of elevated matrix AGEs. In addition, MAR and BFR were found to be dependent on the surrounding environment of implant cores (i.e., cortical or trabecular tissues). Moreover, MS/BS and BFR were also dependent on how far the implant cores were away from the growth plate. These observations suggest that the effect of matrix AGEs on bone formation is dependent on the biological milieu around the implants. Finally, nanoindentation test results indicated that the indentation modulus and hardness of newly formed bone tissues were not affected by the presence of elevated matrix AGEs. In summary, high concentration of matrix AGEs may slow down the bone formation process in vivo, while imposing little effects on bone mineralization.

Abnormal bone formation induced by implantation of osteosarcoma-derived bone-inducing substance in the X-linked hypophosphatemic mouse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, H.; Masuhara, K.; Takaoka, K.

1985-01-01

The X-linked hypophosphatemic mouse (Hyp) has been proposed as a model for the human familial hypophosphatemia (the most common form of vitamin D-resistant rickets). An osteosarcoma-derived bone-inducing substance was subcutaneously implanted into the Hyp mouse. The implant was consistently replaced by cartilage tissue at 2 weeks after implantation. The cartilage matrix seemed to be normal, according to the histological examination, and 35sulphur (TVS) uptake was also normal. Up to 4 weeks after implantation the cartilage matrix was completely replaced by unmineralized bone matrix and hematopoietic bone marrow. Osteoid tissue arising from the implantation of bone inducing substance in the Hypmore » mouse showed no radiologic or histologic sign of calcification. These findings suggest that the abnormalities of endochondral ossification in the Hyp mouse might be characterized by the failure of mineralization in cartilage and bone matrix. Analysis of the effects of bone-inducing substance on the Hyp mouse may help to give greater insight into the mechanism and treatment of human familial hypophosphatemia.« less

Fumed silica nanoparticle mediated biomimicry for optimal cell-material interactions for artificial organ development.

PubMed

de Mel, Achala; Ramesh, Bala; Scurr, David J; Alexander, Morgan R; Hamilton, George; Birchall, Martin; Seifalian, Alexander M

2014-03-01

Replacement of irreversibly damaged organs due to chronic disease, with suitable tissue engineered implants is now a familiar area of interest to clinicians and multidisciplinary scientists. Ideal tissue engineering approaches require scaffolds to be tailor made to mimic physiological environments of interest with specific surface topographical and biological properties for optimal cell-material interactions. This study demonstrates a single-step procedure for inducing biomimicry in a novel nanocomposite base material scaffold, to re-create the extracellular matrix, which is required for stem cell integration and differentiation to mature cells. Fumed silica nanoparticle mediated procedure of scaffold functionalization, can be potentially adapted with multiple bioactive molecules to induce cellular biomimicry, in the development human organs. The proposed nanocomposite materials already in patients for number of implants, including world first synthetic trachea, tear ducts and vascular bypass graft. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The cost effectiveness of acellular dermal matrix in expander-implant immediate breast reconstruction.

PubMed

Krishnan, Naveen M; Chatterjee, Abhishek; Rosenkranz, Kari M; Powell, Stephen G; Nigriny, John F; Vidal, Dale C

2014-04-01

Expander-implant breast reconstruction is often supplemented with acellular dermal matrix (ADM). The use of acellular dermal matrix has allowed for faster, less painful expansions and improved aesthetics, but with increased cost. Our goal was to provide the first cost utility analysis of using acellular dermal matrix in two-stage, expander-implant immediate breast reconstruction following mastectomy. A comprehensive literature review was conducted to identify complication rates for two-stage, expander-implant immediate breast reconstruction with and without acellular dermal matrix. The probabilities of the most common complications were combined with Medicare Current Procedural Terminology reimbursement codes and expert utility estimates to fit into a decision model. The decision model evaluated the cost effectiveness of acellular dermal matrix relative to reconstructions without it. Retail costs for ADM were derived from the LifeCell 2012 company catalogue for Alloderm. The overall complication rates were 30% and 34.5% with and without ADM. The decision model revealed a baseline cost increase of $361.96 when acellular dermal matrix is used. The increase in Quality-Adjusted Life Years (QALYs) is 1.37 in the population with acellular dermal matrix. This yields a cost effective incremental cost-utility ratio (ICUR) of $264.20/QALY. Univariate sensitivity analysis confirmed that using acellular dermal matrix is cost effective even when using retail costs for unilateral and bilateral reconstructions. Our study shows that, despite an increased cost, acellular dermal matrix is a cost effective technology for patients undergoing two-stage, expander-implant immediate breast reconstruction due to its increased utility in successful procedures. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Surface modification of implants in long bone.

PubMed

Förster, Yvonne; Rentsch, Claudia; Schneiders, Wolfgang; Bernhardt, Ricardo; Simon, Jan C; Worch, Hartmut; Rammelt, Stefan

2012-01-01

Coatings of orthopedic implants are investigated to improve the osteoinductive and osteoconductive properties of the implant surfaces and thus to enhance periimplant bone formation. By applying coatings that mimic the extracellular matrix a favorable environment for osteoblasts, osteoclasts and their progenitor cells is provided to promote early and strong fixation of implants. It is known that the early bone ongrowth increases primary implant fixation and reduces the risk of implant failure. This review presents an overview of coating titanium and hydroxyapatite implants with components of the extracellular matrix like collagen type I, chondroitin sulfate and RGD peptide in different small and large animal models. The influence of these components on cells, the inflammation process, new bone formation and bone/implant contact is summarized.

Surface modification of implants in long bone

PubMed Central

Förster, Yvonne; Rentsch, Claudia; Schneiders, Wolfgang; Bernhardt, Ricardo; Simon, Jan C.; Worch, Hartmut; Rammelt, Stefan

2012-01-01

Coatings of orthopedic implants are investigated to improve the osteoinductive and osteoconductive properties of the implant surfaces and thus to enhance periimplant bone formation. By applying coatings that mimic the extracellular matrix a favorable environment for osteoblasts, osteoclasts and their progenitor cells is provided to promote early and strong fixation of implants. It is known that the early bone ongrowth increases primary implant fixation and reduces the risk of implant failure. This review presents an overview of coating titanium and hydroxyapatite implants with components of the extracellular matrix like collagen type I, chondroitin sulfate and RGD peptide in different small and large animal models. The influence of these components on cells, the inflammation process, new bone formation and bone/implant contact is summarized. PMID:23507866

What happens to an acellular dermal matrix after implantation in the human body? A histological and electron microscopic study.

PubMed

Boháč, Martin; Danišovič, Ľuboš; Koller, Ján; Dragúňová, Jana; Varga, Ivan

2018-01-22

Acellular matrices are used for various purposes and they have been studied extensively for their potential roles in regenerating tissues or organs. The acellular matrix generates physiological cues that mimic the native tissue microenvironment. Acellular dermal matrix (ADM) is a soft connective tissue graft generated by a decellularization process that preserves the intact extracellular skin matrix. Upon implantation, this structure serves as a scaffold for donor-side cells to facilitate subsequent incorporation and revascularization. In breast reconstruction, ADM is used mainly for lower pole coverage and the shaping of a new breast. It helps control the positioning of the implant in the inframammary fold, and prevent the formation of contractile pseudocapsule around the breast implant. In this study, we provide a comprehensive histological description of ADM used for human breast reconstruction over the course of several months following implementation. Using immunohistochemical methods (a panel of 12 antibodies) coupled with optical and transmission electron microscopy, we confirmed that the original acellular dermal matrix became recolonized by fibroblasts and myofibroblasts, and also by various other free cells of the connective tissue (lymphocytes, macrophages and multinucleated giant cells, granulocytes, mast cells) after implantation into the patient's body. Within the implanted ADM, there was a relatively rapid ingrowth of blood vessels. Lymphatic vessels were only detected in one case 9 months after the implantation of the ADM. These results suggest that lymphangiogenesis is a longer process than angiogenesis.

Costimulatory molecule expression following exposure to orthopaedic implants wear debris.

PubMed

Bainbridge, J A; Revell, P A; Al-Saffar, N

2001-03-05

Patients with long-term orthopedic implants may develop inflammatory reactions due to the accumulation of biomaterial particles both around the implant and in distant organs. The exact impact of these particles on the normal immune cell function still remain relatively unclear. Activation of T-cells following exposure to biomaterial particles is driven by macrophages and requires synergistic signals primed by both antigen presentation and costimulation. The pattern of costimulatory molecule expression (CD80,CD86) was primarily examined using immunohistochemistry on tissue specimens of bone/implant interface membranes taken from sites of bone erosion. Additionally, costimulatory molecule expression was also assessed in the monocytic leukemia cell line U937 following exposure to clinically relevant titanium aluminum vanadium (TiAlV) and stainless steel particles (FeCrNi) cultured in vitro. This study demonstrates the induction and prominent expression of CD86 on almost all macrophage subsets at the bone/implant interface, including fused forms and large multinucleated giant cells (MNGC). In vitro analysis also indicated phagocytosis of metal particles by differentiated U937 caused significant induction of both CD80 and CD86 (p < 0.01), although the expression of CD86 dominated following prolonged exposure. The data presented highlights that CD86 is the predominant costimulatory molecule ligating to the complementary CD28 molecule at the inflammatory lesion of the interface. We propose that the intracellular presence of indigestible implant material, in addition to elevated costimulatory molecule expression, may promote T-cell inflammatory reactions at sites close to and distant from the orthopedic implant.

Assessment of the Speech Intelligibility Performance of Post Lingual Cochlear Implant Users at Different Signal-to-Noise Ratios Using the Turkish Matrix Test.

PubMed

Polat, Zahra; Bulut, Erdoğan; Ataş, Ahmet

2016-09-01

Spoken word recognition and speech perception tests in quiet are being used as a routine in assessment of the benefit which children and adult cochlear implant users receive from their devices. Cochlear implant users generally demonstrate high level performances in these test materials as they are able to achieve high level speech perception ability in quiet situations. Although these test materials provide valuable information regarding Cochlear Implant (CI) users' performances in optimal listening conditions, they do not give realistic information regarding performances in adverse listening conditions, which is the case in the everyday environment. The aim of this study was to assess the speech intelligibility performance of post lingual CI users in the presence of noise at different signal-to-noise ratio with the Matrix Test developed for Turkish language. Cross-sectional study. The thirty post lingual implant user adult subjects, who had been using implants for a minimum of one year, were evaluated with Turkish Matrix test. Subjects' speech intelligibility was measured using the adaptive and non-adaptive Matrix Test in quiet and noisy environments. The results of the study show a correlation between Pure Tone Average (PTA) values of the subjects and Matrix test Speech Reception Threshold (SRT) values in the quiet. Hence, it is possible to asses PTA values of CI users using the Matrix Test also. However, no correlations were found between Matrix SRT values in the quiet and Matrix SRT values in noise. Similarly, the correlation between PTA values and intelligibility scores in noise was also not significant. Therefore, it may not be possible to assess the intelligibility performance of CI users using test batteries performed in quiet conditions. The Matrix Test can be used to assess the benefit of CI users from their systems in everyday life, since it is possible to perform intelligibility test with the Matrix test using a material that CI users experience in their everyday life and it is possible to assess their difficulty in speech discrimination in noisy conditions they have to cope with.

Copper retention, calcium release and ultrastructural evidence indicate specific Cuprolinic Blue uptake and peculiar modifications in mineralizing aortic valves.

PubMed

Ortolani, F; Tubaro, F; Petrelli, L; Gandaglia, A; Spina, M; Marchini, M

2002-01-01

Previously, reactions with copper phthalocyanines at 0.05 M critical electrolyte concentration were found to cause demineralization in calcifying porcine aortic valves after subdermal implantation in rat, as well as simultaneous visualization of peculiar phthalocyanine-positive layers around cells and cell-derived matrix vesicles. In the present investigation, an appraisal was made of the mechanism and specificity of reactions with Cuprolinic Blue by comparing quantitatively calcium release and copper retention by calcified aortic valves reacted with this phthalocyanine under different critical electrolyte concentration conditions, and the corresponding ultrastructural patterns. It was found that (i) decalcifying properties are inversely proportional to salt molarity; (ii) reactivity to Cuprolinic Blue is critical electrolyte concentration-dependent, since the greatest copper retention occurred in 0.05 M critical electrolyte concentration Cuprolinic Blue-reacted samples, the only ones that also exhibited phthalocyanine-positive layers; (iii) the appearance of phthalocyanine-positive layers depends on Cuprolinic Blue uptake, revealing pericellular clustering of calcium-binding, anionic molecules; and (iv) minor Cuprolinic Blue uptake occurs by residual proteoglycans which still remain in the extracellular matrix after 6-week-long subdermal implantation. The present results indicate that this method is appropriate for the study of mineralized tissues and illustrate peculiar tissue modifications occurring at least in the experimental conditions used here.

Third generation biosensing matrix based on Fe-implanted ZnO thin film

NASA Astrophysics Data System (ADS)

Saha, Shibu; Gupta, Vinay; Sreenivas, K.; Tan, H. H.; Jagadish, C.

2010-09-01

Third generation biosensor based on Fe-implanted ZnO (Fe-ZnO) thin film has been demonstrated. Implantation of Fe in rf-sputtered ZnO thin film introduces redox center along with shallow donor level and thereby enhance its electron transfer property. Glucose oxidase (GOx), chosen as model enzyme, has been immobilized on the surface of the matrix. Cyclic voltammetry and photometric assay show that the prepared bioelectrode, GOx/Fe-ZnO/ITO/Glass is sensitive to the glucose concentration with enhanced response of 0.326 μA mM-1 cm-2 and low Km of 2.76 mM. The results show promising application of Fe-implanted ZnO thin film as an attractive matrix for third generation biosensing.

Enhancement of matrix metalloproteinases 2 and 9 accompanied with neurogenesis following collagen glycosaminoglycan matrix implantation after surgical brain injury.

PubMed

Hsu, Wei-Cherng; Yu, Chun-Hsien; Kung, Woon-Man; Huang, Kuo-Feng

2018-06-01

Surgical brain injury may result in irreversible neurological deficits. Our previous report showed that partial regeneration of a traumatic brain lesion is achieved by implantation of collagen glycosaminoglycan (CGM). Matrix metalloproteinases (MMPs) may play an important role in neurogenesis but there is currently a lack of studies displaying the relationship between the stimulation of MMPs and neurogenesis after collagen glycosaminoglycan implantation following surgical brain trauma. The present study was carried out to further examine the expression of MMP2 and MMP9 after implantation of collagen glycosaminoglycan (CGM) following surgical brain trauma. Using the animal model of surgically induced brain lesion, we implanted CGM into the surgical trauma. Rats were thus divided into three groups: (1) sham operation group: craniotomy only; (2) lesion (L) group: craniotomy + surgical trauma lesion; (3) lesion + CGM (L + CGM) group: CGM implanted following craniotomy and surgical trauma lesion. Cells positive for SOX2 (marker of proliferating neural progenitor cells) and matrix metalloproteinases (MMP2 and MMP9) in the lesion boundary zone were assayed and analyzed by immunofluorescence and ELISA commercial kits, respectively. Our results demonstrated that following implantation of CGM after surgical brain trauma, significant increases in MMP2 + /SOX2 + cells and MMP9 + /SOX2 + cells were seen within the lesion boundary zone in the L + CGM group. Tissue protein concentrations of MMP2 and MMP9 also increased after CGM scaffold implantation. These findings suggest that implantation of a CGM scaffold alone after surgical brain trauma can enhance the expression of MMP2 and MMP9 accompanied by neurogenesis.

Gelatin device for the delivery of growth factors involved in endochondral ossification.

PubMed

Ahrens, Lucas A J; Vonwil, Daniel; Christensen, Jon; Shastri, V Prasad

2017-01-01

Controlled release drug delivery systems are well established as oral and implantable dosage forms. However, the controlled release paradigm can also be used to present complex soluble signals responsible for cellular organization during development. Endochondral ossification (EO), the developmental process of bone formation from a cartilage matrix is controlled by several soluble signals with distinct functions that vary in structure, molecular weight and stability. This makes delivering them from a single vehicle rather challenging. Herein, a gelatin-based delivery system suitable for the delivery of small molecules as well as recombinant human (rh) proteins (rhWNT3A, rhFGF2, rhVEGF, rhBMP4) is reported. The release behavior and biological activity of the released molecules was validated using analytical and biological assays, including cell reporter systems. The simplicity of fabrication of the gelatin device should foster its adaptation by the diverse scientific community interested in interrogating developmental processes, in vivo.

Gelatin device for the delivery of growth factors involved in endochondral ossification

PubMed Central

Ahrens, Lucas A. J.; Vonwil, Daniel; Christensen, Jon

2017-01-01

Controlled release drug delivery systems are well established as oral and implantable dosage forms. However, the controlled release paradigm can also be used to present complex soluble signals responsible for cellular organization during development. Endochondral ossification (EO), the developmental process of bone formation from a cartilage matrix is controlled by several soluble signals with distinct functions that vary in structure, molecular weight and stability. This makes delivering them from a single vehicle rather challenging. Herein, a gelatin-based delivery system suitable for the delivery of small molecules as well as recombinant human (rh) proteins (rhWNT3A, rhFGF2, rhVEGF, rhBMP4) is reported. The release behavior and biological activity of the released molecules was validated using analytical and biological assays, including cell reporter systems. The simplicity of fabrication of the gelatin device should foster its adaptation by the diverse scientific community interested in interrogating developmental processes, in vivo. PMID:28380024

Inflammatory and immunological aspects of dental pulp repair

PubMed Central

Goldberg, Michel; Farges, Jean-Christophe; Lacerda-Pinheiro, Sally; Six, Ngampis; Jegat, Nadège; Decup, Frank; Septier, Dominique; Carrouel, Florence; Durand, Stéphanie; Chaussain-Miller, Catherine; DenBesten, Pamela; Veis, Arthur; Poliard, Anne

2010-01-01

The repair of dental pulp by direct capping with calcium hydroxide or by implantation of bioactive extracellular matrix (ECM) molecules implies a cascade of four steps: a moderate inflammation, the commitment of adult reserve stem cells, their proliferation and terminal differentiation. The link between the initial inflammation and cell commitment is not yet well established but appears as a potential key factor in the reparative process. Either the release of cytokines due to inflammatory events activates resident stem (progenitor) cells, or inflammatory cells or pulp fibroblasts undergo a phenotypic conversion into osteoblast/odontoblast-like progenitors implicated in reparative dentin formation. Activation of antigen-presenting dendritic cells by mild inflammatory processes may also promote osteoblast/odontoblast-like differentiation and expression of ECM molecules implicated in mineralization. Recognition of bacteria by specific odontoblast and fibroblast membrane receptors triggers an inflammatory and immune response within the pulp tissue that would also modulate the repair process. PMID:18602009

Upregulation of BMSCs Osteogenesis by Positively-Charged Tertiary Amines on Polymeric Implants via Charge/iNOS Signaling Pathway

PubMed Central

Zhang, Wei; Liu, Na; Shi, Haigang; Liu, Jun; Shi, Lianxin; Zhang, Bo; Wang, Huaiyu; Ji, Junhui; Chu, Paul K.

2015-01-01

Positively-charged surfaces on implants have a similar potential to upregulate osteogenesis of bone marrow-derived mesenchymal stem cells (BMSCs) as electromagnetic therapy approved for bone regeneration. Generally, their osteogenesis functions are generally considered to stem from the charge-induced adhesion of extracellular matrix (ECM) proteins without exploring the underlying surface charge/cell signaling molecule pathways. Herein, a positively-charged surface with controllable tertiary amines is produced on a polymer implant by plasma surface modification. In addition to inhibiting the TNF-α expression, the positively-charged surface with tertiary amines exhibits excellent cytocompatibility as well as remarkably upregulated osteogenesis-related gene/protein expressions and calcification of the contacted BMSCs. Stimulated by the charged surface, these BMSCs display high iNOS expressions among the three NOS isoforms. Meanwhile, downregulation of the iNOS by L-Can or siRNA inhibit osteogenic differentiation in the BMSCs. These findings suggest that a positively-charged surface with tertiary amines induces osteogenesis of BMSCs via the surface charge/iNOS signaling pathway in addition to elevated ECM protein adhesion. Therefore, creating a positively-charged surface with tertiary amines is a promising approach to promote osseointegration with bone tissues. PMID:25791957

Functionalizing graphene by embedded boron clusters

NASA Astrophysics Data System (ADS)

Quandt, Alexander; Özdoğan, Cem; Kunstmann, Jens; Fehske, Holger

2008-08-01

We present a model system that might serve as a blueprint for the controlled layout of graphene based nanodevices. The systems consists of chains of B7 clusters implanted in a graphene matrix, where the boron clusters are not directly connected. We show that the graphene matrix easily accepts these alternating B7-C6 chains and that the implanted boron components may dramatically modify the electronic properties of graphene based nanomaterials. This suggests a functionalization of graphene nanomaterials, where the semiconducting properties might be supplemented by parts of the graphene matrix itself, but the basic wiring will be provided by alternating chains of implanted boron clusters that connect these areas.

Custom Titanium Ridge Augmentation Matrix (CTRAM): A Case Report.

PubMed

Connors, Christopher A; Liacouras, Peter C; Grant, Gerald T

2016-01-01

This is a case report of a custom titanium ridge augmentation matrix (CTRAM). Using cone beam computed tomography (CBCT), a custom titanium space-maintaining device was developed. Alveolar ridges were virtually augmented, a matrix was virtually designed, and the CTRAM was additively manufactured with titanium (Ti6Al4V). Two cases are presented that resulted in sufficient increased horizontal bone volume with successful dental implant placement. The CTRAM design allows for preoperative planning for increasing alveolar ridge dimensions to support dental implants, reduces surgical time, and prevents the need for a second surgical site to gain sufficient alveolar ridge bone volume for dental implant therapy.

Reconstruction of attached soft tissue around dental implants by acelluar dermal matrix grafts and resin splint

PubMed Central

Liu, Changying; Su, Yucheng; Tan, Baosheng; Ma, Pan; Wu, Gaoyi; Li, Jun; Geng, Wei

2014-01-01

Objectives: The purpose of this study was to recommend a new method using acellular dermal matrix graft and resin splint to reconstruct the attached soft tissue around dental implants in patients with maxillofacial defects. Materials and methods: Total 8 patients (3 male and 5 female patients) diagnosed with maxillofacial defects and dentition defects caused by tumors, fractures or edentulous jaw, were selected for this study. Dental implants were routinely implanted at the edentulous area. Acellular dermal matrix heterografts and resin splint were used to increase the attached soft tissue. The width of attached gingiva in the labial or buccal surface at edentulous area was measured before surgical procedures and after the completion of superstructures. Paired t-test was applied to assess the change of quantitative variables. All tests were 2-tailed, and P < 0.05 was considered statistically significant. Results: The dense connective tissue around implants could be reconstructed one month after the completion of surgical procedures, and the epithelial cuff around the implant neck established very well. The width of attached gingival tissue in the patients increased significantly from a mean of 0.61 ± 0.75 mm to 6.25 ± 1.04 mm. The patients were fully satisfied with the esthetic and functional results achieved. Conclusions: The acellular dermal matrix graft could be used to increase the attached gingiva around dental implants in these patients with maxillofacial defects. The resin splint could facilitate the healing of graft. PMID:25663964

[Fusion implants of carbon fiber reinforced plastic].

PubMed

Früh, H J; Liebetrau, A; Bertagnoli, R

2002-05-01

Carbon fiber reinforced plastics (CFRP) are used in the medical field when high mechanical strength, innovative design, and radiolucency (see spinal fusion implants) are needed. During the manufacturing process of the material CFRP carbon fibers are embedded into a resin matrix. This resin material could be thermoset (e.g., epoxy resin EPN/DDS) or thermoplastic (e.g., PEAK). CFRP is biocompatible, radiolucent, and has higher mechanical capabilities compared to other implant materials. This publication demonstrates the manufacturing process of fusion implants made of a thermoset matrix system using a fiber winding process. The material has been used clinically since 1994 for fusion implants of the cervical and lumbar spine. The results of the fusion systems CORNERSTONE-SR C (cervical) and UNION (lumbar) showed no implant-related complications. New implant systems made of this CFRP material are under investigation and are presented.

Evaluating the feasibility of utilizing the small molecule phenamil as a novel biofactor for bone regenerative engineering.

PubMed

Lo, Kevin W-H; Ulery, Bret D; Kan, Ho Man; Ashe, Keshia M; Laurencin, Cato T

2014-09-01

Osteoblast cell adhesion and differentiation on biomaterials are important achievements necessary for implants to be useful in bone regenerative engineering. Recombinant bone morphogenetic proteins (BMPs) have been shown to be important for these processes; however, there are many challenges associated with the widespread use of these proteins. A recent report demonstrated that the small molecule phenamil, a diuretic derivative, was able to induce osteoblast differentiation and mineralization in vitro via the canonical BMP signalling cascade (Park et al., 2009). In this study, the feasibility of using phenamil as a novel biofactor in conjunction with a biodegradable poly(lactide-co-glycolide acid) (PLAGA) polymeric scaffold for engineering bone tissue was evaluated. The in vitro cellular behaviour of osteoblast-like MC3T3-E1 cells cultured on PLAGA scaffolds in the presence of phenamil at 10 μM were characterized with regard to initial cell adhesion, proliferation, alkaline phosphatase (ALP) activity and matrix mineralization. The results demonstrate that phenamil supported cell proliferation, promoted ALP activity and facilitated matrix mineralization of osteoblast-like MC3T3-E1 cells. Moreover, in this study, we found that phenamil promoted integrin-mediated cell adhesion on PLAGA scaffolds. It was also shown that phenamil encapsulated within porous, microsphere PLAGA scaffolds retained its osteogenic activity upon release. Based on these findings, the small molecule phenamil has the potential to serve as a novel biofactor for the repair and regeneration of bone tissues. Copyright © 2012 John Wiley & Sons, Ltd.

Matrix Vesicle Enzyme Activity and Phospholipid Content in Endosteal Bone Following Implantation of Osseointegrating and Non-Osseointegrating Implant Materials.

DTIC Science & Technology

1992-01-01

limb. The collected hemopoietic material was a combination of cells, fractured cell debris, and matrix vesicles. This material was utilized for the... dogs and rabbits (Deutscher et al., 1978; Fuchs et al., 1981), and the mandibles of humans (Bunte et al., 1977). Following surgical implantation, there...associated with mineralization in a number of additional normal and pathologic conditions, including cementum (Hayashi, 1985), fracture callus (Boskey et al

Immediate Implant-based Prepectoral Breast Reconstruction Using a Vertical Incision

PubMed Central

Lind, Jeffrey G.; Hopkins, Elizabeth G.

2015-01-01

Background: Ideally, breast reconstruction is performed at the time of mastectomy in a single stage with minimal scarring. However, postoperative complications with direct-to-implant subpectoral reconstruction remain significant. These include asymmetry, flap necrosis, animation deformity, and discomfort. We report on a series of patients who have undergone immediate single-stage prepectoral, implant-based breast reconstruction with a smooth, adjustable saline implant covered with mesh/acellular dermal matrix for support using a vertical mastectomy incision. This technique, when combined with an adjustable implant, addresses the complications related to subpectoral implant placement of traditional expanders. Our follow-up time, 4.6 years (55 months), shows a low risk of implant loss and elimination of animation deformity while also providing patients with a safe and aesthetically pleasing result. Methods: All patients who underwent immediate implant-based prepectoral breast reconstruction using a vertical mastectomy incision as a single-staged procedure were included. Charts were reviewed retrospectively. Adjustable smooth round saline implants and mesh/acellular dermal matrix were used for fixation in all cases. Results: Thirty-one patients (62 breasts) underwent single-staged implant-based prepectoral breast reconstruction using a vertical mastectomy incision. Postoperative complications occurred in 9 patients, 6 of which were resolved with postoperative intervention while only 2 cases resulted in implant loss. Conclusions: There can be significant morbidity associated with traditional subpectoral implant-based breast reconstruction. As an alternative, the results of this study show that an immediate single-stage prepectoral breast reconstruction with a smooth saline adjustable implant, using a vertical incision, in conjunction with mesh/matrix support can be performed with excellent aesthetic outcomes and minimal complications. PMID:26180713

Optima HD Imax: Molecular Implant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tieger, D. R.; Splinter, P. R.; Hsieh, T. J.

2008-11-03

Molecular implantation offers semiconductor device manufacturers multiple advantages over traditional high current ion implanters. The dose multiplication due to implanting more than one atom per molecule and the transport of beams at higher energies relative to the effective particle energies result in significant throughput enhancements without risk of energy contamination. The Optima HD Imax is introduced with molecular implant capability and the ability to reach up to 4.2 keV effective {sup 11}B from octadecaborane (B{sub 18}H{sub 22}). The ion source and beamline are optimized for molecular species ionization and transport. The beamline is coupled to the Optima HD mechanically scannedmore » endstation. The use of spot beam technology with ionized molecules maximizes the throughput potential and produces uniform implants with fast setup time and with superior angle control. The implanter architecture is designed to run multiple molecular species; for example, in addition to B{sub 18}H{sub 22} the system is capable of implanting carbon molecules for strain engineering and shallow junction engineering. Source lifetime data and typical operating conditions are described both for high dose, memory applications such as dual poly gate as well as lower energy implants for source drain extension and contact implants. Throughputs have been achieved in excess of 50 wafers per hour at doses up to 1x10{sup 16} ions/cm{sup 2} and for energies as low as 1 keV.« less

Effect of a freeze-dried CMC/PLGA microsphere matrix of rhBMP-2 on bone healing.

PubMed

Schrier, J A; Fink, B F; Rodgers, J B; Vasconez, H C; DeLuca, P P

2001-10-07

The hypothesis of this research was that implants of poly(lactide-co-glycolide) (PLGA) microspheres loaded with bone morphogenetic protein-2 (rhBMP-2) and distributed in a freeze-dried carboxymethylcellulose (CMC) matrix would produce more new bone than would matrix implants of non-protein-loaded microspheres or matrix implants of only CMC. To test this hypothesis it was necessary to fashion microsphere-loaded CMC implants that were simple to insert, fit precisely into a defect, and would not elicit swelling. Microspheres were produced via a water-in-oil-in-water double-emulsion system and were loaded with rhBMP-2 by soaking them in a buffered solution of the protein at a concentration of 5.4 mg protein per gram of PLGA. Following recovery of the loaded microspheres by lyophilization, matrices for implantation were prepared by lyophilizing a suspension of the microspheres in 2% CMC in flat-bottom tissue culture plates. Similar matrices were made with 2% CMC and with 2% CMC containing blank microspheres. A full-thickness calvarial defect model in New Zealand white rabbits was used to assess bone growth. Implants fit the defect well, allowing for direct application. Six weeks postsurgery, defects were collected and processed for undecalcified histology. In vitro, 60% of the loaded rhBMP-2 released from devices or microspheres in 5 to 7 days, with the unembedded microspheres releasing faster than those embedded in CMC. In vivo, the rhBMP-2 microspheres greatly enhanced bone healing, whereas nonloaded PLGA microspheres in the CMC implants had little effect. The results showed that a lyophilized device of rhBMP-2/PLGA microspheres in CMC was an effective implantable protein-delivery system for use in bone repair.

Decellularized Diaphragmatic Muscle Drives a Constructive Angiogenic Response In Vivo.

PubMed

Alvarèz Fallas, Mario Enrique; Piccoli, Martina; Franzin, Chiara; Sgrò, Alberto; Dedja, Arben; Urbani, Luca; Bertin, Enrica; Trevisan, Caterina; Gamba, Piergiorgio; Burns, Alan J; De Coppi, Paolo; Pozzobon, Michela

2018-04-28

Skeletal muscle tissue engineering (TE) aims to efficiently repair large congenital and acquired defects. Biological acellular scaffolds are considered a good tool for TE, as decellularization allows structural preservation of tissue extracellular matrix (ECM) and conservation of its unique cytokine reservoir and the ability to support angiogenesis, cell viability, and proliferation. This represents a major advantage compared to synthetic scaffolds, which can acquire these features only after modification and show limited biocompatibility. In this work, we describe the ability of a skeletal muscle acellular scaffold to promote vascularization both ex vivo and in vivo. Specifically, chicken chorioallantoic membrane assay and protein array confirmed the presence of pro-angiogenic molecules in the decellularized tissue such as HGF, VEGF, and SDF-1α. The acellular muscle was implanted in BL6/J mice both subcutaneously and ortotopically. In the first condition, the ECM-derived scaffold appeared vascularized 7 days post-implantation. When the decellularized diaphragm was ortotopically applied, newly formed blood vessels containing CD31⁺, αSMA⁺, and vWF⁺ cells were visible inside the scaffold. Systemic injection of Evans Blue proved function and perfusion of the new vessels, underlying a tissue-regenerative activation. On the contrary, the implantation of a synthetic matrix made of polytetrafluoroethylene used as control was only surrounded by vWF⁺ cells, with no cell migration inside the scaffold and clear foreign body reaction (giant cells were visible). The molecular profile and the analysis of macrophages confirmed the tendency of the synthetic scaffold to enhance inflammation instead of regeneration. In conclusion, we identified the angiogenic potential of a skeletal muscle-derived acellular scaffold and the pro-regenerative environment activated in vivo, showing clear evidence that the decellularized diaphragm is a suitable candidate for skeletal muscle tissue engineering and regeneration.

Impact of change of matrix crystallinity and polymorphism on ovalbumin release from lipid-based implants.

PubMed

Duque, Luisa; Körber, Martin; Bodmeier, Roland

2018-05-30

The objectives of this study were to prepare lipid-based implants by hot melt extrusion (HME) for the prolonged release of ovalbumin (OVA), and to relate protein release to crystallinity and polymorphic changes of the lipid matrix. Two lipids, glycerol tristearate and hydrogenated palm oil, with different composition and degree of crystallinity were studied. Solid OVA was dispersed within the lipid matrixes, which preserved its stability during extrusion. This was partially attributed to a protective effect of the lipidic matrix. The incorporation of OVA decreased the mechanical strength of the implants prepared with the more crystalline matrix, glycerol tristearate, whereas it remained comparable for the hydrogenated palm oil because of stronger physical and non-covalent interactions between the protein and this lipid. This was also the reason for the faster release of OVA from the glycerol tristearate matrix when compared to the hydrogenated palm oil (8 vs. 28 weeks). Curing induced and increased crystallinity, and changes in the release rate, especially for the more crystalline matrix. In this case, both an increase and a decrease in release, were observed depending on the tempering condition. Curing at higher temperatures induced a melt-mediated crystallization and solid state transformation of the glycerol tristearate matrix and led to rearrangements of the inner structure with the formation of larger pores, which accelerated the release. In contrast, changes in the hydrogenated palm oil under the same curing conditions were less noticeable leading to a more robust formulation, because of less polymorphic changes over time. This study helps to understand the effect of lipid matrix composition and crystallinity degree on the performance of protein-loaded implants, and to establish criteria for the selection of a lipid carrier depending on the release profile desired. Copyright © 2018. Published by Elsevier B.V.

Formation of silicon nanocrystals in sapphire by ion implantation and the origin of visible photoluminescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yerci, S.; Serincan, U.; Dogan, I.

2006-10-01

Silicon nanocrystals, average sizes ranging between 3 and 7 nm, were formed in sapphire matrix by ion implantation and subsequent annealing. Evolution of the nanocrystals was detected by Raman spectroscopy and x-ray diffraction (XRD). Raman spectra display that clusters in the matrix start to form nanocrystalline structures at annealing temperatures as low as 800 deg. C in samples with high dose Si implantation. The onset temperature of crystallization increases with decreasing dose. Raman spectroscopy and XRD reveal gradual transformation of Si clusters into crystalline form. Visible photoluminescence band appears following implantation and its intensity increases with subsequent annealing process. Whilemore » the center of the peak does not shift, the intensity of the peak decreases with increasing dose. The origin of the observed photoluminescence is discussed in terms of radiation induced defects in the sapphire matrix.« less

Morphometric analysis of the location and activity of cytokines in the tissue implant response.

PubMed

Butler, Kenneth R; Benghuzzi, Hamed A; Tucci, Michelle A; Puckett, Aaron

2014-01-01

The objective of this investigation was to evaluate the location and activity of cytokines in the fibrous tissue surrounding tricalcium phosphate (TCP) implants loaded with androgenic hormones. Sixteen animals in four experimental groups (n = 4/group) were implanted with one TCP implant each: Group I (control), Group II (testosterone), Group III (dihydrotestosterone), and Group IV (androstenedione). At 90 days post-implantation, the fibrous tissue surrounding the implants were evaluated following staining with antibodies to IL-1ß, IL-2, IL-6, and TNF?. Data were collected on the presence and distribution of cytokines within the fibrous tissue surrounding all four groups. IL-1ß was primarily found intercellular and associated with fibroblasts and macrophages of Groups I-III. IL-2 was present in the extracellular matrix and was sporadically found on the surface of macrophages in Groups I-III. IL-6 was found primarily concentrated in the fibroblast and collagen rich portions of the fibrous tissue matrix in Groups I-III. TNF-? was present in the extracellular matrix of the fibrous tissue of all four groups and was strongly associated with fibroblast and macrophage rich areas. The results of this study confirm activity of cytokines on target cells and indicate their actions may vary in their effect within the fibrous tissue surrounding TCP implants loaded with androgens.

Demineralized bone matrix fibers formable as general and custom 3D printed mold-based implants for promoting bone regeneration.

PubMed

Rodriguez, Rudy U; Kemper, Nathan; Breathwaite, Erick; Dutta, Sucharita M; Hsu, Erin L; Hsu, Wellington K; Francis, Michael P

2016-07-26

Bone repair frequently requires time-consuming implant construction, particularly when using un-formed implants with poor handling properties. We therefore developed osteoinductive, micro-fibrous surface patterned demineralized bone matrix (DBM) fibers for engineering both defect-matched and general three-dimensional implants. Implant molds were filled with demineralized human cortical bone fibers there were compressed and lyophilized, forming mechanically strong shaped DBM scaffolds. Enzyme linked immunosorbent assays and mass spectrometry confirmed that DBM fibers contained abundant osteogenic growth factors (bone morphogenetic proteins, insulin-like growth factor-I) and extracellular matrix proteins. Mercury porosimetry and mechanical testing showed interconnected pores within the mechanically stable, custom DBM fiber scaffolds. Mesenchymal stem cells readily attached to the DBM and showed increasing metabolic activity over time. DBM fibers further increased alkaline phosphatase activity in C2C12 cells. In vivo, DBM implants elicited osteoinductive potential in a mouse muscle pouch, and also promoted spine fusion in a rat arthrodesis model. DBM fibers can be engineered into custom-shaped, osteoinductive and osteoconductive implants with potential for repairing osseous defects with precise fitment, potentially reducing operating time. By providing pre-formed and custom implants, this regenerative allograft may improve patient outcomes following surgical bone repair, while further advancing personalized orthopedic and craniomaxillofacial medicine using three-dimensional-printed tissue molds.

The component leaching from decellularized pericardial bioscaffolds and its implication in the macrophage response.

PubMed

Mendoza-Novelo, Birzabith; Castellano, Laura E; Padilla-Miranda, Ruth G; Lona-Ramos, María C; Cuéllar-Mata, Patricia; Vega-González, Arturo; Murguía-Pérez, Mario; Mata-Mata, José L; Ávila, Eva E

2016-11-01

The extracellular matrix molecules remaining in bioscaffolds derived from decellularized xenogeneic tissues appear to be important for inducing cell functions conducting tissue regeneration. Here, we studied whether decellularization methods, that is, detergent Triton X-100 (TX) alone and TX combined with reversible alkaline swelling (STX), applied to bovine pericardial tissue, could affect the bioscaffold components. The in vitro macrophage response, subdermal biodegradation, and cell infiltration were also studied. The results indicate a lower leaching of fibronectin, but a higher leaching of laminin and sulfated glycosaminoglycans from tissues decellularized with STX and TX, respectively. The in vitro secretion of interleukin-6 and monocyte chemoattractant protein by RAW264.7 macrophages is promoted by decellularized bioscaffold leachates. A lower polymorphonuclear cell density is observed around decellularized bioscaffolds at 1-day implantation; concurrently showing a higher cell infiltration in STX- than in TX-implant. Cells infiltrated into TX-implant show a fibroblastic morphology at 7-day implantation, concurrently the capillary formation is observed at 14-day. Pericardial bioscaffolds suffer biodegradation more pronounced in STX- than in TX-implant. Both TX and STX decellularization methods favor a high leaching of basal lamina components, which presumably promotes a faster macrophage stimulation compared to nondecellularized tissue, and appear to be associated with an increased host cell infiltration in a rat subdermal implantation. Meanwhile, the connective tissue components leaching from TX decellularized bioscaffolds, unlike the STX ones, appear to be associated with an enhanced angiogenesis accompanied by an early-promoted fibroblastic cell transition. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2810-2822, 2016. © 2016 Wiley Periodicals, Inc.

Sentence Production after Listener and Echoic Training by Prelingual Deaf Children with Cochlear Implants

ERIC Educational Resources Information Center

Golfeto, Raquel M.; de Souza, Deisy G.

2015-01-01

Three children with neurosensory deafness who used cochlear implants were taught to match video clips to dictated sentences. We used matrix training with overlapping components and tested for recombinative generalization. Two 3?×?3 matrices generated 18 sentences. For each matrix, we taught 6 sentences and evaluated generalization with the…

Toroidal-spiral particles for codelivery of anti-VEGFR-2 antibody and irinotecan: a potential implant to hinder recurrence of glioblastoma multiforme.

PubMed

Sharma, Vishal; Köllmer, Melanie; Szymusiak, Magdalena; Nitsche, Ludwig C; Gemeinhart, Richard A; Liu, Ying

2014-03-10

Heterogeneous toroidal-spiral particles (TSPs) were generated by polymer droplet sedimentation, interaction, and cross-linking. TSPs provide a platform for encapsulation and release of multiple compounds of different sizes and physicochemical properties. As a model system, we demonstrate the encapsulation and independently controlled release of an anti-VEGFR-2 antibody and irinotecan for the treatment of glioblastoma multiforme. The anti-VEGFR-2 antibody was released from the TS channels and its binding to HUVECs was confirmed by confocal microscopy and flow cytometry, suggesting active antibody encapsulation and release. Irinotecan, a small molecule drug, was released from the dense polymer matrix of poly(ethylene glycol) diacrylate (MW ~ 700 g/mol; PEGDA 700). Released irinotecan inhibited the proliferation of U251 malignant glioma cells. Since the therapeutic compounds are released through different pathways, specifically diffusion through the polymer matrix versus TS channels, the release rate can be controlled independently through the design of the structure and material of particle components.

Use of Collagen Matrix for Augmentation of the Peri-implant Soft Tissue at the Time of Immediate Implant Placement.

PubMed

Zafiropoulos, Gregor-Georg; John, Gordon

2017-05-01

The aim of this study was to determine the treatment outcome of the use of a porcine monolayer collagen matrix (mCM) to augment peri-implant soft tissue in conjunction with immediate implant placement as an alternative to patient's own connective tissue. A total of 27 implants were placed immediately in 27 patients (14 males and 13 females, with a mean age of 52.2 years) with simultaneous augmentation of the soft tissue by the use of a mCM. The patients were randomly divided into two groups: Group I: An envelope flap was created and mCM was left coronally uncovered, and group II: A coronally repositioned flap was created and the mCM was covered by the mucosa. Soft-tissue thickness (STTh) was measured at the time of surgery (T0) and 6 months postoperatively (T1) using a customized stent. Cone beam computed tomographies (CBCTs) were taken from 12 representative cases at T1. A stringent plaque control regimen was enforced in all the patients during the 6-month observation period. Mean STTh change was similar in both groups (0.7 ± 0.2 and 0.7 ± 0.1 mm in groups I and II respectively). The comparison of STTh between T0 and T1 showed a statistically significant increase of soft tissue in both groups I and II as well as in the total examined population (p < 0.001). The STTh change as well as matrix thickness loss were comparable in both groups (p > 0.05). The evaluation of the CBCTs did not show any signs of resorption of the buccal bone plate. Within the limitations of this study, it could be concluded that the collagen matrix used in conjunction with immediate implant placement leads to an increased thickness of peri-implant soft tissue independent of the flap creation technique and could be an alternative to connective tissue graft. The collagen matrix used seems to be a good alternative to patient's own connective tissue and could be used for the soft tissue augmentation around dental implants.

Glucose sensing molecules having selected fluorescent properties

DOEpatents

Satcher, Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

2004-01-27

An analyte sensing fluorescent molecule that employs intramolecular electron transfer is designed to exhibit selected fluorescent properties in the presence of analytes such as saccharides. The selected fluorescent properties include excitation wavelength, emission wavelength, fluorescence lifetime, quantum yield, photostability, solubility, and temperature or pH sensitivity. The compound comprises an aryl or a substituted phenyl boronic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. The fluorophore and switch component are selected such that the value of the free energy for electron transfer is less than about 3.0 kcal mol.sup.-1. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

The use of acellular dermal matrix membrane for vertical soft tissue augmentation during submerged implant placement: a case series.

PubMed

Puisys, Algirdas; Vindasiute, Egle; Linkevciene, Laura; Linkevicius, Tomas

2015-04-01

To evaluate the efficiency of acellular dermal matrix membrane to augment vertical peri-implant soft tissue thickness during submerged implant placement. Forty acellular dermal matrix-derived allogenic membranes (AlloDerm, BioHorizons, Birmingham, AL, USA) and 42 laser-modified surface internal hex implants (BioHorizons Tapered Laser Lok, Birmingham, AL, USA) were placed in submerged approach in 40 patients (15 males and 25 females, mean age 42.5 ± 1.7) with a thin vertical soft tissue thickness of 2 mm or less. After 3 months, healing abutments were connected to implants, and the augmented soft tissue thickness was measured with periodontal probe. The gain in vertical soft tissue volume was calculated. Mann-Whitney U-test was applied and significance was set to 0.05. All 40 allografts healed successfully. Thin soft tissue before augmentation had an average thickness of 1.54 ± 0.51 mm SD (range, 0.5-2.0 mm, median 1.75 mm), and after soft tissue augmentation with acellular dermal matrix, thickness increased to 3.75 ± 0.54 mm SD (range, 3.0-5.0 mm, median 4.0 mm) at 3 months after placement. This difference between medians was found to be statistically significant (P < 0.001). Mean increase in soft tissue thickness was 2.21 ± 0.85 mm SD (range, 1.0-4.5 mm, median 2.0 mm). It can be concluded that acellular dermal matrix membrane can be successfully used for vertical soft tissue augmentation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

CD44 in cancer progression: adhesion, migration and growth regulation.

PubMed

Marhaba, R; Zöller, M

2004-03-01

It is well established that the large array of functions that a tumour cell has to fulfil to settle as a metastasis in a distant organ requires cooperative activities between the tumour and the surrounding tissue and that several classes of molecules are involved, such as cell-cell and cell-matrix adhesion molecules and matrix degrading enzymes, to name only a few. Furthermore, metastasis formation requires concerted activities between tumour cells and surrounding cells as well as matrix elements and possibly concerted activities between individual molecules of the tumour cell itself. Adhesion molecules have originally been thought to be essential for the formation of multicellular organisms and to tether cells to the extracellular matrix or to neighbouring cells. CD44 transmembrane glycoproteins belong to the families of adhesion molecules and have originally been described to mediate lymphocyte homing to peripheral lymphoid tissues. It was soon recognized that the molecules, under selective conditions, may suffice to initiate metastatic spread of tumour cells. The question remained as to how a single adhesion molecule can fulfil that task. This review outlines that adhesion is by no means a passive task. Rather, ligand binding, as exemplified for CD44 and other similar adhesion molecules, initiates a cascade of events that can be started by adherence to the extracellular matrix. This leads to activation of the molecule itself, binding to additional ligands, such as growth factors and matrix degrading enzymes, complex formation with additional transmembrane molecules and association with cytoskeletal elements and signal transducing molecules. Thus, through the interplay of CD44 with its ligands and associating molecules CD44 modulates adhesiveness, motility, matrix degradation, proliferation and cell survival, features that together may well allow a tumour cell to proceed through all steps of the metastatic cascade.

A novel surgical procedure for coronally repositioning of the buccal implant mucosa using acellular dermal matrix: a case report.

PubMed

Mareque-Bueno, Santiago

2011-01-01

This case report describes a surgical procedure for coronally advancing the peri-implant mucosa to treat a soft tissue dehiscence in a single-tooth implant-supported restoration in combination with an acellular dermal matrix graft. The patient was a 41-year-old systemically healthy, non-smoking female. Her chief complaint pertained to the unesthetic appearance of her right lateral upper incisor, caused by recession of the mucosal margin. On examination, a 3-mm recession could be observed. The periodontium was classified as thin. A 2-mm band of keratinized peri-implant mucosa was present. Keratinized gingiva was approximately 6 mm at adjacent areas. The surgical technique included a novel incision design to coronally position the flap over an acellular dermal matrix graft. Partial coverage of the recession was achieved. After a 6-month period, tissues appeared thicker than preoperatively, with no bleeding on probing and no probing depth >2 mm. The patient was satisfied with the overall treatment result. This case report shows the possibility of achieving partial soft tissue coverage over an implant-supported restoration with the combined use of an acellular dermal matrix and a coronally positioned flap. A novel technique is presented that allowed advancing the flap over the graft in a single-tooth restoration where enough keratinized tissue was present preoperatively.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

PubMed

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

2013-03-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

PubMed Central

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

2012-01-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

[The Russian-language version of the matrix test (RUMatrix) in free field in patients after cochlear implantation in the long term].

PubMed

Goykhburg, M V; Bakhshinyan, V V; Petrova, I P; Wazybok, A; Kollmeier, B; Tavartkiladze, G A

The deterioration of speech intelligibility in the patients using cochlear implantation (CI) systems is especially well apparent in the noisy environment. It explains why phrasal speech tests, such as a Matrix sentence test, have become increasingly more popular in the speech audiometry during rehabilitation after CI. The Matrix test allows to estimate speech perception by the patients in a real life situation. The objective of this study was to assess the effectiveness of audiological rehabilitation of CI patients using the Russian-language version of the matrix test (RUMatrix) in free field in the noisy environment. 33 patients aged from 5 to 40 years with a more than 3 year experience of using cochlear implants inserted at the National Research Center for Audiology and Hearing Rehabilitation were included in our study. Five of these patients were implanted bilaterally. The results of our study showed a statistically significant improvement of speech intelligibility in the noisy environment after the speech processor adjustment; dynamics of the signal-to-noise ratio changes was -1.7 dB (p<0.001). The RUMatrix test is a highly efficient method for the estimation of speech intelligibility in the patients undergoing clinical investigations in the noisy environment. The high degree of comparability of the RUMatrix test with the Matrix tests in other languages makes possible its application in international multicenter studies.

Research on the preparation, biocompatibility and bioactivity of magnesium matrix hydroxyapatite composite material.

PubMed

Linsheng, Li; Guoxiang, Lin; Lihui, Li

2016-08-12

In this paper, magnesium matrix hydroxyapatite composite material was prepared by electrophoretic deposition method. The optimal process parameters of electrophoretic deposition were HA suspension concentration of 0.02 kg/L, aging time of 10 days and voltage of 60 V. Animal experiment and SBF immersion experiment were used to test the biocompatibility and bioactivity of this material respectively. The SD rats were divided into control group and implant group. The implant surrounding tissue was taken to do tissue biopsy, HE dyed and organizational analysis after a certain amount of time in the SD rat body. The biological composite material was soaked in SBF solution under homeothermic condition. After 40 days, the bioactivity of the biological composite material was evaluated by testing the growth ability of apatite on composite material. The experiment results showed that magnesium matrix hydroxyapatite biological composite material was successfully prepared by electrophoretic deposition method. Tissue hyperplasia, connective tissue and new blood vessels appeared in the implant surrounding soft tissue. No infiltration of inflammatory cells of lymphocytes and megakaryocytes around the implant was found. After soaked in SBF solution, a layer bone-like apatite was found on the surface of magnesium matrix hydroxyapatite biological composite material. The magnesium matrix hydroxyapatite biological composite material could promot calcium deposition and induce bone-like apatite formation with no cytotoxicity and good biocompatibility and bioactivity.

DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS.

PubMed

Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

2018-04-01

Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H] - ) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. Graphical Abstract ᅟ.

Susceptibility of metallic magnesium implants to bacterial biofilm infections.

PubMed

Rahim, Muhammad Imran; Rohde, Manfred; Rais, Bushra; Seitz, Jan-Marten; Mueller, Peter P

2016-06-01

Magnesium alloys have promising mechanical and biological properties as biodegradable medical implant materials for temporary applications during bone healing or as vascular stents. Whereas conventional implants are prone to colonization by treatment resistant microbial biofilms in which bacteria are embedded in a protective matrix, magnesium alloys have been reported to act antibacterial in vitro. To permit a basic assessment of antibacterial properties of implant materials in vivo an economic but robust animal model was established. Subcutaneous magnesium implants were inoculated with bacteria in a mouse model. Contrary to the expectations, bacterial activity was enhanced and prolonged in the presence of magnesium implants. Systemic antibiotic treatments were remarkably ineffective, which is a typical property of bacterial biofilms. Biofilm formation was further supported by electron microscopic analyses that revealed highly dense bacterial populations and evidence for the presence of extracellular matrix material. Bacterial agglomerates could be detected not only on the implant surface but also at a limited distance in the peri-implant tissue. Therefore, precautions may be necessary to minimize risks of metallic magnesium-containing implants in prospective clinical applications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1489-1499, 2016. © 2016 Wiley Periodicals, Inc.

Esophageal tissue engineering: Current status and perspectives.

PubMed

Poghosyan, T; Catry, J; Luong-Nguyen, M; Bruneval, P; Domet, T; Arakelian, L; Sfeir, R; Michaud, L; Vanneaux, V; Gottrand, F; Larghero, J; Cattan, P

2016-02-01

Tissue engineering, which consists of the combination and in vivo implantation of elements required for tissue remodeling toward a specific organ phenotype, could be an alternative for classical techniques of esophageal replacement. The current hybrid approach entails creation of an esophageal substitute composed of an acellular matrix and autologous epithelial and muscle cells provides the most successful results. Current research is based on the use of mesenchymal stem cells, whose potential for differentiation and proangioogenic, immune-modulator and anti-inflammatory properties are important assets. In the near future, esophageal substitutes could be constructed from acellular "intelligent matrices" that contain the molecules necessary for tissue regeneration; this should allow circumvention of the implantation step and still obtain standardized in vivo biological responses. At present, tissue engineering applications to esophageal replacement are limited to enlargement plasties with absorbable, non-cellular matrices. Nevertheless, the application of existing clinical techniques for replacement of other organs by tissue engineering in combination with a multiplication of translational research protocols for esophageal replacement in large animals should soon pave the way for health agencies to authorize clinical trials. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Ultra-low-energy ion-beam synthesis of nanometer-separated Si nanoparticles and Ag nanocrystals 2D layers

NASA Astrophysics Data System (ADS)

Carrada, M.; Haj Salem, A.; Pecassou, B.; Paillard, V.; Ben Assayag, G.

2018-03-01

2D networks of Si and Ag nanocrystals have been fabricated in the same SiO2 matrix by Ultra-Low-Energy Ion-Beam-Synthesis. Our synthesis scheme differs from a simple sequential ion implantation and its key point is the control of the matrix integrity through an appropriate intermediate thermal annealing. Si nanocrystal layer is synthesised first due to high thermal budget required for nucleation, while the second Ag nanocrystal plane is formed during a subsequent implantation due to the high diffusivity of Ag in silica. The aim of this work is to show how it is possible to overcome the limitation related to ion mixing and implantation damage to obtain double layers of Si-NCs and Ag-NCs with controlled characteristics. For this, we take advantage of annealing under slight oxidizing ambient to control the oxidation of Si-NCs and the Si excess in the matrix. The nanocrystal characteristics and in particular their position and size can be adjusted thanks to a compromise between the implantation energy, the implanted dose for both Si and Ag ions and the intermediate annealing conditions (atmosphere, temperature and duration).

Classification and identification of molecules through factor analysis method based on terahertz spectroscopy

NASA Astrophysics Data System (ADS)

Huang, Jianglou; Liu, Jinsong; Wang, Kejia; Yang, Zhengang; Liu, Xiaming

2018-06-01

By means of factor analysis approach, a method of molecule classification is built based on the measured terahertz absorption spectra of the molecules. A data matrix can be obtained by sampling the absorption spectra at different frequency points. The data matrix is then decomposed into the product of two matrices: a weight matrix and a characteristic matrix. By using the K-means clustering to deal with the weight matrix, these molecules can be classified. A group of samples (spirobenzopyran, indole, styrene derivatives and inorganic salts) has been prepared, and measured via a terahertz time-domain spectrometer. These samples are classified with 75% accuracy compared to that directly classified via their molecular formulas.

Circadian Rhythm and Cartilage Extracellular Matrix Genes in Osseointegration: A Genome-Wide Screening of Implant Failure by Vitamin D Deficiency

PubMed Central

Mengatto, Cristiane Machado; Mussano, Federico; Honda, Yoshitomo; Colwell, Christopher S.; Nishimura, Ichiro

2011-01-01

Background Successful dental and orthopedic implants require the establishment of an intimate association with bone tissue; however, the mechanistic explanation of how biological systems accomplish osseointegration is still incomplete. We sought to identify critical gene networks involved in osseointegration by exploring the implant failure model under vitamin D deficiency. Methodology Adult male Sprague-Dawley rats were exposed to control or vitamin D-deficient diet prior to the osteotomy surgery in the femur bone and the placement of T-shaped Ti4Al6V implant. Two weeks after the osteotomy and implant placement, tissue formed at the osteotomy site or in the hollow chamber of T-shaped implant was harvested and total RNA was evaluated by whole genome microarray analyses. Principal Findings Two-way ANOVA of microarray data identified 103 genes that were significantly (>2 fold) modulated by the implant placement and vitamin D deficiency. Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses assigned the highest z-score to the circadian rhythm pathway including neuronal PAS domain 2 (NPAS2), and period homolog 2 (Per2). NPAS2 and Aryl hydrocarbon receptor nuclear translocator-like (ARNTL/Bmal 1) were upregulated around implant and diminished by vitamin D deficiency, whereas the expression pattern of Per2 was complementary. Hierarchical cluster analysis further revealed that NPAS2 was in a group predominantly composed of cartilage extracellular matrix (ECM) genes. Whereas the expression of bone ECM genes around implant was not significantly affected by vitamin D deficiency, cartilage ECM genes were modulated by the presence of the implant and vitamin D status. In a proof-of-concept in vitro study, the expression of cartilage type II and X collagens was found upregulated when mouse mesenchymal stem cells were cultured on implant disk with 1,25D supplementation. Conclusions This study suggests that the circadian rhythm system and cartilage extracellular matrix may be involved in the establishment of osseointegration under vitamin D regulation. PMID:21264318

Human platelet lysate improves human cord blood derived ECFC survival and vasculogenesis in three dimensional (3D) collagen matrices

PubMed Central

Kim, Hyojin; Prasain, Nutan; Vemula, Sasidhar; Ferkowicz, Michael J.; Yoshimoto, Momoko; Voytik-Harbin, Sherry L.; Yoder, Mervin C.

2015-01-01

Human cord blood (CB) is enriched in circulating endothelial colony forming cells (ECFC) that display high proliferative potential and in vivo vessel forming ability. Since diminished ECFC survival is known to dampen the vasculogenic response in vivo, we tested how long implanted ECFC survive and generate vessels in three-dimensional (3D) type I collagen matrices in vitro and in vivo. We hypothesized that human platelet lysate (HPL) would promote cell survival and enhance vasculogenesis in the 3D collagen matrices. We report that the percentage of ECFC co-cultured with HPL that were alive was significantly enhanced on days 1 and 3 post- matrix formation, compared to ECFC alone containing matrices. Also, co-culture of ECFC with HPL displayed significantly more vasculogenic activity compared to ECFC alone and expressed significantly more pro-survival molecules (pAkt, p-Bad and Bcl-xL) in the 3D collagen matrices in vitro. Treatment with Akt1 inhibitor (A-674563), Akt2 inhibitor (CCT128930) and Bcl-xL inhibitor (ABT-263/Navitoclax) significantly decreased the cell survival and vasculogenesis of ECFC co-cultured with or without HPL and implicated activation of the Akt1 pathway as the critical mediator of the HPL effect on ECFC in vitro. A significantly greater average vessel number and total vascular area of human CD31+ vessels were present in implants containing ECFC and HPL, compared to the ECFC alone implants in vivo. We conclude that implantation of ECFC with HPL in vivo promotes vasculogenesis and augments blood vessel formation via diminishing apoptosis of the implanted ECFC. PMID:26122935

Human platelet lysate improves human cord blood derived ECFC survival and vasculogenesis in three dimensional (3D) collagen matrices.

PubMed

Kim, Hyojin; Prasain, Nutan; Vemula, Sasidhar; Ferkowicz, Michael J; Yoshimoto, Momoko; Voytik-Harbin, Sherry L; Yoder, Mervin C

2015-09-01

Human cord blood (CB) is enriched in circulating endothelial colony forming cells (ECFCs) that display high proliferative potential and in vivo vessel forming ability. Since diminished ECFC survival is known to dampen the vasculogenic response in vivo, we tested how long implanted ECFC survive and generate vessels in three-dimensional (3D) type I collagen matrices in vitro and in vivo. We hypothesized that human platelet lysate (HPL) would promote cell survival and enhance vasculogenesis in the 3D collagen matrices. We report that the percentage of ECFC co-cultured with HPL that were alive was significantly enhanced on days 1 and 3 post-matrix formation, compared to ECFC alone containing matrices. Also, co-culture of ECFC with HPL displayed significantly more vasculogenic activity compared to ECFC alone and expressed significantly more pro-survival molecules (pAkt, p-Bad and Bcl-xL) in the 3D collagen matrices in vitro. Treatment with Akt1 inhibitor (A-674563), Akt2 inhibitor (CCT128930) and Bcl-xL inhibitor (ABT-263/Navitoclax) significantly decreased the cell survival and vasculogenesis of ECFC co-cultured with or without HPL and implicated activation of the Akt1 pathway as the critical mediator of the HPL effect on ECFC in vitro. A significantly greater average vessel number and total vascular area of human CD31(+) vessels were present in implants containing ECFC and HPL, compared to the ECFC alone implants in vivo. We conclude that implantation of ECFC with HPL in vivo promotes vasculogenesis and augments blood vessel formation via diminishing apoptosis of the implanted ECFC. Copyright © 2015 Elsevier Inc. All rights reserved.

The effect of riboflavin/UVA cross-linking on anti-degeneration and promoting angiogenic capability of decellularized liver matrix.

PubMed

Xiang, Junxi; Liu, Peng; Zheng, Xinglong; Dong, Dinghui; Fan, Shujuan; Dong, Jian; Zhang, Xufeng; Liu, Xuemin; Wang, Bo; Lv, Yi

2017-10-01

Weak mechanical property and unstable degradation rate limited the application of decellularized liver matrix in tissue engineering. The aim of this study was to explore a new method for improving the mechanical properties, anti-degeneration and angiogenic capability of decellularized liver matrix. This was achieved by a novel approach using riboflavin/ultraviolet A treatment to induce collagen cross-linking of decellularized matrix. Histological staining and scanning electron microscope showed that the diameter of cross-linked fibers significantly increased compared with the control group. The average peak load and Young's modulus of decellularized matrix were obviously improved after cross-linking. Then we implanted the modified matrix into the rat hepatic injury model to test the anti-degeneration and angiogenic capability of riboflavin/UVA cross-linked decellularized liver scaffolds in vivo. The results indicated that cross-linked scaffolds degrade more slowly than those in the control group. In the experiment group, average microvessel density in the implanted matrix was higher than that in the control group since the first week after implantation. In conclusion, we initiated the method to improve the biomechanical properties of decellularized liver scaffolds by riboflavin/UVA cross-linking, and more importantly, its improvement on anti-degeneration and angiogenesis was identified. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2662-2669, 2017. © 2017 Wiley Periodicals, Inc.

Tetracycline impregnation affects degradation of porcine collagen matrix in healthy and diabetic rats.

PubMed

Tal, Haim; Weinreb, Miron; Shely, Asaf; Nemcovsky, Carlos E; Moses, Ofer

2016-07-01

The present study evaluated the degradation of collagen matrix (CM) immersed in tetracycline (TTC) or phosphate-buffered saline (PBS) in diabetic and normoglycemic rats. Diabetes was induced in 15 rats by systemic streptozotocin (STZ) (experimental); 15 healthy rats served as controls. One day before implantation 60 CM disks, 5 mm in diameter, were labeled with biotin: 30 were immersed in tetracycline (TTC) and 30 in PBS. One disk of each type was implanted subdermally in each rat. Animals were euthanized after 3 weeks, and tissue specimens containing the disks were prepared for histologic analysis. Horseradish peroxidase (HRP)-conjugated streptavidin was used to detect the remaining biotinylated collagen. Residual collagen area within the CM disks was analyzed and compared to baseline. Diabetes significantly increased the CM degradation. Immersion of the CM disks in a 50-mg/mL TTC solution before implantation decreased its degradation both in diabetic and normoglycemic rats. Diabetes significantly increases collagen matrix degradation; immersion of collagen matrix in TTC before implantation decreases its degradation in both diabetic and normoglycemic conditions. Immersion of medical collagen devices in TTC may be an effective means to decrease their resorption rate and increase their effectiveness, especially in situations with increased degradation such as diabetes.

Microencapsulation of hydrophilic drug substances using biodegradable polyesters. Part II: Implants allowing controlled drug release--a feasibility study using bisphosphonates.

PubMed

Weidenauer, U; Bodmer, D; Kissel, T

2004-03-01

The prolonged delivery of hydrophilic drug salts from hydrophobic polymer carriers at high drug loading is an ambitious goal. Pamidronate disodium salt (APD) containing implants prepared from spray-dried microparticles were investigated using a laboratory ram extruder. An APD-containing polymer matrix consisting of an APD-chitosan implant embedded in the biodegradable polymer D,L-poly(lactide-co-glycolide acid-glucose) (PLG-GLU) was compared with a matrix system with the micronized drug distributed in the PLG-GLU. The APD-chitosan matrix system showed a triphasic release behaviour at loading levels of 6.86 and 15.54% (w/w) over 36 days under in-vitro conditions. At higher loading (31.92%), a drug burst was observed within 6 days due to the formation of pores and channels in the polymeric matrix. In contrast, implants containing the micronized drug showed a more continuous release profile over 48 days up to a loading of 31.78% (w/w). At a drug loading of 46.17% (w/w), a drug burst was observed. Using micronized drug salts and reducing the surface area available for diffusion, parenteral delivery systems for highly water-soluble drug candidates were shown to be technically feasible at high drug loadings.

Degradation of extracellular matrix by mouse trophoblast outgrowths: a model for implantation

PubMed Central

Glass, RH; Aggeler, J; Spindle, A; Pederson, RA; Werb, Z

1983-01-01

During implantation the embryo attaches to the endometrial surface and trophoblast traverses the uterine epithelium, anchoring in the uterine connective tissue. To determine whether trophoblast can facilitate invasion of the uterus by degrading components of normal uterine extracellular matrix, mouse blastocysts were cultured on a radio-labeled extracellular matrix that contained glycoproteins, elastin, and collagen. The embryos attached to the matrix, and trophoblast spread over the surface. Starting on day 5 of culture there was a release of labeled peptides into the medium. The radioactive peptides released from the matrix by the embryos had molecular weights ranging from more than 25,000 to more than 200. By day 7 there were areas where individual trophoblast cells had separated from one another, revealing the underlying substratum that was cleared of matrix. When trophoblast cells were lysed with NH(4)OH on day 8, it was apparent that the area underneath the trophoblast outgrowth had been cleared of matrix. Scanning electron microscopy and time-lapse cinemicrography confirmed that the digestion of matrix was highly localized, taking place only underneath the trophoblast, with no evidence of digestion of the matrix beyond the periphery of the trophoblast outgrowth. The sharp boundaries of degredation observed may be due to localized proteinase secretion by trophoblast, to membrane proteinases on the surface of trophoblast, or to endocytosis. Digestion of the matrix was not dependent on plasminogen, thus ruling out a role for plasminogen activator. Digestion was not inhibited by a variety of hormones and inhibitors, including progesterone, 17β-estradiol, leupeptin, EDTA, colchicine, NH(4)Cl, or ε-aminocaproic acid. This system of culturing embryos on extracellular matrix may be useful in determining the processes that regulate trophoblast migration and invasion into the maternal tissues during implantation.0 PMID:6339525

DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS

NASA Astrophysics Data System (ADS)

Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

2018-01-01

Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H]-) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. [Figure not available: see fulltext.

Qualitative and quantitative evaluation of avian demineralized bone matrix in heterotopic beds.

PubMed

Reza Sanaei, M; Abu, Jalila; Nazari, Mojgan; A B, Mohd Zuki; Allaudin, Zeenathul N

2013-11-01

To evaluate the osteogenic potential of avian demineralized bone matrix (DBM) in the context of implant geometry. Experimental. Rock pigeons (n = 24). Tubular and chipped forms of DBM were prepared by acid demineralization of long bones from healthy allogeneic donors and implanted bilaterally into the pectoral region of 24 pigeons. After euthanasia at 1, 4, 6, 8, 10, and 12 weeks, explants were evaluated histologically and compared by means of quantitative (bone area) and semi quantitative measures (scores). All explants had new bone at retrieval with the exception of tubular implants at the end of week 1. The most reactive part in both implants was the interior region between the periosteal and endosteal surfaces followed by the area at the implant-muscle interface. Quantitative measurements demonstrated a significantly (P = .012) greater percentage of new bone formation induced by tubular implants (80.28 ± 8.94) compared with chip implants (57.64 ± 3.12). There was minimal inflammation. Avian DBM initiates heterotopic bone formation in allogeneic recipients with low grades of immunogenicity. Implant geometry affects this phenomenon as osteoconduction appeared to augment the magnitude of the effects in larger tubular implants. © Copyright 2013 by The American College of Veterinary Surgeons.

Carbon Dots and 9AA as a Binary Matrix for the Detection of Small Molecules by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang

2016-07-01

Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.

Enhanced Antimicrobial Effects of Decellularized Extracellular Matrix (CorMatrix) with Added Vancomycin and Gentamicin for Device Implant Protection.

PubMed

Deering, Thomas F; Chang, Carlos; Snyder, Carl; Natarajan, Selvamuthu K; Matheny, Robert

2017-06-01

The incidence of cardiac implantable electronic device (CIED) infections has risen significantly over the past years. Although several devices are currently available to decrease the incidence of infection, most are made from nonviable synthetic material and are more prone to infection than vascularized tissue. This study was undertaken to assess the resistance to infection of the CorMatrix CanGaroo (CorMatrix Cardiovascular, Roswell, GA, USA), a CIED envelope made of decellularized extracellular matrix (ECM) hydrated in different antibiotic solutions. This study was comprised of two in vitro tests and one animal trial. For all the tests, the ECM was hydrated in a mixture of vancomycin (25 mg/mL) and gentamicin (20 mg/mL) or gentamicin alone (40 mg/mL). The drug elution characteristics were assessed followed by the effectiveness of CanGaroo to prevent the bacterial growth of Staphylococcus aureus and Staphylococcus epidermidis in culture. Then, the direct inoculation of pacemaker implant pockets with both Staphylococcus species was performed in rabbits implanted with either a pacemaker alone or a pacemaker with antibiotic-soaked CorMatrix ECM pouches. The hydration of CanGaroo envelopes in both antibiotic mixtures resulted in antimicrobial activity against both Staphylococcus species, with an early bolus release of antibiotics followed by a slow release lasting for up to 6 days. In vivo, there was a substantial decrease in the occurrence of infection. The hydration of the CanGaroo ECM with an antibiotic solution prevented Staphylococcus species growth in vitro and substantially reduced the incidence of CIED pocket infections in an in vivo rabbit model. © 2017 Wiley Periodicals, Inc.

The promotion of osseointegration of titanium surfaces by coating with silk protein sericin.

PubMed

Nayak, Sunita; Dey, Tuli; Naskar, Deboki; Kundu, Subhas C

2013-04-01

A promising strategy to influence the osseointegration process around orthopaedic titanium implants is the immobilization of bioactive molecules. This recruits appropriate interaction between the surface and the tissue by directing cells adhesion, proliferation, differentiation and active matrix remodelling. In this study, we aimed to investigate the functionalization of metallic implant titanium with silk protein sericin. Titanium surface was immobilized with non-mulberry Antheraea mylitta sericin using glutaraldehyde as crosslinker. To analyse combinatorial effects the sericin immobilized titanium was further conjugated with integrin binding peptide sequence Arg-Gly-Asp (RGD) using ethyl (dimethylaminopropyl) carbodiimide and N-hydroxysulfosuccinimide as coupling agents. The surface of sericin immobilized titanium was characterized biophysically. Osteoblast-like cells were cultured on sericin and sericin/RGD functionalized titanium and found to be more viable than those on pristine titanium. The enhanced adhesion, proliferation, and differentiation of osteoblast cells were observed. RT-PCR analysis showed that mRNA expressions of bone sialoprotein, osteocalcin and alkaline phosphatase were upregulated in osteoblast cells cultured on sericin and sericin/RGD immobilized titanium substrates. Additionally, no significant amount of pro-inflammatory cytokines TNF-α, IL-1β and nitric oxide production were recorded when macrophages cells and osteoblast-macrophages co culture cells were grown on sericin immobilized titanium. The findings demonstrate that the sericin immobilized titanium surfaces are potentially useful bioactive coated materials for titanium-based medical implants. Copyright © 2013 Elsevier Ltd. All rights reserved.

A living thick nanofibrous implant bifunctionalized with active growth factor and stem cells for bone regeneration.

PubMed

Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia

2015-01-01

New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days' implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days' implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration.

Use of cell-free collagen type I matrix implants for the treatment of small cartilage defects in the knee: clinical and magnetic resonance imaging evaluation.

PubMed

Schüttler, Karl F; Schenker, Hanno; Theisen, Christina; Schofer, Markus D; Getgood, Alan; Roessler, Philip P; Struewer, Johannes; Rominger, Marga B; Efe, Turgay

2014-06-01

Articular cartilage defects of the knee are a common condition for which several repair techniques have been described. The aim of the present study was to assess medium-term results of a one-step procedure using a cell-free collagen type I matrix. Fifteen patients with articular cartilage defects of the knee were treated with an 11-mm-diameter cell-free collagen type 1 matrix implant. The matrices were implanted in a press-fit manner into the defect after careful debridement down to the subchondral bone but without penetration of this margin. Follow-up examinations were carried out at 6 weeks, 6 months, and at 12, 24, 36, and 48 months after implantation. Clinical assessment included the visual analogue scale (VAS), the Tegner activity scale, and the International Knee Documentation Committee (IKDC) score. Radiological assessment for graft attachment and tissue regeneration was performed using the magnetic observation of cartilage repair tissue (MOCART) score. A total of 15 patients (males: n = 6 and females: n = 9) with a mean age of 26.4 years (range 19-40) were treated. The mean VAS improved significantly when compared to the preoperative values (P < 0.05). Six weeks after implantation, IKDC values were slightly lower than the preoperative values (n.s.), but increased significantly at final follow-up (P < 0.05). At 24 months, there were no significant differences in the median Tegner score between the post-operative values and the preoperative values (n.s.). However, after 36 months, a significant improvement was noted that lasted at least up to 48 months (P < 0.05). The MOCART score improved consistently up to 4 years after implantation, with significant improvements already observed after 12 months (P < 0.05). No correlation between the clinical scores and the MOCART score could be perceived. The present study showed that the use of cell-free collagen type I matrix implants led to a significant and durable improvement in all the clinical and imaging scores investigated 4 years after implantation. IV.

Engineered arrays of nitrogen-vacancy color centers in diamond based on implantation of CN- molecules through nanoapertures

NASA Astrophysics Data System (ADS)

Spinicelli, P.; Dréau, A.; Rondin, L.; Silva, F.; Achard, J.; Xavier, S.; Bansropun, S.; Debuisschert, T.; Pezzagna, S.; Meijer, J.; Jacques, V.; Roch, J.-F.

2011-02-01

We report a versatile method for engineering arrays of nitrogen-vacancy (NV) color centers in diamond at the nanoscale. The defects were produced in parallel by ion implantation through 80 nm diameter apertures patterned using electron beam lithography in a polymethyl methacrylate (PMMA) layer deposited on a diamond surface. The implantation was performed with CN- molecules that increased the NV defect-formation yield. This method could enable the realization of a solid-state coupled-spin array and could be used for positioning an optically active NV center on a photonic microstructure.

Application of the R-matrix method to photoionization of molecules.

PubMed

Tashiro, Motomichi

2010-04-07

The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

Molecularly Imprinted Intelligent Scaffolds for Tissue Engineering Applications.

PubMed

Neves, Mariana I; Wechsler, Marissa E; Gomes, Manuela E; Reis, Rui L; Granja, Pedro L; Peppas, Nicholas A

2017-02-01

The development of molecularly imprinted polymers (MIPs) using biocompatible production methods enables the possibility to further exploit this technology for biomedical applications. Tissue engineering (TE) approaches use the knowledge of the wound healing process to design scaffolds capable of modulating cell behavior and promote tissue regeneration. Biomacromolecules bear great interest for TE, together with the established recognition of the extracellular matrix, as an important source of signals to cells, both promoting cell-cell and cell-matrix interactions during the healing process. This review focuses on exploring the potential of protein molecular imprinting to create bioactive scaffolds with molecular recognition for TE applications based on the most recent approaches in the field of molecular imprinting of macromolecules. Considerations regarding essential components of molecular imprinting technology will be addressed for TE purposes. Molecular imprinting of biocompatible hydrogels, namely based on natural polymers, is also reviewed here. Hydrogel scaffolds with molecular memory show great promise for regenerative therapies. The first molecular imprinting studies analyzing cell adhesion report promising results with potential applications for cell culture systems, or biomaterials for implantation with the capability for cell recruitment by selectively adsorbing desired molecules.

Synthesis and Characterisation of Photocrosslinked poly(ethylene glycol) diacrylate Implants for Sustained Ocular Drug Delivery.

PubMed

McAvoy, Kathryn; Jones, David; Thakur, Raghu Raj Singh

2018-01-16

To investigate the sustained ocular delivery of small and large drug molecules from photocrosslinked poly(ethylene glycol) diacrylate (PEGDA) implants with varying pore forming agents. Triamcinolone acetonide and ovalbumin loaded photocrosslinked PEGDA implants, with or without pore-forming agents, were fabricated and characterised for chemical, mechanical, swelling, network parameters, as well as drug release and biocompatibility. HPLC-based analytical methods were employed for analysis of two molecules; ELISA was used to demonstrate bioactivity of ovalbumin. Regardless of PEGDA molecular weight or pore former composition all implants loaded with triamcinolone acetonide released significantly faster than those loaded with ovalbumin. Higher molecular weight PEGDA systems (700 Da) resulted in faster drug release of triamcinolone acetonide than their 250 Da counterpart. All ovalbumin released over the 56-day time period was found to be bioactive. Increasing PEGDA molecular weight resulted in increased system swelling, decreased crosslink density (Ve), increased polymer-water interaction parameter (χ), increased average molecular weight between crosslinks (Mc) and increased mesh size (ε). SEM studies showed the porosity of implants increased with increasing PEGDA molecular weight. Biocompatibility showed both PEGDA molecular weight implants were non-toxic when exposed to retinal epithelial cells over a 7-day period. Photocrosslinked PEGDA implant based systems are capable of controlled drug release of both small and large drug molecules through adaptations in the polymer system network. We are currently continuing evaluation of these systems as potential sustained drug delivery devices.

Perlecan and syndecan-4 in uterine tissues during the early pregnancy in mice.

PubMed

San Martin, S; Soto-Suazo, M; Zorn, T M T

2004-07-01

During early pregnancy in mice, there is recruitment of specific immune cells, remodeling of the endometrium, cell differentiation and synthesis of new molecules. Immunohistochemistry was used to determine the distribution of perlecan and syndecan-4 in the uteri before and after embryo implantation. During pre-implantation, perlecan was identified in basement membranes and extracellular spaces of the endometrial stroma. In contrast, expression of syndecan-4 was quite weak. In the peri-implantation period, perlecan remained in the basement membranes, and it was no longer observed in the stroma and it was identified in the embryonic cells. On day 4 of pregnancy, syndecan-4 increased in the fibroblasts of the subepithelial stroma. After implantation, syndecan-4 was pronounced in pre-decidual and mature decidual cells. The coordinate balance between the pre- and post-implantation periods suggests a role of these two molecules in the adaptive modification of the uterine microenvironment to receive and implant the embryo.

Cost minimisation analysis of using acellular dermal matrix (Strattice™) for breast reconstruction compared with standard techniques.

PubMed

Johnson, R K; Wright, C K; Gandhi, A; Charny, M C; Barr, L

2013-03-01

We performed a cost analysis (using UK 2011/12 NHS tariffs as a proxy for cost) comparing immediate breast reconstruction using the new one-stage technique of acellular dermal matrix (Strattice™) with implant versus the standard alternative techniques of tissue expander (TE)/implant as a two-stage procedure and latissimus dorsi (LD) flap reconstruction. Clinical report data were collected for operative time, length of stay, outpatient procedures, and number of elective and emergency admissions in our first consecutive 24 patients undergoing one-stage Strattice reconstruction. Total cost to the NHS based on tariff, assuming top-up payments to cover Strattice acquisition costs, was assessed and compared to the two historical control groups matched on key variables. Eleven patients having unilateral Strattice reconstruction were compared to 10 having TE/implant reconstruction and 10 having LD flap and implant reconstruction. Thirteen patients having bilateral Strattice reconstruction were compared to 12 having bilateral TE/implant reconstruction. Total costs were: unilateral Strattice, £3685; unilateral TE, £4985; unilateral LD and implant, £6321; bilateral TE, £5478; and bilateral Strattice, £6771. The cost analysis shows a financial advantage of using acellular dermal matrix (Strattice) in unilateral breast reconstruction versus alternative procedures. The reimbursement system in England (Payment by Results) is based on disease-related groups similar to that of many countries across Europe and tariffs are based on reported hospital costs, making this analysis of relevance in other countries. Copyright © 2013 Elsevier Ltd. All rights reserved.

Postextraction socket preservation using epithelial connective tissue graft vs porcine collagen matrix. 1-year results of a randomised controlled trial.

PubMed

Meloni, Silvio Mario; Tallarico, Marco; Lolli, Francesco Maria; Deledda, Alessandro; Pisano, Milena; Jovanovic, Sascha A

2015-01-01

To compare epithelial connective tissue graft vs porcine collagen matrix for sealing postextraction sockets grafted with deproteinised bovine bone. A total of 30 patients, who needed a maxillary tooth to be extracted between their premolars and required a delayed, fixed, single implant-supported restoration, had their teeth atraumatically extracted and their sockets grafted with deproteinised bovine bone. Patients were randomised according to a parallel group design into two arms: socket sealing with epithelial connective tissue graft (group A) vs porcine collagen matrix (group B). Outcome measures were: implant success and survival rate, complications, horizontal and vertical alveolar bone dimensional changes measured on Cone Beam computed tomography (CBCT) scans at three levels localised 1, 3, and 5 mm below the most coronal aspect of the bone crest (levels A, B, and C); and between the palatal and buccal wall peaks (level D); and peri-implant marginal bone level changes measured on periapical radiographs. 15 patients were randomised to group A and 15 to group B. No patients dropped out. No failed implants or complications were reported 1 year after implant placement. Five months after tooth extraction there were no statistically significant differences between the 2 groups for both horizontal and vertical alveolar bone dimensional changes. At level A the difference was 0.13 ± 0.18; 95% CI 0.04 to 0.26 mm (P = 0.34), at level B it was 0.08 ± 0.23; 95% CI -0.14 to 0.14 (P = 0.61), at level C it was 0.05 ± 0.25; 95% CI -0.01 to 0.31 mm (P = 0.55) and at level D it was 0.13 ± 0.27; 95% CI -0.02 to 0.32 mm (P = 0.67). One year after implant placement there were no statistically significant differences between the 2 groups for peri-implant marginal bone level changes (difference: 0.07 ± 0.11 mm; 95% CI -0.02 to 0.16; P = 0.41). When teeth extractions were performed atraumatically and sockets were filled with deproteinised bovine bone, sealing the socket with a porcine collagen matrix or a epithelial connective tissue graft showed similar outcomes. The use of porcine collagen matrix allowed simplification of treatment because no palatal donor site was involved.

Use of latissimus dorsi muscle onlay patch alternative to acellular dermal matrix in implant-based breast reconstruction

PubMed Central

Lee, Jeeyeon

2015-01-01

Background An acellular dermal matrix (ADM) is applied to release the surrounding muscles and prevent dislocation or rippling of the implant. We compared implant-based breast reconstruction using the latissimus dorsi (LD) muscle, referred to as an “LD muscle onlay patch,” with using an ADM. Method A total of 56 patients (60 breasts) underwent nipple sparing mastectomy with implant-based breast reconstruction using an ADM or LD muscle onlay patch. Cosmetic outcomes were assessed 4 weeks after chemotherapy or radiotherapy, and statistical analyses were performed. Results Mean surgical time and hospital stay were significantly longer in the LD muscle onlay patch group than the ADM group. However, there were no statistically significant differences between groups in postoperative complications. Cosmetic outcomes for breast symmetry and shape were higher in the LD muscle onlay patch group. Conclusions Implant-based breast reconstruction with an LD muscle onlay patch would be a feasible alternative to using an ADM. PMID:26161312

The Differential Expression of Adhesion Molecule and Extracellular Matrix Genes in Mesenchymal Stromal Cells after Interaction with Cord Blood Hematopoietic Progenitors.

PubMed

Buravkova, L B; Andreeva, E R; Lobanova, M V; Cotnezova, E V; Grigoriev, A I

2018-03-01

The dynamics of the expression of genes encoding adhesion molecules, molecules of the connective tissue matrix, and its remodeling enzymes was studied in multipotent mesenchymal stromal cells (MSCs) from human adipose tissue after interaction with cord blood hematopoietic progenitors (HSPCs). An upregulation of ICAM1 and VCAM1, directly proportional to the coculture time (24-72 h), was found. After 72 h of culturing, a downregulation of the genes encoding the majority of matrix molecules (SPP1; COL6A2,7A1; MMP1,3; TIMP1,3; and HAS1) and cell-matrix adhesion molecules (ITGs) was revealed. The detected changes may ensure the realization of the stromal MSC function due to improvement of adhesion and transmigration of HSPCs into the subcellular space.

Influence of irradiation on the osteoinductive potential of demineralized bone matrix.

PubMed

Wientroub, S; Reddi, A H

1988-04-01

Samples of demineralized bone matrix (DBM) were exposed to graduated doses of radiation (1-15 Megarad) (Mrad) utilizing a linear accelerator and then implanted into the thoracic region of Long-Evans rats. Subcutaneous implantation of DBM into allogenic rats induces endochondral bone. In response to matrix implantation, a cascade of events ensues; mesenchymal cell proliferation on day 3 postimplantation, chondrogenesis on day 7, calcification of the cartilagenous matrix and chondrolysis on day 9, and osteogenesis on day 11 resulting in formation of an ossicle containing active hemopoietic tissue. Bone formation was assessed by measuring alkaline phosphatase activity, the rate of mineralization was determined by measuring 45Ca incorporation to bone mineral, and 40Ca content measured the extent of mineralization; acid phosphatase activity was used as a parameter for bone resorption. The dose of radiation (2.5 Mrad) currently used by bone banks for sterilization of bone tissue did not destroy the bone induction properties of DBM. Furthermore, radiation of 3-5 Mrad even enhanced bone induction, insofar as it produced more bone at the same interval of time than was obtained from unirradiated control samples. None of the radiation doses used in these experiments abolished bone induction, although the response induced by matrix irradiated with doses higher than 5 Mrad was delayed.

Deciphering chondrocyte behaviour in matrix-induced autologous chondrocyte implantation to undergo accurate cartilage repair with hyaline matrix.

PubMed

Demoor, M; Maneix, L; Ollitrault, D; Legendre, F; Duval, E; Claus, S; Mallein-Gerin, F; Moslemi, S; Boumediene, K; Galera, P

2012-06-01

Since the emergence in the 1990s of the autologous chondrocytes transplantation (ACT) in the treatment of cartilage defects, the technique, corresponding initially to implantation of chondrocytes, previously isolated and amplified in vitro, under a periosteal membrane, has greatly evolved. Indeed, the first generations of ACT showed their limits, with in particular the dedifferentiation of chondrocytes during the monolayer culture, inducing the synthesis of fibroblastic collagens, notably type I collagen to the detriment of type II collagen. Beyond the clinical aspect with its encouraging results, new biological substitutes must be tested to obtain a hyaline neocartilage. Therefore, the use of differentiated chondrocytes phenotypically stabilized is essential for the success of ACT at medium and long-term. That is why researchers try now to develop more reliable culture techniques, using among others, new types of biomaterials and molecules known for their chondrogenic activity, giving rise to the 4th generation of ACT. Other sources of cells, being able to follow chondrogenesis program, are also studied. The success of the cartilage regenerative medicine is based on the phenotypic status of the chondrocyte and on one of its essential component of the cartilage, type II collagen, the expression of which should be supported without induction of type I collagen. The knowledge accumulated by the scientific community and the experience of the clinicians will certainly allow to relief this technological challenge, which influence besides, the validation of such biological substitutes by the sanitary authorities. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

A living thick nanofibrous implant bifunctionalized with active growth factor and stem cells for bone regeneration

PubMed Central

Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia

2015-01-01

New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days’ implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days’ implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration. PMID:25709432

Cell adhesion molecules, the extracellular matrix and oral squamous carcinoma.

PubMed

Lyons, A J; Jones, J

2007-08-01

Carcinomas are characterized by invasion of malignant cells into the underlying connective tissue and migration of malignant cells to form metastases at distant sites. These processes require alterations in cell-cell and cell-extracellular matrix interactions. As cell adhesion molecules play a role in cell-cell and cell-extracellular matrix adhesion and interactions they are involved in the process of tumour invasion and metastases. In epithelial tissues, receptors of the integrin family mediate adhesion to the adjacent matrix whereas cadherins largely mediate intercellular adhesion. These and other cell adhesion molecules such as intercellular adhesion molecule-1, CD44, dystroglycans and selectins, are involved and undergo changes in carcinomas, which provide possible targets for anti-cancer drug treatments. In the extracellular matrix that is associated with tumours, laminin 5, oncofetal fibronectin and tenascin C appear. The degree of expression of some of these moieties indicates prognosis in oral cancer and offer targets for antibody-directed radiotherapy. Metalloproteases which degrade the extracellular matrix are increased in carcinomas, and their activity is necessary for tumour angiogenesis and consequent invasion and metastases. Metalloprotease inhibitors have begun to produce decreases in mortality in clinical trials. This report provides a brief overview of our current understanding of cell adhesion molecules, the extracellular matrix, tumour invasion and metastasis.

Surface modification by metal ion implantation forming metallic nanoparticles in an insulating matrix

NASA Astrophysics Data System (ADS)

Salvadori, M. C.; Teixeira, F. S.; Sgubin, L. G.; Cattani, M.; Brown, I. G.

2014-08-01

There is special interest in the incorporation of metallic nanoparticles in a surrounding dielectric matrix for obtaining composites with desirable characteristics such as for surface plasmon resonance, which can be used in photonics and sensing, and controlled surface electrical conductivity. We have investigated nanocomposites produced by metal ion implantation into insulating substrates, where the implanted metal self-assembles into nanoparticles. The nanoparticles nucleate near the maximum of the implantation depth profile (projected range), which can be estimated by computer simulation using the TRIDYN code. TRIDYN is a Monte Carlo simulation program based on the TRIM (Transport and Range of Ions in Matter) code that takes into account compositional changes in the substrate due to two factors: previously implanted dopant atoms, and sputtering of the substrate surface. Our study show that the nanoparticles form a bidimentional array buried a few nanometers below the substrate surface. We have studied Au/PMMA (polymethylmethacrylate), Pt/PMMA, Ti/alumina and Au/alumina systems. Transmission electron microscopy of the implanted samples show that metallic nanoparticles form in the insulating matrix. These nanocomposites have been characterized by measuring the resistivity of the composite layer as a function of the implantation dose. The experimental results are compared with a model based on percolation theory, in which electron transport through the composite is explained by conduction through a random resistor network formed by the metallic nanoparticles. Excellent agreement is found between the experimental results and the predictions of the theory. We conclude in that the conductivity process is due only to percolation (when the conducting elements are in geometric contact) and that the contribution from tunneling conduction is negligible.

Usefulness of Cross-Linked Human Acellular Dermal Matrix as an Implant for Dorsal Augmentation in Rhinoplasty.

PubMed

Yang, Chae Eun; Kim, Soo Jung; Kim, Ji Hee; Lee, Ju Hee; Roh, Tai Suk; Lee, Won Jai

2018-02-01

Asian noses are relatively small and flat compared to Caucasians; therefore, rhinoplasty procedures often focus on dorsal augmentation and tip projection rather than reduction in the nasal framework. Various autologous and alloplastic implant materials have been used for dorsal augmentation. Recently, human acellular dermal matrices have been introduced as an implant material for dorsal augmentation, camouflaging autologous implants without an additional donor site. Here, we introduce a cross-linked human acellular dermal matrix as an implant material in augmentation rhinoplasty and share the clinical experiences. Eighteen patients who underwent augmentation rhinoplasty using acellular dermal matrix from April 2014 to November 2015 were reviewed retrospectively. Clinical outcomes and complications were assessed at the outpatient clinic during the follow-up period ranging from 8 to 38 months. Contour changes were assessed through comparison of preoperative and postoperative photographs by two independent plastic surgeons. Patient satisfaction was assessed at the outpatient clinic by six questions regarding aesthetic and functional aspects. Postoperative photographs demonstrated the height of the nasal dorsum did not decrease over time except two patients whose ADM was grafted into a subperiosteal pocket. Others who underwent supraperiosteal implantation showed acceptable maintenance of dorsal height. No major complication was reported. Overall, patient satisfaction scored 81.02 out of 100. Cross-linked human ADM has advantages of both autogenous and alloplastic materials. The surgical results remain stable without complications. Therefore, it is a suitable alternative implant material for dorsal augmentation in rhinoplasty. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Covalent organic framework as efficient desorption/ionization matrix for direct detection of small molecules by laser desorption/ionization mass spectrometry.

PubMed

Feng, Dan; Xia, Yan

2018-07-19

Covalent organic framework (COF) was explored as a novel matrix with a high desorption/ionization efficiency for direct detection of small molecules by laser desorption/ionization time-of-flight mass spectrometry (LDI-TOF MS). By using COF as an LDI MS matrix, we could detect not only biological micro molecules such as amino acids and fatty acids, but also emerging environmental pollutants like bisphenol S (BPS) and pyrene. With COF as the matrix, higher desorption/ionization efficiency, and less background interference were achieved than the conventional organic matrices. Good salt tolerance (as high as 500 mM NaCl) and repeatability allowed the detection limit of amino acids was 90 fmol. In addition, COF matrix performed well for amino acids analysis in the honey sample. The ionization mechanism was also discussed. These results demonstrate that COF is a powerful matrix for small molecules analysis in real samples by MS. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparison of Regenerative Tissue Quality following Matrix-Associated Cell Implantation Using Amplified Chondrocytes Compared to Synovium-Derived Stem Cells in a Rabbit Model for Cartilage Lesions.

PubMed

Schmal, Hagen; Kowal, Justyna M; Kassem, Moustapha; Seidenstuecker, Michael; Bernstein, Anke; Böttiger, Katharina; Xiong, Tanshiyue; Südkamp, Norbert P; Kubosch, Eva J

2018-01-01

Known problems of the autologous chondrocyte implantation motivate the search for cellular alternatives. The aim of the study was to test the potential of synovium-derived stem cells (SMSC) to regenerate cartilage using a matrix-associated implantation. In an osteochondral defect model of the medial femoral condyle in a rabbit, a collagen membrane was seeded with either culture-expanded allogenic chondrocytes or SMSC and then transplanted into the lesion. A tailored piece synovium served as a control. Rabbit SMSC formed typical cartilage in vitro. Macroscopic evaluation of defect healing and the thickness of the regenerated tissue did not reveal a significant difference between the intervention groups. However, instantaneous and shear modulus, reflecting the biomechanical strength of the repair tissue, was superior in the implantation group using allogenic chondrocytes ( p < 0.05). This correlated with a more chondrogenic structure and higher proteoglycan expression, resulting in a lower OARSI score ( p < 0.05). The repair tissue of all groups expressed comparable amounts of the collagen types I, II, and X. Cartilage regeneration following matrix-associated implantation using allogenic undifferentiated synovium-derived stem cells in a defect model in rabbits showed similar macroscopic results and collagen composition compared to amplified chondrocytes; however, biomechanical characteristics and histological scoring were inferior.

Comparison of Regenerative Tissue Quality following Matrix-Associated Cell Implantation Using Amplified Chondrocytes Compared to Synovium-Derived Stem Cells in a Rabbit Model for Cartilage Lesions

PubMed Central

Kowal, Justyna M.; Seidenstuecker, Michael; Bernstein, Anke; Böttiger, Katharina; Xiong, Tanshiyue; Südkamp, Norbert P.

2018-01-01

Known problems of the autologous chondrocyte implantation motivate the search for cellular alternatives. The aim of the study was to test the potential of synovium-derived stem cells (SMSC) to regenerate cartilage using a matrix-associated implantation. In an osteochondral defect model of the medial femoral condyle in a rabbit, a collagen membrane was seeded with either culture-expanded allogenic chondrocytes or SMSC and then transplanted into the lesion. A tailored piece synovium served as a control. Rabbit SMSC formed typical cartilage in vitro. Macroscopic evaluation of defect healing and the thickness of the regenerated tissue did not reveal a significant difference between the intervention groups. However, instantaneous and shear modulus, reflecting the biomechanical strength of the repair tissue, was superior in the implantation group using allogenic chondrocytes (p < 0.05). This correlated with a more chondrogenic structure and higher proteoglycan expression, resulting in a lower OARSI score (p < 0.05). The repair tissue of all groups expressed comparable amounts of the collagen types I, II, and X. Cartilage regeneration following matrix-associated implantation using allogenic undifferentiated synovium-derived stem cells in a defect model in rabbits showed similar macroscopic results and collagen composition compared to amplified chondrocytes; however, biomechanical characteristics and histological scoring were inferior. PMID:29765410

Establishing Early Functional Perfusion and Structure in Tissue Engineered Cardiac Constructs

PubMed Central

Wang, Bo; Patnaik, Sourav S.; Brazile, Bryn; Butler, J. Ryan; Claude, Andrew; Zhang, Ge; Guan, Jianjun; Hong, Yi; Liao, Jun

2016-01-01

Myocardial infarction (MI) causes massive heart muscle death and remains a leading cause of death in the world. Cardiac tissue engineering aims to replace the infarcted tissues with functional engineered heart muscles or revitalize the infarcted heart by delivering cells, bioactive factors, and/or biomaterials. One major challenge of cardiac tissue engineering and regeneration is the establishment of functional perfusion and structure to achieve timely angiogenesis and effective vascularization, which are essential to the survival of thick implants and the integration of repaired tissue with host heart. In this paper, we review four major approaches to promoting angiogenesis and vascularization in cardiac tissue engineering and regeneration: delivery of pro-angiogenic factors/molecules, direct cell implantation/cell sheet grafting, fabrication of prevascularized cardiac constructs, and the use of bioreactors to promote angiogenesis and vascularization. We further provide a detailed review and discussion on the early perfusion design in nature-derived biomaterials, synthetic biodegradable polymers, tissue-derived acellular scaffolds/whole hearts, and hydrogel derived from extracellular matrix. A better understanding of the current approaches and their advantages, limitations, and hurdles could be useful for developing better materials for future clinical applications. PMID:27480586

Establishing Early Functional Perfusion and Structure in Tissue Engineered Cardiac Constructs.

PubMed

Wang, Bo; Patnaik, Sourav S; Brazile, Bryn; Butler, J Ryan; Claude, Andrew; Zhang, Ge; Guan, Jianjun; Hong, Yi; Liao, Jun

2015-01-01

Myocardial infarction (MI) causes massive heart muscle death and remains a leading cause of death in the world. Cardiac tissue engineering aims to replace the infarcted tissues with functional engineered heart muscles or revitalize the infarcted heart by delivering cells, bioactive factors, and/or biomaterials. One major challenge of cardiac tissue engineering and regeneration is the establishment of functional perfusion and structure to achieve timely angiogenesis and effective vascularization, which are essential to the survival of thick implants and the integration of repaired tissue with host heart. In this paper, we review four major approaches to promoting angiogenesis and vascularization in cardiac tissue engineering and regeneration: delivery of pro-angiogenic factors/molecules, direct cell implantation/cell sheet grafting, fabrication of prevascularized cardiac constructs, and the use of bioreactors to promote angiogenesis and vascularization. We further provide a detailed review and discussion on the early perfusion design in nature-derived biomaterials, synthetic biodegradable polymers, tissue-derived acellular scaffolds/whole hearts, and hydrogel derived from extracellular matrix. A better understanding of the current approaches and their advantages, limitations, and hurdles could be useful for developing better materials for future clinical applications.

In vitro investigation of the effect of matrix molecules on the behavior of colon cancer cells under the effect of geldanamycin derivative.

PubMed

Vural, Kamil; Kosova, Funda; Kurt, Feyzan Özdal; Tuğlu, İbrahim

2017-10-01

The chaperone-binding drug, 17-allylamino-17-demethoxygeldanamycin, has recently come into clinical use. It is a derivative of geldanamycin, an ansamycin benzoquinone antibiotic with anti-carcinogenic effect. Understanding the effect of this drug on the cancer cells and their niche is important for treatment. We applied 17-allylamino-17-demethoxygeldanamycin to colon cancer cell line (Colo 205) on matrix molecules to investigate the relationship of apoptosis with terminal deoxynucleotidyl transferase dUTP nick end labeling immunocytochemistry and related gene expression. We used laminin and collagen I for matrix molecules and vascular endothelial growth factor for angiogenic structure. We also examined apoptosis-related signaling pathway including mitochondrial proteins, cytochrome c, Bcl-2, caspase-9, Apaf-1 expression using real-time polymerase chain reaction. There was clear effect of 17-allylamino-17-demethoxygeldanamycin that killed more cells on tissue culture plastic compared to matrix molecules. The IC 50 value was 0.58 µg/mL for tissue culture plastic compared with 0.64 µg/mL for laminin and 0.75 µg/mL for collagen I. The analyses showed that more cells on matrix molecules underwent apoptosis compared to that on tissue culture plastic. Apoptosis-related gene expression was similar in which Bcl-2 expression decreased and proapoptotic gene expression of the cells on matrix molecules increased compared to that on tissue culture plastic. However, the application of 17-allylamino-17-demethoxygeldanamycin was more effective for the cells on collagen I compared to the cells on laminin. There was also a decrease in angiogenesis as shown by the vascular endothelial growth factor staining. This was more pronounced by coating of the tissue culture plastic with matrix molecules. Our results supported the anti-cancer effect of 17-allylamino-17-demethoxygeldanamycin, and this effect depended on matrix molecules. This effect occurs through apoptosis, and related genes were also altered. All these genes may serve for novel target under the effect of matrix substrate. However, correct interpretation of the results requires further studies.

Extracellular matrix proteins as temporary coating for thin-film neural implants

NASA Astrophysics Data System (ADS)

Ceyssens, Frederik; Deprez, Marjolijn; Turner, Neill; Kil, Dries; van Kuyck, Kris; Welkenhuysen, Marleen; Nuttin, Bart; Badylak, Stephen; Puers, Robert

2017-02-01

Objective. This study investigates the suitability of a thin sheet of extracellular matrix (ECM) proteins as a resorbable coating for temporarily reinforcing fragile or ultra-low stiffness thin-film neural implants to be placed on the brain, i.e. microelectrocorticographic (µECOG) implants. Approach. Thin-film polyimide-based electrode arrays were fabricated using lithographic methods. ECM was harvested from porcine tissue by a decellularization method and coated around the arrays. Mechanical tests and an in vivo experiment on rats were conducted, followed by a histological tissue study combined with a statistical equivalence test (confidence interval approach, 0.05 significance level) to compare the test group with an uncoated control group. Main results. After 3 months, no significant damage was found based on GFAP and NeuN staining of the relevant brain areas. Significance. The study shows that ECM sheets are a suitable temporary coating for thin µECOG neural implants.

Implant Composed of Demineralized Bone and Mesenchymal Stem Cells Genetically Modified with AdBMP2/AdBMP7 for the Regeneration of Bone Fractures in Ovis aries.

PubMed

Hernandez-Hurtado, Adelina A; Borrego-Soto, Gissela; Marino-Martinez, Ivan A; Lara-Arias, Jorge; Romero-Diaz, Viktor J; Abrego-Guerra, Adalberto; Vilchez-Cavazos, Jose F; Elizondo-Riojas, Guillermo; Martinez-Rodriguez, Herminia G; Espinoza-Juarez, Marcela A; Lopez-Romero, Gloria C; Robles-Zamora, Alejandro; Mendoza Lemus, Oscar F; Ortiz-Lopez, Rocio; Rojas-Martinez, Augusto

2016-01-01

Adipose-derived mesenchymal stem cells (ADMSCs) are inducible to an osteogenic phenotype by the bone morphogenetic proteins (BMPs). This facilitates the generation of implants for bone tissue regeneration. This study evaluated the in vitro osteogenic differentiation of ADMSCs transduced individually and in combination with adenoviral vectors expressing BMP2 and BMP7. Moreover, the effectiveness of the implant containing ADMSCs transduced with the adenoviral vectors AdBMP2/AdBMP7 and embedded in demineralized bone matrix (DBM) was tested in a model of tibial fracture in sheep. This graft was compared to ewes implanted with untransduced ADMSCs embedded in the same matrix and with injured but untreated animals. In vivo results showed accelerated osteogenesis in the group treated with the AdBMP2/AdBMP7 transduced ADMSC graft, which also showed improved restoration of the normal bone morphology.

Coating with a Modular Bone Morphogenetic Peptide Promotes Healing of a Bone-Implant Gap in an Ovine Model

PubMed Central

Lu, Yan; Lee, Jae Sung; Nemke, Brett; Graf, Ben K.; Royalty, Kevin; Illgen, Richard; Vanderby, Ray; Markel, Mark D.; Murphy, William L.

2012-01-01

Despite the potential for growth factor delivery strategies to promote orthopedic implant healing, there is a need for growth factor delivery methods that are controllable and amenable to clinical translation. We have developed a modular bone growth factor, herein termed “modular bone morphogenetic peptide (mBMP)”, which was designed to efficiently bind to the surface of orthopedic implants and also stimulate new bone formation. The purpose of this study was to coat a hydroxyapatite-titanium implant with mBMP and evaluate bone healing across a bone-implant gap in the sheep femoral condyle. The mBMP molecules efficiently bound to a hydroxyapatite-titanium implant and 64% of the initially bound mBMP molecules were released in a sustained manner over 28 days. The results demonstrated that the mBMP-coated implant group had significantly more mineralized bone filling in the implant-bone gap than the control group in C-arm computed tomography (DynaCT) scanning (25% more), histological (35% more) and microradiographic images (50% more). Push-out stiffness of the mBMP group was nearly 40% greater than that of control group whereas peak force did not show a significant difference. The results of this study demonstrated that mBMP coated on a hydroxyapatite-titanium implant stimulates new bone formation and may be useful to improve implant fixation in total joint arthroplasty applications. PMID:23185610

Immediate Implant Placement of a Single Central Incisor Using a CAD/CAM Crown-Root Form Technique: Provisional to Final Restoration.

PubMed

Vafiadis, Dean; Goldstein, Gary; Garber, David; Lambrakos, Anthony; Kowalski, Bj

2017-02-01

Preserving soft and hard tissues after extraction and implant placement is crucial for anterior esthetics. This technique will show how the information gathered from a cone-beam computed tomography (CBCT) scan of the maxillary left central incisor and an intra-oral digital impression can be merged to fabricate a CAD/CAM crown-root matrix to be used as an immediate provisional restoration that mimics the natural anatomy. Due to trauma, a left central incisor appeared to be fractured and was scheduled for extraction and implant placement. The crown-root configuration captured by the CBCT scan was merged with the digital files from an intra-oral digital impression. A CAD/CAM crown-root matrix was fabricated. Because the matrix shell was fabricated with the exact anatomy of the natural tooth, it replicated the position and three dimensional anatomy of the soft and hard tissue. It was connected to the implant with a customized provisional abutment. A digital impression of a coded healing abutment was made to fabricate the final implant abutment and final restoration. Throughout the treatment time and 36 months after completion, the thickness of tissue, emergence profile, and adjacent papilla was analyzed by clinical evaluation and photography and seemed to be maintained. The use of a pre-operative intra-oral digital scan of the clinical crown-root architecture and the CBCT scan of the bone/root anatomy, can be used together to fabricate a CAD/CAM crown-root form provisional matrix. This digital design helps in the preservation of the 3D tissue topography, as well as the final restoration. The preservation of soft and hard tissue after extraction and implant placement has always been paramount for ideal anterior implant esthetics. Using the information from digital files from CBCT scans and intra-oral scans may help the clinician identify critical anatomical features that can be replicated in the provisional and final CAD/CAM restoration. (J Esthet Restor Dent 29:13-21, 2017). © 2016 Wiley Periodicals, Inc.

Extracellular matrix regenerative graft attenuates the negative impact of polypropylene prolapse mesh on vagina in rhesus macaque.

PubMed

Liang, Rui; Knight, Katrina; Barone, William; Powers, Robert W; Nolfi, Alexis; Palcsey, Stacy; Abramowitch, Steven; Moalli, Pamela A

2017-02-01

The use of wide pore lightweight polypropylene mesh to improve anatomical outcomes in the surgical repair of prolapse has been hampered by mesh complications. One of the prototype prolapse meshes has been found to negatively impact the vagina by inducing a decrease in smooth muscle volume and contractility and the degradation of key structural proteins (collagen and elastin), resulting in vaginal degeneration. Recently, bioscaffolds derived from extracellular matrix have been used to mediate tissue regeneration and have been widely adopted in tissue engineering applications. Here we aimed to: (1) define whether augmentation of a polypropylene prolapse mesh with an extracellular matrix regenerative graft in a primate sacrocolpopexy model could mitigate the degenerative changes; and (2) determine the impact of the extracellular matrix graft on vagina when implanted alone. A polypropylene-extracellular matrix composite graft (n = 9) and a 6-layered extracellular matrix graft alone (n = 8) were implanted in 17 middle-aged parous rhesus macaques via sacrocolpopexy and compared to historical data obtained from sham (n = 12) and the polypropylene mesh (n = 12) implanted by the same method. Vaginal function was measured in passive (ball-burst test) and active (smooth muscle contractility) mechanical tests. Vaginal histomorphologic/biochemical assessments included hematoxylin-eosin and trichrome staining, immunofluorescent labeling of α-smooth muscle actin and apoptotic cells, measurement of total collagen, collagen subtypes (ratio III/I), mature elastin, and sulfated glycosaminoglycans. Statistical analyses included 1-way analysis of variance, Kruskal-Wallis, and appropriate post-hoc tests. The host inflammatory response in the composite mesh-implanted vagina was reduced compared to that following implantation with the polypropylene mesh alone. The increase in apoptotic cells observed with the polypropylene mesh was blunted in the composite (overall P < .001). Passive mechanical testing showed inferior parameters for both polypropylene mesh alone and the composite compared to sham whereas the contractility and thickness of smooth muscle layer in the composite were improved with a value similar to sham, which was distinct from the decreases observed with polypropylene mesh alone. Biochemically, the composite had similar mature elastin content, sulfated glycosaminoglycan content, and collagen subtype III/I ratio but lower total collagen content when compared to sham (P = .011). Multilayered extracellular matrix graft alone showed overall comparable values to sham in aspects of the biomechanical, histomorphologic, or biochemical endpoints of the vagina. The increased collagen subtype ratio III/I with the extracellular matrix graft alone (P = .033 compared to sham) is consistent with an ongoing active remodeling response. Mesh augmentation with a regenerative extracellular matrix graft attenuated the negative impact of polypropylene mesh on the vagina. Application of the extracellular matrix graft alone had no measurable negative effects suggesting that the benefits of this extracellular matrix graft occur when used without a permanent material. Future studies will focus on understanding mechanisms. Copyright © 2016. Published by Elsevier Inc.

Extracellular matrix regenerative graft attenuates the negative impact of polypropylene prolapse mesh on vagina in rhesus macaque

PubMed Central

Liang, Rui; Knight, Katrina; Barone, William; Powers, Robert W.; Nolfi, Alexis; Palcsey, Stacy; Abramowitch, Steven; Moalli, Pamela A.

2016-01-01

BACKGROUND The use of wide pore lightweight polypropylene mesh to improve anatomical outcomes in the surgical repair of prolapse has been hampered by mesh complications. One of the prototype prolapse meshes has been found to negatively impact the vagina by inducing a decrease in smooth muscle volume and contractility and the degradation of key structural proteins (collagen and elastin), resulting in vaginal degeneration. Recently, bioscaffolds derived from extracellular matrix have been used to mediate tissue regeneration and have been widely adopted in tissue engineering applications. OBJECTIVE Here we aimed to: (1) define whether augmentation of a polypropylene prolapse mesh with an extracellular matrix regenerative graft in a primate sacrocolpopexy model could mitigate the degenerative changes; and (2) determine the impact of the extracellular matrix graft on vagina when implanted alone. STUDY DESIGN A polypropylene-extracellular matrix composite graft (n = 9) and a 6-layered extracellular matrix graft alone (n = 8) were implanted in 17 middle-aged parous rhesus macaques via sacrocolpopexy and compared to historical data obtained from sham (n = 12) and the polypropylene mesh (n = 12) implanted by the same method. Vaginal function was measured in passive (ball-burst test) and active (smooth muscle contractility) mechanical tests. Vaginal histomorphologic/ biochemical assessments included hematoxylin-eosin and trichrome staining, immunofluorescent labeling of α-smooth muscle actin and apoptotic cells, measurement of total collagen, collagen subtypes (ratio III/ I), mature elastin, and sulfated glycosaminoglycans. Statistical analyses included 1-way analysis of variance, Kruskal-Wallis, and appropriate posthoc tests. RESULTS The host inflammatory response in the composite mesh-implanted vagina was reduced compared to that following implantation with the polypropylene mesh alone. The increase in apoptotic cells observed with the polypropylene mesh was blunted in the composite (overall P < .001). Passive mechanical testing showed inferior parameters for both polypropylene mesh alone and the composite compared to sham whereas the contractility and thickness of smooth muscle layer in the composite were improved with a value similar to sham, which was distinct from the decreases observed with polypropylene mesh alone. Biochemically, the composite had similar mature elastin content, sulfated glycosaminoglycan content, and collagen subtype III/I ratio but lower total collagen content when compared to sham (P = .011). Multilayered extracellular matrix graft alone showed overall comparable values to sham in aspects of the biomechanical, histomorphologic, or biochemical end-points of the vagina. The increased collagen subtype ratio III/I with the extracellular matrix graft alone (P = .033 compared to sham) is consistent with an ongoing active remodeling response. CONCLUSION Mesh augmentation with a regenerative extracellular matrix graft attenuated the negative impact of polypropylene mesh on the vagina. Application of the extracellular matrix graft alone had no measurable negative effects suggesting that the benefits of this extra-cellular matrix graft occur when used without a permanent material. Future studies will focus on understanding mechanisms. PMID:27615441

Advances in the Surgical Management of Articular Cartilage Defects: Autologous Chondrocyte Implantation Techniques in the Pipeline.

PubMed

Stein, Spencer; Strauss, Eric; Bosco, Joseph

2013-01-01

The purpose of this review is to gain insight into the latest methods of articular cartilage implantation (ACI) and to detail where they are in the Food and Drug Administration approval and regulatory process. A PubMed search was performed using the phrase "Autologous Chondrocyte Implantation" alone and with the words second generation and third generation. Additionally, clinicaltrials.gov was searched for the names of the seven specific procedures and the parent company websites were referenced. Two-Stage Techniques: BioCart II uses a FGF2v1 culture and a fibrinogen, thrombin matrix, whereas Hyalograft-C uses a Hyaff 11 matrix. MACI uses a collagen I/III matrix. Cartipatch consists of an agarose-alginate hydrogel. Neocart uses a high-pressure bioreactor for culturing with a type I collagen matrix. ChondroCelect makes use of a gene expression analysis to predict chondrocyte proliferation and has demonstrated significant clinical improvement, but failed to show superiority to microfracture in a phase III trial. One Step Technique: CAIS is an ACI procedure where harvested cartilage is minced and implanted into a matrix for defect filling. As full thickness defects in articular cartilage continue to pose a challenge to treat, new methods of repair are being researched. Later generation ACI has been developed to address the prevalence of fibrocartilage with microfracture and the complications associated with the periosteal flap of first generation ACI such as periosteal hypertrophy. The procedures and products reviewed here represent advances in tissue engineering, scaffolds and autologous chondrocyte culturing that may hold promise in our quest to alter the natural history of symptomatic chondral disease.

Neural cell adhesion molecule-deficient beta-cell tumorigenesis results in diminished extracellular matrix molecule expression and tumour cell-matrix adhesion.

PubMed

Håkansson, Joakim; Xian, Xiaojie; He, Liqun; Ståhlberg, Anders; Nelander, Sven; Samuelsson, Tore; Kubista, Mikael; Semb, Henrik

2005-01-01

To understand by which mechanism neural cell adhesion molecule (N-CAM) limits beta tumour cell disaggregation and dissemination, we searched for potential downstream genes of N-CAM during beta tumour cell progression by gene expression profiling. Here, we show that N-CAM-deficient beta-cell tumorigenesis is associated with changes in the expression of genes involved in cell-matrix adhesion and cytoskeletal dynamics, biological processes known to affect the invasive and metastatic behaviour of tumour cells. The extracellular matrix (ECM) molecules emerged as the primary target, i.e. N-CAM deficiency resulted in down-regulated mRNA expression of a broad range of ECM molecules. Consistent with this result, deficient deposition of major ECM stromal components, such as fibronectin, laminin 1 and collagen IV, was observed. Moreover, N-CAM-deficient tumour cells displayed defective matrix adhesion. These results offer a potential mechanism for tumour cell disaggregation during N-CAM-deficient beta tumour cell progression. Prospective consequences of these findings for the role of N-CAM in beta tumour cell dissemination are discussed.

Neuroprotective effects of collagen matrix in rats after traumatic brain injury.

PubMed

Shin, Samuel S; Grandhi, Ramesh; Henchir, Jeremy; Yan, Hong Q; Badylak, Stephen F; Dixon, C Edward

2015-01-01

In previous studies, collagen based matrices have been implanted into the site of lesion in different models of brain injury. We hypothesized that semisynthetic collagen matrix can have neuroprotective function in the setting of traumatic brain injury. Rats were subjected to sham injury or controlled cortical impact. They either received extracellular matrix graft (DuraGen) over the injury site or did not receive any graft and underwent beam balance/beam walking test at post injury days 1-5 and Morris water maze at post injury days 14-18. Animals were sacrificed at day 18 for tissue analysis. Collagen matrix implantation in injured rats did not affect motor function (beam balance test: p = 0.627, beam walking test: p = 0.921). However, injured group with collagen matrix had significantly better spatial memory acquisition (p < 0.05). There was a significant reduction in lesion volume, as well as neuronal loss in CA1 (p < 0.001) and CA3 (p < 0.05) regions of the hippocampus in injured group with collagen matrix (p < 0.05). Collagen matrix reduces contusional lesion volume, neuronal loss, and cognitive deficit after traumatic brain injury. Further studies are needed to demonstrate the mechanisms of neuroprotection by collagen matrix.

Distribution of pericellular matrix molecules in the temporomandibular joint and their chondroprotective effects against inflammation

PubMed Central

Chu, Wern Cui; Zhang, Shipin; Sng, Timothy J; Ong, Yu Jie; Tan, Wen-Li; Ang, Vivien Y; Foldager, Casper B; Toh, Wei Seong

2017-01-01

The objectives of this study were to (1) determine the distribution and synthesis of pericellular matrix (PCM) molecules (collagen VI, collagen IV and laminin) in rat temporomandibular joint (TMJ) and (2) investigate the effects of PCM molecules on chondrocytes against inflammation in osteoarthritis. Four zones (fibrous, proliferating, mature and hypertrophic) of condylar cartilage and three bands (anterior, intermediate and posterior) of disc were analysed by immunohistochemistry for the presence of PCM molecules in rat TMJs. Isolated chondrocytes were pre-treated with PCM molecules before being subjected to interleukin (IL)-1β treatment to stimulate inflammation. The responses of the chondrocytes were analysed using gene expression, nitric oxide release and matrix metalloproteinase (MMP)-13 production measures. Histomorphometric analyses revealed that the highest areal deposition of collagen VI (67.4%), collagen IV (45.7%) and laminin (52.4%) was in the proliferating zone of TMJ condylar cartilage. No significant difference in the distribution of PCM molecules was noted among the three bands of the TMJ disc. All three PCM molecules were expressed intracellularly by chondrocytes cultured in the monolayer. Among the PCM molecules, pre-treatment with collagen VI enhanced cellular proliferation, ameliorated IL-1β-induced MMP-3, MMP-9, MMP-13 and inducible nitric oxide synthase gene expression, and attenuated the downregulation of cartilage matrix genes, including collagen I, aggrecan and cartilage oligomeric matrix protein (COMP). Concurrently, collagen VI pretreatment inhibited nitric oxide and MMP-13 production. Our study demonstrates for the first time the distribution and role of PCM molecules, particularly collagen VI, in the protection of chondrocytes against inflammation. PMID:28282029

Studies on Relaxation Behavior of Corona Poled Aromatic Dipolar Molecules in a Polymer Matrix

DTIC Science & Technology

1990-08-03

concentration upto 30 weight percent. Orientation As expected optically responsive molecules are randomly oriented in the polymer matrix although a small amount...INSERT Figure 4 The retention of SH intensity of the small molecule such as MNA was found to be very poor in the PMMA matrix while the larger rodlike...Polym. Prepr. Am. Chem. Soc., Div. Polym. Chem. 24(2), 309 (1983). 16.- H. Ringsdorf and H. W. Schmidt. Makromol. Chem. 185, 1327 (1984). 17. S. Musikant

Histological and histomorphometrical analysis of a silica matrix embedded nanocrystalline hydroxyapatite bone substitute using the subcutaneous implantation model in Wistar rats.

PubMed

Ghanaati, Shahram; Orth, Carina; Barbeck, Mike; Willershausen, Ines; Thimm, Benjamin W; Booms, Patrick; Stübinger, Stefan; Landes, Constantin; Sader, Robert Anton; Kirkpatrick, Charles James

2010-06-01

The clinical suitability of a bone substitute material is determined by the ability to induce a tissue reaction specific to its composition. The aim of this in vivo study was to analyze the tissue reaction to a silica matrix-embedded, nanocrystalline hydroxyapatite bone substitute.The subcutaneous implantation model in Wistar rats was chosen to assess the effect of silica degradation on the vascularization of the biomaterial and its biodegradation within a time period of 6 months. Already at day 10 after implantation, histomorphometrical analysis showed that the vascularization of the implantation bed reached its peak value compared to all other time points. Both vessel density and vascularization significantly decreased until day 90 after implantation. In this time period, the bone substitute underwent a significant degradation initiated by TRAP-positive and TRAP-negative multinucleated giant cells together with macrophages and lymphocytes. Although no specific tissue reaction could be related to the described silica degradation, the biomaterial was close to being fully degraded without a severe inflammatory response. These characteristics are advantageous for bone regeneration and remodeling processes.

Low-temperature matrix effects on orientational motion of Methyl radical trapped in gas solids: Angular tunneling vs. libration

NASA Astrophysics Data System (ADS)

Dmitriev, Yurij A.; Zelenetckii, Ilia A.; Benetis, Nikolas P.

2018-05-01

EPR investigation of the lineshape of matrix -isolated methyl radical, CH3, spectra recorded in solid N2O and CO2 was carried out. Reversible temperature-dependent line width anisotropy was observed in both matrices. This effect is a fingerprint of the extra-slow radical rotation about the in-plane C2 axes. The rotation was found to be anisotropic and closely correlated to the orientational dynamics of the matrix molecules. It was suggested that a recently discovered "hoping precession" effect of matrix molecules in solid CO2 is a common feature of matrices of the linear molecules CO, N2O, and CO2. A new low-temperature matrix effect, referred to as "libration trap", was proposed which accounts for the changing CH3 reorientational motion about the radical C3-axis from rotation to libration. Temperature dependence of the intensity of the EPR satellites produced by these nonrotating-but librating methyls was presented. This allowed for a rough estimation of the rotation hindering potential due to correlation mismatch between the radical and the nearest matrix molecules' librations.

A 3-year clinical and radiographic study of implants placed simultaneously with maxillary sinus floor augmentations using a new nanocrystalline hydroxyapatite.

PubMed

Heinemann, F; Mundt, T; Biffar, R; Gedrange, T; Goetz, W

2009-12-01

The aims of this case series was to evaluate the success rate of implants and their restorations, the sinus bone graft resorption, and the marginal bone loss around the implants when nanocristalline HA embedded in a silica matrix was exclusively used as grafting material. In 13 partially edentulous patients of a private practice having missing teeth in the posterior maxilla and a subantral bone height between 3 and 7 mm, 19 sinus augmentations (100% Nanobone, Artoss, Rostock, Germany) by the lateral lift technique were performed. The implants (Tiolox/Tiologic Implants, Dentaurum, Ispringen, Germany) were simultaneously placed. After 6 to 9 months 37 implants were restored with fixed dental prostheses. The clinical evaluation included peri-implant parameters, periotest measurements and the restorations. The radiographic bone heights over time were estimated with linear mixed models. The implant success rate was 100% after three years. The periotest values (between -7 and -6) after implant abutment connection indicated a solid osseointegration. The mean rates of the marginal bone loss over the first year were higher (mesial: -0.55, distal: -0.51 mm) than the annual rates thereafter (mesial: -0.09 mm, distal: -0.08 mm). The mean rates of changes in the total bone height were neglectable (<0.2 mm) and not significant. The prosthodontic and esthetic evaluation revealed a successful outcome. Within the limits of this clinical report it may be concluded that maxillary sinus augmentation using 100% nanocristalline HA embedded in a silica matrix to support implants is a reliable procedure.

Clinical and radiographic evaluation of copolymerized Polylactic/polyglycolic acids as a bone filler in combination with a cellular dermal matrix graft around immediate implants

PubMed Central

Soliman, Mahitab M.; Zaki, Azza Abdulrahman; El Gazaerly, Hanaa Mohamed; Shemmrani, Ammar Al; Sorour, Abd El Latif

2014-01-01

Objective This study was conducted to evaluate clinically and radiographically the use of a cellular dermal matrix allograft (Alloderm) in combination with PLA/PGA (Fisiograft) around immediate implants. Materials and Methods Fourteen patients were included in this study, three patients received two implants, total of seventeen implants were placed. Periapical radiographs and orthopantomographs were taken. The selected teeth were extracted atraumatically after the reflection of full thickness flaps. One-piece Zimmer implants were placed immediately into the sockets. Weeks from implantation, radiographic evaluation was made at 6 Fisiograft in powder form was placed in the osseous defects around the implants. The implants were immediately restored with provisional crowns free from occlusion. Patients were clinically evaluated at 3, 6, and 14 months after loading which was done after 6 weeks from implantation. Radiographic evaluation was made at 6 and 14 months from implant placement. Results showed that immediate implantation was successful in sixteen out of seventeen implants, clinical parameters regarding plaque index, gingival index, there was a slight decrease through the follow-up periods from 3 to 14 months but it was non-significant, while there was a significant decrease in the probing depth. Radiographically there was a significant increase in the bone density from 6 to 14 months post loading, while the vertical bone defect was significantly decreased. The fisiograft functioned well as space maker and scaffolding material. The Alloderm performed well as a membrane to be used in association with immediate implants and it has a good potentiality for increasing the width of the keratinized gingiva, which is an important feature for implant esthetics. Conclusion the combination technique between the bone graft and the membrane proved to be successful to overcome dehiscence and osseous defects around immediate implants. PMID:25780357

Non-covalent interactions of a drug molecule encapsulated in a hybrid silica gel.

PubMed

Paul, Geo; Steuernagel, Stefan; Koller, Hubert

2007-12-28

The drug molecule Propranolol has been encapsulated by a sol-gel process in an organic-inorganic hybrid matrix by in-situ self-assembly; the 2D HETCOR solid state NMR spectroscopy provides direct proof of the intimate spatial relationship between the host matrix and guest drug molecules.

Fabrication of poly(vinyl carbazole) waveguides by oxygen ion implantation

NASA Astrophysics Data System (ADS)

Ghailane, Fatima; Manivannan, Gurusamy; Knystautas, Émile J.; Lessard, Roger A.

1995-08-01

Polymer waveguides were fabricated by ion implantation involving poly(vinyl carbazole) films. This material was implanted by oxygen ions (O ++ ) of energies ranging from 50 to 250 keV. The ion doses varied from 1010 to 1015 ions / cm2. The conventional prism-film coupler method was used to determine the waveguiding nature of the implanted and unimplanted films. The increase of the surface refractive index in the implanted layer has been studied by measuring the effective refractive index (neff) for different optical modes. Electron spectroscopy chemical analysis measurements were also performed to assess the effect of ion implantation on the polymer matrix.

Development of an Injectable Salmon Fibrinogen-Thrombin Matrix to Enhance Healing of Compound Fractures of Extremities

DTIC Science & Technology

2011-10-01

of bone regeneration in animals treated with different implantable matrix. The material to be tested in this project is a salmon fibrin matrix... Buprenorphine and metacam (Meloxicam) are also administered at the time of surgery for short term pain relief. Fluoroscopy is performed before and after injury

Strontium-doped hydroxyapatite polysaccharide materials effect on ectopic bone formation

PubMed Central

Aid-Launais, R.; Sagardoy, T.; Siadous, R.; Bareille, R.; Rey, S.; Pechev, S.; Etienne, L.; Kalisky, J.; de Mones, E.; Letourneur, D.; Amedee Vilamitjana, J.

2017-01-01

Previous studies performed using polysaccharide-based matrices supplemented with hydroxyapatite (HA) particles showed their ability to form in subcutaneous and intramuscular sites a mineralized and osteoid tissue. Our objectives are to optimize the HA content in the matrix and to test the combination of HA with strontium (Sr-HA) to increase the matrix bioactivity. First, non-doped Sr-HA powders were combined to the matrix at three different ratios and were implanted subcutaneously for 2 and 4 weeks. Interestingly, matrices showed radiolucent properties before implantation. Quantitative analysis of micro-CT data evidenced a significant increase of mineralized tissue formed ectopically with time of implantation and allowed us to select the best ratio of HA to polysaccharides of 30% (w/w). Then, two Sr-substitution of 8% and 50% were incorporated in the HA powders (8Sr-HA and 50Sr-HA). Both Sr-HA were chemically characterized and dispersed in matrices. In vitro studies performed with human mesenchymal stem cells (MSCs) demonstrated the absence of cytotoxicity of the Sr-doped matrices whatever the amount of incorporated Sr. They also supported osteoblastic differentiation and activated the expression of one late osteoblastic marker involved in the mineralization process i.e. osteopontin. In vivo, subcutaneous implantation of these Sr-doped matrices induced osteoid tissue and blood vessels formation. PMID:28910401

Extracellular matrix mediators of metastatic cell colonization characterized using scaffold mimics of the pre-metastatic niche

PubMed Central

Aguado, Brian A.; Caffe, Jordan R.; Nanavati, Dhaval; Rao, Shreyas S.; Bushnell, Grace G.; Azarin, Samira M.; Shea, Lonnie D.

2016-01-01

Metastatic tumor cells colonize the pre-metastatic niche, which is a complex microenvironment consisting partially of extracellular matrix (ECM) proteins. We sought to identify and validate novel contributors to tumor cell colonization using ECM coated poly(ε-caprolactone) (PCL) scaffolds as mimics of the pre-metastatic niche. Utilizing orthotopic breast cancer mouse models, fibronectin and collagen IV-coated scaffolds implanted in the subcutaneous space captured colonizing tumor cells, showing a greater than 2-fold increase in tumor cell accumulation at the implant site compared to uncoated scaffolds. As a strategy to identify additional ECM colonization contributors, decellularized matrix (DCM) from lungs and livers containing metastatic tumors were characterized. In vitro, metastatic cell adhesion was increased on DCM coatings from diseased organs relative to healthy DCM. Furthermore, in vivo implantations of diseased DCM-coated scaffolds had increased tumor cell colonization relative to healthy DCM coatings. Mass-spectrometry proteomics was performed on healthy and diseased DCM to identify candidates associated with colonization. Myeloperoxidase was identified as abundantly present in diseased organs and validated as a contributor to colonization using myeloperoxidase-coated scaffold implants. This work identified novel ECM proteins associated with colonization using decellularization and proteomics techniques and validated candidates using a scaffold to mimic the pre-metastatic niche. PMID:26844426

Proteoliposomes as matrix vesicles’ biomimetics to study the initiation of skeletal mineralization

PubMed Central

Simão, A.M.S.; Yadav, M.C.; Ciancaglini, P.; Millán, J.L.

2017-01-01

During the process of endochondral bone formation, chondrocytes and osteoblasts mineralize their extracellular matrix by promoting the formation of hydroxyapatite (HA) seed crystals in the sheltered interior of membrane-limited matrix vesicles (MVs). Ion transporters control the availability of phosphate and calcium needed for HA deposition. The lipidic microenvironment in which MV-associated enzymes and transporters function plays a crucial physiological role and must be taken into account when attempting to elucidate their interplay during the initiation of biomineralization. In this short mini-review, we discuss the potential use of proteoliposome systems as chondrocyte- and osteoblast-derived MVs biomimetics, as a means of reconstituting a phospholipid microenvironment in a manner that recapitulates the native functional MV microenvironment. Such a system can be used to elucidate the interplay of MV enzymes during catalysis of biomineralization substrates and in modulating in vitro calcification. As such, the enzymatic defects associated with disease-causing mutations in MV enzymes could be studied in an artificial vesicular environment that better mimics their in vivo biological milieu. These artificial systems could also be used for the screening of small molecule compounds able to modulate the activity of MV enzymes for potential therapeutic uses. Such a nanovesicular system could also prove useful for the repair/treatment of craniofacial and other skeletal defects and to facilitate the mineralization of titanium-based tooth implants. PMID:20401430

Proteoliposomes as matrix vesicles' biomimetics to study the initiation of skeletal mineralization.

PubMed

Simão, A M S; Yadav, M C; Ciancaglini, P; Millán, J L

2010-03-01

During the process of endochondral bone formation, chondrocytes and osteoblasts mineralize their extracellular matrix by promoting the formation of hydroxyapatite (HA) seed crystals in the sheltered interior of membrane-limited matrix vesicles (MVs). Ion transporters control the availability of phosphate and calcium needed for HA deposition. The lipidic microenvironment in which MV-associated enzymes and transporters function plays a crucial physiological role and must be taken into account when attempting to elucidate their interplay during the initiation of biomineralization. In this short mini-review, we discuss the potential use of proteoliposome systems as chondrocyte- and osteoblast-derived MVs biomimetics, as a means of reconstituting a phospholipid microenvironment in a manner that recapitulates the native functional MV microenvironment. Such a system can be used to elucidate the interplay of MV enzymes during catalysis of biomineralization substrates and in modulating in vitro calcification. As such, the enzymatic defects associated with disease-causing mutations in MV enzymes could be studied in an artificial vesicular environment that better mimics their in vivo biological milieu. These artificial systems could also be used for the screening of small molecule compounds able to modulate the activity of MV enzymes for potential therapeutic uses. Such a nanovesicular system could also prove useful for the repair/treatment of craniofacial and other skeletal defects and to facilitate the mineralization of titanium-based tooth implants.

Solute diffusion through fibrotic tissue formed around protective cage system for implantable devices.

PubMed

Prihandana, Gunawan Setia; Ito, Hikaru; Tanimura, Kohei; Yagi, Hiroshi; Hori, Yuki; Soykan, Orhan; Sudo, Ryo; Miki, Norihisa

2015-08-01

This article presents the concept of an implantable cage system that can house and protect implanted biomedical sensing and therapeutic devices in the body. Cylinder-shaped cages made of porous polyvinyl alcohol (PVA) sheets with an 80-µm pore size and/or stainless steel meshes with 0.54-mm openings were implanted subcutaneously in the dorsal region of rats for 5 weeks. Analysis of the explanted cages showed the formation of fibrosis tissue around the cages. PVA cages had fibrotic tissue growing mostly along the outer surface of cages, while stainless steel cages had fibrotic tissue growing into the inside surface of the cage structure, due to the larger porosity of the stainless steel meshes. As the detection of target molecules with short time lags for biosensors and mass transport with low diffusion resistance into and out of certain therapeutic devices are critical for the success of such devices, we examined whether the fibrous tissue formed around the cages were permeable to molecules of our interest. For that purpose, bath diffusion and microfluidic chamber diffusion experiments using solutions containing the target molecules were performed. Diffusion of sodium, potassium and urea through the fibrosis tissue was confirmed, thus suggesting the potential of these cylindrical cages surrounded by fibrosis tissue to successfully encase implantable sensors and therapeutic apparatus. © 2014 Wiley Periodicals, Inc.

In Vitro Analysis of Cartilage Regeneration Using a Collagen Type I Hydrogel (CaReS) in the Bovine Cartilage Punch Model.

PubMed

Horbert, Victoria; Xin, Long; Foehr, Peter; Brinkmann, Olaf; Bungartz, Matthias; Burgkart, Rainer H; Graeve, T; Kinne, Raimund W

2018-02-01

Objective Limitations of matrix-assisted autologous chondrocyte implantation to regenerate functional hyaline cartilage demand a better understanding of the underlying cellular/molecular processes. Thus, the regenerative capacity of a clinically approved hydrogel collagen type I implant was tested in a standardized bovine cartilage punch model. Methods Cartilage rings (outer diameter 6 mm; inner defect diameter 2 mm) were prepared from the bovine trochlear groove. Collagen implants (± bovine chondrocytes) were placed inside the cartilage rings and cultured up to 12 weeks. Cartilage-implant constructs were analyzed by histology (hematoxylin/eosin; safranin O), immunohistology (aggrecan, collagens 1 and 2), and for protein content, RNA expression, and implant push-out force. Results Cartilage-implant constructs revealed vital morphology, preserved matrix integrity throughout culture, progressive, but slight proteoglycan loss from the "host" cartilage or its surface and decreasing proteoglycan release into the culture supernatant. In contrast, collagen 2 and 1 content of cartilage and cartilage-implant interface was approximately constant over time. Cell-free and cell-loaded implants showed (1) cell migration onto/into the implant, (2) progressive deposition of aggrecan and constant levels of collagens 1 and 2, (3) progressively increased mRNA levels for aggrecan and collagen 2, and (4) significantly augmented push-out forces over time. Cell-loaded implants displayed a significantly earlier and more long-lasting deposition of aggrecan, as well as tendentially higher push-out forces. Conclusion Preserved tissue integrity and progressively increasing cartilage differentiation and push-out forces for up to 12 weeks of cultivation suggest initial cartilage regeneration and lateral bonding of the implant in this in vitro model for cartilage replacement materials.

Engineering micropatterned surfaces to modulate the function of vascular stem cells.

PubMed

Li, Jennifer; Wu, Michelle; Chu, Julia; Sochol, Ryan; Patel, Shyam

2014-02-21

Multipotent vascular stem cells have been implicated in vascular disease and in tissue remodeling post therapeutic intervention. Hyper-proliferation and calcified extracellular matrix deposition of VSC cause blood vessel narrowing and plaque hardening thereby increasing the risk of myocardial infarct. In this study, to optimize the surface design of vascular implants, we determined whether micropatterned polymer surfaces can modulate VSC differentiation and calcified matrix deposition. Undifferentiated rat VSC were cultured on microgrooved surfaces of varied groove widths, and on micropost surfaces. 10μm microgrooved surfaces elongated VSC and decreased cell proliferation. However, microgrooved surfaces did not attenuate calcified extracellular matrix deposition by VSC cultured in osteogenic media conditions. In contrast, VSC cultured on micropost surfaces assumed a dendritic morphology, were significantly less proliferative, and deposited minimal calcified extracellular matrix. These results have significant implications for optimizing the design of cardiovascular implant surfaces. Copyright © 2014 Elsevier Inc. All rights reserved.

Osteogenic Activity of Locally Applied Small Molecule Drugs in a Rat Femur Defect Model

PubMed Central

Cottrell, Jessica A.; Vales, Francis M.; Schachter, Deborah; Wadsworth, Scott; Gundlapalli, Rama; Kapadia, Rasesh; O'Connor, J. Patrick

2010-01-01

The long-term success of arthroplastic joints is dependent on the stabilization of the implant within the skeletal site. Movement of the arthroplastic implant within the bone can stimulate osteolysis, and therefore methods which promote rigid fixation or bone growth are expected to enhance implant stability and the long-term success of joint arthroplasty. In the present study, we used a simple bilateral bone defect model to analyze the osteogenic activity of three small-molecule drug implants via microcomputerized tomography (micro-CT) and histomorphometry. In this study, we show that local delivery of alendronate, but not lovastatin or omeprazole, led to significant new bone formation at the defect site. Since alendronate impedes osteoclast-development, it is theorized that alendronate treatment results in a net increase in bone formation by preventing osteoclast mediated remodeling of the newly formed bone and upregulating osteoblasts. PMID:20625499

Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

PubMed

Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

2015-10-01

Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

Multifunctional and biologically active matrices from multicomponent polymeric solutions

NASA Technical Reports Server (NTRS)

Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor); Rabolt, John (Inventor); Casper, Cheryl (Inventor)

2012-01-01

A functionalized electrospun matrix for the controlled-release of biologically active agents, such as growth factors, is presented. The functionalized matrix comprises a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin.

Microenvironment rigidity modulates responses to the HER2 receptor tyrosine kinase inhibitor lapatinib via YAP and TAZ transcription factors

DOE PAGES

Lin, Chun-Han; Pelissier, Fanny A.; Zhang, Hui; ...

2015-09-02

Stiffness is a biophysical property of the extracellular matrix that modulates cellular functions, including proliferation, invasion, and differentiation, and it also may affect therapeutic responses. Therapeutic durability in cancer treatments remains a problem for both chemotherapies and pathway-targeted drugs, but the reasons for this are not well understood. Tumor progression is accompanied by changes in the biophysical properties of the tissue, and we asked whether matrix rigidity modulated the sensitive versus resistant states in HER2-amplified breast cancer cell responses to the HER2-targeted kinase inhibitor lapatinib. The antiproliferative effect of lapatinib was inversely proportional to the elastic modulus of the adhesivemore » substrata. Down-regulation of the mechanosensitive transcription coactivators YAP and TAZ, either by siRNA or with the small-molecule YAP/TEAD inhibitor verteporfin, eliminated modulus-dependent lapatinib resistance. Reduction of YAP in vivo in mice also slowed the growth of implanted HER2-amplified tumors, showing a trend of increasing sensitivity to lapatinib as YAP decreased. Thus we address the role of stiffness in resistance to and efficacy of a HER2 pathway–targeted therapeutic via the mechanotransduction arm of the Hippo pathway.« less

Conducting polymers with immobilised fibrillar collagen for enhanced neural interfacing.

PubMed

Liu, Xiao; Yue, Zhilian; Higgins, Michael J; Wallace, Gordon G

2011-10-01

Conducting polymers with pendant functionality are advantageous in various bionic and organic bioelectronic applications, as they allow facile incorporation of bio-regulative cues to provide bio-mimicry and conductive environments for cell growth, differentiation and function. In this work, polypyrrole substrates doped with chondroitin sulfate (CS), an extracellular matrix molecule bearing carboxylic acid moieties, were electrochemically synthesized and conjugated with type I collagen. During the coupling process, the conjugated collagen formed a 3-dimensional fibrillar matrix in situ at the conducting polymer interface, as evidenced by atomic force microscopy (AFM) and fluorescence microscopy under aqueous physiological conditions. Cyclic voltammetry (CV) and impedance measurement confirmed no significant reduction in the electroactivity of the fibrillar collagen-modified conducting polymer substrates. Rat pheochromocytoma (nerve) cells showed increased differentiation and neurite outgrowth on the fibrillar collagen, which was further enhanced through electrical stimulation of the underlying conducting polymer substrate. Our study demonstrates that the direct coupling of ECM components such as collagen, followed by their further self-assembly into 3-dimensional matrices, has the potential to improve the neural-electrode interface of implant electrodes by encouraging nerve cell attachment and differentiation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Microenvironment rigidity modulates responses to the HER2 receptor tyrosine kinase inhibitor lapatinib via YAP and TAZ transcription factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Chun-Han; Pelissier, Fanny A.; Zhang, Hui

Stiffness is a biophysical property of the extracellular matrix that modulates cellular functions, including proliferation, invasion, and differentiation, and it also may affect therapeutic responses. Therapeutic durability in cancer treatments remains a problem for both chemotherapies and pathway-targeted drugs, but the reasons for this are not well understood. Tumor progression is accompanied by changes in the biophysical properties of the tissue, and we asked whether matrix rigidity modulated the sensitive versus resistant states in HER2-amplified breast cancer cell responses to the HER2-targeted kinase inhibitor lapatinib. The antiproliferative effect of lapatinib was inversely proportional to the elastic modulus of the adhesivemore » substrata. Down-regulation of the mechanosensitive transcription coactivators YAP and TAZ, either by siRNA or with the small-molecule YAP/TEAD inhibitor verteporfin, eliminated modulus-dependent lapatinib resistance. Reduction of YAP in vivo in mice also slowed the growth of implanted HER2-amplified tumors, showing a trend of increasing sensitivity to lapatinib as YAP decreased. Thus we address the role of stiffness in resistance to and efficacy of a HER2 pathway–targeted therapeutic via the mechanotransduction arm of the Hippo pathway.« less

Water in the presence of inert Lennard-Jones obstacles

NASA Astrophysics Data System (ADS)

Kurtjak, Mario; Urbic, Tomaz

2014-04-01

Water confined by the presence of a 'sea' of inert obstacles was examined. In the article, freely mobile two-dimensional Mercedes-Benz (MB) water put to a disordered, but fixed, matrix of Lennard-Jones disks was studied by the Monte Carlo computer simulations. For the MB water molecules in the matrix of Lennard-Jones disks, we explored the structures, hydrogen-bond-network formation and thermodynamics as a function of temperature and size and density of matrix particles. We found that the structure of model water is perturbed by the presence of the obstacles. Density of confined water, which was in equilibrium with the bulk water, was smaller than the density of the bulk water and the temperature dependence of the density of absorbed water did not show the density anomaly in the studied temperature range. The behaviour observed as a consequence of confinement is similar to that of increasing temperature, which can for a matrix lead to a process similar to capillary evaporation. At the same occupancy of space, smaller matrix molecules cause higher destruction effect on the absorbed water molecules than the bigger ones. We have also tested the hypothesis that at low matrix densities the obstacles induce an increased ordering and 'hydrogen bonding' of the MB model molecules, relative to pure fluid, while at high densities the obstacles reduce MB water structuring, as they prevent the fluid to form good 'hydrogen-bonding' networks. However, for the size of matrix molecules similar to that of water, we did not observe this effect.

Tissue Engineering Using Transfected Growth-Factor Genes

NASA Technical Reports Server (NTRS)

Madry, Henning; Langer, Robert S.; Freed, Lisa E.; Trippel, Stephen; Vunjak-Novakovic, Gordana

2005-01-01

A method of growing bioengineered tissues includes, as a major component, the use of mammalian cells that have been transfected with genes for secretion of regulator and growth-factor substances. In a typical application, one either seeds the cells onto an artificial matrix made of a synthetic or natural biocompatible material, or else one cultures the cells until they secrete a desired amount of an extracellular matrix. If such a bioengineered tissue construct is to be used for surgical replacement of injured tissue, then the cells should preferably be the patient s own cells or, if not, at least cells matched to the patient s cells according to a human-leucocyteantigen (HLA) test. The bioengineered tissue construct is typically implanted in the patient's injured natural tissue, wherein the growth-factor genes enhance metabolic functions that promote the in vitro development of functional tissue constructs and their integration with native tissues. If the matrix is biodegradable, then one of the results of metabolism could be absorption of the matrix and replacement of the matrix with tissue formed at least partly by the transfected cells. The method was developed for articular chondrocytes but can (at least in principle) be extended to a variety of cell types and biocompatible matrix materials, including ones that have been exploited in prior tissue-engineering methods. Examples of cell types include chondrocytes, hepatocytes, islet cells, nerve cells, muscle cells, other organ cells, bone- and cartilage-forming cells, epithelial and endothelial cells, connective- tissue stem cells, mesodermal stem cells, and cells of the liver and the pancreas. Cells can be obtained from cell-line cultures, biopsies, and tissue banks. Genes, molecules, or nucleic acids that secrete factors that influence the growth of cells, the production of extracellular matrix material, and other cell functions can be inserted in cells by any of a variety of standard transfection techniques.

Extensive keratinized tissue augmentation during implant rehabilitation after Le Fort I osteotomy: using a new porcine collagen membrane (Mucoderm).

PubMed

Nocini, Pier Francesco; Castellani, Roberto; Zanotti, Guglielmo; Gelpi, Federico; Covani, Ugo; Marconcini, Simone; de Santis, Daniele

2014-05-01

The aim of this study was to test a new collagen matrix (Mucoderm) positioned during oral implant abutment connection. A patient previously treated with Le Fort I for bone augmentation and 8 implants showing minimal amount of keratinized tissue was selected for an extensive keratinized tissue augmentation and deepening of the oral vestibule by apically positioning a split palatal flap and palatal grafting with Mucoderm. Clinical data at 9 and 14 days and 1 and 2 months showed resorption of the collagen graft, augmentation of the keratinized tissue around the implants, and deepening of the vestibule, with minimal morbidity and reduced surgical treatment time. However, some vestibular keratinized tissue contraction was evident. The new collagen matrix may be a promising material as a substitute for an autologous gingival/connective tissue graft. Despite the preliminary results of this innovative article, before drawing any general conclusion, the benefit of the procedure should be further evaluated by prospective clinical trials.

Implant Composed of Demineralized Bone and Mesenchymal Stem Cells Genetically Modified with AdBMP2/AdBMP7 for the Regeneration of Bone Fractures in Ovis aries

PubMed Central

Hernandez-Hurtado, Adelina A.; Lara-Arias, Jorge; Romero-Diaz, Viktor J.; Abrego-Guerra, Adalberto; Vilchez-Cavazos, Jose F.; Elizondo-Riojas, Guillermo; Martinez-Rodriguez, Herminia G.; Espinoza-Juarez, Marcela A.; Mendoza Lemus, Oscar F.

2016-01-01

Adipose-derived mesenchymal stem cells (ADMSCs) are inducible to an osteogenic phenotype by the bone morphogenetic proteins (BMPs). This facilitates the generation of implants for bone tissue regeneration. This study evaluated the in vitro osteogenic differentiation of ADMSCs transduced individually and in combination with adenoviral vectors expressing BMP2 and BMP7. Moreover, the effectiveness of the implant containing ADMSCs transduced with the adenoviral vectors AdBMP2/AdBMP7 and embedded in demineralized bone matrix (DBM) was tested in a model of tibial fracture in sheep. This graft was compared to ewes implanted with untransduced ADMSCs embedded in the same matrix and with injured but untreated animals. In vivo results showed accelerated osteogenesis in the group treated with the AdBMP2/AdBMP7 transduced ADMSC graft, which also showed improved restoration of the normal bone morphology. PMID:27818692

Financial Impact of Dual Vendor, Matrix Pricing, and Sole-Source Contracting on Implant Costs.

PubMed

Althausen, Peter L; Lapham, Joan; Mead, Lisa

2016-12-01

Implant costs comprise the largest proportion of operating room supply costs for orthopedic trauma care. Over the years, hospitals have devised several methods of controlling these costs with the help of physicians. With increasing economic pressure, these negotiations have a tremendous ability to decrease the cost of trauma care. In the past, physicians have taken no responsibility for implant pricing which has made cost control difficult. The reasons have been multifactorial. However, industry surgeon consulting fees, research support, and surgeon comfort with certain implant systems have played a large role in slowing adoption of cost-control measures. With the advent of physician gainsharing and comanagement agreements, physicians now have impetus to change. At our facility, we have used 3 methods for cost containment since 2009: dual vendor, matrix pricing, and sole-source contracting. Each has been increasingly successful, resulting in massive savings for the institution. This article describes the process and benefits of each model.

Osteoblastic differentiating potential of dental pulp stem cells in vitro cultured on a chemically modified microrough titanium surface.

PubMed

DE Colli, Marianna; Radunovic, Milena; Zizzari, Vincenzo L; DI Giacomo, Viviana; DI Nisio, Chiara; Piattelli, Adriano; Calvo Guirado, José L; Zavan, Barbara; Cataldi, Amelia; Zara, Susi

2018-03-30

Titanium surface modification is critical for dental implant success. Our aim was to determine surfaces influence on dental pulp stem cells (DPSCs) viability and differentiation. Implants were divided into sandblasted/acid-etched (control) and sandblasted/acid-etched coated with calcium and magnesium ions (CaMg), supplied as composite (test). Proliferation was evaluated by MTT, differentiation checking osteoblastic gene expression, PGE2 secretion and matrix formation, inflammation by Interleukin 6 (IL-6) detection. MTT and IL-6 do not modify on test. A PGE2 increase on test is recorded. BMP2 is higher on test at early experimental points, Osterix and RUNX2 augment later. Alizarin-red S reveals higher matrix production on test. These results suggest that test surface is more osteoinductive, representing a start point for in vivo studies aiming at the construction of more biocompatible dental implants, whose integration and clinical performance are improved and some undesired effects, such as implant stability loss and further surgical procedures, are reduced.

Synthesis of Ag metallic nanoparticles by 120 keV Ag- ion implantation in TiO2 matrix

NASA Astrophysics Data System (ADS)

Sharma, Himanshu; Singhal, Rahul

2017-12-01

TiO2 thin film synthesized by the RF sputtering method has been implanted by 120 keV Ag- ion with different doses (3 × 1014, 1 × 1015, 3 × 1015, 1 × 1016 and 3 × 1016 ions/cm2). Further, these were characterized by Rutherford back Scattering, XRD, X-ray photoelectron spectroscopy (XPS), UV-visible and fluorescence spectroscopy. Here we reported that after implantation, localized surface Plasmon resonance has been observed for the fluence 3 × 1016 ions/cm2, which was due to the formation of silver nanoparticles. Ag is in metallic form in the matrix of TiO2, which is very interestingly as oxidation of Ag was reported after implantation. Also, we have observed the interaction between nanoparticles of Ag and TiO2, which results in an increasing intensity in lower charge states (Ti3+) of Ti. This interaction is supported by XPS and fluorescence spectroscopy, which can help improve photo catalysis and antibacterial properties.

Matrix elements of vibration kinetic energy operator of tetrahedral molecules in non-orthogonal-dependent coordinates

NASA Astrophysics Data System (ADS)

Protasevich, Alexander E.; Nikitin, Andrei V.

2018-01-01

In this work, we propose an algorithm for calculating the matrix elements of the kinetic energy operator for tetrahedral molecules. This algorithm uses the dependent six-angle coordinates (6A) and takes into account the full symmetry of molecules. Unlike A.V. Nikitin, M. Rey, and Vl. G. Tyuterev who operate with the kinetic energy operator only in Radau orthogonal coordinates, we consider a general case. The matrix elements are shown to be a sum of products of one-dimensional integrals.

Guided Bone Regeneration Using Collagen Scaffolds, Growth Factors, and Periodontal Ligament Stem Cells for Treatment of Peri-Implant Bone Defects In Vivo

PubMed Central

Scholz, Malte; Baudisch, Maria; Liese, Jan; Frerich, Bernhard; Lang, Hermann

2017-01-01

Introduction The aim of the study was an evaluation of different approaches for guided bone regeneration (GBR) of peri-implant defects in an in vivo animal model. Materials and Methods In minipigs (n = 15), peri-implant defects around calcium phosphate- (CaP-; n = 46) coated implants were created and randomly filled with (1) blank, (2) collagen/hydroxylapatite/β-tricalcium phosphate scaffold (CHT), (3) CHT + growth factor cocktail (GFC), (4) jellyfish collagen matrix, (5) jellyfish collagen matrix + GFC, (6) collagen powder, and (7) collagen powder + periodontal ligament stem cells (PDLSC). Additional collagen membranes were used for coverage of the defects. After 120 days of healing, bone growth was evaluated histologically (bone to implant contact (BIC;%)), vertical bone apposition (VBA; mm), and new bone height (NBH; %). Results In all groups, new bone formation was seen. Though, when compared to the blank group, no significant differences were detected for all parameters. BIC and NBH in the group with collagen matrix as well as the group with the collagen matrix + GFC were significantly less when compared to the collagen powder group (all: p < 0.003). Conclusion GBR procedures, in combination with CaP-coated implants, will lead to an enhancement of peri-implant bone growth. There was no additional significant enhancement of osseous regeneration when using GFC or PDLSC. PMID:28951742

Investigation of the stability of glass-ceramic composites containing CeTi 2 O 6 and CaZrTi 2 O 7 after ion implantation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paknahad, Elham; Grosvenor, Andrew P.

Glass-ceramic composite materials have been investigated for nuclear waste sequestration applications due to their ability to incorporate large amounts of radioactive waste elements. A key property that needs to be understood when developing nuclear waste sequestration materials is how the structure of the material responds to radioactive decay of nuclear waste elements, which can be simulated by high energy ion implantation. Borosilicate glass-ceramic composites containing brannerite-type (CeTi2O6) or zirconolite-type (CaZrTi2O7) oxides were synthesized at different annealing temperatures and investigated after being implanted with high-energy Au ions to mimic radiation induced structural damage. Backscattered electron (BSE) images were collected to investigatemore » the interaction of the brannerite crystallites with the glass matrix before and after implantation and showed that the morphology of the crystallites in the composite materials were not affected by radiation damage. Surface sensitive Ti K-edge glancing angle XANES spectra collected from the implanted composite materials showed that the structures of the CeTi2O6 and CaZrTi2O7 ceramics were damaged as a result of implantation; however, analysis of Si L2,3-edge XANES spectra indicated that the glass matrix was not affected by ion implantation.« less

Effectiveness of enamel matrix derivative on the clinical and microbiological outcomes following surgical regenerative treatment of peri-implantitis. A randomized controlled trial.

PubMed

Isehed, Catrine; Holmlund, Anders; Renvert, Stefan; Svenson, Björn; Johansson, Ingegerd; Lundberg, Pernilla

2016-10-01

This randomized clinical trial aimed at comparing radiological, clinical and microbial effects of surgical treatment of peri-implantitis alone or in combination with enamel matrix derivative (EMD). Twenty-six subjects were treated with open flap debridement and decontamination of the implant surfaces with gauze and saline preceding adjunctive EMD or no EMD. Bone level (BL) change was primary outcome and secondary outcomes were changes in pocket depth (PD), plaque, pus, bleeding and the microbiota of the peri-implant biofilm analyzed by the Human Oral Microbe Identification Microarray over a time period of 12 months. In multivariate modelling, increased marginal BL at implant site was significantly associated with EMD, the number of osseous walls in the peri-implant bone defect and a Gram+/aerobic microbial flora, whereas reduced BL was associated with a Gram-/anaerobic microbial flora and presence of bleeding and pus, with a cross-validated predictive capacity (Q(2) ) of 36.4%. Similar, but statistically non-significant, trends were seen for BL, PD, plaque, pus and bleeding in univariate analysis. Adjunctive EMD to surgical treatment of peri-implantitis was associated with prevalence of Gram+/aerobic bacteria during the follow-up period and increased marginal BL 12 months after treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Investigation of the stability of glass-ceramic composites containing CeTi2O6 and CaZrTi2O7 after ion implantation

NASA Astrophysics Data System (ADS)

Paknahad, Elham; Grosvenor, Andrew P.

2017-12-01

Glass-ceramic composite materials have been investigated for nuclear waste sequestration applications due to their ability to incorporate large amounts of radioactive waste elements. A key property that needs to be understood when developing nuclear waste sequestration materials is how the structure of the material responds to radioactive decay of nuclear waste elements, which can be simulated by high energy ion implantation. Borosilicate glass-ceramic composites containing brannerite-type (CeTi2O6) or zirconolite-type (CaZrTi2O7) oxides were synthesized at different annealing temperatures and investigated after being implanted with high-energy Au ions to mimic radiation induced structural damage. Backscattered electron (BSE) images were collected to investigate the interaction of the brannerite crystallites with the glass matrix before and after implantation and showed that the morphology of the crystallites in the composite materials were not affected by radiation damage. Surface sensitive Ti K-edge glancing angle XANES spectra collected from the implanted composite materials showed that the structures of the CeTi2O6 and CaZrTi2O7 ceramics were damaged as a result of implantation; however, analysis of Si L2,3-edge XANES spectra indicated that the glass matrix was not affected by ion implantation.

The role of autologous chondrocyte implantation in the treatment of symptomatic chondromalacia patellae.

PubMed

Macmull, Simon; Jaiswal, Parag K; Bentley, George; Skinner, John A; Carrington, Richard W J; Briggs, Tim W R

2012-07-01

Chondromalacia patella is a distinct clinical entity of abnormal softening of the articular cartilage of the patella, which results in chronic retropatellar pain. Its aetiology is still unclear but the process is thought to be a due to trauma to superficial chondrocytes resulting in a proteolytic enzymic breakdown of the matrix. Our aim was to assess the effectiveness of autologous chondrocyte implantation on patients with a proven symptomatic retropatellar lesion who had at least one failed conventional marrow-stimulating therapy. We performed chondrocyte implantation on 48 patients: 25 received autologous chondrocyte implantation with a type I/III membrane (ACI-C) method (Geistlich Biomaterials, Wolhusen, Switzerland), and 23 received the Matrix-assisted Chondrocyte Implantation (MACI) technique (Genzyme, Kastrup, Denmark). Over a mean follow-up period of 40.3 months, there was a statistically significant improvement in subjective pain scoring using the visual analogue scale (VAS) and objective functional scores using the Modified Cincinnati Rating System (MCS) in both groups. Chondromalacia patellae lesions responded well to chondrocyte implantation. Better results occurred with MACI than with ACI-C. Excellent and good results were achieved in 40% of ACI-C patients and 57% of MACI patients, but success of chondrocyte implantation was greater with medial/odd-facet lesions. Given that the MACI procedure is technically easier and less time consuming, we consider it to be useful for treating patients with symptomatic chondral defects secondary to chondromalacia patellae.

Phase separation of in situ forming poly (lactide-co-glycolide acid) implants investigated using a hydrogel-based subcutaneous tissue surrogate and UV-vis imaging.

PubMed

Sun, Yu; Jensen, Henrik; Petersen, Nickolaj J; Larsen, Susan W; Østergaard, Jesper

2017-10-25

Phase separation of in situ forming poly (lactide-co-glycolide acid) (PLGA) implants with agarose hydrogels as the provider of nonsolvent (water) mimicking subcutaneous tissue was investigated using a novel UV-vis imaging-based analytical platform. In situ forming implants of PLGA-1-methyl-2-pyrrolidinone and PLGA-triacetin representing fast and slow phase separating systems, respectively, were evaluated using this platform. Upon contact with the agarose hydrogel, the phase separation of the systems was followed by the study of changes in light transmission and absorbance as a function of time and position. For the PLGA-1-methyl-2-pyrrolidinone system, the rate of spatial phase separation was determined and found to decrease with increasing the PLGA concentration from 20% to 40% (w/w). Hydrogels with different agarose concentrations (1% and 10% (w/v)) were prepared for providing the nonsolvent, water, to the in situ forming PLGA implants simulating the injection site environment. The resulting implant morphology depended on the stiffness of hydrogel matrix, indicating that the matrix in which implants are formed is of importance. Overall, the work showed that the UV-vis imaging-based platform with an agarose hydrogel mimicking the subcutaneous tissue holds potential in providing bio-relevant and mechanistic information on the phase separation processes of in situ forming implants. Copyright © 2017 Elsevier B.V. All rights reserved.

Guided Bone Regeneration Using Collagen Scaffolds, Growth Factors, and Periodontal Ligament Stem Cells for Treatment of Peri-Implant Bone Defects In Vivo.

PubMed

Kämmerer, Peer W; Scholz, Malte; Baudisch, Maria; Liese, Jan; Wegner, Katharina; Frerich, Bernhard; Lang, Hermann

2017-01-01

The aim of the study was an evaluation of different approaches for guided bone regeneration (GBR) of peri-implant defects in an in vivo animal model. In minipigs ( n = 15), peri-implant defects around calcium phosphate- (CaP-; n = 46) coated implants were created and randomly filled with (1) blank, (2) collagen/hydroxylapatite/ β -tricalcium phosphate scaffold (CHT), (3) CHT + growth factor cocktail (GFC), (4) jellyfish collagen matrix, (5) jellyfish collagen matrix + GFC, (6) collagen powder, and (7) collagen powder + periodontal ligament stem cells (PDLSC). Additional collagen membranes were used for coverage of the defects. After 120 days of healing, bone growth was evaluated histologically (bone to implant contact (BIC;%)), vertical bone apposition (VBA; mm), and new bone height (NBH; %). In all groups, new bone formation was seen. Though, when compared to the blank group, no significant differences were detected for all parameters. BIC and NBH in the group with collagen matrix as well as the group with the collagen matrix + GFC were significantly less when compared to the collagen powder group (all: p < 0.003). GBR procedures, in combination with CaP-coated implants, will lead to an enhancement of peri-implant bone growth. There was no additional significant enhancement of osseous regeneration when using GFC or PDLSC.

Bone augmentation at peri-implant dehiscence defects comparing a synthetic polyethylene glycol hydrogel matrix vs. standard guided bone regeneration techniques.

PubMed

Thoma, Daniel S; Jung, Ui-Won; Park, Jin-Young; Bienz, Stefan P; Hüsler, Jürg; Jung, Ronald E

2017-07-01

The aim of the study was to test whether or not the use of a polyethylene glycol (PEG) hydrogel with or without the addition of an arginylglycylaspartic acid (RGD) sequence applied as a matrix in combination with hydroxyapatite/tricalciumphosphate (HA/TCP) results in similar peri-implant bone regeneration as traditional guided bone regeneration procedures. In 12 beagle dogs, implant placement and peri-implant bone regeneration were performed 2 months after tooth extraction in the maxilla. Two standardized box-shaped defects were bilaterally created, and dental implants were placed in the center of the defects with a dehiscence of 4 mm. Four treatment modalities were randomly applied: i)HA/TCP mixed with a synthetic PEG hydrogel, ii)HA/TCP mixed with a synthetic PEG hydrogel supplemented with an RGD sequence, iii)HA/TCP covered with a native collagen membrane (CM), iv)and no bone augmentation (empty). After a healing period of 8 or 16 weeks, micro-CT and histological analyses were performed. Histomorphometric analysis revealed a greater relative augmented area for groups with bone augmentation (43.3%-53.9% at 8 weeks, 31.2%-42.8% at 16 weeks) compared to empty controls (22.9% at 8 weeks, 1.1% at 16 weeks). The median amount of newly formed bone was greatest in group CM at both time-points. Regarding the first bone-to-implant contact, CM was statistically significantly superior to all other groups at 8 weeks. Bone can partially be regenerated at peri-implant buccal dehiscence defects using traditional guided bone regeneration techniques. The use of a PEG hydrogel applied as a matrix mixed with a synthetic bone substitute material might lack a sufficient stability over time for this kind of defect. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Efficient tree tensor network states (TTNS) for quantum chemistry: Generalizations of the density matrix renormalization group algorithm

NASA Astrophysics Data System (ADS)

Nakatani, Naoki; Chan, Garnet Kin-Lic

2013-04-01

We investigate tree tensor network states for quantum chemistry. Tree tensor network states represent one of the simplest generalizations of matrix product states and the density matrix renormalization group. While matrix product states encode a one-dimensional entanglement structure, tree tensor network states encode a tree entanglement structure, allowing for a more flexible description of general molecules. We describe an optimal tree tensor network state algorithm for quantum chemistry. We introduce the concept of half-renormalization which greatly improves the efficiency of the calculations. Using our efficient formulation we demonstrate the strengths and weaknesses of tree tensor network states versus matrix product states. We carry out benchmark calculations both on tree systems (hydrogen trees and π-conjugated dendrimers) as well as non-tree molecules (hydrogen chains, nitrogen dimer, and chromium dimer). In general, tree tensor network states require much fewer renormalized states to achieve the same accuracy as matrix product states. In non-tree molecules, whether this translates into a computational savings is system dependent, due to the higher prefactor and computational scaling associated with tree algorithms. In tree like molecules, tree network states are easily superior to matrix product states. As an illustration, our largest dendrimer calculation with tree tensor network states correlates 110 electrons in 110 active orbitals.

Enhanced hyaline cartilage matrix synthesis in collagen sponge scaffolds by using siRNA to stabilize chondrocytes phenotype cultured with bone morphogenetic protein-2 under hypoxia.

PubMed

Legendre, Florence; Ollitrault, David; Hervieu, Magalie; Baugé, Catherine; Maneix, Laure; Goux, Didier; Chajra, Hanane; Mallein-Gerin, Frédéric; Boumediene, Karim; Galera, Philippe; Demoor, Magali

2013-07-01

Cartilage healing by tissue engineering is an alternative strategy to reconstitute functional tissue after trauma or age-related degeneration. However, chondrocytes, the major player in cartilage homeostasis, do not self-regenerate efficiently and lose their phenotype during osteoarthritis. This process is called dedifferentiation and also occurs during the first expansion step of autologous chondrocyte implantation (ACI). To ensure successful ACI therapy, chondrocytes must be differentiated and capable of synthesizing hyaline cartilage matrix molecules. We therefore developed a safe procedure for redifferentiating human chondrocytes by combining appropriate physicochemical factors: hypoxic conditions, collagen scaffolds, chondrogenic factors (bone morphogenetic protein-2 [BMP-2], and insulin-like growth factor I [IGF-I]) and RNA interference targeting the COL1A1 gene. Redifferentiation of dedifferentiated chondrocytes was evaluated using gene/protein analyses to identify the chondrocyte phenotypic profile. In our conditions, under BMP-2 treatment, redifferentiated and metabolically active chondrocytes synthesized a hyaline-like cartilage matrix characterized by type IIB collagen and aggrecan molecules without any sign of hypertrophy or osteogenesis. In contrast, IGF-I increased both specific and noncharacteristic markers (collagens I and X) of chondrocytes. The specific increase in COL2A1 gene expression observed in the BMP-2 treatment was shown to involve the specific enhancer region of COL2A1 that binds the trans-activators Sox9/L-Sox5/Sox6 and Sp1, which are associated with a decrease in the trans-inhibitors of COL2A1, c-Krox, and p65 subunit of NF-kappaB. Our procedure in which BMP-2 treatment under hypoxia is associated with a COL1A1 siRNA, significantly increased the differentiation index of chondrocytes, and should offer the opportunity to develop new ACI-based therapies in humans.

Retention and wear behaviors of two implant overdenture stud-type attachments at different implant angulations.

PubMed

Choi, Jae-Won; Bae, Ji-Hyeon; Jeong, Chang-Mo; Huh, Jung-Bo

2017-05-01

Implant angulation should be considered when selecting an attachment. Some in vitro studies have investigated the relationship between implant angulation and changes in the retention force of the stud attachment, but few studies have evaluated the effect of cyclic loading and repeated cycles of insertion and removal on the stud attachment. The purpose of this in vitro study was to evaluate the effects of implant angulation on the retentive characteristics of overdentures with 2 different stud attachments, an experimental system and O-rings in red and orange, after cyclic loading and repeated insertion and removal cycles. The canine region of a mandibular experimental model was fitted with 2 implant fixtures with 2 different stud attachment systems at implant angulations of 0, 15, or 30 degrees. A mastication simulator was used to simulate cyclic loading, and a universal testing machine was used to evaluate retentive force changes after repeated insertion and removal cycles. To simulate the numbers of mastication and insertion and removal cycles per annum, 400000 cyclic loadings and 1080 insertion and removal cycles were performed. Wear patterns and attachment surface deformations were evaluated by scanning electron microscopy. Data were analyzed using the Kruskal-Wallis test, Mann-Whitney U test with Bonferroni correction (α=.05/3=.017), and the paired-sample Student t test (α=.05). When retentive forces before and after testing were compared, O-ring showed significant retention loss at all implant angulations (P<.001). In contrast, the experimental system showed little retention loss in the 0- and 15-degree models (P>.05), whereas the 30-degree model showed a significant increase in retentive force (P=.001). At all implant angulations, retention loss increased significantly for the orange O-ring, followed by the red O-ring, and the experimental system (P<.001). Scanning electron microscopy analysis showed more intense wear in the matrix than the patrix (abutment that matches to matrix) and more severe wear and deformation of the O-ring rubber matrix than of the experimental zirconia ball. Upon completion of the experiment, wear and deformation were found for all attachment systems. Even when implants are not installed in parallel, the experimental system can be used without involving great loss of retention. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

ASPS clinical practice guideline summary on breast reconstruction with expanders and implants.

PubMed

Alderman, Amy; Gutowski, Karol; Ahuja, Amy; Gray, Diedra

2014-10-01

After reading this article, participants should be able to: 1. Understand the evidence regarding the timing of expander/implant breast reconstruction in the setting of radiation therapy. 2. Discuss the implications of a patient's risk factors for possible outcomes and complications of expander/implant breast reconstruction. 3. Implement proper prophylactic antibiotic protocols. 4. Use the guidelines to improve their own clinical outcomes and reduce complications. In March of 2013, the Executive Committee of the American Society of Plastic Surgeons approved an evidence-based guideline on breast reconstruction with expanders and implants, as developed by a guideline-specific work group commissioned by the society's Health Policy Committee. The guideline addresses ten clinical questions: patient education, immediate versus delayed reconstruction, risk factors, radiation therapy, chemotherapy, hormonal therapy, antibiotic prophylaxis, acellular dermal matrix, monitoring for cancer recurrence, and oncologic outcomes associated with implant-based reconstruction. The evidence indicates that patients undergoing mastectomy should be offered a preoperative referral to a plastic surgeon. Evidence varies regarding the association between postoperative complications and timing of postmastectomy expander/implant breast reconstruction. Evidence is limited regarding the optimal timing of expand/implant reconstruction in the setting of radiation therapy but suggests that irradiation to the expander or implant is associated with an increased risk of postoperative complications. Evidence also varies regarding the association between acellular dermal matrix and surgical complications in the setting of postmastectomy expander/implant reconstruction. Data support the use of an appropriate preoperative antibiotic, but antibiotics should be discontinued within 24 hours of the procedure, unless a surgical drain is present. Furthermore, postmastectomy expander/implant breast reconstruction does not adversely affect oncologic outcomes.

Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion

PubMed Central

Li, Zhenhai; Lee, Hyunjung; Zhu, Cheng

2016-01-01

Cell-matrix adhesion complexes are multi-protein structures linking the extracellular matrix (ECM) to the cytoskeleton. They are essential to both cell motility and function by bidirectionally sensing and transmitting mechanical and biochemical stimulations. Several types of cell-matrix adhesions have been identified and they share many key molecular components, such as integrins and actin-integrin linkers. Mechanochemical coupling between ECM molecules and the actin cytoskeleton has been observed from the single cell to the single molecule level and from immune cells to neuronal cells. However, the mechanisms underlying force regulation of integrin-mediated mechanotransduction still need to be elucidated. In this review article, we focus on integrin-mediated adhesions and discuss force regulation of cell-matrix adhesions and key adaptor molecules, three different force-dependent behaviors, and molecular mechanisms for mechanochemical coupling in force regulation. PMID:27720950

Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

NASA Astrophysics Data System (ADS)

Vutha, A.; Horbatsch, M.; Hessels, E.

2018-01-01

We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the $\\hat{\\rm{z}}$ direction by an applied electric field, as has recently been demonstrated by Park, et al. [Angewandte Chemie {\\bf 129}, 1066 (2017)]. The trapped molecules are prepared into a state which has its electron spin perpendicular to $\\hat{\\rm{z}}$, and a magnetic field along $\\hat{\\rm{z}}$ causes precession of this spin. An electron electric dipole moment $d_e$ would affect this precession due to the up to 100~GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring $d_e$ to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

The influence of sterilization processes on the micromechanical properties of carbon fiber-reinforced PEEK composites for bone implant applications.

PubMed

Godara, A; Raabe, D; Green, S

2007-03-01

The effect of sterilization on the structural integrity of the thermoplastic matrix composite polyetheretherketone (PEEK) reinforced with carbon fibers (CF) is investigated by nanoindentation and nanoscratch tests. The use of the material as a medical implant grade requires a detailed understanding of the micromechanical properties which primarily define its in vivo behavior. Sterilization is a mandatory process for such materials used in medical applications like bone implants. The steam and gamma radiation sterilization processes employed in this study are at sufficient levels to affect the micromechanical properties of some polymer materials, particularly in the interphase region between the polymer matrix and the reinforcing fibers. Nanoindentation and nanoscratch tests are used in this work to reveal local gradients in the hardness and the elastic properties of the interphase regions. Both methods help to explore microscopic changes in the hardness, reduced stiffness and scratch resistance in the interphase region and in the bulk polymer matrix due to the different sterilization processes employed. The results reveal that neither steam nor gamma radiation sterilization entails significant changes of the reduced elastic modulus, hardness or coefficient of friction in the bulk polymer matrix. However, minor material changes of the PEEK matrix were observed in the interphase region. Of the two sterilization methods used, the steam treatment has a more significant influence on these small changes in this region and appears to increase slightly the thickness of the interphase zone.

Versatility of Biofilm Matrix Molecules in Staphylococcus epidermidis Clinical Isolates and Importance of Polysaccharide Intercellular Adhesin Expression during High Shear Stress

PubMed Central

Schaeffer, Carolyn R.; Hoang, Tra-My N.; Sudbeck, Craig M.; Alawi, Malik; Tolo, Isaiah E.; Robinson, D. Ashley; Horswill, Alexander R.; Rohde, Holger

2016-01-01

ABSTRACT Staphylococcus epidermidis is a leading cause of hospital-associated infections, including those of intravascular catheters, cerebrospinal fluid shunts, and orthopedic implants. Multiple biofilm matrix molecules with heterogeneous characteristics have been identified, including proteinaceous, polysaccharide, and nucleic acid factors. Two of the best-studied components in S. epidermidis include accumulation-associated protein (Aap) and polysaccharide intercellular adhesin (PIA), produced by the enzymatic products of the icaADBC operon. Biofilm composition varies by strain as well as environmental conditions, and strains producing PIA-mediated biofilms are more robust. Clinically, biofilm-mediated infections occur in a variety of anatomical sites with diverse physiological properties. To test the hypothesis that matrix composition exhibits niche specificity, biofilm-related genetic and physical properties were compared between S. epidermidis strains isolated from high-shear and low-shear environments. Among a collection of 105 clinical strains, significantly more isolates from high-shear environments carried the icaADBC operon than did those from low-shear settings (43.9% versus 22.9%, P < 0.05), while there was no significant difference in the presence of aap (77.2% versus 75.0%, P > 0.05). Additionally, a significantly greater number of high-shear isolates were capable of forming biofilm in vitro in a microtiter assay (82.5% versus 45.8%, P < 0.0001). However, even among high-shear clinical isolates, less than half contained the icaADBC locus; therefore, we selected for ica-negative variants with increased attachment to abiotic surfaces to examine PIA-independent biofilm mechanisms. Sequencing of selected variants identified substitutions capable of enhancing biofilm formation in multiple genes, further highlighting the heterogeneity of S. epidermidis biofilm molecules and mechanisms. IMPORTANCE Staphylococcus epidermidis is a leading cause of infections related to biomaterials, mostly due to their ability to form biofilm. Biofilm accumulation mechanisms vary, including those that are dependent on specific proteins, environmental DNA (eDNA), or polysaccharide intercellular adhesin (PIA). We found that those isolates obtained from high-shear environments, such as the lumen of a catheter, are more likely to produce PIA-mediated biofilms than those isolates obtained from a low-shear biomaterial-related infection. This suggests that PIA functions as a mechanism that is protective against shear flow. Finally, we performed selection experiments documenting the heterogeneity of biofilm accumulation molecules that function in the absence of PIA, further documenting the biofilm-forming potential of S. epidermidis. PMID:27747298

Non-cross-linked porcine acellular dermal matrices for abdominal wall reconstruction.

PubMed

Burns, Nadja K; Jaffari, Mona V; Rios, Carmen N; Mathur, Anshu B; Butler, Charles E

2010-01-01

Non-cross-linked porcine acellular dermal matrices have been used clinically for abdominal wall repair; however, their biologic and mechanical properties and propensity to form visceral adhesions have not been studied. The authors hypothesized that their use would result in fewer, weaker visceral adhesions than polypropylene mesh when used to repair ventral hernias and form a strong interface with the surrounding musculofascia. Thirty-four guinea pigs underwent inlay repair of surgically created ventral hernias using polypropylene mesh, porcine acellular dermal matrix, or a composite of the two. The animals were killed at 4 weeks, and the adhesion tenacity grade and surface area of the repair site involved by adhesions were measured. Sections of the repair sites, including the implant-musculofascia interface, underwent histologic analysis and uniaxial mechanical testing. The incidence of bowel adhesions to the repair site was significantly lower with the dermal matrix (8 percent, p < 0.01) and the matrix/mesh combination (0 percent, p < 0.001) than with polypropylene mesh alone (70 percent). The repairs made with the matrix or the matrix/mesh combination, compared with the polypropylene mesh repairs, had significantly lower mean adhesion surface areas [12.8 percent (p < 0.001), 9.2 percent (p < 0.001), and 79.9 percent] and grades [0.6 (p < 0.001), 0.6 (p < 0.001), and 2.9]. The dermal matrix underwent robust cellular and vascular infiltration. The ultimate tensile strength at the implant-musculofascia interface was similar in all groups. Porcine acellular dermal matrix becomes incorporated into the host tissue and causes fewer adhesions to repair sites than does polypropylene mesh, with similar implant-musculofascia interface strength. It also inhibits adhesions to adjacent dermal matrix in the combination repairs. It has distinct advantages over polypropylene mesh for complex abdominal wall repairs, particularly when material placement directly over bowel is unavoidable.

Saccharide sensing molecules having enhanced fluorescent properties

DOEpatents

Satcher Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

2004-01-06

The present invention provides formulae for fluorescent compounds that have a number of properties which make them uniquely suited for use in sensors of analytes such as saccharides. The advantageous fluorescent properties include favorable excitation wavelengths, emission wavelengths, fluorescence lifetimes, and photostability. Additional advantageous properties include enhanced aqueous solubility, as well as temperature and pH sensitivity. The compound comprises an aryl or a substituted phenyl botonic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

Arrays of carbon nanofibers as a platform for biosensing at the molecular level and for tissue engineering and implantation.

PubMed

Koehne, Jessica E; Chen, Hua; Cassell, Alan; Liu, Gang-yu; Li, Jun; Meyyappan, M

2009-01-01

Arrays of Carbon nanofibers (CNFs) harness the advantages of individual CNF as well the collective property of assemblies, which made them promising materials in biosensing and tissue engineering or implantation. Here, we report two studies to explore the applications of vertically aligned CNFs. First, a nanoelectrode array (NEA) based on vertically aligned CNFs embedded in SiO(2) is used for ultrasensitive DNA detection. Oligonucleotide probes are selectively functionalized at the open ends of the CNFs and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)(3)(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of less than approximately 1000 molecules of PCR amplified DNA targets are detected electrochemically by combining the CNF nanoelectrode array with the Ru(bpy)(3)(2+) amplification mechanism. Second, the SiO(2) matrix was etched back to produce needle-like protruding nanoelectrode arrays to be used as cell interfacing fibers for investigating gene transfection, electrical stimulation and detection of cellular processes. Our goal is to take advantage of the nanostructure of CNFs for unconventional biomolecular studies requiring ultrahigh sensitivity, high-degree of miniaturization and selective biofunctionalization.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Surodin, S. I., E-mail: surodin.bsn@mail.ru; Nikolitchev, D. E.; Kryukov, R. N.

The concentration profiles of species in silicon subjected to gallium and nitrogen co-implantation and subsequent annealing have been investigated by the method of X-ray photoelectron spectroscopy combined with the layer-by-layer ion etching of the implanted layer. It is shown that practically entire implanted gallium undergoes out-diffusion, but the preliminary implantation of nitrogen for the synthesis of a barrier SiN{sub x} layer makes it possible to avoid the essential loss of gallium. In this case, about 14 % of implanted gallium bond to nitrogen. The obtained data are discussed from the viewpoint of the possibility of ion synthesis of GaN inclusionsmore » in silicon matrix.« less

Cobalt coated substrate for matrix-free analysis of small molecules by laser desorption/ionization mass spectrometry

NASA Astrophysics Data System (ADS)

Yalcin, Talat; Li, Liang

2009-12-01

Small molecule analysis is one of the most challenging issues in matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. We have developed a cobalt coated substrate as a target for matrix-free analysis of small molecules in laser desorption/ionization mass spectrometry. Cobalt coating of 60-70 nm thickness has been characterized by scanning electron microscopy, energy dispersive X-ray analysis, X-ray diffraction, and laser induced breakdown spectroscopy. This target facilitates hundreds of samples to be spotted and analyzed without mixing any matrices, in a very short time. This can save a lot of time and money and can be a very practical approach for the analysis of small molecules by laser desorption/ionization mass spectrometry.

Cyclodextrin-supported organic matrix for application of MALDI-MS for forensics. Soft-ionization to obtain protonated molecules of low molecular weight compounds

NASA Astrophysics Data System (ADS)

Yonezawa, Tetsu; Asano, Takashi; Fujino, Tatsuya; Nishihara, Hiroshi

2013-06-01

A mass measurement technique for detecting low-molecular-weight drugs with a cyclodextrin-supported organic matrix was investigated. By using cyclodextrin-supported 2,4,6-trihydroxyacetophenone (THAP), the matrix-related peaks of drugs were suppressed. The peaks of protonated molecules of the sample and THAP were mainly observed, and small fragments were detected in a few cases. Despite the Na+ and K+ peaks were observed in the spectrum, Na+ or K+ adduct sample molecules were undetected, owing to the sugar units of cyclodextrin. The advantages of MALDI-MS with cyclodextrin-supported matrices as an analytical tool for forensic samples are discussed. The suppression of alkali adducted molecules and desorption process are also discussed.

Standardizing the evaluation criteria on treatment outcomes of mandibular implant overdentures: a systematic review

PubMed Central

Kim, Ha-Young; Shin, Sang-Wan

2014-01-01

PURPOSE The aim of this review was to analyze the evaluation criteria on mandibular implant overdentures through a systematic review and suggest standardized evaluation criteria. MATERIALS AND METHODS A systematic literature search was conducted by PubMed search strategy and hand-searching of relevant journals from included studies considering inclusion and exclusion criteria. Randomized clinical trials (RCT) and clinical trial studies comparing attachment systems on mandibular implant overdentures until December, 2011 were selected. Twenty nine studies were finally selected and the data about evaluation methods were collected. RESULTS Evaluation criteria could be classified into 4 groups (implant survival, peri-implant tissue evaluation, prosthetic evaluation, and patient satisfaction). Among 29 studies, 21 studies presented implant survival rate, while any studies reporting implant failure did not present cumulative implant survival rate. Seventeen studies evaluating peri-implant tissue status presented following items as evaluation criteria; marginal bone level (14), plaque Index (13), probing depth (8), bleeding index (8), attachment gingiva level (8), gingival index (6), amount of keratinized gingiva (1). Eighteen studies evaluating prosthetic maintenance and complication also presented following items as evaluation criteria; loose matrix (17), female detachment (15), denture fracture (15), denture relining (14), abutment fracture (14), abutment screw loosening (11), and occlusal adjustment (9). Atypical questionnaire (9), Visual analog scales (VAS) (4), and Oral Health Impact Profile (OHIP) (1) were used as the format of criteria to evaluate patients satisfaction in 14 studies. CONCLUSION For evaluation of implant overdenture, it is necessary to include cumulative survival rate for implant evaluation. It is suggested that peri-implant tissue evaluation criteria include marginal bone level, plaque index, bleeding index, probing depth, and attached gingiva level. It is also suggested that prosthetic evaluation criteria include loose matrix, female detachment, denture fracture, denture relining, abutment fracture, abutment screw loosening, and occlusal adjustment. Finally standardized criteria like OHIP-EDENT or VAS are required for patient satisfaction. PMID:25352954

Cathodic Polarization Coats Titanium Based Implant Materials with Enamel Matrix Derivate (EMD)

PubMed Central

Frank, Matthias J.; Walter, Martin S.; Rubert, Marina; Thiede, Bernd; Monjo, Marta; Reseland, Janne E.; Haugen, Håvard J.; Lyngstadaas, Ståle Petter

2014-01-01

The idea of a bioactive surface coating that enhances bone healing and bone growth is a strong focus of on-going research for bone implant materials. Enamel matrix derivate (EMD) is well documented to support bone regeneration and activates growth of mesenchymal tissues. Thus, it is a prime candidate for coating of existing implant surfaces. The aim of this study was to show that cathodic polarization can be used for coating commercially available implant surfaces with an immobilized but functional and bio-available surface layer of EMD. After coating, XPS revealed EMD-related bindings on the surface while SIMS showed incorporation of EMD into the surface. The hydride layer of the original surface could be activated for coating in an integrated one-step process that did not require any pre-treatment of the surface. SEM images showed nano-spheres and nano-rods on coated surfaces that were EMD-related. Moreover, the surface roughness remained unchanged after coating, as it was shown by optical profilometry. The mass peaks observed in the matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy (MALDI-TOF MS) analysis confirmed the integrity of EMD after coating. Assessment of the bioavailability suggested that the modified surfaces were active for osteoblast like MC3M3-E1 cells in showing enhanced Coll-1 gene expression and ALP activity. PMID:28788564

Round-robin study of arsenic implant dose measurement in silicon by SIMS

NASA Astrophysics Data System (ADS)

Simons, D.; Kim, K.; Benbalagh, R.; Bennett, J.; Chew, A.; Gehre, D.; Hasegawa, T.; Hitzman, C.; Ko, J.; Lindstrom, R.; MacDonald, B.; Magee, C.; Montgomery, N.; Peres, P.; Ronsheim, P.; Yoshikawa, S.; Schuhmacher, M.; Stockwell, W.; Sykes, D.; Tomita, M.; Toujou, F.; Won, J.

2006-07-01

An international round-robin study was undertaken under the auspices of ISO TC201/SC6 to determine the best analytical conditions and the level of interlaboratory agreement for the determination of the implantation dose of arsenic in silicon by secondary ion mass spectrometry (SIMS). Fifteen SIMS laboratories, as well as two laboratories that performed low energy electron-induced X-ray emission spectrometry (LEXES) and one that made measurements by instrumental neutron activation analysis (INAA) were asked to determine the implanted arsenic doses in three unknown samples using as a comparator NIST Standard Reference Material ® 2134. The use of a common reference material by all laboratories resulted in better interlaboratory agreement than was seen in a previous round-robin that lacked a common comparator. The relative standard deviation among laboratories was less than 4% for the medium-dose sample, but several percent larger for the low- and high-dose samples. The high-dose sample showed a significant difference between point-by-point and average matrix normalization because the matrix signal decreased in the vicinity of the implant peak, as observed in a previous study. The dose from point-by-point normalization was in close agreement with that determined by INAA. No clear difference in measurement repeatability was seen when comparing Si 2- and Si 3- as matrix references with AsSi -.

Distance descending ordering method: An O(n) algorithm for inverting the mass matrix in simulation of macromolecules with long branches

NASA Astrophysics Data System (ADS)

Xu, Xiankun; Li, Peiwen

2017-11-01

Fixman's work in 1974 and the follow-up studies have developed a method that can factorize the inverse of mass matrix into an arithmetic combination of three sparse matrices-one of them is positive definite and needs to be further factorized by using the Cholesky decomposition or similar methods. When the molecule subjected to study is of serial chain structure, this method can achieve O (n) time complexity. However, for molecules with long branches, Cholesky decomposition about the corresponding positive definite matrix will introduce massive fill-in due to its nonzero structure. Although there are several methods can be used to reduce the number of fill-in, none of them could strictly guarantee for zero fill-in for all molecules according to our test, and thus cannot obtain O (n) time complexity by using these traditional methods. In this paper we present a new method that can guarantee for no fill-in in doing the Cholesky decomposition, which was developed based on the correlations between the mass matrix and the geometrical structure of molecules. As a result, the inverting of mass matrix will remain the O (n) time complexity, no matter the molecule structure has long branches or not.

Engineering micropatterned surfaces to modulate the function of vascular stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jennifer; Wu, Michelle; Chu, Julia

2014-02-21

Highlights: • We examine vascular stem cell function on microgrooved and micropost patterned polymer substrates. • 10 μm microgrooved surfaces significantly lower VSC proliferation but do not modulate calcified matrix deposition. • Micropost surfaces significantly lower VSC proliferation and decrease calcified matrix deposition. - Abstract: Multipotent vascular stem cells have been implicated in vascular disease and in tissue remodeling post therapeutic intervention. Hyper-proliferation and calcified extracellular matrix deposition of VSC cause blood vessel narrowing and plaque hardening thereby increasing the risk of myocardial infarct. In this study, to optimize the surface design of vascular implants, we determined whether micropatterned polymermore » surfaces can modulate VSC differentiation and calcified matrix deposition. Undifferentiated rat VSC were cultured on microgrooved surfaces of varied groove widths, and on micropost surfaces. 10 μm microgrooved surfaces elongated VSC and decreased cell proliferation. However, microgrooved surfaces did not attenuate calcified extracellular matrix deposition by VSC cultured in osteogenic media conditions. In contrast, VSC cultured on micropost surfaces assumed a dendritic morphology, were significantly less proliferative, and deposited minimal calcified extracellular matrix. These results have significant implications for optimizing the design of cardiovascular implant surfaces.« less

Effect of Tissucol on connective tissue matrix during wound healing: an immunohistochemical study in rat skin.

PubMed

Romanos, G E; Strub, J R

1998-03-05

Fibrin sealants are very useful in different surgical fields. Fixation of free gingival grafts, root coverage procedures, and other techniques increasing connective tissue attachment may be associated with the application of Tissucol in periodontology. The aim of this study was to evaluate the influence of the fibrin sealant in the extracellular matrix, as well as alterations of the connective tissue matrix during wound-healing processes. In the back dermis of 15 Net male rats, Tissucol was implanted after intraperitoneal anesthesia. The implant material was placed in subcutaneous pockets (2 cm in length) which were sutured with interproximal sutures (test and control pockets). At 4, 7, 14, 21, and 28 days after surgery, biopsies of the healed and surrounding tissues were taken, frozen in liquid nitrogen, and examined histologically and immunohistochemically with antibodies against collagen types I, III, IV, V, VI, and VII. The findings showed thick and thin collagen type I and III fibers, respectively, with different orientations localized around the implant material. An increased amount of blood vessels and capillaries (their basement membranes containing collagen type IV) was observed during wound healing which may be associated with the implantation of the sealant. Collagen type V fibers were localized from the first days to the 4th postoperative week and, without any inflammatory reaction (according to histologic staining), formed a fibrillar extracellular matrix with high collagenase resistance. Collagen type VI showed a microfibrillar pattern of distribution, and collagen type VII was localized in the dermo epidermo junction and very deep in the connective tissue in the form of anchoring fibers (only in the test group) during the 4 postoperative weeks of healing. The data showed that Tissucol is a biocompatible component which cannot produce any extensive inflammatory reaction in the matrix. New blood vessel formation, an epithelial-connective tissue interface with high stability, as well as matrix alterations with high resistance in the proteolytic enzymes (i.e., collagenases) can be induced in the connective tissue after use of a fibrin sealant. All of these characteristics may be of great importance in connective tissue healing in periodontal surgical procedures.

Use of a Collagen Matrix as a Substitute for Free Mucosal Grafts in Pre-Prosthetic Surgery: 1 Year Results From a Clinical Prospective Study on 15 Patients

PubMed Central

Maiorana, Carlo; Beretta, Mario; Pivetti, Luca; Stoffella, Enrico; Grossi, Giovanni B.; Herford, Alan S.

2016-01-01

Background: The presence of keratinized tissue around dental implants is more than desirable either from a functional and aesthetic point of view, making soft tissue grafting a common practice in implant rehabilitation. Autogenous soft tissue grafting procedures are usually associated with high morbidity. Aim of this study was to assess the efficacy of a xenogeneic collagen matrix as a substitute for soft tissue grafting around dental implants. Methods: 15 consecutive patients underwent a vestibuloplasty and grafting, both in the mandible and the maxilla, with a collagen matrix. Results: The primary endpoint was to evaluate the resorption of the graft along with the re-epithelization grafted area. The percentage of the resorption was 44,4%, with a mean gain in vestibular height of 3 mm. Secondary endpoints evaluated the clinical appearance, the hemostatic effect and the post-operative pain. All subjects referred minimal pain with no bleeding. No adverse reaction nor infection were noted. Conclusion: This study showed that the used collagen matrix can find major interest in those patients who need a greater aesthetic outcome as the matrix has a perfect integration with the surrounding tissues. Furthermore it is strongly recommended for those patients who can bear little pain. Clinical Significance: Post-operative morbidity of autologous grafts is the biggest concern of this type of surgery. The possibility to use a soft tissue substitute is a great achievement as morbidity decreases and bigger areas can be treated in a single surgery. The present study showed the efficacy of a collagen matrix as this kind of substitute. PMID:27583050

Vascularization and tissue infiltration of a biodegradable polyurethane matrix

PubMed Central

Ganta, Sudhakar R.; Piesco, Nicholas P.; Long, Ping; Gassner, Robert; Motta, Luis F.; Papworth, Glenn D.; Stolz, Donna B.; Watkins, Simon C.; Agarwal, Sudha

2016-01-01

Urethanes are frequently used in biomedical applications because of their excellent biocompatibility. However, their use has been limited to bioresistant polyurethanes. The aim of this study was to develop a nontoxic biodegradable polyurethane and to test its potential for tissue compatibility. A matrix was synthesized with pentane diisocyanate (PDI) as a hard segment and sucrose as a hydroxyl group donor to obtain a microtextured spongy urethane matrix. The matrix was biodegradable in an aqueous solution at 37°C in vitro as well as in vivo. The polymer was mechanically stable at body temperatures and exhibited a glass transition temperature (Tg) of 67°C. The porosity of the polymer network was between 10 and 2000 µm, with the majority of pores between 100 and 300 µm in diameter. This porosity was found to be adequate to support the adherence and proliferation of bone-marrow stromal cells (BMSC) and chondrocytes in vitro. The degradation products of the polymer were nontoxic to cells in vitro. Subdermal implants of the PDI–sucrose matrix did not exhibit toxicity in vivo and did not induce an acute inflammatory response in the host. However, some foreign-body giant cells did accumulate around the polymer and in its pores, suggesting its degradation is facilitated by hydrolysis as well as by giant cells. More important, subdermal implants of the polymer allowed marked infiltration of vascular and connective tissue, suggesting the free flow of fluids and nutrients in the implants. Because of the flexibility of the mechanical strength that can be obtained in urethanes and because of the ease with which a porous microtexture can be achieved, this matrix may be useful in many tissue-engineering applications. PMID:12522810

Short-Term Complications Associated With Acellular Dermal Matrix-Assisted Direct-to-Implant Breast Reconstruction.

PubMed

Hunsicker, Lisa M; Ashikari, Andrew Y; Berry, Colleen; Koch, R Michael; Salzberg, C Andrew

2017-01-01

Although direct-to-implant breast reconstruction is a more concise procedure than 2-stage expander/implant reconstruction, it is less frequently performed. Skeptics of direct-to-implant reconstruction cite risk of postoperative complications as a reason for its rejection. To determine whether these perceptions are valid, we evaluated our 13-year experience of acellular dermal matrix (ADM)-assisted, direct-to-implant breast reconstruction. We report complication and reoperation rates associated with this technique as well as predictors for these outcomes. This retrospective study included all patients who underwent immediate, ADM-assisted, direct-to-implant, breast reconstruction from December 2001 to May 2014 at 2 practices. Postoperative complications, defined as those occurring within the first 12 months after reconstructive surgery, were evaluated. Univariate/multivariate analyses were performed to determine the influence of patient-, breast-, and surgery-related characteristics on the development of complications. A total of 1584 breast reconstructions (721 bilateral, 142 unilateral) in 863 patients were performed; 35% were oncologic, and 65% were prophylactic reconstructions. Complication rate was 8.6% and included skin necrosis (5.9%), infection (3.0%), implant loss (2.9%), seroma (1.1%), and hematoma (0.9%). Reoperative rate in breasts with complications was 3.2%. Age 50 years or older, smoking, nonnipple-sparing mastectomy, and implant size of 600 mL or greater strongly predicted the development of complications (P < 0.001). Our cumulative 13-year experience demonstrates that immediate, ADM-assisted, direct-to-implant breast reconstruction is safe, effective, and reliable. Complication and reoperation rates are less than 10% and are comparable to those reported for 2-stage procedures in the published literature.

Functional cartilage repair capacity of de-differentiated, chondrocyte- and mesenchymal stem cell-laden hydrogels in vitro

PubMed Central

Rackwitz, Lars; Djouad, Farida; Janjanin, Sasa; Nöth, Ulrich; Tuan, Rocky S.

2017-01-01

Objective The long-term performance of cell seeded matrix based cartilage constructs depends on (1) the development of sufficient biomechanical properties, and (2) lateral integration with host tissues, both of which require cartilage specific matrix deposition within the scaffold. In this study, we have examined the potential of tissue-engineered cartilage analogs developed using different cell types, i.e., MSCs versus chondrocytes and de-differentiated chondrocytes, in an established “construct in cartilage ring” model. Design Cell-laden constructs of differentiated chondrocytes, de-differentiated chondrocytes after 2, 5 or 8 population doublings, and MSCs were either implanted into a native cartilage ring immediately after fabrication (immature group) or pretreated for 21 days in a transforming growth factor-β3 (TGF-β3) containing medium prior to implantation. After additional culture for 28 days in a serum-free, chemically defined medium, the extent of lateral integration, and biochemical and biomechanical characteristics of the implants as hybrid constructs were assessed. Results The quality of integration, the amount of accumulated cartilage-specific matrix components and associated biomechanical properties were found to be highest when using differentiated chondrocytes. De-differentiation of chondrocytes negatively impacted the properties of the implants, as even two population doublings of the chondrocytes in culture significantly lowered cartilage repair capacity. In contrast, MSCs showed chondrogenic differentiation with TGF-β3 pre-treatment and superior integrational behavior. Conclusions Chondrocyte expansion and de-differentiation impaired the cell response, resulting in inferior cartilage repair in vitro. With TGF-β3 pre-treatment, MSCs were able to undergo sustained chondrogenic differentiation and exhibited superior matrix deposition and integration compared to de-differentiated chondrocytes. PMID:24887551

The influence of different soft-tissue grafting procedures at single implant placement on esthetics: A randomized controlled trial.

PubMed

Zuiderveld, Elise G; Meijer, Henny J A; Vissink, Arjan; Raghoebar, Gerry M

2018-05-13

Soft tissue grafting to thicken the soft tissue around dental implants was proposed to ameliorate the esthetic outcome. Traditionally, connective tissue is used as a grafting material, but a xenogeneic collagen matrix was introduced as an alternative to reduce patient morbidity. Sixty patients randomly received either no graft (n = 20, NG group), a connective tissue graft (n = 20, CTG group) or a xenogeneic collagen matrix (n = 20, XCM group) when placing an implant in a preserved alveolar ridge. Changes in mid-buccal mucosal level (MBML) at one (T 1 ) and twelve (T 12 ) months after final implant crown placement were compared to the pre-extraction situation. Additionally, esthetics, marginal bone level, clinical peri-implant parameters and patient satisfaction were assessed. At T 12 , mean changes in MBML were -0.48±1.5 mm, -0.04±1.1 mm and -0.17±1.3 mm in the NG, CTG and XCM groups (p = 0.56), respectively. Regarding the other outcome variables, no significant inter-group differences were observed. Soft tissue grafting at single implant placement in preserved alveolar ridges does not result in a better esthetic outcome or in better peri-implant health and should not be considered as a standard procedure. This article is protected by copyright. All rights reserved. © 2018 American Academy of Periodontology.

Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

PubMed

Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

2012-01-01

We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

Biofunctionalization of surfaces by energetic ion implantation: Review of progress on applications in implantable biomedical devices and antibody microarrays

NASA Astrophysics Data System (ADS)

Bilek, Marcela M. M.

2014-08-01

Despite major research efforts in the field of biomaterials, rejection, severe immune responses, scar tissue and poor integration continue to seriously limit the performance of today's implantable biomedical devices. Implantable biomaterials that interact with their host via an interfacial layer of active biomolecules to direct a desired cellular response to the implant would represent a major and much sought after improvement. Another, perhaps equally revolutionary, development that is on the biomedical horizon is the introduction of cost-effective microarrays for fast, highly multiplexed screening for biomarkers on cell membranes and in a variety of analyte solutions. Both of these advances will rely on effective methods of functionalizing surfaces with bioactive molecules. After a brief introduction to other methods currently available, this review will describe recently developed approaches that use energetic ions extracted from plasma to facilitate simple, one-step covalent surface immobilization of bioactive molecules. A kinetic theory model of the immobilization process by reactions with long-lived, mobile, surface-embedded radicals will be presented. The roles of surface chemistry and microstructure of the ion treated layer will be discussed. Early progress on applications of this technology to create diagnostic microarrays and to engineer bioactive surfaces for implantable biomedical devices will be reviewed.

The Effect of Sterile Acellular Dermal Matrix Use on Complication Rates in Implant-Based Immediate Breast Reconstructions

PubMed Central

Park, Youngsoo; Choi, Kyoung Wook; Chung, Kyu-Jin; Kim, Tae Gon; Kim, Yong-Ha

2016-01-01

Background The use of acellular dermal matrix (ADM) in implant-based immediate breast reconstruction has been increasing. The current ADMs available for breast reconstruction are offered as aseptic or sterile. No published studies have compared aseptic and sterile ADM in implant-based immediate breast reconstruction. The authors performed a retrospective study to evaluate the outcomes of aseptic versus sterile ADM in implant-based immediate breast reconstruction. Methods Implant-based immediate breast reconstructions with ADM conducted between April 2013 and January 2016 were included. The patients were divided into 2 groups: the aseptic ADM (AlloDerm) group and the sterile ADM (MegaDerm) group. Archived records were reviewed for demographic data and postoperative complication types and frequencies. The complications included were infection, flap necrosis, capsular contracture, seroma, hematoma, and explantation for any cause. Results Twenty patients were reconstructed with aseptic ADM, and 68 patients with sterile ADM. Rates of infection (15.0% vs. 10.3%), flap necrosis (5.0% vs. 7.4%), capsular contracture (20.0% vs. 14.7%), seroma (10.0% vs. 14.7%), hematoma (0% vs. 1.5%), and explantation (10.0% vs. 8.8%) were not significantly different in the 2 groups. Conclusions Sterile ADM did not provide better results regarding infectious complications than aseptic ADM in implant-based immediate breast reconstruction. PMID:27896182

A parallel algorithm for Hamiltonian matrix construction in electron-molecule collision calculations: MPI-SCATCI

NASA Astrophysics Data System (ADS)

Al-Refaie, Ahmed F.; Tennyson, Jonathan

2017-12-01

Construction and diagonalization of the Hamiltonian matrix is the rate-limiting step in most low-energy electron - molecule collision calculations. Tennyson (1996) implemented a novel algorithm for Hamiltonian construction which took advantage of the structure of the wavefunction in such calculations. This algorithm is re-engineered to make use of modern computer architectures and the use of appropriate diagonalizers is considered. Test calculations demonstrate that significant speed-ups can be gained using multiple CPUs. This opens the way to calculations which consider higher collision energies, larger molecules and / or more target states. The methodology, which is implemented as part of the UK molecular R-matrix codes (UKRMol and UKRMol+) can also be used for studies of bound molecular Rydberg states, photoionization and positron-molecule collisions.

Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

PubMed

Meisel, Jayda E; Chang, Mayland

2017-11-01

The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

Changes of the peri-implant soft tissue thickness after grafting with a collagen matrix.

PubMed

Zafiropoulos, Gregory-George; Deli, Giorgio; Hoffmann, Oliver; John, Gordon

2016-01-01

The aim of this study was to determine the treatment outcome of the use of a porcine monolayer collagen matrix (mCM) to increase soft-tissue volume as a part of implant site development. Implants were placed in single sites in 27 patients. In the test group, mCM was used for soft-tissue augmentation. No graft was placed in the control group. Soft-tissue thickness (STTh) was measured at the time of surgery (T0) and 6 months postoperatively (T1) at two sites (STTh 1, 1 mm below the gingival margin; STTh 2, 3 mm below the mucogingival margin). Significant increases ( P < 0.001) in STTh (STTh 1 = 1.06 mm, 117%; STTh 2 = 0.89 mm, 81%) were observed in the test group. Biopsy results showed angiogenesis and mature connective tissue covered by keratinized epithelium. Within the limitations of this study, it could be concluded that mCM leads to a significant increase of peri-implant soft-tissue thickness, with good histological integration and replacement by soft tissue and may serve as an alternative to connective tissue grafting.

Stretchable nanocomposite electrodes with tunable mechanical properties by supersonic cluster beam implantation in elastomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borghi, F.; Podestà, A.; Milani, P., E-mail: pmilani@mi.infn.it

We demonstrate the fabrication of gold-polydimethylsiloxane nanocomposite electrodes, by supersonic cluster beam implantation, with tunable Young's modulus depending solely on the amount of metal clusters implanted in the elastomeric matrix. We show both experimentally and by atomistic simulations that the mechanical properties of the nanocomposite can be maintained close to that of the bare elastomer for significant metal volume concentrations. Moreover, the elastic properties of the nanocomposite, as experimentally characterized by nanoindentation and modeled with molecular dynamics simulations, are also well described by the Guth-Gold classical model for nanoparticle-filled rubbers, which depends on the presence, concentration, and aspect ratio ofmore » metal nanoparticles, and not on the physical and chemical modification of the polymeric matrix due to the embedding process. The elastic properties of the nanocomposite can therefore be determined and engineered a priori, by controlling only the nanoparticle concentration.« less

Chondroitin sulfates and their binding molecules in the central nervous system.

PubMed

Djerbal, L; Lortat-Jacob, H; Kwok, Jcf

2017-06-01

Chondroitin sulfate (CS) is the most abundant glycosaminoglycan (GAG) in the central nervous system (CNS) matrix. Its sulfation and epimerization patterns give rise to different forms of CS, which enables it to interact specifically and with a significant affinity with various signalling molecules in the matrix including growth factors, receptors and guidance molecules. These interactions control numerous biological and pathological processes, during development and in adulthood. In this review, we describe the specific interactions of different families of proteins involved in various physiological and cognitive mechanisms with CSs in CNS matrix. A better understanding of these interactions could promote a development of inhibitors to treat neurodegenerative diseases.

Nitric oxide regulates tumor cell cross-talk with stromal cells in the tumor microenvironment of the liver.

PubMed

Decker, Ningling Kang; Abdelmoneim, Soha S; Yaqoob, Usman; Hendrickson, Helen; Hormes, Joe; Bentley, Mike; Pitot, Henry; Urrutia, Raul; Gores, Greg J; Shah, Vijay H

2008-10-01

Tumor progression is regulated through paracrine interactions between tumor cells and stromal cells in the microenvironment, including endothelial cells and myofibroblasts. Nitric oxide (NO) is a key molecule in the regulation of tumor-microenvironment interactions, although its precise role is incompletely defined. By using complementary in vitro and in vivo approaches, we studied the effect of endothelial NO synthase (eNOS)-derived NO on liver tumor growth and metastasis in relation to adjacent stromal myofibroblasts and matrix because liver tumors maintain a rich, vascular stromal network enriched with phenotypically heterogeneous myofibroblasts. Mice with an eNOS deficiency developed liver tumors more frequently in response to carcinogens compared with control animals. In a surgical model of pancreatic cancer liver metastasis, eNOS overexpression in the tumor microenvironment attenuated both the number and size of tumor implants. NO promoted anoikis of tumor cells in vitro and limited their invasive capacity. Because tumor cell anoikis and invasion are both regulated by myofibroblast-derived matrix, we explored the effect of NO on tumor cell protease expression. Both microarray and Western blot analysis revealed eNOS-dependent down-regulation of the matrix protease cathepsin B within tumor cells, and silencing of cathepsin B attenuated tumor cell invasive capacity in a similar manner to that observed with eNOS overexpression. Thus, a NO gradient within the tumor microenvironment influences tumor progression through orchestrated molecular interactions between tumor cells and stroma.

Synergistic interactions of blood-borne immune cells, fibroblasts and extracellular matrix drive repair in an in vitro peri-implant wound healing model

NASA Astrophysics Data System (ADS)

Burkhardt, Melanie A.; Waser, Jasmin; Milleret, Vincent; Gerber, Isabel; Emmert, Maximilian Y.; Foolen, Jasper; Hoerstrup, Simon P.; Schlottig, Falko; Vogel, Viola

2016-02-01

Low correlations of cell culture data with clinical outcomes pose major medical challenges with costly consequences. While the majority of biomaterials are tested using in vitro cell monocultures, the importance of synergistic interactions between different cell types on paracrine signalling has recently been highlighted. In this proof-of-concept study, we asked whether the first contact of surfaces with whole human blood could steer the tissue healing response. This hypothesis was tested using alkali-treatment of rough titanium (Ti) surfaces since they have clinically been shown to improve early implant integration and stability, yet blood-free in vitro cell cultures poorly correlated with in vivo tissue healing. We show that alkali-treatment, compared to native Ti surfaces, increased blood clot thickness, including platelet adhesion. Strikingly, blood clots with entrapped blood cells in synergistic interactions with fibroblasts, but not fibroblasts alone, upregulated the secretion of major factors associated with fast healing. This includes matrix metalloproteinases (MMPs) to break down extracellular matrix and the growth factor VEGF, known for its angiogenic potential. Consequently, in vitro test platforms, which consider whole blood-implant interactions, might be superior in predicting wound healing in response to biomaterial properties.

Covariance Matrix Estimation for the Cryo-EM Heterogeneity Problem*

PubMed Central

Katsevich, E.; Katsevich, A.; Singer, A.

2015-01-01

In cryo-electron microscopy (cryo-EM), a microscope generates a top view of a sample of randomly oriented copies of a molecule. The problem of single particle reconstruction (SPR) from cryo-EM is to use the resulting set of noisy two-dimensional projection images taken at unknown directions to reconstruct the three-dimensional (3D) structure of the molecule. In some situations, the molecule under examination exhibits structural variability, which poses a fundamental challenge in SPR. The heterogeneity problem is the task of mapping the space of conformational states of a molecule. It has been previously suggested that the leading eigenvectors of the covariance matrix of the 3D molecules can be used to solve the heterogeneity problem. Estimating the covariance matrix is challenging, since only projections of the molecules are observed, but not the molecules themselves. In this paper, we formulate a general problem of covariance estimation from noisy projections of samples. This problem has intimate connections with matrix completion problems and high-dimensional principal component analysis. We propose an estimator and prove its consistency. When there are finitely many heterogeneity classes, the spectrum of the estimated covariance matrix reveals the number of classes. The estimator can be found as the solution to a certain linear system. In the cryo-EM case, the linear operator to be inverted, which we term the projection covariance transform, is an important object in covariance estimation for tomographic problems involving structural variation. Inverting it involves applying a filter akin to the ramp filter in tomography. We design a basis in which this linear operator is sparse and thus can be tractably inverted despite its large size. We demonstrate via numerical experiments on synthetic datasets the robustness of our algorithm to high levels of noise. PMID:25699132

Effect of nickel-titanium shape memory metal alloy on bone formation.

PubMed

Kapanen, A; Ryhänen, J; Danilov, A; Tuukkanen, J

2001-09-01

The aim of this study was to determine the biocompatibility of NiTi alloy on bone formation in vivo. For this purpose we used ectopic bone formation assay which goes through all the events of bone formation and calcification. Comparisons were made between Nitinol (NiTi), stainless steel (Stst) and titanium-aluminium (6%)-vanadium (4%) alloy (Ti-6Al-4V), which were implanted for 8 weeks under the fascia of the latissimus dorsi muscle in 3-month-old rats. A light-microscopic examination showed no chronic inflammatory or other pathological findings in the induced ossicle or its capsule. New bone replaced part of the decalcified matrix with mineralized new cartilage and bone. The mineral density was measured with peripheral quantitative computed tomography (pQCT). The total bone mineral density (BMD) values were nearly equal between the control and the NiTi samples, the Stst samples and the Ti-6Al-4V samples had lower BMDs. Digital image analysis was used to measure the combined area of new fibrotic tissue and original implanted bone matrix powder around the implants. There were no significant differences between the implanted materials, although Ti-6Al-4V showed the largest matrix powder areas. The same method was used for measurements of proportional cartilage and new bone areas in the ossicles. NiTi showed the largest cartilage area (p < or = 0.05). Between implant groups the new bone area was largest in NiTi. We conclude that NiTi has good biocompatibility, as its effects on ectopic bone formation are similar to those of Stst, and that the ectopic bone formation assay developed here can be used for biocompatibility studies.

Comparison of acellular dermal matrix and synthetic mesh for lateral chest wall reconstruction in a rabbit model.

PubMed

Holton, Luther H; Chung, Thomas; Silverman, Ronald P; Haerian, Hafez; Goldberg, Nelson H; Burrows, Whitney M; Gobin, Andrea; Butler, Charles E

2007-04-01

Synthetic mesh is used for chest wall reconstruction, but infection or exposure can occur and necessitate removal. Human acellular dermal matrix (AlloDerm) has been used to reconstruct musculofascial defects in the trunk with low infection and herniation rates. AlloDerm may have advantages over synthetic mesh for chest wall reconstruction. This study compared outcomes and repair strengths of AlloDerm to expanded polytetrafluoroethylene mesh used for repair of rib cage defects. A 3 x 3-cm, full-thickness, lateral rib cage defect was created in each rabbit and repaired with expanded polytetrafluoroethylene (n = 8) or acellular dermal matrix (n = 9). At 4 weeks, the animals were euthanized and evaluated for lung herniation/dehiscence, strength of adhesions between the implant and intrapleural structures, and breaking strength of the implant materials and the implant-fascia interface. Tissue sections were analyzed with histologic and immunohistochemical staining to evaluate cellular infiltration and vascularization. No herniation or dehiscence occurred with either material. The incidence and strength of adhesions was similar between materials. The mean breaking strength of the AlloDerm-fascia interface (14.5 +/- 8.9 N) was greater than the expanded polytetrafluoroethylene-fascia interface (8.7 +/- 4.4 N; p = 0.027) and similar to the rib-intercostal-rib interface of the contralateral native chest wall (14.0 +/- 5.6 N). The AlloDerm grafts became infiltrated with cells and vascularized after implantation. AlloDerm used for chest wall reconstruction results in greater implant-defect interface strength than expanded polytetrafluoroethylene. The ability of AlloDerm to become vascularized and remodeled by autologous cells and to resist infection may be advantageous for chest wall reconstruction.

UV irradiation study of a tripeptide isolated in an argon matrix: A tautomerism process evidenced by infrared and X-ray photoemission spectroscopies

NASA Astrophysics Data System (ADS)

Mateo-Marti, E.; Pradier, C. M.

2013-05-01

Matrix isolation is a powerful tool for studying photochemical processes occurring in isolated molecules. In this way, we characterized the chemical modifications occurring within a tri peptide molecule, IGF, when exposed to the influence of Ultraviolet (UV) irradiation. This paper first describes the successful formation of the tripeptide (IGF) argon matrix under vacuum conditions, followed by the in situ UV irradiation and characterization of the molecular matrix reactivity after UV-irradiation. These studies have been performed by combining two complementary spectroscopic techniques, Fourier-Transform Reflexion Absorption Spectroscopy (FT-IRRAS) and X-ray Photoelectron Spectroscopy (XPS). The IR spectra of the isolated peptide-matrix, before and after UV irradiation, revealed significant differences that could be associated either to a partial deprotonation of the molecule or to a tautomeric conversion of some amide bonds to imide ones on some peptide molecules. XPS analyses undoubtedly confirmed the second hypothesis; the combination of IRRAS and XPS results provide evidence that UV irradiation of peptides induces a chemical reaction, namely a shift of the double bond, meaning partial conversion from amide tautomer into an imidic acid tautomer.

The quantum matrix and information from the hydrocarbon oil molecule

NASA Astrophysics Data System (ADS)

Seyful-Mulyukov, R. B.

2016-03-01

The quantum matrix of the hydrocarbon (HC) molecule is substantiated. On the basis of its properties and behavior, the genesis of oil is explained as a process of self-evolution of oil and preservation of molecules of different composition and generation time. Individual HC molecules are generated in nanoseconds, and the period of the genesis of oil is comparable with that of migration of the HC fluid from the mantle to the deposit. A model of subatomic abiogenic genesis of oil is presented. Hydrocarbon (HC) molecules of various structure and composition are formed due to interaction of the valency electron orbitals of C and H atoms, the elemental particles of which are quantum objects and carriers of information. On the basis of this, the term quantum matrix of the HC molecule, the properties and behavior of which explain the genesis of oil as a process of its self-evolution and preservation of the molecules of various composition and the period of generation of oil, is substantiated. It is proved that individual HC molecules are generated within nanoseconds and the period of origin of the entire assemblage of more than 500 molecules of oil of various types is comparable with the period of migration of the HC fluid from the mantle to the deposit.

A novel gene expression profile in lymphatics associated with tumor growth and nodal metastasis.

PubMed

Clasper, Steven; Royston, Daniel; Baban, Dilair; Cao, Yihai; Ewers, Stephan; Butz, Stefan; Vestweber, Dietmar; Jackson, David G

2008-09-15

Invasion of lymphatic vessels is a key step in the metastasis of primary tumors to draining lymph nodes. Although the process is enhanced by tumor lymphangiogenesis, it is unclear whether this is a consequence of increased lymphatic vessel number, altered lymphatic vessel properties, or both. Here we have addressed the question by comparing the RNA profiles of primary lymphatic endothelial cells (LEC) isolated from the vasculature of normal tissue and from highly metastatic T-241/vascular endothelial growth factor (VEGF)-C fibrosarcomas implanted in C57BL/6 mice. Our findings reveal significant differences in expression of some 792 genes (i.e., >or=2-fold up- or down-regulated, P

Realization and Integration of Large Lattice Mismatched Materials for Device Innovation: A Comprehensive Approach to the Underlying Science and Practical Application

DTIC Science & Technology

2011-07-08

Nastasi. Effects of Hydrogen Implantation Conditions on the Trapping of Hydrogen in InP, Applied Physics Letters ( ) 2006/07/25 10:01:57 1 TOTAL: 6...formation of 20 nm PMMA cylinder in a matrix of polystyrene. This cylinder pattern can be transferred to an underlying dielectric mask and used in...allowing for selective hydrogen implantation . The implanted wafers were bonded to acceptor substrates and transfer was initiated. The surface of the

Cellular and nerve regeneration within a biosynthetic extracellular matrix for corneal transplantation

NASA Astrophysics Data System (ADS)

Li, Fengfu; Carlsson, David; Lohmann, Chris; Suuronen, Erik; Vascotto, Sandy; Kobuch, Karin; Sheardown, Heather; Munger, Rejean; Nakamura, Masatsugu; Griffith, May

2003-12-01

Our objective was to determine whether key properties of extracellular matrix (ECM) macromolecules can be replicated within tissue-engineered biosynthetic matrices to influence cellular properties and behavior. To achieve this, hydrated collagen and N-isopropylacrylamide copolymer-based ECMs were fabricated and tested on a corneal model. The structural and immunological simplicity of the cornea and importance of its extensive innervation for optimal functioning makes it an ideal test model. In addition, corneal failure is a clinically significant problem. Matrices were therefore designed to have the optical clarity and the proper dimensions, curvature, and biomechanical properties for use as corneal tissue replacements in transplantation. In vitro studies demonstrated that grafting of the laminin adhesion pentapeptide motif, YIGSR, to the hydrogels promoted epithelial stratification and neurite in-growth. Implants into pigs' corneas demonstrated successful in vivo regeneration of host corneal epithelium, stroma, and nerves. In particular, functional nerves were observed to rapidly regenerate in implants. By comparison, nerve regeneration in allograft controls was too slow to be observed during the experimental period, consistent with the behavior of human cornea transplants. Other corneal substitutes have been produced and tested, but here we report an implantable matrix that performs as a physiologically functional tissue substitute and not simply as a prosthetic device. These biosynthetic ECM replacements should have applicability to many areas of tissue engineering and regenerative medicine, especially where nerve function is required. regenerative medicine | tissue engineering | cornea | implantation | innervation

MRI-based, wireless determination of the transfer function of a linear implant: Introduction of the transfer matrix.

PubMed

Tokaya, Janot P; Raaijmakers, Alexander J E; Luijten, Peter R; van den Berg, Cornelis A T

2018-04-24

We introduce the transfer matrix (TM) that makes MR-based wireless determination of transfer functions (TFs) possible. TFs are implant specific measures for RF-safety assessment of linear implants. The TF relates an incident tangential electric field on an implant to a scattered electric field at its tip that generally governs local heating. The TM extends this concept and relates an incident tangential electric field to a current distribution in the implant therewith characterizing the RF response along the entire implant. The TM is exploited to measure TFs with MRI without hardware alterations. A model of rightward and leftward propagating attenuated waves undergoing multiple reflections is used to derive an analytical expression for the TM. This allows parameterization of the TM of generic implants, e.g., (partially) insulated single wires, in a homogeneous medium in a few unknowns that simultaneously describe the TF. These unknowns can be determined with MRI making it possible to measure the TM and, therefore, also the TF. The TM is able to predict an induced current due to an incident electric field and can be accurately parameterized with a limited number of unknowns. Using this description the TF is determined accurately (with a Pearson correlation coefficient R ≥ 0.9 between measurements and simulations) from MRI acquisitions. The TM enables measuring of TFs with MRI of the tested generic implant models. The MR-based method does not need hardware alterations and is wireless hence making TF determination in more realistic scenarios conceivable. © 2018 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine.

MMP2-cleavage of DMP1 generates a bioactive peptide promoting differentiation of dental pulp stem/progenitor cell.

PubMed

Chaussain, Catherine; Eapen, Asha Sarah; Huet, Eric; Floris, Caroline; Ravindran, Sriram; Hao, Jianjun; Menashi, Suzanne; George, Anne

2009-11-12

Dentin Matrix Protein 1 (DMP1) plays a regulatory role in dentin mineralization and can also function as a signaling molecule. MMP-2 (matrix metalloproteinase-2) is a predominant protease in the dentin matrix that plays a prominent role in tooth formation and a potential role during the carious process. The possibility that MMP-2 can cleave DMP1 to release biologically active peptides was investigated in this study. DMP1, both in the recombinant form and in its native state within the dentin matrix, was shown to be a substrate for MMP-2. Proteolytic processing of DMP1 by MMP-2 produced two major peptides, one that contains the C-terminal region of the protein known to carry both the ASARM (aspartic acid and serine rich domain) domain involved in biomineralization and the DNA binding site of DMP1. In vitro experiments with recombinant N- and C-terminal polypeptides mimicking the MMP-2 cleavage products of DMP1 demonstrated an effect of the C-polypeptide on the differentiation of dental pulp stem/progenitor cells to a putative odontoblast phenotype. In vivo implantation of this peptide in a rat injured pulp model induced a rapid formation of a homogeneous dentin bridge covered by a palisade of orientated cells expressing dentin sialoprotein (DSP) and DMP1, attesting an efficient repair process. These data suggest that a peptide generated through the proteolytic processing of DMP1 by MMP-2 can regulate the differentiation of mesenchymal cells during dentinogenesis and thus sustain reparative dentin formation in pathological situations such as carious decay. In addition, these data open a new therapeutic possibility of using this peptide to regenerate dentin after an injury.

Current status of grafts and implants in rhinoplasty: Part II. Homologous grafts and allogenic implants.

PubMed

Sajjadian, Ali; Naghshineh, Nima; Rubinstein, Roee

2010-03-01

After reading this article, the participant should be able to: 1. Understand the challenges in restoring volume and structural integrity in rhinoplasty. 2. Identify the appropriate uses of various homologous grafts and allogenic implants in reconstruction, including: (a) freeze-dried acellular allogenic cadaveric dermis grafts, (b) irradiated cartilage grafts, (c) hydroxyapatite mineral matrix, (d) silicone implants, (e) high-density polyethylene implants, (f) polytetrafluoroethylene implants, and (g) injectable filler materials. 3. Identify the advantages and disadvantages of each of these biomaterials. 4. Understand the specific techniques that may aid in the use these grafts or implants. This review specifically addresses the use of homologous grafts and allogenic implants in rhinoplasty. It is important to stress that autologous materials remain the preferred graft material for use in rhinoplasty, owing to their high biocompatibility and low risk of infection and extrusion. However, concerns of donor-site morbidity, graft availability, and graft resorption have motivated the development and use of homologous and allogenic implants.

Nonexpansive immediate breast reconstruction using human acellular tissue matrix graft (AlloDerm).

PubMed

Salzberg, C Andrew

2006-07-01

Immediate breast reconstruction has become a standard of care following mastectomy for cancer, largely due to improved esthetic and psychologic outcomes achieved with this technique. However, the current historical standards--transverse rectus abdominis myocutaneous flap reconstruction and expander--implant surgery-still have limitations as regards patient morbidity, short-term body-image improvements, and even cost. To address these shortcomings, we employ a novel concept of human tissue replacement to enhance breast shape and provide total coverage, enabling immediate mound reconstruction without the need for breast expansion prior to permanent implant placement. AlloDerm (human acellular tissue matrix) is a human-derived graft tissue with extensive experience in various settings of skin and soft tissue replacement surgery. This report describes the success using acellular tissue matrix to provide total coverage over the prosthesis in immediate reconstruction, with limited muscle dissection. In this population, 49 patients (76 breasts) successfully underwent the acellular tissue matrix-based immediate reconstruction, resulting in durable breast reconstruction with good symmetry. These findings may predict that acellular tissue matrix-supplemented immediate breast reconstruction will become a new technique for the immediate reconstruction of the postmastectomy breast.

Extracellular matrix mediators of metastatic cell colonization characterized using scaffold mimics of the pre-metastatic niche.

PubMed

Aguado, Brian A; Caffe, Jordan R; Nanavati, Dhaval; Rao, Shreyas S; Bushnell, Grace G; Azarin, Samira M; Shea, Lonnie D

2016-03-01

Metastatic tumor cells colonize the pre-metastatic niche, which is a complex microenvironment consisting partially of extracellular matrix (ECM) proteins. We sought to identify and validate novel contributors to tumor cell colonization using ECM-coated poly(ε-caprolactone) (PCL) scaffolds as mimics of the pre-metastatic niche. Utilizing orthotopic breast cancer mouse models, fibronectin and collagen IV-coated scaffolds implanted in the subcutaneous space captured colonizing tumor cells, showing a greater than 2-fold increase in tumor cell accumulation at the implant site compared to uncoated scaffolds. As a strategy to identify additional ECM colonization contributors, decellularized matrix (DCM) from lungs and livers containing metastatic tumors were characterized. In vitro, metastatic cell adhesion was increased on DCM coatings from diseased organs relative to healthy DCM. Furthermore, in vivo implantations of diseased DCM-coated scaffolds had increased tumor cell colonization relative to healthy DCM coatings. Mass-spectrometry proteomics was performed on healthy and diseased DCM to identify candidates associated with colonization. Myeloperoxidase was identified as abundantly present in diseased organs and validated as a contributor to colonization using myeloperoxidase-coated scaffold implants. This work identified novel ECM proteins associated with colonization using decellularization and proteomics techniques and validated candidates using a scaffold to mimic the pre-metastatic niche. The pre-metastatic niche consists partially of ECM proteins that promote metastatic cell colonization to a target organ. We present a biomaterials-based approach to mimic this niche and identify ECM mediators of colonization. Using murine breast cancer models, we implanted microporous PCL scaffolds to recruit colonizing tumor cells in vivo. As a strategy to modulate colonization, we coated scaffolds with various ECM proteins, including decellularized lung and liver matrix from tumor-bearing mice. After characterizing the organ matrices using proteomics, myeloperoxidase was identified as an ECM protein contributing to colonization and validated using our scaffold. Our scaffold provides a platform to identify novel contributors to colonization and allows for the capture of colonizing tumor cells for a variety of downstream clinical applications. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Unusual analyte-matrix adduct ions and mechanism of their formation in MALDI TOF MS of benzene-1,3,5-tricarboxamide and urea compounds.

PubMed

Lou, Xianwen; Fransen, Michel; Stals, Patrick J M; Mes, Tristan; Bovee, Ralf; van Dongen, Joost J L; Meijer, E W

2013-09-01

Analyte-matrix adducts are normally absent under typical matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) conditions. Interestingly, though, in the analysis of several types of organic compounds synthesized in our laboratory, analyte-matrix adduct ion peaks were always recorded when common MALDI matrices such as 4-hydroxy-α-cyanocinnamic acid (CHCA) were used. These compounds are mainly those with a benzene-1,3,5-tricarboxamide (BTA) or urea moiety, which are important building blocks to make new functional supramolecular materials. The possible mechanism of the adduct formation was investigated. A shared feature of the compounds studied is that they can form intermolecular hydrogen bonding with matrices like CHCA. The intermolecular hydrogen bonding will make the association between analyte ions and matrix molecules stronger. As a result, the analyte ions and matrix molecules in MALDI clusters will become more difficult to be separated from each other. Furthermore, it was found that analyte ions were mainly adducted with matrix salts, which is probably due to the much lower volatility of the salts compared with that of their corresponding matrix acids. It seems that the analyte-matrix adduct formation for our compounds are caused by the incomplete evaporation of matrix molecules from the MALDI clusters because of the combined effects of enhanced intermolecular interaction between analyte-matrix and of the low volatility of matrix salts. Based on these findings, strategies to suppress the analyte-matrix adduction are briefly discussed. In return, the positive results of using these strategies support the proposed mechanism of the analyte-matrix adduct formation.

Xenogeneic collagen matrix versus connective tissue graft for buccal soft tissue augmentation at implant site. A randomized, controlled clinical trial.

PubMed

Cairo, Francesco; Barbato, Luigi; Tonelli, Paolo; Batalocco, Guido; Pagavino, Gabriella; Nieri, Michele

2017-07-01

Peri-implant soft tissue may be critical to prevent inflammation and promote gingival margin stability. The purpose of this randomized clinical trial (RCT) is to compare xenogeneic collagen matrix (XCM) versus connective tissue graft (CTG) to increase buccal soft tissue thickness at implant site. Soft tissue augmentation with XCM (test) or CTG (control) was performed at 60 implants in 60 patients at the time of implant uncovering. Measurements were performed by a blinded examiner at baseline, 3 and 6 months. Outcome measures included buccal soft tissue thickness (GT), apico-coronal keratinized tissue (KT), chair time and post-operative discomfort. Visual Analogue Scale (VAS) was used to evaluate patient satisfaction. After 6 months, the final GT increase was 0.9 ± 0.2 in the XCM group and 1.2 ± 0.3 mm in the CTG group, with a significant difference favouring the control group (0.3 mm; p = .0001). Both procedures resulted in similar final KT amount with no significant difference between treatments. XCM was associated with significant less chair-time (p < .0001), less post-operative pain (p < .0001), painkillers intake (p < .0001) and higher final satisfaction than CTG (p = .0195). CTG was more effective than XCM to increase buccal peri-implant soft tissue thickness. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Esthetic soft tissue management for teeth and implants.

PubMed

Fu, Jia-Hui; Su, Chuan-Yi; Wang, Hom-Lay

2012-09-01

Can newly introduced graft materials be successfully used in soft tissue augmentation around teeth and dental implants? An electronic search on the PubMed database for English articles published before March 31, 2012, was performed using the following key words: "root coverage," "soft tissue graft," "periodontal plastic surgery," "subepithelial connective graft (SCTG)," "acellular dermal matrix (ADM)," "guided tissue regeneration based root coverage (GTRC)," "recession defects," "mucogingival defects," "collagen matrix," "living cellular construct (LCC)," "mucograft," and "biologic agents." Literature featuring new soft tissue graft materials, such as ADM, collagen matrix, GTRC, and biologic agents, were included. Data showed (1) allogeneic grafts were comparable to SCTG in terms of mean complete root coverage (CRC), mean root coverage (RC), and mean amount of keratinized tissue (KT) gain; (2) xenogeneic collagen matrix was as comparable to SCTG in terms of mean amount of KT gain around teeth and dental implants but inferior in achieving RC; (3) GTRC was inferior to SCTG in terms of mean CRC and mean RC; (4) LCC was inferior to free gingival graft in terms of mean amount of KT gain but was superior in esthetics and patient satisfaction; and (5) adjunctive use of biologic agents did not exert a significant effect on mean CRC, mean RC, and mean amount of KT gain. Although these new materials do not surpass the gold standard (SCTG), they do provide improved patient satisfaction and esthetics, are available in abundance, and lead to reduced postoperative discomfort and surgical time. Copyright © 2012 Elsevier Inc. All rights reserved.

Critical Evaluation of Risk Factors and Early Complications in 564 Consecutive Two-Stage Implant-Based Breast Reconstructions Using Acellular Dermal Matrix at a Single Center.

PubMed

Selber, Jesse C; Wren, James H; Garvey, Patrick B; Zhang, Hong; Erickson, Cameron; Clemens, Mark W; Butler, Charles E

2015-07-01

Acellular dermal matrix for implant-based breast reconstruction appears to cause higher early complication rates, but long-term outcomes are perceived to be superior. This dichotomy is the subject of considerable debate. The authors hypothesized that patient characteristics and operative variables would have a greater impact on complications than the type of acellular dermal matrix used. A retrospective cohort study was performed of consecutive patients who underwent two-stage, implant-based breast reconstruction with human cadaveric or bovine acellular dermal matrix from 2006 to 2012 at a single institution. Patient characteristics and operative variables were analyzed using logistic regression analyses to identify risk factors for complications. The authors included 564 reconstructions in the study. Radiation therapy and obesity increased the odds of all complications. Every 100-ml increase in preoperative breast volume increased the odds of any complication by 1 percent, the odds of infection by 27 percent, and the risk of explantation by 16 percent. The odds of seroma increased linearly with increasing surface area of acellular dermal matrix. Odds of infection were higher with an intraoperative expander fill volume greater than 50 percent of the total volume. Risk of explantation was twice as high when intraoperative expander fill volume was greater than 300 ml. Radiation therapy, obesity, larger breasts, higher intraoperative fill volumes, and larger acellular dermal matrices are all independent risk factors for early complications. Maximizing the initial mastectomy skin envelope fill must be balanced with the understanding that higher complication rates may result from a larger intraoperative breast mound. Risk, III.

Vibrational excitation and dissociative attachment of a triatomic molecule: CO/sub 2/ in the collinear approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, C.F.; Light, J.C.

1986-02-01

The effective R-matrix model and the R-matrix propagative method applied earlier to elec- tron--diatomic-molecule scattering are extended to treat dissociative attachment of collinear triatomic molecules. To describe the vibrational excitation and dissociative attachment of CO/sub 2/ in the 4-eV region, the nuclear dynamics is solved on a Wall-Porter potential-energy surface. A hybrid approach is developed in which the L/sup 2/ and R-matrix propagation methods are combined to evaluate the global R matrix. Our calculations show that it is easier to excite the symmetric mode vibrations than the asymmetric mode vibrations. Our results also show that the observed structures in themore » energy dependence of the dissociative attachment cross sections are due to the vibrational states of the negative ion (CO/sub 2/ /sup -/) and not to the vibrational states of the CO fragment.« less

Novel peptide-based platform for the dual presentation of biologically active peptide motifs on biomaterials.

PubMed

Mas-Moruno, Carlos; Fraioli, Roberta; Albericio, Fernando; Manero, José María; Gil, F Javier

2014-05-14

Biofunctionalization of metallic materials with cell adhesive molecules derived from the extracellular matrix is a feasible approach to improve cell-material interactions and enhance the biointegration of implant materials (e.g., osseointegration of bone implants). However, classical biomimetic strategies may prove insufficient to elicit complex and multiple biological signals required in the processes of tissue regeneration. Thus, newer strategies are focusing on installing multifunctionality on biomaterials. In this work, we introduce a novel peptide-based divalent platform with the capacity to simultaneously present distinct bioactive peptide motifs in a chemically controlled fashion. As a proof of concept, the integrin-binding sequences RGD and PHSRN were selected and introduced in the platform. The biofunctionalization of titanium with this platform showed a positive trend towards increased numbers of cell attachment, and statistically higher values of spreading and proliferation of osteoblast-like cells compared to control noncoated samples. Moreover, it displayed statistically comparable or improved cell responses compared to samples coated with the single peptides or with an equimolar mixture of the two motifs. Osteoblast-like cells produced higher levels of alkaline phosphatase on surfaces functionalized with the platform than on control titanium; however, these values were not statistically significant. This study demonstrates that these peptidic structures are versatile tools to convey multiple biofunctionality to biomaterials in a chemically defined manner.

Syndecan-1 knock-down in decidualized human endometrial stromal cells leads to significant changes in cytokine and angiogenic factor expression patterns

PubMed Central

2010-01-01

Background Successful embryonic implantation depends on a synchronized embryo-maternal dialogue. Chemokines, such as chemokine ligand 1 (CXCL1), play essential roles in the maternal reproductive tract leading to morphological changes during decidualization, mediating maternal acceptance towards the semi-allograft embryo and induction of angiogenesis. Chemokine binding to their classical G-protein coupled receptors is essentially supported by the syndecan (Sdc) family of heparan sulfate proteoglycans. The aim of this study was to identify the involvement of Sdc-1 at the embryo-maternal interface regarding changes of the chemokine and angiogenic profile of the decidua during the process of decidualization and implantation in human endometrium. Methods A stable Sdc-1 knock-down was generated in the immortalized human endometrial stromal cell line St-T1 and was named KdS1. The ability of KdS1 to decidualize was proven by Insulin-like growth factor binding 1 (IGFBP1) and prolactin (PRL) confirmation on mRNA level before further experiments were carried out. Dot blot protein analyses of decidualized knock-down cells vs non-transfected controls were performed. In order to imitate embryonic implantation, decidualized KdS1 were then incubated with IL-1beta, an embryo secretion product, vs controls. Statistical analyses were performed applying the Student's t-test with p < 0.05, p < 0.02 and p < 0.01 and one way post-hoc ANOVA test with p < 0.05 as cut-offs for statistical significance. Results The induction of the Sdc-1 knock-down revealed significant changes in cytokine and angiogenic factor expression profiles of dKdS1 vs decidualized controls. Incubation with embryonic IL-1beta altered the expression patterns of KdS1 chemokines and angiogenic factors towards inflammatory-associated molecules and factors involved in matrix regulation. Conclusions Sdc-1 knock-down in human endometrial stroma cells led to fulminant changes regarding cytokine and angiogenic factor expression profiles upon decidualization and imitation of embryonic contact. Sdc-1 appears to play an important role as a co-receptor and storage factor for many cytokines and angiogenic factors during decidualization and implantation period, supporting proper implantation and angiogenesis by regulation of chemokine and angiogenic factor secretion in favour of the implanting embryo. PMID:21044331

Changes of the peri-implant soft tissue thickness after grafting with a collagen matrix

PubMed Central

Zafiropoulos, Gregory-George; Deli, Giorgio; Hoffmann, Oliver; John, Gordon

2016-01-01

Background: The aim of this study was to determine the treatment outcome of the use of a porcine monolayer collagen matrix (mCM) to increase soft-tissue volume as a part of implant site development. Materials and Methods: Implants were placed in single sites in 27 patients. In the test group, mCM was used for soft-tissue augmentation. No graft was placed in the control group. Soft-tissue thickness (STTh) was measured at the time of surgery (T0) and 6 months postoperatively (T1) at two sites (STTh 1, 1 mm below the gingival margin; STTh 2, 3 mm below the mucogingival margin). Results: Significant increases (P < 0.001) in STTh (STTh 1 = 1.06 mm, 117%; STTh 2 = 0.89 mm, 81%) were observed in the test group. Biopsy results showed angiogenesis and mature connective tissue covered by keratinized epithelium. Conclusions: Within the limitations of this study, it could be concluded that mCM leads to a significant increase of peri-implant soft-tissue thickness, with good histological integration and replacement by soft tissue and may serve as an alternative to connective tissue grafting. PMID:28298828

New Coating Technique of Ceramic Implants with Different Glass Solder Matrices for Improved Osseointegration-Mechanical Investigations.

PubMed

Mick, Enrico; Markhoff, Jana; Mitrovic, Aurica; Jonitz, Anika; Bader, Rainer

2013-09-11

Ceramics are a very popular material in dental implant technology due to their tribological properties, their biocompatibility and their esthetic appearance. However, their natural surface structure lacks the ability of proper osseointegration, which constitutes a crucial process for the stability and, thus, the functionality of a bone implant. We investigated the application of a glass solder matrix in three configurations-consisting mainly of SiO₂, Al₂O₃, K₂O and Na₂O to TZP-A ceramic specimens. The corresponding adhesive strength and surface roughness of the coatings on ceramic specimens have been analyzed. Thereby, high adhesive strength (70.3 ± 7.9 MPa) was found for the three different coatings. The obtained roughness (R z ) amounted to 18.24 ± 2.48 µm in average, with significant differences between the glass solder configurations. Furthermore, one configuration was also tested after additional etching which did not lead to significant increase of surface roughness (19.37 ± 1.04 µm) or adhesive strength (57.2 ± 5.8 MPa). In conclusion, coating with glass solder matrix seems to be a promising surface modification technique that may enable direct insertion of ceramic implants in dental and orthopaedic surgery.

Ex-vivo transduced autologous skin fibroblasts expressing human Lim Mineralization Protein-3 efficiently form new bone in animal models

PubMed Central

Lattanzi, Wanda; Parrilla, Claudio; Fetoni, Annarita; Logroscino, Giandomenico; Straface, Giuseppe; Pecorini, Giovanni; Stigliano, Egidio; Tampieri, Anna; Bedini, Rossella; Pecci, Raffaella; Michetti, Fabrizio; Gambotto, Andrea; Robbins, Paul D.; Pola, Enrico

2012-01-01

Local gene transfer of the human LIM Mineralization Protein (LMP), a novel intracellular positive regulator of the osteoblast differentiation program, can induce efficient bone formation in rodents. In order to develop a clinically relevant gene therapy approach to facilitate bone healing, we have used primary dermal fibroblasts transduced ex vivo with Ad.LMP3 and seeded on an hydroxyapatite/collagen matrix prior to autologous implantation. Here we demonstrate that genetically modified autologous dermal fibroblasts expressing Ad.LMP-3 are able to induce ectopic bone formation following implantation of the matrix into the mouse triceps and paravertebral muscles. Moreover, implantation of the Ad.LMP-3-modified dermal fibroblasts into a rat mandibular bone critical size defect model results in efficient healing as determined by X-ray, histology and three dimensional micro computed tomography (3DμCT). These results demonstrate the effectiveness of the non-secreted intracellular osteogenic factor LMP-3, in inducing bone formation in vivo. Moreover, the utilization of autologous dermal fibroblasts implanted on a biomaterial represents a promising approach for possible future clinical applications aimed at inducing new bone formation. PMID:18633445

Infrared Matrix-Isolation Study of New Noble-Gas Compounds

NASA Astrophysics Data System (ADS)

Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid

2016-06-01

We identify new noble-gas compounds in solid matrices using IR spectroscopy. The compounds under study belong to two types: HNgY and YNgY' where Ng is a noble-gas atom and Y and Y' are electronegative fragments. The experimental assignments are supported by ab initio calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. We have prepared and characterized two new HNgY compounds (noble-gas hydrides): HKrCCCl in a Kr matrix and HXeCCCl in a Xe matrix.I The synthesis of these compounds includes two steps: UV photolysis of HCCCl in a noble-gas matrix to form the H + CCCl fragments and annealing of the matrix to mobilize H atoms and to promote the H + Ng + CCCl = HNgCCCl reaction. An interesting observation in the experiments on HXeCCCl in a Xe matrix is the temperature-induced transformation of the three H-Xe stretching bands. This observation is explained by temperature-induced changes of local matrix morphology around the embedded HXeCCCl molecule. In these experiments, we have also obtained the IR spectrum of the CCCl radical, which is produced by photodecomposition of HCCCl. We have identified three new YNgY' compounds (fluorinated noble-gas cyanides): FKrCN in a Kr matrix and FXeCN and FXeNC in a Xe matrix.II These molecule are formed by photolysis of FCN in a noble-gas matrix due to locality of this process. The amount of these molecules increases upon thermal mobilization of the F atoms in the photolyzed matrix featuring the F + Ng + CN reaction.

Electron tomography and nano-diffraction enabling the investigation of individual magnetic nanoparticles inside fibers of MR visible implants

NASA Astrophysics Data System (ADS)

Slabu, I.; Wirch, N.; Caumanns, T.; Theissmann, R.; Krüger, M.; Schmitz-Rode, T.; Weirich, T. E.

2017-08-01

Superparamagnetic iron oxide nanoparticles (SPIONPs) incorporated into the base material of implants are used as contrast agents in magnetic resonance imaging for the delineation of the implants from the surrounding tissue. However, the delineation quality is strongly related to the structural characteristics of the incorporated SPIONPs and their interparticle interaction as well as their interaction with the polymer matrix of the implant. Consequently, a profound knowledge of the formation of aggregates inside the polymer matrix, which are responsible for strong interparticle interactions, and of their structural characteristics, is required for controlling the magnetic resonance image quality of the implants. In this work, transmission electron microscopy methods such as electron tomography and nano-electron diffraction were used to depict SPIONP aggregates inside the melt-spin polyvinylidene fluoride fibers used for the assembly of implants and to determine the crystal structure of individual nanocrystals inside these aggregates, respectively. Using these techniques it was possible for the first time to characterize the aggregates inside the fibers of implants and to validate the magnetization measurements that have been previously used to assess the interaction phenomena inside the fibers of implants. With electron tomography, inhomogeneously sized distributed aggregates were delineated and 3D models of these aggregates were constructed. Furthermore, the distribution of the aggregates inside the fibers was verified by means of magnetic force microscopy. With nano-diffraction measurements, the SPIONP crystal structure inside the fibers of the implant could not be clearly assigned to that of magnetite (Fe3O4) or maghemite (γ-Fe2O3). Therefore, additional electron energy loss spectroscopy measurements were performed, which revealed the presence of both phases of Fe3O4 and γ-Fe2O3, probably caused by oxidation processes during the manufacture of the fibers by melt-spinning.

N-(1-Naphthyl) Ethylenediamine Dinitrate: A New Matrix for Negative Ion MALDI-TOF MS Analysis of Small Molecules

NASA Astrophysics Data System (ADS)

Chen, Rui; Chen, Suming; Xiong, Caiqiao; Ding, Xunlei; Wu, Chih-Che; Chang, Huan-Cheng; Xiong, Shaoxiang; Nie, Zongxiu

2012-09-01

An organic salt, N-(1-naphthyl) ethylenediamine dinitrate (NEDN), with rationally designed properties of a strong UV absorbing chromophore, hydrogen binding and nitrate anion donors, has been employed as a matrix to analyze small molecules ( m/z < 1000) such as oligosaccharides, peptides, metabolites and explosives using negative ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Compared with conventional matrixes such as α-cyano-4-hydroxycinnamic acid (CCA) and 2,5-dihydroxybenzoic acid (DHB), NEDN provides a significant improvement in detection sensitivity and yields very few matrix-associated fragment and cluster ions interfering with MS analysis. For low-molecular-weight saccharides, the lowest detection limit achieved ranges from 500 amol to 5 pmol, depending on the molecular weight and the structure of the analytes. Additionally, the mass spectra in the lower mass range ( m/z < 200) consist of only nitrate and nitric acid cluster ions, making the matrix particularly useful for structural identification of oligosaccharides by post-source decay (PSD) MALDI-MS. Such a characteristic is illustrated by using maltoheptaose as a model system. This work demonstrates that NEDN is a novel negative ion-mode matrix for MALDI-MS analysis of small molecules with nitrate anion attachment.

Consistent force field modeling of matrix isolated molecules. V. Minimum energy path potential to the conformer conversion of 1,2-difluoroethane: Ar 364, ab initio calculation of electric multipole moments and electric polarization contribution to the conversion barrier

NASA Astrophysics Data System (ADS)

Gunde, R.; Ha, T.-K.; Günthard, H. H.

1990-08-01

In this paper results of consistent force field modeling (CFF) of the potential function to conversion of the gauche (g) to the trans (t) conformer of 1,2-difluoroethane (DFE) isolated in an argon matrix will be reported. Starting point are locally stable configurations gDFE:Ar 364 (defect GH1) and tDFE:Ar 364 (TH1) obtained in previous work from CFF modeling of a cube shaped Ar 364 fragment containing one DFE molecule in its center. Using the dihedral angle of DFE as an independent parameter the minimum energy path of the conversion process gDFE:Ar 364→tDFE:Ar 364 will be determined by CFF energy minimization. Determination of the minimum energy path is found to require large numbers of energy minimization steps and to lead to a rather complicated motion of the molecule with respect to the crystal fragment. Surprisingly the molecule-matrix interactions lead to a reduction of the g-t barrier by ≈500 cal/mol and to a stabilization of the trans species by ≈500 cal/mol. This finding is a consequence of a delicate interplay of matrix-molecule and matrix-matrix interactions. Calculation of the electric polarization energy (induced dipole-first-order polarization approximation) is based on extended ab initio calculations of dipole and quadrupole moments and a bond polarizability estimate of the first-order polarizability of DFE as a function of the internal rotation angle, on Fourier expansion of multipole components and use of symmetry for reduction of the order of the linear system defining the (self-consistent) induced dipole moments of all Ar atoms. Electric polarization is found to alter the potential function of the conversion process in a profound way: the g-t barrier and the t-g energy difference are increased to ≈3000 cal/mol and to ≈1500 cal/mol respectively (≈2500 and ≈530 cal/mol respectively for free DFE). Further applications of the technique developed in this work to related problems of matrix isolated molecules, e.g., vibrational matrix shifts will be discussed.

Cell recruitment by amnion chorion grafts promotes neovascularization.

PubMed

Maan, Zeshaan N; Rennert, Robert C; Koob, Thomas J; Januszyk, Michael; Li, William W; Gurtner, Geoffrey C

2015-02-01

Nonhealing wounds are a significant health burden. Stem and progenitor cells can accelerate wound repair and regeneration. Human amniotic membrane has demonstrated efficacy in promoting wound healing, though the underlying mechanisms remain unknown. A dehydrated human amnion chorion membrane (dHACM) was tested for its ability to recruit hematopoietic progenitor cells to a surgically implanted graft in a murine model of cutaneous ischemia. dHACM was subcutaneously implanted under elevated skin (ischemic stimulus) in either wild-type mice or mice surgically parabiosed to green fluorescent protein (GFP) + reporter mice. A control acellular dermal matrix, elevated skin without an implant, and normal unwounded skin were used as controls. Wound tissue was harvested and processed for histology and flow cytometric analysis. Implanted dHACMs recruited significantly more progenitor cells compared with controls (*P < 0.05) and displayed in vivo SDF-1 expression with incorporation of CD34 + progenitor cells within the matrix. Parabiosis modeling confirmed the circulatory origin of recruited cells, which coexpressed progenitor cell markers and were localized to foci of neovascularization within implanted matrices. In summary, dHACM effectively recruits circulating progenitor cells, likely because of stromal derived factor 1 (SDF-1) expression. The recruited cells express markers of "stemness" and localize to sites of neovascularization, providing a partial mechanism for the clinical efficacy of human amniotic membrane in the treatment of chronic wounds. Copyright © 2015 Elsevier Inc. All rights reserved.

Cell recruitment by amnion chorion grafts promotes neovascularization

PubMed Central

Koob, Thomas J.; Januszyk, Michael; Li, William W.; Gurtner, Geoffrey C.

2015-01-01

Background Nonhealing wounds are a significant health burden. Stem and progenitor cells can accelerate wound repair and regeneration. Human amniotic membrane has demonstrated efficacy in promoting wound healing, though the underlying mechanisms remain unknown. A dehydrated human amnion chorion membrane (dHACM) was tested for its ability to recruit hematopoietic progenitor cells to a surgically implanted graft in a murine model of cutaneous ischemia. Methods dHACM was subcutaneously implanted under elevated skin (ischemic stimulus) in either wild-type mice or mice surgically parabiosed to green fluorescent protein (GFP) + reporter mice. A control acellular dermal matrix, elevated skin without an implant, and normal unwounded skin were used as controls. Wound tissue was harvested and processed for histology and flow cytometric analysis. Results Implanted dHACMs recruited significantly more progenitor cells compared with controls (*P < 0.05) and displayed in vivo SDF-1 expression with incorporation of CD34 + progenitor cells within the matrix. Parabiosis modeling confirmed the circulatory origin of recruited cells, which coexpressed progenitor cell markers and were localized to foci of neovascularization within implanted matrices. Conclusions In summary, dHACM effectively recruits circulating progenitor cells, likely because of stromal derived factor 1 (SDF-1) expression. The recruited cells express markers of “stemness” and localize to sites of neovascularization, providing a partial mechanism for the clinical efficacy of human amniotic membrane in the treatment of chronic wounds. PMID:25266600

Surface Modifications of Dental Ceramic Implants with Different Glass Solder Matrices: In Vitro Analyses with Human Primary Osteoblasts and Epithelial Cells

PubMed Central

Mick, Enrico

2014-01-01

Ceramic materials show excellent esthetic behavior, along with an absence of hypersensitivity, making them a possible alternative implant material in dental surgery. However, their surface properties enable only limited osseointegration compared to titanium implants. Within this study, a novel surface coating technique for enhanced osseointegration was investigated biologically and mechanically. Specimens of tetragonal zirconia polycrystal (TZP) and aluminum toughened zirconia (ATZ) were modified with glass solder matrices in two configurations which mainly consisted of SiO2, Al2O3, K2O, and Na2O. The influence on human osteoblastic and epithelial cell viability was examined by means of a WST-1 assay as well as live/dead staining. A C1CP-ELISA was carried out to verify procollagen type I production. Uncoated/sandblasted ceramic specimens and sandblasted titanium surfaces were investigated as a reference. Furthermore, mechanical investigations of bilaterally coated pellets were conducted with respect to surface roughness and adhesive strength of the different coatings. These tests could demonstrate a mechanically stable implant coating with glass solder matrices. The coated ceramic specimens show enhanced osteoblastic and partly epithelial viability and matrix production compared to the titanium control. Hence, the new glass solder matrix coating could improve bone cell growth as a prerequisite for enhanced osseointegration of ceramic implants. PMID:25295270

Surface modifications of dental ceramic implants with different glass solder matrices: in vitro analyses with human primary osteoblasts and epithelial cells.

PubMed

Markhoff, Jana; Mick, Enrico; Mitrovic, Aurica; Pasold, Juliane; Wegner, Katharina; Bader, Rainer

2014-01-01

Ceramic materials show excellent esthetic behavior, along with an absence of hypersensitivity, making them a possible alternative implant material in dental surgery. However, their surface properties enable only limited osseointegration compared to titanium implants. Within this study, a novel surface coating technique for enhanced osseointegration was investigated biologically and mechanically. Specimens of tetragonal zirconia polycrystal (TZP) and aluminum toughened zirconia (ATZ) were modified with glass solder matrices in two configurations which mainly consisted of SiO2, Al2O3, K2O, and Na2O. The influence on human osteoblastic and epithelial cell viability was examined by means of a WST-1 assay as well as live/dead staining. A C1CP-ELISA was carried out to verify procollagen type I production. Uncoated/sandblasted ceramic specimens and sandblasted titanium surfaces were investigated as a reference. Furthermore, mechanical investigations of bilaterally coated pellets were conducted with respect to surface roughness and adhesive strength of the different coatings. These tests could demonstrate a mechanically stable implant coating with glass solder matrices. The coated ceramic specimens show enhanced osteoblastic and partly epithelial viability and matrix production compared to the titanium control. Hence, the new glass solder matrix coating could improve bone cell growth as a prerequisite for enhanced osseointegration of ceramic implants.

Somatostatin analogs regress endometriotic implants in rats by decreasing implant levels of vascular endothelial growth factor and matrix metaloproteinase 9.

PubMed

Sevket, Osman; Sevket, Asli; Molla, Taner; Buyukpınarbasılı, Nur; Uysal, Omer; Yılmaz, Bulent; Dane, Banu; Kelekcı, Sefa

2013-06-01

To examine the effect of somatostatin analogs on surgically induced endometriosis in rat models. Endometrial tissue was implanted onto the abdominal peritoneum of 26 rats that were randomized into 3 groups. The rats in group 1(n = 9) were subcutaneously administered with 0.02 mg/kg/d of octreotide (a short-acting analog)for 28 days . The rats in group 2 (n = 8) were subcutaneously injected with 20 mg/kg of a single dose of a long-acting analogue lanreotide The rats in group 3 were given no medication and served as controls (n = 9). Mean volume and histologic score of implants in groups 1 (P < .01 and P < .05, respectively) and 2 (P < .01and P < .05, respectively) were significantly lower than that in group 3. There were significant reductions in vascular endothelial growth factor (VEGF) and matrix metalloproteinase 9 (MMP-9) immunoreactivities in group 1 (0.67 ± 0.50 and 1.22 ± 0.44, respectively; both P < .01) and group 2 (0.71 ± 0.48 and 0.86 ± 0.69, respectively; both P < .01) when compared with the control group (1.78 ± 0.83 and 2.11 ± 0.78, respectively). Somatostatin analogs has regressed significantly the size of the endometriotic implants and caused atrophy of these lesions in rats by decreasing explant levels of VEGF and MMP-9.

A simplified in vivo approach for evaluating the bioabsorbable behavior of candidate stent materials.

PubMed

Pierson, Daniel; Edick, Jacob; Tauscher, Aaron; Pokorney, Ellen; Bowen, Patrick; Gelbaugh, Jesse; Stinson, Jon; Getty, Heather; Lee, Chee Huei; Drelich, Jaroslaw; Goldman, Jeremy

2012-01-01

Metal stents are commonly used to revascularize occluded arteries. A bioabsorbable metal stent that harmlessly erodes away over time may minimize the normal chronic risks associated with permanent implants. However, there is no simple, low-cost method of introducing candidate materials into the arterial environment. Here, we developed a novel experimental model where a biomaterial wire is implanted into a rat artery lumen (simulating bioabsorbable stent blood contact) or artery wall (simulating bioabsorbable stent matrix contact). We use this model to clarify the corrosion mechanism of iron (≥99.5 wt %), which is a candidate bioabsorbable stent material due to its biocompatibility and mechanical strength. We found that iron wire encapsulation within the arterial wall extracellular matrix resulted in substantial biocorrosion by 22 days, with a voluminous corrosion product retained within the vessel wall at 9 months. In contrast, the blood-contacting luminal implant experienced minimal biocorrosion at 9 months. The importance of arterial blood versus arterial wall contact for regulating biocorrosion was confirmed with magnesium wires. We found that magnesium was highly corroded when placed in the arterial wall but was not corroded when exposed to blood in the arterial lumen for 3 weeks. The results demonstrate the capability of the vascular implantation model to conduct rapid in vivo assessments of vascular biomaterial corrosion behavior and to predict long-term biocorrosion behavior from material analyses. The results also highlight the critical role of the arterial environment (blood vs. matrix contact) in directing the corrosion behavior of biodegradable metals. Copyright © 2011 Wiley Periodicals, Inc.

Assembly of the fluorescent acrosomal matrix and its fate in fertilization in the water strider, Aquarius remigis

PubMed Central

Miyata, Haruhiko; Noda, Naoki; Fairbairn, Daphne J.; Oldenbourg, Rudolf; Cardullo, Richard A.

2011-01-01

Animal sperm show remarkable diversity in both morphology and molecular composition. Here we provide the first report of intense intrinsic fluorescence in an animal sperm. The sperm from a semi-aquatic insect, the water strider, Aquarius remigis, contains an intrinsically fluorescent molecule with properties consistent with those of Flavin Adenine Dinucleotid (FAD) which appears first in the acrosomal vesicle of round spermatids and persists in the acrosome throughout spermiogenesis. Fluorescence recovery after photobleaching reveals that the fluorescent molecule exhibits unrestricted mobility in the acrosomal vesicle of round spermatids, but is completely immobile in the acrosome of mature sperm. Fluorescence polarization microscopy shows a net alignment of the fluorescent molecules in the acrosome of the mature sperm but not in the acrosomal vesicle of round spermatids. These results suggest that acrosomal molecules are rearranged in the elongating acrosome and FAD is incorporated into the acrosomal matrix during its formation. Further, we followed the fate of the acrosomal matrix in fertilization utilizing the intrinsic fluorescence. The fluorescent acrosomal matrix was observed inside the fertilized egg and remained structurally intact even after gastrulation started. This observation suggests that FAD is not released from the acrosomal matrix during the fertilization process or early development and supports an idea that FAD is involved in the formation of the acrosomal matrix. The intrinsic fluorescence of the A. remigis acrosome will be a useful marker for following spermatogenesis and fertilization. PMID:20857404

Collagen Matrix Remodeling in Stented Pulmonary Arteries after Transapical Heart Valve Replacement.

PubMed

Ghazanfari, Samaneh; Driessen-Mol, Anita; Hoerstrup, Simon P; Baaijens, Frank P T; Bouten, Carlijn V C

2016-01-01

The use of valved stents for minimally invasive replacement of semilunar heart valves is expected to change the extracellular matrix and mechanical function of the native artery and may thus impair long-term functionality of the implant. Here we investigate the impact of the stent on matrix remodeling of the pulmonary artery in a sheep model, focusing on matrix composition and collagen (re)orientation of the host tissue. Ovine native pulmonary arteries were harvested 8 (n = 2), 16 (n = 4) and 24 (n = 2) weeks after transapical implantation of self-expandable stented heart valves. Second harmonic generation (SHG) microscopy was used to assess the collagen (re)orientation of fresh tissue samples. The collagen and elastin content was quantified using biochemical assays. SHG microscopy revealed regional differences in collagen organization in all explants. In the adventitial layer of the arterial wall far distal to the stent (considered as the control tissue), we observed wavy collagen fibers oriented in the circumferential direction. These circumferential fibers were more straightened in the adventitial layer located behind the stent. On the luminal side of the wall behind the stent, collagen fibers were aligned along the stent struts and randomly oriented between the struts. Immediately distal to the stent, however, fibers on both the luminal and the adventitial side of the wall were oriented in the axial direction, demonstrating the stent impact on the collagen structure of surrounding arterial tissues. Collagen orientation patterns did not change with implantation time, and biochemical analyses showed no changes in the trend of collagen and elastin content with implantation time or location of the vascular wall. We hypothesize that the collagen fibers on the adventitial side of the arterial wall and behind the stent straighten in response to the arterial stretch caused by oversizing of the stent. However, the collagen organization on the luminal side suggests that stent-induced remodeling is dominated by contact guidance. © 2016 S. Karger AG, Basel.

Usefulness of laser ablation ICP-MS for analysis of metallic particles released to oral mucosa after insertion of dental implants.

PubMed

Sajnóg, Adam; Hanć, Anetta; Koczorowski, Ryszard; Makuch, Krzysztof; Barałkiewicz, Danuta

2018-03-01

Despite the fact that titanium is considered highly biocompatible, its presence in the oral cavity (an environment of frequently changing pH and temperature) may result in the release of titanium from intraosseous implants into the oral mucosa, causing a range of reactions from the human body. Fragments of oral mucosa collected from patients after dental implant insertion were analyzed by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). The study revealed an elevated content of elements (Ti, Al, V) which are components of the metal implants and temporary cover screws. Dynamic ablation of the tissue surface was used in order to obtain maps of the content and distribution of analyzed elements. The material consisted of 30 oral mucosa tissue fragments collected 3-5 months after implantation and 10 samples collected before implantation (control group). The application of optical microscope allowed for indication and confirmation of the location of metal particles prior to LA-ICP-MS analysis. The so-obtained map permitted location of regions containing metal particles. LA-ICP-MS analysis revealed groups of samples with similar properties of metal particles, thus confirming that those metal particles were the main source of the elevated content of metals (Ti, Al, V) in the tissue after implantation. A calibration strategy based on matrix matched solid standards with powdered egg white proteins as matrix material was applied with 34 S as an internal standard. The accuracy of the analytical method was verified by ablating pellets of certified reference material ERM-BB422 Fish muscle. Copyright © 2017 Elsevier GmbH. All rights reserved.

Microcomputed tomographic and histologic analysis of anorganic bone matrix coupled with cell-binding peptide suspended in sodium hyaluronate carrier after sinus augmentation: a clinical study.

PubMed

Emam, Hany; Beheiri, Galal; Elsalanty, Mohammed; Sharawy, Mohamed

2011-01-01

Anorganic bovine hydroxyapatite matrix (ABM), when coupled with synthetic cell-binding peptide (P15), mimics the cell-binding region of type 1 collagen and is commercially available suspended in a sodium hyaluronate carrier. The aim of the present study, therefore, was to test the efficacy of ABM/P-15 Putty (DENTSPLY Friadent CeraMed) as a sole graft material for sinus augmentation in patients with severely resorbed posterior maxillae. Sinus augmentation was performed in 10 patients using ABM/P-15 Putty and two provisional dental implants (3.0 mm in diameter). The graft and implants were placed simultaneously with the aid of a surgical stent. After 8 or 16 weeks, the implants were removed using a 4.25-mm trephine bur; this was followed by immediate placement of wider-diameter (5.5-mm) implants. All 20 implants were scanned by microcomputed tomography to determine bone mineral density (BMD), percent bone volume (PBV), and percent bone contact (PBC). There was a significant increase in the BMD of bone around the implants at 8 weeks and 16 weeks compared to native residual (control) bone. There was no significant difference in PBV or PBC between 8 weeks and 16 weeks. The average increase in bone height at 16 weeks was 9.63 ± 1 mm. Microcomputed tomographic images and histologic sections showed dense graft particles surrounded by vital trabecular bone. BMD increases as early as 8 weeks and does not show an additional increase after 16 weeks. PepGen P-15 Putty was found to be a promising osteoconductive graft for sinus augmentation, supporting immediate placement of implants.

Microvessel Density Evaluation of the Effect of Enamel Matrix Derivative on Soft Tissue After Implant Placement: A Preliminary Study.

PubMed

Guimarães, George Furtado; de Araújo, Vera Cavalcanti; Nery, James Carlos; Peruzzo, Daiane Cristina; Soares, Andresa Borges

2015-01-01

Enamel matrix derivative (EMD) is commonly used in periodontal therapy and has been used successfully for periodontal regeneration. In addition, this material has a possible angiogenic effect that has been associated with enhanced wound healing. The aim of this study was to evaluate the effect of EMD on microvessel density (angiogenesis) on the soft tissues surrounding newly placed implants after 14 days. Five patients were selected, each requiring at least one implant on each side of the maxilla, in a split-mouth experimental design. The implants were placed in a two-stage procedure. Each side was then randomized as test or control. On the test side, 0.1 mL of EMD was topically applied to the soft tissues surrounding the implants, while the control side did not receive any treatment. Second-stage surgery was performed after 14 days. A 6-mm punch biopsy was performed for each implant, with the samples subsequently prepared for histology and immunohistochemistry. Quantitative vascularization analysis was performed, which involved counting three areas or "hotspots" containing vessels strongly positive for CD34 and CD105, a pan-endothelial and new vessel marker, respectively. There was no significant difference between test and control groups when evaluating the formation of new blood vessels. The total number of blood vessels, however, was significantly higher in the group treated with EMD (test group). Within the limits of the present study, it can be concluded that topical application of EMD on the soft tissues surrounding newly placed implants resulted in an increased number of blood vessels at 14 days, suggesting that EMD may play a beneficial role in this aspect of wound healing.

Diamagnetic chemical exchange saturation transfer (diaCEST) affords magnetic resonance imaging of extracellular matrix hydrogel implantation in a rat model of stroke.

PubMed

Jin, Tao; Nicholls, Francesca J; Crum, William R; Ghuman, Harmanvir; Badylak, Stephen F; Modo, Michel

2017-01-01

Extracellular matrix (ECM) is widely used as an inductive biological scaffold to repair soft tissue after injury by promoting functional site-appropriate remodeling of the implanted material. However, there is a lack of non-invasive analysis methods to monitor the remodeling characteristics of the ECM material after implantation and its biodegradation over time. We describe the use of diamagnetic chemical exchange saturation transfer (CEST) magnetic resonance imaging to monitor the distribution of an ECM hydrogel after intracerebral implantation into a stroke cavity. In vitro imaging indicated a robust concentration-dependent detection of the ECM precursor and hydrogel at 1.8 and 3.6 ppm, which broadly corresponded to chondroitin sulfate and fibronectin. This detection was robust to changes in pH and improved at 37 °C. In vivo implantation of ECM hydrogel into the stroke cavity in a rat model corresponded macroscopically to the distribution of biomaterial as indicated by histology, but mismatches were also evident. Indeed, CEST imaging detected an endogenous "increased deposition". To account for this endogenous activity, pre-implantation images were subtracted from post-implantation images to yield a selective visualization of hydrogel distribution in the stroke cavity and its evolution over 7 days. The CEST detection of ECM returned to baseline within 3 days due to a decrease in fibronectin and chondroitin sulfate in the hydrogel. The distribution of ECM hydrogel within the stroke cavity is hence feasible in vivo, but further advances are required to warrant a selective long-term monitoring in the context of biodegradation. Copyright © 2016 Elsevier Ltd. All rights reserved.

H-implantation in SO 2 and CO 2 ices

NASA Astrophysics Data System (ADS)

Garozzo, M.; Fulvio, D.; Gomis, O.; Palumbo, M. E.; Strazzulla, G.

2008-07-01

Ices in the solar system are observed on the surface of planets, satellites, comets and asteroids where they are continuously subordinate at particle fluxes (cosmic ions, solar wind and charged particles caught in the magnetosphere of the planets) that deeply modify their physical and structural properties. Each incoming ion destroys molecular bonds producing fragments that, by recombination, form new molecules also different from the original ones. Moreover, if the incoming ion is reactive (H +, O n+ , S n+ , etc.), it can concur to the formation of new molecules. Those effects can be studied by laboratory experiments where, with some limitation, it is possible to reproduce the astrophysical environments of planetary ices. In this work, we describe some experiments of 15-100 keV H + and He + implantation in pure sulfur dioxide (SO 2) at 16 and 80 K and carbon dioxide (CO 2) at 16 K ices aimed to search for the formation of new molecules. Among other results we confirm that carbonic acid (H 2CO 3) is formed after H-implantation in CO 2, vice versa H-implantation in SO 2 at both temperatures does not produce measurable quantity of sulfurous acid (H 2SO 3). The results are discussed in the light of their relevance to the chemistry of some solar system objects, particularly of Io, the innermost of Jupiter's Galilean satellites, that exhibits a surface very rich in frost SO 2 and it is continuously bombarded with H + ions caught in Jupiter's magnetosphere.

Highly ordered molecular rotor matrix on a nanopatterned template: titanyl phthalocyanine molecules on FeO/Pt(111).

PubMed

Lu, Shuangzan; Huang, Min; Qin, Zhihui; Yu, Yinghui; Guo, Qinmin; Cao, Gengyu

2018-08-03

Molecular rotors, motors and gears play important roles in artificial molecular machines, in which rotor and motor matrices are highly desirable for large-scale bottom-up fabrication of molecular machines. Here we demonstrate the fabrication of a highly ordered molecular rotor matrix by depositing nonplanar dipolar titanyl phthalocyanine (TiOPc, C 32 H 16 N 8 OTi) molecules on a Moiré patterned dipolar FeO/Pt(111) substrate. TiOPc molecules with O atoms pointing outwards from the substrate (upward) or towards the substrate (downward) are alternatively adsorbed on the fcc sites by strong lateral confinement. The adsorbed molecules, i.e. two kinds of molecular rotors, show different scanning tunneling microscopy images, thermal stabilities and rotational characteristics. Density functional theory calculations clarify that TiOPc molecules anchoring upwards with high adsorption energies correspond to low-rotational-rate rotors, while those anchoring downwards with low adsorption energies correspond to high-rotational-rate rotors. A robust rotor matrix fully occupied by low-rate rotors is fabricated by depositing molecules on the substrate at elevated temperature. Such a paradigm opens up a promising route to fabricate functional molecular rotor matrices, driven motor matrices and even gear groups on solid substrates.

Dynamics of VEGF matrix-retention in vascular network patterning

NASA Astrophysics Data System (ADS)

Köhn-Luque, A.; de Back, W.; Yamaguchi, Y.; Yoshimura, K.; Herrero, M. A.; Miura, T.

2013-12-01

Vascular endothelial growth factor (VEGF) is a central regulator of blood vessel morphogenesis, although its role in patterning of endothelial cells into vascular networks is not fully understood. It has been suggested that binding of soluble VEGF to extracellular matrix components causes spatially restricted cues that guide endothelial cells into network patterns. Yet, current evidence for such a mechanism remains indirect. In this study, we quantitatively analyse the dynamics of VEGF retention in a controlled in vitro situation of human umbilical vascular endothelial cells (HUVECs) in Matrigel. We show that fluorescent VEGF accumulates in pericellular areas and colocalizes with VEGF binding molecules. Analysis of fluorescence recovery after photobleaching reveals that binding/unbinding to matrix molecules dominates VEGF dynamics in the pericellular region. Computational simulations using our experimental measurements of kinetic parameters show that matrix retention of chemotactic signals can lead to the formation of reticular cellular networks on a realistic timescale. Taken together, these results show that VEGF binds to matrix molecules in proximity of HUVECs in Matrigel, and suggest that bound VEGF drives vascular network patterning.

Immunohistochemical characterization of nanocrystalline hydroxyapatite silica gel (NanoBone(r)) osteogenesis: a study on biopsies from human jaws.

PubMed

Götz, Werner; Gerber, Thomas; Michel, Barbara; Lossdörfer, Stefan; Henkel, Kai-Olaf; Heinemann, Friedhelm

2008-10-01

Bone substitute biomaterials may be osteogenic, osteoconductive or osteoinductive. To test for these probable characteristics in a new nanoporous grafting material consisting of nanocrystalline hydroxyapatite embedded in a porous silica gel matrix (NanoBone(s)), applied in humans, we studied biopsies from 12 patients before dental implantation following various orofacial augmentation techniques with healing times of between 3.5 and 12 months. Sections from decalcified specimens were investigated using histology, histochemistry [periodic acid Schiff, alcian blue staining and tartrate-resistant acid phosphatase (TRAP)] and immunohistochemistry, with markers for osteogenesis, bone remodelling, resorption and vessel walls (alkaline phosphatase, bone morphogenetic protein-2, collagen type I, ED1, osteocalcin, osteopontin, runx2 and Von-Willebrand factor). Histologically, four specific stages of graft transformation into lamellar bone could be characterized. During early stages of healing, bone matrix proteins were absorbed by NanoBone(s) granules, forming a proteinaceous matrix, which was invaded by small vessels and cells. We assume that the deposition of these molecules promotes early osteogenesis in and around NanoBone(s) and supports the concomitant degradation probably by osteoclast-like cells. TRAP-positive osteoclast-like cells were localized directly on the granular surfaces. Runx2-immunoreactive pre-osteoblasts, which are probably involved in direct osteogenesis forming woven bone that is later transformed into lamellar bone, were attracted. Graft resorption and bone apposition around the graft granules appear concomitantly. We postulate that NanoBone(s) has osteoconductive and biomimetic properties and is integrated into the host's physiological bone turnover at a very early stage.

A preclinical evaluation of an autologous living hyaline-like cartilaginous graft for articular cartilage repair: a pilot study.

PubMed

Peck, Yvonne; He, Pengfei; Chilla, Geetha Soujanya V N; Poh, Chueh Loo; Wang, Dong-An

2015-11-09

In this pilot study, an autologous synthetic scaffold-free construct with hyaline quality, termed living hyaline cartilaginous graft (LhCG), was applied for treating cartilage lesions. Implantation of autologous LhCG was done at load-bearing regions of the knees in skeletally mature mini-pigs for 6 months. Over the course of this study, significant radiographical improvement in LhCG treated sites was observed via magnetic resonance imaging. Furthermore, macroscopic repair was effected by LhCG at endpoint. Microscopic inspection revealed that LhCG engraftment restored cartilage thickness, promoted integration with surrounding native cartilage, produced abundant cartilage-specific matrix molecules, and re-established an intact superficial tangential zone. Importantly, the repair efficacy of LhCG was quantitatively shown to be comparable to native, unaffected cartilage in terms of biochemical composition and biomechanical properties. There were no complications related to the donor site of cartilage biopsy. Collectively, these results imply that LhCG engraftment may be a viable approach for articular cartilage repair.

A preclinical evaluation of an autologous living hyaline-like cartilaginous graft for articular cartilage repair: a pilot study

PubMed Central

Peck, Yvonne; He, Pengfei; Chilla, Geetha Soujanya V. N.; Poh, Chueh Loo; Wang, Dong-An

2015-01-01

In this pilot study, an autologous synthetic scaffold-free construct with hyaline quality, termed living hyaline cartilaginous graft (LhCG), was applied for treating cartilage lesions. Implantation of autologous LhCG was done at load-bearing regions of the knees in skeletally mature mini-pigs for 6 months. Over the course of this study, significant radiographical improvement in LhCG treated sites was observed via magnetic resonance imaging. Furthermore, macroscopic repair was effected by LhCG at endpoint. Microscopic inspection revealed that LhCG engraftment restored cartilage thickness, promoted integration with surrounding native cartilage, produced abundant cartilage-specific matrix molecules, and re-established an intact superficial tangential zone. Importantly, the repair efficacy of LhCG was quantitatively shown to be comparable to native, unaffected cartilage in terms of biochemical composition and biomechanical properties. There were no complications related to the donor site of cartilage biopsy. Collectively, these results imply that LhCG engraftment may be a viable approach for articular cartilage repair. PMID:26549401

Myocardial tissue engineering using electrospun nanofiber composites

PubMed Central

Kim, Pyung-Hwan; Cho, Je-Yoel

2016-01-01

Emerging trends for cardiac tissue engineering are focused on increasing the biocompatibility and tissue regeneration ability of artificial heart tissue by incorporating various cell sources and bioactive molecules. Although primary cardiomyocytes can be successfully implanted, clinical applications are restricted due to their low survival rates and poor proliferation. To develop successful cardiovascular tissue regeneration systems, new technologies must be introduced to improve myocardial regeneration. Electrospinning is a simple, versatile technique for fabricating nanofibers. Here, we discuss various biodegradable polymers (natural, synthetic, and combinatorial polymers) that can be used for fiber fabrication. We also describe a series of fiber modification methods that can increase cell survival, proliferation, and migration and provide supporting mechanical properties by mimicking micro-environment structures, such as the extracellular matrix (ECM). In addition, the applications and types of nanofiber-based scaffolds for myocardial regeneration are described. Finally, fusion research methods combined with stem cells and scaffolds to improve biocompatibility are discussed. [BMB Reports 2016; 49(1): 26-36] PMID:26497579

Six-year clinical outcome of single implant-retained mandibular overdentures--a pilot study.

PubMed

Passia, Nicole; Wolfart, Stefan; Kern, Matthias

2015-10-01

The aim of this prospective pilot study was to evaluate the prosthodontic maintenance as well as the implant outcome of single implant-retained mandibular overdentures over an observation period of 6 years. Eleven edentulous patients received one single implant in the midline of the mandible. Denture bases were temporarily relined and 2 months later provided with a ball attachment for implant retention. Implant related parameters and prosthodontic maintenance interventions were assessed 4 weeks after implant loading and then once a year. Over a mean observation period of 75.9 months, no implant was lost. The most frequent prosthetic maintenance intervention was activation of the matrix due to loss of retention, followed by exchange of the female part. Eight denture bases had to be repaired after a fracture in the midline area. Within the limitations of this preliminary clinical study, the concept of a single midline implant to retain a mandibular complete denture was a successful treatment option for elderly edentulous patients. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Heavy doping of CdTe single crystals by Cr ion implantation

NASA Astrophysics Data System (ADS)

Popovych, Volodymyr D.; Böttger, Roman; Heller, Rene; Zhou, Shengqiang; Bester, Mariusz; Cieniek, Bogumil; Mroczka, Robert; Lopucki, Rafal; Sagan, Piotr; Kuzma, Marian

2018-03-01

Implantation of bulk CdTe single crystals with high fluences of 500 keV Cr+ ions was performed to achieve Cr concentration above the equilibrium solubility limit of this element in CdTe lattice. The structure and composition of the implanted samples were studied using secondary ion mass spectrometry (SIMS), scanning electron microscopy (SEM), energy dispersive X-ray (EDX) analysis, X-ray diffraction (XRD) and Rutherford backscattering spectrometry (RBS) to characterize the incorporation of chromium into the host lattice and to investigate irradiation-induced damage build-up. It was found that out-diffusion of Cr atoms and sputtering of the targets alter the depth distribution and limit concentration of the projectile ions in the as-implanted samples. Appearance of crystallographically oriented, metallic α-Cr nanoparticles inside CdTe matrix was found after implantation, as well as a strong disorder at the depth far beyond the projected range of the implanted ions.

Bioactive Coatings for Orthopaedic Implants—Recent Trends in Development of Implant Coatings

PubMed Central

Zhang, Bill G. X.; Myers, Damian E.; Wallace, Gordon G.; Brandt, Milan; Choong, Peter F. M.

2014-01-01

Joint replacement is a major orthopaedic procedure used to treat joint osteoarthritis. Aseptic loosening and infection are the two most significant causes of prosthetic implant failure. The ideal implant should be able to promote osteointegration, deter bacterial adhesion and minimize prosthetic infection. Recent developments in material science and cell biology have seen the development of new orthopaedic implant coatings to address these issues. Coatings consisting of bioceramics, extracellular matrix proteins, biological peptides or growth factors impart bioactivity and biocompatibility to the metallic surface of conventional orthopaedic prosthesis that promote bone ingrowth and differentiation of stem cells into osteoblasts leading to enhanced osteointegration of the implant. Furthermore, coatings such as silver, nitric oxide, antibiotics, antiseptics and antimicrobial peptides with anti-microbial properties have also been developed, which show promise in reducing bacterial adhesion and prosthetic infections. This review summarizes some of the recent developments in coatings for orthopaedic implants. PMID:25000263

Biomechanical behaviour of a jawbone loaded with a prosthetic system supported by monophasic and biphasic implants.

PubMed

Inchingolo, F; Paracchini, L; DE Angelis, F; Cielo, A; Orefici, A; Spitaleri, D; Santacroce, L; Gheno, E; Palermo, A

2016-01-01

Modern implantology is based on the use of endosseous dental implants and on the study of osseointegration processes. The loss of marginal bone around a dental implant can be caused by many factors; the proper distribution of the masticatory loads is important and is closely dependent on the quality and quantity of bone tissue surrounding the implant. In fact, bone has the ability to adapt its microstructure, through processes of resorption and neoformation of new bone matrix, as a result of the mechanical stimuli that are generated during the chewing cycles. The purpose of this article is to redefine in a modern key and in light of current industrial and engineering technology, clinical and biomechanical concepts that characterize the monophasic implants, in order to assess proper use by evaluating the biomechanical differences with the biphasic implants.

Clinical evaluation of a collagen matrix to enhance the width of keratinized gingiva around dental implants

PubMed Central

Lee, Kang-Ho; Kim, Byung-Ock

2010-01-01

Purpose The purpose of this study was to evaluate the effect of collagen matrix with apically positioned flap (APF) on the width of keratinized gingiva, comparing to the results of APF only and APF combined with free gingival graft (FGG) at the second implant surgery. Methods Nine patients were selected from those who had received treatments at the Department of Periodontics, Chosun University Dental Hospital, Gwangju, Korea. We performed APF, APF combined with FGG, and APF combined with collagen matrix coverage respectively. Clinical evaluation of keratinized gingival was performed by measuring the distance from the gingival crest to the mucogingival junction at the mid-buccal point, using a periodontal probe before and after the surgery. Results The ratio of an increase was 0.3, 0.6, and 0.6 for the three subjects in the APF cases, 3, 5, and 7 for the three in the APF combined with FGG case, and 1.5, 0.5, and 3 for the three in the APF combined with collagen matrix coverage case. Conclusions This study suggests that the collagen matrix when used as a soft tissue substitute with the aim of increasing the width of keratinized tissue or mucosa, was as effective and predictable as the FGG. PMID:20498767

Ab initio R-matrix calculations of e+-molecule scattering

NASA Technical Reports Server (NTRS)

Danby, Grahame; Tennyson, Jonathan

1990-01-01

The adaptation of the molecular R-matrix method, originally developed for electron-molecule collision studies, to positron scattering is discussed. Ab initio R-matrix calculations are presented for collisions of low energy positrons with a number of diatomic systems including H2, HF and N2. Differential elastic cross sections for positron-H2 show a minimum at about 45 deg for collision energies between 0.3 and 0.5 Ryd. The calculations predict a bound state of positronHF. Calculations on inelastic processes in N2 and O2 are also discussed.

Mechanical characterization of matrix-induced autologous chondrocyte implantation (MACI®) grafts in an equine model at 53 weeks.

PubMed

Griffin, Darvin J; Bonnevie, Edward D; Lachowsky, Devin J; Hart, James C A; Sparks, Holly D; Moran, Nance; Matthews, Gloria; Nixon, Alan J; Cohen, Itai; Bonassar, Lawrence J

2015-07-16

There has been much interest in using autologous chondrocytes in combination with scaffold materials to aid in cartilage repair. In the present study, a total of 27 animals were used to compare the performance of matrix-assisted chondrocyte implantation (MACI®) using a collagen sponge as a chondrocyte delivery vehicle, the sponge membrane alone, and empty controls. A total of three distinct types of mechanical analyses were performed on repaired cartilage harvested from horses after 53 weeks of implantation: (1) compressive behavior of samples to measure aggregate modulus (HA) and hydraulic permeability (k) in confined compression; (2) local and global shear modulus using confocal strain mapping; and (3) boundary friction coefficient using a custom-built tribometer. Cartilage defects receiving MACI® implants had equilibrium modulus values that were 70% of normal cartilage, and were not statistically different than normal tissue. Defects filled with Maix™ membrane alone or left empty were only 46% and 51-63% of control, respectively. The shear modulus of tissue from all groups of cartilage defects were between 4 and 10 times lower than control tissue, and range from 0.2 to 0.4 MPa. The average values of boundary mode friction coefficients of control tissue from all groups ranged from 0.42 to 0.52. This study represents an extensive characterization of the mechanical performance of the MACI® grafts implant in a large animal model at 53 weeks. Collectively, these data demonstrate a range of implant performance, revealing similar compressive and frictional properties to native tissue, with inferior shear properties. Copyright © 2015. Published by Elsevier Ltd.

Imunohistological aspects of the tissue around dental implants

NASA Astrophysics Data System (ADS)

Nimigean, Victor; Nimigean, Vanda R.; Sǎlǎvǎstru, Dan I.; Moraru, Simona; BuÅ£incu, Lavinia; Ivaşcu, Roxana V.; Poll, Alexandru

2016-03-01

Objectives: study of soft and hard tissues around implants. Material and methods: For the immunohistochemical and histological study of the implant/soft tissue interface, we examined pieces of peri-implant mucosa harvested from 35 patients. The implant/bone interface was assessed using histologic and histomorphometric examination of hard tissues around unloaded, early loaded or delayed loaded dental implants with pre-established design, with a sandblasted and acid-etched surface, placed both in extraction sockets, or after bone healing following tooth removal. This study was performed on 9 common race dogs. Results: The histological study of the implant/soft tissue interface showed regenerative modifications and moderate chronic subepithelial inflammatory reactions. Immunohistochemical evaluation of the soft tissue biopsies revealed the presence of specific immunocompetent cells and proteins of the matrix metalloproteinase (MMP) expression. Bone-implants contacts were more obvious in the apical half of the implants and at the edges of the threads, than between them. A mature, lamelliform bone containing lacunae with osteocytes and lack of connective tissue were noticed around implants that were late placed and loaded. The new-formed bone was also abundant in the crestal zone, not only in the apical part of the implants. Conclusions: A thorough understanding of the microstructure of dental implant/soft and hard tissue interface will improve the longevity of osseointegrated implants.

Minimally invasive esthetic ridge preservation with growth-factor enhanced bone matrix.

PubMed

Nevins, Marc L; Said, Sherif

2017-12-28

Extraction socket preservation procedures are critical to successful esthetic implant therapy. Conventional surgical approaches are technique sensitive and often result in alteration of the soft tissue architecture, which then requires additional corrective surgical procedures. This case series report presents the ability of flapless surgical techniques combined with a growth factor-enhanced bone matrix to provide esthetic ridge preservation at the time of extraction for compromised sockets. When considering esthetic dental implant therapy, preservation, or further enhancement of the available tissue support at the time of tooth extraction may provide an improved esthetic outcome with reduced postoperative sequelae and decreased treatment duration. Advances in minimally invasive surgical techniques combined with recombinant growth factor technology offer an alternative for bone reconstruction while maintaining the gingival architecture for enhanced esthetic outcome. The combination of freeze-dried bone allograft (FDBA) and rhPDGF-BB (platelet-derived growth factor-BB) provides a growth-factor enhanced matrix to induce bone and soft tissue healing. The use of a growth-factor enhanced matrix is an option for minimally invasive ridge preservation procedures for sites with advanced bone loss. Further studies including randomized clinical trials are needed to better understand the extent and limits of these procedures. The use of minimally invasive techniques with growth factors for esthetic ridge preservation reduces patient morbidity associated with more invasive approaches and increases the predictability for enhanced patient outcomes. By reducing the need for autogenous bone grafts the use of this technology is favorable for patient acceptance and ease of treatment process for esthetic dental implant therapy. © 2017 Wiley Periodicals, Inc.

Early matrix change of a nanostructured bone grafting substitute in the rat.

PubMed

Xu, Weiguo; Holzhüter, Gerd; Sorg, Heiko; Wolter, Daniel; Lenz, Solvig; Gerber, Thomas; Vollmar, Brigitte

2009-11-01

A nanocrystalline bone substitute embedded in a highly porous silica gel matrix (NanoBone) has previously been shown to bridge bone defects by an organic matrix. As the initial host response on the bone graft substitute might be a determinant for subsequent bone formation, our present purpose was to characterize the early tissue reaction on this biomaterial. After implantation of 80 mg of NanoBone into the adipose neck tissue of a total of 35 rats, grafts were harvested for subsequent analysis at days 3, 6, 9, 12, and 21. The biomaterial was found encapsulated by granulation tissue which partly penetrated the implant at day 3 and completely pervaded the graft at day 12 on implantation. Histology revealed tartrate-resistant acid phosphatase (TRAP)-positive giant cells covering the biomaterial. ED1 (CD68) immunopositivity of these cells further indicated their osteoclast-like phenotype. Scanning electron microscopy revealed organic tissue components within the periphery of the graft already at day 9, whereas the central hematoma region still presented the silica-surface of the biomaterial. Energy dispersive X-ray spectroscopy further demonstrated that the silica gel was degraded faster in the peripheral granulation tissue than in the central hematoma and was replaced by organic host components by day 12. In conclusion, the silica gel matrix is rapidly replaced by carbohydrate macromolecules. This might represent a key step in the process of graft degradation on its way toward induction of bone formation. The unique composition and structure of this nanoscaled biomaterial seem to support its degradation by host osteoclast-like giant cells.

Orientational ordering of a banana-shaped solute molecule in a nematic calamitic solvent by {sup 2}H-NMR spectroscopy: An indication of glasslike behavior

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cinacchi, Giorgio; Domenici, Valentina

The Saupe ordering matrix of a banana-shaped mesogenic molecule as a solute in a common nematic calamitic solvent has been determined by {sup 2}H-NMR spectroscopy as a function of temperature. The temperature dependence of the Saupe ordering matrix element associated with the principal molecular axis is consistent with a glassy behavior in the reorientational motion of this particular solute molecule. The Haller expression, appropriately modified, provides a good fit to the experimental data.

Concomitant monitoring of implant formation and drug release of in situ forming poly (lactide-co-glycolide acid) implants in a hydrogel matrix mimicking the subcutis using UV-vis imaging.

PubMed

Sun, Yu; Jensen, Henrik; Petersen, Nickolaj J; Larsen, Susan W; Østergaard, Jesper

2018-02-20

For poly (lactide-co-glycolide acid) (PLGA)-based in situ forming implants, the rate of implant formation plays an important role in determining the overall drug release kinetics. Currently, in vitro techniques capable of characterizing the processes of drug release and implant formation at the same time are not available. A hydrogel-based in vitro experimental setup was recently developed requiring only microliter of formulation and forming a closed system potentially suitable for interfacing with various spectroscopic techniques. The aim of the present proof-of-concept study was to investigate the feasibility of concomitant UV imaging, Vis imaging and light microscopy for detailed characterization of the behavior of in situ forming PLGA implants in the hydrogel matrix mimicking the subcutis. The model compounds, piroxicam and α-lactalbumin were added to PLGA-1-methyl-2-pyrrolidinone and PLGA-triacetin solutions. Upon bringing the PLGA-solvent-compound pre-formulation in contact with the hydrogel, Vis imaging and light microscopy were applied to visualize the depot formation and UV imaging was used to quantify drug transport in the hydrogel. As compared to piroxicam, the α-lactalbumin invoked an acceleration of phase separation and an increase of implant size. α-Lactalbumin was released faster from the PLGA-1-methyl-2-pyrrolidinone system than the PLGA-triacetin system opposite to the piroxicam release pattern. A linear relationship between the rate of implant formation and initial compound release within the first 4h was established for the PLGA-NMP systems. This implies that phase separation may be one of the controlling factors in drug release. The rate of implant formation may be an important parameter for predicting and tailoring drug release. The approach combining UV imaging, Vis imaging and light microscopy may facilitate understanding of release processes and holds potential for becoming a useful tool in formulation development of in situ forming implants. Copyright © 2017 Elsevier B.V. All rights reserved.

Laser desorption/ionization mass spectrometry for direct profiling and imaging of small molecules from raw biological materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cha, Sangwon

2008-01-01

Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternativemore » assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.« less

Human Perivascular Stem Cells Show Enhanced Osteogenesis and Vasculogenesis with Nel-Like Molecule I Protein

PubMed Central

Askarinam, Asal; James, Aaron W.; Zara, Janette N.; Goyal, Raghav; Corselli, Mirko; Pan, Angel; Liang, Pei; Chang, Le; Rackohn, Todd; Stoker, David; Zhang, Xinli; Ting, Kang; Péault, Bruno

2013-01-01

An ideal mesenchymal stem cell (MSC) source for bone tissue engineering has yet to be identified. Such an MSC population would be easily harvested in abundance, with minimal morbidity and with high purity. Our laboratories have identified perivascular stem cells (PSCs) as a candidate cell source. PSCs are readily isolatable through fluorescent-activated cell sorting from adipose tissue and have been previously shown to be indistinguishable from MSCs in the phenotype and differentiation potential. PSCs consist of two distinct cell populations: (1) pericytes (CD146+, CD34−, and CD45−), which surround capillaries and microvessels, and (2) adventitial cells (CD146−, CD34+, and CD45−), found within the tunica adventitia of large arteries and veins. We previously demonstrated the osteogenic potential of pericytes by examining pericytes derived from the human fetal pancreas, and illustrated their in vivo trophic and angiogenic effects. In the present study, we used an intramuscular ectopic bone model to develop the translational potential of our original findings using PSCs (as a combination of pericytes and adventitial cells) from human white adipose tissue. We evaluated human PSC (hPSC)-mediated bone formation and vascularization in vivo. We also examined the effects of hPSCs when combined with the novel craniosynostosis-associated protein, Nel-like molecule I (NELL-1). Implants consisting of the demineralized bone matrix putty combined with NELL-1 (3 μg/μL), hPSC (2.5×105 cells), or hPSC+NELL-1, were inserted in the bicep femoris of SCID mice. Bone growth was evaluated using microcomputed tomography, histology, and immunohistochemistry over 4 weeks. Results demonstrated the osteogenic potential of hPSCs and the additive effect of hPSC+NELL-1 on bone formation and vasculogenesis. Comparable osteogenesis was observed with NELL-1 as compared to the more commonly used bone morphogenetic protein-2. Next, hPSCs induced greater implant vascularization than the unsorted stromal vascular fraction from patient-matched samples. Finally, we observed an additive effect on implant vascularization with hPSC+NELL-1 by histomorphometry and immunohistochemistry, accompanied by in vitro elaboration of vasculogenic growth factors. These findings hold significant implications for the cell/protein combination therapy hPSC+NELL-1 in the development of strategies for vascularized bone regeneration. PMID:23406369

Multifunctional and biologically active matrices from multicomponent polymeric solutions

NASA Technical Reports Server (NTRS)

Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor)

2010-01-01

The present invention relates to a biologically active functionalized electrospun matrix to permit immobilization and long-term delivery of biologically active agents. In particular the invention relates to a functionalized polymer matrix comprising a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin. Examples of active molecules that may be used with the multicomponent polymer of the invention include, for example, a drug, a biopolymer, for example a growth factor, a protein, a peptide, a nucleotide, a polysaccharide, a biological macromolecule or the like. The invention is further directed to the formation of functionalized crosslinked matrices, such as hydrogels, that include at least one functionalized compatibilizing polymer capable of assembly.

Photooxidation of Trimethyl Phosphite in Nitrogen, Oxygen, and para-Hydrogen Matrixes at Low Temperatures.

PubMed

Ramanathan, N; Sundararajan, K; Gopi, R; Sankaran, K

2017-03-16

Trimethyl phosphite (TMPhite) was photooxidized to trimethyl phosphate (TMP) in N 2 , O 2 , and para-H 2 matrixes at low temperatures to correlate the conformational landscape of these two molecules. The photooxidation produced the trans (TGG)-rich conformer with respect to the ground state gauche (GGG) conformer of TMP in N 2 and O 2 matrixes, which has diverged from the conformational composition of freshly deposited pure TMP in the low-temperature matrixes. The enrichment of the trans conformer in preference to the gauche conformer of TMP during photooxidation is due to the TMPhite precursor, which exists exclusively in the trans conformer. Interestingly, whereas the photooxidized TMP molecule suffers site effects possibly due to the local asymmetry in N 2 and O 2 matrixes, in the para-H 2 matrix owing to the quantum crystal nature the site effects were observed to be self-repaired.

Antimicrobial polycaprolactone/polyethylene glycol embedded lysozyme coatings of Ti implants for osteoblast functional properties in tissue engineering

NASA Astrophysics Data System (ADS)

Visan, A.; Cristescu, R.; Stefan, N.; Miroiu, M.; Nita, C.; Socol, M.; Florica, C.; Rasoga, O.; Zgura, I.; Sima, L. E.; Chiritoiu, M.; Chifiriuc, M. C.; Holban, A. M.; Mihailescu, I. N.; Socol, G.

2017-09-01

In this study, coatings based on lysozyme embedded into a matrix of polyethylene glycol (PEG) and polycaprolactone (PCL) were fabricated by two different methods (Matrix Assisted Pulsed Laser Evaporation - MAPLE and Dip Coating) for obtaining antimicrobial coatings envisaged for long term medical applications. Coatings with different PEG:PCL compositions (3:1; 1:1; 1:3) were synthesized in order to evaluate the antimicrobial activity of lysozyme embedded into the polymeric matrix. The main surface features, such as roughness and wettability, with impact on the microbial adhesion as well as on the eukaryote cell function were measured. The obtained composite coatings exhibited a significant antibacterial activity against Escherichia coli, Bacillus subtilis, Enterococcus faecalis and Staphylococcus aureus strains. As well, specific blended coatings showed appropriate viability, good spreading and normal cell morphology of SaOs2 human osteoblasts and mesenchymal stem cells (MSCs). These investigations highlight the suitability of biodegradable composites as implant coatings for decreasing the risk of bacterial contamination associated with prosthetic procedures.

Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules.

PubMed

Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

2017-04-21

Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds.

Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules

PubMed Central

Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

2017-01-01

Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds. PMID:28430138

DNA melting profiles from a matrix method.

PubMed

Poland, Douglas

2004-02-05

In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.

Human Endometrial CD98 Is Essential for Blastocyst Adhesion

PubMed Central

Domínguez, Francisco; Simón, Carlos; Quiñonero, Alicia; Ramírez, Miguel Ángel; González-Muñoz, Elena; Burghardt, Hans; Cervero, Ana; Martínez, Sebastián; Pellicer, Antonio; Palacín, Manuel; Sánchez-Madrid, Francisco; Yáñez-Mó, María

2010-01-01

Background Understanding the molecular basis of embryonic implantation is of great clinical and biological relevance. Little is currently known about the adhesion receptors that determine endometrial receptivity for embryonic implantation in humans. Methods and Principal Findings Using two human endometrial cell lines characterized by low and high receptivity, we identified the membrane receptor CD98 as a novel molecule selectively and significantly associated with the receptive phenotype. In human endometrial samples, CD98 was the only molecule studied whose expression was restricted to the implantation window in human endometrial tissue. CD98 expression was restricted to the apical surface and included in tetraspanin-enriched microdomains of primary endometrial epithelial cells, as demonstrated by the biochemical association between CD98 and tetraspanin CD9. CD98 expression was induced in vitro by treatment of primary endometrial epithelial cells with human chorionic gonadotropin, 17-β-estradiol, LIF or EGF. Endometrial overexpression of CD98 or tetraspanin CD9 greatly enhanced mouse blastocyst adhesion, while their siRNA-mediated depletion reduced the blastocyst adhesion rate. Conclusions These results indicate that CD98, a component of tetraspanin-enriched microdomains, appears to be an important determinant of human endometrial receptivity during the implantation window. PMID:20976164

Suspension Matrices for Improved Schwann-Cell Survival after Implantation into the Injured Rat Spinal Cord

PubMed Central

Patel, Vivek; Joseph, Gravil; Patel, Amit; Patel, Samik; Bustin, Devin; Mawson, David; Tuesta, Luis M.; Puentes, Rocio; Ghosh, Mousumi

2010-01-01

Abstract Trauma to the spinal cord produces endogenously irreversible tissue and functional loss, requiring the application of therapeutic approaches to achieve meaningful restoration. Cellular strategies, in particular Schwann-cell implantation, have shown promise in overcoming many of the obstacles facing successful repair of the injured spinal cord. Here, we show that the implantation of Schwann cells as cell suspensions with in-situ gelling laminin:collagen matrices after spinal-cord contusion significantly enhances long-term cell survival but not proliferation, as well as improves graft vascularization and the degree of axonal in-growth over the standard implantation vehicle, minimal media. The use of a matrix to suspend cells prior to implantation should be an important consideration for achieving improved survival and effectiveness of cellular therapies for future clinical application. PMID:20144012

[Three-dimensional parallel collagen scaffold promotes tendon extracellular matrix formation].

PubMed

Zheng, Zefeng; Shen, Weiliang; Le, Huihui; Dai, Xuesong; Ouyang, Hongwei; Chen, Weishan

2016-03-01

To investigate the effects of three-dimensional parallel collagen scaffold on the cell shape, arrangement and extracellular matrix formation of tendon stem cells. Parallel collagen scaffold was fabricated by unidirectional freezing technique, while random collagen scaffold was fabricated by freeze-drying technique. The effects of two scaffolds on cell shape and extracellular matrix formation were investigated in vitro by seeding tendon stem/progenitor cells and in vivo by ectopic implantation. Parallel and random collagen scaffolds were produced successfully. Parallel collagen scaffold was more akin to tendon than random collagen scaffold. Tendon stem/progenitor cells were spindle-shaped and unified orientated in parallel collagen scaffold, while cells on random collagen scaffold had disorder orientation. Two weeks after ectopic implantation, cells had nearly the same orientation with the collagen substance. In parallel collagen scaffold, cells had parallel arrangement, and more spindly cells were observed. By contrast, cells in random collagen scaffold were disorder. Parallel collagen scaffold can induce cells to be in spindly and parallel arrangement, and promote parallel extracellular matrix formation; while random collagen scaffold can induce cells in random arrangement. The results indicate that parallel collagen scaffold is an ideal structure to promote tendon repairing.

Matrix isolation sublimation: An apparatus for producing cryogenic beams of atoms and molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sacramento, R. L.; Alves, B. X.; Silva, B. A.

2015-07-15

We describe the apparatus to generate cryogenic beams of atoms and molecules based on matrix isolation sublimation. Isolation matrices of Ne and H{sub 2} are hosts for atomic and molecular species which are sublimated into vacuum at cryogenic temperatures. The resulting cryogenic beams are used for high-resolution laser spectroscopy. The technique also aims at loading atomic and molecular traps.

Genetically Engineered Autologous Cells for Antiangiogenic Therapy of Breast Cancer

DTIC Science & Technology

2004-07-01

consisted of a large, fragmented avascular center surrounded by a thin band of vascularized matrix material, itself covered by a capsule of connective tissue...contained dead cells that showed features of coagulation necrosis . The minimal inflammatory response consisted of neutrophils scattered within the...vascularize most likely contributed to the death (coagulation necrosis ) of implanted MSCs localized in the implant core and to the fragmentation of the

Enhancement of healing in osteochondral defects by collagen sponge implants.

PubMed

Speer, D P; Chvapil, M; Volz, R G; Holmes, M D

1979-10-01

Implants of porous, highly cross-linked collagen sponge (CS) were tested for their capacity to enhance the healing of osteochondral defects in rabbits. Comparison was made to the healing of similar defects with polyvinyl alcohol sponge (PVAS) implants and with no implants (CONT). Evaluation was carried out up to 44 weeks following implantation and included observation of host cellular response, biodegradability of implant, gross appearance of restored joint surface, collagenous architecture of repair tissue, and properties of the junctions of implants and host articular cartilage, subchondral bone, and medullary bone. Collagen sponge proved most effective in promoting healing of osteochondral defects with fibrous and fibrocartilaginous tissue over restored subchondral bone. Collagen sponge showed many desirable properties as a potential material for biologic resurfacing of damaged joints. These properties included porosity, biodegradability, biocompatability, ability to mechanically protect cells and matrix while directing cell ingrowth, and an available chemical technology for modifying its biomechanical and biological properties. Comparative analysis of results of healing of CS, PVAS, and CONT osteochondral defects suggest rational design criteria for implant materials to improve their effectiveness in restoration of articular surfaces.

Effects of cell-attachment and extracellular matrix on bone formation in vivo in collagen-hydroxyapatite scaffolds.

PubMed

Villa, Max M; Wang, Liping; Rowe, David W; Wei, Mei

2014-01-01

Cell-based tissue engineering can be used to replace missing or damaged bone, but the optimal methods for delivering therapeutic cells to a bony defect have not yet been established. Using transgenic reporter cells as a donor source, two different collagen-hydroxyapatite (HA) scaffolds, and a critical-size calvarial defect model, we investigated the effect of a cell-attachment period prior to implantation, with or without an extracellular matrix-based seeding suspension, on cell engraftment and osteogenesis. When quantitatively compared, the in-house scaffold implanted immediately had a higher mean radiopacity than in-house scaffolds incubated overnight. Both scaffold types implanted immediately had significantly higher area fractions of donor cells, while the in-house collagen-HA scaffolds implanted immediately had higher area fractions of the mineralization label compared with groups incubated overnight. When the cell loading was compared in vitro for each delivery method using the in-house scaffold, immediate loading led to higher numbers of delivered cells. Immediate loading may be preferable in order to ensure robust bone formation in vivo. The use of a secondary ECM carrier improved the distribution of donor cells only when a pre-attachment period was applied. These results have improved our understanding of cell delivery to bony defects in the context of in vivo outcomes.

Structural and optical properties of vanadium ion-implanted GaN

NASA Astrophysics Data System (ADS)

Macková, A.; Malinský, P.; Jagerová, A.; Sofer, Z.; Klímová, K.; Sedmidubský, D.; Mikulics, M.; Lorinčík, J.; Veselá, D.; Böttger, R.; Akhmadaliev, S.

2017-09-01

The field of advanced electronic and optical devices searches for a new generation of transistors and lasers. The practical development of these novel devices depends on the availability of materials with the appropriate magnetic and optical properties, which is strongly connected to the internal morphology and the structural properties of the prepared doped structures. In this contribution, we present the characterisation of V ion-doped GaN epitaxial layers. GaN layers, oriented along the (0 0 0 1) crystallographic direction, grown by low-pressure metal-organic vapour-phase epitaxy (MOVPE) on c-plane sapphire substrates were implanted with 400 keV V+ ions at fluences of 5 × 1015 and 5 × 1016 cm-2. Elemental depth profiling was accomplished by Rutherford Backscattering Spectrometry (RBS) and Secondary Ion Mass Spectrometry (SIMS) to obtain precise information about the dopant distribution. Structural investigations are needed to understand the influence of defect distribution on the crystal-matrix recovery and the desired structural and optical properties. The structural properties of the ion-implanted layers were characterised by RBS-channelling and Raman spectroscopy to get a comprehensive insight into the structural modification of implanted GaN and to study the influence of subsequent annealing on the crystalline matrix reconstruction. Photoluminescence measurement was carried out to check the optical properties of the prepared structures.

Localized ridge defect augmentation using human pericardium membrane and demineralized bone matrix.

PubMed

Vidyadharan, Arun Kumar; Ravindran, Anjana

2014-01-01

Patient wanted to restore her lost teeth with implants in the lower left first molar and second premolar region. Cone beam computerized tomography (CBCT) revealed inadequate bone width and height around future implant sites. The extraction socket of second premolar area revealed inadequate socket healing with sparse bone fill after 4 months of extraction. To evaluate the clinical feasibility of using a collagen physical resorbable barrier made of human pericardium (HP) to augment localized alveolar ridge defects for the subsequent placement of dental implants. Ridge augmentation was done in the compromised area using Puros® demineralized bone matrix (DBM) Putty with chips and an HP allograft membrane. Horizontal (width) and vertical hard tissue measurements with CBCT were recorded on the day of ridge augmentation surgery, 4 month and 7 months follow-up. Intra oral periapical taken 1 year after implant installation showed minimal crestal bone loss. Bone volume achieved through guided bone regeneration was a gain of 4.8 mm horizontally (width) and 6.8 mm vertically in the deficient ridge within a period of 7 months following the procedure. The results suggested that HP Allograft membrane may be a suitable component for augmentation of localized alveolar ridge defects in conjunction with DBM with bone chips.

Assessment of surface concentrations in resorbable ocular implants: controlled drug delivery devices for 5-fluorouracil (5-FU)

NASA Astrophysics Data System (ADS)

Milne, Peter J.; Gautier, Sandrine; Parel, Jean-Marie A.; Jallet, Valerie

1997-05-01

The antineoplastic drug 5-fluorouracil (5-fluoro- 2,4,(1H,3H)-pyrimidinedione; 5-FU) has been used to control proliferation of penetrating fibroblasts and to prevent channel closure following glaucoma filtration surgery (trabeculectomy) or laser sclerectomy. Because of the toxicity of the drug, administration of low dosages slowly over time, at the site of the desired treatment, is indicated for optimum efficacy. Repeated injections of low dosages of the drug represent an undesirable intervention and may also result in unwanted toxicity to the corneal epithelium. A suitable biocompatible and resorbable polymer matrix composed of a poly (D,L-lactic-co-glycolic acid: PLGA) has been admixed with varying amounts of 5-FU and cast as shapes suitable for intracorneal implantation. Slow biodegradation of this polymer over a one to two week period has been shown to result in an acceptably slow drug release mechanism. An issue arising during the clinical evaluation of the efficacy of this drug delivery system was how best to quantify the concentration of 5-FU and its distribution spatially in the solid implant. FT-IR and FT-Raman spectroscopies distinguishes between the drug and the polymer matrix and were used to differentiate and quantitate the 5-FU concentration of the implants.

Dry Arthroscopy With a Retraction System for Matrix-Aided Cartilage Repair of Patellar Lesions

PubMed Central

Sadlik, Boguslaw; Wiewiorski, Martin

2014-01-01

Several commercially available cartilage repair techniques use a natural or synthetic matrix to aid cartilage regeneration (e.g., autologous matrix–induced chondrogenesis or matrix-induced cartilage implantation). However, the use of matrix-aided techniques during conventional knee joint arthroscopy under continuous irrigation is challenging. Insertion and fixation of the matrix can be complicated by the presence of fluid and the confined patellofemoral joint space with limited access to the lesion. To overcome these issues, we developed a novel arthroscopic approach for matrix-aided cartilage repair of patellar lesions. This technical note describes the use of dry arthroscopy assisted by a minimally invasive retraction system. An autologous matrix–induced chondrogenesis procedure is used to illustrate this novel approach. PMID:24749035

440 Consecutive immediate, implant-based, single-surgeon breast reconstructions in 281 patients: a comparison of early outcomes and costs between SurgiMend fetal bovine and AlloDerm human cadaveric acellular dermal matrices.

PubMed

Butterfield, Jennifer L

2013-05-01

A 2010 nationwide survey of plastic and reconstructive surgeons indicated that approximately 83 percent performed predominantly implant-based breast reconstruction, with acellular dermal matrix used by approximately half of those practitioners. Although the medical literature documents well over 2000 cases of breast reconstruction with matrices, relatively few cases using other than human cadaveric acellular dermal matrices have been reported. The author compared complications and costs using SurgiMend fetal bovine and AlloDerm human cadaveric acellular dermal matrices. A retrospective review of a single surgeon's 5-year experience was performed for consecutive, nonrandomized immediate breast reconstructions with acellular dermal matrix from 2005 to 2010. Two hundred eighty-one patients had 440 implant-based reconstructions using SurgiMend [222 patients (79.0 percent)] or AlloDerm [59 patients (21.0 percent)]. No significant differences in complication rates were observed between SurgiMend and AlloDerm for hematoma, infection, major skin necrosis, or breast implant removal. Seroma was the most prevalent complication; the seroma rate for AlloDerm (15.7 percent) was significantly greater than that for SurgiMend (8.3 percent). Using recent product costs for equivalently sized AlloDerm and SurgiMend units, the cost of SurgiMend was $1024 less per breast than AlloDerm. SurgiMend fetal bovine and AlloDerm human cadaveric acellular dermal matrices demonstrate similar rates of major early complications in breast reconstruction in this study. This similarity in complication rates between SurgiMend and AlloDerm and the cost savings seen with the use of SurgiMend are factors for the surgeon to consider in choosing a matrix for breast reconstruction. : Therapeutic, III.

Stem cell-based tissue-engineering for treatment of meniscal tears in the avascular zone.

PubMed

Zellner, Johannes; Hierl, Katja; Mueller, Michael; Pfeifer, Christian; Berner, Arne; Dienstknecht, Thomas; Krutsch, Werner; Geis, Sebastian; Gehmert, Sebastian; Kujat, Richard; Dendorfer, Sebastian; Prantl, Lukas; Nerlich, Michael; Angele, Peter

2013-10-01

Meniscal tears in the avascular zone have a poor self-healing potential, however partial meniscectomy predisposes the knee for early osteoarthritis. Tissue engineering with mesenchymal stem cells and a hyaluronan collagen based scaffold is a promising approach to repair meniscal tears in the avascular zone. 4 mm longitudinal meniscal tears in the avascular zone of lateral menisci of New Zealand White Rabbits were performed. The defect was left empty, sutured with a 5-0 suture or filled with a hyaluronan/collagen composite matrix without cells, with platelet rich plasma or with autologous mesenchymal stem cells. Matrices with stem cells were in part precultured in chondrogenic medium for 14 days prior to the implantation. Menisci were harvested at 6 and 12 weeks. The developed repair tissue was analyzed macroscopically, histologically and biomechanically. Untreated defects, defects treated with suture alone, with cell-free or with platelet rich plasma seeded implants showed a muted fibrous healing response. The implantation of stem cell-matrix constructs initiated fibrocartilage-like repair tissue, with better integration and biomechanical properties in the precultured stem cell-matrix group. A hyaluronan-collagen based composite scaffold seeded with mesenchymal stem cells is more effective in the repair avascular meniscal tear with stable meniscus-like tissue and to restore the native meniscus. Copyright © 2013 Wiley Periodicals, Inc., a Wiley Company.

An In vivo Model for Short-Term Evaluation of the Implantation Effects of Biomolecules or Stem Cells in the Dental Pulp

PubMed Central

Lacerda-Pinheiro, Sally; Marchadier, Arnaud; Donãs, Patricio; Septier, Dominique; Benhamou, Laurent; Kellermann, Odile; Goldberg, Michel; Poliard, Anne

2008-01-01

The continuously growing rodent incisor is a widely used model to investigate odontogenesis and mineralized tissue formation. This study focused on evaluating the mouse mandibular incisor as an experimental biological tool for analyzing in vivo the capacity of odontoblast-like progenitors or bioactive molecules to contribute to reparative dentinogenesis. We describe here a surgical procedure allowing direct access to the forming part of the incisor dental pulp Amelogenin peptide A+4 adsorbed on agarose beads, or dental pulp progenitor cells were implanted in the pulp following this procedure. After 10 days A+4 induced the formation of an osteodentin occluding almost the totality of the pulp compartment. Implantation of progenitor cells leads to formation of islets of osteodentin-like structures located centrally in the pulp. These pilot studies validate the incisor as an experimental model to test the capacity of progenitor cells or bioactive molecules to induce the formation of reparative dentin. PMID:19088885

Cost analysis of postmastectomy reconstruction: A comparison of two staged implant reconstruction using tissue expander and acellular dermal matrix with abdominal-based perforator free flaps.

PubMed

Tran, Bao Ngoc N; Fadayomi, Ayotunde; Lin, Samuel J; Singhal, Dhruv; Lee, Bernard T

2017-09-01

Two staged tissue expander-implant with acellular dermal matrix (TE/I + ADM) and deep inferior epigastric perforator (DIEP) flap are the most common implant and autologous methods of reconstruction in the U.S. Implant-based techniques are disproportionally more popular, partially due to its presumed cost effectiveness. We performed a comprehensive cost analysis to compare TE/I + ADM and DIEP flap. A comparative cost analysis of TE/I + ADM and DIEP flap was performed. Medicare reimbursement costs for each procedure and their associated complications were calculated. Pooled probabilities of complications including cellulitis, seroma, skin necrosis, implant removal, flap loss, partial flap loss, and fat necrosis, were calculated using published studies from 2010 to 2016. Average actual cost for successful TE/I + ADM and DIEP flap were $13 304.55 and $10 237.13, respectively. Incorporating pooled complication data from published literature resulted in an increase in cost to $13 963.46 for TE/I + ADM and $12 624.29 for DIEP flap. The expected costs for successful TE/I + ADM and DIEP flap were $9700.35 and $8644.23, which are lower than the actual costs. DIEP flap breast reconstruction incurs lower costs compared to TE/I + ADM. These costs are lower at baseline and when additional costs from pooled complications are incorporated. © 2017 Wiley Periodicals, Inc.

Development and functional evaluation of biomimetic silicone surfaces with hierarchical micro/nano-topographical features demonstrates favourable in vitro foreign body response of breast-derived fibroblasts.

PubMed

Kyle, Daniel J T; Oikonomou, Antonios; Hill, Ernie; Bayat, Ardeshir

2015-06-01

Reproducing extracellular matrix topographical cues, such as those present within acellular dermal matrix (ADM), in synthetic implant surfaces, may augment cellular responses, independent of surface chemistry. This could lead to enhanced implant integration and performance while reducing complications. In this work, the hierarchical micro and nanoscale features of ADM were accurately and reproducibly replicated in polydimethylsiloxane (PDMS), using an innovative maskless 3D grayscale fabrication process not previously reported. Human breast derived fibroblasts (n=5) were cultured on PDMS surfaces and compared to commercially available smooth and textured silicone implant surfaces, for up to one week. Cell attachment, proliferation and cytotoxicity, in addition to immunofluorescence staining, SEM imaging, qRT-PCR and cytokine array were performed. ADM PDMS surfaces promoted cell adhesion, proliferation and survival (p=<0.05), in addition to increased focal contact formation and spread fibroblast morphology when compared to commercially available implant surfaces. PCNA, vinculin and collagen 1 were up-regulated in fibroblasts on biomimetic surfaces while IL8, TNFα, TGFβ1 and HSP60 were down-regulated (p=<0.05). A reduced inflammatory cytokine response was also observed (p=<0.05). This study represents a novel approach to the development of functionalised biomimetic prosthetic implant surfaces which were demonstrated to significantly attenuate the acute in vitro foreign body reaction to silicone. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Metal Ion-Loaded Nanofibre Matrices for Calcification Inhibition in Polyurethane Implants

PubMed Central

Singh, Charanpreet; Wang, Xungai

2017-01-01

Pathologic calcification leads to structural deterioration of implant materials via stiffening, stress cracking, and other structural disintegration mechanisms, and the effect can be critical for implants intended for long-term or permanent implantation. This study demonstrates the potential of using specific metal ions (MI)s for inhibiting pathological calcification in polyurethane (PU) implants. The hypothesis of using MIs as anti-calcification agents was based on the natural calcium-antagonist role of Mg2+ ions in human body, and the anti-calcification effect of Fe3+ ions in bio-prosthetic heart valves has previously been confirmed. In vitro calcification results indicated that a protective covering mesh of MI-doped PU can prevent calcification by preventing hydroxyapatite crystal growth. However, microstructure and mechanical characterisation revealed oxidative degradation effects from Fe3+ ions on the mechanical properties of the PU matrix. Therefore, from both a mechanical and anti-calcification effects point of view, Mg2+ ions are more promising candidates than Fe3+ ions. The in vitro MI release experiments demonstrated that PU microphase separation and the structural design of PU-MI matrices were important determinants of release kinetics. Increased phase separation in doped PU assisted in consistent long-term release of dissolved MIs from both hard and soft segments of the PU. The use of a composite-sandwich mesh design prevented an initial burst release which improved the late (>20 days) release rate of MIs from the matrix. PMID:28644382

Amino acid sequence preferences to control cell-specific organization of endothelial cells, smooth muscle cells, and fibroblasts.

PubMed

Kanie, Kei; Kato, Ryuji; Zhao, Yingzi; Narita, Yuji; Okochi, Mina; Honda, Hiroyuki

2011-06-01

Effective surface modification with biocompatible molecules is known to be effective in reducing the life-threatening risks related to artificial cardiovascular implants. In recent strategies in regenerative medicine, the enhancement and support of natural repair systems at the site of injury by designed biocompatible molecules have succeeded in rapid and effective injury repair. Therefore, such a strategy could also be effective for rapid endothelialization of cardiovascular implants to lower the risk of thrombosis and stenosis. To achieve this enhancement of the natural repair system, a biomimetic molecule that mimics proper cellular organization at the implant location is required. In spite of the fact that many reported peptides have cell-attracting properties on material surfaces, there have been few peptides that could control cell-specific adhesion. For the advanced cardiovascular implants, peptides that can mimic the natural mechanism that controls cell-specific organization have been strongly anticipated. To obtain such peptides, we hypothesized the cellular bias toward certain varieties of amino acids and examined the cell preference (in terms of adhesion, proliferation, and protein attraction) of varieties and of repeat length on SPOT peptide arrays. To investigate the role of specific peptides in controlling the organization of various cardiovascular-related cells, we compared endothelial cells (ECs), smooth muscle cells (SMCs), and fibroblasts (FBs). A clear, cell-specific preference was found for amino acids (longer than 5-mer) using three types of cells, and the combinational effect of the physicochemical properties of the residues was analyzed to interpret the mechanism. Copyright © 2011 European Peptide Society and John Wiley & Sons, Ltd.

Effects of electromagnetic field frequencies on chondrocytes in 3D cell-printed composite constructs.

PubMed

Yi, Hee-Gyeong; Kang, Kyung Shin; Hong, Jung Min; Jang, Jinah; Park, Moon Nyeo; Jeong, Young Hun; Cho, Dong-Woo

2016-07-01

In cartilage tissue engineering, electromagnetic field (EMF) therapy has been reported to have a modest effect on promoting cartilage regeneration. However, these studies were conducted using different frequencies of EMF to stimulate chondrocytes. Thus, it is necessary to investigate the effect of EMF frequency on cartilage formation. In addition to the stimulation, a scaffold is required to satisfy the characteristics of cartilage such as its hydrated and dense extracellular matrix, and a mechanical resilience to applied loads. Therefore, we 3D-printed a composite construct composed of a polymeric framework and a chondrocyte-laden hydrogel. Here, we observed frequency-dependent positive and negative effects on chondrogenesis using a 3D cell-printed cartilage tissue. We found that a frequency of 45 Hz promoted gene expression and secretion of extracellular matrix molecules of chondrocytes. In contrast, a frequency of 7.5 Hz suppressed chondrogenic differentiation in vitro. Additionally, the EMF-treated composite constructs prior to implantation showed consistent results with those of in vitro, suggesting that in vitro pre-treatment with different EMF frequencies provides different capabilities for the enhancement of cartilage formation in vivo. This correlation between EMF frequency and 3D-printed chondrocytes suggests the necessity for optimization of EMF parameters when this physical stimulus is applied to engineered cartilage. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1797-1804, 2016. © 2016 Wiley Periodicals, Inc.

Fabrication of a three dimensional spongy scaffold using human Wharton's jelly derived extra cellular matrix for wound healing.

PubMed

Beiki, Bahareh; Zeynali, Bahman; Seyedjafari, Ehsan

2017-09-01

The Wharton's jelly (WJ) contains significant amounts of extracellular matrix (ECM) components and rich source of endogenous growth factors. In this study, we designed a new biomimetic spongy scaffold from decellularized WJ-derived ECM and used it as a skin substitute. Histological analysis and biochemical assays showed that bio-active molecules preserved in the fabricated scaffolds and that the scaffolds have highly interconnected porous structure. Cytotoxicity and mechanical evaluation of the scaffold indicated that it is non-toxic and has appropriate mechanical properties. MTT assay, SEM and histological analysis of human fibroblast, seeded on the scaffolds, confirmed cellular viability, attachment, penetration and proliferation. The effectiveness of WJ-derived scaffolds in the regeneration of full-thickness wound was assessed through an in vivo experiment. Our results demonstrated that the scaffolds were well integrated into the mouse tissue and absorbed the exudates after one week. Unlike the controls, in WJ group there were not only complete wound closing and disappearance of the scab, but also complete reepithelialization, newly generated epidermal layers and appendages after 12days of implantation. Taken together, our results indicate that WJ-derived scaffolds are able to improve attachment, penetration and growth of the fibroblast cells and speed up the healing processes, which would offer a proper skin graft for wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.

Potential Role for ADAM15 in Pathological Neovascularization in Mice

PubMed Central

Horiuchi, Keisuke; Weskamp, Gisela; Lum, Lawrence; Hammes, Hans-Peter; Cai, Hui; Brodie, Thomas A.; Ludwig, Thomas; Chiusaroli, Riccardo; Baron, Roland; Preissner, Klaus T.; Manova, Katia; Blobel, Carl P.

2003-01-01

ADAM15 (named for a disintegrin and metalloprotease 15, metargidin) is a membrane-anchored glycoprotein that has been implicated in cell-cell or cell-matrix interactions and in the proteolysis of molecules on the cell surface or extracellular matrix. To characterize the potential roles of ADAM15 during development and in adult mice, we analyzed its expression pattern by mRNA in situ hybridization and generated mice carrying a targeted deletion of ADAM15 (adam15−/− mice). A high level of expression of ADAM15 was found in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of the hippocampus and cerebellum. However, despite the pronounced expression of ADAM15 in these tissues, no major developmental defects or pathological phenotypes were evident in adam15−/− mice. The elevated levels of ADAM15 in endothelial cells prompted an evaluation of its role in neovascularization. In a mouse model for retinopathy of prematurity, adam15−/− mice had a major reduction in neovascularization compared to wild-type controls. Furthermore, the size of tumors resulting from implanted B16F0 mouse melanoma cells was significantly smaller in adam15−/− mice than in wild-type controls. Since ADAM15 does not appear to be required for developmental angiogenesis or for adult homeostasis, it may represent a novel target for the design of inhibitors of pathological neovascularization. PMID:12897135

Efficient parallel linear scaling construction of the density matrix for Born-Oppenheimer molecular dynamics.

PubMed

Mniszewski, S M; Cawkwell, M J; Wall, M E; Mohd-Yusof, J; Bock, N; Germann, T C; Niklasson, A M N

2015-10-13

We present an algorithm for the calculation of the density matrix that for insulators scales linearly with system size and parallelizes efficiently on multicore, shared memory platforms with small and controllable numerical errors. The algorithm is based on an implementation of the second-order spectral projection (SP2) algorithm [ Niklasson, A. M. N. Phys. Rev. B 2002 , 66 , 155115 ] in sparse matrix algebra with the ELLPACK-R data format. We illustrate the performance of the algorithm within self-consistent tight binding theory by total energy calculations of gas phase poly(ethylene) molecules and periodic liquid water systems containing up to 15,000 atoms on up to 16 CPU cores. We consider algorithm-specific performance aspects, such as local vs nonlocal memory access and the degree of matrix sparsity. Comparisons to sparse matrix algebra implementations using off-the-shelf libraries on multicore CPUs, graphics processing units (GPUs), and the Intel many integrated core (MIC) architecture are also presented. The accuracy and stability of the algorithm are illustrated with long duration Born-Oppenheimer molecular dynamics simulations of 1000 water molecules and a 303 atom Trp cage protein solvated by 2682 water molecules.

Multiscale Analyses of the Bone-implant Interface

PubMed Central

Cha, J.Y.; Pereira, M.D.; Smith, A.A.; Houschyar, K.S.; Yin, X.; Mouraret, S.; Brunski, J.B.

2015-01-01

Implants placed with high insertion torque (IT) typically exhibit primary stability, which enables early loading. Whether high IT has a negative impact on peri-implant bone health, however, remains to be determined. The purpose of this study was to ascertain how peri-implant bone responds to strains and stresses created when implants are placed with low and high IT. Titanium micro-implants were inserted into murine femurs with low and high IT using torque values that were scaled to approximate those used to place clinically sized implants. Torque created in peri-implant tissues a distribution and magnitude of strains, which were calculated through finite element modeling. Stiffness tests quantified primary and secondary implant stability. At multiple time points, molecular, cellular, and histomorphometric analyses were performed to quantitatively determine the effect of high and low strains on apoptosis, mineralization, resorption, and collagen matrix deposition in peri-implant bone. Preparation of an osteotomy results in a narrow zone of dead and dying osteocytes in peri-implant bone that is not significantly enlarged in response to implants placed with low IT. Placing implants with high IT more than doubles this zone of dead and dying osteocytes. As a result, peri-implant bone develops micro-fractures, bone resorption is increased, and bone formation is decreased. Using high IT to place an implant creates high interfacial stress and strain that are associated with damage to peri-implant bone and therefore should be avoided to best preserve the viability of this tissue. PMID:25628271

Extracellular matrix scaffold as a tubular graft for ascending aorta aneurysm repair.

PubMed

Abu Saleh, Walid K; Al Jabbari, Odeaa; Grande-Allen, Jane; Ramchandani, Mahesh

2015-08-01

Although extracellular xenograft repair has produced encouraging results when applied to cardiac, valvular, and specific aortic defects, its employment as a tube graft to replace the ascending aorta has not been reported. We describe a patient who underwent resection and replacement of an infected ascending aortic graft with an extracellular matrix conduit. The patient did well, but 14 months later developed a pseudoaneurysm from the staple line used to construct the extracellular matrix conduit. The patient underwent a repeat sternotomy and removal of the graft. Because of the increased risk of graft failure, a homograft was felt to be more appropriate in this setting. Ultimately, we were unable to implant the homograft because it was too small for the aortic root; therefore we decided to construct a tubular graft from Cormatrix extracellular matrix (CorMatrix, Roswell, GA, USA). Fourteen months later, he presented with shortness of breath. Computed tomography scan revealed a 3.5 cm pseudoaneurysm of the ascending aorta. It appeared as if there was a disruption of the staple line in the extra cellular matrix graft. The plan was to replace it with a Dacron graft. The Cormatrix graft material was removed and sent for culture and histological analysis. A 28-mm Gel weave graft (Terumo Cardiovascular Systems, Ann Arbor, MI, USA) was implanted. The patient tolerated the procedure well with good hemodynamics. Our experience suggests that the superior strength, handling characteristics, and resistance to infection make extra cellular matrix scaffold a possible alternative conduit to cryopreserved homografts. Applicability as an aortic conduit merits further investigation to better understand behavior of extra cellular matrix in this situation. © 2015 Wiley Periodicals, Inc.

Adhesion molecules and receptors

USDA-ARS?s Scientific Manuscript database

Adhesion molecules are necessary for leukocyte trafficking and differentiation. They serve to initiate cell-cell interactions under conditions of shear, and they sustain the cell-cell and cell-matrix interactions needed for cellular locomotion. They also can serve directly as signaling molecules act...

iNOS Activity Modulates Inflammation, Angiogenesis, and Tissue Fibrosis in Polyether-Polyurethane Synthetic Implants

PubMed Central

Cassini-Vieira, Puebla; Araújo, Fernanda Assis; da Costa Dias, Filipi Leles; Russo, Remo Castro; Andrade, Silvia Passos; Teixeira, Mauro Martins; Barcelos, Luciola Silva

2015-01-01

There is considerable interest in implantation techniques and scaffolds for tissue engineering and, for safety and biocompatibility reasons, inflammation, angiogenesis, and fibrosis need to be determined. The contribution of inducible nitric oxide synthase (iNOS) in the regulation of the foreign body reaction induced by subcutaneous implantation of a synthetic matrix was never investigated. Here, we examined the role of iNOS in angiogenesis, inflammation, and collagen deposition induced by polyether-polyurethane synthetic implants, using mice with targeted disruption of the iNOS gene (iNOS−/−) and wild-type (WT) mice. The hemoglobin content and number of vessels were decreased in the implants of iNOS−/− mice compared to WT mice 14 days after implantation. VEGF levels were also reduced in the implants of iNOS−/− mice. In contrast, the iNOS−/− implants exhibited an increased neutrophil and macrophage infiltration. However, no alterations were observed in levels of CXCL1 and CCL2, chemokines related to neutrophil and macrophage migration, respectively. Furthermore, the implants of iNOS−/− mice showed boosted collagen deposition. These data suggest that iNOS activity controls inflammation, angiogenesis, and fibrogenesis in polyether-polyurethane synthetic implants and that lack of iNOS expression increases foreign body reaction to implants in mice. PMID:26106257

iNOS Activity Modulates Inflammation, Angiogenesis, and Tissue Fibrosis in Polyether-Polyurethane Synthetic Implants.

PubMed

Cassini-Vieira, Puebla; Araújo, Fernanda Assis; da Costa Dias, Filipi Leles; Russo, Remo Castro; Andrade, Silvia Passos; Teixeira, Mauro Martins; Barcelos, Luciola Silva

2015-01-01

There is considerable interest in implantation techniques and scaffolds for tissue engineering and, for safety and biocompatibility reasons, inflammation, angiogenesis, and fibrosis need to be determined. The contribution of inducible nitric oxide synthase (iNOS) in the regulation of the foreign body reaction induced by subcutaneous implantation of a synthetic matrix was never investigated. Here, we examined the role of iNOS in angiogenesis, inflammation, and collagen deposition induced by polyether-polyurethane synthetic implants, using mice with targeted disruption of the iNOS gene (iNOS(-/-)) and wild-type (WT) mice. The hemoglobin content and number of vessels were decreased in the implants of iNOS(-/-) mice compared to WT mice 14 days after implantation. VEGF levels were also reduced in the implants of iNOS(-/-) mice. In contrast, the iNOS(-/-) implants exhibited an increased neutrophil and macrophage infiltration. However, no alterations were observed in levels of CXCL1 and CCL2, chemokines related to neutrophil and macrophage migration, respectively. Furthermore, the implants of iNOS(-/-) mice showed boosted collagen deposition. These data suggest that iNOS activity controls inflammation, angiogenesis, and fibrogenesis in polyether-polyurethane synthetic implants and that lack of iNOS expression increases foreign body reaction to implants in mice.

Electrophilic properties of common MALDI matrix molecules

NASA Astrophysics Data System (ADS)

Lippa, T. P.; Eustis, S. N.; Wang, D.; Bowen, K. H.

2007-11-01

The negative ion photoelectron spectra of the following MALDI matrix molecules have been measured: 3-carboxypyridine (nicotinic acid), 2,5-dihydroxybenzoic acid (DHB), 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid), 2,6-dihydroxyacetophenone (DHAP), 3-(4-hydroxy-3-methoxyphenyl)-2-propenoic acid (ferulic acid), 3-hydroxy-2-pyridinecarboxylic acid (3HPA), and 2,6-pyridinedicarboxylic acid (dipicolinic acid). Adiabatic electron affinities and vertical detachment energies were extracted from these spectra and reported. In addition, electron affinities were calculated for DHAP, ferulic acid, dipicolinic acid and sinapinic acid. Photoelectron spectra were also measured for the dimer anions of DHB and nicotinic acid and for the fragment anion in which alpha-cyano-cinnamic acid had lost a CO2 unit. Together, these results augment the database of presently available electrophilic data on common matrix molecules along with some of their dimers and fragments.

Multifunctional curing agents and their use in improving strength of composites containing carbon fibers embedded in a polymeric matrix

DOEpatents

Vautard, Frederic; Ozcan, Soydan

2017-04-11

A functionalized carbon fiber having covalently bound on its surface a sizing agent containing epoxy groups, at least some of which are engaged in covalent bonds with crosslinking molecules, wherein each of said crosslinking molecules possesses at least two epoxy-reactive groups and at least one free functional group reactive with functional groups of a polymer matrix in which the carbon fiber is to be incorporated, wherein at least a portion of said crosslinking molecules are engaged, via at least two of their epoxy-reactive groups, in crosslinking bonds between at least two epoxy groups of the sizing agent. Composites comprised of these functionalized carbon fibers embedded in a polymeric matrix are also described. Methods for producing the functionalized carbon fibers and composites thereof are also described.

Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

NASA Astrophysics Data System (ADS)

Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

1997-07-01

Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

Regenerative surgical therapy for peri-implantitis using deproteinized bovine bone mineral with 10% collagen, enamel matrix derivative and Doxycycline-A prospective 3-year cohort study.

PubMed

Mercado, Faustino; Hamlet, Stephen; Ivanovski, Saso

2018-05-16

There is limited evidence regarding the long-term efficacy of regenerative treatment for peri-implantitis. The aim of this study was to evaluate a combination therapy of deproteinized bovine bone mineral with 10% collagen (DBBMC), enamel matrix derivative (EMD) and Doxycycline in the regeneration of bone defects associated with peri-implantitis. Thirty patients diagnosed with peri-implantitis (BoP/suppuration, probing depth greater than 4 mm, minimum radiographic bone loss of 20%, at least 2 years in function) were enrolled in the study. Clinical measurements included probing depths, recession, radiographic bone fill, gingival inflammation and bleeding on probing/suppuration. Following surgical access and debridement, the implant surfaces were decontaminated with 24% EDTA for 2 min, and the bone defects were filled with a combined mixture of DBBMC, EMD and Doxycycline powder. The defects were covered with connective tissue grafts where necessary. Clinical measurements were recorded after 12, 24 and 36 months. The mean probing depth and bone loss at the initial visit was 8.9 mm (±1.9) and 6.92 mm (±1.26), respectively. Both mean probing depth and bone loss reduced significantly from baseline to 3.55 mm (±0.50) and 2.85 mm (±0.73) at 12 months, 3.50 (±0.50) and 2.62 mm (±0.80) at 24 months and 3.50 mm (±0.50) and 2.60 mm (±0.73) at 36 months. 56.6% of the implants were considered successfully treated (according to Successful Treatment Outcome Criterion: PD < 5 mm, no further bone loss >10%, no BoP/suppuration, no recession >0.5 mm for anterior implants and >1.5 mm for posterior implants) after 36 months. Regenerative treatment of peri-implantitis using a combined mixture of DBBMC, EMD and Doxycycline achieved promising results. The benefits of this protocol incorporating EMD should be tested in randomized clinical trials. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Early fixation of cobalt-chromium based alloy surgical implants to bone using a tissue-engineering approach.

PubMed

Ogawa, Munehiro; Tohma, Yasuaki; Ohgushi, Hajime; Takakura, Yoshinori; Tanaka, Yasuhito

2012-01-01

To establish the methods of demonstrating early fixation of metal implants to bone, one side of a Cobalt-Chromium (CoCr) based alloy implant surface was seeded with rabbit marrow mesenchymal cells and the other side was left unseeded. The mesenchymal cells were further cultured in the presence of ascorbic acid, β-glycerophosphate and dexamethasone, resulting in the appearance of osteoblasts and bone matrix on the implant surface. Thus, we succeeded in generating tissue-engineered bone on one side of the CoCr implant. The CoCr implants were then implanted in rabbit bone defects. Three weeks after the implantation, evaluations of mechanical test, undecalcified histological section and electron microscope analysis were performed. Histological and electron microscope images of the tissue engineered surface exhibited abundant new bone formation. However, newly formed bone tissue was difficult to detect on the side without cell seeding. In the mechanical test, the mean values of pull-out forces were 77.15 N and 44.94 N for the tissue-engineered and non-cell-seeded surfaces, respectively. These findings indicate early bone fixation of the tissue-engineered CoCr surface just three weeks after implantation.

Early Fixation of Cobalt-Chromium Based Alloy Surgical Implants to Bone Using a Tissue-engineering Approach

PubMed Central

Ogawa, Munehiro; Tohma, Yasuaki; Ohgushi, Hajime; Takakura, Yoshinori; Tanaka, Yasuhito

2012-01-01

To establish the methods of demonstrating early fixation of metal implants to bone, one side of a Cobalt-Chromium (CoCr) based alloy implant surface was seeded with rabbit marrow mesenchymal cells and the other side was left unseeded. The mesenchymal cells were further cultured in the presence of ascorbic acid, β-glycerophosphate and dexamethasone, resulting in the appearance of osteoblasts and bone matrix on the implant surface. Thus, we succeeded in generating tissue-engineered bone on one side of the CoCr implant. The CoCr implants were then implanted in rabbit bone defects. Three weeks after the implantation, evaluations of mechanical test, undecalcified histological section and electron microscope analysis were performed. Histological and electron microscope images of the tissue engineered surface exhibited abundant new bone formation. However, newly formed bone tissue was difficult to detect on the side without cell seeding. In the mechanical test, the mean values of pull-out forces were 77.15 N and 44.94 N for the tissue-engineered and non-cell-seeded surfaces, respectively. These findings indicate early bone fixation of the tissue-engineered CoCr surface just three weeks after implantation. PMID:22754313

Ultrasound assessment of soft tissue augmentation around implants in the aesthetic zone using a connective tissue graft and xenogeneic collagen matrix - 1-year randomised follow-up.

PubMed

Puzio, Monika; Błaszczyszyn, Artur; Hadzik, Jakub; Dominiak, Marzena

2018-05-01

A comparative, ultrasound evaluation of the thickness of keratinized mucosa (TKT) around implants one year after gingival augmentation (GA) by means of a connective tissue graft (CTG) and the xenogeneic collagen matrix (CMX). A total of 75 bone level tapered implants (Conelog ® Camlog) were inserted in 57 patients in the aesthetic area of both jaws. The patients were divided into 3 groups: control group I- without GA; group II- GA 3 months before implantation, and group III- GA 3 months after implantation. Groups II and III were divided into two subgroups depends on type of material used for GA: (a) CMX (Mucograft ® , Geistlich Pharma AG) and (b) CTG. The patients underwent a clinical and ultrasound examination before, then after 3 and 12 months following GA respectively to evaluate TKT at two points using ultrasound equipment (Pirop ® , Echoson). Point 1 was considered to be in the middle of the line connecting the cemento-enamel junction (CEJ) to the adjacent teeth, and point 2 on the mucogingival junction (MGJ). Three months after GA, the highest increase in gingival thickness was noted in group IIIb (point 1 - 0.95mm, 2 - 1.01mm). However, 12 months after GA the highest gingival thickness was observed in group IIb (point 1 - 1.76mm, 2 - 1.36m) and next IIIb (point 1 - 1.52mm, 2 - 1.15mm). Both CTG and Geistlich Mucograft ® increased TKT, but higher values were noted using CTG augmentation before implantation. An ultrasonic device can be used as a non-invasive, reliable, and reproducible method for evaluating TKT. Copyright © 2017 Elsevier GmbH. All rights reserved.

Microbiological and clinical effects of enamel matrix derivative and sustained-release micro-spherical minocycline application as an adjunct to non-surgical therapy in peri-implant mucosal inflammation.

PubMed

Faramarzi, Masumeh; Goharfar, Zahra; Pourabbas, Reza; Kashefimehr, Atabak; Shirmohmmadi, Adileh

2015-08-01

The purpose of this study was to compare the microbial and clinical effects of mechanical debridement (MD) alone or in combination with the application of enamel matrix derivative (EMD) and sustained-release micro-spherical minocycline (MSM) for treatment of peri-implant mucosal infl ammation (PIMI). Subjects with at least one implant with PIMI were included and divided into control and two different test groups. In all three groups, MD was performed. In the MSM group, following MD, MSM was placed subgingivally around the implants. In the EMD group, after MD, EMD was placed in the sulcus around the implants. Sampling of peri-implant crevicular fl uid for microbial analysis with real-time polymerase chain reaction and recording of probing depth (PD) and bleeding on probing (BOP) were performed prior to as well as two weeks and three months after treatment. Median values and interquartile range were estimated for each variable during the various assessment intervals of the study. In all groups, at two weeks and three months, the counts of Porphyromonas gingivalis decreased significantly compared to baseline. Levels of P. gingivalis were significantly reduced in MSM (P<0.001) and EMD (P=0.026) groups compared to the control group. Also, clinical parameters improved significantly at two weeks and three months. Reduction of PD was significant in MSM (P<0.001) and EMD (P<0.001) groups. The decrease in BOP in the MSM, EMD, and control groups was 60%, 50%, and 20%, respectively. The use of MSM and EMD can be an adjunctive treatment for management of PIMI and improves clinical parameters and reduces P. gingivalis burden three months after treatment.

Mechanical and biological evaluations of beta-tricalcium phosphate/silicone rubber composite as a novel soft-tissue implant.

PubMed

Zhang, Yi-ming; Wang, Shao-liang; Lei, Ze-yuan; Fan, Dong-li

2009-09-01

Although silicone rubber (SR) implants are most commonly used and effective for soft-tissue augmentation, they still have been implicated in many adverse reactions. To overcome this problem, a novel composite beta-tricalcium phosphate/silicone rubber (beta-TCP/SR) was prepared by adding beta-TCP into a SR matrix. This study was to evaluate its application potential by investigating the mechanical properties and biocompatibility of beta-TCP/SR. Mechanical properties, including Shore A hardness and tensile strength, were evaluated with 3-mm-thick samples and a universal testing machine. Cytocompatibility tests were conducted in vitro using 0.2-mm-thick beta-TCP/SR samples by seeding fibroblasts onto different samples. Soft-tissue response to beta-TCP/SR and pull-out measurements were investigated 4 weeks and 24 weeks after implantation. The main mechanical properties were all significantly changed after mixing beta-TCP into the SR matrix, except for tearing strength. The cytocompatibility test showed enhanced adhesion and proliferation of fibroblasts onto beta-TCP/SR. Fibrous tissue ingrowth after resorption of beta-TCP was observed by in vivo histologic analysis. The peri-implant capsules in the beta-TCP/SR group were thinner than in the SR group 24 weeks after implantation. In a 24-week test, the maximum force required to pull out the beta-TCP/SR sheet was about six times greater than that needed for SR. Although some mechanical properties were significantly changed, the results of the cytocompatibility test and in vivo animal study still suggest that beta-TCP/SR may be more suitable as a soft-tissue implant than SR and has the potential to be used in plastic surgery.

Biofilm formation - What we can learn from recent developments.

PubMed

Bjarnsholt, Thomas; Buhlin, Kåre; Dufrêne, Yves F; Gomelsky, Mark; Moroni, Anna; Ramstedt, Madeleine; Rumbaugh, Kendra P; Schulte, Tim; Sun, Lei; Åkerlund, Börje; Römling, Ute

2018-06-01

Although biofilms have been observed early in the history of microbial research, their impact has only recently been fully recognized. Biofilm infections, which contribute to up to 80% of human microbial infections, are associated with common human disorders, such as diabetes mellitus and poor dental hygiene, but also with medical implants. The associated chronic infections such as wound infections, dental caries and periodontitis significantly enhance morbidity, affect quality of life and can result in contraction of follow-up diseases such as cancer. Biofilm infections remain challenging to treat and antibiotic monotherapy is often insufficient, although some rediscovered traditional compounds have shown surprising efficiency. Innovative anti-biofilm strategies include application of anti-biofilm small molecules, intrinsic or external stimulation of production of reactive molecules, utilization of materials with antimicrobial properties and dispersion of biofilms by digestion of the extracellular matrix, also in combination with physical biofilm breakdown. Although basic principles of biofilm formation have been deciphered, the molecular understanding of the formation and structural organization of various types of biofilms has just begun to emerge. Basic studies of biofilm physiology have also resulted in an unexpected discovery of cyclic dinucleotide second messengers that are involved in interkingdom crosstalk via specific mammalian receptors. These findings even open up new venues for exploring novel anti-biofilm strategies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Osseointegration of titanium implants functionalised with phosphoserine-tethered poly(epsilon-lysine) dendrons: a comparative study with traditional surface treatments in sheep.

PubMed

Stübinger, Stefan; Nuss, Katja; Bürki, Alexander; Mosch, Isabel; le Sidler, Miché; Meikle, Steve T; von Rechenberg, Brigitte; Santin, Matteo

2015-02-01

The aim of this study was to analyse the osseointegrative potential of phosphoserine-tethered dendrons when applied as surface functionalisation molecules on titanium implants in a sheep model after 2 and 8 weeks of implantation. Uncoated and dendron-coated implants were implanted in six sheep. Sandblasted and etched (SE) or porous additive manufactured (AM) implants with and without additional dendron functionalisation (SE-PSD; AM-PSD) were placed in the pelvic bone. Three implants per group were examined histologically and six implants were tested biomechanically. After 2 and 8 weeks the bone-to-implant contact (BIC) total values of SE implants (43.7±12.2; 53.3±9.0%) and SE-PSD (46.7±4.5; 61.7±4.9%) as well as AM implants (20.49±5.1; 43.9±9.7%) and AM-PSD implants (19.7±3.5; 48.3±15.6%) showed no statistically significant differences. For SE-PSD and AM-PSD a separate analysis of only the cancellous BIC demonstrated a statistically significant difference after 2 and 8 weeks. Biomechanical findings proved the overall increased stability of the porous implants after 8 weeks. Overall, the great effect of implant macro design on osseointegration was further supported by additional phosphoserine-tethered dendrons for SE and AM implants.

A Meta-analysis of Studies Comparing Outcomes of Diverse Acellular Dermal Matrices for Implant-Based Breast Reconstruction.

PubMed

Lee, Kyeong-Tae; Mun, Goo-Hyun

2017-07-01

The current diversity of the available acellular dermal matrix (ADM) materials for implant-based breast reconstruction raises the issue of whether there are any differences in postoperative outcomes according to the kind of ADM used. The present meta-analysis aimed to investigate whether choice of ADM products can affect outcomes. Studies that used multiple kinds of ADM products for implant-based breast reconstruction and compared outcomes between them were searched. Outcomes of interest were rates of postoperative complications: infection, seroma, mastectomy flap necrosis, reconstruction failure, and overall complications. A total of 17 studies met the selection criteria. There was only 1 randomized controlled trial, and the other 16 studies had retrospective designs. Comparison of FlexHD, DermaMatrix, and ready-to-use AlloDerm with freeze-dried AlloDerm was conducted in multiple studies and could be meta-analyzed, in which 12 studies participated. In the meta-analysis comparing FlexHD and freeze-dried AlloDerm, using the results of 6 studies, both products showed similar pooled risks for all kinds of complications. When comparing DermaMatrix and freeze-dried AlloDerm with the results from 4 studies, there were also no differences between the pooled risks of complications of the two. Similarly, the meta-analysis of 4 studies comparing ready-to-use and freeze-dried AlloDerm demonstrated that the pooled risks for the complications did not differ. This meta-analysis demonstrates that the 3 recently invented, human cadaveric skin-based products of FlexHD, DermaMatrix, and ready-to-use AlloDerm have similar risks of complications compared with those of freeze-dried AlloDerm, which has been used for longer. However, as most studies had low levels of evidence, further investigations are needed.

Connection between the conformation and emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] single molecules during thermal annealing

NASA Astrophysics Data System (ADS)

Ou, Jiemei; Yang, Yuzhao; Lin, Wensheng; Yuan, Zhongke; Gan, Lin; Lin, Xiaofeng; Chen, Xudong; Chen, Yujie

2015-03-01

We investigated the transitions of conformations and their effects on emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) single molecules in PMMA matrix during thermal annealing process. Total internal reflection fluorescence microscopy measurements reveal the transformation from collapsed conformations to extended, highly ordered rod-like structures of MEH-PPV single molecules during thermal annealing. The blue shifts in the ensemble single molecule PL spectra support our hypnosis. The transition occurs as the annealing temperature exceeds 100 °C, implying that an annealing temperature near the glass transition temperature Tg of matrix is ideal for the control and optimization of blend polymer films.

In-vitro and in-vivo design and validation of an injectable polysaccharide-hydroxyapatite composite material for sinus floor augmentation.

PubMed

Fricain, J C; Aid, R; Lanouar, S; Maurel, D B; Le Nihouannen, D; Delmond, S; Letourneur, D; Amedee Vilamitjana, J; Catros, S

2018-04-07

Polysaccharide-based composite matrices consisting of natural polysaccharides, pullulan and dextran supplemented with hydroxyapatite (Matrix-HA) have recently been developed. The principal objective of this study was to evaluate the capacities of this composite material to promote new bone formation in a sinus lift model in the sheep. Secondary objectives were to evaluate in vitro properties of the material regarding cell adhesion and proliferation. In this report, once such composite matrix was prepared as injectable beads after dispersion in a physiological buffer, and evaluated using a large animal model (sheep) for a sinus lift procedure. In vitro studies revealed that these microbeads (250-550μm in diameter) allow vascular cell adhesion and proliferation of Endothelial Cells (EC) after 1 and 7 days of culture. In vivo studies were performed in 12 adult sheep, and newly formed tissue was analyzed by Cone Beam Computed Tomography (CBCT scanning electron microscopy (SEM) and by histology 3 and 6 months post-implantation. CBCT analyses at the implantation time revealed the radiolucent properties of these matrices. Quantitative analysis showed an increase of a dense mineralized tissue in the Matrix-HA group up to 3 months of implantation. The mineralized volume over total volume after 6 months reached comparable values to those obtained for Bio-Oss ® used as positive control. Histological examination confirmed that the Matrix-HA did not induce any long term inflammatory events, and promoted direct contact between the osteoid tissue and lamellar bone structures and beads. After 6 months, we observed a dense network of osteocytes surrounding both biomaterials as well as a newly vascularized formed tissue in close contact to the biomaterials. In conclusion, the absence of animal components in Matrix-HA, the osteoconductive property of Matrix-HA in sheep, resulting in a dense bone and vascularized tissue, and the initial radiolucent property to follow graft integration offer great promises of this composite material for clinical use. Copyright © 2018 The Academy of Dental Materials. Published by Elsevier Inc. All rights reserved.

Probing the tumor microenvironment: collection and induction

NASA Astrophysics Data System (ADS)

Williams, James K.; Padgen, Michael R.; Wang, Yarong; Entenberg, David; Gertler, Frank; Condeelis, John S.; Castracane, James

2012-03-01

The Nano Intravital Device, or NANIVID, is under development as an optically transparent, implantable tool to study the tumor microenvironment. Two etched glass substrates are sealed using a thin polymer membrane to create a reservoir with a single outlet. This reservoir is loaded with a hydrogel blend that contains growth factors or other chemicals to be delivered to the tumor microenvironment. When the device is implanted in the tumor, the hydrogel will swell and release these entrapped molecules, forming a gradient. Validation of the device has been performed in vitro using epidermal growth factor (EGF) and MenaINV, a highly invasive, rat mammary adenocarcinoma cell line. In both 2-D and 3-D environments, cells migrated toward the gradient of EGF released from the device. The chorioallantoic membrane (CAM) of White Leghorn chicken eggs is being utilized to grow xenograft tumors that will be used for ex vivo cell collection. Device optimization is being performed for in vivo use as a tool to collect the invasive cell population. Preliminary cell collection experiments in vivo were performed using a mouse model of breast cancer. As a second application, the device is being explored as a delivery vehicle for chemicals that induce controlled changes in the tumor microenvironment. H2O2 was loaded in the device and generated intracellular reactive oxygen species (ROS) in cells near the device outlet. In the future, other induction targets will be explored, including hypoglycemia and the manipulation of extracellular matrix stiffness.

Periodontal Tissues, Maxillary Jaw Bone, and Tooth Regeneration Approaches: From Animal Models Analyses to Clinical Applications

PubMed Central

Batool, Fareeha; Strub, Marion; Petit, Catherine; Bugueno, Isaac Maximiliano; Bornert, Fabien; Clauss, François; Kuchler-Bopp, Sabine; Benkirane-Jessel, Nadia

2018-01-01

This review encompasses different pre-clinical bioengineering approaches for periodontal tissues, maxillary jaw bone, and the entire tooth. Moreover, it sheds light on their potential clinical therapeutic applications in the field of regenerative medicine. Herein, the electrospinning method for the synthesis of polycaprolactone (PCL) membranes, that are capable of mimicking the extracellular matrix (ECM), has been described. Furthermore, their functionalization with cyclosporine A (CsA), bone morphogenetic protein-2 (BMP-2), or anti-inflammatory drugs’ nanoreservoirs has been demonstrated to induce a localized and targeted action of these molecules after implantation in the maxillary jaw bone. Firstly, periodontal wound healing has been studied in an induced periodontal lesion in mice using an ibuprofen-functionalized PCL membrane. Thereafter, the kinetics of maxillary bone regeneration in a pre-clinical mouse model of surgical bone lesion treated with BMP-2 or BMP-2/Ibuprofen functionalized PCL membranes have been analyzed by histology, immunology, and micro-computed tomography (micro-CT). Furthermore, the achievement of innervation in bioengineered teeth has also been demonstrated after the co-implantation of cultured dental cell reassociations with a trigeminal ganglia (TG) and the cyclosporine A (CsA)-loaded poly(lactic-co-glycolic acid) (PLGA) scaffold in the jaw bone. The prospective clinical applications of these different tissue engineering approaches could be instrumental in the treatment of various periodontal diseases, congenital dental or cranio-facial bone anomalies, and post-surgical complications. PMID:29772691

Improving tissue preparation for matrix-assisted laser desorption ionization mass spectrometry imaging. Part 1: using microspotting.

PubMed

Franck, Julien; Arafah, Karim; Barnes, Alan; Wisztorski, Maxence; Salzet, Michel; Fournier, Isabelle

2009-10-01

Nowadays, matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI MSI) is a powerful technique to obtain the distribution of endogenous and exogenous molecules within tissue sections. It can, thus, be used to study the evolution of molecules across different physiological stages in order to find out markers or get knowledge on signaling pathways. In order to provide valuable information, we must carefully control the sample preparation to avoid any delocalization of molecules of interest inside the tissue during this step. Currently, two strategies can be used to deposit chemicals, such as the MALDI matrix, onto the tissue both involving generation of microdroplets that will be dropped off onto the surface. First strategy involves microspraying of solutions. Here, we have been interested in the development of a microspotting strategy, where nanodroplets of solvent are ejected by a piezoelectric device to generate microspots at the tissue level. Such systems allow one to precisely control sample preparation by creating an array of spots. In terms of matrix crystallization, a microspotting MALDI matrix is hardly compatible with the results by classical (pipetting) methods. We have thus synthesized and studied new solid ionic matrixes in order to obtain high analytical performance using such a deposition system. These developments have enabled optimization of the preparation time because of the high stability of the printing that is generated in these conditions. We have also studied microspotting for performing on-tissue digestion in order to go for identification of proteins or to work from formalin fixed and paraffin embedded (FFPE) tissue samples. We have shown that microspotting is an interesting approach for on tissue digestion. Peptides, proteins, and lipids were studied under this specific preparation strategy to improve imaging performances for this class of molecules.

Nanoengineered implant as a new platform for regenerative nanomedicine using 3D well-organized human cell spheroids

PubMed Central

Keller, Laetitia; Idoux-Gillet, Ysia; Wagner, Quentin; Eap, Sandy; Brasse, David; Schwinté, Pascale; Arruebo, Manuel; Benkirane-Jessel, Nadia

2017-01-01

In tissue engineering, it is still rare today to see clinically transferable strategies for tissue-engineered graft production that conclusively offer better tissue regeneration than the already existing technologies, decreased recovery times, and less risk of complications. Here a novel tissue-engineering concept is presented for the production of living bone implants combining 1) a nanofibrous and microporous implant as cell colonization matrix and 2) 3D bone cell spheroids. This combination, double 3D implants, shows clinical relevant thicknesses for the treatment of an early stage of bone lesions before the need of bone substitutes. The strategy presented here shows a complete closure of a defect in nude mice calvaria after only 31 days. As a novel strategy for bone regenerative nanomedicine, it holds great promises to enhance the therapeutic efficacy of living bone implants. PMID:28138241

Laser-induced emission spectroscopy of matrix-isolated carbon molecules: Experimental setup and new results on C3

NASA Astrophysics Data System (ADS)

Čermák, Ivo; Förderer, Markus; Čermáková, Iva; Kalhofer, Stefan; Stopka-Ebeler, Helmut; Monninger, Gerold; Krätschmer, Wolfgang

1998-06-01

We have studied small carbon molecules using a matrix-isolation technique. Our experimental setup is described in detail. The carbon clusters were produced by evaporating graphite and trapping the carbon-vapor molecules in solid argon, where molecular growth could be induced by controlled matrix annealing. To identify the produced molecules, absorption spectroscopy in the ultraviolet (UV)-visible and infrared (IR) spectral ranges was applied. Additional characterization of the excited and ground states of the molecules was obtained from emission and excitation spectra. The molecules were excited by a pulsed dye laser system and the emission spectra were recorded with a high-sensitivity photodiode-array spectrometer. We present our measurements on linear C3. The à 1Πu excited state of linear C3 was populated by the electronic transition à 1Πu←X˜ 1Σg+, and the corresponding excitation spectra of the C3 fluorescence (à 1Πu→X˜ 1Σg+) and phosphorescence (ã 3Πu→X˜ 1Σg+) were studied. Comparison of excitation and absorption spectra yielded information on site effects due to the matrix environment. Emission bands in the fluorescence and phosphorescence spectra up to vibrational energies of 8500 cm-1 could be observed. The radiation lifetime of the à 1Πu excited state of C3 in solid argon was found to be shorter than 10 ns. The phosphorescence transition ã 3Πu→X˜ 1Σg+ decays in about 10 ms and its rise indicates fast vibrational relaxation within the triplet system. Our data support a linear ground state geometry for C3 also in solid argon.

MAGP1, the extracellular matrix, and metabolism

PubMed Central

Craft, Clarissa S

2014-01-01

Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases. PMID:26167404

MAGP1, the extracellular matrix, and metabolism.

PubMed

Craft, Clarissa S

2015-01-01

Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases.

An implantable smart magnetic nanofiber device for endoscopic hyperthermia treatment and tumor-triggered controlled drug release.

PubMed

Sasikala, Arathyram Ramachandra Kurup; Unnithan, Afeesh Rajan; Yun, Yeo-Heung; Park, Chan Hee; Kim, Cheol Sang

2016-02-01

The study describes the design and synthesis of an implantable smart magnetic nanofiber device for endoscopic hyperthermia treatment and tumor-triggered controlled drug release. This device is achieved using a two-component smart nanofiber matrix from monodisperse iron oxide nanoparticles (IONPs) as well as bortezomib (BTZ), a chemotherapeutic drug. The IONP-incorporated nanofiber matrix was developed by electrospinning a biocompatible and bioresorbable polymer, poly (d,l-lactide-co-glycolide) (PLGA), and tumor-triggered anticancer drug delivery is realized by exploiting mussel-inspired surface functionalization using 2-(3,4-dihydroxyphenyl)ethylamine (dopamine) to conjugate the borate-containing BTZ anticancer drug through a catechol metal binding in a pH-sensitive manner. Thus, an implantable smart magnetic nanofiber device can be exploited to both apply hyperthermia with an alternating magnetic field (AMF) and to achieve cancer cell-specific drug release to enable synergistic cancer therapy. These results confirm that the BTZ-loaded mussel-inspired magnetic nanofiber matrix (BTZ-MMNF) is highly beneficial not only due to the higher therapeutic efficacy and low toxicity towards normal cells but also, as a result of the availability of magnetic nanoparticles for repeated hyperthermia application and tumor-triggered controlled drug release. The current work report on the design and development of a smart nanoplatform responsive to a magnetic field to administer both hyperthermia and pH-dependent anticancer drug release for the synergistic anticancer treatment. The iron oxide nanoparticles (IONPs) incorporated nanofiber matrix was developed by electrospinning a biocompatible polymer, poly (d,l-lactide-co-glycolide) (PLGA), and tumor-triggered anticancer drug delivery is realized by surface functionalization using 2-(3,4-dihydroxyphenyl)ethylamine (dopamine) to conjugate the boratecontaining anticancer drug bortezomib through a catechol metal binding in a pH-sensitive manner. This implantable magnetic nanofiber device can be exploited to apply hyperthermia with an alternating magnetic field and to achieve cancer cell-specific drug release to enable synergistic cancer therapy, which results in an improvement in both quality of life and patient compliance. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

The mesangial matrix in the normal and sclerotic glomerulus.

PubMed

Rosenblum, N D

1994-02-01

Mesangial sclerosis is a final common pathway to glomerular destruction in a variety of glomerular diseases. The expression of several classes of extracellular matrix (ECM) molecules has been defined in the normal and diseased mesangial matrix (MM). However, the manner in which these ECM components determine the three dimensional structure and function of the MM remains to be defined. Structural studies of the MM suggest that its constituent molecules are regionally organized into subcompartments with different three dimensional structures. The diversity of matrix molecules expressed within the MM as well as the organization of these components in nonrenal ECM's, such as the cornea, provides further support for this organizational model. The study of the cornea has also revealed that novel short chain collagenous proteins partially determine the three dimensional structure of the matrix. Recently, a novel collagen, type VIII collagen, has been described in mesangial cells and in the intact glomerulus. It is hypothesized that type VIII collagen is expressed both as a polymer and as a monomer within the glomerulus, and depending on its conformation, may serve unique functions. In the chronically diseased MM, normal MM components are overexpressed and fibrillar collagens are expressed de novo in a delayed fashion. Enhanced proteoglycan expression, observed early in disease, may determine increased volume of the mesangium. This, in turn, may stimulate the production of fibrillar collagens by mesangial cells resulting in a fibrillar noncompliant mesangial matrix.

Stoichiometric titanium dioxide ion implantation in AISI 304 stainless steel for corrosion protection

NASA Astrophysics Data System (ADS)

Hartwig, A.; Decker, M.; Klein, O.; Karl, H.

2015-12-01

The aim of this study is to evaluate the applicability of highly chemically inert titanium dioxide synthesized by ion beam implantation for corrosion protection of AISI 304 stainless steel in sodium chloride solution. More specifically, the prevention of galvanic corrosion between carbon-fiber reinforced plastic (CFRP) and AISI 304 was investigated. Corrosion performance of TiO2 implanted AISI 304 - examined for different implantation and annealing parameters - is strongly influenced by implantation fluence. Experimental results show that a fluence of 5 × 1016 cm-2 (Ti+) and 1 × 1017 cm-2 (O+) is sufficient to prevent pitting corrosion significantly, while galvanic corrosion with CFRP can already be noticeably reduced by an implantation fluence of 5 × 1015 cm-2 (Ti+) and 1 × 1016 cm-2 (O+). Surface roughness, implantation energy and annealing at 200 °C and 400 °C show only little influence on the corrosion behavior. TEM analysis indicates the existence of stoichiometric TiO2 inside the steel matrix for medium fluences and the formation of a separated metal oxide layer for high fluences.

Reducing infection risk in implant-based breast-reconstruction surgery: challenges and solutions

PubMed Central

Ooi, Adrian SH; Song, David H

2016-01-01

Implant-based procedures are the most commonly performed method for postmastectomy breast reconstruction. While donor-site morbidity is low, these procedures are associated with a higher risk of reconstructive loss. Many of these are related to infection of the implant, which can lead to prolonged antibiotic treatment, undesired additional surgical procedures, and unsatisfactory results. This review combines a summary of the recent literature regarding implant-related breast-reconstruction infections and combines this with a practical approach to the patient and surgery aimed at reducing this risk. Prevention of infection begins with appropriate reconstructive choice based on an assessment and optimization of risk factors. These include patient and disease characteristics, such as smoking, obesity, large breast size, and immediate reconstructive procedures, as well as adjuvant therapy, such as radiotherapy and chemotherapy. For implant-based breast reconstruction, preoperative planning and organization is key to reducing infection. A logical and consistent intraoperative and postoperative surgical protocol, including appropriate antibiotic choice, mastectomy-pocket creation, implant handling, and considered acellular dermal matrix use contribute toward the reduction of breast-implant infections. PMID:27621667

Autogenous bone versus deproteinised bovine bone matrix in 1-stage lateral sinus floor elevation in the severely atrophied maxilla: a randomised controlled trial.

PubMed

Merli, Mauro; Moscatelli, Marco; Mariotti, Giorgia; Rotundo, Roberto; Nieri, Michele

2013-01-01

To compare 100% deproteinised bovine bone matrix (DBBM) grafts (test group) with 100% autogenous bone (AB) grafts (control group) for lateral maxillary sinus floor elevation in a parallel group, superiority, randomised controlled trial. Patients with 1 to 3 mm of residual bone height below the maxillary sinus were randomised for sinus floor elevation with DBBM and AB grafts and simultaneous implant placement. Randomisation was computer generated with allocation concealment by sealed envelopes and the radiographic examiner was blinded to group assignment. The abutment connection was performed 8 months after surgery and insertion of the provisional prostheses was performed 9 months after surgery. Outcome variables were implant failures, prosthetic failures, complications, chair time, postoperative pain and radiographic bone level 6 months after loading. Forty patients were randomised: 20 (32 implants) to the DBBM group and 20 (27 implants) to the AB group. One patient from the AB group dropped out. Two implant failures occurred in the DBBM group and no implant failure occurred in the AB group (P = 0.4872). All of the planned prostheses could be delivered. One complication occurred in the DBBM group and 2 in the AB group (P = 0.6050). Chair time was shorter for the DBBM group, with a difference of 27.3 minutes (P = 0.0428). Pain difference measured with a visual analogue scale for 6 days post-surgery was 0.2 in favour of the DBBM group (P = 0.6838). The difference in vertical bone height was 0.0 mm (95% CI -1.1, 1.1; P = 0.9703) and the difference in marginal bone level was 0.3 in favour of AB (95% CI -0.3, 0.9; P = 0.3220). No differences apart from chair time were observed when comparing DBBM and AB grafts with simultaneous implant placement in sinus elevation.

The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

NASA Astrophysics Data System (ADS)

Henry, Jackson; Blair, Enrique P.

2018-02-01

Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

Matrix isolation as a tool for studying interstellar chemical reactions

NASA Technical Reports Server (NTRS)

Ball, David W.; Ortman, Bryan J.; Hauge, Robert H.; Margrave, John L.

1989-01-01

Since the identification of the OH radical as an interstellar species, over 50 molecular species were identified as interstellar denizens. While identification of new species appears straightforward, an explanation for their mechanisms of formation is not. Most astronomers concede that large bodies like interstellar dust grains are necessary for adsorption of molecules and their energies of reactions, but many of the mechanistic steps are unknown and speculative. It is proposed that data from matrix isolation experiments involving the reactions of refractory materials (especially C, Si, and Fe atoms and clusters) with small molecules (mainly H2, H2O, CO, CO2) are particularly applicable to explaining mechanistic details of likely interstellar chemical reactions. In many cases, matrix isolation techniques are the sole method of studying such reactions; also in many cases, complexations and bond rearrangements yield molecules never before observed. The study of these reactions thus provides a logical basis for the mechanisms of interstellar reactions. A list of reactions is presented that would simulate interstellar chemical reactions. These reactions were studied using FTIR-matrix isolation techniques.

Fabrication method, structure, mechanical, and biological properties of decellularized extracellular matrix for replacement of wide bone tissue defects.

PubMed

Anisimova, N Y; Kiselevsky, M V; Sukhorukova, I V; Shvindina, N V; Shtansky, D V

2015-09-01

The present paper was focused on the development of a new method of decellularized extracellular matrix (DECM) fabrication via a chemical treatment of a native bone tissue. Particular attention was paid to the influence of chemical treatment on the mechanical properties of native bones, sterility, and biological performance in vivo using the syngeneic heterotopic and orthotopic implantation models. The obtained data indicated that after a chemical decellularization treatment in 4% aqueous sodium chlorite, no noticeable signs of the erosion of compact cortical bone surface or destruction of trabeculae of spongy bone in spinal channel were observed. The histological studies showed that the chemical treatment resulted in the decellularization of both bone and cartilage tissues. The DECM samples demonstrated no signs of chemical and biological degradation in vivo. Thorough structural characterization revealed that after decellularization, the mineral frame retained its integrity with the organic phase; however clotting and destruction of organic molecules and fibers were observed. FTIR studies revealed several structural changes associated with the destruction of organic molecules, although all organic components typical of intact bone were preserved. The decellularization-induced structural changes in the collagen constituent resulted changed the deformation under compression mechanism: from the major fracture by crack propagation throughout the sample to the predominantly brittle fracture. Although the mechanical properties of radius bones subjected to decellularization were observed to degrade, the mechanical properties of ulna bones in compression and humerus bones in bending remained unchanged. The compressive strength of both the intact and decellularized ulna bones was 125-130 MPa and the flexural strength of humerus bones was 156 and 145 MPa for the intact and decellularized samples, respectively. These results open new avenues for the use of DECM samples as the replacement of wide bone tissue defects. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biological functionality and mechanistic contribution of extracellular matrix-ornamented three dimensional Ti-6Al-4V mesh scaffolds.

PubMed

Kumar, A; Nune, K C; Misra, R D K

2016-11-01

The 3D printed metallic implants are considered bioinert in nature because of the absence of bioactive molecules. Thus, surface modification of bioinert materials is expected to favorably promote osteoblast functions and differentiation. In this context, the objective of this study is to fundamentally elucidate the effect of cell-derived decellularized extracellular matrix (dECM) ornamented 3D printed Ti-6Al-4V scaffolds on biological functions, involving cell adhesion, proliferation, and synthesis of vinculin and actin proteins. To mimic the natural ECM environment, the mineralized ECM of osteoblasts was deposited on the Ti-6Al-4V porous scaffolds, fabricated by electron beam melting (EBM) method. The process comprised of osteoblast proliferation, differentiation, and freeze-thaw cycles to obtain decellularized extra cellular matrix (dECM), in vitro. The dECM provided a natural environment to restore the natural cell functionality of osteoblasts that were cultured on dECM ornamented Ti-6Al-4V scaffolds. In comparison to the bare Ti-6Al-4V scaffolds, a higher cell functionality such as cell adhesion, proliferation, and growth including cell-cell and cell-material interaction were observed on dECM ornamented Ti-6Al-4V scaffolds, which were characterized by using markers for focal adhesion and cytoskeleton such as vinculin and actin. Moreover, electron microscopy also indicated higher cell-material interaction and enhanced proliferation of cells on dECM ornamented Ti-6Al-4V scaffolds, supported by MTT assay. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2751-2763, 2016. © 2016 Wiley Periodicals, Inc.

[Carbon fiber-reinforced plastics as implant materials].

PubMed

Bader, R; Steinhauser, E; Rechl, H; Siebels, W; Mittelmeier, W; Gradinger, R

2003-01-01

Carbon fiber-reinforced plastics have been used clinically as an implant material for different applications for over 20 years.A review of technical basics of the composite materials (carbon fibers and matrix systems), fields of application,advantages (e.g., postoperative visualization without distortion in computed and magnetic resonance tomography), and disadvantages with use as an implant material is given. The question of the biocompatibility of carbon fiber-reinforced plastics is discussed on the basis of experimental and clinical studies. Selected implant systems made of carbon composite materials for treatments in orthopedic surgery such as joint replacement, tumor surgery, and spinal operations are presented and assessed. Present applications for carbon fiber reinforced plastics are seen in the field of spinal surgery, both as cages for interbody fusion and vertebral body replacement.

The ab-initio density matrix renormalization group in practice.

PubMed

Olivares-Amaya, Roberto; Hu, Weifeng; Nakatani, Naoki; Sharma, Sandeep; Yang, Jun; Chan, Garnet Kin-Lic

2015-01-21

The ab-initio density matrix renormalization group (DMRG) is a tool that can be applied to a wide variety of interesting problems in quantum chemistry. Here, we examine the density matrix renormalization group from the vantage point of the quantum chemistry user. What kinds of problems is the DMRG well-suited to? What are the largest systems that can be treated at practical cost? What sort of accuracies can be obtained, and how do we reason about the computational difficulty in different molecules? By examining a diverse benchmark set of molecules: π-electron systems, benchmark main-group and transition metal dimers, and the Mn-oxo-salen and Fe-porphine organometallic compounds, we provide some answers to these questions, and show how the density matrix renormalization group is used in practice.

Large scale nanoparticle screening for small molecule analysis in laser desorption ionization mass spectrometry

DOE PAGES

Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.; ...

2016-08-30

Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less

Large scale nanoparticle screening for small molecule analysis in laser desorption ionization mass spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.

Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less

The cell clone ecology hypothesis and the cell fusion model of cancer progression and metastasis (II): three pathways for spontaneous cell-cell fusion and escape from the intercellular matrix.

PubMed

Parris, George

2006-01-01

The two-stage initiation-progression model of cancer is widely accepted. Initiation appears to result most often from accumulation of damage to the DNA expressed as multiple mutations in the phenotype. Unsymmetrical chromosome segregation during mitosis of normal or mutated cells produces aneuploid cells and also contributes to the evolution of neoplasia. However, it has been pointed out (Parris GE. Med Hypotheses 2005;65:993-4 and 2006;66:76-83) that DNA damage and loss of chromosomes are much more likely to lead the mutant clones of cells to extinction than to successful expansion (e.g., an example of Muller's Ratchet). It was argued that aneuploid neoplasia represent new parasite species that successfully evolve to devour their hosts by incorporating sex-like redistribution of chromosomes through spontaneous or virus-catalyzed cell-cell fusion into their life-cycle. Spontaneous cell-cell fusion is generally blocked by the intercellular matrix to which the cells are bound via surface adhesion molecules (frequently glycoproteins, e.g., CD44). In order for progression of matrix-contained neoplasia toward clinically significant cancer to occur, the parasite cells must escape from the matrix and fuse. Release from the matrix also allows the parasite cells to invade adjacent tissues and metastasize to remote locations. Both invasion and metastasis likely involve fusion of the migrating parasite cells with fusion-prone blast cells. There are at least three pathways through which parasite cells can be liberated from the confining matrix: (i) Their adhesion molecules may be modified (e.g., by hyper-glycosylation) so that they can no longer grip the matrix. (ii) Their adhesion molecules or matrix may be saturated with other ligands (e.g., polyamines). (iii) Their adhesion molecules may be cleaved from the cell surface or the matrix itself may be cleaved (e.g., by MMPs or ADAMs). It is hypothesized that mobilization of parasite cells and cell-cell fusion go hand-in-hand in the progression of neoplasia to clinically significant cancer through invasion and metastasis. The latency between tumor recognition and exposure to mutagens and the increased incidence of cancer with age can probably be related to slow breakdown of the intercellular matrix that provides a barrier to cell-cell fusion.

Nano-scale phase transformation in Ti-implanted austenitic 301 stainless steel.

PubMed

Gustiono, Dwi; Sakaguchi, Norihito; Shibayama, Tamaki; Kinoshita, Hiroshi; Takahashi, Heishichiro

2003-01-01

Phase-transformation behaviours were investigated for austenitic 301 stainless steel during implantation at room temperature with 300 keV Ti ions to fluences of 8 x 10(19) to approximately 3 x 10(21) ions m(-2) by means of transmission electron microscopy. The cross-sectional specimen was prepared using a focused ion beam. Plan observation of the implanted specimen showed that phase transformation from gamma-phase to alpha-phase was induced by implantation to a fluence of 3 x 10(20) Ti ions m(-2). The nucleation of the irradiation (implantation)-induced phase increased with the increase of the dose. The orientation relationship between the gamma matrix and the induced alpha martensitic phase was identified as (011)alpha//(111)gamma and [11-1]alpha//[10-1], close to the Kurdjumov-Sachs relationship. Cross-sectional observation after implantation to a fluence of 5 x 10(20) ions m(-2) showed that phase transformation mostly nucleated near the surface and occurred in the higher the concentration gradient of the implanted ion, i.e. a higher stress concentration takes place and this stress introduced by the implanted ions acts as a driving force for the transformation.

An Autologous Bone Marrow Mesenchymal Stem Cell–Derived Extracellular Matrix Scaffold Applied with Bone Marrow Stimulation for Cartilage Repair

PubMed Central

Tang, Cheng; Jin, Chengzhe; Du, Xiaotao; Yan, Chao; Min, Byoung-Hyun; Xu, Yan

2014-01-01

Purpose: It is well known that implanting a bioactive scaffold into a cartilage defect site can enhance cartilage repair after bone marrow stimulation (BMS). However, most of the current scaffolds are derived from xenogenous tissue and/or artificial polymers. The implantation of these scaffolds adds risks of pathogen transmission, undesirable inflammation, and other immunological reactions, as well as ethical issues in clinical practice. The current study was undertaken to evaluate the effectiveness of implanting autologous bone marrow mesenchymal stem cell–derived extracellular matrix (aBMSC-dECM) scaffolds after BMS for cartilage repair. Methods: Full osteochondral defects were performed on the trochlear groove of both knees in 24 rabbits. One group underwent BMS only in the right knee (the BMS group), and the other group was treated by implantation of the aBMSC-dECM scaffold after BMS in the left knee (the aBMSC-dECM scaffold group). Results: Better repair of cartilage defects was observed in the aBMSC-dECM scaffold group than in the BMS group according to gross observation, histological assessments, immunohistochemistry, and chemical assay. The glycosaminoglycan and DNA content, the distribution of proteoglycan, and the distribution and arrangement of type II and I collagen fibers in the repaired tissue in the aBMSC-dECM scaffold group at 12 weeks after surgery were similar to that surrounding normal hyaline cartilage. Conclusions: Implanting aBMSC-dECM scaffolds can enhance the therapeutic effect of BMS on articular cartilage repair, and this combination treatment is a potential method for successful articular cartilage repair. PMID:24666429

Implantation of silicon dioxide-based nanocrystalline hydroxyapatite and pure phase beta-tricalciumphosphate bone substitute granules in caprine muscle tissue does not induce new bone formation

PubMed Central

2013-01-01

Background Osteoinductive bone substitutes are defined by their ability to induce new bone formation even at heterotopic implantation sites. The present study was designed to analyze the potential osteoinductivity of two different bone substitute materials in caprine muscle tissue. Materials and methods One gram each of either a porous beta-tricalcium phosphate (β-TCP) or an hydroxyapatite/silicon dioxide (HA/SiO2)-based nanocrystalline bone substitute material was implanted in several muscle pouches of goats. The biomaterials were explanted at 29, 91 and 181 days after implantation. Conventional histology and special histochemical stains were performed to detect osteoblast precursor cells as well as mineralized and unmineralized bone matrix. Results Both materials underwent cellular degradation in which tartrate-resistant acid phosphatase (TRAP)-positive osteoclast-like cells and TRAP-negative multinucleated giant cells were involved. The ß-TCP was completely resorbed within the observation period, whereas some granules of the HA-groups were still detectable after 180 days. Neither osteoblasts, osteoblast precursor cells nor extracellular bone matrix were found within the implantation bed of any of the analyzed biomaterials at any of the observed time points. Conclusions This study showed that ß-TCP underwent a faster degradation than the HA-based material. The lack of osteoinductivity for both materials might be due to their granular shape, as osteoinductivity in goat muscle has been mainly attributed to cylindrical or disc-shaped bone substitute materials. This hypothesis however requires further investigation to systematically analyze various materials with comparable characteristics in the same experimental setting. PMID:23286366

Implantation of silicon dioxide-based nanocrystalline hydroxyapatite and pure phase beta-tricalciumphosphate bone substitute granules in caprine muscle tissue does not induce new bone formation.

PubMed

Ghanaati, Shahram; Udeabor, Samuel E; Barbeck, Mike; Willershausen, Ines; Kuenzel, Oliver; Sader, Robert A; Kirkpatrick, C James

2013-01-04

Osteoinductive bone substitutes are defined by their ability to induce new bone formation even at heterotopic implantation sites. The present study was designed to analyze the potential osteoinductivity of two different bone substitute materials in caprine muscle tissue. One gram each of either a porous beta-tricalcium phosphate (β-TCP) or an hydroxyapatite/silicon dioxide (HA/SiO2)-based nanocrystalline bone substitute material was implanted in several muscle pouches of goats. The biomaterials were explanted at 29, 91 and 181 days after implantation. Conventional histology and special histochemical stains were performed to detect osteoblast precursor cells as well as mineralized and unmineralized bone matrix. Both materials underwent cellular degradation in which tartrate-resistant acid phosphatase (TRAP)-positive osteoclast-like cells and TRAP-negative multinucleated giant cells were involved. The ß-TCP was completely resorbed within the observation period, whereas some granules of the HA-groups were still detectable after 180 days. Neither osteoblasts, osteoblast precursor cells nor extracellular bone matrix were found within the implantation bed of any of the analyzed biomaterials at any of the observed time points. This study showed that ß-TCP underwent a faster degradation than the HA-based material. The lack of osteoinductivity for both materials might be due to their granular shape, as osteoinductivity in goat muscle has been mainly attributed to cylindrical or disc-shaped bone substitute materials. This hypothesis however requires further investigation to systematically analyze various materials with comparable characteristics in the same experimental setting.

Expression of adhesion molecules, chemokines and matrix metallo- proteinases (MMPs) in viable and degenerating stage of Taenia solium metacestode in swine neurocysticercosis.

PubMed

Singh, Satyendra K; Singh, Aloukick K; Prasad, Kashi N; Singh, Amrita; Singh, Avinash; Rai, Ravi P; Tripathi, Mukesh; Gupta, Rakesh K; Husain, Nuzhat

2015-11-30

Neurocysticercosis (NCC) is a parasitic infection of central nervous system (CNS). Expression of adhesion molecules, chemokines and matrix metalloproteinases (MMPs) were investigated on brain tissues surrounding viable (n=15) and degenerating cysticerci (n=15) of Taenia solium in swine by real-time RT-PCR and ELISA. Gelatin gel zymography was performed for MMPs activity. ICAM-1 (intercellular adhesion molecule-1), E-selectin, MIP-1α (macrophage inflammatory protein-1α), Eotaxin-1 and RANTES (regulated on activation, normal T cell expressed and secreted) were associated with degenerating cysticerci (cysts). However, VCAM-1 (vascular cell adhesion molecule-1), MCP-1 (monocyte chemotactic protein-1), MMP-2 and MMP-9 were associated with both viable and degenerating cysts. In conclusion, viable and degenerating cysticerci have different immune molecule profiles and role of these molecules in disease pathogenesis needs to be investigated. Copyright © 2015 Elsevier B.V. All rights reserved.

Helium in inert matrix dispersion fuels

NASA Astrophysics Data System (ADS)

van Veen, A.; Konings, R. J. M.; Fedorov, A. V.

2003-07-01

The behaviour of helium, an important decay product in the transmutation chains of actinides, in dispersion-type inert matrix fuels is discussed. A phenomenological description of its accumulation and release in CERCER and CERMET fuel is given. A summary of recent He-implantation studies with inert matrix metal oxides (ZrO 2, MgAl 2O 4, MgO and Al 2O 3) is presented. A general picture is that for high helium concentrations helium and vacancy defects form helium clusters which convert into over-pressurized bubbles. At elevated temperature helium is released from the bubbles. On some occasions thermal stable nano-cavities or nano-pores remain. On the basis of these results the consequences for helium induced swelling and helium storage in oxide matrices kept at 800-1000 °C will be discussed. In addition, results of He-implantation studies for metal matrices (W, Mo, Nb and V alloys) will be presented. Introduction of helium in metals at elevated temperatures leads to clustering of helium to bubbles. When operational temperatures are higher than 0.5 melting temperature, swelling and helium embrittlement might occur.

Expansion and melting of Xe nanocrystals in Si

NASA Astrophysics Data System (ADS)

Faraci, Giuseppe; Pennisi, Agata R.; Zontone, Federico; Li, Boquan; Petrov, Ivan

2006-12-01

Xe agglomerates confined in a Si matrix by ion implantation were synthesized with different size depending on the implantation process and/or the thermal treatment. At low temperature Xe nanocrystals are formed, whose expansion and melting were studied in the range 15- 300K . Previous high resolution x-ray diffraction spectra were corroborated with complementary techniques such as two-dimensional imaging plate patterns and transmission electron microscopy. We detected fcc Xe nanocrystals whose properties were size dependent. The experiments showed that in annealed samples epitaxial condensation of small Xe clusters, on the cavities of the Si matrix, gave in fact expanded and oriented Xe, suggesting a possible preferential growth of Xe(311) planes oriented orthogonally to the Si[02-2] direction. On the contrary, small Xe clusters in an amorphous Si matrix have a fcc lattice contracted as a consequence of surface tension. Furthermore, a solid-to-liquid phase transition size dependent was found. Expansion of fcc Xe lattice was accurately determined as a function of the temperature. Overpressurized nanocrystals and/or binary size distributions were disproved.

Repair of traumatic skeletal muscle injury with bone-marrow-derived mesenchymal stem cells seeded on extracellular matrix.

PubMed

Merritt, Edward K; Cannon, Megan V; Hammers, David W; Le, Long N; Gokhale, Rohit; Sarathy, Apurva; Song, Tae J; Tierney, Matthew T; Suggs, Laura J; Walters, Thomas J; Farrar, Roger P

2010-09-01

Skeletal muscle injury resulting in tissue loss poses unique challenges for surgical repair. Despite the regenerative potential of skeletal muscle, if a significant amount of tissue is lost, skeletal myofibers will not grow to fill the injured area completely. Prior work in our lab has shown the potential to fill the void with an extracellular matrix (ECM) scaffold, resulting in restoration of morphology, but not functional recovery. To improve the functional outcome of the injured muscle, a muscle-derived ECM was implanted into a 1 x 1 cm(2), full-thickness defect in the lateral gastrocnemius (LGAS) of Lewis rats. Seven days later, bone-marrow-derived mesenchymal stem cells (MSCs) were injected directly into the implanted ECM. Partial functional recovery occurred over the course of 42 days when the LGAS was repaired with an MSC-seeded ECM producing 85.4 +/- 3.6% of the contralateral LGAS. This was significantly higher than earlier recovery time points (p < 0.05). The specific tension returned to 94 +/- 9% of the contralateral limb. The implanted MSC-seeded ECM had more blood vessels and regenerating skeletal myofibers than the ECM without cells (p < 0.05). The data suggest that the repair of a skeletal muscle defect injury by the implantation of a muscle-derived ECM seeded with MSCs can improve functional recovery after 42 days.

[Morphology of collagen matrices for tissue engineering (biocompatibility, biodegradation, tissue response)].

PubMed

Shekhter, A B; Guller, A E; Istranov, L P; Istranova, E V; Butnaru, D V; Vinarov, A Z; Zakharkina, O L; Kurkov, A V; Kantimerov, D F; Antonov, E N; Marisov, L V; Glybochko, P V

2015-01-01

to perform a comparative morphological study of biocompatibility, biodegradation, and tissue response to implantation of collagen matrices (scaffolds) for tissue engineering in urology and other areas of medicine. Nine matrix types, such as porous materials reconstructed from collagen solution; a collagen sponge-vicryl mesh composite; decellularized and freeze-dried bovine, equine, and fish dermis; small intestinal submucosa, decellularized bovine dura mater; and decellularized human femoral artery, were implanted subcutaneously in 225 rats. The tissues at the implantation site were investigated for a period of 5 to 90 days. Classical histology and nonlinear optical microscopy (NLOM) were applied. The investigations showed no rejection of all the collagen materials. The period of matrix bioresorption varied from 10 days for collagen sponges to 2 months for decellularized and freeze-dried vessels and vicryl meshes. Collagen was prone to macrophage resorption and enzymatic lysis, being replaced by granulation tissue and then fibrous tissue, followed by its involution. NLOM allowed the investigators to study the number, density, interposition, and spatial organization of collagen structures in the matrices and adjacent tissues, and their change over time during implantation. The performed investigation could recommend three matrices: hybrid collagen/vicryl composite; decellularized bovine dermis; and decellularized porcine small intestinal submucosa, which are most adequate for tissue engineering in urology. These and other collagen matrices may be used in different areas of regenerative medicine.

Histological Comparison in Rats between Carbonate Apatite Fabricated from Gypsum and Sintered Hydroxyapatite on Bone Remodeling

PubMed Central

Ayukawa, Yasunori; Suzuki, Yumiko; Tsuru, Kanji; Koyano, Kiyoshi; Ishikawa, Kunio

2015-01-01

Carbonate apatite (CO3Ap), the form of apatite found in bone, has recently attracted attention. The purpose of the present study was to histologically evaluate the tissue/cellular response toward the low-crystalline CO3Ap fabricated using a dissolution-precipitation reaction with set gypsum as a precursor. When set gypsum was immersed in a 100°C 1 mol/L Na3PO4 aqueous solution for 24 h, the set gypsum transformed into CO3Ap. Both CO3Ap and sintered hydroxyapatite (s-HAp), which was used as a control, were implanted into surgically created tibial bone defects of rats for histological evaluation. Two and 4 weeks after the implantation, histological sections were created and observed using light microscopy. The CO3Ap granules revealed both direct apposition of the bone matrix by osteoblasts and osteoclastic resorption. In contrast, the s-HAp granules maintained their contour even after 4 weeks following implantation which implied that there was a lack of replacement into the bone. The s-HAp granules were sometimes encapsulated with fibrous tissue, and macrophage polykaryon was occasionally observed directly apposed to the implanted granules. From the viewpoint of bone remodeling, the CO3Ap granules mimicked the bone matrix, suggesting that CO3Ap may be an appropriate bone substitute. PMID:26504813

Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.

PubMed

Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K

2007-01-01

Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.

CO2 in solid para-hydrogen: spectral splitting and the CO2···(o-H2)n clusters.

PubMed

Du, Jun-He; Wan, Lei; Wu, Lei; Xu, Gang; Deng, Wen-Ping; Liu, An-Wen; Chen, Yang; Hu, Shui-Ming

2011-02-17

Complicated high-resolution spectral structures are often observed for molecules doped in solid molecular hydrogen. The structures can result from miscellaneous effects and are often interpreted differently in references. The spectrum of the ν(3) band of CO(2) in solid para-H(2) presents a model system which exhibits rich spectral structures. With the help of the potential energy simulation of the CO(2) molecule doped in para-hydrogen matrix, and extensive experiments with different CO(2) isotopologues and different ortho-hydrogen concentrations in the matrix, the spectral features observed in p-H(2) matrix are assigned to the CO(2)···(o-H(2))(n) clusters and also to energy level splitting that is due to different alignments of the doped CO(2) molecules in the matrix. The assignments are further supported by the dynamics analysis and also by the spectrum recorded with sample codoped with O(2) which serves as catalyst transferring o-H(2) to p-H(2) in the matrix at 4 K temperature. The observed spectral features of CO(2)/pH(2) can potentially be used as an alternative readout of the temperature and orthohydrogen concentration in the solid para-hydrogen.

Immediate direct-to-implant breast reconstruction using anatomical implants.

PubMed

Kim, Sung-Eun; Jung, Dong-Woo; Chung, Kyu-Jin; Lee, Jun Ho; Kim, Tae Gon; Kim, Yong-Ha; Lee, Soo Jung; Kang, Su Hwan; Choi, Jung Eun

2014-09-01

In 2012, a new anatomic breast implant of form-stable silicone gel was introduced onto the Korean market. The intended use of this implant is in the area of aesthetic breast surgery, and many reports are promising. Thus far, however, there have been no reports on the use of this implant for breast reconstruction in Korea. We used this breast implant in breast reconstruction surgery and report our early experience. From November 2012 to April 2013, the Natrelle Style 410 form-stable anatomically shaped cohesive silicone gel-filled breast implant was used in 31 breasts of 30 patients for implant breast reconstruction with an acellular dermal matrix. Patients were treated with skin-sparing mastectomies followed by immediate breast reconstruction. The mean breast resection volume was 240 mL (range, 83-540 mL). The mean size of the breast implants was 217 mL (range, 125-395 mL). Breast shape outcomes were considered acceptable. Infection and skin thinning occurred in one patient each, and hematoma and seroma did not occur. Three cases of wound dehiscence occurred, one requiring surgical intervention, while the others healed with conservative treatment in one month. Rippling did not occur. So far, complications such as capsular contracture and malrotation of breast implant have not yet arisen. By using anatomic breast implants in breast reconstruction, we achieved satisfactory results with aesthetics better than those obtained with round breast implants. Therefore, we concluded that the anatomical implant is suitable for breast reconstruction.

Altered extracellular matrix remodeling and angiogenesis in sponge granulomas of thrombospondin 2-null mice.

PubMed

Kyriakides, T R; Zhu, Y H; Yang, Z; Huynh, G; Bornstein, P

2001-10-01

The matricellular angiogenesis inhibitor, thrombospondin (TSP) 2, has been shown to be an important modulator of wound healing and the foreign body response. Specifically, TSP2-null mice display improved healing with minimal scarring and form well-vascularized foreign body capsules. In this study we performed subcutaneous implantation of sponges and investigated the resulting angiogenic and fibrogenic responses. Histological and immunohistochemical analysis of sponges, excised at 7, 14, and 21 days after implantation, revealed significant differences between TSP2-null and wild-type mice. Most notably, TSP2-null mice exhibited increased angiogenesis and fibrotic encapsulation of the sponge. However, invasion of dense tissue was compromised, even though its overall density was increased. Furthermore, histomorphometry and biochemical assays demonstrated a significant increase in the extracellular distribution of matrix metalloproteinase (MMP) 2, but no change in the levels of active transforming growth factor-beta(1). The alterations in neovascularization, dense tissue invasion, and MMP2 in TSP2-null mice coincided with the deposition of TSP2 in the extracellular matrix of wild-type animals. These observations support the proposed role of TSP2 as a modulator of angiogenesis and matrix remodeling during tissue repair. In addition, they provide in vivo evidence for a newly proposed function of TSP2 as a modulator of extracellular MMP2 levels.

Laser-Sintered Constructs with Bio-inspired Porosity and Surface Micro/Nano-Roughness Enhance Mesenchymal Stem Cell Differentiation and Matrix Mineralization In Vitro.

PubMed

Cheng, Alice; Cohen, David J; Boyan, Barbara D; Schwartz, Zvi

2016-12-01

Direct metal laser sintering can produce porous Ti-6Al-4V orthopedic and dental implants. The process requires reduced resources and time and can provide greater structural control than machine manufacturing. Implants in bone are colonized by mesenchymal stem cells (MSCs), which can differentiate into osteoblasts and contribute to osseointegration. This study examined osteoblast differentiation and matrix mineralization of human MSCs cultured on laser-sintered Ti-6Al-4V constructs with varying porosity and at different time scales. 2D solid disks and low, medium and high porosity (LP, MP, and HP) 3D constructs based on a human trabecular bone template were laser sintered from Ti-6Al-4V powder and further processed to have micro- and nanoscale roughness. hMSCs exhibited greater osteoblastic differentiation and local factor production on all 3D porous constructs compared to 2D surfaces, which was sustained for 9 days without use of exogenous factors. hMSCs cultured for 8 weeks on MP constructs in osteogenic medium (OM), OM supplemented with BMP2 or collagen-coated MP constructs in OM exhibited bone-like extracellular matrix mineralization. Use of bio-inspired porosity for the 3D architecture of additively manufactured Ti-6Al-4V enhanced osteogenic differentiation of hMSCs beyond surface roughness alone. This study suggests that a 3D architecture may enhance the osseointegration of orthopedic and dental implants in vivo.

Influence of defect dimensions on periodontal wound healing/regeneration in intrabony defects following implantation of a bovine bone biomaterial and provisions for guided tissue regeneration: an experimental study in the dog.

PubMed

Stavropoulos, Andreas; Wikesjö, Ulf M E

2010-06-01

To evaluate the influence of defect dimensions on periodontal wound healing/regeneration in intrabony defects following implantation of a deproteinized bovine bone/collagen matrix under provisions for guided tissue regeneration. Contra-lateral one-wall intrabony [6 x 6 mm (wide/deep) versus 4 x 4 mm (narrow/shallow)] periodontal defects were surgically created at the edentulated mesial aspect of the mandibular first molars in three Labradors, i.e., three defects in each category. The defects were implanted with the bovine bone/collagen matrix and covered with a collagen membrane. Histologic/histometric analysis followed an 18-month healing interval. New cementum encompassed the entire intrabony component in both wide/deep (5.6 +/- 0.5 mm) and narrow/shallow (4.2 +/- 0.1 mm) defects; bone formation amounted to 5.6 +/- 0.6 and 4.0 +/- 0.8 mm, respectively. Mineralized bone encompassed 57.5%versus 65% and the bone biomaterial 11.6%versus 13.1% of the defect space. A periodontal ligament with a width and composition similar to that of the resident periodontal ligament encompassing the entire aspect of the defects was observed. Root resorption/ankylosis was rare. Both wide/deep and narrow/shallow intrabony defects showed a substantial potential for periodontal regeneration in this pre-clinical model. The contribution of the bovine bone/collagen matrix and guided tissue regeneration to this regenerative potential is not clear.

Antimicrobial photodynamic therapy (aPDT) induction of biofilm matrix architectural and bioadhesive modifications.

PubMed

Mang, Thomas; Rogers, Stephen; Keinan, David; Honma, Kiyonobu; Baier, Robert

2016-03-01

Dental implants are commonly used today for the treatment of partially and fully edentulous patients. Despite the high success rate they are not resistant to complications and failure due to a variety of problems including peri-implantitis or peri-mucositis due to bacterial biofilm formation on the implant surface. The use of non-surgical and surgical treatment procedure to promote healing in cases with peri-implantitis have limited efficacy. Here we studied the ability of photodynamic therapy to destroy a known bacterial pathogen and the extracellular matrix architecture of biofilm attached to titanium plates and germanium prisms. Titanium plates or germanium prisms were incubated for 24h with Fusobacterium nucleatum a fusiform, gram-negative bacterium was used to enable biofilm formation. Photodynamic therapy was carried out by incubating the biofilm samples on each substrata with porfimer sodium. Treatment was carried out using a diode laser at 630nm, 150mW/cm(2) for light doses ranging from 25-100J/cm(2). Evaluation of killing efficacy was done by counting colony forming units compared to controls. Multiple attenuated internal reflection-infrared spectroscopy (MAIR-IR) and SEM were used to analyze the samples pre and post PDT for validation. F. nucleatum was significantly reduced in a dose dependent manner by treatment with PDT. Changes in biofilm components and strength of bioadhesion were examined with MAIR-IR following jet impingement using calibrated water jets. SEM demonstrates significant morphological alterations in the bacteria, consistent with damage associated with exposure to reactive oxygen species. The results are indicative that aPDT is a method that can be used to eradicate micro-organisms associated with biofilm in peri-implantitis on relevant substrata. Data shows that the slime layer of the biofilm is removed and that further methods need to be employed to completely remove weakened or destroyed biofilm matrix components. Reactive oxygen species (ROS) mediated oxidative damage results in morphologic changes as a consequence of changes in cell membrane integrity. Copyright © 2015 Elsevier B.V. All rights reserved.

Mesenchymal stem cell-derived extracellular matrix enhances chondrogenic phenotype of and cartilage formation by encapsulated chondrocytes in vitro and in vivo.

PubMed

Yang, Yuanheng; Lin, Hang; Shen, He; Wang, Bing; Lei, Guanghua; Tuan, Rocky S

2018-03-15

Mesenchymal stem cell derived extracellular matrix (MSC-ECM) is a natural biomaterial with robust bioactivity and good biocompatibility, and has been studied as a scaffold for tissue engineering. In this investigation, we tested the applicability of using decellularized human bone marrow derived MSC-ECM (hBMSC-ECM) as a culture substrate for chondrocyte expansion in vitro, as well as a scaffold for chondrocyte-based cartilage repair. hBMSC-ECM deposited by hBMSCs cultured on tissue culture plastic (TCP) was harvested, and then subjected to a decellularization process to remove hBMSCs. Compared with chondrocytes grown on TCP, chondrocytes seeded onto hBMSC-ECM exhibited significantly increased proliferation rate, and maintained better chondrocytic phenotype than TCP group. After being expanded to the same cell number and placed in high-density micromass cultures, chondrocytes from the ECM group showed better chondrogenic differentiation profile than those from the TCP group. To test cartilage formation ability, composites of hBMSC-ECM impregnated with chondrocytes were subjected to brief trypsin treatment to allow cell-mediated contraction, and folded to form 3-dimensional chondrocyte-impregnated hBMSC-ECM (Cell/ECM constructs). Upon culture in vitro in chondrogenic medium for 21 days, robust cartilage formation was observed in the Cell/ECM constructs. Similarly prepared Cell/ECM constructs were tested in vivo by subcutaneous implantation into SCID mice. Prominent cartilage formation was observed in the implanted Cell/ECM constructs 14 days post-implantation, with higher sGAG deposition compared to controls consisting of chondrocyte cell sheets. Taken together, these findings demonstrate that hBMSC-ECM is a superior culture substrate for chondrocyte expansion and a bioactive matrix potentially applicable for cartilage regeneration in vivo. Current cell-based treatments for focal cartilage defects face challenges, including chondrocyte dedifferentiation, need for xenogenic scaffolds, and suboptimal cartilage formation. We present here a novel technique that utilizes adult stem cell-derived extracellular matrix, as a culture substrate and/or encapsulation scaffold for human adult chondrocytes, for the repair of cartilage defects. Chondrocytes cultured in stem cell-derived matrix showed higher proliferation, better chondrocytic phenotype, and improved redifferentiation ability upon in vitro culture expansion. Most importantly, 3-dimensional constructs formed from chondrocytes folded within stem cell matrix manifested excellent cartilage formation both in vitro and in vivo. These findings demonstrate the suitability of stem cell-derived extracellular matrix as a culture substrate for chondrocyte expansion as well as a candidate bioactive matrix for cartilage regeneration. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Experimental and theoretical studies of implant assisted magnetic drug targeting

NASA Astrophysics Data System (ADS)

Aviles, Misael O.

One way to achieve drug targeting in the body is to incorporate magnetic nanoparticles into drug carriers and then retain them at the site using an externally applied magnetic field. This process is referred to as magnetic drug targeting (MDT). However, the main limitation of MDT is that an externally applied magnetic field alone may not be able to retain a sufficient number of magnetic drug carrier particles (MDCPs) to justify its use. Such a limitation might not exist when high gradient magnetic separation (HGMS) principles are applied to assist MDT by means of ferromagnetic implants. It was hypothesized that an Implant Assisted -- MDT (IA-MDT) system would increase the retention of the MDCPs at a target site where an implant had been previously located, since the magnetic forces are produced internally. With this in mind, the overall objective of this work was to demonstrate the feasibility of an IA-MDT system through mathematical modeling and in vitro experimentation. The mathematical models were developed and used to demonstrate the behavior and limitations of IA-MDT, and the in vitro experiments were designed and used to validate the models and to further elucidate the important parameters that affect the performance of the system. IA-MDT was studied with three plausible implants, ferromagnetic stents, seed particles, and wires. All implants were studied theoretically and experimentally using flow through systems with polymer particles containing magnetite nanoparticles as MDCPs. In the stent studies, a wire coil or mesh was simply placed in a flow field and the capture of the MDCPs was studied. In the other cases, a porous polymer matrix was used as a surrogate capillary tissue scaffold to study the capture of the MDCPs using wires or particle seeds as the implant, with the seeds either fixed within the polymer matrix or captured prior to capturing the MDCPs. An in vitro heart tissue perfusion model was also used to study the use of stents. In general, all the results demonstrated that IA-MDT is indeed feasible and that careful modification of the MDCP properties and implant properties are fundamental to the success of this technology.

Surface-assisted laser desorption ionization mass spectrometry techniques for application in forensics.

PubMed

Guinan, Taryn; Kirkbride, Paul; Pigou, Paul E; Ronci, Maurizio; Kobus, Hilton; Voelcker, Nicolas H

2015-01-01

Matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) is an excellent analytical technique for the rapid and sensitive analysis of macromolecules (>700 Da), such as peptides, proteins, nucleic acids, and synthetic polymers. However, the detection of smaller organic molecules with masses below 700 Da using MALDI-MS is challenging due to the appearance of matrix adducts and matrix fragment peaks in the same spectral range. Recently, nanostructured substrates have been developed that facilitate matrix-free laser desorption ionization (LDI), contributing to an emerging analytical paradigm referred to as surface-assisted laser desorption ionization (SALDI) MS. Since SALDI enables the detection of small organic molecules, it is rapidly growing in popularity, including in the field of forensics. At the same time, SALDI also holds significant potential as a high throughput analytical tool in roadside, work place and athlete drug testing. In this review, we discuss recent advances in SALDI techniques such as desorption ionization on porous silicon (DIOS), nano-initiator mass spectrometry (NIMS) and nano assisted laser desorption ionization (NALDI™) and compare their strengths and weaknesses with particular focus on forensic applications. These include the detection of illicit drug molecules and their metabolites in biological matrices and small molecule detection from forensic samples including banknotes and fingerprints. Finally, the review highlights recent advances in mass spectrometry imaging (MSI) using SALDI techniques. © 2014 Wiley Periodicals, Inc.

High Matrix Metalloproteinase Activity is a Hallmark of Periapical Granulomas

PubMed Central

de Paula e Silva, Francisco Wanderley Garcia; D'Silva, Nisha J.; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine

2009-01-01

Introduction Inability to distinguish periapical cysts from granulomas prior to performing root canal treatment leads to uncertainty in treatment outcomes, because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Methods Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Since matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed using one-way ANOVA followed by Tukey test. Results We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the matrix metalloproteinase (MMP) family. Compared to cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs), in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared to cysts. Conclusion Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas, unlike periapical cysts. PMID:19720222

Light and transmission electron microscopy of the intact interfaces between non-submerged titanium-coated epoxy resin implants and bone or gingiva.

PubMed

Listgarten, M A; Buser, D; Steinemann, S G; Donath, K; Lang, N P; Weber, H P

1992-02-01

This experiment was aimed at studying the intact tissue/implant interface of non-submerged dental implants with a titanium surface. Epoxy-resin replicas were fabricated from 3.05 x 8 mm cylindrical titanium implants with a plasma-sprayed apical portion and a smooth coronal collar. The replicas were coated with a 90-120-nm-thick layer of pure titanium and autoclaved. The coated replicas were inserted as non-submerged endosseous implants in the edentulous premolar region of dog mandibles and allowed to heal for three months. Jaw sections containing the implants were processed for light and electron microscopic study of the intact tissue/implant interface with and without prior demineralization. Gingival connective tissue fibers were closely adapted to the titanium layer, in an orientation more or less parallel to the implant surface. There was no evidence of any fiber insertions into the surface irregularities of the smooth or rough titanium surface. Undemineralized bone was intimately adapted to the titanium surface without any intervening space. In demineralized sections, the collagen fibers of the bone matrix tended to be somewhat thinner and occasionally less densely packed in the vicinity of the implant surface. However, they extended all the way to the titanium surface, without any intervening fibril-free layer.

Enhanced antitumor efficacy of poly(D,L-lactide-co-glycolide)-based methotrexate-loaded implants on sarcoma 180 tumor-bearing mice

PubMed Central

Gao, Li; Xia, Lunyang; Zhang, Ruhui; Duan, Dandan; Liu, Xiuxiu; Xu, Jianjian; Luo, Lan

2017-01-01

Purpose Methotrexate is widely used in chemotherapy for a variety of malignancies. However, severe toxicity, poor pharmacokinetics, and narrow safety margin of methotrexate limit its clinical application. The aim of this study was to develop sustained-release methotrexate-loaded implants and evaluate antitumor activity of the implants after intratumoral implantation. Materials and methods We prepared the implants containing methotrexate, poly(D,L-lactide-co-glycolide), and polyethylene glycol 4000 with the melt-molding technique. The implants were characterized with regards to drug content, morphology, in vitro, and in vivo release profiles. Differential scanning calorimetry (DSC) and Fourier transform infrared spectroscopy (FTIR) were carried out to investigate the physicochemical properties of the implants. Furthermore, the antitumor activity of the implants was tested in a sarcoma 180 mouse model. Results The implants were prepared as solid rods. Scanning electron microscopy images showed a smooth surface of the implant, suggesting that methotrexate was homogeneously dispersed in the polymeric matrix. The results of DSC and FTIR indicated that no significant interaction between methotrexate and the polymer was observed in the implants. Both in vitro and in vivo release profiles of the implants were characterized by burst release followed by sustained release of methotrexate. Intratumoral implantation of methotrexate-loaded implants could efficiently delay tumor growth. Moreover, an increase in the dose of implants led to a higher tumor suppression rate without additional systemic toxicity. Conclusion These results demonstrate that methotrexate-loaded implants had significant antitumor efficacy in a sarcoma 180 mouse model without dose-limiting side effects, and suggest that the implants could be potentially applied as an intratumoral delivery system to treat cancer. PMID:29118572

Interventions for replacing missing teeth: management of soft tissues for dental implants.

PubMed

Esposito, Marco; Maghaireh, Hassan; Grusovin, Maria Gabriella; Ziounas, Ioannis; Worthington, Helen V

2012-02-15

Dental implants are usually placed by elevating a soft tissue flap, but in some instances, they can also be placed flapless reducing patient discomfort. Several flap designs and suturing techniques have been proposed. Soft tissues are often manipulated and augmented for aesthetic reasons. It is often recommended that implants are surrounded by a sufficient width of attached/keratinised mucosa to improve their long-term prognosis. To evaluate whether (1a) flapless procedures are beneficial for patients, and (1b) which is the ideal flap design; whether (2a) soft tissue correction/augmentation techniques are beneficial for patients, and (2b) which are the best techniques; whether (3a) techniques to increase the peri-implant keratinised mucosa are beneficial for patients, and (3b) which are the best techniques; and (4) which are the best suturing techniques/materials. The following electronic databases were searched: the Cochrane Oral Health Group Trials Register (to 9 June 2011), the Cochrane Central Register of Controlled Trials (CENTRAL) (The Cochrane Library 2011, Issue 2), MEDLINE via OVID (1950 to 9 June 2011), EMBASE via OVID (1980 to 9 June 2011). Several dental journals were handsearched. There were no language restrictions. All randomised controlled trials (RCTs) of root-form osseointegrated dental implants, with a follow-up of at least 6 months after function, comparing various techniques to handle soft tissues in relation to dental implants. Outcome measures, according to the different hypotheses, were: prosthetic and implant failures, biological complications, aesthetics evaluated by patients and dentists, postoperative pain, marginal peri-implant bone level changes on periapical radiographs, patient preference, ease of maintenance by patient, soft tissue thickness changes and attached/keratinised mucosa height changes. Screening of eligible studies, assessment of the methodological quality of the trials and data extraction were conducted at least in duplicate and independently by two or more review authors. Trial authors were contacted for missing information. Results were expressed using risk ratios for dichotomous outcomes and mean differences for continuous outcomes with 95% confidence intervals. Seventeen potentially eligible RCTs were identified but only six trials with 138 patients in total could be included. One study was at low risk of bias, two studies were judged to be at unclear risk of bias and three at high risk of bias. Two trials (56 patients) compared flapless placement of dental implants with conventional flap elevation, one trial (10 patients) compared crestal versus vestibular incisions, one trial (20 patients) Erbium:YAG laser versus flap elevation at the second-stage surgery for implant exposure, one split-mouth trial (10 patients) evaluated whether connective tissue graft at implant placement could be effective in augmenting peri-implant tissues, and one trial (40 patients) compared autograft with an animal-derived collagen matrix to increase the height of the keratinised mucosa. On a patient, rather than per implant basis, implants placed with a flapless technique and implant exposures performed with laser induced statistically significantly less postoperative pain than flap elevation. Sites augmented with soft tissues connective grafts showed a better aesthetic and thicker tissues. Both palatal autografts or the use of a porcine-derived collagen matrix are effective in increasing the height of keratinised mucosa at the price of a 0.5 mm recession of peri-implant soft tissues. There were no other statistically significant differences for any of the remaining analyses. There is limited weak evidence suggesting that flapless implant placement is feasible and has been shown to reduce patient postoperative discomfort in adequately selected patients, that augmentation at implant sites with soft tissue grafts is effective in increasing soft tissue thickness improving aesthetics and that one technique to increase the height of keratinised mucosa using autografts or an animal-derived collagen matrix was able to achieve its goal but at the price of a worsened aesthetic outcome (0.5 mm of recession). There is insufficient reliable evidence to provide recommendations on which is the ideal flap design, the best soft tissue augmentation technique, whether techniques to increase the width of keratinised/attached mucosa are beneficial to patients or not, and which are the best incision/suture techniques/materials. Properly designed and conducted RCTs, with at least 6 months of follow-up, are needed to provide reliable answers to these questions.

Second rank direction cosine spherical tensor operators and the nuclear electric quadrupole hyperfine structure Hamiltonian of rotating molecules

NASA Astrophysics Data System (ADS)

di Lauro, C.

2018-03-01

Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.

New insights into the roles of matrix metalloproteinases in colorectal cancer development and progression.

PubMed

Leeman, Matthew F; Curran, Stephanie; Murray, Graeme I

2003-12-01

This review outlines new concepts that are emerging for the functions of matrix metalloproteinases in colorectal cancer development and progression. The two main concepts that will be discussed are the role of matrix metalloproteinases in the early stages of colorectal tumour development and the functional mechanisms by which matrix metalloproteinases contribute to colorectal tumour invasion and metastasis. The matrix metalloproteinases are a group of enzymes, which have been best characterized for their ability to degrade extracellular matrix proteins and thus they have been extensively studied in tumour invasion. It is now becoming recognized that the matrix metalloproteinases have key roles in a variety of biological processes that are distinct from their well-defined role in matrix degradation. This group of enzymes has been shown to interact with a broad range of non-matrix proteins including growth factors and their receptors, mediators of apoptosis, and cell adhesion molecules. The elucidation of novel biological roles for the matrix metalloproteinases also challenges the current predominant concept of matrix metalloproteinases as enzymes only involved in matrix degradation. Recent studies have shown that several matrix metalloproteinases, especially matrilysin (MMP-7), interact with the specific molecular genetic and signalling pathways involved in colorectal cancer development. In particular, matrilysin is activated at an early stage of colorectal tumourigenesis by the beta-catenin signalling pathway. Furthermore, studies are now elucidating specific mechanisms by which individual matrix metalloproteinases, especially membrane-type matrix metalloproteinases, interact with specific cell adhesion molecules and cytoskeletal proteins and thus contribute dynamically to colorectal tumour invasion. Copyright 2003 John Wiley & Sons, Ltd.

Applying AFM-based nanofabrication for measuring the thickness of nanopatterns: the role of head groups in the vertical self-assembly of omega-functionalized n-alkanethiols.

PubMed

Kelley, Algernon T; Ngunjiri, Johnpeter N; Serem, Wilson K; Lawrence, Steve O; Yu, Jing-Jiang; Crowe, William E; Garno, Jayne C

2010-03-02

Molecules of n-alkanethiols with methyl head groups typically form well-ordered monolayers during solution self-assembly for a wide range of experimental conditions. However, we have consistently observed that, for either carboxylic acid or thiol-terminated n-alkanethiols, under certain conditions nanografted patterns are generated with a thickness corresponding precisely to a double layer. To investigate the role of head groups for solution self-assembly, designed patterns of omega-functionalized n-alkanethiols were nanografted with systematic changes in concentration. Nanografting is an in situ approach for writing patterns of thiolated molecules on gold surfaces by scanning with an AFM tip under high force, accomplished in dilute solutions of desired ink molecules. As the tip is scanned across the surface of a self-assembled monolayer under force, the matrix molecules are displaced from the surface and are immediately replaced with fresh molecules from solution to generate nanopatterns. In this report, side-by-side comparison of nanografted patterns is achieved for different matrix molecules using AFM images. The chain length and head groups (i.e., carboxyl, hydroxyl, methyl, thiol) were varied for the nanopatterns and matrix monolayers. Interactions such as head-to-head dimerization affect the vertical self-assembly of omega-functionalized n-alkanethiol molecules within nanografted patterns. At certain threshold concentrations, double layers were observed to form when nanografting with head groups of carboxylic acid and dithiols, whereas single layers were generated exclusively for nanografted patterns with methyl and hydroxyl groups, regardless of changes in concentration.

Penetration of analogues of H2O and CO2 in proteins studied by room temperature phosphorescence of tryptophan.

PubMed

Wright, W W; Owen, C S; Vanderkooi, J M

1992-07-21

The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)

Volatile element chemistry of selected lunar, meteoritic, and terrestrial samples

NASA Technical Reports Server (NTRS)

Simoneit, B. R.; Christiansen, P. C.; Burlingame, A. L.

1973-01-01

Using vacuum pyrolysis and high resolution mass spectrometry, a study is made of the gas release patterns of representative lunar samples, meteorites, terrestrial samples, and synthetic samples doped with various sources of carbon and nitrogen. The pyrolytic gas evolution patterns were intercorrelated, allowing an assessment of the possible sources of the volatilizable material in the lunar samples to be made. Lightly surface adsorbed species and more strongly chemisorbed species are released from ambient to 300 C and from 300 to 500 C, respectively. The low-temperature volatiles (less than 500 C) derived from various chondrites correlate well with the gas evolution patterns of volatile-rich samples, as for example 74220 and 61221. Solar wind entrapped species and molecules derived from reactions probably in the grain surfaces are evolved from about 500 to 700 C, respectively. Solar wind implanted C, N, and S species are generated from 750 to 1150 C, probably by reaction with the mineral matrix during the annealing process. Possible indigenous and/or refractory carbide, nitride, and sulfide C, N, and S are released in the region from 1200 C to fusion.

Therapeutic potential of Wenshen Xiaozheng tang, a traditional Chinese medicine prescription, for treating endometriosis.

PubMed

Zhang, Zhenzhen; Hu, Chunping; Tang, Weiwei; Gui, Tao; Qian, Ruyun; Xing, Yuxia; Cao, Peng; Wan, Guiping

2013-10-01

The objective of this study is to investigate the effect of Wenshen Xiaozheng Tang (WXT) on the development of endometriosis in a rat model. Sprague-Dawley rats in which endometriotic implants were induced were divided randomly into 3 groups. The rats in the low-dose and high-dose WXT groups were administered WXT 8.57 and 17.14 g/kg/d, respectively. The rats in the control groups received an equal volume of dissolvent, as did the sham-operated rats. After treatment for 4 weeks, WXT significantly decreased the mean lesion size as well as the peritoneal fluid and serum levels of tumor necrosis factor α and interleukin 1β. Cyclooxygenase-2, matrix metalloproteinase 9, plasminogen activator inhibitor 1, and intercellular adhesion molecule 1 messenger RNA (mRNA) levels were downregulated, and the mRNA expression of tissue inhibitor of metalloproteinase 1 was upregulated in the endometriotic lesions of WXT versus control group. Our data suggested that WXT may suppress the development of endometriosis by inhibiting the production of proinflammatory cytokines and regulating the expression of invasion-related genes in the endometriotic lesions.

Water-based polyurethane 3D printed scaffolds with controlled release function for customized cartilage tissue engineering.

PubMed

Hung, Kun-Che; Tseng, Ching-Shiow; Dai, Lien-Guo; Hsu, Shan-hui

2016-03-01

Conventional 3D printing may not readily incorporate bioactive ingredients for controlled release because the process often involves the use of heat, organic solvent, or crosslinkers that reduce the bioactivity of the ingredients. Water-based 3D printing materials with controlled bioactivity for customized cartilage tissue engineering is developed in this study. The printing ink contains the water dispersion of synthetic biodegradable polyurethane (PU) elastic nanoparticles, hyaluronan, and bioactive ingredients TGFβ3 or a small molecule drug Y27632 to replace TGFβ3. Compliant scaffolds are printed from the ink at low temperature. These scaffolds promote the self-aggregation of mesenchymal stem cells (MSCs) and, with timely release of the bioactive ingredients, induce the chondrogenic differentiation of MSCs and produce matrix for cartilage repair. Moreover, the growth factor-free controlled release design may prevent cartilage hypertrophy. Rabbit knee implantation supports the potential of the novel 3D printing scaffolds in cartilage regeneration. We consider that the 3D printing composite scaffolds with controlled release bioactivity may have potential in customized tissue engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Designing multifunctional polymers for cardiovascular implants.

PubMed

Wischke, Christian; Lendlein, Andreas

2011-01-01

Polymer-based biomaterials are extensively used in all disciplines of clinical medicine and innovations in biomaterial science are building a product pipeline, e.g., of future cardiovascular implants. Still, cardiovascular applications demand a number of extensive requirements of properties and functions to be fulfilled by the polymer matrix. This report provides an overview on some of these issues and how they can be addressed by a tailored design of novel polymer-based biomaterials. Multifunctional shape-memory polymers are highlighted as a class of materials that combine biocompatibility and the capability for stimuli-induced active movements for anchoring of implants with a controlled degradation and drug release profile to enable a functional regeneration of the tissue at the application site.

Management of Distal Tibial Metaphyseal Bone Defects With an Intramedullary Nitinol Scaffold: A Novel Technique.

PubMed

Ford, Samuel E; Ellington, J Kent

2017-08-01

Difficult problems that are faced when reconstructing severe pilon fractures include filling metaphyseal defects and supporting an impacted, multifragmented articular surface. Supplements to plate fixation currently available in a surgeon's armamentarium include cancellous bone autograft, structural bone allograft, demineralized bone matrix, and calcium-based cements. Cancellous autograft possesses limited inherent mechanical stability and is associated with graft site morbidity. Structural allografts incorporate inconsistently and are plagued by late resorption. Demineralized bone matrix also lacks inherent structural stability. Calcium phosphate cements are not rigidly fixed to bone unless fixation is applied from cortical bone or through a plate, which must be taken into consideration when planning fixation. The Conventus DRS (Conventus Orthopaedics, Maple Grove, MN) implant is an expandable nitinol scaffold that takes advantage of the elasticity and shape memory of nitinol alloy. Once deployed and locked, it serves as a stable intramedullary base for fragment-specific periarticular fracture fixation, even in the face of metaphyseal bone loss. Two cases of successful implant use are presented. In both cases, the implant is used to fill a metaphyseal void and provide stable articular support to the distal tibial plafond. Therapeutic Level V: Case Report, Expert Opinion.

Matrix addressable vertical cavity surface emitting laser array

NASA Astrophysics Data System (ADS)

Orenstein, M.; von Lehmen, A. C.; Chang-Hasnain, C.; Stoffel, N. G.; Harbison, J. P.

1991-02-01

The design, fabrication and characterization of 1024-element matrix-addressable vertical-cavity surface-emitting laser (VCSEL) arrays are described. A strained InGaAs quantum-well VCSEL structure was grown by MBE, and an array of 32 x 32 lasers was defined using a proton implantation process. A matrix addressing architecture was employed, which enables the individual addressing of each of the 1024 lasers using only 64 electrical contacts. All the lasers in the array, measured after the laser definition step, were operating with fairly homogeneous characteristics; threshold current of 6.8 mA and output quantum differential efficiency of about 8 percent.

Seroma Formation in Rat Latissimus Dorsi Resection in the Presence of Biologics: The Role of Quilting.

PubMed

Hurwitz, Zachary M; Ignotz, Ronald A; Rowin, Craig; Freniere, Brian B; Lalikos, Janice F; Dunn, Raymond M

2015-09-01

Seroma formation is a well-recognized complication associated with many operative procedures. Despite its ubiquity, a lack of definitive scientific understanding of the etiology, natural history, and biochemistry of seromas remains. We endeavored to create and examine seromas in a rat model in the setting of commonly used biologic implants and to examine the role of quilting sutures/mechanical fixation in mitigating seroma development. Female Sprague-Dawley rats were assigned to either Quilting or Nonquilting groups then subdivided into one of 3 porcine dermal implant groups (Permacol Surgical Implant, Strattice Reconstructive Tissue Matrix, or XCM Biologic Tissue Matrix) or control group. A 5-cm midline back incision was made, the skin reflected and the latissimus dorsi muscle resected bilaterally. Implants were sutured into the surgical bed using a running suture. The skin of nonquilted rats was closed with a running subcuticular suture. Quilted rats underwent placement of absorbable quilting sutures spaced 2 cm apart between the skin and underlying implant or muscle before skin closure. Postoperatively, rats were monitored for seroma formation with fluid aspirated as needed. At 28 or 90 days, rats were euthanized. Seroma and implants were examined grossly and under light microscopy. Of nonquilted rats, 42/54 (78%) developed seromas compared with 19/46 (41%) of quilted rats (P < 0.05), defined by bursa cavity present at necropsy. When a biologic implant was present, 28/35 (80%) of nonquilted rats developed seromas compared with 12/33 (36%) of quilted rats (P < 0.05). In the control group, 14/19 (74%) of nonquilted rats developed seromas compared with 7/13 (54%) of quilted rats. This difference was not statistically significant. Bursa presence was confirmed histologically in all cases, with no difference in bursa character seen between groups. This study confirms a reliable rat model of seroma formation, with most of the rats exhibiting at least subclinical seromas. There was no difference in seroma formation rate in the presence of biologic implants, and no differences in bursa character between implants. Mechanical fixation with quilting sutures decreased seroma rate significantly in all subgroups. All rats with seromas at necropsy had histological evidence of a bursa with no difference in appearance between groups.

Biomedical application of MALDI mass spectrometry for small-molecule analysis.

PubMed

van Kampen, Jeroen J A; Burgers, Peter C; de Groot, Ronald; Gruters, Rob A; Luider, Theo M

2011-01-01

Matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) is an emerging analytical tool for the analysis of molecules with molar masses below 1,000 Da; that is, small molecules. This technique offers rapid analysis, high sensitivity, low sample consumption, a relative high tolerance towards salts and buffers, and the possibility to store sample on the target plate. The successful application of the technique is, however, hampered by low molecular weight (LMW) matrix-derived interference signals and by poor reproducibility of signal intensities during quantitative analyses. In this review, we focus on the biomedical application of MALDI-MS for the analysis of small molecules and discuss its favorable properties and its challenges as well as strategies to improve the performance of the technique. Furthermore, practical aspects and applications are presented. © 2010 Wiley Periodicals, Inc.

MAPLE deposition of PLGA:PEG films for controlled drug delivery: Influence of PEG molecular weight

NASA Astrophysics Data System (ADS)

Paun, Irina Alexandra; Moldovan, Antoniu; Luculescu, Catalin Romeo; Staicu, Angela; Dinescu, Maria

2012-09-01

Implantable devices consisting of indomethacin (INC) cores coated with poly(lactide-co-glycolide):polyethylene glycol films (i.e. PLGA:PEG films) deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) were produced. To predict their behavior after implantation inside the body, the implants were studied in vitro, in media similar with those encountered inside the body (phosphate buffered saline (PBS) pH 7.4 and blood). The influence of the molecular weight of PEG (i.e. low (1450 Da) versus high (10 kDa) molecular weights) on the characteristics of the implants was investigated, in terms of morphology, blood compatibility and kinetics of the drug release. The use of PEG of high molecular weight resulted in larger pores on the implants surfaces, enhanced blood compatibility of the implants and higher drug delivery rates. For both molecular weights PEGs, sustained release of INC was maintained over a three weeks interval. Theoretical fitting of the drug release data with Higuchi's model indicated that the INC was released mainly by diffusion, most probably through the pores formed in PLGA:PEG films during PBS immersion.

Soft tissue management for dental implants: what are the most effective techniques? A Cochrane systematic review.

PubMed

Esposito, Marco; Maghaireh, Hassan; Grusovin, Maria Gabriella; Ziounas, Ioannis; Worthington, Helen V

2012-01-01

This review is based on a Cochrane systematic review entitled 'Interventions for replacing missing teeth: management of soft tissues for dental implants' published in The Cochrane Library (see http:// www.cochrane.org/ for information). Cochrane systematic reviews are regularly updated to include new research, and in response to comments and criticisms from readers. If you wish to comment on this review, please send your comments to the Cochrane website or to Marco Esposito. The Cochrane Library should be consulted for the most recent version of the review. The results of a Cochrane review can be interpreted differently, depending on people's perspectives and circumstances. Please consider the conclusions presented carefully. They are the opinions of the review authors, and are not necessarily shared by the Cochrane Collaboration. To evaluate whether flapless procedures are beneficial for patients and which is the ideal flap design, whether soft tissue correction/augmentation techniques are beneficial for patients and which are the best techniques, whether techniques to increase the peri-implant keratinised mucosa are beneficial for patients and which are the best techniques, and which are the best suturing techniques/ materials. The Cochrane Oral Health Group's Trials Register, CENTRAL, MEDLINE and EMBASE were searched up to the 9th of June 2011 for randomised controlled trials (RCTs) of rootform osseointegrated dental implants, with a follow-up of at least 6 months after function, comparing various techniques to handle soft tissues in relation to dental implants. Primary outcome measures were prosthetic failures, implant failures and biological complications. Screening of eligible studies, assessment of the methodological quality of the trials and data extraction were conducted at least in duplicate and independently by two or more review authors. The statistical unit was the patient and not the prosthesis, the procedure or the implant. RESULTS were expressed using risk ratios for dichotomous outcomes and mean differences for continuous outcomes with 95% confidence intervals (CI). Seventeen potentially eligible RCTs were identified but only six trials with 138 patients in total could be included. The following techniques were compared in the six included studies: flapless placement of dental implants versus conventional flap elevation (2 trials, 56 patients), crestal versus vestibular incisions (1 trial, 10 patients), Erbium:YAG laser versus flap elevation at the second-stage surgery for implant exposure (1 trial, 20 patients), whether a connective tissue graft at implant placement could be effective in augmenting peri-implant tissues (1 split-mouth trial, 10 patients), and autograft versus an animal-derived collagen matrix to increase the height of the keratinised mucosa (1 trial, 40 patients). On a patient rather than per implant basis, implants placed with a flapless technique and implant exposures performed with laser lead to statistically significantly less postoperative pain than flap elevation. Sites augmented with soft tissue connective grafts had better aesthetics and thicker tissues. Both palatal autografts or the use of a porcine-derived collagen matrix are effective in increasing the height of keratinised mucosa at the cost of a 0.5 mm recession of peri-implant soft tissues. There were no other statistically significant differences for any of the remaining analyses. There is limited weak evidence suggesting that flapless implant placement is feasible and has been shown to reduce patient postoperative discomfort in adequately selected patients, that augmentation at implant sites with soft tissue grafts is effective in increasing soft tissue thickness and improving aesthetics, and that one technique to increase the height of keratinised mucosa using autografts or an animal-derived collagen matrix was able to achieve its goal but at the cost of a worsened aesthetic outcome (0.5 mm of recession). There is insufficient reliable evidence to provide recommendations on which is the ideal flap design, the best soft tissue augmentation technique, whether techniques to increase the width of keratinised/attached mucosa are beneficial to patients or not, and which are the best incision/suture techniques/materials. Properly designed and conducted RCTs, with at least 6 months of follow-up, are needed to provide reliable answers to these questions.

Electroluminescence from completely horizontally oriented dye molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komino, Takeshi; Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395; Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395

2016-06-13

A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimatemore » orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.« less

Radiation-induced transformations of isolated CH3CN molecules in noble gas matrices

NASA Astrophysics Data System (ADS)

Kameneva, Svetlana V.; Volosatova, Anastasia D.; Feldman, Vladimir I.

2017-12-01

The transformations of isolated CH3CN molecules in various solid noble-gas matrices (Ne, Ar, Kr, and Xe) under the action of X-ray irradiation at 5 K were investigated by FTIR spectroscopy. The main products are CH3NC, CH2CNH and CH2NCH molecular isomers as well as CH2CN and CH2NC radicals. The matrix has a strong effect on the distribution of reaction channels. In particular, the highest relative yield of keteneimine (CH2CNH) was found in Ne matrix, whereas the formation of CH3NC predominates in xenon. It was explained by differences in the matrix ionization energy (IE) resulting in different distributions of hot ionic reactions. The reactions of neutral excited states are mainly involved in Xe matrix with low IE, while the isomerization of the primary acetonitrile positive ions may be quite effective in Ne and Ar. Annealing of the irradiated samples results in mobilization of trapped hydrogen atoms followed by their reactions with radicals to yield parent molecule and its isomers. The scheme of the radiation-induced processes and its implications for the acetonitrile chemistry in cosmic ices are discussed.

Hollow fiber: a biophotonic implant for live cells

NASA Astrophysics Data System (ADS)

Silvestre, Oscar F.; Holton, Mark D.; Summers, Huw D.; Smith, Paul J.; Errington, Rachel J.

2009-02-01

The technical objective of this study has been to design, build and validate biocompatible hollow fiber implants based on fluorescence with integrated biophotonics components to enable in fiber kinetic cell based assays. A human osteosarcoma in vitro cell model fiber system has been established with validation studies to determine in fiber cell growth, cell cycle analysis and organization in normal and drug treated conditions. The rationale for implant development have focused on developing benchmark concepts in standard monolayer tissue culture followed by the development of in vitro hollow fiber designs; encompassing imaging with and without integrated biophotonics. Furthermore the effect of introducing targetable biosensors into the encapsulated tumor implant such as quantum dots for informing new detection readouts and possible implant designs have been evaluated. A preliminary micro/macro imaging approach has been undertaken, that could provide a mean to track distinct morphological changes in cells growing in a 3D matrix within the fiber which affect the light scattering properties of the implant. Parallel engineering studies have showed the influence of the optical properties of the fiber polymer wall in all imaging modes. Taken all together, we show the basic foundation and the opportunities for multi-modal imaging within an in vitro implant format.

A long-acting buprenorphine delivery system.

PubMed

Pontani, R B; Misra, A L

1983-03-01

A subcutaneously implantable buprenorphine delivery system utilizing cholesterol-glyceryltristearate matrix for prolonged release of drug is described. Implantable cylindrical pellets of buprenorphine (cholesterol 36 mg, glyceryltristearate 4 mg, buprenorphine hydrochloride 10 mg), diameter 3 mm, length 6 mm blocked the antinociceptive action (hot plate, 55 degrees C) of 10 mg kg-1 SC challenge dose of morphine in rats for 12 weeks or more (longer periods not evaluated). The cumulative percent release of buprenorphine from the test devices 2, 4, 6, 10 and 12 weeks after implantation was 27.4, 35.9, 37.6, 39.9 and 43.1, respectively. The release of buprenorphine from 10 mg pellets approximated first-order kinetics with half-lives of 0.85 and 50.24 weeks, for alpha and beta phases, respectively. The test devices possess the desirable characteristics of simplicity, biocompatibility, nontoxicity, ease of sterilization with ethylene oxide, small size for ease of insertion and removal, minimal encapsulation by surrounding tissue and an extended period of drug release unaffected by body metabolism. No side effects were seen in implanted rats which fed well and gained weight during entire treatment. Neither deterioration of implant nor any gross anatomic changes at implant site were apparent 12 weeks after pellet implantation.

In vivo investigation of twin-screw extruded lipid implants for vaccine delivery.

PubMed

Even, Marie-Paule; Young, Katie; Winter, Gerhard; Hook, Sarah; Engert, Julia

2014-07-01

Sustained release systems have become the focus of attention in vaccine delivery as they may reduce or prevent the need for repeated dosing. In this work, lipid implants were prepared by twin-screw extrusion and investigated as vaccine delivery systems in vivo. The lipid implants consisted of cholesterol, soybean lecithin, and Dynasan 114. Ovalbumin (OVA) was employed as a model antigen and Quil-A (QA) as an adjuvant. In addition, OVA and QA loaded liposomes were prepared by the lipid-film hydration method, freeze-dried and then added to the lipid matrix prior to extrusion. Implants were administered subcutaneously and the kinetics of antigen release as well as the overall immune response stimulated were analysed by measuring CD4(+) and CD8(+) T cell proliferation, OVA-specific IgG production as well as cytokine (IFN-γ and IL4) secretion. Vaccine release from the implants was completed by 14 days. Inclusion of adjuvant into the implants was required for the generation of cellular and humoral immune responses. Inclusion of liposomes into the implant did not enhance the resulting immune responses generated. Copyright © 2014 Elsevier B.V. All rights reserved.

Organic–inorganic binary mixture matrix for comprehensive laser-desorption ionization mass spectrometric analysis and imaging of medium-size molecules including phospholipids, glycerolipids, and oligosaccharides

DOE PAGES

Feenstra, Adam D.; Ames Lab., Ames, IA; O'Neill, Kelly C.; ...

2016-10-13

Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a widely adopted, versatile technique, especially in high-throughput analysis and imaging. However, matrix-dependent selectivity of analytes is often a severe limitation. In this work, a mixture of organic 2,5-dihydroxybenzoic acid and inorganic Fe 3O 4 nanoparticles is developed as a binary MALDI matrix to alleviate the well-known issue of triacylglycerol (TG) ion suppression by phosphatidylcholine (PC). In application to lipid standards and maize seed cross-sections, the binary matrix not only dramatically reduced the ion suppression of TG, but also efficiently desorbed and ionized a wide variety of lipids such as cationic PC, anionicmore » phosphatidylethanolamine (PE) and phosphatidylinositol (PI), and neutral digalactosyldiacylglycerol (DGDG). The binary matrix was also very efficient for large polysaccharides, which were not detected by either of the individual matrices. As a result, the usefulness of the binary matrix is demonstrated in MS imaging of maize seed sections, successfully visualizing diverse medium-size molecules and acquiring high-quality MS/MS spectra for these compounds.« less

Pseudomonas biofilm matrix composition and niche biology

PubMed Central

Mann, Ethan E.; Wozniak, Daniel J.

2014-01-01

Biofilms are a predominant form of growth for bacteria in the environment and in the clinic. Critical for biofilm development are adherence, proliferation, and dispersion phases. Each of these stages includes reinforcement by, or modulation of, the extracellular matrix. Pseudomonas aeruginosa has been a model organism for the study of biofilm formation. Additionally, other Pseudomonas species utilize biofilm formation during plant colonization and environmental persistence. Pseudomonads produce several biofilm matrix molecules, including polysaccharides, nucleic acids, and proteins. Accessory matrix components shown to aid biofilm formation and adaptability under varying conditions are also produced by pseudomonads. Adaptation facilitated by biofilm formation allows for selection of genetic variants with unique and distinguishable colony morphology. Examples include rugose small-colony variants and wrinkly spreaders (WS), which over produce Psl/Pel or cellulose, respectively, and mucoid bacteria that over produce alginate. The well-documented emergence of these variants suggests that pseudomonads take advantage of matrix-building subpopulations conferring specific benefits for the entire population. This review will focus on various polysaccharides as well as additional Pseudomonas biofilm matrix components. Discussions will center on structure–function relationships, regulation, and the role of individual matrix molecules in niche biology. PMID:22212072

Long-term clinical study and multiscale analysis of in vivo biodegradation mechanism of Mg alloy

PubMed Central

Lee, Jee-Wook; Han, Hyung-Seop; Han, Kyeong-Jin; Park, Jimin; Jeon, Hojeong; Ok, Myoung-Ryul; Seok, Hyun-Kwang; Ahn, Jae-Pyoung; Lee, Kyung Eun; Lee, Dong-Ho; Yang, Seok-Jo; Cho, Sung-Youn; Cha, Pil-Ryung; Kwon, Hoon; Nam, Tae-Hyun; Han, Jee Hye Lo; Rho, Hyoung-Jin; Lee, Kang-Sik; Kim, Yu-Chan; Mantovani, Diego

2016-01-01

There has been a tremendous amount of research in the past decade to optimize the mechanical properties and degradation behavior of the biodegradable Mg alloy for orthopedic implant. Despite the feasibility of degrading implant, the lack of fundamental understanding about biocompatibility and underlying bone formation mechanism is currently limiting the use in clinical applications. Herein, we report the result of long-term clinical study and systematic investigation of bone formation mechanism of the biodegradable Mg-5wt%Ca-1wt%Zn alloy implant through simultaneous observation of changes in element composition and crystallinity within degrading interface at hierarchical levels. Controlled degradation of Mg-5wt%Ca-1wt%Zn alloy results in the formation of biomimicking calcification matrix at the degrading interface to initiate the bone formation process. This process facilitates early bone healing and allows the complete replacement of biodegradable Mg implant by the new bone within 1 y of implantation, as demonstrated in 53 cases of successful long-term clinical study. PMID:26729859

Depth profiling of high energy nitrogen ions implanted in the <1 0 0>, <1 1 0> and randomly oriented silicon crystals

NASA Astrophysics Data System (ADS)

Erić, M.; Petrović, S.; Kokkoris, M.; Lagoyannis, A.; Paneta, V.; Harissopulos, S.; Telečki, I.

2012-03-01

This work reports on the experimentally obtained depth profiles of 4 MeV 14N2+ ions implanted in the <1 0 0>, <1 1 0> and randomly oriented silicon crystals. The ion fluence was 1017 particles/cm2. The nitrogen depth profiling has been performed using the Nuclear Reaction Analysis (NRA) method, via the study of 14N(d,α0)12C and 14N(d,α1)12C nuclear reactions, and with the implementation of SRIM 2010 and SIMNRA computer simulation codes. For the randomly oriented silicon crystal, change of the density of silicon matrix and the nitrogen "bubble" formation have been proposed as the explanation for the difference between the experimental and simulated nitrogen depth profiles. During the implantation, the RBS/C spectra were measured on the nitrogen implanted and on the virgin crystal spots. These spectra provide information on the amorphization of the silicon crystals induced by the ion implantation.

Entropic trapping of macromolecules by mesoscopic periodic voids in a polymer hydrogel

NASA Astrophysics Data System (ADS)

Liu, Lei; Li, Pusheng; Asher, Sanford A.

1999-01-01

The separation of macromolecules such as polymers and DNA by means of electrophoresis, gel permeation chromatography or filtration exploits size-dependent differences in the time it takes for the molecules to migrate through a random porous network. Transport through the gel matrices, which usually consist of full swollen crosslinked polymers, depends on the relative size of the macromolecule compared with the pore radius. Sufficiently small molecules are thought to adopt an approximately spherical conformation when diffusing through the gel matrix, whereas larger ones are forced to migrate in a snake-like fashion. Molecules of intermediate size, however, can get temporarily trapped in the largest pores of the matrix, where the molecule can extend and thus maximize its conformational entropy. This `entropic trapping' is thought to increase the dependence of diffusion rate on molecular size. Here we report the direct experimental verification of this phenomenon. Bragg diffraction from a hydrogel containing a periodic array of monodisperse water voids confirms that polymers of different weights partition between the hydrogel matrix and the water voids according to the predictions of the entropic trapping theory. Our approach might also lead to the design of improved separation media based on entropic trapping.

Platelet lysate gel and endothelial progenitors stimulate microvascular network formation in vitro: tissue engineering implications.

PubMed

Fortunato, Tiago M; Beltrami, Cristina; Emanueli, Costanza; De Bank, Paul A; Pula, Giordano

2016-05-04

Revascularisation is a key step for tissue regeneration and complete organ engineering. We describe the generation of human platelet lysate gel (hPLG), an extracellular matrix preparation from human platelets able to support the proliferation of endothelial colony forming cells (ECFCs) in 2D cultures and the formation of a complete microvascular network in vitro in 3D cultures. Existing extracellular matrix preparations require addition of high concentrations of recombinant growth factors and allow only limited formation of capillary-like structures. Additional advantages of our approach over existing extracellular matrices are the absence of any animal product in the composition hPLG and the possibility of obtaining hPLG from patients to generate homologous scaffolds for re-implantation. This discovery has the potential to accelerate the development of regenerative medicine applications based on implantation of microvascular networks expanded ex vivo or the generation of fully vascularised organs.

Platelet lysate gel and endothelial progenitors stimulate microvascular network formation in vitro: tissue engineering implications

PubMed Central

Fortunato, Tiago M.; Beltrami, Cristina; Emanueli, Costanza; De Bank, Paul A.; Pula, Giordano

2016-01-01

Revascularisation is a key step for tissue regeneration and complete organ engineering. We describe the generation of human platelet lysate gel (hPLG), an extracellular matrix preparation from human platelets able to support the proliferation of endothelial colony forming cells (ECFCs) in 2D cultures and the formation of a complete microvascular network in vitro in 3D cultures. Existing extracellular matrix preparations require addition of high concentrations of recombinant growth factors and allow only limited formation of capillary-like structures. Additional advantages of our approach over existing extracellular matrices are the absence of any animal product in the composition hPLG and the possibility of obtaining hPLG from patients to generate homologous scaffolds for re-implantation. This discovery has the potential to accelerate the development of regenerative medicine applications based on implantation of microvascular networks expanded ex vivo or the generation of fully vascularised organs. PMID:27141997

Equine-derived bone mineral matrix for maxillary sinus floor augmentation: a clinical, radiographic, histologic, and histomorphometric case series.

PubMed

Nevins, Myron; Heinemann, Friedhelm; Janke, Ulrich W; Lombardi, Teresa; Nisand, David; Rocchietta, Isabella; Santoro, Giacomo; Schupbach, Peter; Kim, David M

2013-01-01

The objective of this proof-of-principle multicenter case series was to examine the bone regenerative potential of a newly introduced equine-derived bone mineral matrix (Equimatrix) to provide human sinus augmentation for the purpose of implant placement in the posterior maxilla. There were 10 patients requiring 12 maxillary sinus augmentations enrolled in this study. Histologic results at 6 months demonstrated abundant amounts of vital new bone in intimate contact with residual graft particles. Active bridging between residual graft particles with newly regenerated bone was routinely observed in intact core specimens. A mean value of 23.4% vital bone formation was observed at 6 months. This compared favorably with previous results using xenografts to produce bone in the maxillary sinus for the purpose of dental implant placement. Both the qualitative and quantitative results of this case series suggest comparable bone regenerative results at 6 months to bovine-derived xenografts.

Treatment of soft tissue recessions at titanium implants using a resorbable collagen matrix: a pilot study.

PubMed

Schwarz, Frank; Mihatovic, Ilja; Shirakata, Yoshinori; Becker, Jürgen; Bosshardt, Dieter; Sculean, Anton

2014-01-01

To histologically assess the effectiveness of a porcine-derived collagen matrix (CM) and a subepithelial connective tissue graft (CTG) for the coverage of single mucosal recessions at osseointegrated dental implants. Chronic-type mucosal Miller Class I-like recessions (mean clinical defect height: 0.67 ± 0.33-1.16 ± 0.19 mm) were established at the buccal aspect of titanium implants with platform switch in six beagle dogs. The defects were randomly allocated to either (1) coronally advanced flap surgery (CAF) + CM, (2) CAF + CTG or (3) CAF alone. At 12 weeks, histomorphometrical measurements were made (e.g.) between the implant shoulder (IS) and the mucosal margin (PM) and IS and the outer contour of the adjacent soft tissue (mucosal thickness [MT]). All treatment procedures investigated were associated with an almost complete soft tissue coverage of the defect area (i.e. coronal positioning of PM relative to IS). Mean IS-PM and MT values tended to be increased in both CAF + CM (1.04 ± 0.74 mm/0.71 ± 0.55 mm) and CAF + CTG (0.88 ± 1.23 mm/0.62 ± 0.66 mm) groups when compared with CAF (0.16 ± 0.28 mm/0.34 ± 0.23 mm) alone. These differences, however, did not reach statistical significance. Within the limits of this pilot study, it was concluded that all treatment procedures investigated were effective in covering soft tissue recessions at titanium implants. © 2012 John Wiley & Sons A/S.

[Biocompatibility testing of various biomaterials as dependent on immune status].

PubMed

Endres, S; Landgraff, M; Kratz, M; Wilke, A

2004-01-01

This study deals with the ingrowth behaviour of biomaterials (hydroxyapatite, cp-titanium, cobalt-chromium-molybdenum and PAEK) in relationship to the immunological competence in an animal model. Measured were the production of extracellular matrix (ECM) after implantation in non-immunocompetent naked mice and immunocompetent wild mice. Intention of the trial was to find out if either the immunological competence or the duration of implantation influences the quantity of produced ECM. In addition, the ingrowth behaviour was investigated under these conditions by using four different biomaterials. Biomaterials (hydroxyapatite, cp-titanium, cobalt-chromium-molybdenum and PAEK) were implanted for 14 or 60 days, respectively. CLSM, SEM and SEM-EDX were used for analysis of the ECM and for measuring the distance between ECM and the biomaterials. CLSM was also used for the detection of collagen I and III as a parameter of the quality of osteointegration. In all cases a matrix grew on the surface of the biomaterials. The CLSM detected a co-localisation of collagen I and III. In the case of hydroxyapatite collagen I and III were found at a distance of 1 micro m over the surface. The largest space between the surface of the implant and the ECM was found in the case of PAEK. The smallest space was in the case of hydroxyapatite. In all investigated biomaterials the proportion of collagen I to collagen III varied through the duration of implantation. As is known from the literature we found different ingrowth behaviours on using different biomaterials. Furthermore, we found a statistically significant influence of the immunological competence of the host with regard to ECM production. We draw the conclusion that immunological competence improves the ingrowth behaviour of biomaterials.

An efficient voting algorithm for finding additive biclusters with random background.

PubMed

Xiao, Jing; Wang, Lusheng; Liu, Xiaowen; Jiang, Tao

2008-12-01

The biclustering problem has been extensively studied in many areas, including e-commerce, data mining, machine learning, pattern recognition, statistics, and, more recently, computational biology. Given an n x m matrix A (n >or= m), the main goal of biclustering is to identify a subset of rows (called objects) and a subset of columns (called properties) such that some objective function that specifies the quality of the found bicluster (formed by the subsets of rows and of columns of A) is optimized. The problem has been proved or conjectured to be NP-hard for various objective functions. In this article, we study a probabilistic model for the implanted additive bicluster problem, where each element in the n x m background matrix is a random integer from [0, L - 1] for some integer L, and a k x k implanted additive bicluster is obtained from an error-free additive bicluster by randomly changing each element to a number in [0, L - 1] with probability theta. We propose an O(n(2)m) time algorithm based on voting to solve the problem. We show that when k >or= Omega(square root of (n log n)), the voting algorithm can correctly find the implanted bicluster with probability at least 1 - (9/n(2)). We also implement our algorithm as a C++ program named VOTE. The implementation incorporates several ideas for estimating the size of an implanted bicluster, adjusting the threshold in voting, dealing with small biclusters, and dealing with overlapping implanted biclusters. Our experimental results on both simulated and real datasets show that VOTE can find biclusters with a high accuracy and speed.

Structural and in vivo mechanical characterization of canine patellar cartilage: a closed chondromalacia patellae model.

PubMed

LaBerge, M; Audet, J; Drouin, G; Rivard, C H

1993-01-01

The purpose of this project was to study the relationship between the structure of the patellar cartilage and its response to static compressive loading with a closed chondromalacia patellae model. An animal model was used to induce degeneration of the patella that was monitored quantitatively and qualitatively as a function of time. Ten adult mongrel dogs had their left patellofemoral groove replaced by a customized metallic implant covered with a thin film of polyethylene for periods of 3 months (five dogs) and 6 months (five dogs). An indenter was designed to perform mechanical indentation testing on the patellar cartilage in situ. The animals were anesthetized and the response of patellar cartilage to a static compressive load of 4.5 MPa was monitored for 20 min and its relaxation after load removal for 20 min. Indentation tests were performed every 3 months of the implantation period. At the end of the implantation period, the patellae were processed for histology, and sections were stained with Safranin-O indicative of the proteoglycans content. Macroscopically, no apparent degeneration or fibrillation of the patellar surfaces was observed after 3 or 6 months of implantation. However, the patellar surface showed a change in coloration after 6 months. A 17 +/- 3% and 37 +/- 8% deformation of the cartilage were calculated for the 3-month and 6-month specimens, respectively. Histologically, a progressive loss of proteoglycans was observed in the matrix as a function of implantation time. These results indicated that an increase in cartilage compliance is associated with an intrinsic remodeling of the cartilage matrix and that these changes might occur without external signs of degeneration and can be quantified.

[The yeast biofilm in human medicine].

PubMed

Růzicka, Filip; Holá, Veronika; Votava, Miroslav

2007-08-01

In recent years, the role of Candida yeasts as causative agents of nosocomial infections has increased. One of the important virulence factors contributing to the development of such infections is biofilm production. This virulence factor enables yeast to colonize both native surfaces and artificial implants. The most common sources of infection are patients themselves, in particular the gastrointestinal tract and skin. The vectors of exogenous yeast infections are predominantly the hands of the health personnel and contaminated medical instruments. The adhesion of yeasts to the implant surfaces is determined both by implant surface and yeast characteristics. This is followed by proliferation and production of microcolonies and extracellular matrix. The final biofilm structure is also influenced by the production of hyphae and pseudohyphae. The entire process of biofilm production is controlled by numerous regulatory systems, with the key role being played by the quorum sensing system. Like the adhered bacterial cultures, candidas growing in the form of a biofilm are highly resistant to antimicrobial therapy. Resistance of yeast biofilms to antifungals is a complex process with multiple contributing factors. These are especially increased gene expression (e.g. genes encoding the so called multidrug efflux pumps), limited penetration of substances through the extracellular matrix, inhibited cell growth and altered microenvironment in deeper biofilm layers. The concentrations of antifungals able to effectively affect the biofilm cells exceed, by several orders of magnitude, the values of conventionally determined MICs. High biofilm resistance results in ineffective antifungal therapy of biofilm infections. Therefore, if possible, the colonized implant should be removed. Conservative therapy should involve antifungals with a proven effect on the biofilm (e.g. caspofungin). The most effective measure in fighting biofilm infections is prevention, especially adhering to aseptic techniques when manipulating with implants and their correct maintenance.

b matrix errors in echo planar diffusion tensor imaging

PubMed Central

Boujraf, Saïd; Luypaert, Robert; Osteaux, Michel

2001-01-01

Diffusion‐weighted magnetic resonance imaging (DW‐MRI) is a recognized tool for early detection of infarction of the human brain. DW‐MRI uses the signal loss associated with the random thermal motion of water molecules in the presence of magnetic field gradients to derive parameters that reflect the translational mobility of the water molecules in tissues. If diffusion‐weighted images with different values of b matrix are acquired during one individual investigation, it is possible to calculate apparent diffusion coefficient maps that are the elements of the diffusion tensor. The diffusion tensor elements represent the apparent diffusion coefficient of protons of water molecules in each pixel in the corresponding sample. The relation between signal intensity in the diffusion‐weighted images, diffusion tensor, and b matrix is derived from the Bloch equations. Our goal is to establish the magnitude of the error made in the calculation of the elements of the diffusion tensor when the imaging gradients are ignored. PACS number(s): 87.57. –s, 87.61.–c PMID:11602015

Biomaterials and Culture Technologies for Regenerative Therapy of Liver Tissue.

PubMed

Perez, Roman A; Jung, Cho-Rok; Kim, Hae-Won

2017-01-01

Regenerative approach has emerged to substitute the current extracorporeal technologies for the treatment of diseased and damaged liver tissue. This is based on the use of biomaterials that modulate the responses of hepatic cells through the unique matrix properties tuned to recapitulate regenerative functions. Cells in liver preserve their phenotype or differentiate through the interactions with extracellular matrix molecules. Therefore, the intrinsic properties of the engineered biomaterials, such as stiffness and surface topography, need to be tailored to induce appropriate cellular functions. The matrix physical stimuli can be combined with biochemical cues, such as immobilized functional groups or the delivered actions of signaling molecules. Furthermore, the external modulation of cells, through cocultures with nonparenchymal cells (e.g., endothelial cells) that can signal bioactive molecules, is another promising avenue to regenerate liver tissue. This review disseminates the recent approaches of regenerating liver tissue, with a focus on the development of biomaterials and the related culture technologies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Physical, Spatial, and Molecular Aspects of Extracellular Matrix of In Vivo Niches and Artificial Scaffolds Relevant to Stem Cells Research

PubMed Central

Akhmanova, Maria; Osidak, Egor; Domogatsky, Sergey; Rodin, Sergey; Domogatskaya, Anna

2015-01-01

Extracellular matrix can influence stem cell choices, such as self-renewal, quiescence, migration, proliferation, phenotype maintenance, differentiation, or apoptosis. Three aspects of extracellular matrix were extensively studied during the last decade: physical properties, spatial presentation of adhesive epitopes, and molecular complexity. Over 15 different parameters have been shown to influence stem cell choices. Physical aspects include stiffness (or elasticity), viscoelasticity, pore size, porosity, amplitude and frequency of static and dynamic deformations applied to the matrix. Spatial aspects include scaffold dimensionality (2D or 3D) and thickness; cell polarity; area, shape, and microscale topography of cell adhesion surface; epitope concentration, epitope clustering characteristics (number of epitopes per cluster, spacing between epitopes within cluster, spacing between separate clusters, cluster patterns, and level of disorder in epitope arrangement), and nanotopography. Biochemical characteristics of natural extracellular matrix molecules regard diversity and structural complexity of matrix molecules, affinity and specificity of epitope interaction with cell receptors, role of non-affinity domains, complexity of supramolecular organization, and co-signaling by growth factors or matrix epitopes. Synergy between several matrix aspects enables stem cells to retain their function in vivo and may be a key to generation of long-term, robust, and effective in vitro stem cell culture systems. PMID:26351461

Short-term implantation effects of a DCPD-based calcium phosphate cement.

PubMed

Frayssinet, P; Gineste, L; Conte, P; Fages, J; Rouquet, N

1998-06-01

Calcium phosphate cements can be handled in paste form and set in a wet medium after precipitation of calcium phosphate crystals in the implantation site. Depending on the products entering into the chemical reaction leading to the precipitation of calcium phosphates, different phases can be obtained with different mechanical properties, setting times and injectability. We tested a cement composed of a powder, containing beta-tricalcium phosphate (beta-TCP) and sodium pyrophosphate mixed with a solution of phosphoric and sulphuric acids. The cement set under a dicalcium phosphate dihydrate (DCPD)-based matrix containing beta-TCP particles. This was injected with a syringe into a defect drilled in rabbit condyles, the control being an identical defect left empty in the opposite condyle. The condyles were analysed histologically 2, 6 and 18 weeks after implantation. After injection into the bone defect the cement set and formed a porous calcium phosphate structure. Two different calcium phosphate phases with different solubility rates could be identified by scanning electron microscopy (SEM) observation. The less-soluble fragments could be degraded by cell phagocytosis in cell compartments of low pH or integrated in the newly formed bone matrix. The degradation rate of the material was relatively high but compatible with the ingrowth of bone trabeculae within the resorbing material. The ossification process was different from the creeping substitution occurring at the ceramic contact. Bone did not form directly at the cement surface following the differentiation of osteoblasts at the material surface. The trabeculae came to the material surface from the edges of the implantation site. Bone formation in the implantation site was significantly higher than in the control region during the first week of implantation. In conclusion, this material set in situ was well tolerated, inducing a mild foreign-body reaction, which did not impair its replacement by newly formed bone within a few weeks.

[Penile augmentation using acellular dermal matrix].

PubMed

Zhang, Jin-ming; Cui, Yong-yan; Pan, Shu-juan; Liang, Wei-qiang; Chen, Xiao-xuan

2004-11-01

Penile enhancement was performed using acellular dermal matrix. Multiple layers of acellular dermal matrix were placed underneath the penile skin to enlarge its girth. Since March 2002, penile augmentation has been performed on 12 cases using acellular dermal matrix. Postoperatively all the patients had a 1.3-3.1 cm (2.6 cm in average) increase in penile girth in a flaccid state. The penis had normal appearance and feeling without contour deformities. All patients gained sexual ability 3 months after the operation. One had a delayed wound healing due to tight dressing, which was repaired with a scrotal skin flap. Penile enlargement by implantation of multiple layers of acellular dermal matrix was a safe and effective operation. This method can be performed in an outpatient ambulatory setting. The advantages of the acellular dermal matrix over the autogenous dermal fat grafts are elimination of donor site injury and scar and significant shortening of operation time.

Block copolymer templated self-assembly of disk-shaped molecules

NASA Astrophysics Data System (ADS)

Aragones, J. L.; Alexander-Katz, A.

2017-08-01

Stacking of disk-shaped organic molecules is a promising strategy to develop electronic and photovoltaic devices. Here, we investigate the capability of a soft block copolymer matrix that microphase separates into a cylindrical phase to direct the self-assembly of disk-shaped molecules by means of molecular simulations. We show that two disk molecules confined in the cylinder domain experience a depletion force, induced by the polymer chains, which results in the formation of stacks of disks. This entropic interaction and the soft confinement provided by the matrix are both responsible for the structures that can be self-assembled, which include slanted or columnar stacks. In addition, we evidence the transmission of stresses between the different minority domains of the microphase, which results in the establishment of a long-ranged interaction between disk molecules embedded in different domains; this interaction is of the order of the microphase periodicity and may be exploited to direct assembly of disks at larger scales.

Histologic analysis of fetal bovine derived acellular dermal matrix in tissue expander breast reconstruction.

PubMed

Gaster, Richard S; Berger, Aaron J; Monica, Stefanie D; Sweeney, Robert T; Endress, Ryan; Lee, Gordon K

2013-04-01

This study seeks to determine human host response to fetal bovine acellular dermal matrix (ADM) in staged implant-based breast reconstruction. A prospective study was performed for patients undergoing immediate breast reconstruction with tissue expander placement and SurgiMend acellular fetal bovine dermis. At the time of exchange for permanent implant, we obtained tissue specimens of SurgiMend and native capsule. Histological and immunohistochemical assays were performed to characterize the extent of ADM incorporation/degradation, host cell infiltration, neovascularization, inflammation, and host replacement of acellular fetal bovine collagen. Seventeen capsules from 12 patients were included in our study. The average "implantation" time of SurgiMend was 7.8 months (range, 2-23 months). Histological analysis of the biopsy of tissue revealed rare infiltration of host inflammatory cells, even at 23 months. One patient had an infection requiring removal of the tissue expander at 2 months. Contracture, inflammatory changes, edema, and polymorphonuclear leukocyte infiltration were rare in the ADM. An acellular capsule was seen in many cases, at the interface of SurgiMend with the tissue expander. SurgiMend demonstrated a very infrequent inflammatory response. An antibody specific to bovine collagen allowed for direct identification of bovine collagen separate from human collagen. Cellular infiltration and neovascularization of SurgiMend correlated with the quality of the mastectomy skin flap rather than the duration of implantation. Future studies are needed to further characterize the molecular mechanisms underlying tissue incorporation of this product.

Implantation of healthy matrix-embedded endothelial cells rescues dysfunctional endothelium and ischemic tissue in liver engraftment

PubMed Central

Melgar-Lesmes, Pedro; Balcells, Mercedes; Edelman, Elazer R.

2017-01-01

Objective Liver transplantation is limited by ischemic injury which promotes endothelial cell and hepatocyte dysfunction and eventually organ failure. We sought to understand how endothelial state determines liver recover after hepatectomy and engraftment. Design Matrix-embedded endothelial cells (MEECs) with retained healthy phenotype or control acellular matrices were implanted in direct contact with the remaining median lobe of donor mice undergoing partial hepatectomy (70%), or in the interface between the remaining median lobe and an autograft or isograft from the left lobe in hepatectomized recipient mice. Hepatic vascular architecture, DNA fragmentation and apoptosis in the median lobe and grafts, serum markers of liver damage and phenotype of macrophage and lymphocyte subsets in the liver after engraftment were analyzed 7 days post-op. Results Healthy MEECs create a functional vascular splice in donor and recipient liver after 70% hepatectomy in mouse protecting these livers from ischemic injury, hepatic congestion and inflammation. Macrophages recruited adjacent to the vascular nodes into the implants switched to an anti-inflammatory and regenerative profile M2. MEECs improved liver function and the rate of liver regeneration and prevented apoptosis in donor liver lobes, autologous grafts, and allogeneic engraftment. Conclusions Implants with healthy endothelial cells rescue liver donor and recipient endothelium and parenchyma from ischemic injury after major hepatectomy and engraftment. This study highlights endothelial-hepatocyte crosstalk in hepatic repair and provides a promising new approach to improve regenerative medicine outcomes and liver transplantation. PMID:26851165

Laser desorption ionization mass spectrometry: Recent progress in matrix-free and label-assisted techniques.

PubMed

Mandal, Arundhoti; Singha, Monisha; Addy, Partha Sarathi; Basak, Amit

2017-10-13

The MALDI-based mass spectrometry, over the last three decades, has become an important analytical tool. It is a gentle ionization technique, usually applicable to detect and characterize analytes with high molecular weights like proteins and other macromolecules. The earlier difficulty of detection of analytes with low molecular weights like small organic molecules and metal ion complexes with this technique arose due to the cluster of peaks in the low molecular weight region generated from the matrix. To detect such molecules and metal ion complexes, a four-prong strategy has been developed. These include use of alternate matrix materials, employment of new surface materials that require no matrix, use of metabolites that directly absorb the laser light, and the laser-absorbing label-assisted LDI-MS (popularly known as LALDI-MS). This review will highlight the developments with all these strategies with a special emphasis on LALDI-MS. © 2017 Wiley Periodicals, Inc.

Characterization of porous glass fiber-reinforced composite (FRC) implant structures: porosity and mechanical properties.

PubMed

Ylä-Soininmäki, Anne; Moritz, Niko; Lassila, Lippo V J; Peltola, Matti; Aro, Hannu T; Vallittu, Pekka K

2013-12-01

The aim of this study was to characterize the microstructure and mechanical properties of porous fiber-reinforced composites (FRC). Implants made of the FRC structures are intended for cranial applications. The FRC specimens were prepared by impregnating E-glass fiber sheet with non-resorbable bifunctional bis-phenyl glycidyl dimethacrylate and triethylene glycol dimethacrylate resin matrix. Four groups of porous FRC specimens were prepared with a different amount of resin matrix. Control group contained specimens of fibers, which were bound together with sizing only. Microstructure of the specimens was analyzed using a micro computed tomography (micro-CT) based method. Mechanical properties of the specimens were measured with a tensile test. The amount of resin matrix in the specimens had an effect on the microstructure. Total porosity was 59.5 % (median) in the group with the lowest resin content and 11.2 % (median) in the group with the highest resin content. In control group, total porosity was 94.2 % (median). Correlations with resin content were obtained for all micro-CT based parameters except TbPf. The tensile strength of the composites was 21.3 MPa (median) in the group with the highest resin content and 43.4 MPa (median) in the group with the highest resin content. The tensile strength in control group was 18.9 MPa (median). There were strong correlations between the tensile strength of the specimens and most of the micro-CT based parameters. This experiment suggests that porous FRC structures may have the potential for use in implants for cranial bone reconstructions, provided further relevant in vitro and in vivo tests are performed.

Multilayer cell-seeded polymer nanofiber constructs for soft-tissue reconstruction.

PubMed

Barker, Daniel A; Bowers, Daniel T; Hughley, Brian; Chance, Elizabeth W; Klembczyk, Kevin J; Brayman, Kenneth L; Park, Stephen S; Botchwey, Edward A

2013-09-01

Cell seeding throughout the thickness of a nanofiber construct allows for patient-specific implant alternatives with long-lasting effects, earlier integration, and reduced inflammation when compared with traditional implants. Cell seeding may improve implant integration with host tissue; however, the effect of cell seeding on thick nanofiber constructs has not been studied. To use a novel cell-preseeded nanofiber tissue engineering technique to create a 3-dimensional biocompatible implant alternative to decellularized extracellular matrix. Animal study with mammalian cell culture to study tissue engineered scaffolds. Academic research laboratory. Thirty-six Sprague-Dawley rats. The rats each received 4 implant types. The grafts included rat primary (enhanced green fluorescent protein-positive [eGFP+]) fibroblast-seeded polycaprolactone (PCL)/collagen nanofiber scaffold, PCL/collagen cell-free nanofiber scaffold, acellular human cadaveric dermis (AlloDerm), and acellular porcine dermis (ENDURAGen). Rats were monitored postoperatively and received enrofloxacin in the drinking water for 4 days prophylactically and buprenorphine (0.2-0.5 mg/kg administered subcutaneously twice a day postoperatively for pain for 48 hours). The viability of NIH/3T3 fibroblasts cultured on PCL electrospun nanofibers was evaluated using fluorescence microscopy. Soft-tissue remodeling was examined histologically and with novel ex vivo volume determinations of implants using micro-computed tomography of cell-seeded implants relative to nanofibers without cells and commonly used dermal grafts of porcine and human origin (ENDURAGen and AlloDerm, respectively). The fate and distribution of eGFP+ seeded donor fibroblasts were assessed using immunohistochemistry. Fibroblasts migrated across nanofiber layers within 12 hours and remained viable on a single layer for up to 14 days. Scanning electron microscopy confirmed a nanoscale structure with a mean (SD) diameter of 158 (72) nm. Low extrusion rates demonstrated the excellent biocompatibility in vivo. Histological examination of the scaffolds demonstrated minimal inflammation. Cell seeding encouraged rapid vascularization of the nanofiber implants. Cells of donor origin (eGFP+) declined with the duration of implantation. Implant volume was not significantly affected for up to 8 weeks by the preseeding of cells (P > .05). Polymer nanofiber-based scaffolds mimic natural extracellular matrix. Preseeding the nanofiber construct with cells improved vascularization without notable effects on volume. An effect of cell preseeding on scaffold vascularization was evident beyond the presence of preseeded cells. This 3-dimensional, multilayer method of cell seeding throughout a 1-mm-thick construct is simple and feasible for clinical application. Further development of this technique may affect the clinical practice of facial plastic and reconstructive surgeons.

Single-stage cell-based cartilage regeneration using a combination of chondrons and mesenchymal stromal cells: comparison with microfracture.

PubMed

Bekkers, Joris E J; Tsuchida, Anika I; van Rijen, Mattie H P; Vonk, Lucienne A; Dhert, Wouter J A; Creemers, Laura B; Saris, Daniel B F

2013-09-01

Autologous chondrocyte implantation (ACI) is traditionally a 2-step procedure used to repair focal articular cartilage lesions. With use of a combination of chondrons (chondrocytes in their own territorial matrix) and mesenchymal stromal cells (MSCs), ACI could be innovated and performed in a single step, as sufficient cells would be available to fill the defect within a 1-step surgical procedure. Chondrons have been shown to have higher regenerative capacities than chondrocytes without such a pericellular matrix. To evaluate cartilage formation by a combination of chondrons and MSCs in vitro and in both small and large animal models. Controlled laboratory study. Chondrons and MSCs were cultured at different ratios in vitro containing 0%, 5%, 10%, 20%, 50%, or 100% chondrons (n = 3); embedded in injectable fibrin glue (Beriplast); and implanted subcutaneously in nude mice (n = 10; ratios of 0%, 5%, 10%, and 20% chondrons). Also, in a 1-step procedure, a combination of chondrons and MSCs was implanted in a freshly created focal articular cartilage lesion (10% chondrons) in goats (n = 8) and compared with microfracture. The effect of both treatments, after 6-month follow-up, was evaluated using biochemical glycosaminoglycan (GAG) and GAG/DNA analysis and scored using validated scoring systems for macroscopic and microscopic defect repairs. The addition of MSCs to chondron cultures enhanced cartilage-specific matrix production as reflected by a higher GAG production (P < .03), both in absolute levels and normalized to DNA content, compared with chondrocyte and 100% chondron cultures. Similar results were observed after 4 weeks of subcutaneous implantation in nude mice. Treatment of freshly created cartilage defects in goats using a combination of chondrons and MSCs in Beriplast resulted in better microscopic, macroscopic, and biochemical cartilage regeneration (P ≤ .02) compared with microfracture treatment. The combination of chondrons and MSCs increased cartilage matrix formation, and this combination of cells was safely applied in a goat model for focal cartilage lesions, outperforming microfracture. This study describes the bench-to-preclinical development of a new cell-based regenerative treatment for focal articular cartilage defects that outperforms microfracture in goats. In addition, it is a single-step procedure, thereby making the expensive cell expansion and reimplantation of dedifferentiated cells, as in ACI, redundant.

Site location and optical properties of Eu implanted sapphire

NASA Astrophysics Data System (ADS)

Marques, C.; Wemans, A.; Maneira, M. J. P.; Kozanecki, A.; da Silva, R. C.; Alves, E.

2005-10-01

Synthetic colourless transparent (0 0 0 1) sapphire crystals were implanted at room temperature with 100 keV europium ions to fluences up to 1 × 1016 cm-2. Surface damage is observed at low fluences, as seen by Rutherford backscattering spectrometry under channelling conditions. Optical absorption measurements revealed a variety of structures, most probably related to F-type defects characteristic of implantation damage. Thermal treatments in air or in vacuum up to 1000 °C do not produce noticeable changes both in the matrix or the europium profiles. However, the complete recovery of the implantation damage and some redistribution of the europium ions is achieved after annealing at 1300 °C in air. Detailed lattice site location studies performed for various axial directions allowed to assess the damage recovery and the incorporation of the Eu ions into well defined crystallographic sites, possibly in an oxide phase also inferred from optical absorption measurements.

Determination of the implantation dose in silicon wafers by X-ray fluorescence analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klockenkaemper, R.; Becker, M.; Bubert, H.

1990-08-01

The ion dose implanted in silicon wafers was determined by X-ray fluorescence analysis after the implantation process. As only near-surface layers below 1-{mu}m thickness were considered, the calibration could be carried out with external standards consisting of thin films of doped gelatine spread on pure wafers. Dose values for Cr and Co were determined between 4 {times} 10{sup 15} and 2 {times} 10{sup 17} atoms/cm{sup 2}, the detection limits being about 3 {times} 10{sup 14} atoms/cm{sup 2}. The results are precise and accurate apart from a residual scatter of less than 7%. This was confirmed by flame atomic absorption spectrometrymore » after volatilization of the silicon matrix as SiF{sub 4}. It was found that ion-current measurements carried out during the implantation process can have considerable systematic errors.« less

Physical Selectivity of Molecularly Imprinted polymers evaluated through free volume size distributions derived from Positron Lifetime Spectroscopy

NASA Astrophysics Data System (ADS)

Pasang, T.; Ranganathaiah, C.

2015-06-01

The technique of imprinting molecules of various sizes in a stable structure of polymer matrix has derived multitudes of applications. Once the template molecule is extracted from the polymer matrix, it leaves behind a cavity which is physically (size and shape) and chemically (functional binding site) compatible to the particular template molecule. Positron Annihilation Lifetime Spectroscopy (PALS) is a well known technique to measure cavity sizes precisely in the nanoscale and is not being used in the field of MIPs effectively. This method is capable of measuring nanopores and hence suitable to understand the physical selectivity of the MIPs better. With this idea in mind, we have prepared molecular imprinted polymers (MIPs) with methacrylicacid (MAA) as monomer and EGDMA as cross linker in different molar ratio for three different size template molecules, viz. 4-Chlorophenol (4CP)(2.29 Å), 2-Nephthol (2NP) (3.36 Å) and Phenolphthalein (PP) (4.47Å). FTIR and the dye chemical reactions are used to confirm the complete extraction of the template molecules from the polymer matrix. The free volume size and its distribution have been derived from the measured o-Ps lifetime spectra. Based on the free volume distribution analysis, the percentage of functional cavities for the three template molecules are determined. Percentage of functional binding cavities for 4-CP molecules has been found out to be 70.2% and the rest are native cavities. Similarly for 2NP it is 81.5% and nearly 100% for PP. Therefore, PALS method proves to be very precise and accurate for determining the physical selectivity of MIPs.

Development of FRP composite structural biomaterials: ultimate strength of the fiber/matrix interfacial bond in in vivo simulated environments.

PubMed

Latour, R A; Black, J

1992-05-01

Fiber reinforced polymer (FRP) composites are being developed as alternatives to metals for structural orthopedic implant applications. FRP composite fracture behavior and environmental interactions are distinctly different from those which occur in metals. These differences must be accounted for in the design and evaluation of implant performance. Fiber/matrix interfacial bond strength in a FRP composite is known to strongly influence fracture behavior. The interfacial bond strength of four candidate fiber/matrix combinations (carbon fiber/polycarbonate, carbon fiber/polysulfone, polyaramid fiber/polycarbonate, polyaramid fiber/polysulfone) were investigated at 37 degrees C in dry and in vivo simulated (saline, exudate) environments. Ultimate bond strength was measured by a single fiber-microdroplet pull-out test. Dry bond strengths were significantly decreased following exposure to either saline or exudate with bond strength loss being approximately equal in both the saline and exudate. Bond strength loss is attributed to the diffusion of water and/or salt ions into the sample and their interaction with interfacial bonding. Because bond degradation is dependent upon diffusion, diffusional equilibrium must be obtained in composite test samples before the full effect of the test environment upon composite mechanical behavior can be determined.

[Clinical and etiopathogenetic role of plasminogen and metaloproteinase systems in the tumor growth. Pericellular proteolysis of extracellular matrix and tumor growth].

PubMed

Cosić, Sanda Jelisavac; Kovac, Zdenko

2011-01-01

Pericellular proteolysis is a cascade process involved in degradation of extracellular matrix. This process is included in various physiological and pathological processes. Pericellullar proteolysis has major functions like degradation of tissue stroma and weakening of intercellular connections but it also has a function in the synthesis of bioactive molecules (cytokines, growth factors and inhibitory factors). Plasminogen system is involved in fibrinolysis and starts metalloproteinase activation. Activity of proteolytic molecules is controlled by the rate of zymogenic activation, half-life of molecules, and action of inhibitory molecules. Inhibition is achieved through direct binding of inhibitor and enzyme and takes a few steps. Pericellular proteolysis is involved in tumor invasion and metastasis, inflammatory reaction, degenerative diseases and other diseases. Pathophysiological regulation of pericellular proteolysis in mentioned diseases contributes to clinical properties of diseases and has diagnostic and therapeutic importance.

Effect of insertion torque on titanium implant osseointegration: an animal experimental study.

PubMed

Duyck, Joke; Roesems, Rutger; Cardoso, Marcio V; Ogawa, Toru; De Villa Camargos, Germana; Vandamme, Katleen

2015-02-01

To evaluate the effect of implant insertion torque on the peri-implant bone healing and implant osseointegration. Bilaterally in the tibia of five adult New Zealand white rabbits, 20 implants were installed, subdivided into four groups, corresponding to two insertion torque conditions (low, < 10 Ncm vs. high > 50 Ncm) and 2 experimental periods (2 weeks vs. 4 weeks of healing). The implant insertion torque was determined by the surgical drill diameter relative to the implant diameter. Implant osseointegration was evaluated by quantitative histology (bone-to-implant contact with host bone [BIC-host], with neoformed bone [BIC-de novo], with both bone types [BIC-total], and peri-implant bone [BA/TA]). Every response was modelled over time using GEE (general estimation equation) with an unstructured variance-covariance matrix to correct for dependency between the measurements from one animal. The statistical significance level of α = 0.05 was applied. Significantly, more BIC-host and BIC-total were recorded for H implants compared with L implants after 2 week of healing (P = 0.010 and P = 0.0001, respectively). However, this result was no longer found for the extended healing period. Furthermore, BIC-total significantly increased over time for L implants (P < 0.00001). In contrast, the significant increase in BA/TA over time was found for H implants (P < 0.01). Finally, H insertion torque led to an increased BA/TA after 4 week of healing (P < 0.02) compared with the L insertion protocol. L insertion torque implants installed in the rabbit tibial bone osseointegrate with considerable de novo bone formation. This bone neoformation enables L implants to catch up, already during the early osseointegration stage, the initial inferior amount BIC contact compared with that of H implants. A negative impact of the created strain environment accompanying H insertion torque implant installation on the biological process of osseointegration could not be observed, at least not at tissue level. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Efficient optical nonlinear Langmuir-Blodgett films: roles of matrix molecules

NASA Astrophysics Data System (ADS)

Ma, Shihong; Lu, Xingze; Liu, Liying; Han, Kui; Wang, Wencheng; Zhang, Zhi-Ming

1996-10-01

A novel bifat-chain amphiphilic molecule nitrogencrown (NC) was adopted as an inert material for fabrication of optical nonlinear Langmuir-Blodgett (LB) multilayers. Structural improvement in the Z-type mixed fullerene derivative (C60-Be)/NC LB multilayers samples was realized by insertion of the C60-Be molecules between two hydrophobic chains of the NC molecules. The relatively large third-order susceptibility (chi) (3)xxxx(- 3(omega) ;(omega) ,(omega) ,(omega) ) equals 2.9 multiplied by 10-19 M2V-2 (or 2.1 multiplied by 10-11 esu) was deduced by measuring third harmonic generation (THG) from the C60-Be samples. The second harmonic generation (SHG) intensity increased quadratically with the bilayer number (up to 116 bilayers) in Y-type hemicyanine (HEM)/NC interleaving LB multilayers due to improvement of the structural properties by insertion of the long hydrophobic tail of HEM molecules between two chains of NC molecules. The second-order susceptibility (chi) (2)zxx(-2(omega) ;(omega) ,(omega) ) equals 18 pM V-1 (or 4.35 multiplied by 10-8 esu) was obtained by measuring SHG from the HEM samples. The NC molecule has attractive features as a matrix material in fabrications of LB multilayers made from optically nonlinear materials with hydrophobic long tails or ball-like molecules.

Nanotechnology for dental implants.

PubMed

Tomsia, Antoni P; Lee, Janice S; Wegst, Ulrike G K; Saiz, Eduardo

2013-01-01

With the advent of nanotechnology, an opportunity exists for the engineering of new dental implant materials. Metallic dental implants have been successfully used for decades, but they have shortcomings related to osseointegration and mechanical properties that do not match those of bone. Absent the development of an entirely new class of materials, faster osseointegration of currently available dental implants can be accomplished by various surface modifications. To date, there is no consensus regarding the preferred method(s) of implant surface modification, and further development will be required before the ideal implant surface can be created, let alone become available for clinical use. Current approaches can generally be categorized into three areas: ceramic coatings, surface functionalization, and patterning on the micro- to nanoscale. The distinctions among these are imprecise, as some or all of these approaches can be combined to improve in vivo implant performance. These surface improvements have resulted in durable implants with a high percentage of success and long-term function. Nanotechnology has provided another set of opportunities for the manipulation of implant surfaces in its capacity to mimic the surface topography formed by extracellular matrix components of natural tissue. The possibilities introduced by nanotechnology now permit the tailoring of implant chemistry and structure with an unprecedented degree of control. For the first time, tools are available that can be used to manipulate the physicochemical environment and monitor key cellular events at the molecular level. These new tools and capabilities will result in faster bone formation, reduced healing time, and rapid recovery to function.

Recommendations for Quantitative Analysis of Small Molecules by Matrix-assisted laser desorption ionization mass spectrometry

PubMed Central

Wang, Poguang; Giese, Roger W.

2017-01-01

Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) has been used for quantitative analysis of small molecules for many years. It is usually preceded by an LC separation step when complex samples are tested. With the development several years ago of “modern MALDI” (automation, high repetition laser, high resolution peaks), the ease of use and performance of MALDI as a quantitative technique greatly increased. This review focuses on practical aspects of modern MALDI for quantitation of small molecules conducted in an ordinary way (no special reagents, devices or techniques for the spotting step of MALDI), and includes our ordinary, preferred Methods The review is organized as 18 recommendations with accompanying explanations, criticisms and exceptions. PMID:28118972

Density-matrix approach for the electroluminescence of molecules in a scanning tunneling microscope.

PubMed

Tian, Guangjun; Liu, Ji-Cai; Luo, Yi

2011-04-29

The electroluminescence (EL) of molecules confined inside a nanocavity in the scanning tunneling microscope possesses many intriguing but unexplained features. We present here a general theoretical approach based on the density-matrix formalism to describe the EL from molecules near a metal surface induced by both electron tunneling and localized surface plasmon excitations simultaneously. It reveals the underlying physical mechanism for the external bias dependent EL. The important role played by the localized surface plasmon on the EL is highlighted. Calculations for porphyrin derivatives have reproduced corresponding experimental spectra and nicely explained the observed unusual large variation of emission spectral profiles. This general theoretical approach can find many applications in the design of molecular electronic and photonic devices.

Ion penetration depth in the plant cell wall

NASA Astrophysics Data System (ADS)

Yu, L. D.; Vilaithong, T.; Phanchaisri, B.; Apavatjrut, P.; Anuntalabhochai, S.; Evans, P.; Brown, I. G.

2003-05-01

This study investigates the depth of ion penetration in plant cell wall material. Based on the biological structure of the plant cell wall, a physical model is proposed which assumes that the wall is composed of randomly orientated layers of cylindrical microfibrils made from cellulose molecules of C 6H 12O 6. With this model, we have determined numerical factors for ion implantation in the plant cell wall to correct values calculated from conventional ion implantation programs. Using these correction factors, it is possible to apply common ion implantation programs to estimate the ion penetration depth in the cell for bioengineering purposes. These estimates are compared with measured data from experiments and good agreement is achieved.

Hypothesis: Co-transfer of genuine embryos and implantation-promoting compounds via artificial containers improve endometrium receptivity.

PubMed

Celik, Onder; Acet, Mustafa; Celik, Sudenaz; Sahin, Levent; Koc, Onder; Celik, Nilufer

2017-06-01

As with other organs endometrial functions are altered with the advancing age. Age related decrease in reproductive functions leads to decline in the number of oocytes retrieved and the synthesis of endometrial receptivity molecules. Despite the significant improvement in assisted reproductive technologies we do not have so many options to enhance endometrial receptivity. Due to lack of drugs having endometrium receptivity enhancement properties, oocyte donation seems to be the only solution for women with implantation failure. The euploid oocytes come from young and healthy donors may overcome age associated endometrial receptivity defect. Nevertheless, many reasons restrict us from using oocyte donation in women with implantation failure. We, therefore, hypothesized that by mimicking a young blastocyst's effect on endometrium, the transfer of genuine embryos and implantation-promoting compounds together might be the new treatment option for infertile women with recurrent implantation failure. Artificial beads, MI or GV oocytes, and empty zona can be used as a container for intrauterine replacement of implantation-promoting compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ion implantation in ices and its relevance to the icy moons of the external planets

NASA Astrophysics Data System (ADS)

Strazzulla, G.; Baratta, G. A.; Fulvio, D.; Garozzo, M.; Leto, G.; Palumbo, M. E.; Spinella, F.

2007-08-01

Solid, atmosphere-less objects in the Solar System are continuously irradiated by energetic ions mostly in the keV-MeV energy range. Being the penetration depth of the incoming ions usually much lower than the thickness of the target, they are stopped into the ice. They deposit energy in the target induce the breaking of molecular bonds. The recombination of fragments produce different molecules. Reactive ions (e.g., H, C, N, O, S) induce all of the effects of any other ion, but in addition have a chance, by implantation in the target, to form new species containing the projectile. An ongoing research program performed at our laboratory has the aim to investigate ion implantation of reactive ions in many relevant ice mixtures. The results obtained so far indicate that some molecular species observed on icy planetary surfaces could not be native of that object but formed by implantation of reactive ions. In particular we present data obtained after: • C, N and S implantation in water ice • H implantation in carbon and sulfur dioxide

Construction of the Fock Matrix on a Grid-Based Molecular Orbital Basis Using GPGPUs.

PubMed

Losilla, Sergio A; Watson, Mark A; Aspuru-Guzik, Alán; Sundholm, Dage

2015-05-12

We present a GPGPU implementation of the construction of the Fock matrix in the molecular orbital basis using the fully numerical, grid-based bubbles representation. For a test set of molecules containing up to 90 electrons, the total Hartree-Fock energies obtained from reference GTO-based calculations are reproduced within 10(-4) Eh to 10(-8) Eh for most of the molecules studied. Despite the very large number of arithmetic operations involved, the high performance obtained made the calculations possible on a single Nvidia Tesla K40 GPGPU card.

[Experimental study of the collagen matrix for increase the gums using a 3D-modeling].

PubMed

Baulin, I M; Badalyan, V A; Ryakhovsky, A N

2015-01-01

In an experimental study on mini-pigs demonstrated that the use of collagen matrix Mucograft open method leads to the formation of mature connective tissue around the implants, more pronounced after 70 days, and the width of attached mucosa already 45th day (from 4.4 ± 0.3 to 7.7 ± 0.5 mm) is comparable to that of free gingival graft. Three-dimensional computer modeling of jaws experimental animals showed the soft tissue augmentation by 0.8 ± 0.1 cm3 after use of collagen matrix Mucograft and 1.1 ± 0.12 cm3 after free gingival graft.

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, Daniel J.; Wallace, J. Shield

1998-01-01

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle.

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, D.J.; Wallace, J.S.

1998-08-18

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle. 13 figs.

Current concepts in periodontal bioengineering

PubMed Central

Taba, M.; Jin, Q.; Sugai, J.V.; Giannobile, W.V.

2008-01-01

Repair of tooth supporting alveolar bone defects caused by periodontal and peri-implant tissue destruction is a major goal of reconstructive therapy. Oral and craniofacial tissue engineering has been achieved with limited success by the utilization of a variety of approaches such as cell-occlusive barrier membranes, bone substitutes and autogenous block grafting techniques. Signaling molecules such as growth factors have been used to restore lost tooth support because of damage by periodontal disease or trauma. This paper will review emerging periodontal therapies in the areas of materials science, growth factor biology and cell/gene therapy. Several different polymer delivery systems that aid in the targeting of proteins, genes and cells to periodontal and peri-implant defects will be highlighted. Results from preclinical and clinical trials will be reviewed using the topical application of bone morphogenetic proteins (BMP-2 and BMP-7) and platelet-derived growth factor-BB (PDGF) for periodontal and peri-implant regeneration. The paper concludes with recent research on the use of ex vivo and in vivo gene delivery strategies via gene therapy vectors encoding growth promoting and inhibiting molecules (PDGF, BMP, noggin and others) to regenerate periodontal structures including bone, periodontal ligament and cementum. PMID:16238610

Hybrid PCL/CaCO3 scaffolds with capabilities of carrying biologically active molecules: Synthesis, loading and in vivo applications.

PubMed

Saveleva, M S; Ivanov, A N; Kurtukova, M O; Atkin, V S; Ivanova, A G; Lyubun, G P; Martyukova, A V; Cherevko, E I; Sargsyan, A K; Fedonnikov, A S; Norkin, I A; Skirtach, A G; Gorin, D A; Parakhonskiy, B V

2018-04-01

Designing advanced biomaterials for tissue regeneration with drug delivery and release functionalities remains a challenge in regenerative medicine. In this research, we have developed novel composite scaffolds based on polymeric polycaprolactone fibers coated with porous calcium carbonate structures (PCL/CaCO 3 ) for tissue engineering and have shown their drug delivery and release in rats. In vivo biocompatibility tests of PCL/CaCO 3 scaffolds were complemented with in vivo drug release study, where tannic acid (TA) was used as a model drug. Release of TA from the scaffolds was realized by recrystallization of the porous vaterite phase of calcium carbonate into the crystalline calcite. Cell colonization and tissue vascularization as well as transplantability of developed PCL/CaCO 3 +TA scaffolds were observed. Detailed study of scaffold transformations during 21-day implantation period was followed by scanning electron microscopy and X-ray diffraction studies before and after in vivo implantation. The presented results demonstrate that PCL/CaCO 3 scaffolds are attractive candidates for implants in bone regeneration and tissue engineering with a possibility of loading biologically active molecules and controlled release. Copyright © 2017 Elsevier B.V. All rights reserved.

Regional differences of tibial and femoral cartilage in the chondrocyte gene expression, immunhistochemistry and composite in different stages of osteoarthritis.

PubMed

Lahm, A; Dabravolski, D; Spank, H; Merk, H; Esser, J; Kasch, R

2017-04-01

The function of articular cartilage as an avascular tissue is mainly served by collagen type II and proteoglycan molecules. Within this matrix homeostasis between production and breakdown of the matrix is exceptionally sensitive. The current study was conducted to identify regional differences in specific alterations in cartilage composition during the osteoarthritic process of the human knee joint. Therefor the changes in the expression of the key molecules of the extracellular matrix were measured in dependence of the anatomical side (femoral vs tibial) and associated with immunohistochemistry and quantitative measurement. 60 serial osteochondral femoral condyle and the tibial plateau samples of patients undergoing implantation of total knee endoprosthesis of areas showing mild (Group A, macroscopically ICRS grade 1b) respectively advanced (Group B, macroscopically ICRS grade 3a/3b) (30 each) osteoarthritis according to the histological-histochemical grading system (HHGS) were compared with 20 healthy biopsies with immunohistochemistry and histology. We quantified our results on the gene expression of collagen type I and II and aggrecan with the help of real-time (RT)-PCR. Proteoglycan content was measured colorometrically. In group A slightly increased colour intensity was found for collagen II in deeper layers, suggesting a persisting but initially still intact repair process. But especially on the medial tibia plateau the initial Col II increase in gene expression is followed by a decrease leading to the lowest over all Col II expression on the medial plateau, here especially in the central part. There in late stage diseases the collagen type I expression was also more pronounced. Markedly decreased safranin O staining intensity was observed in the radial zone and less reduced intensity in the transitional zone with loss of zonal anatomy in 40% of the specimens in group A and all specimens in group B. Correlation between colorometrically analysed proteoglycan GAG content and aggrecan Real Time PCR is mainly weak. Tibial and femoral cartilage in contrast to patellar cartilage both are preferential exposed to compressive stresses, but presence of menisci affects the load distribution at the tibial side, which creates varying conditions for the different cartilage surfaces in the knee. As directly measured Poissońs ratio in tibial cartilage is higher but Younǵs modulus is lower than in femoral cartilage, different resulting feedback amplification loops interact with proceeding cartilage damage. The initial loss of aggrecan may support Matrix metalloproteinases (Mmps) in the access to the collagen network and the considerably differing mechanical properties at both joint surfaces result in varying increased synthesis and release of matrix degrading enzymes. The present study has identified a selection of events which reflect the response of cartilage structure and composite, chondrocytes itself and their productivity to changes in mechanical stress depending on the anatomical site. Copyright © 2017 Elsevier Ltd. All rights reserved.

Matrix Vesicle Enzyme Activity and Phospholipid Content in Endosteal Bone Following Implantation of Osseointegrating and Non-Osseointegrating Implant Materials.

DTIC Science & Technology

1991-11-01

formation of dental calculus by colonies of organized dental plaque (Boyan et al., 1982; Ennever et al., 1978b; and Sidaway, 1980). Although first thought...chamber was achieved by frontal 17 penetration of the antero-medial aspect of the exposed bone with a saline-cooled, round dental burr (#4) and a...penetration of the antero- 24 25 medial aspect of the exposed bone with a saline-cooled, round dental burr (#4) and a 20,000 RPM motor. The bone marrow

Gelatin promotes rapid restoration of the blood brain barrier after acute brain injury.

PubMed

Kumosa, Lucas S; Zetterberg, Valdemar; Schouenborg, Jens

2018-01-01

Gelatin coating of brain implants is known to provide considerable benefits in terms of reduced inflammatory sequalae and long-term neuroprotective effects. However, the mechanisms for gelatin's protective role in brain injury are still unknown. To address this question, cellular and molecular markers were studied with quantitative immunohistochemical microscopy at acute (<2hours, 1, 3days), intermediate (1-2 weeks) and long-term time points (6 weeks) after transient insertion of stainless steel needles into female rat cortex cerebri with or without gelatin coating. Compared to non-coated controls, injuries caused by gelatin coated needles showed a significantly faster resolution of post-stab bleeding/leakage and differential effects on different groups of microglia cells. While similar levels of matrix metalloproteinase (MMP-2 and MMP-9, two gelatinases) was found for coated and noncoated needle stabs during the first week, markedly increased levels of both MMPs was seen for gelatin-coated but not non-coated needle stabs after 2weeks. Neuronal populations and activated astrocytes were largely unaffected. In conclusion, the beneficial effects of gelatin may be the combined results of faster healing of the blood brain barrier curtailing leakage of blood borne molecules/cells into brain parenchyma and to a modulation of the microglial population response favoring restitution of the injured tissue. These findings present an important therapeutic potential for gelatin coatings in various disease, injury and surgical conditions. The neural interfaces field holds great promise to enable elucidation of neural information processing and to develop new implantable devices for stimulation based therapy. Currently, this field is struggling to find solutions for reducing tissue reactions to implanted micro and nanotechnology. Prior studies have recently shown that gelatin coatings lower activation of digestive microglia and mitigate the ubiquitous loss of neurons adjacent to implanted probes, both of which impede implant function. The underlying mechanisms remain to be elucidated, however. Our findings demonstrate for the first time that gelatin has a significant effect on the BBB by promoting rapid restoration of integrity after injury. Moreover, gelatin alters microglia phenotypes and modulates gelatinase activity for up to 2weeks favoring anti-inflammation and restoration of the tissue. Given the key importance of the BBB for normal brain functions, we believe our findings have substantial significance and will be highly interesting to researchers in the biomaterial field. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Electronic and magnetic properties of Ni nanoparticles embedded in various organic semiconductor matrices.

PubMed

Bräuer, Björn; Vaynzof, Yana; Zhao, Wei; Kahn, Antoine; Li, Wen; Zahn, Dietrich R T; Fernández, César de Julián; Sangregorio, Claudio; Salvan, Georgeta

2009-04-09

Ni nanoparticles with a size distribution from 2 to 6 nm, embedded in various organic matrices, were fabricated in ultrahigh vacuum. For this purpose metal free and Ni phthalocyanine, fullerene C(60), and pentacene were coevaporated with Ni. When coevaporated, Ni and H(2)Pc react, leading to the formation of NiPc and Ni nanoparticles. The molecular structure of the matrix was found to have negligible effect on the size of the nanoparticles but to influence the magnetic anisotropy of the nanoparticles: Ni nanoparticles formed in the buckyball matrix have a cubic symmetry, while nanoparticles formed in matrices consisting of planar molecules exhibit a uniaxial symmetry. After exposure to atmosphere, photoelectron spectroscopy investigations demonstrate the presence of metallic Ni nanoparticles accompanied by Ni oxide and the existence of a charge transfer from the organic matrix to the particles in all investigated systems. The oxidized Ni nanoparticles exhibit a larger magnetic anisotropy compared to the freshly prepared particles which show superparamagnetic properties above 17 K. Moreover, photoelectron spectroscopy was used to probe the oxidation process of the Ni nanoparticles in different organic matrices. It could thus be shown that a matrix consisting of spherical molecules like C(60) prevent the particles much better from oxidation compared to matrices of flat molecules.

Effects of osmotic pressure in the extracellular matrix on tissue deformation.

PubMed

Lu, Y; Parker, K H; Wang, W

2006-06-15

In soft tissues, large molecules such as proteoglycans trapped in the extracellular matrix (ECM) generate high levels of osmotic pressure to counter-balance external pressures. The semi-permeable matrix and fixed negative charges on these molecules serve to promote the swelling of tissues when there is an imbalance of molecular concentrations. Structural molecules, such as collagen fibres, form a network of stretch-resistant matrix, which prevents tissue from over-swelling and keeps tissue integrity. However, collagen makes little contribution to load bearing; the osmotic pressure in the ECM is the main contributor balancing external pressures. Although there have been a number of studies on tissue deformation, there is no rigorous analysis focusing on the contribution of the osmotic pressure in the ECM on the viscoelastic behaviour of soft tissues. Furthermore, most previous works were carried out based on the assumption of infinitesimal deformation, whereas tissue deformation is finite under physiological conditions. In the current study, a simplified mathematical model is proposed. Analytic solutions for solute distribution in the ECM and the free-moving boundary were derived by solving integro-differential equations under constant and dynamic loading conditions. Osmotic pressure in the ECM is found to contribute significantly to the viscoelastic characteristics of soft tissues during their deformation.

A generalized graph-theoretical matrix of heterosystems and its application to the VMV procedure.

PubMed

Mozrzymas, Anna

2011-12-14

The extensions of generalized (molecular) graph-theoretical matrix and vector-matrix-vector procedure are considered. The elements of the generalized matrix are redefined in order to describe molecules containing heteroatoms and multiple bonds. The adjacency, distance, detour and reciprocal distance matrices of heterosystems, and corresponding vectors are derived from newly defined generalized graph matrix. The topological indices, which are most widely used in predicting physicochemical and biological properties/activities of various compounds, can be calculated from the new generalized vector-matrix-vector invariant. Copyright © 2011 Elsevier Ltd. All rights reserved.

Graft shrinkage and survival rate of implants after sinus floor elevation using a nanocrystalline hydroxyapatite embedded in silica gel matrix: a 1-year prospective study.

PubMed

El Hage, Marc; Abi Najm, Semaan; Bischof, Mvark; Nedir, Rabah; Carrel, Jean-Pierre; Bernard, Jean-Pierre

2012-06-01

The aims of this study were (1) to evaluate the vertical shrinkage percentage of nanocrystalline hydroxyapatite embedded in silica gel used for maxillary sinus floor elevation (SFE) and (2) to determine the survival rate of the implants 1 year after placement in the healed grafted sinuses. Eleven maxillary sinuses were augmented in eight patients with NanoBone. After a healing period averaging 14.42 months, 19 implants were placed and followed up with clinical and radiographic evaluation. Panoramic radiographs were taken immediately after SFE and at 12 months after grafting. Measurements of changes in height were made by a computerized measuring technique using an image editing software. The mean graft height shrinkage percentage at 12 months after surgery was 8.84% (±5.32). One implant was lost before loading. All the 18 remaining osseointegrated implants received the prosthetic rehabilitation and were controlled after 3 months of functional loading. The implant survival rate at the 1-year interval was 94.74%. A 100% NanoBone alloplastic graft used in lateral SFE procedures presented limited height shrinkage. Implants placed in these grafted sinuses showed survival rates similar to those found in published data. These results should be interpreted cautiously considering the study's reduced sample size.

Nano Sponges for Drug Delivery and Medicinal Applications

NASA Technical Reports Server (NTRS)

Tour, James M.; Lucente-Schultz, Rebecca; Leonard, Ashley; Kosynkin, Dimitry V.; Price, Brandi Katherine; Hudson, Jared L.; Conyers, Jodie L., Jr.; Moore, Valerie C.; Casscells, S. Ward; Myers, Jeffrey N.;

Human buccal plate extraction socket regeneration with recombinant human platelet-derived growth factor BB or enamel matrix derivative.

PubMed

Nevins, Marc L; Camelo, Marcelo; Schupbach, Peter; Nevins, Myron; Kim, Soo-Woo; Kim, David M

2011-01-01

The objective of this study was to assess the osseous healing of buccal plate extraction socket defects. There were four cohorts: group A (mineral collagen bone substitute [MCBS] scaffold alone), group B (MCBS with recombinant human platelet-derived growth factor BB [rhPDGF-BB; 0.3 mg/mL]), group C (MCBS with enamel matrix derivative [EMD]), and group D (combination of EMD with bone ceramic). The primary outcome of bone quality was evaluated using light microscopy, backscatter scanning electron microscopy, and histomorphometrics. Reentry surgery provided an opportunity for clinical observation of the healed ridge morphology. Sixteen patients with buccal wall extraction socket defects were randomized into four treatment groups of equal size. Grafting was provided at the time of extraction with advancement of the buccal flap for primary closure. A trephine core biopsy of the implant site preparation was performed after 5 months for implant placement. Histologic examination identified new bone healing around the biomaterial scaffolds. Statistically significant differences in new bone formation were not observed among the treatment groups. There was a histomorphometric trend toward more new bone for the rhPDGF-BB-treated group (group B). This group had the most favorable ridge morphology for optimal implant placement.

Metal colloids and semiconductor quantum dots: Linear and nonlinear optical properties

NASA Technical Reports Server (NTRS)

Henderson, D. O.; My, R.; Tung, Y.; Ueda, A.; Zhu, J.; Collins, W. E.; Hall, Christopher

1995-01-01

One aspect of this project involves a collaborative effort with the Solid State Division of ORNL. The thrust behind this research is to develop ion implantion for synthesizing novel materials (quantum dots wires and wells, and metal colloids) for applications in all optical switching devices, up conversion, and the synthesis of novel refractory materials. In general the host material is typically a glass such as optical grade silica. The ions of interest are Au, Ag, Cd, Se, In, P, Sb, Ga and As. An emphasis is placed on host guest interactions between the matrix and the implanted ion and how the matrix effects and implantation parameters can be used to obtain designer level optical devices tailored for specific applications. The specific materials of interest are: CdSe, CdTe, InAs, GaAs, InP, GaP, InSb, GaSb and InGaAs. A second aspect of this research program involves using porous glass (25-200 A) for fabricating materials of finite size. In this part of the program, we are particularly interested in characterizing the thermodynamic and optical properties of these non-composite materials. We also address how phase diagram of the confined material is altered by the interfacial properties between the confined material and the pore wall.

Physicochemical and osteoplastic characteristics of 3D printed bone grafts based on synthetic calcium phosphates and natural polymers

NASA Astrophysics Data System (ADS)

Nezhurina, E. K.; Karalkin, P. A.; Komlev, V. S.; Sviridova, I. K.; Kirsanova, V. A.; Akhmedova, S. A.; Shanskiy, Ya D.; Fedotov, A. Yu; Barinov, S. M.; Sergeeva, N. S.

2018-04-01

A creation of personalized implants for regeneration of bone tissue seems to be a very promising biomedical technological approach. We have studied the physicochemical characteristics, cyto- and biocompatibility of three-dimensional constructs based on sodium alginate and gelatin in combination with 2 types of calcium phosphate (tricalcium phosphate or octacalcium phosphate) obtained by inkjet 3D printing. In our experiments, we have studied the physical and chemical properties of the constructs – their porosity, chemical composition, microarchitecture of the surface and mechanical elasticity. The cytocompatibility of 3D constructs and matrix-for-cell properties were investigated in vitro on a model of human osteosarcoma MG-63 cell line by means of MTT assay. The biocompatibility of 3D constructs was studied on the model of subcutaneous implantation in mice up to 12 weeks. All types of 3D constructs were cytocompatible in vitro, demonstrated good matrix-for-cells properties, and had supported cell proliferation for 2 weeks. In results of subcutaneous in vivo test all constructs demonstrated biocompatibility with slow bioresorption of organic and inorganic components. Osteogenesis proceeded more actively in rat tibia model defects (marginal excision), substituted by 3D printed 3-component implants based on alginate, gelatin and octacalcium phosphate.

Antimicrobial thin films based on ayurvedic plants extracts embedded in a bioactive glass matrix

NASA Astrophysics Data System (ADS)

Floroian, L.; Ristoscu, C.; Candiani, G.; Pastori, N.; Moscatelli, M.; Mihailescu, N.; Negut, I.; Badea, M.; Gilca, M.; Chiesa, R.; Mihailescu, I. N.

2017-09-01

Ayurvedic medicine is one of the oldest medical systems. It is an example of a coherent traditional system which has a time-tested and precise algorithm for medicinal plant selection, based on several ethnopharmacophore descriptors which knowledge endows the user to adequately choose the optimal plant for the treatment of certain pathology. This work aims for linking traditional knowledge with biomedical science by using traditional ayurvedic plants extracts with antimicrobial effect in form of thin films for implant protection. We report on the transfer of novel composites from bioactive glass mixed with antimicrobial plants extracts and polymer by matrix-assisted pulsed laser evaporation into uniform thin layers onto stainless steel implant-like surfaces. The comprehensive characterization of the deposited films was performed by complementary analyses: Fourier transformed infrared spectroscopy, glow discharge optical emission spectroscopy, scanning electron microscopy, atomic force microscopy, electrochemical impedance spectroscopy, UV-VIS absorption spectroscopy and antimicrobial tests. The results emphasize upon the multifunctionality of these coatings which allow to halt the leakage of metal and metal oxides into the biological fluids and eventually to inner organs (by polymer use), to speed up the osseointegration (due to the bioactive glass use), to exert antimicrobial effects (by ayurvedic plants extracts use) and to decrease the implant price (by cheaper stainless steel use).

Semistochastic approach to many electron systems

NASA Astrophysics Data System (ADS)

Grossjean, M. K.; Grossjean, M. F.; Schulten, K.; Tavan, P.

1992-08-01

A Pariser-Parr-Pople (PPP) Hamiltonian of an 8π electron system of the molecule octatetraene, represented in a configuration-interaction basis (CI basis), is analyzed with respect to the statistical properties of its matrix elements. Based on this analysis we develop an effective Hamiltonian, which represents virtual excitations by a Gaussian orthogonal ensemble (GOE). We also examine numerical approaches which replace the original Hamiltonian by a semistochastically generated CI matrix. In that CI matrix, the matrix elements of high energy excitations are choosen randomly according to distributions reflecting the statistics of the original CI matrix.

Laser Sintered Porous Ti-6Al-4V Implants Stimulate Vertical Bone Growth.

PubMed

Cheng, Alice; Cohen, David J; Kahn, Adrian; Clohessy, Ryan M; Sahingur, Kaan; Newton, Joseph B; Hyzy, Sharon L; Boyan, Barbara D; Schwartz, Zvi

2017-08-01

The objective of this study was to examine the ability of 3D implants with trabecular-bone-inspired porosity and micro-/nano-rough surfaces to enhance vertical bone ingrowth. Porous Ti-6Al-4V constructs were fabricated via laser-sintering and processed to obtain micro-/nano-rough surfaces. Male and female human osteoblasts were seeded on constructs to analyze cell morphology and response. Implants were then placed on rat calvaria for 10 weeks to assess vertical bone ingrowth, mechanical stability and osseointegration. All osteoblasts showed higher levels of osteocalcin, osteoprotegerin, vascular endothelial growth factor and bone morphogenetic protein 2 on porous constructs compared to solid laser-sintered controls. Porous implants placed in vivo resulted in an average of 3.1 ± 0.6 mm 3 vertical bone growth and osseointegration within implant pores and had significantly higher pull-out strength values than solid implants. New bone formation and pull-out strength was not improved with the addition of demineralized bone matrix putty. Scanning electron images and histological results corroborated vertical bone growth. This study indicates that Ti-6Al-4V implants fabricated by additive manufacturing to have porosity based on trabecular bone and post-build processing to have micro-/nano-surface roughness can support vertical bone growth in vivo, and suggests that these implants may be used clinically to increase osseointegration in challenging patient cases.

Cross-linked xenogenic collagen implantation in the sheep model for vaginal surgery.

PubMed

Endo, Masayuki; Urbankova, Iva; Vlacil, Jaromir; Sengupta, Siddarth; Deprest, Thomas; Klosterhalfen, Bernd; Feola, Andrew; Deprest, Jan

The properties of meshes used in reconstructive surgery affect the host response and biomechanical characteristics of the grafted tissue. Whereas durable synthetics induce a chronic inflammation, biological grafts are usually considered as more biocompatible. The location of implantation is another determinant of the host response: the vagina is a different environment with specific function and anatomy. Herein, we evaluated a cross-linked acellular collagen matrix (ACM), pretreated by the anti-calcification procedure ADAPT® in a sheep model for vaginal surgery. Ten sheep were implanted with a cross-linked ACM, and six controls were implanted with a polypropylene (PP; 56 g/m 2 ) control. One implant was inserted in the lower rectovaginal septum, and one was used for abdominal wall defect reconstruction. Grafts were removed after 180 days; all graft-related complications were recorded, and explants underwent bi-axial tensiometry and contractility testing. Half of ACM-implanted animals had palpable induration in the vaginal implantation area, two of these also on the abdominal implant. One animal had a vaginal exposure. Vaginal ACMs were 63 % less stiff compared to abdominal ACM explants ( p  = 0.01) but comparable to vaginal PP explants. Seven anterior vaginal ACM explants showed areas of graft degradation on histology. There was no overall difference in vaginal contractility. Considering histologic degradation in the anterior vaginal implant as representative for the host, posterior ACM explants of animals with degradation had a 60 % reduced contractility as compared to PP ( p  = 0.048). Three abdominal implants showed histologic degradation; those were more compliant than non-degraded implants. Vaginal implantation with ACM was associated with graft-related complications (GRCs) and biomechanical properties comparable to PP. Partially degraded ACM had a decreased vaginal contractility.

Extracellular matrix biomimicry for the creation of investigational and therapeutic devices.

PubMed

Pellowe, Amanda S; Gonzalez, Anjelica L

2016-01-01

The extracellular matrix (ECM) is a web of fibrous proteins that serves as a scaffold for tissues and organs, and is important for maintaining homeostasis and facilitating cellular adhesion. Integrin transmembrane receptors are the primary adhesion molecules that anchor cells to the ECM, thus integrating cells with their microenvironments. Integrins play a critical role in facilitating cell-matrix interactions and promoting signal transduction, both from the cell to the ECM and vice versa, ultimately mediating cell behavior. For this reason, many advanced biomaterials employ biomimicry by replicating the form and function of fibrous ECM proteins. The ECM also acts as a reservoir for small molecules and growth factors, wherein fibrous proteins directly bind and present these bioactive moieties that facilitate cell activity. Therefore biomimicry can be enhanced by incorporating small molecules into ECM-like substrates. Biomimetic ECM materials have served as invaluable research tools for studying interactions between cells and the surrounding ECM, revealing that cell-matrix signaling is driven by mechanical forces, integrin engagement, and small molecules. Mimicking pathological ECMs has also elucidated disease specific cell behaviors. For example, biomimetic tumor microenvironments have been used to induce metastatic cell behaviors, and have thereby shown promise for in vitro cancer drug testing and targeting. Further, ECM-like substrates have been successfully employed for autologous cell recolonization for tissue engineering and wound healing. As we continue to learn more about the mechanical and biochemical characteristics of the ECM, these properties can be harnessed to develop new biomaterials, biomedical devices, and therapeutics. © 2015 Wiley Periodicals, Inc.

High resolution mass spectrometry method and system for analysis of whole proteins and other large molecules

DOEpatents

Reilly, Peter T. A. [Knoxville, TN; Harris, William A [Naperville, IL

2010-03-02

A matrix assisted laser desorption/ionization (MALDI) method and related system for analyzing high molecular weight analytes includes the steps of providing at least one matrix-containing particle inside an ion trap, wherein at least one high molecular weight analyte molecule is provided within the matrix-containing particle, and MALDI on the high molecular weight particle while within the ion trap. A laser power used for ionization is sufficient to completely vaporize the particle and form at least one high molecular weight analyte ion, but is low enough to avoid fragmenting the high molecular weight analyte ion. The high molecular weight analyte ion is extracted out from the ion trap, and is then analyzed using a detector. The detector is preferably a pyrolyzing and ionizing detector.

1,5-Diaminonaphthalene hydrochloride assisted laser desorption/ionization mass spectrometry imaging of small molecules in tissues following focal cerebral ischemia.

PubMed

Liu, Huihui; Chen, Rui; Wang, Jiyun; Chen, Suming; Xiong, Caiqiao; Wang, Jianing; Hou, Jian; He, Qing; Zhang, Ning; Nie, Zongxiu; Mao, Lanqun

2014-10-21

A sensitive analytical technique for visualizing small endogenous molecules simultaneously is of great significance for clearly elucidating metabolic mechanisms during pathological progression. In the present study, 1,5-naphthalenediamine (1,5-DAN) hydrochloride was prepared for matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI) of small molecules in liver, brain, and kidneys from mice. Furthermore, 1,5-DAN hydrochloride assisted LDI MSI of small molecules in brain tissue of rats subjected to middle cerebral artery occlusion (MCAO) was carried out to investigate the altered metabolic pathways and mechanisms underlying the development of ischemic brain damage. Our results suggested that the newly prepared matrix possessed brilliant features including low cost, strong ultraviolet absorption, high salt tolerance capacity, and fewer background signals especially in the low mass range (typically m/z < 500), which permitted us to visualize the spatial distribution of a broad range of small molecule metabolites including metal ions, amino acids, carboxylic acids, nucleotide derivatives, peptide, and lipids simultaneously. Nineteen endogenous metabolites involved in metabolic networks such as ATP metabolism, tricarboxylic acid (TCA) cycle, glutamate-glutamine cycle, and malate-aspartate shuttle, together with metal ions and phospholipids as well as antioxidants underwent relatively obvious changes after 24 h of MCAO. The results were highly consistent with the data obtained by MRM MS analysis. These findings highlighted the promising potential of the organic salt matrix for application in the field of biomedical research.

Breast-implant texturing associated with delamination of capsular layers: A histological analysis of the double capsule phenomenon.

PubMed

Efanov, J I; Giot, J P; Fernandez, J; Danino, M A

2017-06-01

Macro-texturing of breast implants was developed with the double goal of improving implant stabilization within the breast cavity and decreasing the rate of capsular contractures. However, recent evidence suggests that double capsular formation, a potentially worrisome phenomenon associated with late seromas and biofilms, occurs with preponderance in macro-textured implants. Our objective was to analyze histologically different regions of double capsules to determine if they are more prone to mechanical movements. A prospective analysis including patients undergoing second-stage expander to definitive breast-implant reconstruction post-mastectomy was conducted after intraoperative identification of the double capsule phenomenon. Two samples were collected from each capsules around the implant, located centrally and laterally. The specimens were sent for histological analysis by the institution's pathologist. In total, 10 patients were identified intraoperatively with partial double capsule phenomenon. Among samples retrieved from the lateral aspect of the breast implant, all were associated with delamination and fractures in the collagen matrix of the double capsules. This phenomenon was not observed in any sample from the dome of the breast. Breast-implant macro-texturing plays an important role on delamination of capsules on lateral portions of the breast, which may have an etiologic role in double capsule formation. Manufacturing implants with macro-texturing on one side and smooth surface on the other could diminish mechanical shear forces responsible for these findings. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

A novel bioerodible deep scleral lamellar cyclosporine implant for uveitis.

PubMed

Gilger, Brian C; Salmon, Jacklyn H; Wilkie, David A; Cruysberg, Lars P J; Kim, Jonghyeon; Hayat, Matt; Kim, Hyuncheol; Kim, Stephanie; Yuan, Peng; Lee, Susan S; Harrington, Susan M; Murray, Patrick R; Edelhauser, Henry F; Csaky, Karl G; Robinson, Michael R

2006-06-01

To determine the feasibility, safety, and effectiveness of an episcleral or deep scleral lamellar sustained release cyclosporine (CsA) device in a naturally occurring animal model of uveitis. A two-compartment perfusion chamber was used to assess in vitro human and equine scleral permeability of fluorescein, dexamethasone-fluorescein, or CsA. A biodegradable, matrix-reservoir CsA implant was designed, and release rates of CsA were determined in vitro. Tissue CsA levels were measured in eyes with the implant. Horses with equine recurrent uveitis (ERU) received episcleral or deep scleral lamellar CsA implants and were monitored for up to 3 years. Dexamethasone-fluorescein and CsA penetrated the in vitro equine sclera poorly; however, low but detectable levels of CsA were detected intraocularly in vivo. The implant placed episclerally failed to control inflammatory episodes in ERU. CsA implants placed in the deep sclera adjacent to the suprachoroidal space resulted in high levels of CsA in most ocular tissues. In clinical equine patients with ERU, frequency of uveitic flare-ups was significantly decreased after implantation of a deep scleral lamellar CsA implant. Diffusion of CsA across the sclera from the episcleral space was not a feasible method of drug delivery to the equine eye. However, placing a deep scleral lamellar CsA implant adjacent to the suprachoroidal space was effective in achieving therapeutic ocular drug concentrations and controlling uveitis in horses with ERU.

The center for production of single-photon emitters at the electrostatic-deflector line of the Tandem accelerator of LABEC (Florence)

NASA Astrophysics Data System (ADS)

Lagomarsino, Stefano; Sciortino, Silvio; Gelli, Nicla; Flatae, Assegid M.; Gorelli, Federico; Santoro, Mario; Chiari, Massimo; Czelusniac, Caroline; Massi, Mirko; Taccetti, Francesco; Agio, Mario; Giuntini, Lorenzo

2018-05-01

The line for the pulsed beam of the 3 MeV Tandetron accelerator at LABEC (Florence) has been upgraded for ion implantation experiments aiming at the fabrication of single-photon emitters in a solid-state matrix. A system based on Al attenuators has been calibrated in order to extend the energy range of the implanted ions from MeV down to the tens of keV. A new motorized XY stage has been installed in the implantation chamber for achieving ultra-fine control on the position of each implanted ion, allowing to reach the scale imposed by lateral straggling. A set-up for the activation of the implanted ions has been developed, based on an annealing furnace operating under controlled high-vacuum conditions. The first experiments have been performed with silicon ions implanted in diamond and the luminescent signal of the silicon-vacancy (SiV) center, peaked at 738 nm, has been observed for a wide range of implantation fluences (108 ÷ 1015 cm-2) and implantation depths (from a few nm to 2.4 μm). Studies on the efficiency of the annealing process have been performed and the activation yield has been measured to range from 1% to 3%. The implantation and annealing facility has thus been tuned for the production of SiV centers in diamond, but is in principle suitable for other ion species and solid-state matrices.

Insufficient irrigation induces peri-implant bone resorption: an in vivo histologic analysis in sheep.

PubMed

Trisi, Paolo; Berardini, Marco; Falco, Antonello; Podaliri Vulpiani, Michele; Perfetti, Giorgio

2014-06-01

To measure in vivo impact of dense bone overheating on implant osseointegration and peri-implant bone resorption comparing different bur irrigation methods vs. no irrigation. Twenty TI-bone implants were inserted in the inferior edge of mandibles of sheep. Different cooling procedures were used in each group: no irrigation (group A), only internal bur irrigation (group B), both internal and external irrigation (group C), and external irrigation (group D). The histomorphometric parameters calculated for each implant were as follows: %cortical bone-implant contact (%CBIC) and %cortical bone volume (%CBV). Friedman's test was applied to test the statistical differences. In group A, we found a huge resorption of cortical bone with %CBIC and %CBV values extremely low. Groups B and C showed mean %CBIC and %BV values higher than other groups The mean %CBV value was significantly different when comparing group B and group C vs. group A (P < 0.05). Significant differences in %CBIC were found also between group C and group A (P < 0.05). Thermal injury, due to insufficient irrigation, of hard bone caused massive resorption of the cortical bone and implant failure. Drilling procedures on hard bone need an adequate cooling supply because the bone matrix overheating may induce complete resorption of dense bone around implants. Internal-external irrigation and only internal irrigation showed to be more efficient than other types of cooling methods in preventing bone resorption around implants. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Evidence for the formation of SiGe nanoparticles in Ge-implanted Si 3N 4

DOE PAGES

Mirzaei, S.; Kremer, F.; Feng, R.; ...

2017-03-14

SiGe nanoparticles were formed in an amorphous Si 3N 4 matrix by Ge + ion implantation and thermal annealing. The size of the nanoparticles was determined by transmission electron microscopy and their atomic structure by x-ray absorption spectroscopy. Nanoparticles were observed for excess Ge concentrations in the range from 9 to 12 at. % after annealing at temperatures in the range from 700 to 900 °C. The average nanoparticle size increased with excess Ge concentration and annealing temperature and varied from an average diameter of 1.8±0.2 nm for the lowest concentration and annealing temperature to 3.2±0.5 nm for the highestmore » concentration and annealing temperature. Our study demonstrates that the structural properties of embedded SiGe nanoparticles in amorphous Si 3N 4 are sensitive to the implantation and post implantation conditions. Furthermore, we demonstrate that ion implantation is a novel pathway to fabricate and control the SiGe nanoparticle structure and potentially useful for future optoelectronic device applications.« less

Bacterial adherence and biofilm formation on medical implants: a review.

PubMed

Veerachamy, Suganthan; Yarlagadda, Tejasri; Manivasagam, Geetha; Yarlagadda, Prasad Kdv

2014-10-01

Biofilms are a complex group of microbial cells that adhere to the exopolysaccharide matrix present on the surface of medical devices. Biofilm-associated infections in the medical devices pose a serious problem to the public health and adversely affect the function of the device. Medical implants used in oral and orthopedic surgery are fabricated using alloys such as stainless steel and titanium. The biological behavior, such as osseointegration and its antibacterial activity, essentially depends on both the chemical composition and the morphology of the surface of the device. Surface treatment of medical implants by various physical and chemical techniques are attempted in order to improve their surface properties so as to facilitate bio-integration and prevent bacterial adhesion. The potential source of infection of the surrounding tissue and antimicrobial strategies are from bacteria adherent to or in a biofilm on the implant which should prevent both biofilm formation and tissue colonization. This article provides an overview of bacterial biofilm formation and methods adopted for the inhibition of bacterial adhesion on medical implants. © IMechE 2014.

Functional Amyloids Keep Quorum-sensing Molecules in Check*

PubMed Central

Seviour, Thomas; Hansen, Susan Hove; Yang, Liang; Yau, Yin Hoe; Wang, Victor Bochuan; Stenvang, Marcel R.; Christiansen, Gunna; Marsili, Enrico; Givskov, Michael; Chen, Yicai; Otzen, Daniel E.; Nielsen, Per Halkjær; Geifman-Shochat, Susana; Kjelleberg, Staffan; Dueholm, Morten S.

2015-01-01

The mechanism by which extracellular metabolites, including redox mediators and quorum-sensing signaling molecules, traffic through the extracellular matrix of biofilms is poorly explored. We hypothesize that functional amyloids, abundant in natural biofilms and possessing hydrophobic domains, retain these metabolites. Using surface plasmon resonance, we demonstrate that the quorum-sensing (QS) molecules, 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone, and the redox mediator pyocyanin bind with transient affinity to functional amyloids from Pseudomonas (Fap). Their high hydrophobicity predisposes them to signal-amyloid interactions, but specific interactions also play a role. Transient interactions allow for rapid association and dissociation kinetics, which make the QS molecules bioavailable and at the same time secure within the extracellular matrix as a consequence of serial bindings. Retention of the QS molecules was confirmed using Pseudomonas aeruginosa PAO1-based 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone reporter assays, showing that Fap fibrils pretreated with the QS molecules activate the reporters even after sequential washes. Pyocyanin retention was validated by electrochemical analysis of pyocyanin-pretreated Fap fibrils subjected to the same washing process. Results suggest that QS molecule-amyloid interactions are probably important in the turbulent environments commonly encountered in natural habitats. PMID:25586180

Performance of the density matrix functional theory in the quantum theory of atoms in molecules.

PubMed

García-Revilla, Marco; Francisco, E; Costales, A; Martín Pendás, A

2012-02-02

The generalization to arbitrary molecular geometries of the energetic partitioning provided by the atomic virial theorem of the quantum theory of atoms in molecules (QTAIM) leads to an exact and chemically intuitive energy partitioning scheme, the interacting quantum atoms (IQA) approach, that depends on the availability of second-order reduced density matrices (2-RDMs). This work explores the performance of this approach in particular and of the QTAIM in general with approximate 2-RDMs obtained from the density matrix functional theory (DMFT), which rests on the natural expansion (natural orbitals and their corresponding occupation numbers) of the first-order reduced density matrix (1-RDM). A number of these functionals have been implemented in the promolden code and used to perform QTAIM and IQA analyses on several representative molecules and model chemical reactions. Total energies, covalent intra- and interbasin exchange-correlation interactions, as well as localization and delocalization indices have been determined with these functionals from 1-RDMs obtained at different levels of theory. Results are compared to the values computed from the exact 2-RDMs, whenever possible.

Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

NASA Astrophysics Data System (ADS)

Li, Yonghui; Ullrich, Carsten

2013-03-01

The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

Incorporation of dopant impurities into a silicon oxynitride matrix containing silicon nanocrystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehrhardt, Fabien; Muller, Dominique; Slaoui, Abdelilah, E-mail: abdelilah.slaoui@unistra.fr

2016-05-07

Dopant impurities, such as gallium (Ga), indium (In), and phosphorus (P), were incorporated into silicon-rich silicon oxynitride (SRSON) thin films by the ion implantation technique. To form silicon nanoparticles, the implanted layers were thermally annealed at temperatures up to 1100 °C for 60 min. This thermal treatment generates a phase separation of the silicon nanoparticles from the SRSON matrix in the presence of the dopant atoms. We report on the position of the dopant species within the host matrix and relative to the silicon nanoparticles, as well as on the effect of the dopants on the crystalline structure and the size ofmore » the Si nanoparticles. The energy-filtered transmission electron microscopy technique is thoroughly used to identify the chemical species. The distribution of the dopant elements within the SRSON compound is determined using Rutherford backscattering spectroscopy. Energy dispersive X-ray mapping coupled with spectral imaging of silicon plasmons was performed to spatially localize at the nanoscale the dopant impurities and the silicon nanoparticles in the SRSON films. Three different behaviors were observed according to the implanted dopant type (Ga, In, or P). The In-doped SRSON layers clearly showed separated nanoparticles based on indium, InOx, or silicon. In contrast, in the P-doped SRSON layers, Si and P are completely miscible. A high concentration of P atoms was found within the Si nanoparticles. Lastly, in Ga-doped SRSON the Ga atoms formed large nanoparticles close to the SRSON surface, while the Si nanoparticles were localized in the bulk of the SRSON layer. In this work, we shed light on the mechanisms responsible for these three different behaviors.« less

Synthesis, Biodegradability, and Biocompatibility of Lysine Diisocyanate–Glucose Polymers

PubMed Central

ZHANG, JIAN-YING; BECKMAN, ERIC J.; HU, JING; YANG, GUO-GUANG; AGARWAL, SUDHA; HOLLINGER, JEFFREY O.

2016-01-01

The success of a tissue-engineering application depends on the use of suitable biomaterials that degrade in a timely manner and induce the least immunogenicity in the host. With this purpose in mind, we have attempted to synthesize a novel nontoxic biodegradable lysine diisocyanate (LDI)-and glucose-based polymer via polymerization of highly purified LDI with glucose and its subsequent hydration to form a spongy matrix. The LDI–glucose polymer was degradable in aqueous solutions at 37, 22, and 4°C, and yielded lysine and glucose as breakdown products. The degradation products of the LDI–glucose polymer did not significantly affect the pH of the solution. The physical properties of the polymer were found to be adequate for supporting cell growth in vitro, as evidenced by the fact that rabbit bone marrow stromal cells (BMSCs) attached to the polymer matrix, remained viable on its surface, and formed multilayered confluent cultures with retention of their phenotype over a period of 2 to 4 weeks. These observations suggest that the LDI–glucose polymer and its degradation products were nontoxic in vitro. Further examination in vivo over 8 weeks revealed that subcutaneous implantation of hydrated matrix degraded in vivo three times faster than in vitro. The implanted polymer was not immunogenic and did not induce antibody responses in the host. Histological analysis of the implanted polymer showed that LDI–glucose polymer induced a minimal foreign body reaction, with formation of a capsule around the degrading polymer. The results suggest that biodegradable peptide-based polymers can be synthesized, and may potentially find their way into biomedical applications because of their biodegradability and biocompatibility. PMID:12459056

40 projects in stem cell research, tissue engineering, tolerance induction and more (NRP46 "Implants and Transplants" 1999-2006).

PubMed

Thiel, Gilbert T

2007-03-02

Forty projects on stem cell research, tissue and matrix engineering, tolerance induction and other topics were supported by the Swiss National Research Program NRP46 (Implants, Transplants) from 1999-2006. The last project is devoted to developing stem cell lines from frozen surplus human embryos in Switzerland, which would otherwise have to be destroyed at the end of 2008. It is entitled JESP (Joint Embryonic Stem Cell Project) since it involves two Swiss universities, in vitro fertilisation centres and experts from the humanities (ethics and law) to handle this difficult problem. Over the years, stem cell transplantation and tissue/matrix engineering have drawn closer to each other and even developed synergies. Progress in stem cell research has been slower than anticipated, but a multitude of technical skills (phenotyping, isolation, transfection, induction of differentiation, labelling, expanding cells in culture, etc) were acquired. Understanding of stem cell biology has grown. The 7 projects on tissue and matrix engineering progressed closer to clinical applicability than the stem cell projects. Of 3 projects to implant encapsulated cells for the production of hormones (insulin, erythropoietin), one is close to clinical pilot studies with an advanced encapsulated device. Five projects were devoted to mechanisms of tolerance or the role of metzincins in chronic allograft nephropathy. Four studies in psychology and communication in transplantation were funded, as were 5 projects in ethics, law and the history of transplantation in Switzerland. The goal of NRP46 was to provide an impulse for research in these new fields and bring together experts from the humanities, biology and medicine to cope more effectively with the problems of regenerative medicine in the future. The majority of goals were attained, mainly in the basics.

Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

PubMed

Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

2012-06-05

Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

Matrix isolation infrared spectroscopic studies and density functional theory calculations of the MNN, (MN)2 (M = Y and La), and Y3NN molecules.

PubMed

Teng, Yun-Lei; Xu, Qiang

2008-04-24

The reactions of yttrium and lanthanum with dinitrogen were reinvestigated. Laser-ablated yttrium and lanthanum atoms were co-deposited at 4 K with dinitrogen in excess argon, and the low-temperature reactions of Y and La with N2 in solid argon were studied using infrared spectroscopy. The reaction products YNN, (YN)2, LaNN, and (LaN)2 were formed in the present experiments and characterized on the basis of 14N/15N isotopic shifts, mixed isotope splitting patterns, stepwise annealing, change of reagent concentration and laser energy, and comparison with theoretical predictions. Some assignments were made based on a previous report. Density functional theory calculations were performed on these systems to identify possible reaction products. The agreement between experimental and calculated vibrational frequencies, relative absorption intensities, and isotopic shifts of the MNN and (MN)2 (M = Y and La) molecules supports the identification of these molecules from the matrix infrared spectra. Plausible reaction mechanisms were proposed for the formation of these molecules along with tentative identification of the Y3NN molecule.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Enzymatically cross-linked injectable alginate-g-pyrrole hydrogels for neovascularization.

PubMed

Devolder, Ross; Antoniadou, Eleni; Kong, Hyunjoon

2013-11-28

Microparticles capable of releasing protein drugs are often incorporated into injectable hydrogels to minimize their displacement at an implantation site, reduce initial drug burst, and further control drug release rates over a broader range. However, there is still a need to develop methods for releasing drug molecules over extended periods of time, in order to sustain the bioactivity of drug molecules at an implantation site. In this study, we hypothesized that a hydrogel formed through the cross-linking of pyrrole units linked to a hydrophilic polymer would release protein drugs in a more sustained manner, because of an enhanced association between cross-linked pyrrole groups and the drug molecules. To examine this hypothesis, we prepared hydrogels of alginate substituted with pyrrole groups, alginate-g-pyrrole, through a horse-radish peroxidase (HRP)-activated cross-linking of the pyrrole groups. The hydrogels were encapsulated with poly(lactic-co-glycolic acid) (PLGA) microparticles loaded with vascular endothelial growth factor (VEGF). The resulting hydrogel system released VEGF in a more sustained manner than Ca(2+) alginate or Ca(2+) alginate-g-pyrrole gel systems. Finally, implantations of the VEGF-releasing HRP-activated alginate-g-pyrrole hydrogel system on chicken chorioallantoic membranes resulted in the formation of blood vessels in higher densities and with larger diameters, compared to other control conditions. Overall, the drug releasing system developed in this study will be broadly useful for regulating release rates of a wide array of protein drugs, and further enhance the quality of protein drug-based therapies. © 2013 Elsevier B.V. All rights reserved.

Study on quantitative analysis of Ti, Al and V in clinical soft tissues after placing the dental implants by laser ablation inductively coupled plasma mass spectrometry

NASA Astrophysics Data System (ADS)

Sajnóg, Adam; Hanć, Anetta; Makuch, Krzysztof; Koczorowski, Ryszard; Barałkiewicz, Danuta

2016-11-01

Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used for in-situ quantitative analysis of oral mucosa of patients before and after implantation with titanium implants and a closing screw based on Ti6Al4V alloy. Two calibration strategies were applied, both were based on matrix matched solid standards with analytes addition. A novel approach was the application of powdered egg white proteins as a matrix material which have a similar composition to the examined tissue. In the another approach, certified reference material Bovine Muscle ERM-BB184 was used. The isotope 34S was found to be the most appropriate as an internal standard since it is homogenously distributed in the examined tissues and resulted in lower relative standard deviation values of signal of analytes of interest. Other isotopes (13C, 26Mg, 43Ca) were also evaluated as potential internal standards. The analytical performance parameters and microwave digestion of solid standards followed by solution nebulization ICP-MS analysis proved that both calibration methods are fit for their intended purpose. The LA-ICP-MS analysis on the surface of tissues after the implantation process revealed an elevated content of elements in comparison to the control group. Analytes are distributed inhomogeneously and display local maximal content of Ti up to ca. 900 μg g- 1, Al up to ca. 760 μg g- 1 and for V up to 160 μg g- 1.

Laser-Modified Surface Enhances Osseointegration and Biomechanical Anchorage of Commercially Pure Titanium Implants for Bone-Anchored Hearing Systems

PubMed Central

Omar, Omar; Simonsson, Hanna; Palmquist, Anders; Thomsen, Peter

2016-01-01

Osseointegrated implants inserted in the temporal bone are a vital component of bone-anchored hearing systems (BAHS). Despite low implant failure levels, early loading protocols and simplified procedures necessitate the application of implants which promote bone formation, bone bonding and biomechanical stability. Here, screw-shaped, commercially pure titanium implants were selectively laser ablated within the thread valley using an Nd:YAG laser to produce a microtopography with a superimposed nanotexture and a thickened surface oxide layer. State-of-the-art machined implants served as controls. After eight weeks’ implantation in rabbit tibiae, resonance frequency analysis (RFA) values increased from insertion to retrieval for both implant types, while removal torque (RTQ) measurements showed 153% higher biomechanical anchorage of the laser-modified implants. Comparably high bone area (BA) and bone-implant contact (BIC) were recorded for both implant types but with distinctly different failure patterns following biomechanical testing. Fracture lines appeared within the bone ~30–50 μm from the laser-modified surface, while separation occurred at the bone-implant interface for the machined surface. Strong correlations were found between RTQ and BIC and between RFA at retrieval and BA. In the endosteal threads, where all the bone had formed de novo, the extracellular matrix composition, the mineralised bone area and osteocyte densities were comparable for the two types of implant. Using resin cast etching, osteocyte canaliculi were observed directly approaching the laser-modified implant surface. Transmission electron microscopy showed canaliculi in close proximity to the laser-modified surface, in addition to a highly ordered arrangement of collagen fibrils aligned parallel to the implant surface contour. It is concluded that the physico-chemical surface properties of laser-modified surfaces (thicker oxide, micro- and nanoscale texture) promote bone bonding which may be of benefit in situations where large demands are imposed on biomechanically stable interfaces, such as in early loading and in compromised conditions. PMID:27299883

A comparison of profilometer and AutoCAD software techniques in evaluation of implant angulation in vitro.

PubMed

Assunção, Wirley Gonçalves; Gomes, Erica Alves; Tabata, Lucas Fernando; Gennari-Filho, Humberto

2008-01-01

The aim of this study was to compare 2 different methods of assessment of implants at different inclinations (90 degrees and 65 degrees)--with a profilometer and AutoCAD software. Impressions (n = 5) of a metal matrix containing 2 implants, 1 at 90 degrees to the surface and 1 at 65 degrees to the surface, were obtained with square impression copings joined together with dental floss splinting covered with autopolymerizing acrylic resin, an open custom tray, and vinyl polysiloxane impression material. Measurement of the angles (in degrees) of the implant analogs were assessed by the same blinded operator with a profilometer and through analysis of digitized images by AutoCAD software. For each implant analog, 3 readings were performed with each method. The results were subjected to a nonparametric Kruskal-Wallis test, with P < or = .05 considered significant. For implants perpendicular to the horizontal surface of the specimen (90 degrees), there were no significant differences between the mean measurements obtained with the profilometer (90.04 degrees) and AutoCAD (89.95 degrees; P = .9142). In the analyses of the angled implants at 65 degrees in relation to the horizontal surface of the specimen, significant differences were observed (P = .0472) between the mean readings with the profilometer (65.73 degrees) and AutoCAD (66.25 degrees). The degrees of accuracy of implant angulation recording vary among the techniques available and may vary depending on the angle of the implant. Further investigation is needed to determine the best test conditions and the best measuring technique for determination of the angle of the implant in vitro.

Repairing the vibratory vocal fold.

PubMed

Long, Jennifer L

2018-01-01

A vibratory vocal fold replacement would introduce a new treatment paradigm for structural vocal fold diseases such as scarring and lamina propria loss. This work implants a tissue-engineered replacement for vocal fold lamina propria and epithelium in rabbits and compares histology and function to injured controls and orthotopic transplants. Hypotheses were that the cell-based implant would engraft and control the wound response, reducing fibrosis and restoring vibration. Translational research. Rabbit adipose-derived mesenchymal stem cells (ASC) were embedded within a three-dimensional fibrin gel, forming the cell-based outer vocal fold replacement (COVR). Sixteen rabbits underwent unilateral resection of vocal fold epithelium and lamina propria, as well as reconstruction with one of three treatments: fibrin glue alone with healing by secondary intention, replantation of autologous resected vocal fold cover, or COVR implantation. After 4 weeks, larynges were examined histologically and with phonation. Fifteen rabbits survived. All tissues incorporated well after implantation. After 1 month, both graft types improved histology and vibration relative to injured controls. Extracellular matrix (ECM) of the replanted mucosa was disrupted, and ECM of the COVR implants remained immature. Immune reaction was evident when male cells were implanted into female rabbits. Best histologic and short-term vibratory outcomes were achieved with COVR implants containing male cells implanted into male rabbits. Vocal fold cover replacement with a stem cell-based tissue-engineered construct is feasible and beneficial in acute rabbit implantation. Wound-modifying behavior of the COVR implant is judged to be an important factor in preventing fibrosis. NA. Laryngoscope, 128:153-159, 2018. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

UKRmol: a low-energy electron- and positron-molecule scattering suite

NASA Astrophysics Data System (ADS)

Carr, J. M.; Galiatsatos, P. G.; Gorfinkiel, J. D.; Harvey, A. G.; Lysaght, M. A.; Madden, D.; Mašín, Z.; Plummer, M.; Tennyson, J.; Varambhia, H. N.

2012-03-01

We describe the UK computational implementation of the R-matrix method for the treatment of electron and positron scattering from molecules. Recent developments in the UKRmol suite are detailed together with the collision processes it is enabling us to treat.

Functionalizing graphene by embedded boron clusters

NASA Astrophysics Data System (ADS)

Quandt, Alexander; Kunstmann, Jens; Ozdogan, Cem; Fehske, Holger

2010-03-01

We present results from an ab initio study of B7 clusters implanted into graphene [1,2]. Our model system consists of an alternating chain of quasiplanar B7 clusters. We show that graphene easily accepts these alternating B7-C6 chains and that the implanted boron components may dramatically modify the electronic properties. This suggests that our model system might serve as a blueprint for the controlled layout of graphene based nanodevices, where the semiconducting properties are supplemented by parts of the graphene matrix itself, and the basic metallic wiring is provided by alternating chains of implanted boron clusters. [1] A. Quandt, C. "Ozdogan, J. Kunstmann, and H. Fehske, Nanotechnology 19, 335707 (2008). [2] A. Quandt, C. "Ozdogan, J. Kunstmann, and H. Fehske, phys. stat. solidi (b) 245, 2077 (2008).

Matrix change of bone grafting substitute after implantation into guinea pig bulla.

PubMed

Punke, Ch; Zehlicke, T; Just, T; Holzhüter, G; Gerber, T; Pau, H W

2012-05-01

Many different surgical techniques have been developed to remove open mastoid cavities. In addition to autologous materials, alloplastic substances have been used. A very slow absorption of these materials and extrusion reactions have been reported. We investigated a newly developed, highly porous bone grafting material to eliminate open mastoid cavities, in an animal model. To characterise the transformation process, the early tissue reactions were studied in relation to the matrix transformation of the bone material. NanoBone (NB), a highly porous bone grafting material based on calcium phosphate and silica, was filled into the open bullae from 20 guinea pigs. The bullae were examined histologically. Energy dispersive X-ray spectroscopy (EDX) was used to investigate the change in the elemental composition at different sampling times. The surface topography of the sections was examined by electron microscopy. After 1 week, periodic acid-Schiffs (PAS) staining demonstrated accumulation of glycogen and proteins, particularly in the border area of the NB particles. After 2 weeks, the particles were evenly coloured after PAS staining. EDX analysis showed a rapid absorption of the silica in the bone grafting material. NanoBone showed a rapid matrix change after implantation in the bullae of guinea pigs. The absorption of the silica matrix and replacement by PAS-positive substances like glycoproteins and mucopolysaccharides seems to play a decisive role in the degradation processes of NB. This is associated with the good osteoinductive properties of the material.

Matrix-enhanced secondary ion mass spectrometry: The Alchemist's solution?

NASA Astrophysics Data System (ADS)

Delcorte, Arnaud

2006-07-01

Because of the requirements of large molecule characterization and high-lateral resolution SIMS imaging, the possibility of improving molecular ion yields by the use of specific sample preparation procedures has recently generated a renewed interest in the static SIMS community. In comparison with polyatomic projectiles, however, signal enhancement by a matrix might appear to some as the alchemist's versus the scientist's solution to the current problems of organic SIMS. In this contribution, I would like to discuss critically the pros and cons of matrix-enhanced SIMS procedures, in the new framework that includes polyatomic ion bombardment. This discussion is based on a short review of the experimental and theoretical developments achieved in the last decade with respect to the three following approaches: (i) blending the analyte with a low-molecular weight organic matrix (MALDI-type preparation procedure); (ii) mixing alkali/noble metal salts with the analyte; (iii) evaporating a noble metal layer on the analyte sample surface (organic molecules, polymers).

Analyte-Size-Dependent Ionization and Quantification of Monosaccharides in Human Plasma Using Cation-Exchanged Smectite Layers.

PubMed

Ding, Yuqi; Kawakita, Kento; Xu, Jiawei; Akiyama, Kazuhiko; Fujino, Tatsuya

2015-08-04

Smectite, a synthetic inorganic polymer with a saponite structure, was subjected to matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). Typical organic matrix molecules 2,4,6-trihydroxyacetophenone (THAP) and 2,5-dihydroxybenzoic acid (DHBA) were intercalated into the layer spacing of cation-exchanged smectite, and the complex was used as a new matrix for laser desorption/ionization mass spectrometry. Because of layer spacing limitations, only a small analyte that could enter the layer and bind to THAP or DHBA could be ionized. This was confirmed by examining different analyte/matrix preparation methods and by measuring saccharides with different molecular sizes. Because of the homogeneous distribution of THAP molecules in the smectite layer spacing, high reproducibility of the analyte peak intensity was achieved. By using isotope-labeled (13)C6-d-glucose as the internal standard, quantitative analysis of monosaccharides in pretreated human plasma sample was performed, and the value of 8.6 ± 0.3 μg/mg was estimated.

Electronic method for autofluorography of macromolecules on two-D matrices

DOEpatents

Davidson, Jackson B.; Case, Arthur L.

1983-01-01

A method for detecting, localizing, and quantifying macromolecules contained in a two-dimensional matrix is provided which employs a television-based position sensitive detection system. A molecule-containing matrix may be produced by conventional means to produce spots of light at the molecule locations which are detected by the television system. The matrix, such as a gel matrix, is exposed to an electronic camera system including an image-intensifier and secondary electron conduction camera capable of light integrating times of many minutes. A light image stored in the form of a charge image on the camera tube target is scanned by conventional television techniques, digitized, and stored in a digital memory. Intensity of any point on the image may be determined from the number at the memory address of the point. The entire image may be displayed on a television monitor for inspection and photographing or individual spots may be analyzed through selected readout of the memory locations. Compared to conventional film exposure methods, the exposure time may be reduced 100-1000 times.

PslG, a self-produced glycosyl hydrolase, triggers biofilm disassembly by disrupting exopolysaccharide matrix.

PubMed

Yu, Shan; Su, Tiantian; Wu, Huijun; Liu, Shiheng; Wang, Di; Zhao, Tianhu; Jin, Zengjun; Du, Wenbin; Zhu, Mei-Jun; Chua, Song Lin; Yang, Liang; Zhu, Deyu; Gu, Lichuan; Ma, Luyan Z

2015-12-01

Biofilms are surface-associated communities of microorganism embedded in extracellular matrix. Exopolysaccharide is a critical component in the extracellular matrix that maintains biofilm architecture and protects resident biofilm bacteria from antimicrobials and host immune attack. However, self-produced factors that target the matrix exopolysaccharides, are still poorly understood. Here, we show that PslG, a protein involved in the synthesis of a key biofilm matrix exopolysaccharide Psl in Pseudomonas aeruginosa, prevents biofilm formation and disassembles existing biofilms within minutes at nanomolar concentrations when supplied exogenously. The crystal structure of PslG indicates the typical features of an endoglycosidase. PslG mainly disrupts the Psl matrix to disperse bacteria from biofilms. PslG treatment markedly enhances biofilm sensitivity to antibiotics and macrophage cells, resulting in improved biofilm clearance in a mouse implant infection model. Furthermore, PslG shows biofilm inhibition and disassembly activity against a wide range of Pseudomonas species, indicating its great potential in combating biofilm-related complications.

Stage-two surgery using collagen soft tissue grafts: clinical cases and ultrastructural analysis.

PubMed

Fischer, Kai R; Fickl, Stefan; Mardas, Nikos; Bozec, Laurent; Donos, Nikolaos

2014-01-01

To present the application of two different soft tissue grafts around dental implants during stage-two surgery. Furthermore, the ultrastructure of these materials is shown and discussed using scanning electron microscopy (SEM). Although soft tissue autografts may be currently regarded as the gold standard, harvesting of these grafts might lead to higher morbidity, longer chair time, and intra-/postoperative complications at the donor site. New developments in collagen scaff olds have provided an alternative to successfully replace autologous grafts in clinical practice. The SEM pictures clearly show the different composition of a bilayer scaff old (collagen matrix, CM) and a porcine acellular dermal matrix (ADM). These distinctive properties lead to different possible indications. Within the presented cases, ADM was used to augment the ridge contour and was placed into a buccal pouch to achieve complete coverage and an uneventful closed healing. On the other side, CM was left exposed to the oral cavity to successfully gain keratinized mucosa around and between two dental implants.

Effects of Particle Size and Porosity on In Vivo Remodeling of Settable Allograft Bone/Polymer Composites

PubMed Central

Prieto, Edna M.; Talley, Anne D.; Gould, Nicholas R.; Zienkiewicz, Katarzyna J.; Drapeau, Susan J.; Kalpakci, Kerem N.

2014-01-01

Established clinical approaches to treat bone voids include the implantation of autograft or allograft bone, ceramics, and other bone void fillers (BVFs). Composites prepared from lysine-derived polyurethanes and allograft bone can be injected as a reactive liquid and set to yield BVFs with mechanical strength comparable to trabecular bone. In this study, we investigated the effects of porosity, allograft particle size, and matrix mineralization on remodeling of injectable and settable allograft/polymer composites in a rabbit femoral condyle plug defect model. Both low viscosity (LV) and high viscosity (HV) grafts incorporating small (<105 μm) particles only partially healed at 12 weeks, and the addition of 10% demineralized bone matrix did not enhance healing. In contrast, composite grafts with large (105 – 500 μm) allograft particles healed at 12 weeks post-implantation, as evidenced by radial μCT and histomorphometric analysis. This study highlights particle size and surface connectivity as influential parameters regulating the remodeling of composite bone scaffolds. PMID:25581686

Bioinspired Design of Polycaprolactone Composite Nanofibers as Artificial Bone Extracellular Matrix for Bone Regeneration Application.

PubMed

Gao, Xiang; Song, Jinlin; Zhang, Yancong; Xu, Xiao; Zhang, Siqi; Ji, Ping; Wei, Shicheng

2016-10-07

The design and development of functional biomimetic systems for programmed stem cell response is a field of topical interest. To mimic bone extracellular matrix, we present an innovative strategy for constructing drug-loaded composite nanofibrous scaffolds in this study, which could integrate multiple cues from calcium phosphate mineral, bioactive molecule, and highly ordered fiber topography for the control of stem cell fate. Briefly, inspired by mussel adhesion mechanism, a polydopamine (pDA)-templated nanohydroxyapatite (tHA) was synthesized and then surface-functionalized with bone morphogenetic protein-7-derived peptides via catechol chemistry. Afterward, the resulting peptide-loaded tHA (tHA/pep) particles were blended with polycaprolactone (PCL) solution to fabricate electrospun hybrid nanofibers with random and aligned orientation. Our research demonstrated that the bioactivity of grafted peptides was retained in composite nanofibers. Compared to controls, PCL-tHA/pep composite nanofibers showed improved cytocompatibility. Moreover, the incorporated tHA/pep particles in nanofibers could further facilitate osteogenic differentiation potential of human mesenchymal stem cells (hMSCs). More importantly, the aligned PCL-tHA/pep composite nanofibers showed more osteogenic activity than did randomly oriented counterparts, even under nonosteoinductive conditions, indicating excellent performance of biomimetic design in cell fate decision. After in vivo implantation, the PCL-tHA/pep composite nanofibers with highly ordered structure could significantly promote the regeneration of lamellar-like bones in a rat calvarial critical-sized defect. Accordingly, the presented strategy in our work could be applied for a wide range of potential applications in not only bone regeneration application but also pharmaceutical science.

Matrix metalloproteinase processing of signaling molecules to regulate inflammation.

PubMed

Butler, Georgina S; Overall, Christopher M

2013-10-01

Inflammation is a complex and highly regulated process that facilitates the clearance of pathogens and mediates tissue repair. Failure to resolve inflammation can lead to chronic inflammatory diseases such as periodontitis. Matrix metalloproteinases are generally thought to be detrimental in disease because degradation of extracellular matrix contributes to pathology. However, proteomic techniques (degradomics) are revealing that matrix metalloproteinases process a diverse array of substrates and therefore have a broad range of functions. Many matrix metalloproteinase substrates modulate inflammation and hence, by processing these proteins, matrix metalloproteinases can orchestrate the inflammatory response. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Hyaline Articular Matrix Formed by Dynamic Self-Regenerating Cartilage and Hydrogels.

PubMed

Meppelink, Amanda M; Zhao, Xing; Griffin, Darvin J; Erali, Richard; Gill, Thomas J; Bonassar, Lawrence J; Redmond, Robert W; Randolph, Mark A

2016-07-01

Injuries to the articular cartilage surface are challenging to repair because cartilage possesses a limited capacity for self-repair. The outcomes of current clinical procedures aimed to address these injuries are inconsistent and unsatisfactory. We have developed a novel method for generating hyaline articular cartilage to improve the outcome of joint surface repair. A suspension of 10(7) swine chondrocytes was cultured under reciprocating motion for 14 days. The resulting dynamic self-regenerating cartilage (dSRC) was placed in a cartilage ring and capped with fibrin and collagen gel. A control group consisted of chondrocytes encapsulated in fibrin gel. Constructs were implanted subcutaneously in nude mice and harvested after 6 weeks. Gross, histological, immunohistochemical, biochemical, and biomechanical analyses were performed. In swine patellar groove, dSRC was implanted into osteochondral defects capped with collagen gel and compared to defects filled with osteochondral plugs, collagen gel, or left empty after 6 weeks. In mice, the fibrin- and collagen-capped dSRC constructs showed enhanced contiguous cartilage matrix formation over the control of cells encapsulated in fibrin gel. Biochemically, the fibrin and collagen gel dSRC groups were statistically improved in glycosaminoglycan and hydroxyproline content compared to the control. There was no statistical difference in the biomechanical data between the dSRC groups and the control. The swine model also showed contiguous cartilage matrix in the dSRC group but not in the collagen gel and empty defects. These data demonstrate the survivability and successful matrix formation of dSRC under the mechanical forces experienced by normal hyaline cartilage in the knee joint. The results from this study demonstrate that dSRC capped with hydrogels successfully engineers contiguous articular cartilage matrix in both nonload-bearing and load-bearing environments.

Photoionization of Atoms and Molecules using a Configuration-Average Distorted-Wave Method

NASA Astrophysics Data System (ADS)

Pindzola, M. S.; Balance, C. P.; Loch, S. D.; Ludlow, J. A.

2011-05-01

A configuration-average distorted-wave method is applied to calculate the photoionization cross section for the outer subshells of the C atom and the C2 diatomic molecule. Comparisions are made with previous R-matrix and Hartree- Fock distorted-wave calculations.

The Atom in a Molecule: Implications for Molecular Structure and Properties

DTIC Science & Technology

2016-05-23

unlimited. PA Clearance #16075.” Atomic- Product Representations of Molecules Employ “van der Waals” products of atomic states to represent molecules...representation the electrons “stay home” with each nucleus. Atomic fragment operators are well-defined over product representations. Expectation values of...release; distribution unlimited. PA Clearance #16075.” Hamiltonian Matrix in the Atomic- Product Basis Technical Questions Addressed: J. Chem. Phys

Fluorescein isothiocyanate-labeled human plasma fibronectin in extracellular matrix remodeling.

PubMed

Hoffmann, Celine; Leroy-Dudal, Johanne; Patel, Salima; Gallet, Olivier; Pauthe, Emmanuel

2008-01-01

Fluorescein isothiocyanate (FITC) is a well-known probe for labeling biologically relevant proteins. However, the impact of the labeling procedure on protein structure and biological activities remains unclear. In this work, FITC-labeled human plasma fibronectin (Fn) was developed to gain insight into the dynamic relationship between cells and Fn. The similarities and differences concerning the structure and function between Fn-FITC and standard Fn were evaluated using biochemical as well as cellular approaches. By varying the FITC/Fn ratio, we demonstrated that overlabeling (>10 FITC molecules/Fn molecule) induces probe fluorescence quenching, protein aggregation, and cell growth modifications. A correct balance between reliable fluorescence for detection and no significant modifications to structure and biological function compared with standard Fn was obtained with a final ratio of 3 FITC molecules per Fn molecule (Fn-FITC3). Fn-FITC3, similar to standard Fn, is correctly recruited into the cell matrix network. Also, Fn-FITC3 is proposed to be a powerful molecular tool to investigate Fn organization and cellular behavior concomitantly.

Expression of Pattern Recognition Receptors in Epithelial Cells Around Clinically Healthy Implants and Healthy Teeth.

PubMed

Calcaterra, Roberta; Di Girolamo, Michele; Mirisola, Concetta; Baggi, Luigi

2016-06-01

Gingival epithelial cells have a pivotal role in the recognition of microorganisms and damage-associated molecular pattern molecules and in the regulation of the immune response. The investigation of the behavior of Toll-like receptors (TLRs) and nucleotide oligomerization domain (NOD) like receptors (NLRs) around a healthy implant may help to address the first step of periimplantitis pathogenesis. To investigate by quantitative real-time polymerase chain reaction, the mRNA expressions of TLR2, TLR3, TLR4, TLR5, TLR6, TLR9, NOD1, NOD2, and NLRP3 from gingival epithelial cells of the sulcus around healthy implants and around healthy teeth. Two types of implant-abutment systems with tube-in-tube interface were tested. After 6 months of implant restoration, gingival epithelial cells were obtained from the gingival sulcus around the implants and around the adjacent teeth of 10 patients. Our results did not reach statistical significance among the mRNA expressions of TLR2, TLR3, TLR4, TLR5, TLR6, TLR9, NOD1, NOD2, and NLRP3 in epithelial cells around the implant versus around natural teeth. This study shows that the implant-abutment systems tested did not induce an immune response by the surrounding epithelial cells at 6 months since their positioning, as well as in the adjacent clincally healthy teeth.

Nitrogen implantation with a scanning electron microscope.

PubMed

Becker, S; Raatz, N; Jankuhn, St; John, R; Meijer, J

2018-01-08

Established techniques for ion implantation rely on technically advanced and costly machines like particle accelerators that only few research groups possess. We report here about a new and surprisingly simple ion implantation method that is based upon a widespread laboratory instrument: The scanning electron microscope. We show that it can be utilized to ionize atoms and molecules from the restgas by collisions with electrons of the beam and subsequently accelerate and implant them into an insulating sample by the effect of a potential building up at the sample surface. Our method is demonstrated by the implantation of nitrogen ions into diamond and their subsequent conversion to nitrogen vacancy centres which can be easily measured by fluorescence confocal microscopy. To provide evidence that the observed centres are truly generated in the way we describe, we supplied a 98% isotopically enriched 15 N gas to the chamber, whose natural abundance is very low. By employing the method of optically detected magnetic resonance, we were thus able to verify that the investigated centres are actually created from the 15 N isotopes. We also show that this method is compatible with lithography techniques using e-beam resist, as demonstrated by the implantation of lines using PMMA.

Detection of abnormal extracellular matrix in the interstitium of regenerating renal tubules.

PubMed

Minuth, Will W; Denk, Lucia

2014-12-15

Stem/progenitor cells are promising candidates for the regeneration of parenchyma in acute and chronic renal failure. However, recent data exhibit that survival of stem/progenitor cells after implantation in diseased renal parenchyma is restricted. To elaborate basic parameters improving survival, cell seeding was simulated under advanced in vitro conditions. After isolation, renal stem/progenitor cells were mounted in a polyester interstitium for perfusion culture. During generation of tubules, chemically defined CO2 Independent Medium or Leibovitz's L-15 Medium was applied. Specimens were then fixed for transmission electron microscopy to analyze morphological features in generated tubules. Fixation in conventional glutaraldehyde (GA) solution shows development of tubules each exhibiting a polarized epithelium, an intact basal lamina and an inconspicuous interstitium. In contrast, special fixation of specimens in GA solution containing cupromeronic blue, ruthenium red or tannic acid unveils previously not visible extracellular matrix. Control experiments elucidate that a comparable extracellular matrix is not present in the interstitium of the matured kidney. Thus, generation of renal tubules in combination with advanced fixation of specimens for electron microscopy demonstrates that development of abnormal features in the newly developed interstitium has to be considered, when repair of renal parenchyma is performed by implantation of stem/progenitor cells.

Histomorphometric and whole-genome expression analysis of peri-implant soft tissue healing: a comparison of flapless and open surgery.

PubMed

Mueller, Cornelia Katharina; Thorwarth, Michael; Schultze-Mosgau, Stefan

2011-01-01

The structure of peri-implant soft tissue that is regenerated after flapless and flap surgery has been shown to differ. However, its underlying mechanisms are relatively unknown. The present study sought to identify differences in the inflammatory cell infiltration and expression of gene transcripts during transmucosal healing between the two approaches with two different implant designs. All mandibular premolars were removed from 12 minipigs. One month later, four implants (two NobelReplace Tapered Groovy and two NobelPerfect Groovy, Nobel Biocare) were placed in each quadrant. One quadrant was randomized to flapless insertion, while the other was chosen for flap surgery in each animal. Following 1, 2, 4, and 12 weeks of transmucosal implant healing, biopsy specimens were retrieved from the peri-implant soft tissue according to a standardized procedure to avoid crossover effects. Samples were subjected to a leukocyte count and a gene expression analysis. When the flapless placement technique was used, leukocyte influx in the peri-implant soft tissue was significantly smaller compared to open surgery for both implant designs. Gene expression analysis revealed significant overexpression of molecules associated with detoxification and reepithelialization in the flapless group. In contrast, myofibroblast-associated gene transcripts were significantly enriched in the flap surgery group. The present data indicate perpetuation of inflammatory reactions as well as increased fibrotic scar tissue deposition in the peri-implant area following implant placement by the flap approach. Flapless implant insertion results in less inflammation and early reepithelialization, providing the potential for the formation of a fully functioning as well as esthetically preferable peri-implant soft tissue collar.

A power-efficient communication system between brain-implantable devices and external computers.

PubMed

Yao, Ning; Lee, Heung-No; Chang, Cheng-Chun; Sclabassi, Robert J; Sun, Mingui

2007-01-01

In this paper, we propose a power efficient communication system for linking a brain-implantable device to an external system. For battery powered implantable devices, the processor and the transmitter power should be reduced in order to both conserve battery power and reduce the health risks associated with transmission. To accomplish this, a joint source-channel coding/decoding system is devised. Low-density generator matrix (LDGM) codes are used in our system due to their low encoding complexity. The power cost for signal processing within the implantable device is greatly reduced by avoiding explicit source encoding. Raw data which is highly correlated is transmitted. At the receiver, a Markov chain source correlation model is utilized to approximate and capture the correlation of raw data. A turbo iterative receiver algorithm is designed which connects the Markov chain source model to the LDGM decoder in a turbo-iterative way. Simulation results show that the proposed system can save up to 1 to 2.5 dB on transmission power.

Evolution of the taste of a bitter Camembert cheese during ripening: characterization of a matrix effect.

PubMed

Engel, E; Nicklaus, S; Septier, C; Salles, C; Le Quéré, J L

2001-06-01

The objective of this study was to characterize the effect of ripening on the taste of a typically bitter Camembert cheese. The first step was to select a typically bitter cheese among several products obtained by different processes supposed to enhance this taste defect. Second, the evolution of cheese taste during ripening was characterized from a sensory point of view. Finally, the relative impact of fat, proteins, and water-soluble molecules on cheese taste was determined by using omission tests performed on a reconstituted cheese. These omission tests showed that cheese taste resulted mainly from the gustatory properties of water-soluble molecules but was modulated by a matrix effect due to fat, proteins, and cheese structure. The evolution of this matrix effect during ripening was discussed for each taste characteristic.

Iminopropadienones RN=C=C=C=O and bisiminopropadienes RN=C=C=C=NR: Matrix infrared spectra and anharmonic frequency calculations

NASA Astrophysics Data System (ADS)

Bégué, Didier; Baraille, Isabelle; Andersen, Heidi Gade; Wentrup, Curt

2013-10-01

Methyliminopropadienone MeN=C=C=C=O 1a was generated by flash vacuum thermolysis from four different precursors and isolated in solid argon. The matrix-isolation infrared spectrum is dominated by unusually strong anharmonic effects resulting in complex fine structure of the absorptions due to the NCCCO moiety in the 2200 cm-1 region. Doubling and tripling of the corresponding absorption bands are observed for phenyliminopropadienone PhN=C=C=C=O 1b and bis(phenylimino)propadiene PhN=C=C=C=NPh 9, respectively. Anharmonic vibrational frequency calculations allow the identification of a number of overtones and combination bands as the cause of the splittings for each molecule. This method constitutes an important tool for the characterization of reactive intermediates and unusual molecules by matrix-isolation infrared spectroscopy.

Controlling the Biomimetic Implant Interface: Modulating Antimicrobial Activity by Spacer Design

NASA Astrophysics Data System (ADS)

Wisdom, Cate; Vanoosten, Sarah Kay; Boone, Kyle W.; Khvostenko, Dmytro; Arnold, Paul M.; Snead, Malcolm L.; Tamerler, Candan

2016-08-01

Surgical site infection is a common cause of post-operative morbidity, often leading to implant loosening, ultimately requiring revision surgery, increased costs and worse surgical outcomes. Since implant failure starts at the implant surface, creating and controlling the bio-material interface will play a critical role in reducing infection while improving host cell-to-implant interaction. Here, we engineered a biomimetic interface based upon a chimeric peptide that incorporates a titanium binding peptide (TiBP) with an antimicrobial peptide (AMP) into a single molecule to direct binding to the implant surface and deliver an antimicrobial activity against S. mutans and S. epidermidis, two bacteria which are linked with clinical implant infections. To optimize antimicrobial activity, we investigated the design of the spacer domain separating the two functional domains of the chimeric peptide. Lengthening and changing the amino acid composition of the spacer resulted in an improvement of minimum inhibitory concentration by a three-fold against S. mutans. Surfaces coated with the chimeric peptide reduced dramatically the number of bacteria, with up to a nine-fold reduction for S. mutans and a 48-fold reduction for S. epidermidis. Ab initio predictions of antimicrobial activity based on structural features were confirmed. Host cell attachment and viability at the biomimetic interface were also improved compared to the untreated implant surface. Biomimetic interfaces formed with this chimeric peptide offer interminable potential by coupling antimicrobial and improved host cell responses to implantable titanium materials, and this peptide based approach can be extended to various biomaterials surfaces.

Pre-hatching embryo-dependent and -independent programming of endometrial function in cattle

PubMed Central

Sponchiado, Mariana; Gomes, Nathália Souza; Fontes, Patrícia Kubo; Martins, Thiago; del Collado, Maite; Pastore, Athos de Assumpção; Pugliesi, Guilherme; Nogueira, Marcelo Fábio Gouveia

2017-01-01

The bovine pre-implantation embryo secretes bioactive molecules from early development stages, but effects on endometrial function are reported to start only after elongation. Here, we interrogated spatially defined regions of the endometrium transcriptome for responses to a day 7 embryo in vivo. We hypothesize that exposure to an embryo changes the abundance of specific transcripts in the cranial region of the pregnant uterine horn. Endometrium was collected from the uterotubal junction (UTJ), anterior (IA), medial (IM) and posterior (IP) regions of the uterine horn ipsilateral to the CL 7 days after estrus from sham-inseminated (Con) or artificially inseminated, confirmed pregnant (Preg) cows. Abundance of 86 transcripts was evaluated by qPCR using a microfluidic platform. Abundance of 12 transcripts was modulated in the Preg endometrium, including classical interferon-stimulated genes (ISG15, MX1, MX2 and OAS1Y), prostaglandin biosynthesis genes (PTGES, HPGD and AKR1C4), water channel (AQP4) and a solute transporter (SLC1A4) and this was in the UTJ and IA mainly. Additionally, for 71 transcripts, abundance varied according to region of the reproductive tract. Regulation included downregulation of genes associated with proliferation (IGF1, IGF2, IGF1R and IGF2R) and extracellular matrix remodeling (MMP14, MMP19 and MMP2) and upregulation of anti-adhesive genes (MUC1) in the cranial regions of uterine horn. Physical proximity to the embryo provides paracrine regulation of endometrial function. Embryo-independent regulation of the endometrial transcriptome may support subsequent stages of embryo development, such as elongation and implantation. We speculate that successful early embryo-dependent and -independent programming fine-tune endometrial functions that are important for maintenance of pregnancy in cattle. PMID:28423001

Comparative matrix isolation infrared spectroscopy study of 1,3- and 1,4-diene monoterpenes (α-phellandrene and γ-terpinene).

PubMed

Marzec, K M; Reva, I; Fausto, R; Proniewicz, L M

2011-05-05

In the present work, γ-terpinene (a 1,4-diene derivative) and α-phellandrene (1,3-diene derivative) were isolated in cryogenic argon matrices and their structures, vibrational spectra, and photochemistries were characterized with the aid of FTIR spectroscopy and quantum chemical calculations performed at the DFT/B3LYP/6-311++G(d,p) level of approximation. The molecules bear one conformationally relevant internal rotation axis, corresponding to the rotation of the isopropyl group. The calculations provide evidence of three minima on the potential energy surfaces of the studied molecules, where the isopropyl group assumes the trans, gauche+, and gauche- conformations (T, G+, G-). The signatures of all these conformers were identified in the experimental matrix infrared spectra, with the T forms dominating, in agreement with the theoretical predicted abundances in gas phase at room temperature. In situ UV (λ > 200 nm) irradiation of matrix-isolated α-phellandrene led to its isomerization into an open-ring species. The photoproduct was found to exhibit the ZE configuration of its backbone, which to be formed from the reactant molecule does not require extensive structural rearrangements of both the reagent and matrix. γ-Terpinene was photostable when subjected to irradiation under the same experimental conditions. In addition, the liquid compounds at room temperature were also investigated by FTIR-ATR and FT-Raman spectroscopies.

Intra- and intermolecular H-bond mediated tautomerization and dimerization of 3-methyl-1,2-cyclopentanedione: Infrared spectroscopy in argon matrix and CCl 4 solution

NASA Astrophysics Data System (ADS)

Samanta, Amit K.; Pandey, Prasenjit; Bandyopadhyay, Biman; Mukhopadhyay, Anamika; Chakraborty, Tapas

2011-05-01

Mid-infrared spectra of 3-methyl-1,2-cyclopentanedione (3-MeCPD) have been recorded by isolating the molecule in a cold argon matrix (8 K) and also in CCl 4 solution at room temperature. The spectral features reveal that in both media, the molecule exists exclusively in an enol tautomeric form, which is stabilized by an intramolecular O sbnd H⋯O hydrogen bond. NBO analysis shows that the preferred conformer is further stabilized because of hyperconjugation interaction between the methyl and vinyl group of the enol tautomer. In CCl 4 solution, the molecule undergoes extensive self association and generates a doubly hydrogen bonded centrosymmetric dimer. The dimerization constant ( K d) is estimated to have a value of ˜9 L mol -1 at room temperature (25 °C) and the thermodynamic parameters, Δ H°, Δ S° and Δ G°, of dimerization are estimated by measuring K d at several temperatures within the range 22-60 °C. The same dimer is also produced when the matrix is annealed at a higher temperature. In addition, a non-centrosymmetric singly hydrogen bonded dimer is also identified in the argon matrix. A comparison between the spectral features of the two dimers indicates that the dimerization effect on doubly H-bonded case is influenced by cooperative interaction between the two H-bonds.

Molecular and histological study on the effects of non-thermal irreversible electroporation on the liver.

PubMed

Zhang, Yanfang; Lyu, Chenang; Liu, Yu; Lv, Yanpeng; Chang, Tammy T; Rubinsky, Boris

2018-06-07

Non-thermal irreversible electroporation (NTIRE) is a biophysical phenomenon in which certain electric fields delivered across the cell membrane in tissue, cause cell death, without affecting the extracellular matrix. "Minimally invasive regenerative surgery" is a new medical modality for treatment of end-stage organ or tissue failure in which exogenous cells are implanted in a decellularized niche in tissue, formed by the delivery of NTIRE electric fields across a targeted volume of tissue. We anticipate that the success of the procedure will depend on the time of implantation relative to the application of NTIRE. This study was performed to elucidate the histological and molecular events that occur within 24 h after NTIRE, in the context of optimal criteria for the time of implantation. To this end, we examined the histology of NTIRE treated rat liver with H&E, Masson trichrome and TUNEL staining. Western blot was used to examine pro and cleaved caspase-3 (marker for apoptosis), pro and cleaved caspase-1 and gasdermin D (markers for pyroptosis), and RIP3 and MLKL (markers for necroptosis). The key findings are that, complete hepatocytes disintegration within an intact extracellular matrix is seen at 6 h and, new hepatocytes are seen in the treated region at 24 h, after NTIRE. There is no evidence of apoptotic cell death from NTIRE, contrary to commonly made claims in the NTIRE literature. However, molecular pathways of pyroptosis and necroptosis, programed necrosis associated with inflammation, are activated at 6 h after NTIRE and are not evident at 24 h after NTIRE. These are fundamental new findings of basic value to the field of NTIRE in all its applications. Taken together the results suggest the hypothesis that an optimal time for implantation is about 24 h after NTIRE. Future studies in which exogenous cells are implanted at different times after NTIRE are required to examine this hypothesis. Copyright © 2018 Elsevier Inc. All rights reserved.

Extracellular matrix and cell shape: potential control points for inhibition of angiogenesis

NASA Technical Reports Server (NTRS)

Ingber, D.

1991-01-01

Capillary endothelial (CE) cells require two extracellular signals in order to switch from quiescence to growth and back to differentiation during angiogenesis: soluble angiogenic factors and insoluble extracellular matrix (ECM) molecules. Soluble endothelial mitogens, such as basic fibroblast growth factor (FGF), act over large distances to trigger capillary growth, whereas ECM molecules act locally to modulate cell responsiveness to these soluble cues. Recent studies reveal that ECM molecules regulate CE cell growth and differentiation by modulating cell shape and by activating intracellular chemical signaling pathways inside the cell. Recognition of the importance of ECM and cell shape during capillary morphogenesis has led to the identification of a series of new angiogenesis inhibitors. Elucidation of the molecular mechanism of capillary regulation may result in development of even more potent angiogenesis modulators in the future.

Matrix-isolation and ab initio study of HKrCCCl and HXeCCCl

NASA Astrophysics Data System (ADS)

Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid

2015-12-01

We report on two new noble-gas molecules, HKrCCCl and HXeCCCl, prepared in low-temperature Kr and Xe matrices. These molecules are made by UV photolysis of HCCCl in the matrices and subsequent thermal annealing. The HCCCl precursor is produced by microwave discharge of a mixture of a matrix gas with trichloroethylene (HClC=CCl2). The assignments of the new noble-gas molecules are supported by deuteration experiments and quantum chemical calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. No evidence of ClXeCCH, which is computationally reliably stable, is found in the experiments. ClKrCCH as well as the Ar compounds HArCCCl and ClArCCH are not observed either, which is in agreement with the calculations.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Rutherford Backscattering Spectrometry studies of 100 keV nitrogen ion implanted polypropylene polymer

NASA Astrophysics Data System (ADS)

Chawla, Mahak; Aggarwal, Sanjeev; Sharma, Annu

2017-09-01

The effect of nitrogen ion implantation on the structure and composition in polypropylene (PP) polymer has been studied. Implantation was carried out using 100 keV N+ ions at different fluences of 1 × 1015, 1 × 1016 and 1 × 1017 ions cm-2 with beam current density of ∼0.65 μA cm-2. Surface morphological changes in the pre- and post-implanted PP specimens have been studied using Rutherford Backscattering Spectrometry (RBS) and UV-Visible Spectroscopy. The spatial distribution of implantation induced modification in the form of carbonization and dehydrogenation in the near surface region of PP matrix, the projected range, retained dose of implanted nitrogen, the various elements present in the implanted layers and their differential cross-sections have been analyzed using RBS spectra. RUMP simulation yielded an increase in the concentration of carbon near the surface from 33 at.% (virgin) to 42 at.% at fluence of 1 × 1017 N+ cm-2. Further, optical absorption has been found to increase with a shift in the absorption edge from UV towards visible region with increasing fluence. UV-Vis absorption spectra also indicate a drastic decrease in optical energy gap from 4.12 eV (virgin) to 0.25 eV (1 × 1017 N+ cm-2) indicating towards the formation of carbonaceous network in the implanted region. All these changes observed using UV-Visible have been further correlated with the outcomes of the RBS characterization.

Adhesive interactions of human multiple myeloma cell lines with different extracellular matrix molecules.

PubMed

Kibler, C; Schermutzki, F; Waller, H D; Timpl, R; Müller, C A; Klein, G

1998-06-01

Multiple myeloma represents a human B cell malignancy which is characterized by a predominant localization of the malignant cell clone within the bone marrow. With the exception of the terminal stage of the disease the myeloma tumor cells do not circulate in the peripheral blood. The bone marrow microenvironment is believed to play an important role in homing, proliferation and terminal differentiation of myeloma cells. Here we have studied the expression of several extracellular matrix (ECM) molecules in the bone marrow of multiple myeloma patients and analyzed their adhesive capacities with four different human myeloma-derived cell lines. All ECM molecules analyzed (tenascin, laminin, fibronectin, collagen types I, III, V and VI) could be detected in bone marrow cryostat sections of multiple myeloma patients. Adhesion assays showed that only laminin, the microfibrillar collagen type VI and fibronectin were strong adhesive components for the myeloma cell lines U266, IM-9, OPM-2 and NCI-H929. Tenascin and collagen type I were only weak adhesive substrates for these myeloma cells. Adhesion to laminin and fibronectin was beta 1-integrin-mediated since addition of anti-beta 1-integrin antibodies could inhibit the binding of the four different cell types to both matrix molecules. In contrast, integrins do not seem to be involved in binding of the myeloma cells to collagen type VI. Instead, inhibition of binding by heparin suggested that membrane-bound heparan sulfate proteoglycans are responsible ligands for binding to collagen type VI. Adhesion assays with several B-cell lines resembling earlier differentiation stages revealed only weak interactions with tenascin and no interactions with collagen type VI, laminin or fibronectin. In summary, the interactions of human myeloma cells with the extracellular matrix may explain the specific retention of the plasma cells within the bone marrow.

Amplified spontaneous emission of pyranyliden derivatives in PVK matrix

NASA Astrophysics Data System (ADS)

Vembris, Aivars; Zarinsh, Elmars; Kokars, Valdis

2016-04-01

One of the well-known red light emitting laser dyes is 4-(dicyanomethylene)-2-methyl-6-(4-dimethylaminostyryl)-4Hpyran (DCM). Amplified spontaneous emission (ASE) has been widely investigated of DCM molecules or its derivatives in polymer or low molecular weight matrix. The main issue for these molecules is aggregation which limits doping concentration in matrix. Lowest ASE threshold values within concentration range of 2 and 4 wt% were obtained. In this work ASE properties of two original DCM derivatives in poly(N-vinylcarbazole) (PVK) at various concentrations will be discussed. One of the derivatives is the same DCM dye with replaced butyl groups at electron donor part with bulky trytiloxyethyl groups (DWK-1). These groups do not influence electron transitions in the dye but prevent aggregation of the molecules. Second derivative (DWK-2) consists of two equal donor groups with the attached trytiloxyethyl groups. All results were compared with DCM:PVK system. Photoluminescence quantum yield (PLQY) is almost three times larger for DWK-1 concentration up to 20wt% with respect to DCM systems. PLQY was saturated on 0.06 at higher DWK-1 concentrations. Bulky trytiloxyethyl groups prevent aggregation of the molecules thus decreasing interaction between dyes and numbers of non-radiative decays. Red shift of photoluminescence and amplified spontaneous emission at higher concentrations were observed due to the solid state solvation effect. Increases of dye density in matrix with smaller lose in PLQY resulted in low ASE threshold energy. The lowest threshold value was obtained around 29 μJ/cm2 in DWK-1:PVK films.

Enhanced healing of rat calvarial critical size defect with selenium-doped lamellar biocomposites.

PubMed

Wang, Yanhua; Lv, Peng; Ma, Zhe; Zhang, Jingcheng

2013-10-01

A 3D porous lamellar selenium-containing nano-hydroxyapatite (SeHAN)/chitosan (CS) biocomposite was synthesized. The selenium-containing hydroxyapatite (HA) grains of 150~200 nm in length and 20~30 nm in width were observed by dynamic light scattering and transmission electron microscopy. A combination of X-ray diffraction, Fourier-transform infrared spectroscopy, and SEM indicated that HA particles were uniformly dispersed in chitosan matrix and there was a chemical interaction between chitosan and HA. Then, a standard critical size calvarial bone defect was created in Wistar rats. In group 1, no implant was made in the defect. In groups 2 and 3, HA nanoparticles (HAN)/CS biocomposite and SeHAN/CS biocomposite were implanted into the defect, respectively. After 4 weeks, the histological assessment clearly exhibited no significant changes, only found some living cells anchored in the periphery of the implants. After 8 and 12 weeks, most newly formed osteoid tissue was found in the SeHAN/CS implant group. Additionally, the newly formed osteoid tissue, both at the edge and in the center of implants, was bioactive and neovascularized. Microfocus computerized tomography measurements also confirmed the much better quality of the newly formed bone tissue in SeHAN/CS implant group than that in HAN/CS implant group (p < 0.01). Collectively, the SeHAN/CS biocomposite, as a bioactive bone grafting substitute, significantly enhanced the repair of bone defect.

High matrix metalloproteinase activity is a hallmark of periapical granulomas.

PubMed

de Paula-Silva, Francisco Wanderley Garcia; D'Silva, Nisha J; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine

2009-09-01

The inability to distinguish periapical cysts from granulomas before performing root canal treatment leads to uncertainty in treatment outcomes because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Because matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed by using one-way analysis of variance followed by the Tukey test. We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the MMP family. Compared with cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs) in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared with cysts. Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas unlike periapical cysts.

Biomimetic/Optical Sensors for Detecting Bacterial Species

NASA Technical Reports Server (NTRS)

Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

2006-01-01

Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites that bind only to molecules matched to the sites; other molecules are excluded. In a sensor according to the proposal, the MIP would feature molecular recognition sites that would bind the specific signaling molecules selectively according to their size, shape, and chemical functionality (see figure). As the film took up the signaling molecules in the molecular recognition sites, the index of refraction and thickness of the film would change, causing a wavelength shift of the peak of the resonance spectrum. It has been estimated that by measuring this wavelength shift, it should be possible to detect as little as 10 picomoles of a peptide signaling compound.

Enhancing surface properties of breast implants by using electrospun silk fibroin.

PubMed

Valencia-Lazcano, A A; Román-Doval, R; De La Cruz-Burelo, E; Millán-Casarrubias, E J; Rodríguez-Ortega, A

2017-08-24

In the present study, a new electrospun silk fibroin coating of silicone breast implants with improved biocompatibility and mechanical properties was obtained. Fibrous scaffolds were produced by electrospinning a solution containing silk fibroin, derived from Bombyx mori cocoons, and polyethylene oxide (PEO) to be used as a coating of breast implants. A randomly oriented structure of fibroin/PEO was electrospun on implants as assessed by SEM analysis, roughness measurements and ATR-FTIR spectroscopy. The scaffold showed 0.25 µm diameter fibres, 0.76 µm size superficial pores, arithmetic roughness of 0.632 ± 0.12 µm and texture aspect ratio of 0.893 ± 0.04. ATR-FTIR spectroscopy demonstrates the presence of PEO and fibroin in the coating. The mechanical characterisation of the implants before and after being coated with fibroin/PEO demonstrated that the fibroin/PEO scaffold contributes to the increase in the elastic modulus from 0.392 ± 0.02 to 0.560 ± 0.03 MPa and to a more elastic behaviour of the breast implants. Using the fibroin/PEO coating, human fibroblasts seeded on this matrix increased viability up to 30% compared to conventional breast implants. Electrospun silk fibroin could represent a clinically compatible, viable form to coat breast implants. Low cytotoxicity by the fibroin coating and its physico-chemical and mechanical properties may find application in improving breast implants biocompatibility. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2017. © 2017 Wiley Periodicals, Inc.

Carbon nanodots as a matrix for the analysis of low-molecular-weight molecules in both positive- and negative-ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and quantification of glucose and uric acid in real samples.

PubMed

Chen, Suming; Zheng, Huzhi; Wang, Jianing; Hou, Jian; He, Qing; Liu, Huihui; Xiong, Caiqiao; Kong, Xianglei; Nie, Zongxiu

2013-07-16

Carbon nanodots were applied for the first time as a new matrix for the analysis of low-molecular-weight compounds by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) in both positive- and negative-ion modes. A wide range of small molecules including amino acids, peptides, fatty acids, as well as β-agonists and neutral oligosaccharides were analyzed by MALDI MS with carbon nanodots as the matrix, and the lowest 0.2 fmol limits-of-detection were obtained for octadecanoic acid. Clear sodium and potassium adducts and deprotonated signals were produced in positive- and negative-ion modes. Furthermore, the glucose and uric acid in real samples were quantitatively determined by the internal standard method with the linear range of 0.5-9 mM and 0.1-1.8 mM (R(2) > 0.999), respectively. This work gives new insight into the application of carbon nanodots and provides a general approach for rapid analysis of low-molecular-weight compounds.

How bacteria hack the matrix and dodge the bullets of immunity.

PubMed

Paulsson, Magnus; Riesbeck, Kristian

2018-06-30

Haemophilus influenzae , Moraxella catarrhalis and Pseudomonas aeruginosa are common Gram-negative pathogens associated with an array of pulmonary diseases. All three species have multiple adhesins in their outer membrane, i.e. surface structures that confer the ability to bind to surrounding cells, proteins or tissues. This mini-review focuses on proteins with high affinity for the components of the extracellular matrix such as collagen, laminin, fibronectin and vitronectin. Adhesins are not structurally related and may be lipoproteins, transmembrane porins or large protruding trimeric auto-transporters. They enable bacteria to avoid being cleared together with mucus by attaching to patches of exposed extracellular matrix, or indirectly adhering to epithelial cells using matrix proteins as bridging molecules. As more adhesins are being unravelled, it is apparent that bacterial adhesion is a highly conserved mechanism, and that most adhesins target the same regions on the proteins of the extracellular matrix. The surface exposed adhesins are prime targets for new vaccines and the interactions between proteins are often possible to inhibit with interfering molecules, e.g heparin. In conclusion, this highly interesting research field of microbiology has unravelled host-pathogen interactions with high therapeutic potential. Copyright ©ERS 2018.

Radiation effects in astrophysical ices

NASA Astrophysics Data System (ADS)

Boduch, Philippe; Dartois, Emmanuel; de Barros, Ana L. F.; da Silveira, Enio F.; Domaracka, Alicja; Lv, Xue-Yang; Palumbo, Maria Elisabetta; Pilling, Sergio; Rothard, Hermann; Seperuelo Duarte, Eduardo; Strazzulla, Giovanni

2015-07-01

The interaction of heavy ions with astrophysical ices was studied at different beamlines of GANIL by infrared absorption spectroscopy. This allowed simulating in the laboratory the physico-chemical modifications induced in icy objects in space, exposed to radiation fields such as the solar wind, magnetospheric particles and interstellar cosmic rays. We briefly discuss sputtering, destruction and formation of molecules, amorphization and compaction, implantation, and finally the formation of organic molecules. This latter topic is related to the question of the initial conditions for the emergence of life.

Chronic multichannel neural recordings from soft regenerative microchannel electrodes during gait

NASA Astrophysics Data System (ADS)

Musick, Katherine M.; Rigosa, Jacopo; Narasimhan, Shreya; Wurth, Sophie; Capogrosso, Marco; Chew, Daniel J.; Fawcett, James W.; Micera, Silvestro; Lacour, Stéphanie P.

2015-09-01

Reliably interfacing a nerve with an electrode array is one of the approaches to restore motor and sensory functions after an injury to the peripheral nerve. Accomplishing this with current technologies is challenging as the electrode-neuron interface often degrades over time, and surrounding myoelectric signals contaminate the neuro-signals in awake, moving animals. The purpose of this study was to evaluate the potential of microchannel electrode implants to monitor over time and in freely moving animals, neural activity from regenerating nerves. We designed and fabricated implants with silicone rubber and elastic thin-film metallization. Each implant carries an eight-by-twelve matrix of parallel microchannels (of 120 × 110 μm2 cross-section and 4 mm length) and gold thin-film electrodes embedded in the floor of ten of the microchannels. After sterilization, the soft, multi-lumen electrode implant is sutured between the stumps of the sciatic nerve. Over a period of three months and in four rats, the microchannel electrodes recorded spike activity from the regenerating sciatic nerve. Histology indicates mini-nerves formed of axons and supporting cells regenerate robustly in the implants. Analysis of the recorded spikes and gait kinematics over the ten-week period suggests firing patterns collected with the microchannel electrode implant can be associated with different phases of gait.

In vivo evaluation of the bone integration of coated poly(vinyl-alcohol) hydrogel fiber implants.

PubMed

Moreau, David; Villain, Arthur; Bachy, Manon; Proudhon, Henry; Ku, David N; Hannouche, Didier; Petite, Hervé; Corté, Laurent

2017-08-01

Recently, it has been shown that constructs of poly(vinyl alcohol) (PVA) hydrogel fibers reproduce closely the tensile behavior of ligaments. However, the biological response to these systems has not been explored yet. Here, we report the first in vivo evaluation of these implants and focus on the integration in bone, using a rabbit model of bone tunnel healing. Implants consisted in bundles of PVA hydrogel fibers embedded in a PVA hydrogel matrix. Half of the samples were coated with a composite coating of hydroxyapatite (HA) particles embedded in PVA hydrogel. The biological integration was evaluated at 6 weeks using histology and micro-CT imaging. For all implants, a good biological tolerance and growth of new bone tissue are reported. All the implants were surrounded by a fibrous layer comparable to what was previously observed for poly(ethylene terephthalate) (PET) fibers currently used in humans for ligament reconstruction. An image analysis method is proposed to quantify the thickness of this fibrous capsule. Implants coated with HA were not significantly osteoconductive, which can be attributed to the slow dissolution of the selected hydroxyapatite. Overall, these results confirm the relevance of PVA hydrogel fibers for ligament reconstruction and adjustments are proposed to enhance its osseointegration.

Excitation energies from range-separated time-dependent density and density matrix functional theory.

PubMed

Pernal, Katarzyna

2012-05-14

Time-dependent density functional theory (TD-DFT) in the adiabatic formulation exhibits known failures when applied to predicting excitation energies. One of them is the lack of the doubly excited configurations. On the other hand, the time-dependent theory based on a one-electron reduced density matrix functional (time-dependent density matrix functional theory, TD-DMFT) has proven accurate in determining single and double excitations of H(2) molecule if the exact functional is employed in the adiabatic approximation. We propose a new approach for computing excited state energies that relies on functionals of electron density and one-electron reduced density matrix, where the latter is applied in the long-range region of electron-electron interactions. A similar approach has been recently successfully employed in predicting ground state potential energy curves of diatomic molecules even in the dissociation limit, where static correlation effects are dominating. In the paper, a time-dependent functional theory based on the range-separation of electronic interaction operator is rigorously formulated. To turn the approach into a practical scheme the adiabatic approximation is proposed for the short- and long-range components of the coupling matrix present in the linear response equations. In the end, the problem of finding excitation energies is turned into an eigenproblem for a symmetric matrix. Assignment of obtained excitations is discussed and it is shown how to identify double excitations from the analysis of approximate transition density matrix elements. The proposed method used with the short-range local density approximation (srLDA) and the long-range Buijse-Baerends density matrix functional (lrBB) is applied to H(2) molecule (at equilibrium geometry and in the dissociation limit) and to Be atom. The method accounts for double excitations in the investigated systems but, unfortunately, the accuracy of some of them is poor. The quality of the other excitations is in general much better than that offered by TD-DFT-LDA or TD-DMFT-BB approximations if the range-separation parameter is properly chosen. The latter remains an open problem.

Probing Biomolecular Structures and Dynamics of Single Molecules Using In-Gel Alternating-Laser Excitation

PubMed Central

Santoso, Yusdi; Kapanidis, Achillefs N.

2009-01-01

Gel electrophoresis is a standard biochemical technique used for separating biomolecules on the basis of size and charge. Despite the use of gels in early single-molecule experiments, gel electrophoresis has not been widely adopted for single-molecule fluorescence spectroscopy. We present a novel method that combines gel electrophoresis and single-molecule fluorescence spectroscopy to simultaneously purify and analyze biomolecules in a gel matrix. Our method, in-gel ALEX, uses non-denaturing gels to purify biomolecular complexes of interest from free components, aggregates, and non-specific complexes. The gel matrix also slows down translational diffusion of molecules, giving rise to long, high-resolution time traces without surface immobilization, which allow extended observations of conformational dynamics in a biologically friendly environment. We demonstrated the compatibility of this method with different types of single molecule spectroscopy techniques, including confocal detection and fluorescence-correlation spectroscopy. We demonstrated that in-gel ALEX can be used to study conformational dynamics at the millisecond timescale; by studying a DNA hairpin in gels, we directly observed fluorescence fluctuations due to conformational interconversion between folded and unfolded states. Our method is amenable to the addition of small molecules that can alter the equilibrium and dynamic properties of the system. In-gel ALEX will be a versatile tool for studying structures and dynamics of complex biomolecules and their assemblies. PMID:19863108

In vivo performance of an acellular disc-like angle ply structure (DAPS) for total disc replacement in a small animal model.

PubMed

Martin, John T; Kim, Dong Hwa; Milby, Andrew H; Pfeifer, Christian G; Smith, Lachlan J; Elliott, Dawn M; Smith, Harvey E; Mauck, Robert L

2017-01-01

Total intervertebral disc replacement with a biologic engineered disc may be an alternative to spinal fusion for treating end-stage disc disease. In previous work, we developed disc-like angle ply structures (DAPS) that replicate the structure and function of the native disc and a rat tail model to evaluate DAPS in vivo. Here, we evaluated a strategy in which, after in vivo implantation, endogenous cells could colonize the acellular DAPS and form an extracellular matrix organized by the DAPS topographical template. To do so, acellular DAPS were implanted into the caudal spines of rats and evaluated over 12 weeks by mechanical testing, histology, and microcomputed tomography. An external fixation device was used to stabilize the implant site and various control groups were included to evaluate the effect of immobilization. There was robust tissue formation within the DAPS after implantation and compressive mechanical properties of the implant matched that of the native motion segment. Immobilization provided a stable site for fibrous tissue formation after either a discectomy or a DAPS implantation, but bony fusion eventually resulted, with segments showing intervertebral bridging after long-term implantation, a process that was accelerated by the implanted DAPS. Thus, while compressive mechanical properties were replicated after DAPS implantation, methods to actively prevent fusion must be developed. Future work will focus on limiting fusion by remobilizing the motion segment after a period of integration, delivering pro-chondrogenic factors, and pre-seeding DAPS with cells prior to implantation. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:23-31, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Methodologies for Studying B. subtilis Biofilms as a Model for Characterizing Small Molecule Biofilm Inhibitors.

PubMed

Bucher, Tabitha; Kartvelishvily, Elena; Kolodkin-Gal, Ilana

2016-10-09

This work assesses different methodologies to study the impact of small molecule biofilm inhibitors, such as D-amino acids, on the development and resilience of Bacillus subtilis biofilms. First, methods are presented that select for small molecule inhibitors with biofilm-specific targets in order to separate the effect of the small molecule inhibitors on planktonic growth from their effect on biofilm formation. Next, we focus on how inoculation conditions affect the sensitivity of multicellular, floating B. subtilis cultures to small molecule inhibitors. The results suggest that discrepancies in the reported effects of such inhibitors such as D-amino acids are due to inconsistent pre-culture conditions. Furthermore, a recently developed protocol is described for evaluating the contribution of small molecule treatments towards biofilm resistance to antibacterial substances. Lastly, scanning electron microscopy (SEM) techniques are presented to analyze the three-dimensional spatial arrangement of cells and their surrounding extracellular matrix in a B. subtilis biofilm. SEM facilitates insight into the three-dimensional biofilm architecture and the matrix texture. A combination of the methods described here can greatly assist the study of biofilm development in the presence and absence of biofilm inhibitors, and shed light on the mechanism of action of these inhibitors.

Soft tissue wound healing at teeth, dental implants and the edentulous ridge when using barrier membranes, growth and differentiation factors and soft tissue substitutes.

PubMed

Vignoletti, Fabio; Nunez, Javier; Sanz, Mariano

2014-04-01

To review the biological processes of wound healing following periodontal and periimplant plastic surgery when different technologies are used in a) the coverage of root and implant dehiscences, b) the augmentation of keratinized tissue (KT) and c) the augmentation of soft tissue volume. An electronic search from The National Library of Medicine (MEDLINE-PubMed) was performed: English articles with research focus in oral soft tissue regeneration, providing histological outcomes, either from animal experimental studies or human biopsy material were included. Barrier membranes, enamel matrix derivatives, growth factors, allogeneic and xenogeneic soft tissue substitutes have been used in soft tissue regeneration demonstrating different degrees of regeneration. In root coverage, these technologies were able to improve new attachment, although none has shown complete regeneration. In KT augmentation, tissue-engineered allogenic products and xenogeneic collagen matrixes demonstrated integration within the host connective tissue and promotion of keratinization. In soft tissue augmentation and peri-implant plastic surgery there are no histological data currently available. Soft tissue substitutes, growth differentiation factors demonstrated promising histological results in terms of soft tissue regeneration and keratinization, whereas there is a need for further studies to prove their added value in soft tissue augmentation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Analytical investigations of poly(acrylic acid) coatings electrodeposited on titanium-based implants: a versatile approach to biocompatibility enhancement.

PubMed

De Giglio, E; Cometa, S; Cioffi, N; Torsi, L; Sabbatini, L

2007-12-01

A polyacrylic acid film was synthesized on titanium substrates from aqueous solutions via an electroreductive process for the first time. This work was done in order to develop a versatile coating for titanium-based orthopaedic implants that acts as both an effective bioactive surface and an effective anti-corrosion barrier. The chemical structure of the PAA coating was investigated by X-ray photoelectron spectroscopy (XPS). Scanning electron microscopy (SEM) was employed to evaluate the effect of annealing treatment on the morphology of the coatings in terms of their uniformity and porosity. Inductively coupled plasma mass spectrometry was used to measure ion concentrations in ion release tests performed on Ti-6Al-4V sheets modified with PAA coatings (annealed and unannealed). Results indicate that the annealing process produces coatings that possess considerable anti-corrosion performance. Moreover, the availability and the reactivity of the surface carboxylic groups were exploited in order to graft biological molecules onto the PAA-modified titanium implants. The feasibility of the grafting reaction was tested using a single aminoacid residue. A fluorinated aminoacid was selected, and the grafting reaction was monitored both by XPS, using fluorine as a marker element, and via quartz crystal microbalance (QCM) measurements. The success of the grafting reaction opens the door to the synthesis of a wide variety of PAA-based coatings that are functionalized with selected bioactive molecules and promote positive reactions with the biological system interfacing the implant while considerably reducing ion release into surrounding tissues.

Making molecular balloons in laser-induced explosive boiling of polymer solutions.

PubMed

Leveugle, Elodie; Sellinger, Aaron; Fitz-Gerald, James M; Zhigilei, Leonid V

2007-05-25

The effect of the dynamic molecular rearrangements leading to compositional segregation is revealed in coarse-grained molecular dynamics simulations of short pulse laser interaction with a polymer solution in a volatile matrix. An internal release of matrix vapor at the onset of the explosive boiling of the overheated liquid is capable of pushing polymer molecules to the outskirts of a transient bubble, forming a polymer-rich surface layer enclosing the volatile matrix material. The results explain unexpected "deflated balloon" structures observed in films deposited by the matrix-assisted pulsed laser evaporation technique.

Spectroscopic studies of clusterization of methanol molecules isolated in a nitrogen matrix

NASA Astrophysics Data System (ADS)

Vaskivskyi, Ye.; Doroshenko, I.; Chernolevska, Ye.; Pogorelov, V.; Pitsevich, G.

2017-12-01

IR absorption spectra of methanol isolated in a nitrogen matrix are recorded at temperatures ranging from 9 to 34 K. The changes in the spectra with increasing matrix temperature are analyzed. Based on quantum-chemical calculations of the geometric and spectral parameters of different methanol clusters, the observed absorption bands are identified. The cluster composition of the sample is determined at each temperature. It is shown that as the matrix is heated there is a redistribution among the different cluster structures in the sample, from smaller to larger clusters.

Raman Scattering Studies on Ag Nanocluster Composites Formed by Ion Implantation into Silica

NASA Astrophysics Data System (ADS)

Ren, Feng; Jiang, Chang Zhong; Fu, De Jun; Fu, Qiang

2005-12-01

Highly-pure amorphous silica slides were implanted by 200 keV Ag ions with doses ranged from 1× 1016 to 2× 1017 ions/cm2. Optical absorption spectra show that Ag nanoclusters with various sizes have been formed. Enhancement of surface enhanced Raman scattering signal by a factor up to about 103 was obtained by changing the Ag particle size. The silica was damaged by the implanted Ag ions, and the large compression stress on the silica leads to the shift of Raman peaks. New bands at 1368 and 1586 cm-1, which are attributed to the vibration of Ag-O bond and O2 molecules in silica, are observed in the samples with doses higher than 1× 1017 ions/cm2.

Monte Carlo study of disorder in HMTA

NASA Astrophysics Data System (ADS)

Goossens, D. J.; Welberry, T. R.

2001-12-01

We investigate disordered solids by automated fitting of a Monte Carlo simulation of a crystal to observed single-crystal diffuse X-ray scattering. This method has been extended to the study of crystals of relatively large organic molecules by using a z-matrix to describe the molecules. This allows exploration of motions within molecules. We refer to the correlated thermal motion observed in benzil, and to the occupational and thermal disorder in the 1:1 adduct of hexamethylenetetramine and azelaic acid, HMTA. The technique is capable of giving insight into modes of vibration within molecules and correlated motions between molecules.