Håkansson, Joakim; Xian, Xiaojie; He, Liqun; Ståhlberg, Anders; Nelander, Sven; Samuelsson, Tore; Kubista, Mikael; Semb, Henrik
2005-01-01
To understand by which mechanism neural cell adhesion molecule (N-CAM) limits beta tumour cell disaggregation and dissemination, we searched for potential downstream genes of N-CAM during beta tumour cell progression by gene expression profiling. Here, we show that N-CAM-deficient beta-cell tumorigenesis is associated with changes in the expression of genes involved in cell-matrix adhesion and cytoskeletal dynamics, biological processes known to affect the invasive and metastatic behaviour of tumour cells. The extracellular matrix (ECM) molecules emerged as the primary target, i.e. N-CAM deficiency resulted in down-regulated mRNA expression of a broad range of ECM molecules. Consistent with this result, deficient deposition of major ECM stromal components, such as fibronectin, laminin 1 and collagen IV, was observed. Moreover, N-CAM-deficient tumour cells displayed defective matrix adhesion. These results offer a potential mechanism for tumour cell disaggregation during N-CAM-deficient beta tumour cell progression. Prospective consequences of these findings for the role of N-CAM in beta tumour cell dissemination are discussed.
NASA Astrophysics Data System (ADS)
Dmitriev, Yurij A.; Zelenetckii, Ilia A.; Benetis, Nikolas P.
2018-05-01
EPR investigation of the lineshape of matrix -isolated methyl radical, CH3, spectra recorded in solid N2O and CO2 was carried out. Reversible temperature-dependent line width anisotropy was observed in both matrices. This effect is a fingerprint of the extra-slow radical rotation about the in-plane C2 axes. The rotation was found to be anisotropic and closely correlated to the orientational dynamics of the matrix molecules. It was suggested that a recently discovered "hoping precession" effect of matrix molecules in solid CO2 is a common feature of matrices of the linear molecules CO, N2O, and CO2. A new low-temperature matrix effect, referred to as "libration trap", was proposed which accounts for the changing CH3 reorientational motion about the radical C3-axis from rotation to libration. Temperature dependence of the intensity of the EPR satellites produced by these nonrotating-but librating methyls was presented. This allowed for a rough estimation of the rotation hindering potential due to correlation mismatch between the radical and the nearest matrix molecules' librations.
NASA Astrophysics Data System (ADS)
Gunde, R.; Ha, T.-K.; Günthard, H. H.
1990-08-01
In this paper results of consistent force field modeling (CFF) of the potential function to conversion of the gauche (g) to the trans (t) conformer of 1,2-difluoroethane (DFE) isolated in an argon matrix will be reported. Starting point are locally stable configurations gDFE:Ar 364 (defect GH1) and tDFE:Ar 364 (TH1) obtained in previous work from CFF modeling of a cube shaped Ar 364 fragment containing one DFE molecule in its center. Using the dihedral angle of DFE as an independent parameter the minimum energy path of the conversion process gDFE:Ar 364→tDFE:Ar 364 will be determined by CFF energy minimization. Determination of the minimum energy path is found to require large numbers of energy minimization steps and to lead to a rather complicated motion of the molecule with respect to the crystal fragment. Surprisingly the molecule-matrix interactions lead to a reduction of the g-t barrier by ≈500 cal/mol and to a stabilization of the trans species by ≈500 cal/mol. This finding is a consequence of a delicate interplay of matrix-molecule and matrix-matrix interactions. Calculation of the electric polarization energy (induced dipole-first-order polarization approximation) is based on extended ab initio calculations of dipole and quadrupole moments and a bond polarizability estimate of the first-order polarizability of DFE as a function of the internal rotation angle, on Fourier expansion of multipole components and use of symmetry for reduction of the order of the linear system defining the (self-consistent) induced dipole moments of all Ar atoms. Electric polarization is found to alter the potential function of the conversion process in a profound way: the g-t barrier and the t-g energy difference are increased to ≈3000 cal/mol and to ≈1500 cal/mol respectively (≈2500 and ≈530 cal/mol respectively for free DFE). Further applications of the technique developed in this work to related problems of matrix isolated molecules, e.g., vibrational matrix shifts will be discussed.
CO2 in solid para-hydrogen: spectral splitting and the CO2···(o-H2)n clusters.
Du, Jun-He; Wan, Lei; Wu, Lei; Xu, Gang; Deng, Wen-Ping; Liu, An-Wen; Chen, Yang; Hu, Shui-Ming
2011-02-17
Complicated high-resolution spectral structures are often observed for molecules doped in solid molecular hydrogen. The structures can result from miscellaneous effects and are often interpreted differently in references. The spectrum of the ν(3) band of CO(2) in solid para-H(2) presents a model system which exhibits rich spectral structures. With the help of the potential energy simulation of the CO(2) molecule doped in para-hydrogen matrix, and extensive experiments with different CO(2) isotopologues and different ortho-hydrogen concentrations in the matrix, the spectral features observed in p-H(2) matrix are assigned to the CO(2)···(o-H(2))(n) clusters and also to energy level splitting that is due to different alignments of the doped CO(2) molecules in the matrix. The assignments are further supported by the dynamics analysis and also by the spectrum recorded with sample codoped with O(2) which serves as catalyst transferring o-H(2) to p-H(2) in the matrix at 4 K temperature. The observed spectral features of CO(2)/pH(2) can potentially be used as an alternative readout of the temperature and orthohydrogen concentration in the solid para-hydrogen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, C.F.; Light, J.C.
1986-02-01
The effective R-matrix model and the R-matrix propagative method applied earlier to elec- tron--diatomic-molecule scattering are extended to treat dissociative attachment of collinear triatomic molecules. To describe the vibrational excitation and dissociative attachment of CO/sub 2/ in the 4-eV region, the nuclear dynamics is solved on a Wall-Porter potential-energy surface. A hybrid approach is developed in which the L/sup 2/ and R-matrix propagation methods are combined to evaluate the global R matrix. Our calculations show that it is easier to excite the symmetric mode vibrations than the asymmetric mode vibrations. Our results also show that the observed structures in themore » energy dependence of the dissociative attachment cross sections are due to the vibrational states of the negative ion (CO/sub 2/ /sup -/) and not to the vibrational states of the CO fragment.« less
Moradi, Ali; Ataollahi, Forough; Sayar, Katayoun; Pramanik, Sumit; Chong, Pan-Pan; Khalil, Alizan Abdul; Kamarul, Tunku; Pingguan-Murphy, Belinda
2016-01-01
Extracellular matrices have drawn attention in tissue engineering as potential biomaterials for scaffold fabrication because of their bioactive components. Noninvasive techniques of scaffold fabrication and cross-linking treatments are believed to maintain the integrity of bioactive molecules while providing proper architectural and mechanical properties. Cartilage matrix derived scaffolds are designed to support the maintenance of chondrocytes and provide proper signals for differentiation of chondroinducible cells. Chondroinductive potential of bovine articular cartilage matrix derived porous scaffolds on human dermal fibroblasts and the effect of scaffold shrinkage on chondrogenesis were investigated. An increase in sulfated glycosaminoglycans production along with upregulation of chondrogenic genes confirmed that physically treated cartilage matrix derived scaffolds have chondrogenic potential on human dermal fibroblasts. © 2015 Wiley Periodicals, Inc.
Modeling of diatomic molecule using the Morse potential and the Verlet algorithm
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fidiani, Elok
Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H{sub 2} and O{sub 2}. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction betweenmore » the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.« less
Synthesis of Dibenzo[hi,st]ovalene and Its Amplified Spontaneous Emission in a Polystyrene Matrix.
Paternò, Giuseppe M; Chen, Qiang; Wang, Xiao-Ye; Liu, Junzhi; Motti, Silvia G; Petrozza, Annamaria; Feng, Xinliang; Lanzani, Guglielmo; Müllen, Klaus; Narita, Akimitsu; Scotognella, Francesco
2017-06-06
A large number of graphene molecules, or large polycyclic aromatic hydrocarbons (PAHs), have been synthesized and display various optoelectronic properties. Nevertheless, their potential for application in photonics has remained largely unexplored. Herein, we describe the synthesis of a highly luminescent and stable graphene molecule, namely a substituted dibenzo[hi,st]ovalene (DBO 1), with zigzag edges and elucidate its promising optical-gain properties by means of ultrafast transient absorption spectroscopy. Upon incorporation of DBO into an inert polystyrene matrix, amplified stimulated emission can be observed with a relatively low power threshold (ca. 60 μJ cm -2 ), thus highlighting its high potential for lasing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Curcumin: a potential candidate for matrix metalloproteinase inhibitors.
Kumar, Dileep; Kumar, Manish; Saravanan, Chinnadurai; Singh, Sushil Kumar
2012-10-01
Curcumin, a natural yellow pigment of turmeric, has become focus of interest with regard to its role in regulation of matrix metalloproteinases (MMPs). MMPs are metal-dependent endopeptidases capable of degrading components of the extracellular matrix. MMPs are involved in chronic diseases such as arthritis, Alzheimer's disease, psoriasis, chronic obstructive pulmonary disease, asthma, cancer, neuropathic pain, and atherosclerosis. Curcumin regulates the expression and secretion of various MMPs. This review documents the matrix metalloproteinase inhibitory activity of curcumin on various diseases viz., cancer, arthritis, and ulcer. Finally, the steps to be taken for getting potent curcuminoids have also been discussed in the structure-activity relationship (SAR) section. From this review, readers can get answer to the question: Is curcumin a potential MMPI candidate? Numerous approaches have been taken to beget a molecule with specificity restricted to a particular MMP as well as good oral bioavailability; however, nearly all the molecules lack these criteria. Using quantitative structure-activity relationship (QSAR) modeling and virtual screening, new analogs of curcumin can be designed which will be selectively inhibiting different MMPs.
Davis, Max E.; Gumucio, Jonathan P.; Sugg, Kristoffer B.; Bedi, Asheesh
2013-01-01
The extracellular matrix (ECM) of skeletal muscle and tendon is composed of different types of collagen molecules that play important roles in the transmission of forces throughout the body, and in the repair and regeneration of injured tissues. Fibroblasts are the primary cells in muscle and tendon that maintain, repair, and modify the ECM in response to mechanical loading, injury, and inactivity. Matrix metalloproteinases (MMPs) are enzymes that digest collagen and other structural molecules, which are synthesized and excreted by fibroblasts. MMPs are required for baseline ECM homeostasis, but disruption of MMP regulation due to injury or disease can alter the normal ECM architecture and prevent proper force transmission. Chronic injuries and diseases of muscles and tendons can be severely debilitating, and current therapeutic modalities to enhance healing are quite limited. This review will discuss the mechanobiology of MMPs, and the potential use of MMP inhibitors to improve the treatment of injured and diseased skeletal muscle and tendon tissue. PMID:23640595
NASA Technical Reports Server (NTRS)
Thuemmel, Helmar T.; Huo, Winifred M.; Langhoff, Stephen R. (Technical Monitor)
1995-01-01
For the calculation of electron molecule collision cross sections R-matrix methods automatically take advantage of the division of configuration space into an inner region (I) bounded by radius tau b, where the scattered electron is within the molecular charge cloud and the system is described by an correlated Configuration Interaction (CI) treatment in close analogy to bound state calculations, and an outer region (II) where the scattered electron moves in the long-range multipole potential of the target and efficient analytic methods can be used for solving the asymptotic Schroedinger equation plus boundary conditions.
Guinan, Taryn; Kirkbride, Paul; Pigou, Paul E; Ronci, Maurizio; Kobus, Hilton; Voelcker, Nicolas H
2015-01-01
Matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) is an excellent analytical technique for the rapid and sensitive analysis of macromolecules (>700 Da), such as peptides, proteins, nucleic acids, and synthetic polymers. However, the detection of smaller organic molecules with masses below 700 Da using MALDI-MS is challenging due to the appearance of matrix adducts and matrix fragment peaks in the same spectral range. Recently, nanostructured substrates have been developed that facilitate matrix-free laser desorption ionization (LDI), contributing to an emerging analytical paradigm referred to as surface-assisted laser desorption ionization (SALDI) MS. Since SALDI enables the detection of small organic molecules, it is rapidly growing in popularity, including in the field of forensics. At the same time, SALDI also holds significant potential as a high throughput analytical tool in roadside, work place and athlete drug testing. In this review, we discuss recent advances in SALDI techniques such as desorption ionization on porous silicon (DIOS), nano-initiator mass spectrometry (NIMS) and nano assisted laser desorption ionization (NALDI™) and compare their strengths and weaknesses with particular focus on forensic applications. These include the detection of illicit drug molecules and their metabolites in biological matrices and small molecule detection from forensic samples including banknotes and fingerprints. Finally, the review highlights recent advances in mass spectrometry imaging (MSI) using SALDI techniques. © 2014 Wiley Periodicals, Inc.
Extracellular matrix and cell shape: potential control points for inhibition of angiogenesis
NASA Technical Reports Server (NTRS)
Ingber, D.
1991-01-01
Capillary endothelial (CE) cells require two extracellular signals in order to switch from quiescence to growth and back to differentiation during angiogenesis: soluble angiogenic factors and insoluble extracellular matrix (ECM) molecules. Soluble endothelial mitogens, such as basic fibroblast growth factor (FGF), act over large distances to trigger capillary growth, whereas ECM molecules act locally to modulate cell responsiveness to these soluble cues. Recent studies reveal that ECM molecules regulate CE cell growth and differentiation by modulating cell shape and by activating intracellular chemical signaling pathways inside the cell. Recognition of the importance of ECM and cell shape during capillary morphogenesis has led to the identification of a series of new angiogenesis inhibitors. Elucidation of the molecular mechanism of capillary regulation may result in development of even more potent angiogenesis modulators in the future.
CD44 in cancer progression: adhesion, migration and growth regulation.
Marhaba, R; Zöller, M
2004-03-01
It is well established that the large array of functions that a tumour cell has to fulfil to settle as a metastasis in a distant organ requires cooperative activities between the tumour and the surrounding tissue and that several classes of molecules are involved, such as cell-cell and cell-matrix adhesion molecules and matrix degrading enzymes, to name only a few. Furthermore, metastasis formation requires concerted activities between tumour cells and surrounding cells as well as matrix elements and possibly concerted activities between individual molecules of the tumour cell itself. Adhesion molecules have originally been thought to be essential for the formation of multicellular organisms and to tether cells to the extracellular matrix or to neighbouring cells. CD44 transmembrane glycoproteins belong to the families of adhesion molecules and have originally been described to mediate lymphocyte homing to peripheral lymphoid tissues. It was soon recognized that the molecules, under selective conditions, may suffice to initiate metastatic spread of tumour cells. The question remained as to how a single adhesion molecule can fulfil that task. This review outlines that adhesion is by no means a passive task. Rather, ligand binding, as exemplified for CD44 and other similar adhesion molecules, initiates a cascade of events that can be started by adherence to the extracellular matrix. This leads to activation of the molecule itself, binding to additional ligands, such as growth factors and matrix degrading enzymes, complex formation with additional transmembrane molecules and association with cytoskeletal elements and signal transducing molecules. Thus, through the interplay of CD44 with its ligands and associating molecules CD44 modulates adhesiveness, motility, matrix degradation, proliferation and cell survival, features that together may well allow a tumour cell to proceed through all steps of the metastatic cascade.
Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J
2013-03-01
Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.
Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.
2012-01-01
Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516
Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua
2018-04-01
Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H] - ) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. Graphical Abstract ᅟ.
Matrix Metalloproteinases as Regulators of Periodontal Inflammation.
Franco, Cavalla; Patricia, Hernández-Ríos; Timo, Sorsa; Claudia, Biguetti; Marcela, Hernández
2017-02-17
Periodontitis are infectious diseases characterized by immune-mediated destruction of periodontal supporting tissues and tooth loss. Matrix metalloproteinases (MMPs) are key proteases involved in destructive periodontal diseases. The study and interest in MMP has been fuelled by emerging evidence demonstrating the broad spectrum of molecules that can be cleaved by them and the myriad of biological processes that they can potentially regulate. The huge complexity of MMP functions within the 'protease web' is crucial for many physiologic and pathologic processes, including immunity, inflammation, bone resorption, and wound healing. Evidence points out that MMPs assemble in activation cascades and besides their classical extracellular matrix substrates, they cleave several signalling molecules-such as cytokines, chemokines, and growth factors, among others-regulating their biological functions and/or bioavailability during periodontal diseases. In this review, we provide an overview of emerging evidence of MMPs as regulators of periodontal inflammation.
NASA Astrophysics Data System (ADS)
Huang, Jianglou; Liu, Jinsong; Wang, Kejia; Yang, Zhengang; Liu, Xiaming
2018-06-01
By means of factor analysis approach, a method of molecule classification is built based on the measured terahertz absorption spectra of the molecules. A data matrix can be obtained by sampling the absorption spectra at different frequency points. The data matrix is then decomposed into the product of two matrices: a weight matrix and a characteristic matrix. By using the K-means clustering to deal with the weight matrix, these molecules can be classified. A group of samples (spirobenzopyran, indole, styrene derivatives and inorganic salts) has been prepared, and measured via a terahertz time-domain spectrometer. These samples are classified with 75% accuracy compared to that directly classified via their molecular formulas.
NASA Astrophysics Data System (ADS)
Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua
2018-01-01
Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H]-) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. [Figure not available: see fulltext.
How bacteria hack the matrix and dodge the bullets of immunity.
Paulsson, Magnus; Riesbeck, Kristian
2018-06-30
Haemophilus influenzae , Moraxella catarrhalis and Pseudomonas aeruginosa are common Gram-negative pathogens associated with an array of pulmonary diseases. All three species have multiple adhesins in their outer membrane, i.e. surface structures that confer the ability to bind to surrounding cells, proteins or tissues. This mini-review focuses on proteins with high affinity for the components of the extracellular matrix such as collagen, laminin, fibronectin and vitronectin. Adhesins are not structurally related and may be lipoproteins, transmembrane porins or large protruding trimeric auto-transporters. They enable bacteria to avoid being cleared together with mucus by attaching to patches of exposed extracellular matrix, or indirectly adhering to epithelial cells using matrix proteins as bridging molecules. As more adhesins are being unravelled, it is apparent that bacterial adhesion is a highly conserved mechanism, and that most adhesins target the same regions on the proteins of the extracellular matrix. The surface exposed adhesins are prime targets for new vaccines and the interactions between proteins are often possible to inhibit with interfering molecules, e.g heparin. In conclusion, this highly interesting research field of microbiology has unravelled host-pathogen interactions with high therapeutic potential. Copyright ©ERS 2018.
Potential Roles of Protease Inhibitors in Cancer Progression.
Yang, Peng; Li, Zhuo-Yu; Li, Han-Qing
2015-01-01
Proteases are important molecules that are involved in many key physiological processes. Protease signaling pathways are strictly controlled, and disorders in protease activity can result in pathological changes such as cardiovascular and inflammatory diseases, cancer and neurological disorders. Many proteases have been associated with increasing tumor metastasis in various human cancers, suggesting important functional roles in the metastatic process because of their ability to degrade the extracellular matrix barrier. Proteases are also capable of cleaving non-extracellular matrix molecules. Inhibitors of proteases to some extent can reduce invasion and metastasis of cancer cells, and slow down cancer progression. In this review, we focus on the role of a few proteases and their inhibitors in tumors as a basis for cancer prognostication and therapy.
Liu, Huihui; Chen, Rui; Wang, Jiyun; Chen, Suming; Xiong, Caiqiao; Wang, Jianing; Hou, Jian; He, Qing; Zhang, Ning; Nie, Zongxiu; Mao, Lanqun
2014-10-21
A sensitive analytical technique for visualizing small endogenous molecules simultaneously is of great significance for clearly elucidating metabolic mechanisms during pathological progression. In the present study, 1,5-naphthalenediamine (1,5-DAN) hydrochloride was prepared for matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI) of small molecules in liver, brain, and kidneys from mice. Furthermore, 1,5-DAN hydrochloride assisted LDI MSI of small molecules in brain tissue of rats subjected to middle cerebral artery occlusion (MCAO) was carried out to investigate the altered metabolic pathways and mechanisms underlying the development of ischemic brain damage. Our results suggested that the newly prepared matrix possessed brilliant features including low cost, strong ultraviolet absorption, high salt tolerance capacity, and fewer background signals especially in the low mass range (typically m/z < 500), which permitted us to visualize the spatial distribution of a broad range of small molecule metabolites including metal ions, amino acids, carboxylic acids, nucleotide derivatives, peptide, and lipids simultaneously. Nineteen endogenous metabolites involved in metabolic networks such as ATP metabolism, tricarboxylic acid (TCA) cycle, glutamate-glutamine cycle, and malate-aspartate shuttle, together with metal ions and phospholipids as well as antioxidants underwent relatively obvious changes after 24 h of MCAO. The results were highly consistent with the data obtained by MRM MS analysis. These findings highlighted the promising potential of the organic salt matrix for application in the field of biomedical research.
Matrix isolation infrared spectra and photochemistry of hydantoin.
Ildiz, Gulce Ogruc; Nunes, Cláudio M; Fausto, Rui
2013-01-31
Hydantoin (C(3)H(4)N(2)O(2), 2,4-imidazolidinedione) was isolated in argon matrix at 10 K and its infrared spectrum and unimolecular photochemistry were investigated. The molecular structure of the compound was studied both at the DFT(B3LYP) and MP2 levels of approximation with valence triple- and quadruple-ζ basis sets (6-311++G(d,p); cc-pVQZ). It was concluded that the minima in the potential energy surfaces of the molecule correspond to C(1) symmetry structures. However, the energy barrier separating the two-equivalent-by-symmetry minima stays below their zero-point energy, which makes the C(s) symmetry structure, which separates the two minima, the experimentally relevant one. The electronic structure of the molecule was studied in detail by performing the Natural Bond Orbital analysis of its electronic configuration within the DFT(B3LYP)/cc-pVQZ space. The infrared spectrum of the matrix isolated compound was fully assigned also with help of the theoretically predicted spectrum. Upon irradiation at λ = 230 nm, matrix-isolated hydantoin was found to photofragment into isocyanic acid, CO, and methylenimine.
Fujimura, Yoshinori; Miura, Daisuke
2014-01-01
Understanding the spatial distribution of bioactive small molecules is indispensable for elucidating their biological or pharmaceutical roles. Mass spectrometry imaging (MSI) enables determination of the distribution of ionizable molecules present in tissue sections of whole-body or single heterogeneous organ samples by direct ionization and detection. This emerging technique is now widely used for in situ label-free molecular imaging of endogenous or exogenous small molecules. MSI allows the simultaneous visualization of many types of molecules including a parent molecule and its metabolites. Thus, MSI has received much attention as a potential tool for pathological analysis, understanding pharmaceutical mechanisms, and biomarker discovery. On the other hand, several issues regarding the technical limitations of MSI are as of yet still unresolved. In this review, we describe the capabilities of the latest matrix-assisted laser desorption/ionization (MALDI)-MSI technology for visualizing in situ metabolism of endogenous metabolites or dietary phytochemicals (food factors), and also discuss the technical problems and new challenges, including MALDI matrix selection and metabolite identification, that need to be addressed for effective and widespread application of MSI in the diverse fields of biological, biomedical, and nutraceutical (food functionality) research. PMID:24957029
NASA Astrophysics Data System (ADS)
Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang
2016-07-01
Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.
Marzec, K M; Reva, I; Fausto, R; Proniewicz, L M
2011-05-05
In the present work, γ-terpinene (a 1,4-diene derivative) and α-phellandrene (1,3-diene derivative) were isolated in cryogenic argon matrices and their structures, vibrational spectra, and photochemistries were characterized with the aid of FTIR spectroscopy and quantum chemical calculations performed at the DFT/B3LYP/6-311++G(d,p) level of approximation. The molecules bear one conformationally relevant internal rotation axis, corresponding to the rotation of the isopropyl group. The calculations provide evidence of three minima on the potential energy surfaces of the studied molecules, where the isopropyl group assumes the trans, gauche+, and gauche- conformations (T, G+, G-). The signatures of all these conformers were identified in the experimental matrix infrared spectra, with the T forms dominating, in agreement with the theoretical predicted abundances in gas phase at room temperature. In situ UV (λ > 200 nm) irradiation of matrix-isolated α-phellandrene led to its isomerization into an open-ring species. The photoproduct was found to exhibit the ZE configuration of its backbone, which to be formed from the reactant molecule does not require extensive structural rearrangements of both the reagent and matrix. γ-Terpinene was photostable when subjected to irradiation under the same experimental conditions. In addition, the liquid compounds at room temperature were also investigated by FTIR-ATR and FT-Raman spectroscopies.
Application of the R-matrix method to photoionization of molecules.
Tashiro, Motomichi
2010-04-07
The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.
Buravkova, L B; Andreeva, E R; Lobanova, M V; Cotnezova, E V; Grigoriev, A I
2018-03-01
The dynamics of the expression of genes encoding adhesion molecules, molecules of the connective tissue matrix, and its remodeling enzymes was studied in multipotent mesenchymal stromal cells (MSCs) from human adipose tissue after interaction with cord blood hematopoietic progenitors (HSPCs). An upregulation of ICAM1 and VCAM1, directly proportional to the coculture time (24-72 h), was found. After 72 h of culturing, a downregulation of the genes encoding the majority of matrix molecules (SPP1; COL6A2,7A1; MMP1,3; TIMP1,3; and HAS1) and cell-matrix adhesion molecules (ITGs) was revealed. The detected changes may ensure the realization of the stromal MSC function due to improvement of adhesion and transmigration of HSPCs into the subcellular space.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laursen, S.L.
Investigations of chemical reactions on electronically excited reaction surfaces are presented. The role of excited-surface multiplicity is of particular interest, as are chemical reactivity and energy transfer in systems in which photochemistry is initiated through a metal atom sensitizer.'' Two approaches are employed: A heavy-atom matrix affords access to forbidden triplet reaction surfaces, eliminating the need for a potentially reactive sensitizer. Later, the role of the metal atom in the photosensitization process is examined directly.
Cell adhesion molecules, the extracellular matrix and oral squamous carcinoma.
Lyons, A J; Jones, J
2007-08-01
Carcinomas are characterized by invasion of malignant cells into the underlying connective tissue and migration of malignant cells to form metastases at distant sites. These processes require alterations in cell-cell and cell-extracellular matrix interactions. As cell adhesion molecules play a role in cell-cell and cell-extracellular matrix adhesion and interactions they are involved in the process of tumour invasion and metastases. In epithelial tissues, receptors of the integrin family mediate adhesion to the adjacent matrix whereas cadherins largely mediate intercellular adhesion. These and other cell adhesion molecules such as intercellular adhesion molecule-1, CD44, dystroglycans and selectins, are involved and undergo changes in carcinomas, which provide possible targets for anti-cancer drug treatments. In the extracellular matrix that is associated with tumours, laminin 5, oncofetal fibronectin and tenascin C appear. The degree of expression of some of these moieties indicates prognosis in oral cancer and offer targets for antibody-directed radiotherapy. Metalloproteases which degrade the extracellular matrix are increased in carcinomas, and their activity is necessary for tumour angiogenesis and consequent invasion and metastases. Metalloprotease inhibitors have begun to produce decreases in mortality in clinical trials. This report provides a brief overview of our current understanding of cell adhesion molecules, the extracellular matrix, tumour invasion and metastasis.
Feng, Dan; Xia, Yan
2018-07-19
Covalent organic framework (COF) was explored as a novel matrix with a high desorption/ionization efficiency for direct detection of small molecules by laser desorption/ionization time-of-flight mass spectrometry (LDI-TOF MS). By using COF as an LDI MS matrix, we could detect not only biological micro molecules such as amino acids and fatty acids, but also emerging environmental pollutants like bisphenol S (BPS) and pyrene. With COF as the matrix, higher desorption/ionization efficiency, and less background interference were achieved than the conventional organic matrices. Good salt tolerance (as high as 500 mM NaCl) and repeatability allowed the detection limit of amino acids was 90 fmol. In addition, COF matrix performed well for amino acids analysis in the honey sample. The ionization mechanism was also discussed. These results demonstrate that COF is a powerful matrix for small molecules analysis in real samples by MS. Copyright © 2018 Elsevier B.V. All rights reserved.
Vural, Kamil; Kosova, Funda; Kurt, Feyzan Özdal; Tuğlu, İbrahim
2017-10-01
The chaperone-binding drug, 17-allylamino-17-demethoxygeldanamycin, has recently come into clinical use. It is a derivative of geldanamycin, an ansamycin benzoquinone antibiotic with anti-carcinogenic effect. Understanding the effect of this drug on the cancer cells and their niche is important for treatment. We applied 17-allylamino-17-demethoxygeldanamycin to colon cancer cell line (Colo 205) on matrix molecules to investigate the relationship of apoptosis with terminal deoxynucleotidyl transferase dUTP nick end labeling immunocytochemistry and related gene expression. We used laminin and collagen I for matrix molecules and vascular endothelial growth factor for angiogenic structure. We also examined apoptosis-related signaling pathway including mitochondrial proteins, cytochrome c, Bcl-2, caspase-9, Apaf-1 expression using real-time polymerase chain reaction. There was clear effect of 17-allylamino-17-demethoxygeldanamycin that killed more cells on tissue culture plastic compared to matrix molecules. The IC 50 value was 0.58 µg/mL for tissue culture plastic compared with 0.64 µg/mL for laminin and 0.75 µg/mL for collagen I. The analyses showed that more cells on matrix molecules underwent apoptosis compared to that on tissue culture plastic. Apoptosis-related gene expression was similar in which Bcl-2 expression decreased and proapoptotic gene expression of the cells on matrix molecules increased compared to that on tissue culture plastic. However, the application of 17-allylamino-17-demethoxygeldanamycin was more effective for the cells on collagen I compared to the cells on laminin. There was also a decrease in angiogenesis as shown by the vascular endothelial growth factor staining. This was more pronounced by coating of the tissue culture plastic with matrix molecules. Our results supported the anti-cancer effect of 17-allylamino-17-demethoxygeldanamycin, and this effect depended on matrix molecules. This effect occurs through apoptosis, and related genes were also altered. All these genes may serve for novel target under the effect of matrix substrate. However, correct interpretation of the results requires further studies.
Einstein coefficients and oscillator strengths for low lying state of CO molecules
NASA Astrophysics Data System (ADS)
Swer, S.; Syiemiong, A.; Ram, M.; Jha, A. K.; Saxena, A.
2018-04-01
Einstein Coefficients and Oscillator Strengths for different state of CO molecule have been calculated using LEROY'S LEVEL program and MOLCAS ab initio code. Using the wave function derived from Morse potential and transition dipole moment obtained from ab initio calculation, The potential energy functions were computed for these states using the spectroscopic constants. The Morse potential of these states and electronic transition dipole moment of the transition calculated in a recent ab initio study have been used in LEVEL program to produce transition dipole matrix element for a large number of bands. Einstein Coefficients have also been used to compute the radiative lifetimes of several vibrational levels and the calculated values are compared with other theoretical results and experimental values.
An efficient basis set representation for calculating electrons in molecules
Jones, Jeremiah R.; Rouet, Francois -Henry; Lawler, Keith V.; ...
2016-04-27
The method of McCurdy, Baertschy, and Rescigno, is generalised to obtain a straightforward, surprisingly accurate, and scalable numerical representation for calculating the electronic wave functions of molecules. It uses a basis set of product sinc functions arrayed on a Cartesian grid, and yields 1 kcal/mol precision for valence transition energies with a grid resolution of approximately 0.1 bohr. The Coulomb matrix elements are replaced with matrix elements obtained from the kinetic energy operator. A resolution-of-the-identity approximation renders the primitive one- and two-electron matrix elements diagonal; in other words, the Coulomb operator is local with respect to the grid indices. Themore » calculation of contracted two-electron matrix elements among orbitals requires only O( Nlog (N)) multiplication operations, not O( N 4), where N is the number of basis functions; N = n 3 on cubic grids. The representation not only is numerically expedient, but also produces energies and properties superior to those calculated variationally. Absolute energies, absorption cross sections, transition energies, and ionisation potentials are reported for 1- (He +, H + 2), 2- (H 2, He), 10- (CH 4), and 56-electron (C 8H 8) systems.« less
Ju, Dawei; Sun, Dazhi; Xiu, Lijuan; Meng, Xianze; Zhang, Cian; Wei, Pinkang
2012-03-01
Interleukin-8 is known as an important chemokine involved in tumor angiogenesis and progression. Overexpression of interleukin-8 has been detected in a variety of human tumors, including gastric cancer, and is negatively correlated with prognosis. The aim of our study is to determine the effects of interleukin-8 on proliferation, adhesion, migration and invasion abilities and correlated molecular mechanisms in gastric cancer. We made recombinant interleukin-8 ranged from 0 ng/ml to 100 ng/ml interferes in human gastric cancer SCG-7901 cells in vitro. The results shown that interleukin-8 did not change cell proliferation, but promoted cell adhesion to endothelial cell and extracellular matrix components (collagen, laminin and fibronectin) as detected by Cell Counting Kit-8. And it induced migration and invasion ability based on scratch and transwell-chamber assays. Also, interleukin-8 regulated the protein and mRNA expression of matrix metalloproteinase-9, intercellular adhesion molecule-1 and E-cad and there was obviously a dose-dependent relationship, but the protein or mRNA expression of matrix metalloproteinase-2 was not obviously changed under the tested conditions. Our findings indicate that interleukin-8 is associated with adhesion, migration and invasion in gastric cancer and the regulation of matrix metalloproteinase-9, intercellular adhesion molecule-1 and E-cad expression is one of the potential molecule mechanisms. The studies imply interleukin-8 may be an alternative treatment strategy against gastric cancer.
Time-independent quantum dynamics for diatom-surface scattering
NASA Astrophysics Data System (ADS)
Saalfrank, Peter; Miller, William H.
1993-06-01
Two time-independent quantum reactive scattering methods, namely, the S-matrix Kohn technique to compute the full S-matrix, and the absorbing boundary Green's function method to compute cumulative reaction probabilities, are applied here to the case of diatom-surface scattering. In both cases a discrete variable representation for the operators is used. We test the methods for two- and three-dimensional uncorrugated potential energy surfaces, which have been used earlier by Halstead et al. [J. Chem. Phys. 93, 2359 (1990)] and by Sheng et al. [J. Chem. Phys. 97, 684 (1992)] in studies of H2 dissociating on metal substrates with theoretical techniques different from those applied here. We find overall but not always perfect agreement with these earlier studies. Based on ab initio data and experiment, a new, six-dimensional potential energy surface for the dissociative chemisorption of H2 on Ni(100) is proposed. Two- and three-dimensional cuts through the new potential are performed to illustrate special dynamical aspects of this particular molecule-surface reaction: (i) the role of corrugation effects, (ii) the importance of the ``cartwheel'' rotation of H2, and (iii) the role of the ``helicopter'' degree of freedom for the adsorbing molecule.
Chu, Wern Cui; Zhang, Shipin; Sng, Timothy J; Ong, Yu Jie; Tan, Wen-Li; Ang, Vivien Y; Foldager, Casper B; Toh, Wei Seong
2017-01-01
The objectives of this study were to (1) determine the distribution and synthesis of pericellular matrix (PCM) molecules (collagen VI, collagen IV and laminin) in rat temporomandibular joint (TMJ) and (2) investigate the effects of PCM molecules on chondrocytes against inflammation in osteoarthritis. Four zones (fibrous, proliferating, mature and hypertrophic) of condylar cartilage and three bands (anterior, intermediate and posterior) of disc were analysed by immunohistochemistry for the presence of PCM molecules in rat TMJs. Isolated chondrocytes were pre-treated with PCM molecules before being subjected to interleukin (IL)-1β treatment to stimulate inflammation. The responses of the chondrocytes were analysed using gene expression, nitric oxide release and matrix metalloproteinase (MMP)-13 production measures. Histomorphometric analyses revealed that the highest areal deposition of collagen VI (67.4%), collagen IV (45.7%) and laminin (52.4%) was in the proliferating zone of TMJ condylar cartilage. No significant difference in the distribution of PCM molecules was noted among the three bands of the TMJ disc. All three PCM molecules were expressed intracellularly by chondrocytes cultured in the monolayer. Among the PCM molecules, pre-treatment with collagen VI enhanced cellular proliferation, ameliorated IL-1β-induced MMP-3, MMP-9, MMP-13 and inducible nitric oxide synthase gene expression, and attenuated the downregulation of cartilage matrix genes, including collagen I, aggrecan and cartilage oligomeric matrix protein (COMP). Concurrently, collagen VI pretreatment inhibited nitric oxide and MMP-13 production. Our study demonstrates for the first time the distribution and role of PCM molecules, particularly collagen VI, in the protection of chondrocytes against inflammation. PMID:28282029
Studies on Relaxation Behavior of Corona Poled Aromatic Dipolar Molecules in a Polymer Matrix
1990-08-03
concentration upto 30 weight percent. Orientation As expected optically responsive molecules are randomly oriented in the polymer matrix although a small amount...INSERT Figure 4 The retention of SH intensity of the small molecule such as MNA was found to be very poor in the PMMA matrix while the larger rodlike...Polym. Prepr. Am. Chem. Soc., Div. Polym. Chem. 24(2), 309 (1983). 16.- H. Ringsdorf and H. W. Schmidt. Makromol. Chem. 185, 1327 (1984). 17. S. Musikant
Non-covalent interactions of a drug molecule encapsulated in a hybrid silica gel.
Paul, Geo; Steuernagel, Stefan; Koller, Hubert
2007-12-28
The drug molecule Propranolol has been encapsulated by a sol-gel process in an organic-inorganic hybrid matrix by in-situ self-assembly; the 2D HETCOR solid state NMR spectroscopy provides direct proof of the intimate spatial relationship between the host matrix and guest drug molecules.
Pernal, Katarzyna
2012-05-14
Time-dependent density functional theory (TD-DFT) in the adiabatic formulation exhibits known failures when applied to predicting excitation energies. One of them is the lack of the doubly excited configurations. On the other hand, the time-dependent theory based on a one-electron reduced density matrix functional (time-dependent density matrix functional theory, TD-DMFT) has proven accurate in determining single and double excitations of H(2) molecule if the exact functional is employed in the adiabatic approximation. We propose a new approach for computing excited state energies that relies on functionals of electron density and one-electron reduced density matrix, where the latter is applied in the long-range region of electron-electron interactions. A similar approach has been recently successfully employed in predicting ground state potential energy curves of diatomic molecules even in the dissociation limit, where static correlation effects are dominating. In the paper, a time-dependent functional theory based on the range-separation of electronic interaction operator is rigorously formulated. To turn the approach into a practical scheme the adiabatic approximation is proposed for the short- and long-range components of the coupling matrix present in the linear response equations. In the end, the problem of finding excitation energies is turned into an eigenproblem for a symmetric matrix. Assignment of obtained excitations is discussed and it is shown how to identify double excitations from the analysis of approximate transition density matrix elements. The proposed method used with the short-range local density approximation (srLDA) and the long-range Buijse-Baerends density matrix functional (lrBB) is applied to H(2) molecule (at equilibrium geometry and in the dissociation limit) and to Be atom. The method accounts for double excitations in the investigated systems but, unfortunately, the accuracy of some of them is poor. The quality of the other excitations is in general much better than that offered by TD-DFT-LDA or TD-DMFT-BB approximations if the range-separation parameter is properly chosen. The latter remains an open problem.
Wischke, Christian; Behl, Marc; Lendlein, Andreas
2013-09-01
Shape-memory polymers (SMPs) have gained interest for temporary drug-release systems that should be anchored in the body by self-sufficient active movements of the polymeric matrix. Based on the so far published scientific literature, this review highlights three aspects that require particular attention when combining SMPs with drug molecules: i) the defined polymer morphology as required for the shape-memory function, ii) the strong effects that processing conditions such as drug-loading methodologies can have on the drug-release pattern from SMPs, and iii) the independent control of drug release and degradation by their timely separation. The combination of SMPs with a drug-release functionality leads to multifunctional carriers that are an interesting technology for pharmaceutical sciences and can be further expanded by new materials such as thermoplastic SMPs or temperature-memory polymers. Experimental studies should include relevant molecules as (model) drugs and provide a thermomechanical characterization also in an aqueous environment, report on the potential effect of drug type and loading levels on the shape-memory functionality, and explore the potential correlation of polymer degradation and drug release.
Multifunctional and biologically active matrices from multicomponent polymeric solutions
NASA Technical Reports Server (NTRS)
Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor); Rabolt, John (Inventor); Casper, Cheryl (Inventor)
2012-01-01
A functionalized electrospun matrix for the controlled-release of biologically active agents, such as growth factors, is presented. The functionalized matrix comprises a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin.
Water in the presence of inert Lennard-Jones obstacles
NASA Astrophysics Data System (ADS)
Kurtjak, Mario; Urbic, Tomaz
2014-04-01
Water confined by the presence of a 'sea' of inert obstacles was examined. In the article, freely mobile two-dimensional Mercedes-Benz (MB) water put to a disordered, but fixed, matrix of Lennard-Jones disks was studied by the Monte Carlo computer simulations. For the MB water molecules in the matrix of Lennard-Jones disks, we explored the structures, hydrogen-bond-network formation and thermodynamics as a function of temperature and size and density of matrix particles. We found that the structure of model water is perturbed by the presence of the obstacles. Density of confined water, which was in equilibrium with the bulk water, was smaller than the density of the bulk water and the temperature dependence of the density of absorbed water did not show the density anomaly in the studied temperature range. The behaviour observed as a consequence of confinement is similar to that of increasing temperature, which can for a matrix lead to a process similar to capillary evaporation. At the same occupancy of space, smaller matrix molecules cause higher destruction effect on the absorbed water molecules than the bigger ones. We have also tested the hypothesis that at low matrix densities the obstacles induce an increased ordering and 'hydrogen bonding' of the MB model molecules, relative to pure fluid, while at high densities the obstacles reduce MB water structuring, as they prevent the fluid to form good 'hydrogen-bonding' networks. However, for the size of matrix molecules similar to that of water, we did not observe this effect.
NASA Astrophysics Data System (ADS)
Protasevich, Alexander E.; Nikitin, Andrei V.
2018-01-01
In this work, we propose an algorithm for calculating the matrix elements of the kinetic energy operator for tetrahedral molecules. This algorithm uses the dependent six-angle coordinates (6A) and takes into account the full symmetry of molecules. Unlike A.V. Nikitin, M. Rey, and Vl. G. Tyuterev who operate with the kinetic energy operator only in Radau orthogonal coordinates, we consider a general case. The matrix elements are shown to be a sum of products of one-dimensional integrals.
NASA Astrophysics Data System (ADS)
Jamróz, M. H.; Dobrowolski, J. Cz.
2001-05-01
For the most stable Li, Na, and Cu(I) diformates we present the vibrational spectra, supported by potential energy distribution (PED) analysis, and the interaction energies between formic acid and metal formate by the DFT (B3PW91) method. PED analysis of the theoretical spectra forms the basis for the elucidation of the future matrix isolation IR spectra.
NASA Astrophysics Data System (ADS)
Nakatani, Naoki; Chan, Garnet Kin-Lic
2013-04-01
We investigate tree tensor network states for quantum chemistry. Tree tensor network states represent one of the simplest generalizations of matrix product states and the density matrix renormalization group. While matrix product states encode a one-dimensional entanglement structure, tree tensor network states encode a tree entanglement structure, allowing for a more flexible description of general molecules. We describe an optimal tree tensor network state algorithm for quantum chemistry. We introduce the concept of half-renormalization which greatly improves the efficiency of the calculations. Using our efficient formulation we demonstrate the strengths and weaknesses of tree tensor network states versus matrix product states. We carry out benchmark calculations both on tree systems (hydrogen trees and π-conjugated dendrimers) as well as non-tree molecules (hydrogen chains, nitrogen dimer, and chromium dimer). In general, tree tensor network states require much fewer renormalized states to achieve the same accuracy as matrix product states. In non-tree molecules, whether this translates into a computational savings is system dependent, due to the higher prefactor and computational scaling associated with tree algorithms. In tree like molecules, tree network states are easily superior to matrix product states. As an illustration, our largest dendrimer calculation with tree tensor network states correlates 110 electrons in 110 active orbitals.
Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion
Li, Zhenhai; Lee, Hyunjung; Zhu, Cheng
2016-01-01
Cell-matrix adhesion complexes are multi-protein structures linking the extracellular matrix (ECM) to the cytoskeleton. They are essential to both cell motility and function by bidirectionally sensing and transmitting mechanical and biochemical stimulations. Several types of cell-matrix adhesions have been identified and they share many key molecular components, such as integrins and actin-integrin linkers. Mechanochemical coupling between ECM molecules and the actin cytoskeleton has been observed from the single cell to the single molecule level and from immune cells to neuronal cells. However, the mechanisms underlying force regulation of integrin-mediated mechanotransduction still need to be elucidated. In this review article, we focus on integrin-mediated adhesions and discuss force regulation of cell-matrix adhesions and key adaptor molecules, three different force-dependent behaviors, and molecular mechanisms for mechanochemical coupling in force regulation. PMID:27720950
NASA Astrophysics Data System (ADS)
Vutha, A.; Horbatsch, M.; Hessels, E.
2018-01-01
We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the $\\hat{\\rm{z}}$ direction by an applied electric field, as has recently been demonstrated by Park, et al. [Angewandte Chemie {\\bf 129}, 1066 (2017)]. The trapped molecules are prepared into a state which has its electron spin perpendicular to $\\hat{\\rm{z}}$, and a magnetic field along $\\hat{\\rm{z}}$ causes precession of this spin. An electron electric dipole moment $d_e$ would affect this precession due to the up to 100~GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring $d_e$ to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.
Quantum interference in multi-branched molecules: The exact transfer matrix solutions.
Jiang, Yu
2017-12-07
We present a transfer matrix formalism for studying quantum interference in a single molecule electronic system with internal branched structures. Based on the Schrödinger equation with the Bethe ansatz and employing Kirchhoff's rule for quantum wires, we derive a general closed-form expression for the transmission and reflection amplitudes of a two-port quantum network. We show that the transport through a molecule with complex internal structures can be reduced to that of a single two-port scattering unit, which contains all the information of the original composite molecule. Our method allows for the calculation of the transmission coefficient for various types of individual molecular modules giving rise to different resonant transport behaviors such as the Breit-Wigner, Fano, and Mach-Zehnder resonances. As an illustration, we first re-derive the transmittance of the Aharonov-Bohm ring, and then we apply our formulation to N identical parity-time (PT)-symmetric potentials, connected in series as well as in parallel. It is shown that the spectral singularities and PT-symmetric transitions of single scattering cells may be observed in coupled systems. Such transitions may occur at the same or distinct values of the critical parameters, depending on the connection modes under which the scattering objects are coupled.
NASA Astrophysics Data System (ADS)
Bubin, Sergiy; Adamowicz, Ludwik
2008-03-01
In this work we consider explicitly correlated complex Gaussian basis functions for expanding the wave function of an N-particle system with the L =1 total orbital angular momentum. We derive analytical expressions for various matrix elements with these basis functions including the overlap, kinetic energy, and potential energy (Coulomb interaction) matrix elements, as well as matrix elements of other quantities. The derivatives of the overlap, kinetic, and potential energy integrals with respect to the Gaussian exponential parameters are also derived and used to calculate the energy gradient. All the derivations are performed using the formalism of the matrix differential calculus that facilitates a way of expressing the integrals in an elegant matrix form, which is convenient for the theoretical analysis and the computer implementation. The new method is tested in calculations of two systems: the lowest P state of the beryllium atom and the bound P state of the positronium molecule (with the negative parity). Both calculations yielded new, lowest-to-date, variational upper bounds, while the number of basis functions used was significantly smaller than in previous studies. It was possible to accomplish this due to the use of the analytic energy gradient in the minimization of the variational energy.
Bubin, Sergiy; Adamowicz, Ludwik
2008-03-21
In this work we consider explicitly correlated complex Gaussian basis functions for expanding the wave function of an N-particle system with the L=1 total orbital angular momentum. We derive analytical expressions for various matrix elements with these basis functions including the overlap, kinetic energy, and potential energy (Coulomb interaction) matrix elements, as well as matrix elements of other quantities. The derivatives of the overlap, kinetic, and potential energy integrals with respect to the Gaussian exponential parameters are also derived and used to calculate the energy gradient. All the derivations are performed using the formalism of the matrix differential calculus that facilitates a way of expressing the integrals in an elegant matrix form, which is convenient for the theoretical analysis and the computer implementation. The new method is tested in calculations of two systems: the lowest P state of the beryllium atom and the bound P state of the positronium molecule (with the negative parity). Both calculations yielded new, lowest-to-date, variational upper bounds, while the number of basis functions used was significantly smaller than in previous studies. It was possible to accomplish this due to the use of the analytic energy gradient in the minimization of the variational energy.
NASA Astrophysics Data System (ADS)
Yalcin, Talat; Li, Liang
2009-12-01
Small molecule analysis is one of the most challenging issues in matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. We have developed a cobalt coated substrate as a target for matrix-free analysis of small molecules in laser desorption/ionization mass spectrometry. Cobalt coating of 60-70 nm thickness has been characterized by scanning electron microscopy, energy dispersive X-ray analysis, X-ray diffraction, and laser induced breakdown spectroscopy. This target facilitates hundreds of samples to be spotted and analyzed without mixing any matrices, in a very short time. This can save a lot of time and money and can be a very practical approach for the analysis of small molecules by laser desorption/ionization mass spectrometry.
NASA Astrophysics Data System (ADS)
Yonezawa, Tetsu; Asano, Takashi; Fujino, Tatsuya; Nishihara, Hiroshi
2013-06-01
A mass measurement technique for detecting low-molecular-weight drugs with a cyclodextrin-supported organic matrix was investigated. By using cyclodextrin-supported 2,4,6-trihydroxyacetophenone (THAP), the matrix-related peaks of drugs were suppressed. The peaks of protonated molecules of the sample and THAP were mainly observed, and small fragments were detected in a few cases. Despite the Na+ and K+ peaks were observed in the spectrum, Na+ or K+ adduct sample molecules were undetected, owing to the sugar units of cyclodextrin. The advantages of MALDI-MS with cyclodextrin-supported matrices as an analytical tool for forensic samples are discussed. The suppression of alkali adducted molecules and desorption process are also discussed.
Area laser crystallized LTPS TFTs with implanted contacts for active matrix OLED displays
NASA Astrophysics Data System (ADS)
Persidis, Efstathios; Baur, Holger; Pieralisi, Fabio; Schalberger, Patrick; Fruehauf, Norbert
2008-03-01
We have developed a four mask low temperature poly-Si (LTPS) TFT process for p- and n-channel devices. Our PECVD deposited amorphous silicon is recrystallized to polycrystalline silicon with single area excimer laser crystallization while formation of drain and source is carried out with self aligned ion beam implantation. We have investigated implantation parameters, suitability of various metallizations as well as laser activation and annealing procedures. To prove the potential capability of our devices, which are suitable for conventional and inverted OLEDs alike, we have produced several functional active matrix backplanes implementing different pixel circuits. Our active matrix backplane process has been customized to drive small molecules as well as polymers, regardless if top or bottom emitting.
Matrix-Isolation Spectroscopy of Reactive Organic Molecules of Relevance to Interstellar Space
NASA Astrophysics Data System (ADS)
Kopff, Laura A.; Nolan, Alex M.; Kreifels, Terese A.; Draxler, Thomas W.; Esselman, Brian J.; Burrmann, Nicola J.; McMahon, Robert J.
2010-11-01
Matrix isolation, the process of trapping a molecule in an inert gas at low temperature, provides a means for studying highly reactive intermediates, such as carbenes or radicals. Reactive species can be characterized by IR, UV-vis and/or EPR spectroscopy. Comparison of experimental and computed spectral data, as well as chemical reactivity, is used for structural assignment Triplet propynylidene is proposed to exist in the interstellar medium (ISM), due to the detection of a higher-energy isomers via rotational spectroscopy. Currently, we are exploring the structural and photochemical effects of varying substituents on the propynylidne system. A diazo precursor has been synthesized and photolyzed to produce dimethylpropynylidene in an argon matrix. A photochemical hydrogen shift to produce 1-penten-3-yne has been observed through infrared spectroscopy. Cyanocarbons are known to be abundant in the ISM and the atmosphere of Titan, however matrixisolation studies have not yet been carried out for a significant number of these compounds. Photolysis of 3-cyano-3-methyldiazirine should yield methylcyanocarbene, one of the simplest species in this family. Another molecule of interest is l-HC4N, which has been detected in the ISM, but has not yet been matrix-isolated and characterized. The study of arylcarbenes is vital to understanding the chemistry of carbon-rich environments, such as discharges, interstellar clouds, and circumstellar envelopes. The identification of small, sulfur containing molecules, and the identification of aromatics in the ISM make future thiophene and benzothiophene detections a real possibility. Studies on 2- and 3-diazomethyl substituted benzothiophenes are underway to assess their photochemical reactivity and potential for forming benzothiophene carbenes. Macrocylic polyynes are proposed to be involved in carbon condensation via the ring coalescence and annealing model to produce graphitic sheets or fullerenes. To simplify a complex system we are experimentally and computationally studying the series of ethynyl-substituted cyclobutadienes and their possible involvement in the build-up of larger carbon containing molecules in the ISM. The Bergman cyclization of cyclobutadiene has been explored computationally and the photochemical precursor is currently being synthesized.
NASA Astrophysics Data System (ADS)
Xu, Xiankun; Li, Peiwen
2017-11-01
Fixman's work in 1974 and the follow-up studies have developed a method that can factorize the inverse of mass matrix into an arithmetic combination of three sparse matrices-one of them is positive definite and needs to be further factorized by using the Cholesky decomposition or similar methods. When the molecule subjected to study is of serial chain structure, this method can achieve O (n) time complexity. However, for molecules with long branches, Cholesky decomposition about the corresponding positive definite matrix will introduce massive fill-in due to its nonzero structure. Although there are several methods can be used to reduce the number of fill-in, none of them could strictly guarantee for zero fill-in for all molecules according to our test, and thus cannot obtain O (n) time complexity by using these traditional methods. In this paper we present a new method that can guarantee for no fill-in in doing the Cholesky decomposition, which was developed based on the correlations between the mass matrix and the geometrical structure of molecules. As a result, the inverting of mass matrix will remain the O (n) time complexity, no matter the molecule structure has long branches or not.
NASA Astrophysics Data System (ADS)
Wang, YUAN; Hejuan, LIANG; Ping, HUANG; Xiaoqiang, AN; Jian, JIANG; Lili, CUI
2018-05-01
In the present study, the electret 5-fluorouracil patch was developed, the effective surface potential, piezoelectric coefficient d 33, open-circuit thermally stimulated discharge (TSD) current spectra and shear adhesion of the patch were measured. The drug release profile of the patch was determined by using high performance liquid chromatography method. A stable potential difference which was positively dependent on the surface potential of the electret was generated on two sides of the patch. The measurements of d 33 coefficient, TSD current spectra and adhesion performance showed that the electrostatic field of the electret could cause polarization and cohesive strength decreasing of the matrix molecules, change the distribution and interaction of the drug molecules in patch, therefore to increase the release of drug from the transdermal patch.
Fu, Chien-Ping; Lirio, Stephen; Liu, Wan-Ling; Lin, Chia-Her; Huang, Hsi-Ya
2015-08-12
A 3D metal-organic framework (MOF) nanomaterial as matrix for surface-assisted laser desorption/ionization mass spectrometry (SALDI-MS) and tandem mass spectrometry (MS/MS) was developed for the analysis of complex biomolecules. Unlike other nanoparticle matrices, this MOF nanomaterial does not need chemical modification prior to use. An exceptional signal reproducibility as well as very low background interferences in analyzing mono-/di-saccharides, peptides and complex starch digests demonstrate its high potential for biomolecule assays, especially for small molecules. Copyright © 2015 Elsevier B.V. All rights reserved.
Characterization of Carbon Nanotube Reinforced Nickel
NASA Technical Reports Server (NTRS)
Gill, Hansel; Hudson, Steve; Bhat, Biliyar; Munafo, Paul M. (Technical Monitor)
2002-01-01
Carbon nanotubes are cylindrical molecules composed of carbon atoms in a regular hexagonal arrangement. If nanotubes can be uniformly dispersed in a supporting matrix to form structural materials, the resulting structures could be significantly lighter and stronger than current aerospace materials. Work is currently being done to develop an electrolyte-based self-assembly process that produces a Carbon Nanotube/Nickel composite material with high specific strength. This process is expected to produce a lightweight metal matrix composite material, which maintains it's thermal and electrical conductivities, and is potentially suitable for applications such as advanced structures, space based optics, and cryogenic tanks.
Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo
2012-01-01
We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.
Sputtering and detection of large organic molecules from Europa
NASA Astrophysics Data System (ADS)
Johnson, R. E.; Sundqvist, B. U. R.
2018-07-01
Mass spectroscopy of bio-molecules by heavy ion induced sputtering, which became a practical laboratory procedure, was also suggested as a potential tool for spacecraft studies of targets of interest in astrobiology. With the planning of new missions to Europa, there is renewed interest in the possibility of detecting organic molecules that might have originated in its subsurface ocean and can be sputtered from its surface often intact by impacting energetic heavy ions trapped in Jupiter's magnetosphere. Here we review the laboratory data and modeling bearing on this issue. We then give estimates of the ejection into the gas-phase of trace organic species embedded in an ice matrix on Europa's surface and their possible detection during a flyby mission.
NASA Astrophysics Data System (ADS)
Al-Refaie, Ahmed F.; Tennyson, Jonathan
2017-12-01
Construction and diagonalization of the Hamiltonian matrix is the rate-limiting step in most low-energy electron - molecule collision calculations. Tennyson (1996) implemented a novel algorithm for Hamiltonian construction which took advantage of the structure of the wavefunction in such calculations. This algorithm is re-engineered to make use of modern computer architectures and the use of appropriate diagonalizers is considered. Test calculations demonstrate that significant speed-ups can be gained using multiple CPUs. This opens the way to calculations which consider higher collision energies, larger molecules and / or more target states. The methodology, which is implemented as part of the UK molecular R-matrix codes (UKRMol and UKRMol+) can also be used for studies of bound molecular Rydberg states, photoionization and positron-molecule collisions.
Meisel, Jayda E; Chang, Mayland
2017-11-01
The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.
Schramm, E; Mühlberger, F; Mitschke, S; Reichardt, G; Schulte-Ladbeck, R; Pütz, M; Zimmermann, R
2008-02-01
Several ionization potentials (IPs) of security relevant substances were determined with single photon ionization time of flight mass spectrometry (SPI-TOFMS) using monochromatized synchrotron radiation from the "Berliner Elektronenspeicherring-Gesellschaft für Synchrotronstrahlung" (BESSY). In detail, the IPs of nine explosives and related compounds, seven narcotics and narcotics precursors, and one chemical warfare agent (CWA) precursor were determined, whereas six IPs already known from the literature were verified correctly. From seven other substances, including one CWA precursor, the IP could not be determined as the molecule ion peak could not be detected. For these substances the appearance energy (AE) of a main fragment was determined. The analyzed security-relevant substances showed IPs significantly below the IPs of common matrix compounds such as nitrogen and oxygen. Therefore, it is possible to find photon energies in between, whereby the molecules of interest can be detected with SPI in very low concentrations due to the shielding of the matrix. All determined IPs except the one of the explosive EGDN were below 10.5 eV. Hence, laser-generated 118 nm photons can be applied for detecting almost all security-relevant substances by, e.g., SPI-TOFMS.
Latire, Thomas; Legendre, Florence; Bouyoucef, Mouloud; Marin, Frédéric; Carreiras, Franck; Rigot-Jolivet, Muriel; Lebel, Jean-Marc; Galéra, Philippe; Serpentini, Antoine
2017-10-01
Mollusc shells are composed of more than 95% calcium carbonate and less than 5% organic matrix consisting mostly of proteins, glycoproteins and polysaccharides. In this study, we investigated the effects of matrix macromolecular components extracted from the shells of two edible molluscs of economic interest, i.e., the blue mussel Mytilus edulis and the Pacific oyster Crassostrea gigas. The potential biological activities of these organic molecules were analysed on human dermal fibroblasts in primary culture. Our results demonstrate that shell extracts of the two studied molluscs modulate the metabolic activities of the cells. In addition, the extracts caused a decrease of type I collagen and a concomitant increase of active MMP-1, both at the mRNA and the protein levels. Therefore, our results suggest that shell extracts from M. edulis and C. gigas contain molecules that promote the catabolic pathway of human dermal fibroblasts. This work emphasises the potential use of these shell matrices in the context of anti-fibrotic strategies, particularly against scleroderma. More generally, it stresses the usefulness to valorise bivalve shells that are coproducts of shellfish farming activity.
The Dimer Interface of the Membrane Type 1 Matrix Metalloproteinase Hemopexin Domain
Tochowicz, Anna; Goettig, Peter; Evans, Richard; Visse, Robert; Shitomi, Yasuyuki; Palmisano, Ralf; Ito, Noriko; Richter, Klaus; Maskos, Klaus; Franke, Daniel; Svergun, Dmitri; Nagase, Hideaki; Bode, Wolfram; Itoh, Yoshifumi
2011-01-01
Homodimerization is an essential step for membrane type 1 matrix metalloproteinase (MT1-MMP) to activate proMMP-2 and to degrade collagen on the cell surface. To uncover the molecular basis of the hemopexin (Hpx) domain-driven dimerization of MT1-MMP, a crystal structure of the Hpx domain was solved at 1.7 Å resolution. Two interactions were identified as potential biological dimer interfaces in the crystal structure, and mutagenesis studies revealed that the biological dimer possesses a symmetrical interaction where blades II and III of molecule A interact with blades III and II of molecule B. The mutations of amino acids involved in the interaction weakened the dimer interaction of Hpx domains in solution, and incorporation of these mutations into the full-length enzyme significantly inhibited dimer-dependent functions on the cell surface, including proMMP-2 activation, collagen degradation, and invasion into the three-dimensional collagen matrix, whereas dimer-independent functions, including gelatin film degradation and two-dimensional cell migration, were not affected. These results shed light on the structural basis of MT1-MMP dimerization that is crucial to promote cellular invasion. PMID:21193411
Tochowicz, Anna; Goettig, Peter; Evans, Richard; Visse, Robert; Shitomi, Yasuyuki; Palmisano, Ralf; Ito, Noriko; Richter, Klaus; Maskos, Klaus; Franke, Daniel; Svergun, Dmitri; Nagase, Hideaki; Bode, Wolfram; Itoh, Yoshifumi
2011-03-04
Homodimerization is an essential step for membrane type 1 matrix metalloproteinase (MT1-MMP) to activate proMMP-2 and to degrade collagen on the cell surface. To uncover the molecular basis of the hemopexin (Hpx) domain-driven dimerization of MT1-MMP, a crystal structure of the Hpx domain was solved at 1.7 Å resolution. Two interactions were identified as potential biological dimer interfaces in the crystal structure, and mutagenesis studies revealed that the biological dimer possesses a symmetrical interaction where blades II and III of molecule A interact with blades III and II of molecule B. The mutations of amino acids involved in the interaction weakened the dimer interaction of Hpx domains in solution, and incorporation of these mutations into the full-length enzyme significantly inhibited dimer-dependent functions on the cell surface, including proMMP-2 activation, collagen degradation, and invasion into the three-dimensional collagen matrix, whereas dimer-independent functions, including gelatin film degradation and two-dimensional cell migration, were not affected. These results shed light on the structural basis of MT1-MMP dimerization that is crucial to promote cellular invasion.
Chondroitin sulfates and their binding molecules in the central nervous system.
Djerbal, L; Lortat-Jacob, H; Kwok, Jcf
2017-06-01
Chondroitin sulfate (CS) is the most abundant glycosaminoglycan (GAG) in the central nervous system (CNS) matrix. Its sulfation and epimerization patterns give rise to different forms of CS, which enables it to interact specifically and with a significant affinity with various signalling molecules in the matrix including growth factors, receptors and guidance molecules. These interactions control numerous biological and pathological processes, during development and in adulthood. In this review, we describe the specific interactions of different families of proteins involved in various physiological and cognitive mechanisms with CSs in CNS matrix. A better understanding of these interactions could promote a development of inhibitors to treat neurodegenerative diseases.
Development of electrospun bone-mimetic matrices for bone regenerative applications
NASA Astrophysics Data System (ADS)
Phipps, Matthew Christopher
Although bone has a dramatic capacity for regeneration, certain injuries and procedures present defects that are unable to heal properly, requiring surgical intervention to induce and support osteoregeneration. Our research group has hypothesized that the development of a biodegradable material that mimics the natural composition and architecture of bone extracellular matrix has the potential to provide therapeutic benefit to these patients. Utilizing a process known as electrospinning, our lab has developed a bone-mimetic matrix (BMM) consisting of composite nanofibers of the mechanically sta-ble polymer polycaprolactone (PCL), and the natural bone matrix molecules type-I colla-gen and hydroxyapatite nanocrystals (HA). We herein show that BMMs supported great-er adhesion, proliferation, and integrin activation of mesenchymal stem cells (MSCs), the multipotent bone-progenitor cells within bone marrow and the periosteum, in comparison to electrospun PCL alone. These cellular responses, which are essential early steps in the process of bone regeneration, highlight the benefits of presenting cells with natural bone molecules. Subsequently, evaluation of new bone formation in a rat cortical tibia defect showed that BMMs are highly osteoconductive. However, these studies also revealed the inability of endogenous cells to migrate within electrospun matrices due to the inherently small pore sizes. To address this limitation, which will negatively impact the rate of scaf-fold-to-bone turnover and inhibit vascularization, sacrificial fibers were added to the ma-trix. The removal of these fibers after fabrication resulted in BMMs with larger pores, leading to increased infiltration of MSCs and endogenous bone cells. Lastly, we evaluat-ed the potential of our matrices to stimulate the recruitment of MSCs, a vital step in bone healing, through the sustained delivery of platelet derived growth factor-BB (PDGF-BB). BMMs were found to adsorb and subsequently release greater quantities of PDGF-BB, compared to PCL scaffolds, over an 8-week interval. The released PDGF-BB retained its bioactivity, stimulating MSC chemotaxis in two separate assays. Collectively, these re-sults suggest that electrospun matrices incorporating the bone matrix molecules collagen I and HA, with sacrificial fibers, provide a favorable scaffold for MSC survival and infil-tration as well as the ability to sequester PDGF-BB from solution, leading to sustained local delivery and MSC chemotaxis.
Covariance Matrix Estimation for the Cryo-EM Heterogeneity Problem*
Katsevich, E.; Katsevich, A.; Singer, A.
2015-01-01
In cryo-electron microscopy (cryo-EM), a microscope generates a top view of a sample of randomly oriented copies of a molecule. The problem of single particle reconstruction (SPR) from cryo-EM is to use the resulting set of noisy two-dimensional projection images taken at unknown directions to reconstruct the three-dimensional (3D) structure of the molecule. In some situations, the molecule under examination exhibits structural variability, which poses a fundamental challenge in SPR. The heterogeneity problem is the task of mapping the space of conformational states of a molecule. It has been previously suggested that the leading eigenvectors of the covariance matrix of the 3D molecules can be used to solve the heterogeneity problem. Estimating the covariance matrix is challenging, since only projections of the molecules are observed, but not the molecules themselves. In this paper, we formulate a general problem of covariance estimation from noisy projections of samples. This problem has intimate connections with matrix completion problems and high-dimensional principal component analysis. We propose an estimator and prove its consistency. When there are finitely many heterogeneity classes, the spectrum of the estimated covariance matrix reveals the number of classes. The estimator can be found as the solution to a certain linear system. In the cryo-EM case, the linear operator to be inverted, which we term the projection covariance transform, is an important object in covariance estimation for tomographic problems involving structural variation. Inverting it involves applying a filter akin to the ramp filter in tomography. We design a basis in which this linear operator is sparse and thus can be tractably inverted despite its large size. We demonstrate via numerical experiments on synthetic datasets the robustness of our algorithm to high levels of noise. PMID:25699132
Hoy, Erik P; Mazziotti, David A
2015-08-14
Tensor factorization of the 2-electron integral matrix is a well-known technique for reducing the computational scaling of ab initio electronic structure methods toward that of Hartree-Fock and density functional theories. The simplest factorization that maintains the positive semidefinite character of the 2-electron integral matrix is the Cholesky factorization. In this paper, we introduce a family of positive semidefinite factorizations that generalize the Cholesky factorization. Using an implementation of the factorization within the parametric 2-RDM method [D. A. Mazziotti, Phys. Rev. Lett. 101, 253002 (2008)], we study several inorganic molecules, alkane chains, and potential energy curves and find that this generalized factorization retains the accuracy and size extensivity of the Cholesky factorization, even in the presence of multi-reference correlation. The generalized family of positive semidefinite factorizations has potential applications to low-scaling ab initio electronic structure methods that treat electron correlation with a computational cost approaching that of the Hartree-Fock method or density functional theory.
Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.
Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua
2014-10-28
Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.
NASA Astrophysics Data System (ADS)
Mateo-Marti, E.; Pradier, C. M.
2013-05-01
Matrix isolation is a powerful tool for studying photochemical processes occurring in isolated molecules. In this way, we characterized the chemical modifications occurring within a tri peptide molecule, IGF, when exposed to the influence of Ultraviolet (UV) irradiation. This paper first describes the successful formation of the tripeptide (IGF) argon matrix under vacuum conditions, followed by the in situ UV irradiation and characterization of the molecular matrix reactivity after UV-irradiation. These studies have been performed by combining two complementary spectroscopic techniques, Fourier-Transform Reflexion Absorption Spectroscopy (FT-IRRAS) and X-ray Photoelectron Spectroscopy (XPS). The IR spectra of the isolated peptide-matrix, before and after UV irradiation, revealed significant differences that could be associated either to a partial deprotonation of the molecule or to a tautomeric conversion of some amide bonds to imide ones on some peptide molecules. XPS analyses undoubtedly confirmed the second hypothesis; the combination of IRRAS and XPS results provide evidence that UV irradiation of peptides induces a chemical reaction, namely a shift of the double bond, meaning partial conversion from amide tautomer into an imidic acid tautomer.
The quantum matrix and information from the hydrocarbon oil molecule
NASA Astrophysics Data System (ADS)
Seyful-Mulyukov, R. B.
2016-03-01
The quantum matrix of the hydrocarbon (HC) molecule is substantiated. On the basis of its properties and behavior, the genesis of oil is explained as a process of self-evolution of oil and preservation of molecules of different composition and generation time. Individual HC molecules are generated in nanoseconds, and the period of the genesis of oil is comparable with that of migration of the HC fluid from the mantle to the deposit. A model of subatomic abiogenic genesis of oil is presented. Hydrocarbon (HC) molecules of various structure and composition are formed due to interaction of the valency electron orbitals of C and H atoms, the elemental particles of which are quantum objects and carriers of information. On the basis of this, the term quantum matrix of the HC molecule, the properties and behavior of which explain the genesis of oil as a process of its self-evolution and preservation of the molecules of various composition and the period of generation of oil, is substantiated. It is proved that individual HC molecules are generated within nanoseconds and the period of origin of the entire assemblage of more than 500 molecules of oil of various types is comparable with the period of migration of the HC fluid from the mantle to the deposit.
NASA Astrophysics Data System (ADS)
Ohmura, S.; Kato, T.; Oyamada, T.; Koseki, S.; Ohmura, H.; Kono, H.
2018-02-01
The mechanisms of anisotropic near-IR tunnel ionization and high-order harmonic generation (HHG) in a CO molecule are theoretically investigated by using the multiconfiguration time-dependent Hartree-Fock (MCTDHF) method developed for the simulation of multielectron dynamics of molecules. The multielectron dynamics obtained by numerically solving the equations of motion (EOMs) in the MCTDHF method is converted to a single orbital picture in the natural orbital representation where the first-order reduced density matrix is diagonalized. The ionization through each natural orbital is examined and the process of HHG is classified into different optical paths designated by a combinations of initial, intermediate and final natural orbitals. The EOMs for natural spin-orbitals are also derived within the framework of the MCTDHF, which maintains the first-order reduced density matrix to be a diagonal one throughout the time propagation of a many-electron wave function. The orbital dependent, time-dependent effective potentials that govern the dynamics of respective time-dependent natural orbitals are deduced from the derived EOMs, of which the temporal variation can be used to interpret the motion of the electron density associated with each natural spin-orbital. The roles of the orbital shape, multiorbital ionization, linear Stark effect and multielectron interaction in the ionization and HHG of a CO molecule are revealed by the effective potentials obtained. When the laser electric field points to the nucleus O from C, tunnel ionization from the C atom side is enhanced; a hump structure originating from multielectron interaction is then formed on the top of the field-induced distorted barrier of the HOMO effective potential. This hump formation, responsible for the directional anisotropy of tunnel ionization, restrains the influence of the linear Stark effect on the energy shifts of bound states.
van Aggelen, Helen; Verstichel, Brecht; Bultinck, Patrick; Van Neck, Dimitri; Ayers, Paul W; Cooper, David L
2011-02-07
Variational second order density matrix theory under "two-positivity" constraints tends to dissociate molecules into unphysical fractionally charged products with too low energies. We aim to construct a qualitatively correct potential energy surface for F(3)(-) by applying subspace energy constraints on mono- and diatomic subspaces of the molecular basis space. Monoatomic subspace constraints do not guarantee correct dissociation: the constraints are thus geometry dependent. Furthermore, the number of subspace constraints needed for correct dissociation does not grow linearly with the number of atoms. The subspace constraints do impose correct chemical properties in the dissociation limit and size-consistency, but the structure of the resulting second order density matrix method does not exactly correspond to a system of noninteracting units.
1990-01-01
It has recently become clear that both extracellular matrix (ECM) glycoproteins and various cell adhesion molecules (CAMs) can promote neurite outgrowth from primary neurons, though little is known of the intracellular mechanisms through which these signals are transduced. We have previously obtained evidence that protein kinase C function is an important part of the neuronal response to laminin (Bixby, J.L. 1989. Neuron. 3:287-297). Because such CAMs as L1 (Lagenauer, C., and V. Lemmon. 1987. Proc. Natl. Acad. Sci. USA. 84:7753-7757) and N-cadherin (Bixby, J.L. and R. Zhang. 1990. J. Cell Biol. 110:1253-1260) can be purified and used as substrates to promote neurite growth, we have now tested whether the response to CAMs is similarly dependent on protein kinase C. We find that inhibition of protein kinase C inhibits growth on fibronectin or collagen as well as on laminin. In contrast, C kinase inhibition actually potentiates the initial growth response to L1 or N- cadherin. The later "phase" of outgrowth on both of these CAMs is inhibited, however. Additionally, phorbol esters, which have no effect on neurite growth when optimal laminin concentrations are used, potentiate growth even on optimal concentrations of L1 or N-cadherin. The results indicate that different intracellular mechanisms operate during initial process outgrowth on ECM substrates as compared to CAM substrates, and suggest that protein kinase C function is required for continued neurite growth on each of these glycoproteins. PMID:2277083
Strekalova, Tatyana; Sun, Mu; Sibbe, Mirjam; Evers, Matthias; Dityatev, Alexander; Gass, Peter; Schachner, Melitta
2002-09-01
The extracellular matrix molecule tenascin-C (TN-C) has been shown to be involved in hippocampal synaptic plasticity in vitro. Here, we describe a deficit in hippocampus-dependent contextual memory in TN-C-deficient mice using the step-down avoidance paradigm. We further show that a fragment of TN-C containing the fibronectin type-III repeats 6-8 (FN6-8), but not a fragment containing repeats 3-5, bound to pyramidal and granule cell somata in the hippocampal formation of C57BL/6J mice and repelled axons of pyramidal neurons when presented as a border in vitro. Injection of the FN6-8 fragment into the hippocampus inhibited retention of memory in the step-down paradigm and reduced levels of long-term potentiation in the CA1 region of the hippocampus. In summary, our data show that TN-C is involved in hippocampus-dependent contextual memory and synaptic plasticity and identify the FN6-8 domain as one of molecular determinants mediating these functions.
Huygens-Fresnel picture for electron-molecule elastic scattering★
NASA Astrophysics Data System (ADS)
Baltenkov, Arkadiy S.; Msezane, Alfred Z.
2017-11-01
The elastic scattering cross sections for a slow electron by C2 and H2 molecules have been calculated within the framework of the non-overlapping atomic potential model. For the amplitudes of the multiple electron scattering by a target the wave function of the molecular continuum is represented as a combination of a plane wave and two spherical waves generated by the centers of atomic spheres. This wave function obeys the Huygens-Fresnel principle according to which the electron wave scattering by a system of two centers is accompanied by generation of two spherical waves; their interaction creates a diffraction pattern far from the target. Each of the Huygens waves, in turn, is a superposition of the partial spherical waves with different orbital angular momenta l and their projections m. The amplitudes of these partial waves are defined by the corresponding phases of electron elastic scattering by an isolated atomic potential. In numerical calculations the s- and p-phase shifts are taken into account. So the number of interfering electron waves is equal to eight: two of which are the s-type waves and the remaining six waves are of the p-type with different m values. The calculation of the scattering amplitudes in closed form (rather than in the form of S-matrix expansion) is reduced to solving a system of eight inhomogeneous algebraic equations. The differential and total cross sections of electron scattering by fixed-in-space molecules and randomly oriented ones have been calculated as well. We conclude by discussing the special features of the S-matrix method for the case of arbitrary non-spherical potentials. Contribution to the Topical Issue "Low energy positron and electron interactions", edited by James Sullivan, Ron White, Michael Bromley, Ilya Fabrikant, and David Cassidy.
Lou, Xianwen; Fransen, Michel; Stals, Patrick J M; Mes, Tristan; Bovee, Ralf; van Dongen, Joost J L; Meijer, E W
2013-09-01
Analyte-matrix adducts are normally absent under typical matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) conditions. Interestingly, though, in the analysis of several types of organic compounds synthesized in our laboratory, analyte-matrix adduct ion peaks were always recorded when common MALDI matrices such as 4-hydroxy-α-cyanocinnamic acid (CHCA) were used. These compounds are mainly those with a benzene-1,3,5-tricarboxamide (BTA) or urea moiety, which are important building blocks to make new functional supramolecular materials. The possible mechanism of the adduct formation was investigated. A shared feature of the compounds studied is that they can form intermolecular hydrogen bonding with matrices like CHCA. The intermolecular hydrogen bonding will make the association between analyte ions and matrix molecules stronger. As a result, the analyte ions and matrix molecules in MALDI clusters will become more difficult to be separated from each other. Furthermore, it was found that analyte ions were mainly adducted with matrix salts, which is probably due to the much lower volatility of the salts compared with that of their corresponding matrix acids. It seems that the analyte-matrix adduct formation for our compounds are caused by the incomplete evaporation of matrix molecules from the MALDI clusters because of the combined effects of enhanced intermolecular interaction between analyte-matrix and of the low volatility of matrix salts. Based on these findings, strategies to suppress the analyte-matrix adduction are briefly discussed. In return, the positive results of using these strategies support the proposed mechanism of the analyte-matrix adduct formation.
NASA Astrophysics Data System (ADS)
Wang, Xiao-Gang; Carrington, Tucker
2018-02-01
We compute numerically exact rovibrational levels of water dimer, with 12 vibrational coordinates, on the accurate CCpol-8sf ab initio flexible monomer potential energy surface [C. Leforestier et al., J. Chem. Phys. 137, 014305 (2012)]. It does not have a sum-of-products or multimode form and therefore quadrature in some form must be used. To do the calculation, it is necessary to use an efficient basis set and to develop computational tools, for evaluating the matrix-vector products required to calculate the spectrum, that obviate the need to store the potential on a 12D quadrature grid. The basis functions we use are products of monomer vibrational wavefunctions and standard rigid-monomer basis functions (which involve products of three Wigner functions). Potential matrix-vector products are evaluated using the F matrix idea previously used to compute rovibrational levels of 5-atom and 6-atom molecules. When the coupling between inter- and intra-monomer coordinates is weak, this crude adiabatic type basis is efficient (only a few monomer vibrational wavefunctions are necessary), although the calculation of matrix elements is straightforward. It is much easier to use than an adiabatic basis. The product structure of the basis is compatible with the product structure of the kinetic energy operator and this facilitates computation of matrix-vector products. Compared with the results obtained using a [6 + 6]D adiabatic approach, we find good agreement for the inter-molecular levels and larger differences for the intra-molecular water bend levels.
Wang, Xiao-Gang; Carrington, Tucker
2018-02-21
We compute numerically exact rovibrational levels of water dimer, with 12 vibrational coordinates, on the accurate CCpol-8sf ab initio flexible monomer potential energy surface [C. Leforestier et al., J. Chem. Phys. 137, 014305 (2012)]. It does not have a sum-of-products or multimode form and therefore quadrature in some form must be used. To do the calculation, it is necessary to use an efficient basis set and to develop computational tools, for evaluating the matrix-vector products required to calculate the spectrum, that obviate the need to store the potential on a 12D quadrature grid. The basis functions we use are products of monomer vibrational wavefunctions and standard rigid-monomer basis functions (which involve products of three Wigner functions). Potential matrix-vector products are evaluated using the F matrix idea previously used to compute rovibrational levels of 5-atom and 6-atom molecules. When the coupling between inter- and intra-monomer coordinates is weak, this crude adiabatic type basis is efficient (only a few monomer vibrational wavefunctions are necessary), although the calculation of matrix elements is straightforward. It is much easier to use than an adiabatic basis. The product structure of the basis is compatible with the product structure of the kinetic energy operator and this facilitates computation of matrix-vector products. Compared with the results obtained using a [6 + 6]D adiabatic approach, we find good agreement for the inter-molecular levels and larger differences for the intra-molecular water bend levels.
A highly soluble matrix metalloproteinase-9 inhibitor for potential treatment of dry eye syndrome.
Mori, Mattia; De Lorenzo, Emanuele; Torre, Eugenio; Fragai, Marco; Nativi, Cristina; Luchinat, Claudio; Arcangeli, Annarosa
2012-11-01
Dry eye syndrome (DES) or keratoconjunctivitis sicca is an eye disease caused by the chronic lack of lubrication and moisture of the eye. The pathogenesis of DES involves the over-expression and over-activity of corneal Matrix Metalloproteinase 9 (MMP-9). We propose herein a new, non-symptomatic approach for the treatment of DES based on the inhibition of MMP-9 by a new highly soluble molecule, designed as PES_103 that has been shown to inhibit MMP-9 both in vitro and in vivo. The efficacy of PES_103 in vivo and the potential benefits of this treatment in restoring tear production were studied in this work using an animal model of reduced lacrimation. PES_103 did not show any significant corneal toxicity. © 2012 The Authors Basic & Clinical Pharmacology & Toxicology © 2012 Nordic Pharmacological Society.
NASA Astrophysics Data System (ADS)
Díaz Costanzo, Guadalupe; Goyanes, Silvia; Ledesma, Silvia
2015-04-01
Azo-dye molecules may suffer from bleaching under certain illumination conditions. When this photoinduced process occurs, it generates an irreversible effect that is characterized by the loss of absorption of the dye molecule. Moreover, the well-known isomerization of azodye molecules does not occur anymore. In this work it is shown how the addition of a small amount of multi-walled carbon nanotubes (MWCNTs) helps to decrease the bleaching effect in a photosensitive guest-host azo-polymer film. Two different systems were fabricated using an epoxy resin as polymer matrix. An azo-dye, Disperse Orange 3, was used as photosensitive material in both systems and MWCNTs were added into one of them. The optical response of the polymeric systems was studied considering the degree of photoinduced birefringence. Photobleaching of the azo-dye was observed in all cases however, the effect is lower for the composite material containing 0.2 wt % MWCNTs. The weak interaction between MWCNTs and dye molecules is less favorable when the material is heated. The optical behavior of the heated composite material suggests that carbon nanotubes can be potentially used as azo dye dispensers. The results are interpreted in terms of the non-covalent interaction between azo-dye molecules and MWCNTs.
Versican and its associated molecules: potential diagnostic markers for multiple myeloma.
Gupta, Nidhi; Khan, Rehan; Kumar, Raman; Kumar, Lalit; Sharma, Alpana
2015-03-10
Multiple myeloma (MM) represents a malignancy of B-cells characterized by proliferation of malignant plasma cells in the bone marrow (BM). Versican (VCAN), an extracellular matrix (ECM) protein, appears to be involved in multiple processes in several cancers. Identifying optimum diagnostic markers and delineating its association with disease severity might be important for controlling MM. Expression of VCAN and its associated molecules (β-catenin, β1 integrin and FAK) were investigated in 60 subjects to evaluate their usefulness as diagnostic marker. Circulatory and molecular levels of above molecules were analyzed in their BM and Blood using ELISA, Q-PCR and western blotting along with their ROC curve analysis. Circulatory levels of VCAN, β-catenin and FAK were significantly higher in patients with varying significance in each stage. β-Catenin and FAK intracellular levels were significantly elevated in patients. mRNA levels of all molecules were significantly higher in BMMNCs while VCAN and β-catenin also showed increase in PBMCs. Upregulation of these molecules was also observed at protein level. ROC curve analysis for VCAN showed absolute combination of sensitivity and specificity for diagnosis in serum. Significant elevation of VCAN and its associated molecules imply their role in MM. Optimal sensitivity and specificity of VCAN might utilize its importance as potential marker for active disease. Copyright © 2015 Elsevier B.V. All rights reserved.
Infrared Matrix-Isolation Study of New Noble-Gas Compounds
NASA Astrophysics Data System (ADS)
Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid
2016-06-01
We identify new noble-gas compounds in solid matrices using IR spectroscopy. The compounds under study belong to two types: HNgY and YNgY' where Ng is a noble-gas atom and Y and Y' are electronegative fragments. The experimental assignments are supported by ab initio calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. We have prepared and characterized two new HNgY compounds (noble-gas hydrides): HKrCCCl in a Kr matrix and HXeCCCl in a Xe matrix.I The synthesis of these compounds includes two steps: UV photolysis of HCCCl in a noble-gas matrix to form the H + CCCl fragments and annealing of the matrix to mobilize H atoms and to promote the H + Ng + CCCl = HNgCCCl reaction. An interesting observation in the experiments on HXeCCCl in a Xe matrix is the temperature-induced transformation of the three H-Xe stretching bands. This observation is explained by temperature-induced changes of local matrix morphology around the embedded HXeCCCl molecule. In these experiments, we have also obtained the IR spectrum of the CCCl radical, which is produced by photodecomposition of HCCCl. We have identified three new YNgY' compounds (fluorinated noble-gas cyanides): FKrCN in a Kr matrix and FXeCN and FXeNC in a Xe matrix.II These molecule are formed by photolysis of FCN in a noble-gas matrix due to locality of this process. The amount of these molecules increases upon thermal mobilization of the F atoms in the photolyzed matrix featuring the F + Ng + CN reaction.
NASA Astrophysics Data System (ADS)
Chen, Rui; Chen, Suming; Xiong, Caiqiao; Ding, Xunlei; Wu, Chih-Che; Chang, Huan-Cheng; Xiong, Shaoxiang; Nie, Zongxiu
2012-09-01
An organic salt, N-(1-naphthyl) ethylenediamine dinitrate (NEDN), with rationally designed properties of a strong UV absorbing chromophore, hydrogen binding and nitrate anion donors, has been employed as a matrix to analyze small molecules ( m/z < 1000) such as oligosaccharides, peptides, metabolites and explosives using negative ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Compared with conventional matrixes such as α-cyano-4-hydroxycinnamic acid (CCA) and 2,5-dihydroxybenzoic acid (DHB), NEDN provides a significant improvement in detection sensitivity and yields very few matrix-associated fragment and cluster ions interfering with MS analysis. For low-molecular-weight saccharides, the lowest detection limit achieved ranges from 500 amol to 5 pmol, depending on the molecular weight and the structure of the analytes. Additionally, the mass spectra in the lower mass range ( m/z < 200) consist of only nitrate and nitric acid cluster ions, making the matrix particularly useful for structural identification of oligosaccharides by post-source decay (PSD) MALDI-MS. Such a characteristic is illustrated by using maltoheptaose as a model system. This work demonstrates that NEDN is a novel negative ion-mode matrix for MALDI-MS analysis of small molecules with nitrate anion attachment.
Puverel, S; Houlbrèque, F; Tambutté, E; Zoccola, D; Payan, P; Caminiti, N; Tambutté, S; Allemand, D
2007-08-01
Biominerals contain both inorganic and organic components. Organic components are collectively termed the organic matrix, and this matrix has been reported to play a crucial role in mineralization. Several matrix proteins have been characterized in vertebrates, but only a few in invertebrates, primarily in Molluscs and Echinoderms. Methods classically used to extract organic matrix proteins eliminate potential low molecular weight matrix components, since cut-offs ranging from 3.5 to 10 kDa are used to desalt matrix extracts. Consequently, the presence of such components remains unknown and these are never subjected to further analyses. In the present study, we have used microcolonies from the Scleractinian coral Stylophora pistillata to study newly synthesized matrix components by labelling them with 14C-labelled amino acids. Radioactive matrix components were investigated by a method in which both total organic matrix and fractions of matrix below and above 5 kDa were analyzed. Using this method and SDS-PAGE analyses, we were able to detect the presence of low molecular mass matrix components (<3.5 kDa), but no free amino acids in the skeletal organic matrix. Since more than 98% of the 14C-labelled amino acids were incorporated into low molecular weight molecules, these probably form the bulk of newly synthesized organic matrix components. Our results suggest that these low molecular weight components may be peptides, which can be involved in the regulation of coral skeleton mineralization.
Pham, T. Anh; Nguyen, Huy -Viet; Rocca, Dario; ...
2013-04-26
Inmore » a recent paper we presented an approach to evaluate quasiparticle energies based on the spectral decomposition of the static dielectric matrix. This method does not require the calculation of unoccupied electronic states or the direct diagonalization of large dielectric matrices, and it avoids the use of plasmon-pole models. The numerical accuracy of the approach is controlled by a single parameter, i.e., the number of eigenvectors used in the spectral decomposition of the dielectric matrix. Here we present a comprehensive validation of the method, encompassing calculations of ionization potentials and electron affinities of various molecules and of band gaps for several crystalline and disordered semiconductors. Lastly, we demonstrate the efficiency of our approach by carrying out G W calculations for systems with several hundred valence electrons.« less
Miyata, Haruhiko; Noda, Naoki; Fairbairn, Daphne J.; Oldenbourg, Rudolf; Cardullo, Richard A.
2011-01-01
Animal sperm show remarkable diversity in both morphology and molecular composition. Here we provide the first report of intense intrinsic fluorescence in an animal sperm. The sperm from a semi-aquatic insect, the water strider, Aquarius remigis, contains an intrinsically fluorescent molecule with properties consistent with those of Flavin Adenine Dinucleotid (FAD) which appears first in the acrosomal vesicle of round spermatids and persists in the acrosome throughout spermiogenesis. Fluorescence recovery after photobleaching reveals that the fluorescent molecule exhibits unrestricted mobility in the acrosomal vesicle of round spermatids, but is completely immobile in the acrosome of mature sperm. Fluorescence polarization microscopy shows a net alignment of the fluorescent molecules in the acrosome of the mature sperm but not in the acrosomal vesicle of round spermatids. These results suggest that acrosomal molecules are rearranged in the elongating acrosome and FAD is incorporated into the acrosomal matrix during its formation. Further, we followed the fate of the acrosomal matrix in fertilization utilizing the intrinsic fluorescence. The fluorescent acrosomal matrix was observed inside the fertilized egg and remained structurally intact even after gastrulation started. This observation suggests that FAD is not released from the acrosomal matrix during the fertilization process or early development and supports an idea that FAD is involved in the formation of the acrosomal matrix. The intrinsic fluorescence of the A. remigis acrosome will be a useful marker for following spermatogenesis and fertilization. PMID:20857404
Lu, Shuangzan; Huang, Min; Qin, Zhihui; Yu, Yinghui; Guo, Qinmin; Cao, Gengyu
2018-08-03
Molecular rotors, motors and gears play important roles in artificial molecular machines, in which rotor and motor matrices are highly desirable for large-scale bottom-up fabrication of molecular machines. Here we demonstrate the fabrication of a highly ordered molecular rotor matrix by depositing nonplanar dipolar titanyl phthalocyanine (TiOPc, C 32 H 16 N 8 OTi) molecules on a Moiré patterned dipolar FeO/Pt(111) substrate. TiOPc molecules with O atoms pointing outwards from the substrate (upward) or towards the substrate (downward) are alternatively adsorbed on the fcc sites by strong lateral confinement. The adsorbed molecules, i.e. two kinds of molecular rotors, show different scanning tunneling microscopy images, thermal stabilities and rotational characteristics. Density functional theory calculations clarify that TiOPc molecules anchoring upwards with high adsorption energies correspond to low-rotational-rate rotors, while those anchoring downwards with low adsorption energies correspond to high-rotational-rate rotors. A robust rotor matrix fully occupied by low-rate rotors is fabricated by depositing molecules on the substrate at elevated temperature. Such a paradigm opens up a promising route to fabricate functional molecular rotor matrices, driven motor matrices and even gear groups on solid substrates.
Korolkov, M V; Manz, J
2007-05-07
The preparation of matrix isolated homonuclear diatomic molecules in a vibrational superposition state c0Phie=1,v=0+cjPhie=1,v=j, with large (|c0|2 approximately 1) plus small contributions (|cj|2<1) of the ground v=0 and specific v=j low excited vibrational eigenstates, respectively, in the electronic ground (e=1) state, and without any net population transfer to electronic excited (e>1) states, is an important challenge; it serves as a prerequisite for coherent spin control. For this purpose, the authors investigate two scenarios of laser pulse control, involving sequential or intrapulse pump- and dump-type transitions via excited vibronic states Phiex,k with a dominant singlet or triplet character. The mechanisms are demonstrated by means of quantum simulations for representative nuclear wave packets on coupled potential energy surfaces, using as an example a one-dimensional model for Cl2 in an Ar matrix. A simple three-state model (including Phi1,0, Phi1,j and Phiex,k) allows illuminating analyses and efficient determinations of the parameters of the laser pulses based on the values of the transition energies and dipole couplings of the transient state which are derived from the absorption spectra.
Dynamics of VEGF matrix-retention in vascular network patterning
NASA Astrophysics Data System (ADS)
Köhn-Luque, A.; de Back, W.; Yamaguchi, Y.; Yoshimura, K.; Herrero, M. A.; Miura, T.
2013-12-01
Vascular endothelial growth factor (VEGF) is a central regulator of blood vessel morphogenesis, although its role in patterning of endothelial cells into vascular networks is not fully understood. It has been suggested that binding of soluble VEGF to extracellular matrix components causes spatially restricted cues that guide endothelial cells into network patterns. Yet, current evidence for such a mechanism remains indirect. In this study, we quantitatively analyse the dynamics of VEGF retention in a controlled in vitro situation of human umbilical vascular endothelial cells (HUVECs) in Matrigel. We show that fluorescent VEGF accumulates in pericellular areas and colocalizes with VEGF binding molecules. Analysis of fluorescence recovery after photobleaching reveals that binding/unbinding to matrix molecules dominates VEGF dynamics in the pericellular region. Computational simulations using our experimental measurements of kinetic parameters show that matrix retention of chemotactic signals can lead to the formation of reticular cellular networks on a realistic timescale. Taken together, these results show that VEGF binds to matrix molecules in proximity of HUVECs in Matrigel, and suggest that bound VEGF drives vascular network patterning.
NASA Astrophysics Data System (ADS)
Wieferink, Jürgen; Krüger, Peter; Pollmann, Johannes
2006-11-01
We present an algorithm for DFT calculations employing Gaussian basis sets for the wave function and a Fourier basis for the potential representation. In particular, a numerically very efficient calculation of the local potential matrix elements and the charge density is described. Special emphasis is placed on the consequences of periodicity and explicit k -vector dependence. The algorithm is tested by comparison with more straightforward ones for the case of adsorption of ethylene on the silicon-rich SiC(001)-(3×2) surface clearly revealing its substantial advantages. A complete self-consistency cycle is speeded up by roughly one order of magnitude since the calculation of matrix elements and of the charge density are accelerated by factors of 10 and 80, respectively, as compared to their straightforward calculation. Our results for C2H4:SiC(001)-(3×2) show that ethylene molecules preferentially adsorb in on-top positions above Si dimers on the substrate surface saturating both dimer dangling bonds per unit cell. In addition, a twist of the molecules around a surface-perpendicular axis is slightly favored energetically similar to the case of a complete monolayer of ethylene adsorbed on the Si(001)-(2×1) surface.
Graphene as a Novel Matrix for the Analysis of Small Molecules by MALDI-TOF MS
Dong, Xiaoli; Cheng, Jinsheng; Li, Jinghong; Wang, Yinsheng
2010-01-01
Graphene was utilized for the first time as matrix for the analysis of low-molecular weight compounds using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Polar compounds including amino acids, polyamines, anticancer drugs and nucleosides could be successfully analyzed. Additionally, nonpolar compounds including steroids could be detected with high resolution and sensitivity. Compared with conventional matrix, graphene exhibited high desorption/ionization efficiency for nonpolar compounds. The graphene matrix functions as substrate to trap analytes, and it transfers energy to the analytes upon laser irradiation, which allowed for the analytes to be readily desorbed/ionized and interference of intrinsic matrix ions to be eliminated. The use of graphene as matrix avoided the fragmentation of analytes and provided good reproducibility and high salt tolerance, underscoring the potential application of graphene as matrix for MALDI-MS analysis of practical samples in complex sample matrices. We also demonstrated that the use of graphene as adsorbent for the solid-phase extraction of squalene could improve greatly the detection limit. This work not only opens a new field for applications of graphene, but also offers a new technique for high-speed analysis of low-molecular weight compounds in areas such as metabolism research and natural products characterization. PMID:20565059
Kim, Se Jin; Shin, Gi Won; Choi, Seok Jin; Hwang, Hee Sung; Jung, Gyoo Yeol; Seo, Tae Seok
2010-03-01
Rapid and simple analysis for the multiple target pathogens is critical for patient management. CE-SSCP analysis on a microchip provides high speed, high sensitivity, and a portable genetic analysis platform in molecular diagnostic fields. The capability of separating ssDNA molecules in a capillary electrophoretic microchannel with high resolution is a critical issue to perform the precise interpretation in the electropherogram. In this study, we explored the potential of poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) (PEO-PPO-PEO) triblock copolymer as a sieving matrix for CE-SSCP analysis on a microdevice. To demonstrate the superior resolving power of PEO-PPO-PEO copolymers, 255-bp PCR amplicons obtained from 16S ribosomal RNA genes of four bacterial species, namely Proteus mirabilis, Haemophilus ducreyi, Pseudomonas aeruginosa, and Neisseria meningitidis, were analyzed in the PEO-PPO-PEO matrix in comparison with 5% linear polyacrylamide and commercial GeneScan gel. Due to enhanced dynamic coating and sieving ability, PEO-PPO-PEO copolymer displayed fourfold enhancement of resolving power in the CE-SSCP to separate same-sized DNA molecules. Fivefold input of genomic DNA of P. aeruginosa and/or N. meningitidis produced proportionally increased corresponding amplicon peaks, enabling correct quantitative analysis in the pathogen detection. Besides the high-resolution sieving capability, a facile loading and replenishment of gel in the microchannel due to thermally reversible gelation property makes PEO-PPO-PEO triblock copolymer an excellent matrix in the CE-SSCP analysis on the microdevice.
NASA Astrophysics Data System (ADS)
Unal, Mustafa; Akkus, Ozan
2018-01-01
Water loss is an early onset indicator of osteoarthritis. Although Raman spectroscopy (RS) holds the potential for measurement of cartilage hydration, the knowledge of Raman OH-stretch bands of biological tissue is very limited. We assesed here the sensitivity of RS to identify and classify water types in the cartilage. Raman spectrum measurements over the high wavenumber range were employed to identify different water fractions in articular cartilage. Raman spectra were collected from wet and sequentially dehydrated cartilage along with pure collagen type II and chondroitin sulfate standards. OH-stretch band of cartilage is dominated by mobile water, up to 95% of total intensities. We identified six peaks in cartilage spectrum using second-derivative analysis: peaks at 3200 and 3650 cm-1 are associated with organic matrix (both collagen and proteglycan) and matrix-bound water molecules. Peaks at 3250, 3453, and 3630 cm-1 are associated with collagen and collagen-related water molecules, whereas the peak at 3520 cm-1 is associated with proteoglycan (PG) and PG-related water molecules. The current work is the first thorough analysis of the Raman OH-stretch band of the cartilage and with the knowledge generated by this study, it may now be possible to study on cartilage hydration by RS.
NASA Astrophysics Data System (ADS)
Leś, Andrzej; Adamowicz, Ludwik
1991-06-01
The molecular electrostatic potential and molecular electric field have been estimated by means of the expectation values of the respective one-electron operators. We used the molecular density matrix that includes the electron correlation effects up to the second-order of the many body perturbation theory. The results show that around the 2(1H)-pyrimidone molecule one may distinguish the electrophilic and nucleophilic regions, the latter characterized by two potential minima of -2.9 V. In the tautomeric form, 2-hydroxypyrimidine, a third potential minimum of -2.1 V appears close to the N1 nitrogen atom. For both molecules strong orientational forces acting on polar solvents are predicted in the vicinity of oxygen (O7) and nitrogen (N3) atoms. The electron correlation effects do not significantly alter the SCF values of the electrostatic potential and electric field at the distances within the van der Waals envelope of the pyrimidine bases. At larger distances, however, the correlation correction is significant, particularly in the direction facing the proton transfer path.
Jabłońska-Trypuć, Agata; Matejczyk, Marzena; Rosochacki, Stanisław
2016-01-01
The main group of enzymes responsible for the collagen and other protein degradation in extracellular matrix (ECM) are matrix metalloproteinases (MMPs). Collagen is the main structural component of connective tissue and its degradation is a very important process in the development, morphogenesis, tissue remodeling, and repair. Typical structure of MMPs consists of several distinct domains. MMP family can be divided into six groups: collagenases, gelatinases, stromelysins, matrilysins, membrane-type MMPs, and other non-classified MMPs. MMPs and their inhibitors have multiple biological functions in all stages of cancer development: from initiation to outgrowth of clinically relevant metastases and likewise in apoptosis and angiogenesis. MMPs and their inhibitors are extensively examined as potential anticancer drugs. MMP inhibitors can be divided into two main groups: synthetic and natural inhibitors. Selected synthetic inhibitors are in clinical trials on humans, e.g. synthetic peptides, non-peptidic molecules, chemically modified tetracyclines, and bisphosphonates. Natural MMP inhibitors are mainly isoflavonoids and shark cartilage.
Ab initio R-matrix calculations of e+-molecule scattering
NASA Technical Reports Server (NTRS)
Danby, Grahame; Tennyson, Jonathan
1990-01-01
The adaptation of the molecular R-matrix method, originally developed for electron-molecule collision studies, to positron scattering is discussed. Ab initio R-matrix calculations are presented for collisions of low energy positrons with a number of diatomic systems including H2, HF and N2. Differential elastic cross sections for positron-H2 show a minimum at about 45 deg for collision energies between 0.3 and 0.5 Ryd. The calculations predict a bound state of positronHF. Calculations on inelastic processes in N2 and O2 are also discussed.
Brooks, Amanda E
2015-01-01
Drug delivery across mucus membranes is a particularly effective route of administration due to the large surface area. However, the unique environment present at the mucosa necessitates altered drug formulations designed to (1) deliver sensitive biologic molecules, (2) promote intimate contact between the mucosa and the drug, and (3) prolong the drug's local residence time. Thus, the pharmaceutical industry has an interest in drug delivery systems formulated around the use of mucoadhesive polymers. Mucoadhesive polymers, both synthetic and biological, have a history of use in local drug delivery. Prominently featured in the literature are chitosan, alginate, and cellulose derivatives. More recently, silk and silk-like derivatives have been explored for their potential as mucoadhesive polymers. Both silkworms and spiders produce sticky silk-like glue substances, sericin and aggregate silk respectively, that may prove an effective, natural matrix for drug delivery to the mucosa. This mini review will explore the potential of silk and silk-like derivatives as a biocompatible mucoadhesive polymer matrix for local controlled drug delivery.
PyVCI: A flexible open-source code for calculating accurate molecular infrared spectra
NASA Astrophysics Data System (ADS)
Sibaev, Marat; Crittenden, Deborah L.
2016-06-01
The PyVCI program package is a general purpose open-source code for simulating accurate molecular spectra, based upon force field expansions of the potential energy surface in normal mode coordinates. It includes harmonic normal coordinate analysis and vibrational configuration interaction (VCI) algorithms, implemented primarily in Python for accessibility but with time-consuming routines written in C. Coriolis coupling terms may be optionally included in the vibrational Hamiltonian. Non-negligible VCI matrix elements are stored in sparse matrix format to alleviate the diagonalization problem. CPU and memory requirements may be further controlled by algorithmic choices and/or numerical screening procedures, and recommended values are established by benchmarking using a test set of 44 molecules for which accurate analytical potential energy surfaces are available. Force fields in normal mode coordinates are obtained from the PyPES library of high quality analytical potential energy surfaces (to 6th order) or by numerical differentiation of analytic second derivatives generated using the GAMESS quantum chemical program package (to 4th order).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cinacchi, Giorgio; Domenici, Valentina
The Saupe ordering matrix of a banana-shaped mesogenic molecule as a solute in a common nematic calamitic solvent has been determined by {sup 2}H-NMR spectroscopy as a function of temperature. The temperature dependence of the Saupe ordering matrix element associated with the principal molecular axis is consistent with a glassy behavior in the reorientational motion of this particular solute molecule. The Haller expression, appropriately modified, provides a good fit to the experimental data.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cha, Sangwon
2008-01-01
Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternativemore » assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.« less
Multifunctional and biologically active matrices from multicomponent polymeric solutions
NASA Technical Reports Server (NTRS)
Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor)
2010-01-01
The present invention relates to a biologically active functionalized electrospun matrix to permit immobilization and long-term delivery of biologically active agents. In particular the invention relates to a functionalized polymer matrix comprising a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin. Examples of active molecules that may be used with the multicomponent polymer of the invention include, for example, a drug, a biopolymer, for example a growth factor, a protein, a peptide, a nucleotide, a polysaccharide, a biological macromolecule or the like. The invention is further directed to the formation of functionalized crosslinked matrices, such as hydrogels, that include at least one functionalized compatibilizing polymer capable of assembly.
Ramanathan, N; Sundararajan, K; Gopi, R; Sankaran, K
2017-03-16
Trimethyl phosphite (TMPhite) was photooxidized to trimethyl phosphate (TMP) in N 2 , O 2 , and para-H 2 matrixes at low temperatures to correlate the conformational landscape of these two molecules. The photooxidation produced the trans (TGG)-rich conformer with respect to the ground state gauche (GGG) conformer of TMP in N 2 and O 2 matrixes, which has diverged from the conformational composition of freshly deposited pure TMP in the low-temperature matrixes. The enrichment of the trans conformer in preference to the gauche conformer of TMP during photooxidation is due to the TMPhite precursor, which exists exclusively in the trans conformer. Interestingly, whereas the photooxidized TMP molecule suffers site effects possibly due to the local asymmetry in N 2 and O 2 matrixes, in the para-H 2 matrix owing to the quantum crystal nature the site effects were observed to be self-repaired.
Impact of proteolytic enzymes in colorectal cancer development and progression.
Herszényi, László; Barabás, Loránd; Hritz, István; István, Gábor; Tulassay, Zsolt
2014-10-07
Tumor invasion and metastasis is a highly complicated, multi-step phenomenon. In the complex event of tumor progression, tumor cells interact with basement membrane and extracellular matrix components. Proteolytic enzymes (proteinases) are involved in the degradation of extracellular matrix, but also in cancer invasion and metastasis. The four categories of proteinases (cysteine-, serine-, aspartic-, and metalloproteinases) are named and classified according to the essential catalytic component in their active site. We and others have shown that proteolytic enzymes play a major role not only in colorectal cancer (CRC) invasion and metastasis, but also in malignant transformation of precancerous lesions into cancer. Tissue and serum-plasma antigen concentrations of proteinases might be of great value in identifying patients with poor prognosis in CRC. Our results, in concordance with others indicate the potential tumor marker impact of proteinases for the early diagnosis of CRC. In addition, proteinases may also serve as potential target molecules for therapeutic agents.
Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei
2017-04-21
Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds.
Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei
2017-01-01
Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds. PMID:28430138
DNA melting profiles from a matrix method.
Poland, Douglas
2004-02-05
In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Emfietzoglou, D.; Moscovitch, M.
1999-01-01
A theoretical study was carried out to investigate the feasibility of using the radiation-induced colour decay of photochromic molecules embedded in a polymer matrix as a probe for studying the microscopic energy deposition of heavy charged particles (HCPs) in a tissue-equivalent solid. The theoretical treatment makes use of the radial dose distribution function as derived from gas-phase physics, together with the effects of the increase in temperature and of matrix degradation on the colour-decay kinetics of the photochromic molecules, according to empirical models derived for the solid state. Bearing in mind the non-stochastic nature of the model, the use of gas-phase physics at the level of radiation interaction, and the fact that some empirical quantities used have been established macroscopically, all factors which signify that extra caution is required in the interpretation of the results, it is shown that when the optimum information retrieval time (after track formation) is considered the technique may be able to resolve differences in the energy deposition pattern by different HCPs in the nanometre range (1-10 nm; material's mass density
) from the track axis. Most importantly, though, the present study aims to erect a theoretical framework for the possible application of the technique and to highlight those aspects which are likely to be critical to its practical usage, such as particle type and energy range, and spatial scale and magnitude of the expected effect together with its dependence on time, the physical characteristics of the matrix, and the kinetic behaviour of the type of photochromic molecule studied. Furthermore, it establishes a rationale for interpreting the experimentally observed (if available) colour changes in the HCP track in terms of the microscopic distribution of energy deposition in it.
NASA Astrophysics Data System (ADS)
Pranger, Lawrence A.
This research explored the processing and properties of PNCs using a polyfurfural alcohol (PFA) matrix. The precursor for PFA, furfuryl alcohol (FA) is sourced from feedstocks rich in hemicellulose, such as corn cobs, oat hulls and wood. To exploit FA as a polymerizable solvent, cellulose whiskers (CW) and montmorillonite clay (MMT) were used as the nanoparticle phase. Results from PNC processing show that CW and MMT can be dispersed in the PFA matrix by means of insitu polymerization, without the use of surfactants or dilution in solvents. Both CW and MMT nanoparticles catalyze the polymerization of furfuryl alcohol (FA). Moreover, the insitu intercalative polymerization of FA in the interlayer galleries of MMT leads to the complete exfoliation of the MMT in the PFA matrix. CW and MMT both function as effective matrix modifiers, increasing the thermal stability of PFA nanocomposites compared to pure PFA polymer. The increased thermal stability is seen as significant increases in the onset of degradation and in residual weight at high temperature. This research also explored the surface functionalization of Cu, Ni and Pt substrates by self-assembly of a range of difunctional linker molecules. Characterization by XPS and PM-IRRAS indicate that diisocyanides and dicarboxylic acids both form chemically "sticky" surfaces after self-assembly on Cu and Ni. Sticky surfaces may provide a means of increasing nanoparticle dispersion in metal nanocluster filled PNCs, by increasing their interaction with the matrix polymer. Another potential application for sticky surfaces on Cu is in the ongoing miniaturization of circuit boards. The functionalization of Cu bond pad substrates with linker molecules may provide an alternate means of bonding components to their bond pads, with higher placement accuracy compared to solder bumps.
Zhao, Qin; Xu, Jing; Yin, Jia; Feng, Yu-Qi
2015-08-19
In the present study, humic acids (HAs) were applied as both a matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and an adsorbent of magnetic solid phase extraction (MSPE) for the first time. As natural macromolecule compounds, HAs are inherently highly functionalized and contain laser energy absorbing-transferring aromatic structures. This special molecular structure made HAs a good candidate for use as a MALDI matrix in small molecule analysis. At the same time, due to its good adsorption ability, HAs was prepared as MSPE adsorbent via a simple co-mixing method, in which the commercially available HAs were directly mixed with Fe3O4 magnetic nanoparticles (MNPs) in a mortar and grinded evenly and completely. In this process, MNPs were physically wrapped and adhered to tiny HAs leading to the formation of magnetic HAs (MHAs). To verify the bi-function of the MHAs, Rhodamine B (RdB) was chosen as model compound. Our results show that the combination of MHAs-based MSPE and MALDI-TOF-MS can provide a rapid and sensitive method for the determination of RdB in chili oil. The whole analytical procedure could be completed within 30 min for simultaneous determination of more than 20 samples, and the limit of quantitation for RdB was found to be 0.02 μg/g. The recoveries in chili oil were in the range 73.8-81.5% with the RSDs less than 21.3% (intraday) and 20.3% (interday). The proposed strategy has potential applications for high-throughput analysis of small molecules in complex samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Efficient calculation of the energy of a molecule in an arbitrary electric field
NASA Astrophysics Data System (ADS)
Pulay, Peter; Janowski, Tomasz
In thermodynamic (e.g., Monte Carlo) simulations with electronic embedding, the energy of the active site or solute must be calculated for millions of configurations of the environment (solvent or protein matrix) to obtain reliable statistics. This precludes the use of accurate but expensive ab initio and density functional techniques. Except for the immediate neighbors, the effect of the environment is electrostatic. We show that the energy of a molecule in the irregular field of the environment can be determined very efficiently by expanding the electric potential in known functions, and precalculating the first and second order response of the molecule to the components of the potential. These generalized multipole moments and polarizabilities allow the calculation of the energy of the system without further ab initio calculations. Several expansion functions were explored: polynomials, distributed inverse powers, and sine functions. The latter provide the numerically most stable fit but require new types of integrals. Distributed inverse powers can be simulated using dummy atoms, and energies calculated this way provide a very good approximation to the actual energies in the field of the environment.
Matrix Metalloproteinases as Regulators of Periodontal Inflammation
Franco, Cavalla; Patricia, Hernández-Ríos; Timo, Sorsa; Claudia, Biguetti; Marcela, Hernández
2017-01-01
Periodontitis are infectious diseases characterized by immune-mediated destruction of periodontal supporting tissues and tooth loss. Matrix metalloproteinases (MMPs) are key proteases involved in destructive periodontal diseases. The study and interest in MMP has been fuelled by emerging evidence demonstrating the broad spectrum of molecules that can be cleaved by them and the myriad of biological processes that they can potentially regulate. The huge complexity of MMP functions within the ‘protease web’ is crucial for many physiologic and pathologic processes, including immunity, inflammation, bone resorption, and wound healing. Evidence points out that MMPs assemble in activation cascades and besides their classical extracellular matrix substrates, they cleave several signalling molecules—such as cytokines, chemokines, and growth factors, among others—regulating their biological functions and/or bioavailability during periodontal diseases. In this review, we provide an overview of emerging evidence of MMPs as regulators of periodontal inflammation. PMID:28218665
Cell adhesion molecules in context
2011-01-01
Cell adhesion molecules (CAMs) are now known to mediate much more than adhesion between cells and between cells and the extracellular matrix. Work by many researchers has illuminated their roles in modulating activation of molecules such as receptor tyrosine kinases, with subsequent effects on cell survival, migration and process extension. CAMs are also known to serve as substrates for proteases that can create diffusible fragments capable of signaling independently from the CAM. The diversity of interactions is further modulated by membrane rafts, which can co-localize or separate potential signaling partners to affect the likelihood of a given signaling pathway being activated. Given the ever-growing number of known CAMs and the fact that their heterophilic binding in cis or in trans can affect their interactions with other molecules, including membrane-bound receptors, one would predict a wide range of effects attributable to a particular CAM in a particular cell at a particular stage of development. The function(s) of a given CAM must therefore be considered in the context of the history of the cell expressing it and the repertoire of molecules expressed both by that cell and its neighbors. PMID:20948304
Matrix isolation sublimation: An apparatus for producing cryogenic beams of atoms and molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sacramento, R. L.; Alves, B. X.; Silva, B. A.
2015-07-15
We describe the apparatus to generate cryogenic beams of atoms and molecules based on matrix isolation sublimation. Isolation matrices of Ne and H{sub 2} are hosts for atomic and molecular species which are sublimated into vacuum at cryogenic temperatures. The resulting cryogenic beams are used for high-resolution laser spectroscopy. The technique also aims at loading atomic and molecular traps.
Identification of chondrocyte-binding peptides by phage display.
Cheung, Crystal S F; Lui, Julian C; Baron, Jeffrey
2013-07-01
As an initial step toward targeting cartilage tissue for potential therapeutic applications, we sought cartilage-binding peptides using phage display, a powerful technology for selection of peptides that bind to molecules of interest. A library of phage displaying random 12-amino acid peptides was iteratively incubated with cultured chondrocytes to select phage that bind cartilage. The resulting phage clones demonstrated increased affinity to chondrocytes by ELISA, when compared to a wild-type, insertless phage. Furthermore, the selected phage showed little preferential binding to other cell types, including primary skin fibroblast, myocyte and hepatocyte cultures, suggesting a tissue-specific interaction. Immunohistochemical staining revealed that the selected phage bound chondrocytes themselves and the surrounding extracellular matrix. FITC-tagged peptides were synthesized based on the sequence of cartilage-binding phage clones. These peptides, but not a random peptide, bound cultured chondrocytes, and extracelluar matrix. In conclusion, using phage display, we identified peptide sequences that specifically target chondrocytes. We anticipate that such peptides may be coupled to therapeutic molecules to provide targeted treatment for cartilage disorders. Copyright © 2013 Orthopaedic Research Society.
Tensegrity: the architectural basis of cellular mechanotransduction
NASA Technical Reports Server (NTRS)
Ingber, D. E.
1997-01-01
Physical forces of gravity, hemodynamic stresses, and movement play a critical role in tissue development. Yet, little is known about how cells convert these mechanical signals into a chemical response. This review attempts to place the potential molecular mediators of mechanotransduction (e.g. stretch-sensitive ion channels, signaling molecules, cytoskeleton, integrins) within the context of the structural complexity of living cells. The model presented relies on recent experimental findings, which suggests that cells use tensegrity architecture for their organization. Tensegrity predicts that cells are hard-wired to respond immediately to mechanical stresses transmitted over cell surface receptors that physically couple the cytoskeleton to extracellular matrix (e.g. integrins) or to other cells (cadherins, selectins, CAMs). Many signal transducing molecules that are activated by cell binding to growth factors and extracellular matrix associate with cytoskeletal scaffolds within focal adhesion complexes. Mechanical signals, therefore, may be integrated with other environmental signals and transduced into a biochemical response through force-dependent changes in scaffold geometry or molecular mechanics. Tensegrity also provides a mechanism to focus mechanical energy on molecular transducers and to orchestrate and tune the cellular response.
Mniszewski, S M; Cawkwell, M J; Wall, M E; Mohd-Yusof, J; Bock, N; Germann, T C; Niklasson, A M N
2015-10-13
We present an algorithm for the calculation of the density matrix that for insulators scales linearly with system size and parallelizes efficiently on multicore, shared memory platforms with small and controllable numerical errors. The algorithm is based on an implementation of the second-order spectral projection (SP2) algorithm [ Niklasson, A. M. N. Phys. Rev. B 2002 , 66 , 155115 ] in sparse matrix algebra with the ELLPACK-R data format. We illustrate the performance of the algorithm within self-consistent tight binding theory by total energy calculations of gas phase poly(ethylene) molecules and periodic liquid water systems containing up to 15,000 atoms on up to 16 CPU cores. We consider algorithm-specific performance aspects, such as local vs nonlocal memory access and the degree of matrix sparsity. Comparisons to sparse matrix algebra implementations using off-the-shelf libraries on multicore CPUs, graphics processing units (GPUs), and the Intel many integrated core (MIC) architecture are also presented. The accuracy and stability of the algorithm are illustrated with long duration Born-Oppenheimer molecular dynamics simulations of 1000 water molecules and a 303 atom Trp cage protein solvated by 2682 water molecules.
Cell signaling molecules as drug targets in lung cancer: an overview.
Mukherjee, Tapan K; Paul, Karan; Mukhopadhyay, Srirupa
2011-07-01
Lung being one of the vital and essential organs in the body, lung cancer is a major cause of mortality in the modern human society. Lung cancer can be broadly subdivided into nonsmall cell lung cancer (NSCLC) and small cell lung cancer (SCLC). Although NSCLC is sometimes treated with surgery, the advanced and metastatic NSCLC and SCLC usually respond better to chemotherapy and radiation. The most important targets of these chemotherapeutic agents are various intracellular signaling molecules. The primary focus of this review article is to summarize the description of various cell signaling molecules involved in lung cancer development and their regulation by chemotherapeutic agents. Extensive research work in recent years has identified several cellular signaling molecules that may be intricately involved in the complexity of lung cancer. Some of these cell signaling molecules are epidermal growth factor receptors, vascular endothelial growth factor receptors, mammalian target of rapamycin, mitogen-activated protein kinase phosphatase-1, peroxisome proliferator-activated receptor-gamma, matrix metalloproteinases and receptor for advanced glycation end-products. The present review will strengthen our current knowledge regarding the efficacy of the above-mentioned cell signaling molecules as potential beneficial drug targets against lung cancer.
Adhesion molecules and receptors
USDA-ARS?s Scientific Manuscript database
Adhesion molecules are necessary for leukocyte trafficking and differentiation. They serve to initiate cell-cell interactions under conditions of shear, and they sustain the cell-cell and cell-matrix interactions needed for cellular locomotion. They also can serve directly as signaling molecules act...
Electrophilic properties of common MALDI matrix molecules
NASA Astrophysics Data System (ADS)
Lippa, T. P.; Eustis, S. N.; Wang, D.; Bowen, K. H.
2007-11-01
The negative ion photoelectron spectra of the following MALDI matrix molecules have been measured: 3-carboxypyridine (nicotinic acid), 2,5-dihydroxybenzoic acid (DHB), 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid), 2,6-dihydroxyacetophenone (DHAP), 3-(4-hydroxy-3-methoxyphenyl)-2-propenoic acid (ferulic acid), 3-hydroxy-2-pyridinecarboxylic acid (3HPA), and 2,6-pyridinedicarboxylic acid (dipicolinic acid). Adiabatic electron affinities and vertical detachment energies were extracted from these spectra and reported. In addition, electron affinities were calculated for DHAP, ferulic acid, dipicolinic acid and sinapinic acid. Photoelectron spectra were also measured for the dimer anions of DHB and nicotinic acid and for the fragment anion in which alpha-cyano-cinnamic acid had lost a CO2 unit. Together, these results augment the database of presently available electrophilic data on common matrix molecules along with some of their dimers and fragments.
Vautard, Frederic; Ozcan, Soydan
2017-04-11
A functionalized carbon fiber having covalently bound on its surface a sizing agent containing epoxy groups, at least some of which are engaged in covalent bonds with crosslinking molecules, wherein each of said crosslinking molecules possesses at least two epoxy-reactive groups and at least one free functional group reactive with functional groups of a polymer matrix in which the carbon fiber is to be incorporated, wherein at least a portion of said crosslinking molecules are engaged, via at least two of their epoxy-reactive groups, in crosslinking bonds between at least two epoxy groups of the sizing agent. Composites comprised of these functionalized carbon fibers embedded in a polymeric matrix are also described. Methods for producing the functionalized carbon fibers and composites thereof are also described.
Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules
NASA Astrophysics Data System (ADS)
Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.
1997-07-01
Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.
Sen, Triparna; Moulik, Shuvojit; Dutta, Anindita; Choudhury, Paromita Roy; Banerji, Aniruddha; Das, Shamik; Roy, Madhumita; Chatterjee, Amitava
2009-02-13
The tumor inhibiting property of green tea polyphenol epigallocatechin-3-gallate (EGCG) is well documented. Studies reveal that matrix-metalloproteinases (MMPs) play pivotal roles in tumor invasion through degradation of basement membranes and extracellular matrix (ECM). We studied the effect of EGCG on matrixmetalloproteinases-2 (MMP-2), the factors involved in activation, secretion and signaling molecules that might be involved in the regulation of MMP-2 in human breast cancer cell line, MCF-7. MCF-7 was treated with EGCG (20 muM, 24 h), the effect of EGCG on MMP-2 expression, activity and its regulatory molecules were studied by gelatin zymography, Western blot, quantitative and semi-quantitative real time RT-PCR, immunoflourescence and cell adhesion assay. EGCG treatment reduced the activity, protein expression and mRNA expression level of MMP-2. EGCG treatment reduced the expression of focal adhesion kinase (FAK), membrane type-1-matrix metalloproteinase (MT1-MMP), nuclear factor-kappa B (NF-kB), vascular endothelial growth factor (VEGF) and reduced the adhesion of MCF-7 cells to ECM, fibronectin and vitronectin. Real time RT-PCR revealed a reduced expression of integrin receptors alpha5, beta1, alphav and beta3 due to EGCG treatment. Down regulation of expression of MT1-MMP, NF-kB, VEGF and disruption of functional status of integrin receptors may indicate decreased MMP-2 activation; low levels of FAK expression might indicate disruption in FAK-induced MMP-2 secretion and decrease in activation of phosphatidyl-inositol-3-kinase (PI-3K), extracellular regulated kinase (ERK) indicates probable hindrance in MMP-2 regulation and induction. We propose EGCG as potential inhibitor of expression and activity of pro-MMP-2 by a process involving multiple regulatory molecules in MCF-7.
LRP1 protects the vasculature by regulating levels of connective tissue growth factor and HtrA1.
Muratoglu, Selen C; Belgrave, Shani; Hampton, Brian; Migliorini, Mary; Coksaygan, Turhan; Chen, Ling; Mikhailenko, Irina; Strickland, Dudley K
2013-09-01
Low-density lipoprotein receptor-related protein 1 (LRP1) is a large endocytic and signaling receptor that is abundant in vascular smooth muscle cells. Mice in which the lrp1 gene is deleted in smooth muscle cells (smLRP1(-/-)) on a low-density lipoprotein receptor-deficient background display excessive platelet derived growth factor-signaling, smooth muscle cell proliferation, aneurysm formation, and increased susceptibility to atherosclerosis. The objectives of the current study were to examine the potential of LRP1 to modulate vascular physiology under nonatherogenic conditions. We found smLRP1(-/-) mice to have extensive in vivo aortic dilatation accompanied by disorganized and degraded elastic lamina along with medial thickening of the arterial vessels resulting from excess matrix deposition. Surprisingly, this was not attributable to excessive platelet derived growth factor-signaling. Rather, quantitative differential proteomic analysis revealed that smLRP1(-/-) vessels contain a 4-fold increase in protein levels of high-temperature requirement factor A1 (HtrA1), which is a secreted serine protease that is known to degrade matrix components and to impair elastogenesis, resulting in fragmentation of elastic fibers. Importantly, our study discovered that HtrA1 is a novel LRP1 ligand. Proteomics analysis also identified excessive accumulation of connective tissue growth factor, an LRP1 ligand and a key mediator of fibrosis. Our findings suggest a critical role for LRP1 in maintaining the integrity of vessels by regulating protease activity as well as matrix deposition by modulating HtrA1 and connective tissue growth factor protein levels. This study highlights 2 new molecules, connective tissue growth factor and HtrA1, which contribute to detrimental changes in the vasculature and, therefore, represent new target molecules for potential therapeutic intervention to maintain vessel wall homeostasis.
Toward the laboratory identification of the not-so-simple NS2 neutral and anion isomers
NASA Astrophysics Data System (ADS)
Fortenberry, Ryan C.; Thackston, Russell; Francisco, Joseph S.; Lee, Timothy J.
2017-08-01
The NS2 radical is a simple arrangement of atoms with a complex electronic structure. This molecule was first reported by Hassanzadeh and Andrew's group [J. Am. Chem. Soc. 114, 83 (1992)] through Ar matrix isolation experiments. In the quarter century since this seminal work was published, almost nothing has been reported about nitrogen disulfide even though NS2 is isovalent with the common NO2. The present study aims to shed new insight into possible challenges with the characterization of this radical. No less than three potential energy surfaces all intersect in the C2v region of the SNS radical isomer. A type-C Renner-Teller molecule is present for the linear 2Πu state where the potential energy surface is fully contained within the 2.05 kcal/mol lower energy X ˜ 2A1 state. A C2v, 1 2B1 state is present in this same region, but a double excitation is required to access this state from the X ˜ 2A1 state of SNS. Additionally, a 1 2A' NSS isomer is also present but with notable differences in the geometry from the global minimum. Consequently, the rovibronic spectrum of these NS2 isomers is quite complicated. While the present theory and previous Ar matrix experiments agree well on isotopic shifts, they differ notably for the absolute fundamental vibrational frequency transitions. These differences are likely a combination of matrix shifts and issues associated with the neglect of non-adiabatic coupling in the computations. In either case, it is clear that high-resolution gas phase experimental observations will be complicated to sort. The present computations should aid in their analysis.
NASA Astrophysics Data System (ADS)
Ou, Jiemei; Yang, Yuzhao; Lin, Wensheng; Yuan, Zhongke; Gan, Lin; Lin, Xiaofeng; Chen, Xudong; Chen, Yujie
2015-03-01
We investigated the transitions of conformations and their effects on emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) single molecules in PMMA matrix during thermal annealing process. Total internal reflection fluorescence microscopy measurements reveal the transformation from collapsed conformations to extended, highly ordered rod-like structures of MEH-PPV single molecules during thermal annealing. The blue shifts in the ensemble single molecule PL spectra support our hypnosis. The transition occurs as the annealing temperature exceeds 100 °C, implying that an annealing temperature near the glass transition temperature Tg of matrix is ideal for the control and optimization of blend polymer films.
Goel, Meenakshi; Larson, Eli; Venkatramani, C J; Al-Sayah, Mohammad A
2018-05-01
Enantioselective analysis is an essential requirement during the pharmaceutical development of chiral drug molecules. In pre-clinical and clinical studies, the Food and Drug Administration (FDA) mandates the assessment of "in vivo" inter-conversion of chiral drugs to determine their physiological effects. In-vivo analysis of the active pharmaceutical ingredient (API) and its potential metabolites could be quite challenging due to their low abundance (ng/mL levels) and matrix interferences. Therefore, highly selective and sensitive analytical techniques are required to separate the API and its metabolites from the matrix components and one another. Additionally, for chiral APIs, further analytical separation is required to resolve the API and its potential metabolites from their corresponding enantiomers. In this work, we demonstrate the optimization of our previously designed two-dimensional liquid chromatography-supercritical fluid chromatography-mass spectrometry (2D-LC-SFC -MS) system to achieve 10 ng/mL detection limit [1]. The first LC dimension, used as a desalting step, could efficiently separate the API from its potential metabolites and matrix components. The API and its metabolites were then trapped/focused on small trapping columns and transferred onto the second SFC dimension for chiral separation. Detection can be achieved by ultra-violet (UV) or MS detection. Different system parameters such as column dimensions, transfer volumes, trapping column stationary phase, system tubing internal diameter (i.d.), and detection techniques, were optimized to enhance the sensitivity of the 2D-LC-SFC-MS system. The limit of detection was determined to be 10 ng/mL. An application is described where a mouse hepatocyte treated sample was analyzed using the optimized 2D-LC-SFC-MS system with successful assessment of the ratio of API to its metabolite (1D-LC), as well as the corresponding enantiomeric excess values (% e.e.) of each (2D-SFC). Copyright © 2018 Elsevier B.V. All rights reserved.
Nuclear localization of matrix metalloproteinases.
Mannello, Ferdinando; Medda, Virginia
2012-03-01
Matrix metalloproteinases (MMPs) were originally identified as matrixin proteases that act in the extracellular matrix. Recent works have uncovered nontraditional roles for MMPs in the extracellular space as well as in the cytosol and nucleus. There is strong evidence that subspecialized and compartmentalized matrixins participate in many physiological and pathological cellular processes, in which they can act as both degradative and regulatory proteases. In this review, we discuss the transcriptional and translational control of matrixin expression, their regulation of intracellular sorting, and the structural basis of activation and inhibition. In particular, we highlight the emerging roles of various matrixin forms in diseases. The activity of matrix metalloproteinases is regulated at several levels, including enzyme activation, inhibition, complex formation and compartmentalization. Most MMPs are secreted and have their function in the extracellular environment. MMPs are also found inside cells, both in the nucleus, cytosol and organelles. The role of intracellular located MMPs is still poorly understood, although recent studies have unraveled some of their functions. The localization, activation and activity of MMPs are regulated by their interactions with other proteins, proteoglycan core proteins and / or their glycosaminoglycan chains, as well as other molecules. Complexes formed between MMPs and various molecules may also include interactions with noncatalytic sites. Such exosites are regions involved in substrate processing, localized outside the active site, and are potential binding sites of specific MMP inhibitors. Knowledge about regulation of MMP activity is essential for understanding various physiological processes and pathogenesis of diseases, as well as for the development of new MMP targeting drugs. Copyright © 2011 Elsevier GmbH. All rights reserved.
Franck, Julien; Arafah, Karim; Barnes, Alan; Wisztorski, Maxence; Salzet, Michel; Fournier, Isabelle
2009-10-01
Nowadays, matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI MSI) is a powerful technique to obtain the distribution of endogenous and exogenous molecules within tissue sections. It can, thus, be used to study the evolution of molecules across different physiological stages in order to find out markers or get knowledge on signaling pathways. In order to provide valuable information, we must carefully control the sample preparation to avoid any delocalization of molecules of interest inside the tissue during this step. Currently, two strategies can be used to deposit chemicals, such as the MALDI matrix, onto the tissue both involving generation of microdroplets that will be dropped off onto the surface. First strategy involves microspraying of solutions. Here, we have been interested in the development of a microspotting strategy, where nanodroplets of solvent are ejected by a piezoelectric device to generate microspots at the tissue level. Such systems allow one to precisely control sample preparation by creating an array of spots. In terms of matrix crystallization, a microspotting MALDI matrix is hardly compatible with the results by classical (pipetting) methods. We have thus synthesized and studied new solid ionic matrixes in order to obtain high analytical performance using such a deposition system. These developments have enabled optimization of the preparation time because of the high stability of the printing that is generated in these conditions. We have also studied microspotting for performing on-tissue digestion in order to go for identification of proteins or to work from formalin fixed and paraffin embedded (FFPE) tissue samples. We have shown that microspotting is an interesting approach for on tissue digestion. Peptides, proteins, and lipids were studied under this specific preparation strategy to improve imaging performances for this class of molecules.
Domestication of the Cardiac Mitochondrion for Energy Conversion
Balaban, Robert S.
2009-01-01
The control of mitochondria energy conversion by cytosolic processes is reviewed. The nature of the cytosolic and mitochondrial potential energy homeostasis over wide ranges of energy utilization is reviewed and the consequences of this homeostasis in the control network are discussed. An analysis of the major candidate cytosolic signaling molecules ADP, Pi and Ca2+ are reviewed based on the magnitude and source of the cytosolic concentration changes as well as the potential targets of action within the mitochondrial energy conversion system. Based on this analysis, Ca2+ is the best candidate as a cytosolic signaling molecule for this process based on its ability to act as both a feed-forward and feed-back indicator of ATP hydrolysis and numerous targets within the matrix to provide a balanced activation of ATP production. These targets include numerous dehydrogenases and the F1-F0-ATPase. Pi is also a good candidate since it is an early signal of a mismatch between cytosolic ATP production and ATP synthesis in the presence of creatine kinase and has multiple targets within oxidative phosphorylation including NADH generation, electron flux in the cytochrome chain and a substrate for the F1-F0-ATPase. The mechanism of the coordinated activation of oxidative phosphorylation by these signaling molecules in discussed in light of the recent discoveries of extensive protein phosphorylation sites and other post-translational modifications. From this review it is clear that the control network associated with the maintenance of the cytosolic potential energy homeostasis is extremely complex with multiple pathways orchestrated to balance the sinks and sources in this system. New tools are needed to image and monitor metabolites within subcellular compartments to resolve many of these issues as well as the functional characterization of the numerous matrix post-translational events being discovered along with the enzymatic processes generating and removing these protein modifications. PMID:19265699
NASA Astrophysics Data System (ADS)
Čermák, Ivo; Förderer, Markus; Čermáková, Iva; Kalhofer, Stefan; Stopka-Ebeler, Helmut; Monninger, Gerold; Krätschmer, Wolfgang
1998-06-01
We have studied small carbon molecules using a matrix-isolation technique. Our experimental setup is described in detail. The carbon clusters were produced by evaporating graphite and trapping the carbon-vapor molecules in solid argon, where molecular growth could be induced by controlled matrix annealing. To identify the produced molecules, absorption spectroscopy in the ultraviolet (UV)-visible and infrared (IR) spectral ranges was applied. Additional characterization of the excited and ground states of the molecules was obtained from emission and excitation spectra. The molecules were excited by a pulsed dye laser system and the emission spectra were recorded with a high-sensitivity photodiode-array spectrometer. We present our measurements on linear C3. The à 1Πu excited state of linear C3 was populated by the electronic transition à 1Πu←X˜ 1Σg+, and the corresponding excitation spectra of the C3 fluorescence (à 1Πu→X˜ 1Σg+) and phosphorescence (ã 3Πu→X˜ 1Σg+) were studied. Comparison of excitation and absorption spectra yielded information on site effects due to the matrix environment. Emission bands in the fluorescence and phosphorescence spectra up to vibrational energies of 8500 cm-1 could be observed. The radiation lifetime of the à 1Πu excited state of C3 in solid argon was found to be shorter than 10 ns. The phosphorescence transition ã 3Πu→X˜ 1Σg+ decays in about 10 ms and its rise indicates fast vibrational relaxation within the triplet system. Our data support a linear ground state geometry for C3 also in solid argon.
MAGP1, the extracellular matrix, and metabolism
Craft, Clarissa S
2014-01-01
Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases. PMID:26167404
MAGP1, the extracellular matrix, and metabolism.
Craft, Clarissa S
2015-01-01
Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases.
The mesangial matrix in the normal and sclerotic glomerulus.
Rosenblum, N D
1994-02-01
Mesangial sclerosis is a final common pathway to glomerular destruction in a variety of glomerular diseases. The expression of several classes of extracellular matrix (ECM) molecules has been defined in the normal and diseased mesangial matrix (MM). However, the manner in which these ECM components determine the three dimensional structure and function of the MM remains to be defined. Structural studies of the MM suggest that its constituent molecules are regionally organized into subcompartments with different three dimensional structures. The diversity of matrix molecules expressed within the MM as well as the organization of these components in nonrenal ECM's, such as the cornea, provides further support for this organizational model. The study of the cornea has also revealed that novel short chain collagenous proteins partially determine the three dimensional structure of the matrix. Recently, a novel collagen, type VIII collagen, has been described in mesangial cells and in the intact glomerulus. It is hypothesized that type VIII collagen is expressed both as a polymer and as a monomer within the glomerulus, and depending on its conformation, may serve unique functions. In the chronically diseased MM, normal MM components are overexpressed and fibrillar collagens are expressed de novo in a delayed fashion. Enhanced proteoglycan expression, observed early in disease, may determine increased volume of the mesangium. This, in turn, may stimulate the production of fibrillar collagens by mesangial cells resulting in a fibrillar noncompliant mesangial matrix.
NASA Astrophysics Data System (ADS)
Henry, Jackson; Blair, Enrique P.
2018-02-01
Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.
Matrix isolation as a tool for studying interstellar chemical reactions
NASA Technical Reports Server (NTRS)
Ball, David W.; Ortman, Bryan J.; Hauge, Robert H.; Margrave, John L.
1989-01-01
Since the identification of the OH radical as an interstellar species, over 50 molecular species were identified as interstellar denizens. While identification of new species appears straightforward, an explanation for their mechanisms of formation is not. Most astronomers concede that large bodies like interstellar dust grains are necessary for adsorption of molecules and their energies of reactions, but many of the mechanistic steps are unknown and speculative. It is proposed that data from matrix isolation experiments involving the reactions of refractory materials (especially C, Si, and Fe atoms and clusters) with small molecules (mainly H2, H2O, CO, CO2) are particularly applicable to explaining mechanistic details of likely interstellar chemical reactions. In many cases, matrix isolation techniques are the sole method of studying such reactions; also in many cases, complexations and bond rearrangements yield molecules never before observed. The study of these reactions thus provides a logical basis for the mechanisms of interstellar reactions. A list of reactions is presented that would simulate interstellar chemical reactions. These reactions were studied using FTIR-matrix isolation techniques.
van Kampen, Jeroen J A; Luider, Theo M; Ruttink, Paul J A; Burgers, Peter C
2009-11-01
In a previous study [van Kampen et al. Analytical Chemistry 2006; 78: 5403], we found that meso-tetrakis (pentafluorophenyl)porphyrin (F20TPP), in combination with lithium salts, provides an efficient matrix to cationize small molecules by Li+ attachment and that this combination can be successfully applied to the quantitative analysis of drugs, such as antiretroviral compounds using matrix-assisted laser desorption ionization in conjunction with a time-of-flight analyzer (MALDI-TOF). In the present study, we further explore the mechanism of metal ion attachment to F20TPP and analytes by MALDI-FTMS(/MS). To this end, we have studied the interaction of F20TPP and analytes with various mono-, di- and trivalent metal ions (Li+, Na+, K+, Rb+, Cs+, Co2+, Cu2+, Zn2+, Fe2+, Fe3+ and Ga3+). For the alkali cations, we find that F20TPP forms complexes only with Li+ and Na+; in addition, model analyte molecules such as poly(ethyleneglycol)s, mixed with F20TPP and the alkali cations, also only form Li+ and Na+ adducts. This contrasts sharply with the commonly used matrix 2,5-dihydroxybenzoic acid, where analytes are most efficiently cationized by Na+ or K+. Reasons for this difference are delineated. Ab initio calculations on porphyrin itself reveal that even the smallest alkali cation, Li+, does not fit in the porphyrin cavity, but lies on top of it, pushing the 21H and 23 H hydrogen atoms out of and below the plane with concomitant bending of the porphyrin skeleton in the opposite direction, i.e. toward the cation. Thus, the Li+ ion is not effectively sequestered and is in fact exposed and thus accessible for donation to analyte molecules. Interaction of F20TPP with di- and trivalent metal ions leads to protoporphyrin-metal ions, where the metal ion is captured within the protoporphyrin dianion cavity. The most intense signal is obtained when F20TPP is reacted with CuCl2 and then subjected to laser ablation. This method presents an easy general route to study the metal containing protoporphyrin molecules, which could all act as potential MALDI matrices. Copyright 2009 John Wiley & Sons, Ltd.
The ab-initio density matrix renormalization group in practice.
Olivares-Amaya, Roberto; Hu, Weifeng; Nakatani, Naoki; Sharma, Sandeep; Yang, Jun; Chan, Garnet Kin-Lic
2015-01-21
The ab-initio density matrix renormalization group (DMRG) is a tool that can be applied to a wide variety of interesting problems in quantum chemistry. Here, we examine the density matrix renormalization group from the vantage point of the quantum chemistry user. What kinds of problems is the DMRG well-suited to? What are the largest systems that can be treated at practical cost? What sort of accuracies can be obtained, and how do we reason about the computational difficulty in different molecules? By examining a diverse benchmark set of molecules: π-electron systems, benchmark main-group and transition metal dimers, and the Mn-oxo-salen and Fe-porphine organometallic compounds, we provide some answers to these questions, and show how the density matrix renormalization group is used in practice.
Ren, Xiang; Zhang, Tong; Wu, Dan; Yan, Tao; Pang, Xuehui; Du, Bin; Lou, Wanruo; Wei, Qin
2017-08-15
Herein, a super-labeled immunoassay was fabricated for matrix metalloproteinases-2 detection. A self-corrosion ITO micro circuit board was designed in this sensing platform to reduce the random error in the same testing condition, and the self-constructed sensing platform is portable with a cheap price. The K-modified graphene (K-GS) was utilized as the matrix material, which was synthesized well by phenylate and phenanthrene through the polar bond of nonpolar molecule phenylate and the π-π interaction for the first time. An aptamer-based labels based on Au nanoparticles (AuNPs), thionine (Th) and horseradish peroxidase (HRP) were applied as the signal source for tri infinite amplification. This fabricated super-labeled immunoassay exhibit excellent performance for MMPs-2 detection. It displayed a broad linear range of 10 -4 -10ng/mL with a low detection limit of 35 fg/mL, which may have a potential application in the clinical diagnose. Copyright © 2017 Elsevier B.V. All rights reserved.
Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.; ...
2016-08-30
Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.
Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less
Parris, George
2006-01-01
The two-stage initiation-progression model of cancer is widely accepted. Initiation appears to result most often from accumulation of damage to the DNA expressed as multiple mutations in the phenotype. Unsymmetrical chromosome segregation during mitosis of normal or mutated cells produces aneuploid cells and also contributes to the evolution of neoplasia. However, it has been pointed out (Parris GE. Med Hypotheses 2005;65:993-4 and 2006;66:76-83) that DNA damage and loss of chromosomes are much more likely to lead the mutant clones of cells to extinction than to successful expansion (e.g., an example of Muller's Ratchet). It was argued that aneuploid neoplasia represent new parasite species that successfully evolve to devour their hosts by incorporating sex-like redistribution of chromosomes through spontaneous or virus-catalyzed cell-cell fusion into their life-cycle. Spontaneous cell-cell fusion is generally blocked by the intercellular matrix to which the cells are bound via surface adhesion molecules (frequently glycoproteins, e.g., CD44). In order for progression of matrix-contained neoplasia toward clinically significant cancer to occur, the parasite cells must escape from the matrix and fuse. Release from the matrix also allows the parasite cells to invade adjacent tissues and metastasize to remote locations. Both invasion and metastasis likely involve fusion of the migrating parasite cells with fusion-prone blast cells. There are at least three pathways through which parasite cells can be liberated from the confining matrix: (i) Their adhesion molecules may be modified (e.g., by hyper-glycosylation) so that they can no longer grip the matrix. (ii) Their adhesion molecules or matrix may be saturated with other ligands (e.g., polyamines). (iii) Their adhesion molecules may be cleaved from the cell surface or the matrix itself may be cleaved (e.g., by MMPs or ADAMs). It is hypothesized that mobilization of parasite cells and cell-cell fusion go hand-in-hand in the progression of neoplasia to clinically significant cancer through invasion and metastasis. The latency between tumor recognition and exposure to mutagens and the increased incidence of cancer with age can probably be related to slow breakdown of the intercellular matrix that provides a barrier to cell-cell fusion.
Singh, Satyendra K; Singh, Aloukick K; Prasad, Kashi N; Singh, Amrita; Singh, Avinash; Rai, Ravi P; Tripathi, Mukesh; Gupta, Rakesh K; Husain, Nuzhat
2015-11-30
Neurocysticercosis (NCC) is a parasitic infection of central nervous system (CNS). Expression of adhesion molecules, chemokines and matrix metalloproteinases (MMPs) were investigated on brain tissues surrounding viable (n=15) and degenerating cysticerci (n=15) of Taenia solium in swine by real-time RT-PCR and ELISA. Gelatin gel zymography was performed for MMPs activity. ICAM-1 (intercellular adhesion molecule-1), E-selectin, MIP-1α (macrophage inflammatory protein-1α), Eotaxin-1 and RANTES (regulated on activation, normal T cell expressed and secreted) were associated with degenerating cysticerci (cysts). However, VCAM-1 (vascular cell adhesion molecule-1), MCP-1 (monocyte chemotactic protein-1), MMP-2 and MMP-9 were associated with both viable and degenerating cysts. In conclusion, viable and degenerating cysticerci have different immune molecule profiles and role of these molecules in disease pathogenesis needs to be investigated. Copyright © 2015 Elsevier B.V. All rights reserved.
Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.
Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K
2007-01-01
Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.
Mechanisms of Aquaporin-Facilitated Cancer Invasion and Metastasis
NASA Astrophysics Data System (ADS)
De Ieso, Michael L.; Yool, Andrea J.
2018-04-01
Cancer is a leading cause of death worldwide, and its incidence is rising with numbers expected to increase 70% in the next two decades. The fact that current mainline treatments for cancer patients are accompanied by debilitating side effects prompts a growing demand for new therapies that not only inhibit growth and proliferation of cancer cells, but also control invasion and metastasis. One class of targets gaining international attention is the aquaporins, a family of membrane-spanning water channels with diverse physiological functions and extensive tissue-specific distributions in humans. Aquaporins -1, -2, -3, -4, -5, -8, and -9 have been linked to roles in cancer proliferation, invasion and metastasis, but their mechanisms of action remain to be fully defined. Aquaporins are implicated in the metastatic cascade in processes of angiogenesis, cellular dissociation, migration and invasion. Cancer invasion and metastasis are proposed to be potentiated by aquaporins in boosting tumor angiogenesis, enhancing cell volume regulation, regulating cell-cell and cell-matrix adhesions, interacting with actin cytoskeleton, regulating proteases and extracellular-matrix degrading molecules, contributing to the regulation of epithelial-mesenchymal transitions, and interacting with signaling pathways enabling motility and invasion. Pharmacological modulators of aquaporin channels are being identified and tested for therapeutic potential, including compounds derived from loop diuretics, metal-containing organic compounds, plant natural products, and other small molecules. Further studies on aquaporin-dependent functions in cancer metastasis are needed to define the differential contributions of different classes of aquaporin channels to regulation of fluid balance, cell volume, small solute transport, signal transduction, their possible relevance as rate limiting steps, and potential values as therapeutic targets for proliferation and invasion.
NASA Astrophysics Data System (ADS)
Brooks, Amanda
2015-11-01
Drug delivery across mucus membranes is a particularly effective route of administration due to the large surface area. However, the unique environment present at the mucosa necessitates altered drug formulations designed to (1) deliver sensitive biologic molecules, (2) promote intimate contact between the mucosa and the drug, and (3) prolong the drug’s local residence time. Thus, the pharmaceutical industry has an interest in drug delivery systems formulated around the use of mucoadhesive polymers. Mucoadhesive polymers, both synthetic and biological, have a history of use in local drug delivery. Prominently featured in the literature are chitosan, alginate, and cellulose derivatives. More recently, silk and silk-like derivatives have been explored for their potential as mucoadhesive polymers. Both silkworms and spiders produce sticky silk-like glue substances, sericin and aggregate silk respectively, that may prove an effective, natural matrix for drug delivery to the mucosa. This mini review will explore the potential of silk and silk-like derivatives as a biocompatible mucoadhesive polymer matrix for local controlled drug delivery.
Howard, Karen L; Boyer, Gregory L
2007-01-01
A novel method for simplifying adduct patterns to improve the detection and identification of peptide toxins using matrix-assisted laser desorption/ionization (MALDI) time-of-flight (TOF) mass spectrometry is presented. Addition of 200 microM zinc sulfate heptahydrate (ZnSO(4) . 7H(2)O) to samples prior to spotting on the target enhances detection of the protonated molecule while suppressing competing adducts. This produces a highly simplified spectrum with the potential to enhance quantitative analysis, particularly for complex samples. The resulting improvement in total signal strength and reduction in the coefficient of variation (from 31.1% to 5.2% for microcystin-LR) further enhance the potential for sensitive and accurate quantitation. Other potential additives tested, including 18-crown-6 ether, alkali metal salts (lithium chloride, sodium chloride, potassium chloride), and other transition metal salts (silver chloride, silver nitrate, copper(II) nitrate, copper(II) sulfate, zinc acetate), were unable to achieve comparable results. Application of this technique to the analysis of several microcystins, potent peptide hepatotoxins from cyanobacteria, is illustrated. Copyright (c) 2007 John Wiley & Sons, Ltd.
Bouyoucef, Mouloud; Rakic, Rodolphe; Gómez-Leduc, Tangni; Latire, Thomas; Marin, Frédéric; Leclercq, Sylvain; Carreiras, Franck; Serpentini, Antoine; Lebel, Jean-Marc; Galéra, Philippe; Legendre, Florence
2018-04-07
The shells of the bivalve mollusks are organo-mineral structures predominantly composed of calcium carbonate, but also of a minor organic matrix, a mixture of proteins, glycoproteins, and polysaccharides. These proteins are involved in mineral deposition and, more generally, in the spatial organization of the shell crystallites in well-defined microstructures. In this work, we extracted different organic shell extracts (acid-soluble matrix, acid-insoluble matrix, water-soluble matrix, guanidine HCl/EDTA-extracted matrix, referred as ASM, AIM, WSM, and EDTAM, respectively) from the shell of the scallop Pecten maximus and studied their biological activities on human articular chondrocytes (HACs). We found that these extracts differentially modulate the biological activities of HACs, depending on the type of extraction and the concentration used. Furthermore, we showed that, unlike ASM and AIM, WSM promotes maintenance of the chondrocyte phenotype in monolayer culture. WSM increased the expression of chondrocyte-specific markers (aggrecan and type II collagen), without enhancing that of the main chondrocyte dedifferentiation marker (type I collagen). We also demonstrated that WSM could favor redifferentiation of chondrocyte in collagen sponge scaffold in hypoxia. Thus, this study suggests that the organic matrix of Pecten maximus, particularly WSM, may contain interesting molecules with chondrogenic effects. Our research emphasizes the potential use of WSM of Pecten maximus for cell therapy of cartilage.
High Matrix Metalloproteinase Activity is a Hallmark of Periapical Granulomas
de Paula e Silva, Francisco Wanderley Garcia; D'Silva, Nisha J.; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine
2009-01-01
Introduction Inability to distinguish periapical cysts from granulomas prior to performing root canal treatment leads to uncertainty in treatment outcomes, because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Methods Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Since matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed using one-way ANOVA followed by Tukey test. Results We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the matrix metalloproteinase (MMP) family. Compared to cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs), in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared to cysts. Conclusion Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas, unlike periapical cysts. PMID:19720222
Natural Non-Mulberry Silk Nanoparticles for Potential-Controlled Drug Release
Wang, Juan; Yin, Zhuping; Xue, Xiang; Kundu, Subhas C.; Mo, Xiumei; Lu, Shenzhou
2016-01-01
Natural silk protein nanoparticles are a promising biomaterial for drug delivery due to their pleiotropic properties, including biocompatibility, high bioavailability, and biodegradability. Chinese oak tasar Antheraea pernyi silk fibroin (ApF) nanoparticles are easily obtained using cations as reagents under mild conditions. The mild conditions are potentially advantageous for the encapsulation of sensitive drugs and therapeutic molecules. In the present study, silk fibroin protein nanoparticles are loaded with differently-charged small-molecule drugs, such as doxorubicin hydrochloride, ibuprofen, and ibuprofen-Na, by simple absorption based on electrostatic interactions. The structure, morphology and biocompatibility of the silk nanoparticles in vitro are investigated. In vitro release of the drugs from the nanoparticles depends on charge-charge interactions between the drugs and the nanoparticles. The release behavior of the compounds from the nanoparticles demonstrates that positively-charged molecules are released in a more prolonged or sustained manner. Cell viability studies with L929 demonstrated that the ApF nanoparticles significantly promoted cell growth. The results suggest that Chinese oak tasar Antheraea pernyi silk fibroin nanoparticles can be used as an alternative matrix for drug carrying and controlled release in diverse biomedical applications. PMID:27916946
DOE Office of Scientific and Technical Information (OSTI.GOV)
Corey, G.C.; Alexander, M.H.
1986-11-15
A new derivation is presented of the infinite order sudden (IOS) approximation for rotationally inelastic collisions of a diatomic molecule in a Pi electronic state with a closed shell atom. This derivation clearly demonstrates the connection between the two sudden S functions for scattering off the adiabatic potential surface of A' and A symmetry, which would arise from an ab initio calculation on an atom + Pi-state molecule system, and the S matrix elements in diabatic basis, which are required in the quantum treatment of the collision dynamics. Coupled states and IOS calculations were carried out for collisions of NImore » X 2 Pi with helium and argon, based on a electron gas potential surface at total energies of 63, 150, and 300 meV. The IOS approximation is not reliable for collisions of NO with Ar, even at the highest collision energy considered here. However, for collisions with He at 150 and 300 meV, the IOS approximation is nearly quantitative for transitions both within and between the Omega = 1/2 and Omega = 3/2 manifolds.« less
NASA Astrophysics Data System (ADS)
Castro-Palacios, Juan Carlos; Rubayo-Soneira, Jesús; Ishii, Keisaku; Yamashita, Koichi
2007-04-01
The intermolecular potentials for the NO(XΠ2)-Kr and NO(AΣ+2)-Kr systems have been calculated using highly accurate ab initio calculations. The spin-restricted coupled cluster method for the ground 1A'2 state [NO(XΠ2)-Kr ] and the multireference singles and doubles configuration interaction method for the excited 2A'2 state [NO(AΣ+2)-Kr], respectively, were used. The potential energy surfaces (PESs) show two linear wells and one that is almost in the perpendicular position. An analytical representation of the PESs has been constructed for the triatomic systems and used to carry out molecular dynamics (MD) simulations of the NO-doped krypton matrix response after excitation of NO. MD results are shown comparatively for three sets of potentials: (1) anisotropic ab initio potentials [NO molecule direction fixed during the dynamics and considered as a point (its center of mass)], (2) isotropic ab initio potentials (isotropic part in a Legendre polynomial expansion of the PESs), and (3) fitted Kr-NO potentials to the spectroscopic data. An important finding of this work is that the anisotropic and isotropic ab initio potentials calculated for the Kr-NO triatomic system are not suitable for describing the dynamics of structural relaxation upon Rydberg excitation of a NO impurity in the crystal. However, the isotropic ab initio potential in the ground state almost overlaps the published experimental potential, being almost independent of the angle asymmetry. This fact is also manifested in the radial distribution function around NO. However, in the case of the excited state the isotropic ab initio potential differs from the fitted potentials, which indicates that the Kr-NO interaction in the matrix is quite different because of the presence of the surrounding Kr atoms acting on the NO molecule. MD simulations for isotropic potentials reasonably reproduce the experimental observables for the femtosecond response and the bubble size but do not match spectroscopic results. A general overall view of the results suggests that, when the Kr-NO interaction takes place inside the matrix, potentials are rather symmetric and less repulsive than those for the triatomic system. pectroscopy, yields a mean absolute deviation of about 5cm-1 over the 22 levels. The dissociation energy with respect to the lowest vibrational energy is calculated within 30cm-1 of the experimental value of 12953±8cm-1. The reported agreement of the theoretical spectrum and dissociation energy with experiment is contingent upon the inclusion of the effects of core-generated electron correlation, spin-orbit coupling, and scalar relativity. The Dunham analysis [Phys. Rev. 41, 721 (1932)] of the spectrum is found to be very accurate. New values are given for the spectroscopic constants.
Chauhan, Vikash P.; Martin, John D.; Liu, Hao; Lacorre, Delphine A.; Jain, Saloni R.; Kozin, Sergey V.; Stylianopoulos, Triantafyllos; Mousa, Ahmed S.; Han, Xiaoxing; Adstamongkonkul, Pichet; Popović, Zoran; Huang, Peigen; Bawendi, Moungi G.; Boucher, Yves; Jain, Rakesh K.
2013-01-01
Cancer and stromal cells actively exert physical forces (solid stress) to compress tumour blood vessels, thus reducing vascular perfusion. Tumour interstitial matrix also contributes to solid stress, with hyaluronan implicated as the primary matrix molecule responsible for vessel compression because of its swelling behaviour. Here we show, unexpectedly, that hyaluronan compresses vessels only in collagen-rich tumours, suggesting that collagen and hyaluronan together are critical targets for decompressing tumour vessels. We demonstrate that the angiotensin inhibitor losartan reduces stromal collagen and hyaluronan production, associated with decreased expression of profibrotic signals TGF-β1, CCN2 and ET-1, downstream of angiotensin-II-receptor-1 inhibition. Consequently, losartan reduces solid stress in tumours resulting in increased vascular perfusion. Through this physical mechanism, losartan improves drug and oxygen delivery to tumours, thereby potentiating chemotherapy and reducing hypoxia in breast and pancreatic cancer models. Thus, angiotensin inhibitors —inexpensive drugs with decades of safe use — could be rapidly repurposed as cancer therapeutics. PMID:24084631
Giese, Timothy J; York, Darrin M
2010-12-28
We extend the Kohn-Sham potential energy expansion (VE) to include variations of the kinetic energy density and use the VE formulation with a 6-31G* basis to perform a "Jacob's ladder" comparison of small molecule properties using density functionals classified as being either LDA, GGA, or meta-GGA. We show that the VE reproduces standard Kohn-Sham DFT results well if all integrals are performed without further approximation, and there is no substantial improvement in using meta-GGA functionals relative to GGA functionals. The advantages of using GGA versus LDA functionals becomes apparent when modeling hydrogen bonds. We furthermore examine the effect of using integral approximations to compute the zeroth-order energy and first-order matrix elements, and the results suggest that the origin of the short-range repulsive potential within self-consistent charge density-functional tight-binding methods mainly arises from the approximations made to the first-order matrix elements.
NASA Astrophysics Data System (ADS)
di Lauro, C.
2018-03-01
Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.
Dowlatshahi Pour, Masoumeh; Malmberg, Per; Ewing, Andrew
2016-05-01
We have characterized the use of sublimation to deposit matrix-assisted laser desorption/ionization (MALDI) matrices in secondary ion mass spectrometry (SIMS) analysis, i.e. matrix-enhanced SIMS (ME-SIMS), a common surface modification method to enhance sensitivity for larger molecules and to increase the production of intact molecular ions. We use sublimation to apply a thin layer of a conventional MALDI matrix, 2,5-dihydroxybenzoic acid (DHB), onto rat brain cerebellum tissue to show how this technique can be used to enhance molecular yields in SIMS while still retaining a lateral resolution around 2 μm and also to investigate the mechanism of this enhancement. The results here illustrate that cholesterol, which is a dominant lipid species in the brain, is decreased on the tissue surface after deposition of matrix, particularly in white matter. The decrease of cholesterol is followed by an increased ion yield of several other lipid species. Depth profiling of the sublimed rat brain reveals that the lipid species are de facto extracted by the DHB matrix and concentrated in the top most layers of the sublimed matrix. This extraction/concentration of lipids directly leads to an increase of higher mass lipid ion yield. It is also possible that the decrease of cholesterol decreases the potential suppression of ion yield caused by cholesterol migration to the tissue surface. This result provides us with significant insights into the possible mechanisms involved when using sublimation to deposit this matrix in ME-SIMS.
EMMPRIN in gynecologic cancers: pathologic and therapeutic aspects.
Liu, Dan-tong
2015-07-01
The highly glycosylated transmembrane protein extracellular matrix metalloproteinase inducer (EMMPRIN) is associated with several pathological conditions, including various types of cancers. In different gynecological malignancies, such as ovarian, cervical, and endometrial cancers, EMMPRIN plays significant roles in cell adhesion modulation, tumor growth, invasion, angiogenesis, and metastasis by inducing the production of various molecules, including matrix metalloproteinases and vascular endothelial growth factor. Because of its high level of expression, EMMPRIN can possibly be used as a diagnostic marker of gynecological cancers. Recent studies have showed that targeting EMMPRIN, especially by RNA interference (RNAi) technology, has promising therapeutic potential in basic research on gynecological cancer treatments, which make a platform for the future clinical success. This review study focused on the association of EMMPRIN in gynecological cancers in the perspectives of pathogenesis, diagnosis, and therapeutics.
Leeman, Matthew F; Curran, Stephanie; Murray, Graeme I
2003-12-01
This review outlines new concepts that are emerging for the functions of matrix metalloproteinases in colorectal cancer development and progression. The two main concepts that will be discussed are the role of matrix metalloproteinases in the early stages of colorectal tumour development and the functional mechanisms by which matrix metalloproteinases contribute to colorectal tumour invasion and metastasis. The matrix metalloproteinases are a group of enzymes, which have been best characterized for their ability to degrade extracellular matrix proteins and thus they have been extensively studied in tumour invasion. It is now becoming recognized that the matrix metalloproteinases have key roles in a variety of biological processes that are distinct from their well-defined role in matrix degradation. This group of enzymes has been shown to interact with a broad range of non-matrix proteins including growth factors and their receptors, mediators of apoptosis, and cell adhesion molecules. The elucidation of novel biological roles for the matrix metalloproteinases also challenges the current predominant concept of matrix metalloproteinases as enzymes only involved in matrix degradation. Recent studies have shown that several matrix metalloproteinases, especially matrilysin (MMP-7), interact with the specific molecular genetic and signalling pathways involved in colorectal cancer development. In particular, matrilysin is activated at an early stage of colorectal tumourigenesis by the beta-catenin signalling pathway. Furthermore, studies are now elucidating specific mechanisms by which individual matrix metalloproteinases, especially membrane-type matrix metalloproteinases, interact with specific cell adhesion molecules and cytoskeletal proteins and thus contribute dynamically to colorectal tumour invasion. Copyright 2003 John Wiley & Sons, Ltd.
Kelley, Algernon T; Ngunjiri, Johnpeter N; Serem, Wilson K; Lawrence, Steve O; Yu, Jing-Jiang; Crowe, William E; Garno, Jayne C
2010-03-02
Molecules of n-alkanethiols with methyl head groups typically form well-ordered monolayers during solution self-assembly for a wide range of experimental conditions. However, we have consistently observed that, for either carboxylic acid or thiol-terminated n-alkanethiols, under certain conditions nanografted patterns are generated with a thickness corresponding precisely to a double layer. To investigate the role of head groups for solution self-assembly, designed patterns of omega-functionalized n-alkanethiols were nanografted with systematic changes in concentration. Nanografting is an in situ approach for writing patterns of thiolated molecules on gold surfaces by scanning with an AFM tip under high force, accomplished in dilute solutions of desired ink molecules. As the tip is scanned across the surface of a self-assembled monolayer under force, the matrix molecules are displaced from the surface and are immediately replaced with fresh molecules from solution to generate nanopatterns. In this report, side-by-side comparison of nanografted patterns is achieved for different matrix molecules using AFM images. The chain length and head groups (i.e., carboxyl, hydroxyl, methyl, thiol) were varied for the nanopatterns and matrix monolayers. Interactions such as head-to-head dimerization affect the vertical self-assembly of omega-functionalized n-alkanethiol molecules within nanografted patterns. At certain threshold concentrations, double layers were observed to form when nanografting with head groups of carboxylic acid and dithiols, whereas single layers were generated exclusively for nanografted patterns with methyl and hydroxyl groups, regardless of changes in concentration.
Wright, W W; Owen, C S; Vanderkooi, J M
1992-07-21
The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)
EvArnoldi: A New Algorithm for Large-Scale Eigenvalue Problems.
Tal-Ezer, Hillel
2016-05-19
Eigenvalues and eigenvectors are an essential theme in numerical linear algebra. Their study is mainly motivated by their high importance in a wide range of applications. Knowledge of eigenvalues is essential in quantum molecular science. Solutions of the Schrödinger equation for the electrons composing the molecule are the basis of electronic structure theory. Electronic eigenvalues compose the potential energy surfaces for nuclear motion. The eigenvectors allow calculation of diople transition matrix elements, the core of spectroscopy. The vibrational dynamics molecule also requires knowledge of the eigenvalues of the vibrational Hamiltonian. Typically in these problems, the dimension of Hilbert space is huge. Practically, only a small subset of eigenvalues is required. In this paper, we present a highly efficient algorithm, named EvArnoldi, for solving the large-scale eigenvalues problem. The algorithm, in its basic formulation, is mathematically equivalent to ARPACK ( Sorensen , D. C. Implicitly Restarted Arnoldi/Lanczos Methods for Large Scale Eigenvalue Calculations ; Springer , 1997 ; Lehoucq , R. B. ; Sorensen , D. C. SIAM Journal on Matrix Analysis and Applications 1996 , 17 , 789 ; Calvetti , D. ; Reichel , L. ; Sorensen , D. C. Electronic Transactions on Numerical Analysis 1994 , 2 , 21 ) (or Eigs of Matlab) but significantly simpler.
Biomedical application of MALDI mass spectrometry for small-molecule analysis.
van Kampen, Jeroen J A; Burgers, Peter C; de Groot, Ronald; Gruters, Rob A; Luider, Theo M
2011-01-01
Matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) is an emerging analytical tool for the analysis of molecules with molar masses below 1,000 Da; that is, small molecules. This technique offers rapid analysis, high sensitivity, low sample consumption, a relative high tolerance towards salts and buffers, and the possibility to store sample on the target plate. The successful application of the technique is, however, hampered by low molecular weight (LMW) matrix-derived interference signals and by poor reproducibility of signal intensities during quantitative analyses. In this review, we focus on the biomedical application of MALDI-MS for the analysis of small molecules and discuss its favorable properties and its challenges as well as strategies to improve the performance of the technique. Furthermore, practical aspects and applications are presented. © 2010 Wiley Periodicals, Inc.
Electroluminescence from completely horizontally oriented dye molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Komino, Takeshi; Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395; Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395
2016-06-13
A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimatemore » orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.« less
Radiation-induced transformations of isolated CH3CN molecules in noble gas matrices
NASA Astrophysics Data System (ADS)
Kameneva, Svetlana V.; Volosatova, Anastasia D.; Feldman, Vladimir I.
2017-12-01
The transformations of isolated CH3CN molecules in various solid noble-gas matrices (Ne, Ar, Kr, and Xe) under the action of X-ray irradiation at 5 K were investigated by FTIR spectroscopy. The main products are CH3NC, CH2CNH and CH2NCH molecular isomers as well as CH2CN and CH2NC radicals. The matrix has a strong effect on the distribution of reaction channels. In particular, the highest relative yield of keteneimine (CH2CNH) was found in Ne matrix, whereas the formation of CH3NC predominates in xenon. It was explained by differences in the matrix ionization energy (IE) resulting in different distributions of hot ionic reactions. The reactions of neutral excited states are mainly involved in Xe matrix with low IE, while the isomerization of the primary acetonitrile positive ions may be quite effective in Ne and Ar. Annealing of the irradiated samples results in mobilization of trapped hydrogen atoms followed by their reactions with radicals to yield parent molecule and its isomers. The scheme of the radiation-induced processes and its implications for the acetonitrile chemistry in cosmic ices are discussed.
Feenstra, Adam D.; Ames Lab., Ames, IA; O'Neill, Kelly C.; ...
2016-10-13
Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a widely adopted, versatile technique, especially in high-throughput analysis and imaging. However, matrix-dependent selectivity of analytes is often a severe limitation. In this work, a mixture of organic 2,5-dihydroxybenzoic acid and inorganic Fe 3O 4 nanoparticles is developed as a binary MALDI matrix to alleviate the well-known issue of triacylglycerol (TG) ion suppression by phosphatidylcholine (PC). In application to lipid standards and maize seed cross-sections, the binary matrix not only dramatically reduced the ion suppression of TG, but also efficiently desorbed and ionized a wide variety of lipids such as cationic PC, anionicmore » phosphatidylethanolamine (PE) and phosphatidylinositol (PI), and neutral digalactosyldiacylglycerol (DGDG). The binary matrix was also very efficient for large polysaccharides, which were not detected by either of the individual matrices. As a result, the usefulness of the binary matrix is demonstrated in MS imaging of maize seed sections, successfully visualizing diverse medium-size molecules and acquiring high-quality MS/MS spectra for these compounds.« less
Pseudomonas biofilm matrix composition and niche biology
Mann, Ethan E.; Wozniak, Daniel J.
2014-01-01
Biofilms are a predominant form of growth for bacteria in the environment and in the clinic. Critical for biofilm development are adherence, proliferation, and dispersion phases. Each of these stages includes reinforcement by, or modulation of, the extracellular matrix. Pseudomonas aeruginosa has been a model organism for the study of biofilm formation. Additionally, other Pseudomonas species utilize biofilm formation during plant colonization and environmental persistence. Pseudomonads produce several biofilm matrix molecules, including polysaccharides, nucleic acids, and proteins. Accessory matrix components shown to aid biofilm formation and adaptability under varying conditions are also produced by pseudomonads. Adaptation facilitated by biofilm formation allows for selection of genetic variants with unique and distinguishable colony morphology. Examples include rugose small-colony variants and wrinkly spreaders (WS), which over produce Psl/Pel or cellulose, respectively, and mucoid bacteria that over produce alginate. The well-documented emergence of these variants suggests that pseudomonads take advantage of matrix-building subpopulations conferring specific benefits for the entire population. This review will focus on various polysaccharides as well as additional Pseudomonas biofilm matrix components. Discussions will center on structure–function relationships, regulation, and the role of individual matrix molecules in niche biology. PMID:22212072
Di Marino, Daniele; Oteri, Francesco; della Rocca, Blasco Morozzo; D'Annessa, Ilda; Falconi, Mattia
2012-06-01
The mitochondrial adenosine diphosphate/adenosine triphosphate (ADP/ATP) carrier-AAC-was crystallized in complex with its specific inhibitor carboxyatractyloside (CATR). The protein consists of a six-transmembrane helix bundle that defines the nucleotide translocation pathway, which is closed towards the matrix side due to sharp kinks in the odd-numbered helices. In this paper, we describe the interaction between the matrix side of the AAC transporter and the ATP(4-) molecule using carrier structures obtained through classical molecular dynamics simulation (MD) and a protein-ligand docking procedure. Fifteen structures were extracted from a previously published MD trajectory through clustering analysis, and 50 docking runs were carried out for each carrier conformation, for a total of 750 runs ("MD docking"). The results were compared to those from 750 docking runs performed on the X-ray structure ("X docking"). The docking procedure indicated the presence of a single interaction site in the X-ray structure that was conserved in the structures extracted from the MD trajectory. MD docking showed the presence of a second binding site that was not found in the X docking. The interaction strategy between the AAC transporter and the ATP(4-) molecule was analyzed by investigating the composition and 3D arrangement of the interaction pockets, together with the orientations of the substrate inside them. A relationship between sequence repeats and the ATP(4-) binding sites in the AAC carrier structure is proposed.
Entropic trapping of macromolecules by mesoscopic periodic voids in a polymer hydrogel
NASA Astrophysics Data System (ADS)
Liu, Lei; Li, Pusheng; Asher, Sanford A.
1999-01-01
The separation of macromolecules such as polymers and DNA by means of electrophoresis, gel permeation chromatography or filtration exploits size-dependent differences in the time it takes for the molecules to migrate through a random porous network. Transport through the gel matrices, which usually consist of full swollen crosslinked polymers, depends on the relative size of the macromolecule compared with the pore radius. Sufficiently small molecules are thought to adopt an approximately spherical conformation when diffusing through the gel matrix, whereas larger ones are forced to migrate in a snake-like fashion. Molecules of intermediate size, however, can get temporarily trapped in the largest pores of the matrix, where the molecule can extend and thus maximize its conformational entropy. This `entropic trapping' is thought to increase the dependence of diffusion rate on molecular size. Here we report the direct experimental verification of this phenomenon. Bragg diffraction from a hydrogel containing a periodic array of monodisperse water voids confirms that polymers of different weights partition between the hydrogel matrix and the water voids according to the predictions of the entropic trapping theory. Our approach might also lead to the design of improved separation media based on entropic trapping.
b matrix errors in echo planar diffusion tensor imaging
Boujraf, Saïd; Luypaert, Robert; Osteaux, Michel
2001-01-01
Diffusion‐weighted magnetic resonance imaging (DW‐MRI) is a recognized tool for early detection of infarction of the human brain. DW‐MRI uses the signal loss associated with the random thermal motion of water molecules in the presence of magnetic field gradients to derive parameters that reflect the translational mobility of the water molecules in tissues. If diffusion‐weighted images with different values of b matrix are acquired during one individual investigation, it is possible to calculate apparent diffusion coefficient maps that are the elements of the diffusion tensor. The diffusion tensor elements represent the apparent diffusion coefficient of protons of water molecules in each pixel in the corresponding sample. The relation between signal intensity in the diffusion‐weighted images, diffusion tensor, and b matrix is derived from the Bloch equations. Our goal is to establish the magnitude of the error made in the calculation of the elements of the diffusion tensor when the imaging gradients are ignored. PACS number(s): 87.57. –s, 87.61.–c PMID:11602015
Biomaterials and Culture Technologies for Regenerative Therapy of Liver Tissue.
Perez, Roman A; Jung, Cho-Rok; Kim, Hae-Won
2017-01-01
Regenerative approach has emerged to substitute the current extracorporeal technologies for the treatment of diseased and damaged liver tissue. This is based on the use of biomaterials that modulate the responses of hepatic cells through the unique matrix properties tuned to recapitulate regenerative functions. Cells in liver preserve their phenotype or differentiate through the interactions with extracellular matrix molecules. Therefore, the intrinsic properties of the engineered biomaterials, such as stiffness and surface topography, need to be tailored to induce appropriate cellular functions. The matrix physical stimuli can be combined with biochemical cues, such as immobilized functional groups or the delivered actions of signaling molecules. Furthermore, the external modulation of cells, through cocultures with nonparenchymal cells (e.g., endothelial cells) that can signal bioactive molecules, is another promising avenue to regenerate liver tissue. This review disseminates the recent approaches of regenerating liver tissue, with a focus on the development of biomaterials and the related culture technologies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Akhmanova, Maria; Osidak, Egor; Domogatsky, Sergey; Rodin, Sergey; Domogatskaya, Anna
2015-01-01
Extracellular matrix can influence stem cell choices, such as self-renewal, quiescence, migration, proliferation, phenotype maintenance, differentiation, or apoptosis. Three aspects of extracellular matrix were extensively studied during the last decade: physical properties, spatial presentation of adhesive epitopes, and molecular complexity. Over 15 different parameters have been shown to influence stem cell choices. Physical aspects include stiffness (or elasticity), viscoelasticity, pore size, porosity, amplitude and frequency of static and dynamic deformations applied to the matrix. Spatial aspects include scaffold dimensionality (2D or 3D) and thickness; cell polarity; area, shape, and microscale topography of cell adhesion surface; epitope concentration, epitope clustering characteristics (number of epitopes per cluster, spacing between epitopes within cluster, spacing between separate clusters, cluster patterns, and level of disorder in epitope arrangement), and nanotopography. Biochemical characteristics of natural extracellular matrix molecules regard diversity and structural complexity of matrix molecules, affinity and specificity of epitope interaction with cell receptors, role of non-affinity domains, complexity of supramolecular organization, and co-signaling by growth factors or matrix epitopes. Synergy between several matrix aspects enables stem cells to retain their function in vivo and may be a key to generation of long-term, robust, and effective in vitro stem cell culture systems. PMID:26351461
NASA Astrophysics Data System (ADS)
Markushin, Y.; Sivakumar, P.; Melikechi, N.; Boukari, H.
2018-02-01
We report femtosecond Laser-induced Breakdown Spectroscopy (fs-LIBS) measurements on several amino acids (Serine, Glutamine, and Cysteine) and Albumin protein solutions mixed with Ficoll polysaccharide at different proportions. The goal is to assess the effects of a host matrix on the identification and spectral characterization of amino acids by fs-LIBS. fs-LIBS utilizes an intense short laser pulse to obliterate a sample into basic constituents and to record the emission spectrum of atoms, ions, and molecules in the cooling down of the plasma plume. Several spectral peaks associated primarily with elemental composition of a sample were observed in the fs-LIBS spectra in a range from 200 to 950 nm. In addition, some molecular information associated with diatomic vibrational modes in certain molecules such as C-C and C-N were also obtained. The presence of Ficoll affects the relative intensity and broadening of the CN band, which could be considered as signatures of the amino acids. The fs-LIBS data and their analysis compare favorably with those derived from Fourier Transform Infrared Spectroscopy (FTIR). Interpretation of the spectral information enclosed in the emission of the diatomic molecules during laser ablation may lead to a better understanding of plume chemistry with a direct consequence on chemical analysis of complex samples such as amino acids. Altogether, the results demonstrate the potential of fs-LIBS technique as a detection method of biomolecules and for probing interactions of these biomolecules with a host matrix.
Lo, Kevin W-H; Ulery, Bret D; Kan, Ho Man; Ashe, Keshia M; Laurencin, Cato T
2014-09-01
Osteoblast cell adhesion and differentiation on biomaterials are important achievements necessary for implants to be useful in bone regenerative engineering. Recombinant bone morphogenetic proteins (BMPs) have been shown to be important for these processes; however, there are many challenges associated with the widespread use of these proteins. A recent report demonstrated that the small molecule phenamil, a diuretic derivative, was able to induce osteoblast differentiation and mineralization in vitro via the canonical BMP signalling cascade (Park et al., 2009). In this study, the feasibility of using phenamil as a novel biofactor in conjunction with a biodegradable poly(lactide-co-glycolide acid) (PLAGA) polymeric scaffold for engineering bone tissue was evaluated. The in vitro cellular behaviour of osteoblast-like MC3T3-E1 cells cultured on PLAGA scaffolds in the presence of phenamil at 10 μM were characterized with regard to initial cell adhesion, proliferation, alkaline phosphatase (ALP) activity and matrix mineralization. The results demonstrate that phenamil supported cell proliferation, promoted ALP activity and facilitated matrix mineralization of osteoblast-like MC3T3-E1 cells. Moreover, in this study, we found that phenamil promoted integrin-mediated cell adhesion on PLAGA scaffolds. It was also shown that phenamil encapsulated within porous, microsphere PLAGA scaffolds retained its osteogenic activity upon release. Based on these findings, the small molecule phenamil has the potential to serve as a novel biofactor for the repair and regeneration of bone tissues. Copyright © 2012 John Wiley & Sons, Ltd.
Skandalis, Spyros S; Afratis, Nikolaos; Smirlaki, Gianna; Nikitovic, Dragana; Theocharis, Achilleas D; Tzanakakis, George N; Karamanos, Nikos K
2014-04-01
In hormone-dependent breast cancer, estrogen receptors are the principal signaling molecules that regulate several cell functions either by the genomic pathway acting directly as transcription factors in the nucleus or by the non-genomic pathway interacting with other receptors and their adjacent pathways like EGFR/IGFR. It is well established in literature that EGFR and IGFR signaling pathways promote cell proliferation and differentiation. Moreover, recent data indicate the cross-talk between ERs and EGFR/IGFR signaling pathways causing a transformation of cell functions as well as deregulation on normal expression pattern of matrix molecules. Specifically, proteoglycans, a major category of extracellular matrix (ECM) and cell surface macromolecules, are modified during malignancy and cause alterations in cancer cell signaling, affecting eventually functional cell properties such as proliferation, adhesion and migration. The on-going strategies to block only one of the above signaling effectors result cancer cells to overcome such inactivation using alternative signaling pathways. In this article, we therefore review the underlying mechanisms in respect to the role of ERs and the involvement of cross-talk between ERs, IGFR and EGFR in breast cancer cell properties and expression of extracellular secreted and cell bound proteoglycans involved in cancer progression. Understanding such signaling pathways may help to establish new potential pharmacological targets in terms of using ECM molecules to design novel anticancer therapies. © 2013. Published by Elsevier B.V. All rights reserved.
Øvergård, Aina-Cathrine; Eichner, Christiane; Nilsen, Frank; Dalvin, Sussie
2017-04-01
Heme peroxidases are the most abundant type of peroxidase catalyzing a H 2 O 2 -dependent oxidation of a wide variety of substrates. They are involved in numerous processes like the innate immune response, hormone and prostaglandin synthesis and crosslinking of proteins within extracellular matrixes (ECM) as well as molecules within the cuticle and chorion of arthropods and nematodes. In the present study, a Lepeophtheirus salmonis heme peroxidase (LsHPX) 1 was characterized. Amino acids in the active site of heme peroxidases were conserved, and the predicted protein sequence showed the highest similarity to genes annotated as chorion peroxidases and genes suggested to be involved in cuticle hardening or adhesion. LsHPX1 exhibited a dynamic expression during ontogenesis and during the nauplius molting cycle. Transcripts were localized to muscle cells near the muscle-tendon junction, in nerve tissue especially at neuromuscular junctions, subcuticular epithelium, subepithelial cells facing the hemolymph, exocrine glands within the subepithelial tissue and in isolated cells within the testis. Knock-down of LsHPX1 in nauplius larvae decreased the swimming activity of emerging copepodids. Histological analysis of knock-down animals revealed increased spacing between myofibers and changes in subepithelial and exocrine gland tissue. Considering these results, the potential role of LsHPX1 in crosslinking molecules of salmon louse ECMs is discussed. Copyright © 2017 Elsevier Inc. All rights reserved.
Block copolymer templated self-assembly of disk-shaped molecules
NASA Astrophysics Data System (ADS)
Aragones, J. L.; Alexander-Katz, A.
2017-08-01
Stacking of disk-shaped organic molecules is a promising strategy to develop electronic and photovoltaic devices. Here, we investigate the capability of a soft block copolymer matrix that microphase separates into a cylindrical phase to direct the self-assembly of disk-shaped molecules by means of molecular simulations. We show that two disk molecules confined in the cylinder domain experience a depletion force, induced by the polymer chains, which results in the formation of stacks of disks. This entropic interaction and the soft confinement provided by the matrix are both responsible for the structures that can be self-assembled, which include slanted or columnar stacks. In addition, we evidence the transmission of stresses between the different minority domains of the microphase, which results in the establishment of a long-ranged interaction between disk molecules embedded in different domains; this interaction is of the order of the microphase periodicity and may be exploited to direct assembly of disks at larger scales.
Mandal, Arundhoti; Singha, Monisha; Addy, Partha Sarathi; Basak, Amit
2017-10-13
The MALDI-based mass spectrometry, over the last three decades, has become an important analytical tool. It is a gentle ionization technique, usually applicable to detect and characterize analytes with high molecular weights like proteins and other macromolecules. The earlier difficulty of detection of analytes with low molecular weights like small organic molecules and metal ion complexes with this technique arose due to the cluster of peaks in the low molecular weight region generated from the matrix. To detect such molecules and metal ion complexes, a four-prong strategy has been developed. These include use of alternate matrix materials, employment of new surface materials that require no matrix, use of metabolites that directly absorb the laser light, and the laser-absorbing label-assisted LDI-MS (popularly known as LALDI-MS). This review will highlight the developments with all these strategies with a special emphasis on LALDI-MS. © 2017 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Pasang, T.; Ranganathaiah, C.
2015-06-01
The technique of imprinting molecules of various sizes in a stable structure of polymer matrix has derived multitudes of applications. Once the template molecule is extracted from the polymer matrix, it leaves behind a cavity which is physically (size and shape) and chemically (functional binding site) compatible to the particular template molecule. Positron Annihilation Lifetime Spectroscopy (PALS) is a well known technique to measure cavity sizes precisely in the nanoscale and is not being used in the field of MIPs effectively. This method is capable of measuring nanopores and hence suitable to understand the physical selectivity of the MIPs better. With this idea in mind, we have prepared molecular imprinted polymers (MIPs) with methacrylicacid (MAA) as monomer and EGDMA as cross linker in different molar ratio for three different size template molecules, viz. 4-Chlorophenol (4CP)(2.29 Å), 2-Nephthol (2NP) (3.36 Å) and Phenolphthalein (PP) (4.47Å). FTIR and the dye chemical reactions are used to confirm the complete extraction of the template molecules from the polymer matrix. The free volume size and its distribution have been derived from the measured o-Ps lifetime spectra. Based on the free volume distribution analysis, the percentage of functional cavities for the three template molecules are determined. Percentage of functional binding cavities for 4-CP molecules has been found out to be 70.2% and the rest are native cavities. Similarly for 2NP it is 81.5% and nearly 100% for PP. Therefore, PALS method proves to be very precise and accurate for determining the physical selectivity of MIPs.
Cosić, Sanda Jelisavac; Kovac, Zdenko
2011-01-01
Pericellular proteolysis is a cascade process involved in degradation of extracellular matrix. This process is included in various physiological and pathological processes. Pericellullar proteolysis has major functions like degradation of tissue stroma and weakening of intercellular connections but it also has a function in the synthesis of bioactive molecules (cytokines, growth factors and inhibitory factors). Plasminogen system is involved in fibrinolysis and starts metalloproteinase activation. Activity of proteolytic molecules is controlled by the rate of zymogenic activation, half-life of molecules, and action of inhibitory molecules. Inhibition is achieved through direct binding of inhibitor and enzyme and takes a few steps. Pericellular proteolysis is involved in tumor invasion and metastasis, inflammatory reaction, degenerative diseases and other diseases. Pathophysiological regulation of pericellular proteolysis in mentioned diseases contributes to clinical properties of diseases and has diagnostic and therapeutic importance.
Efficient optical nonlinear Langmuir-Blodgett films: roles of matrix molecules
NASA Astrophysics Data System (ADS)
Ma, Shihong; Lu, Xingze; Liu, Liying; Han, Kui; Wang, Wencheng; Zhang, Zhi-Ming
1996-10-01
A novel bifat-chain amphiphilic molecule nitrogencrown (NC) was adopted as an inert material for fabrication of optical nonlinear Langmuir-Blodgett (LB) multilayers. Structural improvement in the Z-type mixed fullerene derivative (C60-Be)/NC LB multilayers samples was realized by insertion of the C60-Be molecules between two hydrophobic chains of the NC molecules. The relatively large third-order susceptibility (chi) (3)xxxx(- 3(omega) ;(omega) ,(omega) ,(omega) ) equals 2.9 multiplied by 10-19 M2V-2 (or 2.1 multiplied by 10-11 esu) was deduced by measuring third harmonic generation (THG) from the C60-Be samples. The second harmonic generation (SHG) intensity increased quadratically with the bilayer number (up to 116 bilayers) in Y-type hemicyanine (HEM)/NC interleaving LB multilayers due to improvement of the structural properties by insertion of the long hydrophobic tail of HEM molecules between two chains of NC molecules. The second-order susceptibility (chi) (2)zxx(-2(omega) ;(omega) ,(omega) ) equals 18 pM V-1 (or 4.35 multiplied by 10-8 esu) was obtained by measuring SHG from the HEM samples. The NC molecule has attractive features as a matrix material in fabrications of LB multilayers made from optically nonlinear materials with hydrophobic long tails or ball-like molecules.
Butler, G S; Overall, C M
2007-01-01
We illustrate the use of quantitative proteomics, namely isotope-coded affinity tag labelling and tandem mass spectrometry, to assess the targets and effects of the blockade of matrix metalloproteinases by an inhibitor drug in a breast cancer cell culture system. Treatment of MT1-MMP-transfected MDA-MB-231 cells with AG3340 (Prinomastat) directly affected the processing a multitude of matrix metalloproteinase substrates, and indirectly altered the expression of an array of other proteins with diverse functions. Therefore, broad spectrum blockade of MMPs has wide-ranging biological consequences. In this human breast cancer cell line, secreted substrates accumulated uncleaved in the conditioned medium and plasma membrane protein substrates were retained on the cell surface, due to reduced processing and shedding of these proteins (cell surface receptors, growth factors and bioactive molecules) to the medium in the presence of the matrix metalloproteinase inhibitor. Hence, proteomic investigation of drug-perturbed cellular proteomes can identify new protease substrates and at the same time provides valuable information for target validation, drug efficacy and potential side effects prior to commitment to clinical trials.
Matrix metalloproteinases: their biological functions and clinical implications.
Hijova, E
2005-01-01
Matrix metalloproteinases (MMPs), which are also known as matrixins, are proteinases that participate in extracellular matrix remodelling and degradation. Under normal physiological conditions, the activities of MMPs are precisely regulated at the level of transcription, at that of activation of the pro-MMP precursor zymogenes as well as at that of inhibition by endogenous inhibitors (tissue inhibitors of metalloproteinases, TIMPs). Alterations in the regulation of MMP activity are implicated in diseases such as cancer, fibrosis, arthritis and atherosclerosis. The pathological effects of MMPs and TIMPs in cardiovascular diseases involve vascular remodelling, atherosclerotic plaque instability and cardiac remodelling in congestive heart failure or after myocardial infarction. Since excessive tissue remodelling and increased matrix metalloproteinases activity have been demonstrated during atherosclerotic lesion progression (including plaque disruption), MMPs represent a potential target for therapeutic intervention aimed at the modification of vascular pathology by restoring the physiological balance between MMPs and TIMPs. Recent findings suggest that MMPs are also involved in cancer initiation, invasion and metastasis; MMP inhibitors could be considered for evaluation as cancer chemopreventive molecules. This review describes the members of MMP and TIMP families and discusses the structure, function and regulation of MMP activity. (Tab. 1, Ref: 45.)
Wang, Poguang; Giese, Roger W.
2017-01-01
Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) has been used for quantitative analysis of small molecules for many years. It is usually preceded by an LC separation step when complex samples are tested. With the development several years ago of “modern MALDI” (automation, high repetition laser, high resolution peaks), the ease of use and performance of MALDI as a quantitative technique greatly increased. This review focuses on practical aspects of modern MALDI for quantitation of small molecules conducted in an ordinary way (no special reagents, devices or techniques for the spotting step of MALDI), and includes our ordinary, preferred Methods The review is organized as 18 recommendations with accompanying explanations, criticisms and exceptions. PMID:28118972
Density-matrix approach for the electroluminescence of molecules in a scanning tunneling microscope.
Tian, Guangjun; Liu, Ji-Cai; Luo, Yi
2011-04-29
The electroluminescence (EL) of molecules confined inside a nanocavity in the scanning tunneling microscope possesses many intriguing but unexplained features. We present here a general theoretical approach based on the density-matrix formalism to describe the EL from molecules near a metal surface induced by both electron tunneling and localized surface plasmon excitations simultaneously. It reveals the underlying physical mechanism for the external bias dependent EL. The important role played by the localized surface plasmon on the EL is highlighted. Calculations for porphyrin derivatives have reproduced corresponding experimental spectra and nicely explained the observed unusual large variation of emission spectral profiles. This general theoretical approach can find many applications in the design of molecular electronic and photonic devices.
Lončar-Brzak, Božana; Klobučar, Marko; Veliki-Dalić, Irena; Sabol, Ivan; Kraljević Pavelić, Sandra; Krušlin, Božo; Mravak-Stipetić, Marinka
2018-03-01
The aim of this study was to examine molecular alterations on the protein level in lesions of oral lichen planus (OLP), oral squamous cell carcinoma (OSCC) and healthy mucosa. Global protein profiling methods based on liquid chromatography coupled to mass spectrometry (LC-MS) were used, with a special emphasis on evaluation of deregulated extracellular matrix molecules expression, as well as on analyses of IG2F and IGFR2 expression in healthy mucosa, OLP and OSCC tissues by comparative semi-quantitative immunohistochemistry. Mass spectrometry-based proteomics profiling of healthy mucosa, OLP and OSCC tissues (and accompanied histologically unaltered tissues, respectively) identified 55 extracellular matrix proteins. Twenty among identified proteins were common to all groups of samples. Expression of small leucine-rich extracellular matrix proteoglycans lumican and biglycan was found both in OSCC and OLP and they were validated by Western blot analysis as putative biomarkers. A significant increase (p < 0.05) of biglycan expression in OLP-AT group was determined in comparison with OLP-T group, while lumican showed significant up-regulation (p < 0.05) in OLP-T and OSCC-T groups vs. adjacent and control tissue groups. Biglycan expression was only determined in OSCC-AT group. Immunohistochemical analysis of IGF2 and IG2FR expression revealed no significant difference among groups of samples. Biglycan and lumican were identified as important pathogenesis biomarkers of OLP that point to its malignant potential.
Sawyer, Andrew J; Kyriakides, Themis R
2016-02-01
Extracellular matrix is composed of a complex array of molecules that together provide structural and functional support to cells. These properties are mainly mediated by the activity of collagenous and elastic fibers, proteoglycans, and proteins such as fibronectin and laminin. ECM composition is tissue-specific and could include matricellular proteins whose primary role is to modulate cell-matrix interactions. In adults, matricellular proteins are primarily expressed during injury, inflammation and disease. Particularly, they are closely associated with the progression and prognosis of cardiovascular and fibrotic diseases, and cancer. This review aims to provide an overview of the potential use of matricellular proteins in drug delivery including the generation of therapeutic agents based on the properties and structures of these proteins as well as their utility as biomarkers for specific diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
Virtual High-Throughput Screening for Matrix Metalloproteinase Inhibitors.
Choi, Jun Yong; Fuerst, Rita
2017-01-01
Structure-based virtual screening (SBVS) is a common method for the fast identification of hit structures at the beginning of a medicinal chemistry program in drug discovery. The SBVS, described in this manuscript, is focused on finding small molecule hits that can be further utilized as a starting point for the development of inhibitors of matrix metalloproteinase 13 (MMP-13) via structure-based molecular design. We intended to identify a set of structurally diverse hits, which occupy all subsites (S1'-S3', S2, and S3) centering the zinc containing binding site of MMP-13, by the virtual screening of a chemical library comprising more than ten million commercially available compounds. In total, 23 compounds were found as potential MMP-13 inhibitors using Glide docking followed by the analysis of the structural interaction fingerprints (SIFt) of the docked structures.
NASA Astrophysics Data System (ADS)
Vembris, Aivars; Zarins, Elmars; Kokars, Valdis
2017-10-01
Organic solid state lasers are thoughtfully investigated due to their potential applications in communication, sensors, biomedicine, etc. Low amplified spontaneous emission (ASE) excitation threshold value is essential for further use of the material in devices. Intramolecular interaction limits high molecule density load in the matrix. It is the case of the well-known red light emitting laser dye - 4-(dicyanomethylene)-2-methyl-6-(4-dimethylaminostyryl)-4H-pyran (DCM). The lowest ASE threshold value of the mentioned laser dye could be obtained within the concentration range between 2 and 4 wt%. At higher concentration threshold energy drastically increases. In this work optical and ASE properties of three original DCM derivatives in poly(N-vinylcarbazole) (PVK) at various concentrations will be discussed. One of the derivatives is modified DCM dye in which the methyl substituents in the electron donor part have been replaced with bulky trityloxyethyl groups (DWK-1). These sterically significant functional groups do not influence electron transitions in the dye but prevent aggregation of the molecules. The chemical structure of the second investigated compound is similar to DWK-1 where the methyl group is replaced with the tert-butyl substituent (DWK-1TB). The third derivative (DWK-2) consists of two N,N-di(trityloxyethyl)amino electron donor groups. All results were compared with DCM:PVK system. Photoluminescence quantum yield (PLQY) is up to ten times larger for DWK-1TB with respect to DCM systems. Bulky trityloxyethyl groups prevent aggregation of the molecules thus decreasing interaction between dyes and amount of non-radiative decays. The red shift of the photoluminescence and amplified spontaneous emission at higher concentrations were observed due to the solid state solvation effect. The increase of the investigated dye density in the matrix with a smaller reduction in PLQY resulted in low ASE threshold energy. The lowest threshold value was obtained around 21 μJ/cm2 (2.1 kW/cm2) in DWK-1TB:PVK films.
Construction of the Fock Matrix on a Grid-Based Molecular Orbital Basis Using GPGPUs.
Losilla, Sergio A; Watson, Mark A; Aspuru-Guzik, Alán; Sundholm, Dage
2015-05-12
We present a GPGPU implementation of the construction of the Fock matrix in the molecular orbital basis using the fully numerical, grid-based bubbles representation. For a test set of molecules containing up to 90 electrons, the total Hartree-Fock energies obtained from reference GTO-based calculations are reproduced within 10(-4) Eh to 10(-8) Eh for most of the molecules studied. Despite the very large number of arithmetic operations involved, the high performance obtained made the calculations possible on a single Nvidia Tesla K40 GPGPU card.
Controlled release of molecular components of dendrimer/bioactive complexes
Segalman, Daniel J.; Wallace, J. Shield
1998-01-01
A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle.
Controlled release of molecular components of dendrimer/bioactive complexes
Segalman, D.J.; Wallace, J.S.
1998-08-18
A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle. 13 figs.
Liu, Tong; Song, Deli; Dong, Jianzeng; Zhu, Pinghui; Liu, Jie; Liu, Wei; Ma, Xiaohai; Zhao, Lei; Ling, Shukuan
2017-01-01
Myocardial fibrosis is an important part of cardiac remodeling that leads to heart failure and death. Myocardial fibrosis results from increased myofibroblast activity and excessive extracellular matrix deposition. Various cells and molecules are involved in this process, providing targets for potential drug therapies. Currently, the main detection methods of myocardial fibrosis rely on serum markers, cardiac magnetic resonance imaging, and endomyocardial biopsy. This review summarizes our current knowledge regarding the pathophysiology, quantitative assessment, and novel therapeutic strategies of myocardial fibrosis. PMID:28484397
Bräuer, Björn; Vaynzof, Yana; Zhao, Wei; Kahn, Antoine; Li, Wen; Zahn, Dietrich R T; Fernández, César de Julián; Sangregorio, Claudio; Salvan, Georgeta
2009-04-09
Ni nanoparticles with a size distribution from 2 to 6 nm, embedded in various organic matrices, were fabricated in ultrahigh vacuum. For this purpose metal free and Ni phthalocyanine, fullerene C(60), and pentacene were coevaporated with Ni. When coevaporated, Ni and H(2)Pc react, leading to the formation of NiPc and Ni nanoparticles. The molecular structure of the matrix was found to have negligible effect on the size of the nanoparticles but to influence the magnetic anisotropy of the nanoparticles: Ni nanoparticles formed in the buckyball matrix have a cubic symmetry, while nanoparticles formed in matrices consisting of planar molecules exhibit a uniaxial symmetry. After exposure to atmosphere, photoelectron spectroscopy investigations demonstrate the presence of metallic Ni nanoparticles accompanied by Ni oxide and the existence of a charge transfer from the organic matrix to the particles in all investigated systems. The oxidized Ni nanoparticles exhibit a larger magnetic anisotropy compared to the freshly prepared particles which show superparamagnetic properties above 17 K. Moreover, photoelectron spectroscopy was used to probe the oxidation process of the Ni nanoparticles in different organic matrices. It could thus be shown that a matrix consisting of spherical molecules like C(60) prevent the particles much better from oxidation compared to matrices of flat molecules.
Effects of osmotic pressure in the extracellular matrix on tissue deformation.
Lu, Y; Parker, K H; Wang, W
2006-06-15
In soft tissues, large molecules such as proteoglycans trapped in the extracellular matrix (ECM) generate high levels of osmotic pressure to counter-balance external pressures. The semi-permeable matrix and fixed negative charges on these molecules serve to promote the swelling of tissues when there is an imbalance of molecular concentrations. Structural molecules, such as collagen fibres, form a network of stretch-resistant matrix, which prevents tissue from over-swelling and keeps tissue integrity. However, collagen makes little contribution to load bearing; the osmotic pressure in the ECM is the main contributor balancing external pressures. Although there have been a number of studies on tissue deformation, there is no rigorous analysis focusing on the contribution of the osmotic pressure in the ECM on the viscoelastic behaviour of soft tissues. Furthermore, most previous works were carried out based on the assumption of infinitesimal deformation, whereas tissue deformation is finite under physiological conditions. In the current study, a simplified mathematical model is proposed. Analytic solutions for solute distribution in the ECM and the free-moving boundary were derived by solving integro-differential equations under constant and dynamic loading conditions. Osmotic pressure in the ECM is found to contribute significantly to the viscoelastic characteristics of soft tissues during their deformation.
A generalized graph-theoretical matrix of heterosystems and its application to the VMV procedure.
Mozrzymas, Anna
2011-12-14
The extensions of generalized (molecular) graph-theoretical matrix and vector-matrix-vector procedure are considered. The elements of the generalized matrix are redefined in order to describe molecules containing heteroatoms and multiple bonds. The adjacency, distance, detour and reciprocal distance matrices of heterosystems, and corresponding vectors are derived from newly defined generalized graph matrix. The topological indices, which are most widely used in predicting physicochemical and biological properties/activities of various compounds, can be calculated from the new generalized vector-matrix-vector invariant. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ito, Shinya; Ogawa, Koji; Takeuchi, Koh; Takagi, Motoki; Yoshida, Masahito; Hirokawa, Takatsugu; Hirayama, Shoshiro; Shin-Ya, Kazuo; Shimada, Ichio; Doi, Takayuki; Goshima, Naoki; Natsume, Tohru; Nagata, Kazuhiro
2017-12-08
Fibrosis can disrupt tissue structure and integrity and impair organ function. Fibrosis is characterized by abnormal collagen accumulation in the extracellular matrix. Pharmacological inhibition of collagen secretion therefore represents a promising strategy for the management of fibrotic disorders, such as liver and lung fibrosis. Hsp47 is an endoplasmic reticulum (ER)-resident collagen-specific molecular chaperone essential for correct folding of procollagen in the ER. Genetic deletion of Hsp47 or inhibition of its interaction with procollagen interferes with procollagen triple helix production, which vastly reduces procollagen secretion from fibroblasts. Thus, Hsp47 could be a potential and promising target for the management of fibrosis. In this study, we screened small-molecule compounds that inhibit the interaction of Hsp47 with collagen from chemical libraries using surface plasmon resonance (BIAcore), and we found a molecule AK778 and its cleavage product Col003 competitively inhibited the interaction and caused the inhibition of collagen secretion by destabilizing the collagen triple helix. Structural information obtained with NMR analysis revealed that Col003 competitively binds to the collagen-binding site on Hsp47. We propose that these structural insights could provide a basis for designing more effective therapeutic drugs for managing fibrosis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed
2014-01-01
Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699
Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed
2014-01-01
Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.
Gene Expression Profiling of the Intact Dermal Sheath Cup of Human Hair Follicles.
Niiyama, Shiro; Ishimatsu-Tsuji, Yumiko; Nakazawa, Yosuke; Yoshida, Yuzo; Soma, Tsutomu; Ideta, Ritsuro; Mukai, Hideki; Kishimoto, Jiro
2018-04-24
Cells that constitute the dermal papillae of hair follicles might be derived from the dermal sheath, the peribulbar component of which is the dermal sheath cup. The dermal sheath cup is thought to include the progenitor cells of the dermal papillae and possesses hair inductive potential; however, it has not yet been well characterized. This study investigated the gene expression profile of the intact dermal sheath cup, and identified dermal sheath cup signature genes, including extracellular matrix components and BMP-binding molecules, as well as TGF-b1 as an upstream regulator. Among these, GREM2, a member of the BMP antagonists, was found by in situ hybridization to be highly specific to the dermal sheath cup, implying that GREM2 is a key molecule contributing to maintenance of the properties of the dermal sheath cup.
NASA Astrophysics Data System (ADS)
Justino, Licínia L. G.; Reva, Igor; Fausto, Rui
2016-07-01
Near-infrared (near-IR) narrowband selective vibrational excitation and annealing of gallic acid (3,4,5-trihydroxybenzoic acid) isolated in cryogenic matrices were used to induce interconversions between its most stable conformers. The isomerizations were probed by infrared spectroscopy. An extensive set of quantum chemical calculations, carried out at the DFT(B3LYP)/6-311++G(d,p) level of approximation, was used to undertake a detailed analysis of the ground state potential energy surface of the molecule. This investigation of the molecule conformational space allowed extracting mechanistic insights into the observed annealing- or near-IR-induced isomerization processes. The infrared spectra of the two most stable conformers of gallic acid in N2, Xe, and Ar matrices were fully assigned. Finally, the UV-induced photochemistry of the matrix isolated compound was investigated.
Dahl, Russell; Sergienko, Eduard A.; Mostofi, Yalda S.; Yang, Li; Su, Ying; Simao, Ana Maria; Narisawa, Sonoko; Brown, Brock; Mangravita-Novo, Arianna; Vicchiarelli, Michael; Smith, Layton H.; O’Neill, W. Charles; Millán, José Luis; Cosford, Nicholas D. P.
2009-01-01
We report the characterization and optimization of drug-like small molecule inhibitors of tissue-nonspecific alkaline phosphatase (TNAP), an enzyme critical for the regulation of extracellular matrix calcification during bone formation and growth. High-throughput screening (HTS) of a small molecule library led to the identification of arylsulfonamides as potent and selective inhibitors of TNAP. Critical structural requirements for activity were determined, and the compounds were subsequently profiled for in vitro activity and bioavailability parameters including metabolic stability and permeability. The plasma levels following subcutaneous administration of a member of the lead series in rat was determined, demonstrating the potential of these TNAP inhibitors as systemically active therapeutic agents to target various diseases involving soft tissue calcification. A representative member of the series was also characterized in mechanistic and kinetic studies. PMID:19821572
Nano Sponges for Drug Delivery and Medicinal Applications
NASA Technical Reports Server (NTRS)
Tour, James M.; Lucente-Schultz, Rebecca; Leonard, Ashley; Kosynkin, Dimitry V.; Price, Brandi Katherine; Hudson, Jared L.; Conyers, Jodie L., Jr.; Moore, Valerie C.; Casscells, S. Ward; Myers, Jeffrey N.;
2012-01-01
This invention is a means of delivering a drug, or payload, to cells using non-covalent associations of the payload with nano-engineered scaffolds; specifically, functionalized single-walled carbon nanotubes (SWNTs) and their derivatives where the payload is effectively sequestered by the nanotube's addends and then delivered to the site (often interior of a cell) of interest. Polyethylene glycol (PEG) and other water-soluble organic molecules have been shown to greatly enhance the solubility of SWNTs in water. PEG groups and other water-solubilizing addends can act to sequester (sponge) molecules and deliver them into cells. Using PEG that, when attached to the SWNTs, the SWNT/PEG matrix will enter cells has been demonstrated. This was visualized by the addition of fluorescein isothiocyanate (FITC) to the SWNT/PEG matrix. Control studies showed that both FITC alone and FITC/PEG did not enter the cells. These observations suggest that the FITC is highly associated with the SWNT/PEG matrix that brings the FITC into the cells, allowing visualization of SWNTs in cells. The FITC is not covalently attached, because extended dialysis in hot DMF will remove all fluorescence quickly (one week). However, prolonged dialysis in water (1-2 months) will only slowly diminish the fluorescence. This demonstrates that the SWNT/PEG matrix solubilizes the FITC by sequestering it from the surrounding water and into the more solubilizing organic environment of the SWNT/PEG matrix of this type. This can be extended for the sequestering of other molecules such as drugs with PEG and other surfactants.
Semistochastic approach to many electron systems
NASA Astrophysics Data System (ADS)
Grossjean, M. K.; Grossjean, M. F.; Schulten, K.; Tavan, P.
1992-08-01
A Pariser-Parr-Pople (PPP) Hamiltonian of an 8π electron system of the molecule octatetraene, represented in a configuration-interaction basis (CI basis), is analyzed with respect to the statistical properties of its matrix elements. Based on this analysis we develop an effective Hamiltonian, which represents virtual excitations by a Gaussian orthogonal ensemble (GOE). We also examine numerical approaches which replace the original Hamiltonian by a semistochastically generated CI matrix. In that CI matrix, the matrix elements of high energy excitations are choosen randomly according to distributions reflecting the statistics of the original CI matrix.
Therapeutic Potential of Matrix Metalloproteinase Inhibition in Breast Cancer
Raeeszadeh‐Sarmazdeh, Maryam; Radisky, Derek C.
2017-01-01
ABSTRACT Matrix metalloproteinases (MMPs) are a family of zinc endopeptidases that cleave nearly all components of the extracellular matrix as well as many other soluble and cell‐associated proteins. MMPs have been implicated in normal physiological processes, including development, and in the acquisition and progression of the malignant phenotype. Disappointing results from a series of clinical trials testing small molecule, broad spectrum MMP inhibitors as cancer therapeutics led to a re‐evaluation of how MMPs function in the tumor microenvironment, and ongoing research continues to reveal that these proteins play complex roles in cancer development and progression. It is now clear that effective targeting of MMPs for therapeutic benefit will require selective inhibition of specific MMPs. Here, we provide an overview of the MMP family and its biological regulators, the tissue inhibitors of metalloproteinases (TIMPs). We then summarize recent research from model systems that elucidate how specific MMPs drive the malignant phenotype of breast cancer cells, including acquisition of cancer stem cell features and induction of the epithelial–mesenchymal transition, and we also outline clinical studies that implicate specific MMPs in breast cancer outcomes. We conclude by discussing ongoing strategies for development of inhibitors with therapeutic potential that are capable of selectively targeting the MMPs most responsible for tumor promotion, with special consideration of the potential of biologics including antibodies and engineered proteins based on the TIMP scaffold. J. Cell. Biochem. 118: 3531–3548, 2017. © 2017 The Authors. Journal of Cellular Biochemistry Published by Wiley Periodicals, Inc. PMID:28585723
Small Molecule Inhibitors Target the Tissue Transglutaminase and Fibronectin Interaction
Yakubov, Bakhtiyor; Chen, Lan; Belkin, Alexey M.; Zhang, Sheng; Chelladurai, Bhadrani; Zhang, Zhong-Yin; Matei, Daniela
2014-01-01
Tissue transglutaminase (TG2) mediates protein crosslinking through generation of ε−(γ-glutamyl) lysine isopeptide bonds and promotes cell adhesion through interaction with fibronectin (FN) and integrins. Cell adhesion to the peritoneal matrix regulated by TG2 facilitates ovarian cancer dissemination. Therefore, disruption of the TG2-FN complex by small molecules may inhibit cell adhesion and metastasis. A novel high throughput screening (HTS) assay based on AlphaLISA™ technology was developed to measure the formation of a complex between His-TG2 and the biotinylated FN fragment that binds TG2 and to discover small molecules that inhibit this protein-protein interaction. Several hits were identified from 10,000 compounds screened. The top candidates selected based on >70% inhibition of the TG2/FN complex formation were confirmed by using ELISA and bioassays measuring cell adhesion, migration, invasion, and proliferation. In conclusion, the AlphaLISA bead format assay measuring the TG2-FN interaction is robust and suitable for HTS of small molecules. One compound identified from the screen (TG53) potently inhibited ovarian cancer cell adhesion to FN, cell migration, and invasion and could be further developed as a potential inhibitor for ovarian cancer dissemination. PMID:24586660
LIAD-fs scheme for studies of ultrafast laser interactions with gas phase biomolecules.
Calvert, C R; Belshaw, L; Duffy, M J; Kelly, O; King, R B; Smyth, A G; Kelly, T J; Costello, J T; Timson, D J; Bryan, W A; Kierspel, T; Rice, P; Turcu, I C E; Cacho, C M; Springate, E; Williams, I D; Greenwood, J B
2012-05-14
Laser induced acoustic desorption (LIAD) has been used for the first time to study the parent ion production and fragmentation mechanisms of a biological molecule in an intense femtosecond (fs) laser field. The photoacoustic shock wave generated in the analyte substrate (thin Ta foil) has been simulated using the hydrodynamic HYADES code, and the full LIAD process has been experimentally characterised as a function of the desorption UV-laser pulse parameters. Observed neutral plumes of densities >10(9) cm(-3) which are free from solvent or matrix contamination demonstrate the suitability and potential of the source for studying ultrafast dynamics in the gas phase using fs laser pulses. Results obtained with phenylalanine show that through manipulation of fundamental femtosecond laser parameters (such as pulse length, intensity and wavelength), energy deposition within the molecule can be controlled to allow enhancement of parent ion production or generation of characteristic fragmentation patterns. In particular by reducing the pulse length to a timescale equivalent to the fastest vibrational periods in the molecule, we demonstrate how fragmentation of the molecule can be minimised whilst maintaining a high ionisation efficiency. This journal is © the Owner Societies 2012
Liu, Yang; Zhang, Yu; Chen, Shao-Nong; Friesen, J Brent; Nikolić, Dejan; Choules, Mary P; McAlpine, James B; Lankin, David C; Gemeinhart, Richard A; Pauli, Guido F
2018-06-01
Natural Deep Eutectic Solvent (NADES) species can exhibit unexpected solubilizing power for lipophilic molecules despite their simple composition: hydrophilic organic molecules and water. In the present study, the unique properties of NADES species were applied in combination with a model polymer system: a hydrophilic chitosan/alginate hydrogel. Briefly, NADES species (e.g., mannose-dimethylurea-water, 2:5:5, mole/mole) formed matrices to 1) dissolve lipophilic molecules (e.g., curcumin), 2) load lipophilic molecule(s) into the hydrogel, and 3) spontaneously vacate from the system. NADES species ubiquitously occur in natural sources, and a crude extract is a mixture of the NADES species and bioactive metabolites. Based on these ideas, we hypothesized that the crude extract may also allow the loading of natural bioactive molecules from a natural NADES species into (bio)hydrogel systems. To evaluate this hypothesis in vitro, Schisandra chinensis fruit extract was chosen as a representative mixture of lipophilic botanical molecules and hydrophilic NADES species. The results showed that the NADES matrix of S. chinensis was capable of loading at least three bioactive lignans (i.e., gomisin A, gomisin J, and angeloylgomisin H) into the polymer system. The lipophilic metabolites can subsequently be released from the hydrogel. The outcomes suggest that a unique drug delivery mechanism may exist in nature, thereby potentially improving the bioavailability of lipophilic metabolites through physicochemical interactions with the NADES. Copyright © 2018 Elsevier B.V. All rights reserved.
Fibronectin-tethered graphene oxide as an artificial matrix for osteogenesis.
Subbiah, Ramesh; Du, Ping; Van, Se Young; Suhaeri, Muhammad; Hwang, Mintai P; Lee, Kangwon; Park, Kwideok
2014-10-20
An artificial matrix (Fn-Tigra), consisting of graphene oxide (GO) and fibronectin (Fn), is developed on pure titanium (Ti) substrates via an electrodropping technique assisted with a custom-made coaxial needle. The morphology and topography of the resulting artificial matrix is orderly aligned and composed of porous microcavities. In addition, Fn is homogenously distributed and firmly bound onto GO as determined via immunofluorescence and elemental mapping, respectively. The artificial matrix is moderately hydrophobic (63.7°), and exhibits an average roughness of 546 nm and a Young's modulus (E) of approximately 4.8 GPa. The biocompatibility, cellular behavior, and osteogenic potential of preosteoblasts on Fn-Tigra are compared to those of cells cultured on Ti and Ti-GO (Tigra). Cell proliferation and viability are significantly higher on Fn-Tigra and Tigra than that of cells grown on Ti. Focal adhesion molecule (vinculin) expression is highly activated at the central and peripheral area of preosteoblasts when cultured on Fn-Tigra. Furthermore, we demonstrate enhanced in vitro osteogenic differentiation of preosteoblasts cultured on Fn-Tigra over those cultured on bare Ti, as determined via Alizarin red and von Kossa staining, and the analysis of osteocalcin, type I collagen, alkaline phosphatase activity, and calcium contents. Finally, we investigate the biophysical and biomechanical properties of the cells using AFM. While the height and roughness of preosteoblasts increased with time, cell surface area decreased during in vitro osteogenesis over 2 weeks. In addition, the E of cells cultured on Tigra and Fn-Tigra increase in a statistically significant and time-dependent manner by 30%, while those cultured on bare Ti retain a relatively consistent E. In summary, we engineer a biocompatible artificial matrix (Fn-Tigra) capable of osteogenic induction and consequently demonstrate its potential in bone tissue engineering applications.
Extracellular matrix biomimicry for the creation of investigational and therapeutic devices.
Pellowe, Amanda S; Gonzalez, Anjelica L
2016-01-01
The extracellular matrix (ECM) is a web of fibrous proteins that serves as a scaffold for tissues and organs, and is important for maintaining homeostasis and facilitating cellular adhesion. Integrin transmembrane receptors are the primary adhesion molecules that anchor cells to the ECM, thus integrating cells with their microenvironments. Integrins play a critical role in facilitating cell-matrix interactions and promoting signal transduction, both from the cell to the ECM and vice versa, ultimately mediating cell behavior. For this reason, many advanced biomaterials employ biomimicry by replicating the form and function of fibrous ECM proteins. The ECM also acts as a reservoir for small molecules and growth factors, wherein fibrous proteins directly bind and present these bioactive moieties that facilitate cell activity. Therefore biomimicry can be enhanced by incorporating small molecules into ECM-like substrates. Biomimetic ECM materials have served as invaluable research tools for studying interactions between cells and the surrounding ECM, revealing that cell-matrix signaling is driven by mechanical forces, integrin engagement, and small molecules. Mimicking pathological ECMs has also elucidated disease specific cell behaviors. For example, biomimetic tumor microenvironments have been used to induce metastatic cell behaviors, and have thereby shown promise for in vitro cancer drug testing and targeting. Further, ECM-like substrates have been successfully employed for autologous cell recolonization for tissue engineering and wound healing. As we continue to learn more about the mechanical and biochemical characteristics of the ECM, these properties can be harnessed to develop new biomaterials, biomedical devices, and therapeutics. © 2015 Wiley Periodicals, Inc.
Reilly, Peter T. A. [Knoxville, TN; Harris, William A [Naperville, IL
2010-03-02
A matrix assisted laser desorption/ionization (MALDI) method and related system for analyzing high molecular weight analytes includes the steps of providing at least one matrix-containing particle inside an ion trap, wherein at least one high molecular weight analyte molecule is provided within the matrix-containing particle, and MALDI on the high molecular weight particle while within the ion trap. A laser power used for ionization is sufficient to completely vaporize the particle and form at least one high molecular weight analyte ion, but is low enough to avoid fragmenting the high molecular weight analyte ion. The high molecular weight analyte ion is extracted out from the ion trap, and is then analyzed using a detector. The detector is preferably a pyrolyzing and ionizing detector.
Functional Amyloids Keep Quorum-sensing Molecules in Check*
Seviour, Thomas; Hansen, Susan Hove; Yang, Liang; Yau, Yin Hoe; Wang, Victor Bochuan; Stenvang, Marcel R.; Christiansen, Gunna; Marsili, Enrico; Givskov, Michael; Chen, Yicai; Otzen, Daniel E.; Nielsen, Per Halkjær; Geifman-Shochat, Susana; Kjelleberg, Staffan; Dueholm, Morten S.
2015-01-01
The mechanism by which extracellular metabolites, including redox mediators and quorum-sensing signaling molecules, traffic through the extracellular matrix of biofilms is poorly explored. We hypothesize that functional amyloids, abundant in natural biofilms and possessing hydrophobic domains, retain these metabolites. Using surface plasmon resonance, we demonstrate that the quorum-sensing (QS) molecules, 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone, and the redox mediator pyocyanin bind with transient affinity to functional amyloids from Pseudomonas (Fap). Their high hydrophobicity predisposes them to signal-amyloid interactions, but specific interactions also play a role. Transient interactions allow for rapid association and dissociation kinetics, which make the QS molecules bioavailable and at the same time secure within the extracellular matrix as a consequence of serial bindings. Retention of the QS molecules was confirmed using Pseudomonas aeruginosa PAO1-based 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone reporter assays, showing that Fap fibrils pretreated with the QS molecules activate the reporters even after sequential washes. Pyocyanin retention was validated by electrochemical analysis of pyocyanin-pretreated Fap fibrils subjected to the same washing process. Results suggest that QS molecule-amyloid interactions are probably important in the turbulent environments commonly encountered in natural habitats. PMID:25586180
Performance of the density matrix functional theory in the quantum theory of atoms in molecules.
García-Revilla, Marco; Francisco, E; Costales, A; Martín Pendás, A
2012-02-02
The generalization to arbitrary molecular geometries of the energetic partitioning provided by the atomic virial theorem of the quantum theory of atoms in molecules (QTAIM) leads to an exact and chemically intuitive energy partitioning scheme, the interacting quantum atoms (IQA) approach, that depends on the availability of second-order reduced density matrices (2-RDMs). This work explores the performance of this approach in particular and of the QTAIM in general with approximate 2-RDMs obtained from the density matrix functional theory (DMFT), which rests on the natural expansion (natural orbitals and their corresponding occupation numbers) of the first-order reduced density matrix (1-RDM). A number of these functionals have been implemented in the promolden code and used to perform QTAIM and IQA analyses on several representative molecules and model chemical reactions. Total energies, covalent intra- and interbasin exchange-correlation interactions, as well as localization and delocalization indices have been determined with these functionals from 1-RDMs obtained at different levels of theory. Results are compared to the values computed from the exact 2-RDMs, whenever possible.
NASA Astrophysics Data System (ADS)
Li, Yonghui; Ullrich, Carsten
2013-03-01
The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651
Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua
2016-07-15
Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Assessing the Potential of Metal-Assisted Imaging Mass Spectrometry in Cancer Research.
Dufresne, M; Patterson, N H; Lauzon, N; Chaurand, P
2017-01-01
In the last decade, imaging mass spectrometry (IMS) has been the primary tool for biomolecular imaging. While it is possible to map a wide range of biomolecules using matrix-assisted laser desorption/ionization IMS ranging from high-molecular-weight proteins to small metabolites, more often than not only the most abundant easily ionisable species are detected. To better understand complex diseases such as cancer more specific and sensitive methods need to be developed to enable the detection of lower abundance molecules but also molecules that have yet to be imaged by IMS. In recent years, a big shift has occurred in the imaging community from developing wide reaching methods to developing targeted ones which increases sensitivity through the use of more specific sample preparations. This has been primarily marked by the advent of solvent-free matrix deposition methods for polar lipids, chemical derivatization for hormones and metabolites, and the use of alternative ionization agents for neutral lipids. In this chapter, we discuss two of the latest sample preparations which exploit the use of alternative ionization agents to enable the detection of certain classes of neutral lipids along with free fatty acids by high-sensitivity IMS as demonstrated within our lab. © 2017 Elsevier Inc. All rights reserved.
Study of electron impact inelastic scattering of chlorine molecule (Cl2)
NASA Astrophysics Data System (ADS)
Yadav, Hitesh; Vinodkumar, Minaxi; Limbachiya, Chetan; Vinodkumar, P. C.
2018-02-01
A theoretical study is carried out for electron interactions with the chlorine molecule (Cl2) for incident energies ranging from 0.01 to 5000 eV. This wide range of energy has allowed us to investigate a variety of processes and report data on symmetric excitation energies, dissociative electron attachment (DEA), total excitation cross sections, and ionization cross section (Q ion) along with total inelastic cross sections (Q inel). The present study is important since Cl2 is a prominent gas for plasma etching and its anionic atoms are important in the etching of semiconductor wafers. In order to compute the total inelastic cross sections, we have employed the ab initio R-matrix method (0.01 to 15 eV) together with the spherical complex optical potential method (∼15 to 5000 eV). The R-matrix calculations are performed using a close coupling method, and we have used DEA estimator via Quantemol-N to calculate the DEA fragmentation and cross sections. The present study finds overall good agreement with the available experimental data. Total excitation and inelastic cross sections of e-{{{Cl}}}2 scattering for a wide energy range (0.01 to 5 keV) are reported for the first time, to the best of our knowledge.
Analysis of human articular chondrocyte CD44 isoform expression and function in health and disease.
Salter, D M; Godolphin, J L; Gourlay, M S; Lawson, M F; Hughes, D E; Dunne, E
1996-08-01
Interactions between articular chondrocytes and components of the extracellular matrix are of potential importance in the normal function of cartilage and in the pathophysiology of arthritis. Little is known of the basis of these interactions, but cell adhesive molecules such as CD44 are likely to be involved. Immunohistology using six well-characterized anti-CD44 monoclonal antibodies demonstrated standard CD44 isoform (CD44H) expression by all chondrocytes in normal and osteoarthrotic (OA) cartilage but absence of the CD44E variant. Polymerase chain reaction (PCR) of reverse transcribed mRNA from monolayer cultures of normal and OA chondrocytes using primer sequences which span the region containing variably spliced exons produced a predominant band representing the standard form of CD44, which lacks the variable exons 6-15 (v1-v10). No product was seen at the expected size of the epithelial variant of CD44 (CD44v8-10). Use of exon-specific primers, however, showed expression of variant exons resulting in multiple minor isoforms. Standard CD44 was also shown to be the predominantly expressed isoform identified by immunoprecipitation, but human articular chondrocytes did not adhere to hyaluronan in vitro. Chondrocyte CD44 may function as an adhesion receptor for other matrix molecules such as fibronectin or collagen.
Sanz-Sanz, Cristina; Aguado, Alfredo; Roncero, Octavio; Naumkin, Fedor
2016-01-01
Analytical derivatives and non-adiabatic coupling matrix elements are derived for Hn+ systems (n=3, 4 and 5). The method uses a generalized Hellmann-Feynman theorem applied to a multi-state description based on diatomics-in-molecules (for H3+) or triatomics-in-molecules (for H4+ and H5+) formalisms, corrected with a permutationally invariant many-body term to get high accuracy. The analytical non-adiabatic coupling matrix elements are compared with ab initio calculations performed at multi-reference configuration interaction level. These magnitudes are used to calculate H2(v′=0,j′=0)+H2+(v,j=0) collisions, to determine the effect of electronic transitions using a molecular dynamics method with electronic transitions. Cross sections for several initial vibrational states of H2+ are calculated and compared with the available experimental data, yielding an excellent agreement. The effect of vibrational excitation of H2+ reactant, and its relation with non-adiabatic processes are discussed. Also, the behavior at low collisional energies, in the 1 meV-0.1 eV interval, of interest in astrophysical environments, are discussed in terms of the long range behaviour of the interaction potential which is properly described within the TRIM formalism. PMID:26696058
Seehusen, Frauke; Al-Azreg, Seham A.; Raddatz, Barbara B.; Haist, Verena; Puff, Christina; Spitzbarth, Ingo; Ulrich, Reiner; Baumgärtner, Wolfgang
2016-01-01
In demyelinating diseases, changes in the quality and quantity of the extracellular matrix (ECM) may contribute to demyelination and failure of myelin repair and axonal sprouting, especially in chronic lesions. To characterize changes in the ECM in canine distemper demyelinating leukoencephalitis (DL), histochemical and immunohistochemical investigations of formalin-fixed paraffin-embedded cerebella using azan, picrosirius red and Gomori`s silver stain as well as antibodies directed against aggrecan, type I and IV collagen, fibronectin, laminin and phosphacan showed alterations of the ECM in CDV-infected dogs. A significantly increased amount of aggrecan was detected in early and late white matter lesions. In addition, the positive signal for collagens I and IV as well as fibronectin was significantly increased in late lesions. Conversely, the expression of phosphacan was significantly decreased in early and more pronounced in late lesions compared to controls. Furthermore, a set of genes involved in ECM was extracted from a publically available microarray data set and was analyzed for differential gene expression. Gene expression of ECM molecules, their biosynthesis pathways, and pro-fibrotic factors was mildly up-regulated whereas expression of matrix remodeling enzymes was up-regulated to a relatively higher extent. Summarized, the observed findings indicate that changes in the quality and content of ECM molecules represent important, mainly post-transcriptional features in advanced canine distemper lesions. Considering the insufficiency of morphological regeneration in chronic distemper lesions, the accumulated ECM seems to play a crucial role upon regenerative processes and may explain the relatively small regenerative potential in late stages of this disease. PMID:27441688
Seehusen, Frauke; Al-Azreg, Seham A; Raddatz, Barbara B; Haist, Verena; Puff, Christina; Spitzbarth, Ingo; Ulrich, Reiner; Baumgärtner, Wolfgang
2016-01-01
In demyelinating diseases, changes in the quality and quantity of the extracellular matrix (ECM) may contribute to demyelination and failure of myelin repair and axonal sprouting, especially in chronic lesions. To characterize changes in the ECM in canine distemper demyelinating leukoencephalitis (DL), histochemical and immunohistochemical investigations of formalin-fixed paraffin-embedded cerebella using azan, picrosirius red and Gomori`s silver stain as well as antibodies directed against aggrecan, type I and IV collagen, fibronectin, laminin and phosphacan showed alterations of the ECM in CDV-infected dogs. A significantly increased amount of aggrecan was detected in early and late white matter lesions. In addition, the positive signal for collagens I and IV as well as fibronectin was significantly increased in late lesions. Conversely, the expression of phosphacan was significantly decreased in early and more pronounced in late lesions compared to controls. Furthermore, a set of genes involved in ECM was extracted from a publically available microarray data set and was analyzed for differential gene expression. Gene expression of ECM molecules, their biosynthesis pathways, and pro-fibrotic factors was mildly up-regulated whereas expression of matrix remodeling enzymes was up-regulated to a relatively higher extent. Summarized, the observed findings indicate that changes in the quality and content of ECM molecules represent important, mainly post-transcriptional features in advanced canine distemper lesions. Considering the insufficiency of morphological regeneration in chronic distemper lesions, the accumulated ECM seems to play a crucial role upon regenerative processes and may explain the relatively small regenerative potential in late stages of this disease.
Skariyachan, Sinosh; Acharya, Archana B; Subramaniyan, Saumya; Babu, Sumangala; Kulkarni, Shruthi; Narayanappa, Rajeswari
2016-09-01
The current study explores therapeutic potential of metabolites extracted from marine sponge (Cliona sp.)-associated bacteria against MDR pathogens and predicts the binding prospective of probable lead molecules against VP40 target of Ebola virus. The metabolite-producing bacteria were characterized by agar overlay assay and as per the protocols in Bergey's manual of determinative bacteriology. The antibacterial activities of extracted metabolites were tested against clinical pathogens by well-diffusion assay. The selected metabolite producers were characterized by 16S rDNA sequencing. Chemical screening and Fourier Transform Infrared (FTIR) analysis for selected compounds were performed. The probable lead molecules present in the metabolites were hypothesized based on proximate analysis, FTIR data, and literature survey. The drug-like properties and binding potential of lead molecules against VP40 target of Ebola virus were hypothesized by computational virtual screening and molecular docking. The current study demonstrated that clear zones around bacterial colonies in agar overlay assay. Antibiotic sensitivity profiling demonstrated that the clinical isolates were multi-drug resistant, however; most of them showed sensitivity to secondary metabolites (MIC-15 μl/well). The proximate and FTIR analysis suggested that probable metabolites belonged to alkaloids with O-H, C-H, C=O, and N-H groups. 16S rDNA characterization of selected metabolite producers demonstrated that 96% and 99% sequence identity to Comamonas testosteroni and Citrobacter freundii, respectively. The docking studies suggested that molecules such as Gymnastatin, Sorbicillactone, Marizomib, and Daryamide can designed as probable lead candidates against VP40 target of Ebola virus.
Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria
2012-06-05
Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.
Teng, Yun-Lei; Xu, Qiang
2008-04-24
The reactions of yttrium and lanthanum with dinitrogen were reinvestigated. Laser-ablated yttrium and lanthanum atoms were co-deposited at 4 K with dinitrogen in excess argon, and the low-temperature reactions of Y and La with N2 in solid argon were studied using infrared spectroscopy. The reaction products YNN, (YN)2, LaNN, and (LaN)2 were formed in the present experiments and characterized on the basis of 14N/15N isotopic shifts, mixed isotope splitting patterns, stepwise annealing, change of reagent concentration and laser energy, and comparison with theoretical predictions. Some assignments were made based on a previous report. Density functional theory calculations were performed on these systems to identify possible reaction products. The agreement between experimental and calculated vibrational frequencies, relative absorption intensities, and isotopic shifts of the MNN and (MN)2 (M = Y and La) molecules supports the identification of these molecules from the matrix infrared spectra. Plausible reaction mechanisms were proposed for the formation of these molecules along with tentative identification of the Y3NN molecule.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Molecularly Imprinted Intelligent Scaffolds for Tissue Engineering Applications.
Neves, Mariana I; Wechsler, Marissa E; Gomes, Manuela E; Reis, Rui L; Granja, Pedro L; Peppas, Nicholas A
2017-02-01
The development of molecularly imprinted polymers (MIPs) using biocompatible production methods enables the possibility to further exploit this technology for biomedical applications. Tissue engineering (TE) approaches use the knowledge of the wound healing process to design scaffolds capable of modulating cell behavior and promote tissue regeneration. Biomacromolecules bear great interest for TE, together with the established recognition of the extracellular matrix, as an important source of signals to cells, both promoting cell-cell and cell-matrix interactions during the healing process. This review focuses on exploring the potential of protein molecular imprinting to create bioactive scaffolds with molecular recognition for TE applications based on the most recent approaches in the field of molecular imprinting of macromolecules. Considerations regarding essential components of molecular imprinting technology will be addressed for TE purposes. Molecular imprinting of biocompatible hydrogels, namely based on natural polymers, is also reviewed here. Hydrogel scaffolds with molecular memory show great promise for regenerative therapies. The first molecular imprinting studies analyzing cell adhesion report promising results with potential applications for cell culture systems, or biomaterials for implantation with the capability for cell recruitment by selectively adsorbing desired molecules.
Macri-Pellizzeri, Laura; De-Juan-Pardo, Elena M; Prosper, Felipe; Pelacho, Beatriz
2018-04-01
Tissue-specific stem cells reside in a specialized environment known as niche. The niche plays a central role in the regulation of cell behaviour and, through the concerted action of soluble molecules, supportive somatic cells, and extracellular matrix components, directs stem cells to proliferate, differentiate, or remain quiescent. Great efforts have been done to decompose and separately analyse the contribution of these cues in the in vivo environment. Specifically, the mechanical properties of the extracellular matrix influence many aspects of cell behaviour, including self-renewal and differentiation. Deciphering the role of biomechanics could thereby provide important insights to control the stem cells responses in a more effective way with the aim to promote their therapeutic potential. In this review, we provide a wide overview of the effect that the microenvironment stiffness exerts on the control of cell behaviour with a particular focus on the induction of stem cells differentiation. We also describe the process of mechanotransduction and the molecular effectors involved. Finally, we critically discuss the potential involvement of tissue biomechanics in the design of novel tissue engineering strategies. Copyright © 2017 John Wiley & Sons, Ltd.
Banerjee, Shubhadeep; Pal, Tapan K; Guha, Sujoy K
2012-03-01
To understand and maximize the therapeutic potential of poly(styrene-co-maleic acid) (SMA), a synthetic, pharmacologically-active co-polymer, its effect on conformation, phase behavior and stability of lipid matrix models of cell membranes were investigated. The modes of interaction between SMA and lipid molecules were also studied. While, attenuated total reflection-Fourier-transform infrared (ATR-FTIR) and static (31)P nuclear magnetic resonance (NMR) experiments detected SMA-induced conformational changes in the headgroup region, differential scanning calorimetry (DSC) studies revealed thermotropic phase behavior changes of the membranes. (1)H NMR results indicated weak immobilization of SMA within the bilayers. Molecular interpretation of the results indicated the role of hydrogen-bond formation and hydrophobic forces between SMA and zwitterionic phospholipid bilayers. The extent of membrane fluidization and generation of isotropic phases were affected by the surface charge of the liposomes, and hence suggested the role of electrostatic interactions between SMA and charged lipid headgroups. SMA was thus found to directly affect the structural integrity of model membranes. Copyright © 2011 Elsevier B.V. All rights reserved.
Creating Perfused Functional Vascular Channels Using 3D Bio-Printing Technology
Lee, Vivian K.; Kim, Diana Y.; Ngo, Haygan; Lee, Young; Seo, Lan; Yoo, Seung-Schik; Vincent, Peter A.; Dai, Guohao
2014-01-01
We developed a methodology using 3D bio-printing technology to create a functional in vitro vascular channel with perfused open lumen using only cells and biological matrices. The fabricated vasculature has a tight, confluent endothelium lining, presenting barrier function for both plasma protein and high-molecular weight dextran molecule. The fluidic vascular channel is capable of supporting the viability of tissue up to 5mm in distance at 5 million cells/mL density under the physiological flow condition. In static-cultured vascular channels, active angiogenic sprouting from the vessel surface was observed whereas physiological flow strongly suppressed this process. Gene expression analysis were reported in this study to show the potential of this vessel model in vascular biology research. The methods have great potential in vascularized tissue fabrication using 3D bio-printing technology as the vascular channel is simultaneously created while cells and matrix are printed around the channel in desired 3D patterns. It can also serve as a unique experimental tool for investigating fundamental mechanisms of vascular remodeling with extracellular matrix and maturation process under 3D flow condition. PMID:24965886
UKRmol: a low-energy electron- and positron-molecule scattering suite
NASA Astrophysics Data System (ADS)
Carr, J. M.; Galiatsatos, P. G.; Gorfinkiel, J. D.; Harvey, A. G.; Lysaght, M. A.; Madden, D.; Mašín, Z.; Plummer, M.; Tennyson, J.; Varambhia, H. N.
2012-03-01
We describe the UK computational implementation of the R-matrix method for the treatment of electron and positron scattering from molecules. Recent developments in the UKRmol suite are detailed together with the collision processes it is enabling us to treat.
Park, Keun-Hong; Bae, You Han
2002-07-01
The spheroid of specific cells is often regarded as the better form in artificial organs and mammalian cell bioreactors for improved cell-specific functions. In this study, freshly harvested primary rat hepatocytes, which had been cultivated as spheroids and entrapped in a synthetic thermo-reversible extracellular matrix, were examined for differentiated morphology and enhanced liver-specific functions as compared to a control set (hepatocytes in single-cell form). A copolymer of N-isopropylacrylamide (98 mole % in the feed) and acrylic acid (poly(NiPAAm-co-AAc)), and the adhesion molecule, an Arg-Gly-Asp (RGD)-incorporated thermo-reversible matrix, were used to entrap hepatocytes in the form of either spheroids or single cells. In a 28-day culture period, the spheroids in the RGD-incorporated gel maintained higher viability and produced albumin and urea at constant rates, while there was lower cell viability and less albumin secretion by the spheroids in p(NiPAAm-co-AAc). Hepatocytes cultured as spheroids in the RGD-incorporated gel would constitute a potentially useful three-dimensional cell system for application in a bio-artificial liver device.
Fortunati, E; Luzi, F; Jiménez, A; Gopakumar, D A; Puglia, D; Thomas, S; Kenny, J M; Chiralt, A; Torre, L
2016-09-20
Novel gluten based bionanocomposites reinforced with cellulose nanofibrils (CNF) and cellulose nanocrystals (CNC) extracted from sunflower stalks by respectively a steam explosion treatment and a hydrolysis procedure, were prepared by casting/evaporation. The extracted cellulose nanomaterials, both CNC and CNF, were embedded in gluten matrix and their effect was investigated. Morphological investigations highlighted that gluten based bionanocomposites showed a homogenous morphology, the absence of visible cellulose nanoreinforcements, and the presence of holes for Gluten_CNF nanocomposites. Gluten_CNF showed a reduction of water vapour permeability coefficients but the values are higher respect to gluten reinforced with CNC. This behaviour could be related to the ability of CNC to increase the tortuous path of gas molecules. Moreover, the results from thermal, mechanical and barrier properties confirmed the strong interactions obtained between CNC and gluten matrix during the process. The study suggested the possibility to re-valorise agricultural wastes with potential applications as reinforcement in polymer matrix bionanocomposites. Copyright © 2016 Elsevier Ltd. All rights reserved.
Scattering matrix approach to the dissociative recombination of HCO{sup +} and N{sub 2}H{sup +}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fonseca dos Santos, S.; Douguet, N.; Orel, A. E.
We present a theoretical study of the indirect dissociative recombination of linear polyatomic ions at low collisional energies. The approach is based on the computation of the scattering matrix just above the ionization threshold and enables the explicit determination of all diabatic electronic couplings responsible for dissociative recombination. In addition, we use the multi-channel quantum-defect theory to demonstrate the precision of the scattering matrix by reproducing accurately ab initio Rydberg state energies of the neutral molecule. We consider the molecular ions N{sub 2}H{sup +} and HCO{sup +} as benchmark systems of astrophysical interest and improve former theoretical studies, which hadmore » repeatedly produced smaller cross sections than experimentally measured. Specifically, we demonstrate the crucial role of the previously overlooked stretching modes for linear polyatomic ions with large permanent dipole moment. The theoretical cross sections for both ions agree well with experimental data over a wide energy range. Finally, we consider the potential role of the HOC{sup +} isomer in the experimental cross sections of HCO{sup +} at energies below 10 meV.« less
Holzhauser, Thomas; Kleiner, Kornelia; Janise, Annabella; Röder, Martin
2014-11-15
A novel method to quantify species or DNA on the basis of a competitive quantitative real-time polymerase chain reaction (cqPCR) was developed. Potentially allergenic peanut in food served as one example. Based on an internal competitive DNA sequence for normalisation of DNA extraction and amplification, the cqPCR was threshold-calibrated against 100mg/kg incurred peanut in milk chocolate. No external standards were necessary. The competitive molecule successfully served as calibrator for quantification, matrix normalisation, and inhibition control. Although designed for verification of a virtual threshold of 100mg/kg, the method allowed quantification of 10-1,000 mg/kg peanut incurred in various food matrices and without further matrix adaption: On the basis of four PCR replicates per sample, mean recovery of 10-1,000 mg/kg peanut in chocolate, vanilla ice cream, cookie dough, cookie, and muesli was 87% (range: 39-147%) in comparison to 199% (range: 114-237%) by three commercial ELISA kits. Copyright © 2014 Elsevier Ltd. All rights reserved.
Lipase biofilm deposited by Matrix Assisted Pulsed Laser Evaporation technique
NASA Astrophysics Data System (ADS)
Aronne, Antonio; Bloisi, Francesco; Calabria, Raffaela; Califano, Valeria; Depero, Laura E.; Fanelli, Esther; Federici, Stefania; Massoli, Patrizio; Vicari, Luciano R. M.
2015-05-01
Lipase is an enzyme that finds application in biodiesel production and for detection of esters and triglycerides in biosensors. Matrix Assisted Pulsed Laser Evaporation (MAPLE), a technique derived from Pulsed Laser Deposition (PLD) for deposition of undamaged biomolecules or polymers, is characterized by the use of a frozen target obtained from a solution/suspension of the guest material (to be deposited) in a volatile matrix (solvent). The presence of the solvent avoids or at least reduces the potential damage of guest molecules by laser radiation but only the guest material reaches the substrate in an essentially solvent-free deposition. MAPLE can be used for enzymes immobilization, essential for industrial application, allowing the development of continuous processes, an easier separation of products, the reuse of the catalyst and, in some cases, enhancing enzyme properties (pH, temperature stability, etc.) and catalytic activity in non-aqueous media. Here we show that MAPLE technique can be used to deposit undamaged lipase and that the complex structure (due to droplets generated during extraction from target) of the deposited material can be controlled by changing the laser beam fluence.
Schvartzman, Mark; Palma, Matteo; Sable, Julia; Abramson, Justin; Hu, Xian; Sheetz, Michael P.; Wind, Shalom J.
2011-01-01
The ability to control the placement of individual molecules promises to enable a wide range of applications and is a key challenge in nanoscience and nanotechnology. Many biological interactions, in particular, are sensitive to the precise geometric arrangement of proteins. We have developed a technique which combines molecular-scale nanolithography with site-selective biochemistry to create biomimetic arrays of individual protein binding sites. The binding sites can be arranged in heterogeneous patterns of virtually any possible geometry with a nearly unlimited number of degrees of freedom. We have used these arrays to explore how the geometric organization of the extracellular matrix (ECM) binding ligand RGD (Arg-Gly-Asp) affects cell adhesion and spreading. Systematic variation of spacing, density and cluster size of individual integrin binding sites was used to elicit different cell behavior. Cell spreading assays on arrays of different geometric arrangements revealed a dramatic increase in spreading efficiency when at least 4 liganded sites were spaced within 60 nm or less, with no dependence on global density. This points to the existence of a minimal matrix adhesion unit for fibronectin defined in space and stoichiometry. Developing an understanding of the ECM geometries that activate specific cellular functional complexes is a critical step toward controlling cell behavior. Potential practical applications range from new therapeutic treatments to the rational design of tissue scaffolds that can optimize healing without scarring. More broadly, spatial control at the single-molecule level can elucidate factors controlling individual molecular interactions and can enable synthesis of new systems based on molecular-scale architectures. PMID:21319842
Wu, Yachuan; Quan, Xiangchun; Si, Xiurong; Wang, Xinrui
2016-06-01
Detrimental biofilms have become a great concern in many areas due to their strong resistance and insensitivity to traditional antimicrobial agents. Norspermidine is a potent small molecule for biofilm dispersal. In this study, silver ion, a conventional inorganic biocide, was combined with norspermidine and used for control and removal of multi-species biofilms formed by a mixed culture from wastewater treatment systems. Results showed that silver ion (0.01-1 mg/L) treatment alone failed to remove the existing wastewater biofilms. Norspermidine at the concentrations of 500-1000 μM was capable to disrupt and disperse the existing biofilms with a biofilm reduction of 21-34 % after 24-h exposure. The combined treatment with norspermidine (500 μM) and silver ion (0.01 mg/L) increased biofilm reduction to 48 % (24-h exposure). The combined treatment also enhanced biofilm disinfection ratio (82 %, 2-h exposure) by 2.0- and 2.6-folds compared to norspermidine (27 %) or silver ion (23 %) treatment alone, respectively. Confocal laser scanning microscopic (CLSM) observations found that norspermidine could disrupt biofilm matrix and promote biofilm dispersal via breaking down exopolysaccharides. The combined treatment increased the reduction in biofilm cell density and viability, possibly due to the damage of biofilm matrix, enhanced silver ion diffusion in biofilms, and increased biofilm sensitivity. These findings indicate that the combination of a small molecule norspermidine with a traditional biocide silver ion presents a novel strategy to remove and kill biofilms, which have a potential application in addressing wastewater biofilm-related issues.
Zhang, Xu; Diekwisch, Thomas G H; Luan, Xianghong
2011-12-01
The functional significance of extracellular matrix proteins in the life of vertebrates is underscored by a high level of sequence variability in tandem with a substantial degree of conservation in terms of cell-cell and cell-matrix adhesion interactions. Many extracellular matrix proteins feature multiple adhesion domains for successful attachment to substrates, such as integrin, CD63, and heparin. Here we have used homology and ab initio modeling algorithms to compare mouse ameloblastin (mAMBN) and human ameloblastin (hABMN) isoforms and to analyze their potential for cell adhesion and interaction with other matrix molecules as well as calcium binding. Sequence comparison between mAMBN and hAMBN revealed a 26-amino-acid deletion in mAMBN, corresponding to a helix-loop-helix frameshift. The human AMBN domain (174Q-201G), homologous to the mAMBN 157E-178I helix-loop-helix region, formed a helix-loop motif with an extended loop, suggesting a higher degree of flexibility of hAMBN compared with mAMBN, as confirmed by molecular dynamics simulation. Heparin-binding domains, CD63-interaction domains, and calcium-binding sites in both hAMBN and mAMBN support the concept of AMBN as an extracellular matrix protein. The high level of conservation between AMBN functional domains related to adhesion and differentiation was remarkable when compared with only 61% amino acid sequence homology. © 2011 Eur J Oral Sci.
Matrix-enhanced secondary ion mass spectrometry: The Alchemist's solution?
NASA Astrophysics Data System (ADS)
Delcorte, Arnaud
2006-07-01
Because of the requirements of large molecule characterization and high-lateral resolution SIMS imaging, the possibility of improving molecular ion yields by the use of specific sample preparation procedures has recently generated a renewed interest in the static SIMS community. In comparison with polyatomic projectiles, however, signal enhancement by a matrix might appear to some as the alchemist's versus the scientist's solution to the current problems of organic SIMS. In this contribution, I would like to discuss critically the pros and cons of matrix-enhanced SIMS procedures, in the new framework that includes polyatomic ion bombardment. This discussion is based on a short review of the experimental and theoretical developments achieved in the last decade with respect to the three following approaches: (i) blending the analyte with a low-molecular weight organic matrix (MALDI-type preparation procedure); (ii) mixing alkali/noble metal salts with the analyte; (iii) evaporating a noble metal layer on the analyte sample surface (organic molecules, polymers).
Ding, Yuqi; Kawakita, Kento; Xu, Jiawei; Akiyama, Kazuhiko; Fujino, Tatsuya
2015-08-04
Smectite, a synthetic inorganic polymer with a saponite structure, was subjected to matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). Typical organic matrix molecules 2,4,6-trihydroxyacetophenone (THAP) and 2,5-dihydroxybenzoic acid (DHBA) were intercalated into the layer spacing of cation-exchanged smectite, and the complex was used as a new matrix for laser desorption/ionization mass spectrometry. Because of layer spacing limitations, only a small analyte that could enter the layer and bind to THAP or DHBA could be ionized. This was confirmed by examining different analyte/matrix preparation methods and by measuring saccharides with different molecular sizes. Because of the homogeneous distribution of THAP molecules in the smectite layer spacing, high reproducibility of the analyte peak intensity was achieved. By using isotope-labeled (13)C6-d-glucose as the internal standard, quantitative analysis of monosaccharides in pretreated human plasma sample was performed, and the value of 8.6 ± 0.3 μg/mg was estimated.
Electronic method for autofluorography of macromolecules on two-D matrices
Davidson, Jackson B.; Case, Arthur L.
1983-01-01
A method for detecting, localizing, and quantifying macromolecules contained in a two-dimensional matrix is provided which employs a television-based position sensitive detection system. A molecule-containing matrix may be produced by conventional means to produce spots of light at the molecule locations which are detected by the television system. The matrix, such as a gel matrix, is exposed to an electronic camera system including an image-intensifier and secondary electron conduction camera capable of light integrating times of many minutes. A light image stored in the form of a charge image on the camera tube target is scanned by conventional television techniques, digitized, and stored in a digital memory. Intensity of any point on the image may be determined from the number at the memory address of the point. The entire image may be displayed on a television monitor for inspection and photographing or individual spots may be analyzed through selected readout of the memory locations. Compared to conventional film exposure methods, the exposure time may be reduced 100-1000 times.
Decreasing the metastatic potential in cancers--targeting the heparan sulfate proteoglycans.
Fjeldstad, K; Kolset, S O
2005-09-01
The heterogeneity of proteoglycans (PG)s contributes to their functional diversity. Many functions depend on their ability to bind and modulate the activity of components of the extracellular matrix (ECM). The ability of PGs to interact with other molecules, such as growth factors, is largely determined by the fine structure of the glycosaminoglycan (GAG) chains. Tumorigenesis is associated with changes in the PG synthesis. Heparan sulfate (HS) PGs are involved in several aspects of cancer biology including tumor progression, angiogenesis, and metastasis. PGs can have both tumor promoting and tumor suppressing activities depending on the protein core, the GAG attached, molecules they associate with, localization, the tumor subtype, stages, and degree of tumor differentiation. Perlecan is an angiogenic factor involved in tumor invasiveness. The C-terminal domain V of perlecan, named endorepellin, has however been shown to inhibit angiogenesis. Another angiogenic factor is endostatin, the COOH-terminal domain of the part-time PG collagen XVIII. Glypicans and syndecans may promote local cancer cell growth in some cancer tissues, but inhibit tissue invasion and metastasis in others. The GAG hyaluronan (HA) promotes cancer growth by providing a loose matrix for migrating tumor cells and mediates adhesion of cancer cells. HSPG degrading enzymes like heparanase, heparitinase, and other enzymes such as hyaluronidase and MMP are also important in tumor metastasis. Several different treatment strategies that target PGs have been developed. They have the potential to be effective in reducing tumor growth and inhibit the formation of metastases. PGs are also valuable tumor markers in several cancers.
In vitro mineralization and bone osteogenesis in poly(ε-caprolactone)/gelatin nanofibers.
Alvarez Perez, Marco A; Guarino, Vincenzo; Cirillo, Valentina; Ambrosio, Luigi
2012-11-01
The implementation of bio-inspired strategies in developing scaffolds for the reconstruction of oral, craniofacial and bone skeletal tissues after injury or resection remains a challenge. Currently, advanced scaffolds comprising nanofibers endowed with biochemical/biophysical signaling capability offer great advantages in bone regeneration, because of their faithful mimesis of the characteristic size scales encountered in the fibrous network of the native extracellular matrix (ECM). In this study, we investigate the biological potential of nanofibers made of polycaprolactone and gelatin on guiding the regenerative mechanisms of bone. Contact angle measurements and environmental SEM investigations indicate a weak linkage of gelatin molecules to PCL chains, facilitating an efficient adhesion signal to cells up to 3 days of culture. In vitro studies performed on human mesenchymal stem cells (hMSC) until 3 weeks in culture medium with osteogenic supplementation, clearly showing the effectiveness of PCL/Gelatin electrospun scaffolds in promoting bone osteogenesis and mineralization. The increase of alkaline phosphatase activity (ALP) and gene expression of bone-related molecules (bone sialoprotein, osteopontin and osteocalcin), indicated by immunodetection and upregulation level of mRNA, confirm that proposed nanofibers promote the osteogenic differentiation of hMSC, preferentially in osteogenic medium. Moreover, the evidence of newly formed collagen fibers synthesis by SIRCOL and their mineralization evaluated by Alizarin Red staining and EDS mapping of the elements Ca, P and Mg corroborate the idea that native osteoid matrix is ultimately deposited. All these data suggest that PCL and gelatin electrospun nanofibers have great potential as osteogenesis promoting scaffolds for successful application in bone surgery. Copyright © 2012 Wiley Periodicals, Inc.
Vanderploeg, Eric J; Wilson, Christopher G; Imler, Stacy M; Ling, Carrie Hang-Yin; Levenston, Marc E
2012-01-01
A deeper understanding of the composition and organization of extracellular matrix molecules in native, healthy meniscus tissue is required to fully appreciate the degeneration that occurs in joint disease and the intricate environment in which an engineered meniscal graft would need to function. In this study, regional variations in the tissue-level and pericellular distributions of collagen types I, II and VI and the proteoglycans aggrecan, biglycan and decorin were examined in the juvenile bovine meniscus. The collagen networks were extensively, but not completely, colocalized, with tissue-level organization that varied with radial position across the meniscus. Type VI collagen exhibited close association with large bundles composed of type I and II collagen and, in contrast to type I and II collagen, was further concentrated in the pericellular matrix. Aggrecan was detected throughout the inner region of the meniscus but was restricted to the pericellular matrix and sheaths of collagen bundles in the middle and outer regions. The small proteoglycans biglycan and decorin exhibited regional variations in staining intensity but were consistently localized in the intra- and/or peri-cellular compartments. These results provide insight into the complex hierarchy of extracellular matrix organization in the meniscus and provide a framework for better understanding meniscal degeneration and disease progression and evaluating potential repair and regeneration strategies. PMID:22703476
Li, Xiang; Danell, Ryan M; Brinckerhoff, William B; Pinnick, Veronica T; van Amerom, Friso; Arevalo, Ricardo D; Getty, Stephanie A; Mahaffy, Paul R; Steininger, Harald; Goesmann, Fred
2015-02-01
Evidence from recent Mars missions indicates the presence of perchlorate salts up to 1 wt % level in the near-surface materials. Mixed perchlorates and other oxychlorine species may complicate the detection of organic molecules in bulk martian samples when using pyrolysis techniques. To address this analytical challenge, we report here results of laboratory measurements with laser desorption mass spectrometry, including analyses performed on both commercial and Mars Organic Molecule Analyzer (MOMA) breadboard instruments. We demonstrate that the detection of nonvolatile organics in selected spiked mineral-matrix materials by laser desorption/ionization (LDI) mass spectrometry is not inhibited by the presence of up to 1 wt % perchlorate salt. The organics in the sample are not significantly degraded or combusted in the LDI process, and the parent molecular ion is retained in the mass spectrum. The LDI technique provides distinct potential benefits for the detection of organics in situ on the martian surface and has the potential to aid in the search for signs of life on Mars.
Matrix metalloproteinase processing of signaling molecules to regulate inflammation.
Butler, Georgina S; Overall, Christopher M
2013-10-01
Inflammation is a complex and highly regulated process that facilitates the clearance of pathogens and mediates tissue repair. Failure to resolve inflammation can lead to chronic inflammatory diseases such as periodontitis. Matrix metalloproteinases are generally thought to be detrimental in disease because degradation of extracellular matrix contributes to pathology. However, proteomic techniques (degradomics) are revealing that matrix metalloproteinases process a diverse array of substrates and therefore have a broad range of functions. Many matrix metalloproteinase substrates modulate inflammation and hence, by processing these proteins, matrix metalloproteinases can orchestrate the inflammatory response. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The role of laminins in cartilaginous tissues: from development to regeneration.
Sun, Y; Wang, T L; Toh, W S; Pei, M
2017-07-21
As a key molecule of the extracellular matrix, laminin provides a delicate microenvironment for cell functions. Recent findings suggest that laminins expressed by cartilage-forming cells (chondrocytes, progenitor cells and stem cells) could promote chondrogenesis. However, few papers outline the effect of laminins on providing a favorable matrix microenvironment for cartilage regeneration. In this review, we delineated the expression of laminins in hyaline cartilage, fibrocartilage and cartilage-like tissue (nucleus pulposus) throughout several developmental stages. We also examined the effect of laminins on the biological activities of chondrocytes, including adhesion, migration and survival. Furthermore, we scrutinized the potential influence of various laminin isoforms on cartilage-forming cells' proliferation and chondrogenic differentiation. With this information, we hope to facilitate the understanding of the spatial and temporal interactions between cartilage-forming cells and laminin microenvironment to eventually advance cell-based cartilage engineering and regeneration.
Veis, Libor; Antalík, Andrej; Brabec, Jiří; Neese, Frank; Legeza, Örs; Pittner, Jiří
2016-10-03
In the past decade, the quantum chemical version of the density matrix renormalization group (DMRG) method has established itself as the method of choice for calculations of strongly correlated molecular systems. Despite its favorable scaling, it is in practice not suitable for computations of dynamic correlation. We present a novel method for accurate "post-DMRG" treatment of dynamic correlation based on the tailored coupled cluster (CC) theory in which the DMRG method is responsible for the proper description of nondynamic correlation, whereas dynamic correlation is incorporated through the framework of the CC theory. We illustrate the potential of this method on prominent multireference systems, in particular, N 2 and Cr 2 molecules and also oxo-Mn(Salen), for which we have performed the first post-DMRG computations in order to shed light on the energy ordering of the lowest spin states.
Low surface area graphene/cellulose composite as a host matrix for lithium sulphur batteries
NASA Astrophysics Data System (ADS)
Patel, Manu U. M.; Luong, Nguyen Dang; Seppälä, Jukka; Tchernychova, Elena; Dominko, Robert
2014-05-01
Graphene/cellulose composites were prepared and studied as potential host matrixes for sulphur impregnation and use in Li-S batteries. We demonstrate that with the proper design of a relatively low surface area graphene/cellulose composite, a high electrochemical performance along with good cyclability can be achieved. Graphene cellulose composites are built from two constituents: a two-dimensional electronic conductive graphene and cellulose fibres as a structural frame; together they form a laminar type of pore. The graphene sheets that uniformly anchor sulphur molecules provide confinement ability for polysulphides, sufficient space to accommodate sulphur volumetric expansion, a large contact area with the sulphur and a short transport pathway for both electrons and lithium ions. Nano-cellulose prevents the opening of graphene sheets due to the volume expansion caused by dissolved polysulphides during battery operation. This, in turn, prevents the diffusion of lithium polysulphides into the electrolyte, enabling a long cycle life.
Photoionization of Atoms and Molecules using a Configuration-Average Distorted-Wave Method
NASA Astrophysics Data System (ADS)
Pindzola, M. S.; Balance, C. P.; Loch, S. D.; Ludlow, J. A.
2011-05-01
A configuration-average distorted-wave method is applied to calculate the photoionization cross section for the outer subshells of the C atom and the C2 diatomic molecule. Comparisions are made with previous R-matrix and Hartree- Fock distorted-wave calculations.
The Atom in a Molecule: Implications for Molecular Structure and Properties
2016-05-23
unlimited. PA Clearance #16075.” Atomic- Product Representations of Molecules Employ “van der Waals” products of atomic states to represent molecules...representation the electrons “stay home” with each nucleus. Atomic fragment operators are well-defined over product representations. Expectation values of...release; distribution unlimited. PA Clearance #16075.” Hamiltonian Matrix in the Atomic- Product Basis Technical Questions Addressed: J. Chem. Phys
Fluorescein isothiocyanate-labeled human plasma fibronectin in extracellular matrix remodeling.
Hoffmann, Celine; Leroy-Dudal, Johanne; Patel, Salima; Gallet, Olivier; Pauthe, Emmanuel
2008-01-01
Fluorescein isothiocyanate (FITC) is a well-known probe for labeling biologically relevant proteins. However, the impact of the labeling procedure on protein structure and biological activities remains unclear. In this work, FITC-labeled human plasma fibronectin (Fn) was developed to gain insight into the dynamic relationship between cells and Fn. The similarities and differences concerning the structure and function between Fn-FITC and standard Fn were evaluated using biochemical as well as cellular approaches. By varying the FITC/Fn ratio, we demonstrated that overlabeling (>10 FITC molecules/Fn molecule) induces probe fluorescence quenching, protein aggregation, and cell growth modifications. A correct balance between reliable fluorescence for detection and no significant modifications to structure and biological function compared with standard Fn was obtained with a final ratio of 3 FITC molecules per Fn molecule (Fn-FITC3). Fn-FITC3, similar to standard Fn, is correctly recruited into the cell matrix network. Also, Fn-FITC3 is proposed to be a powerful molecular tool to investigate Fn organization and cellular behavior concomitantly.
Engel, E; Nicklaus, S; Septier, C; Salles, C; Le Quéré, J L
2001-06-01
The objective of this study was to characterize the effect of ripening on the taste of a typically bitter Camembert cheese. The first step was to select a typically bitter cheese among several products obtained by different processes supposed to enhance this taste defect. Second, the evolution of cheese taste during ripening was characterized from a sensory point of view. Finally, the relative impact of fat, proteins, and water-soluble molecules on cheese taste was determined by using omission tests performed on a reconstituted cheese. These omission tests showed that cheese taste resulted mainly from the gustatory properties of water-soluble molecules but was modulated by a matrix effect due to fat, proteins, and cheese structure. The evolution of this matrix effect during ripening was discussed for each taste characteristic.
NASA Astrophysics Data System (ADS)
Bégué, Didier; Baraille, Isabelle; Andersen, Heidi Gade; Wentrup, Curt
2013-10-01
Methyliminopropadienone MeN=C=C=C=O 1a was generated by flash vacuum thermolysis from four different precursors and isolated in solid argon. The matrix-isolation infrared spectrum is dominated by unusually strong anharmonic effects resulting in complex fine structure of the absorptions due to the NCCCO moiety in the 2200 cm-1 region. Doubling and tripling of the corresponding absorption bands are observed for phenyliminopropadienone PhN=C=C=C=O 1b and bis(phenylimino)propadiene PhN=C=C=C=NPh 9, respectively. Anharmonic vibrational frequency calculations allow the identification of a number of overtones and combination bands as the cause of the splittings for each molecule. This method constitutes an important tool for the characterization of reactive intermediates and unusual molecules by matrix-isolation infrared spectroscopy.
Identification of Odorant-Receptor Interactions by Global Mapping of the Human Odorome
Audouze, Karine; Tromelin, Anne; Le Bon, Anne Marie; Belloir, Christine; Petersen, Rasmus Koefoed; Kristiansen, Karsten; Brunak, Søren; Taboureau, Olivier
2014-01-01
The human olfactory system recognizes a broad spectrum of odorants using approximately 400 different olfactory receptors (hORs). Although significant improvements of heterologous expression systems used to study interactions between ORs and odorant molecules have been made, screening the olfactory repertoire of hORs remains a tremendous challenge. We therefore developed a chemical systems level approach based on protein-protein association network to investigate novel hOR-odorant relationships. Using this new approach, we proposed and validated new bioactivities for odorant molecules and OR2W1, OR51E1 and OR5P3. As it remains largely unknown how human perception of odorants influence or prevent diseases, we also developed an odorant-protein matrix to explore global relationships between chemicals, biological targets and disease susceptibilities. We successfully experimentally demonstrated interactions between odorants and the cannabinoid receptor 1 (CB1) and the peroxisome proliferator-activated receptor gamma (PPARγ). Overall, these results illustrate the potential of integrative systems chemical biology to explore the impact of odorant molecules on human health, i.e. human odorome. PMID:24695519
Berretta, Sabina; Pantazopoulos, Harry; Markota, Matej; Brown, Christopher; Batzianouli, Eleni T
2015-09-01
Perineuronal nets (PNNs) were shown to be markedly altered in subjects with schizophrenia. In particular, decreases of PNNs have been detected in the amygdala, entorhinal cortex and prefrontal cortex. The formation of these specialized extracellular matrix (ECM) aggregates during postnatal development, their functions, and association with distinct populations of GABAergic interneurons, bear great relevance to the pathophysiology of schizophrenia. PNNs gradually mature in an experience-dependent manner during late stages of postnatal development, overlapping with the prodromal period/age of onset of schizophrenia. Throughout adulthood, PNNs regulate neuronal properties, including synaptic remodeling, cell membrane compartmentalization and subsequent regulation of glutamate receptors and calcium channels, and susceptibility to oxidative stress. With the present paper, we discuss evidence for PNN abnormalities in schizophrenia, the potential functional impact of such abnormalities on inhibitory circuits and, in turn, cognitive and emotion processing. We integrate these considerations with results from recent genetic studies showing genetic susceptibility for schizophrenia associated with genes encoding for PNN components, matrix-regulating molecules and immune system factors. Notably, the composition of PNNs is regulated dynamically in response to factors such as fear, reward, stress, and immune response. This regulation occurs through families of matrix metalloproteinases that cleave ECM components, altering their functions and affecting plasticity. Several metalloproteinases have been proposed as vulnerability factors for schizophrenia. We speculate that the physiological process of PNN remodeling may be disrupted in schizophrenia as a result of interactions between matrix remodeling processes and immune system dysregulation. In turn, these mechanisms may contribute to the dysfunction of GABAergic neurons. Copyright © 2015. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Samanta, Amit K.; Pandey, Prasenjit; Bandyopadhyay, Biman; Mukhopadhyay, Anamika; Chakraborty, Tapas
2011-05-01
Mid-infrared spectra of 3-methyl-1,2-cyclopentanedione (3-MeCPD) have been recorded by isolating the molecule in a cold argon matrix (8 K) and also in CCl 4 solution at room temperature. The spectral features reveal that in both media, the molecule exists exclusively in an enol tautomeric form, which is stabilized by an intramolecular O sbnd H⋯O hydrogen bond. NBO analysis shows that the preferred conformer is further stabilized because of hyperconjugation interaction between the methyl and vinyl group of the enol tautomer. In CCl 4 solution, the molecule undergoes extensive self association and generates a doubly hydrogen bonded centrosymmetric dimer. The dimerization constant ( K d) is estimated to have a value of ˜9 L mol -1 at room temperature (25 °C) and the thermodynamic parameters, Δ H°, Δ S° and Δ G°, of dimerization are estimated by measuring K d at several temperatures within the range 22-60 °C. The same dimer is also produced when the matrix is annealed at a higher temperature. In addition, a non-centrosymmetric singly hydrogen bonded dimer is also identified in the argon matrix. A comparison between the spectral features of the two dimers indicates that the dimerization effect on doubly H-bonded case is influenced by cooperative interaction between the two H-bonds.
Proteoliposomes as matrix vesicles’ biomimetics to study the initiation of skeletal mineralization
Simão, A.M.S.; Yadav, M.C.; Ciancaglini, P.; Millán, J.L.
2017-01-01
During the process of endochondral bone formation, chondrocytes and osteoblasts mineralize their extracellular matrix by promoting the formation of hydroxyapatite (HA) seed crystals in the sheltered interior of membrane-limited matrix vesicles (MVs). Ion transporters control the availability of phosphate and calcium needed for HA deposition. The lipidic microenvironment in which MV-associated enzymes and transporters function plays a crucial physiological role and must be taken into account when attempting to elucidate their interplay during the initiation of biomineralization. In this short mini-review, we discuss the potential use of proteoliposome systems as chondrocyte- and osteoblast-derived MVs biomimetics, as a means of reconstituting a phospholipid microenvironment in a manner that recapitulates the native functional MV microenvironment. Such a system can be used to elucidate the interplay of MV enzymes during catalysis of biomineralization substrates and in modulating in vitro calcification. As such, the enzymatic defects associated with disease-causing mutations in MV enzymes could be studied in an artificial vesicular environment that better mimics their in vivo biological milieu. These artificial systems could also be used for the screening of small molecule compounds able to modulate the activity of MV enzymes for potential therapeutic uses. Such a nanovesicular system could also prove useful for the repair/treatment of craniofacial and other skeletal defects and to facilitate the mineralization of titanium-based tooth implants. PMID:20401430
Proteoliposomes as matrix vesicles' biomimetics to study the initiation of skeletal mineralization.
Simão, A M S; Yadav, M C; Ciancaglini, P; Millán, J L
2010-03-01
During the process of endochondral bone formation, chondrocytes and osteoblasts mineralize their extracellular matrix by promoting the formation of hydroxyapatite (HA) seed crystals in the sheltered interior of membrane-limited matrix vesicles (MVs). Ion transporters control the availability of phosphate and calcium needed for HA deposition. The lipidic microenvironment in which MV-associated enzymes and transporters function plays a crucial physiological role and must be taken into account when attempting to elucidate their interplay during the initiation of biomineralization. In this short mini-review, we discuss the potential use of proteoliposome systems as chondrocyte- and osteoblast-derived MVs biomimetics, as a means of reconstituting a phospholipid microenvironment in a manner that recapitulates the native functional MV microenvironment. Such a system can be used to elucidate the interplay of MV enzymes during catalysis of biomineralization substrates and in modulating in vitro calcification. As such, the enzymatic defects associated with disease-causing mutations in MV enzymes could be studied in an artificial vesicular environment that better mimics their in vivo biological milieu. These artificial systems could also be used for the screening of small molecule compounds able to modulate the activity of MV enzymes for potential therapeutic uses. Such a nanovesicular system could also prove useful for the repair/treatment of craniofacial and other skeletal defects and to facilitate the mineralization of titanium-based tooth implants.
NASA Technical Reports Server (NTRS)
Schwenke, David W.; Langhoff, Stephen R. (Technical Monitor)
1995-01-01
A description is given of an algorithm for computing ro-vibrational energy levels for tetratomic molecules. The expressions required for evaluating transition intensities are also given. The variational principle is used to determine the energy levels and the kinetic energy operator is simple and evaluated exactly. The computational procedure is split up into the determination of one dimensional radial basis functions, the computation of a contracted rotational-bending basis, followed by a final variational step coupling all degrees of freedom. An angular basis is proposed whereby the rotational-bending contraction takes place in three steps. Angular matrix elements of the potential are evaluated by expansion in terms of a suitable basis and the angular integrals are given in a factorized form which simplifies their evaluation. The basis functions in the final variational step have the full permutation symmetries of the identical particles. Sample results are given for HCCH and BH3.
Enantioselective recognition at mesoporous chiral metal surfaces.
Wattanakit, Chularat; Côme, Yémima Bon Saint; Lapeyre, Veronique; Bopp, Philippe A; Heim, Matthias; Yadnum, Sudarat; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander
2014-01-01
Chirality is widespread in natural systems, and artificial reproduction of chiral recognition is a major scientific challenge, especially owing to various potential applications ranging from catalysis to sensing and separation science. In this context, molecular imprinting is a well-known approach for generating materials with enantioselective properties, and it has been successfully employed using polymers. However, it is particularly difficult to synthesize chiral metal matrices by this method. Here we report the fabrication of a chirally imprinted mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and chiral template molecules. The porous platinum retains a chiral character after removal of the template molecules. A matrix obtained in this way exhibits a large active surface area due to its mesoporosity, and also shows a significant discrimination between two enantiomers, when they are probed using such materials as electrodes.
Inflammatory and immunological aspects of dental pulp repair
Goldberg, Michel; Farges, Jean-Christophe; Lacerda-Pinheiro, Sally; Six, Ngampis; Jegat, Nadège; Decup, Frank; Septier, Dominique; Carrouel, Florence; Durand, Stéphanie; Chaussain-Miller, Catherine; DenBesten, Pamela; Veis, Arthur; Poliard, Anne
2010-01-01
The repair of dental pulp by direct capping with calcium hydroxide or by implantation of bioactive extracellular matrix (ECM) molecules implies a cascade of four steps: a moderate inflammation, the commitment of adult reserve stem cells, their proliferation and terminal differentiation. The link between the initial inflammation and cell commitment is not yet well established but appears as a potential key factor in the reparative process. Either the release of cytokines due to inflammatory events activates resident stem (progenitor) cells, or inflammatory cells or pulp fibroblasts undergo a phenotypic conversion into osteoblast/odontoblast-like progenitors implicated in reparative dentin formation. Activation of antigen-presenting dendritic cells by mild inflammatory processes may also promote osteoblast/odontoblast-like differentiation and expression of ECM molecules implicated in mineralization. Recognition of bacteria by specific odontoblast and fibroblast membrane receptors triggers an inflammatory and immune response within the pulp tissue that would also modulate the repair process. PMID:18602009
DOE Office of Scientific and Technical Information (OSTI.GOV)
Justino, Licínia L. G., E-mail: liciniaj@ci.uc.pt; Reva, Igor; Fausto, Rui
2016-07-07
Near-infrared (near-IR) narrowband selective vibrational excitation and annealing of gallic acid (3,4,5-trihydroxybenzoic acid) isolated in cryogenic matrices were used to induce interconversions between its most stable conformers. The isomerizations were probed by infrared spectroscopy. An extensive set of quantum chemical calculations, carried out at the DFT(B3LYP)/6-311++G(d,p) level of approximation, was used to undertake a detailed analysis of the ground state potential energy surface of the molecule. This investigation of the molecule conformational space allowed extracting mechanistic insights into the observed annealing- or near-IR-induced isomerization processes. The infrared spectra of the two most stable conformers of gallic acid in N{sub 2},more » Xe, and Ar matrices were fully assigned. Finally, the UV-induced photochemistry of the matrix isolated compound was investigated.« less
Matrix-isolation and ab initio study of HKrCCCl and HXeCCCl
NASA Astrophysics Data System (ADS)
Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid
2015-12-01
We report on two new noble-gas molecules, HKrCCCl and HXeCCCl, prepared in low-temperature Kr and Xe matrices. These molecules are made by UV photolysis of HCCCl in the matrices and subsequent thermal annealing. The HCCCl precursor is produced by microwave discharge of a mixture of a matrix gas with trichloroethylene (HClC=CCl2). The assignments of the new noble-gas molecules are supported by deuteration experiments and quantum chemical calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. No evidence of ClXeCCH, which is computationally reliably stable, is found in the experiments. ClKrCCH as well as the Ar compounds HArCCCl and ClArCCH are not observed either, which is in agreement with the calculations.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Kibler, C; Schermutzki, F; Waller, H D; Timpl, R; Müller, C A; Klein, G
1998-06-01
Multiple myeloma represents a human B cell malignancy which is characterized by a predominant localization of the malignant cell clone within the bone marrow. With the exception of the terminal stage of the disease the myeloma tumor cells do not circulate in the peripheral blood. The bone marrow microenvironment is believed to play an important role in homing, proliferation and terminal differentiation of myeloma cells. Here we have studied the expression of several extracellular matrix (ECM) molecules in the bone marrow of multiple myeloma patients and analyzed their adhesive capacities with four different human myeloma-derived cell lines. All ECM molecules analyzed (tenascin, laminin, fibronectin, collagen types I, III, V and VI) could be detected in bone marrow cryostat sections of multiple myeloma patients. Adhesion assays showed that only laminin, the microfibrillar collagen type VI and fibronectin were strong adhesive components for the myeloma cell lines U266, IM-9, OPM-2 and NCI-H929. Tenascin and collagen type I were only weak adhesive substrates for these myeloma cells. Adhesion to laminin and fibronectin was beta 1-integrin-mediated since addition of anti-beta 1-integrin antibodies could inhibit the binding of the four different cell types to both matrix molecules. In contrast, integrins do not seem to be involved in binding of the myeloma cells to collagen type VI. Instead, inhibition of binding by heparin suggested that membrane-bound heparan sulfate proteoglycans are responsible ligands for binding to collagen type VI. Adhesion assays with several B-cell lines resembling earlier differentiation stages revealed only weak interactions with tenascin and no interactions with collagen type VI, laminin or fibronectin. In summary, the interactions of human myeloma cells with the extracellular matrix may explain the specific retention of the plasma cells within the bone marrow.
Amplified spontaneous emission of pyranyliden derivatives in PVK matrix
NASA Astrophysics Data System (ADS)
Vembris, Aivars; Zarinsh, Elmars; Kokars, Valdis
2016-04-01
One of the well-known red light emitting laser dyes is 4-(dicyanomethylene)-2-methyl-6-(4-dimethylaminostyryl)-4Hpyran (DCM). Amplified spontaneous emission (ASE) has been widely investigated of DCM molecules or its derivatives in polymer or low molecular weight matrix. The main issue for these molecules is aggregation which limits doping concentration in matrix. Lowest ASE threshold values within concentration range of 2 and 4 wt% were obtained. In this work ASE properties of two original DCM derivatives in poly(N-vinylcarbazole) (PVK) at various concentrations will be discussed. One of the derivatives is the same DCM dye with replaced butyl groups at electron donor part with bulky trytiloxyethyl groups (DWK-1). These groups do not influence electron transitions in the dye but prevent aggregation of the molecules. Second derivative (DWK-2) consists of two equal donor groups with the attached trytiloxyethyl groups. All results were compared with DCM:PVK system. Photoluminescence quantum yield (PLQY) is almost three times larger for DWK-1 concentration up to 20wt% with respect to DCM systems. PLQY was saturated on 0.06 at higher DWK-1 concentrations. Bulky trytiloxyethyl groups prevent aggregation of the molecules thus decreasing interaction between dyes and numbers of non-radiative decays. Red shift of photoluminescence and amplified spontaneous emission at higher concentrations were observed due to the solid state solvation effect. Increases of dye density in matrix with smaller lose in PLQY resulted in low ASE threshold energy. The lowest threshold value was obtained around 29 μJ/cm2 in DWK-1:PVK films.
High matrix metalloproteinase activity is a hallmark of periapical granulomas.
de Paula-Silva, Francisco Wanderley Garcia; D'Silva, Nisha J; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine
2009-09-01
The inability to distinguish periapical cysts from granulomas before performing root canal treatment leads to uncertainty in treatment outcomes because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Because matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed by using one-way analysis of variance followed by the Tukey test. We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the MMP family. Compared with cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs) in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared with cysts. Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas unlike periapical cysts.
Biomimetic/Optical Sensors for Detecting Bacterial Species
NASA Technical Reports Server (NTRS)
Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth
2006-01-01
Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites that bind only to molecules matched to the sites; other molecules are excluded. In a sensor according to the proposal, the MIP would feature molecular recognition sites that would bind the specific signaling molecules selectively according to their size, shape, and chemical functionality (see figure). As the film took up the signaling molecules in the molecular recognition sites, the index of refraction and thickness of the film would change, causing a wavelength shift of the peak of the resonance spectrum. It has been estimated that by measuring this wavelength shift, it should be possible to detect as little as 10 picomoles of a peptide signaling compound.
González, Mariela Natacha; de Mello, Wallace; Butler-Browne, Gillian S; Silva-Barbosa, Suse Dayse; Mouly, Vincent; Savino, Wilson; Riederer, Ingo
2017-10-10
The hepatocyte growth factor (HGF) is required for the activation of muscle progenitor cells called satellite cells (SC), plays a role in the migration of proliferating SC (myoblasts), and is present as a soluble factor during muscle regeneration, along with extracellular matrix (ECM) molecules. In this study, we aimed at determining whether HGF is able to interact with ECM proteins, particularly laminin 111 and fibronectin, and to modulate human myoblast migration. We evaluated the expression of the HGF-receptor c-Met, laminin, and fibronectin receptors by immunoblotting, flow cytometry, or immunofluorescence and used Transwell assays to analyze myoblast migration on laminin 111 and fibronectin in the absence or presence of HGF. Zymography was used to check whether HGF could modulate the production of matrix metalloproteinases by human myoblasts, and the activation of MAPK/ERK pathways was evaluated by immunoblotting. We demonstrated that human myoblasts express c-Met, together with laminin and fibronectin receptors. We observed that human laminin 111 and fibronectin have a chemotactic effect on myoblast migration, and this was synergistically increased when low doses of HGF were added. We detected an increase in MMP-2 activity in myoblasts treated with HGF. Conversely, MMP-2 inhibition decreased the HGF-associated stimulation of cell migration triggered by laminin or fibronectin. HGF treatment also induced in human myoblasts activation of MAPK/ERK pathways, whose specific inhibition decreased the HGF-associated stimulus of cell migration triggered by laminin 111 or fibronectin. We demonstrate that HGF induces ERK phosphorylation and MMP production, thus stimulating human myoblast migration on ECM molecules. Conceptually, these data state that the mechanisms involved in the migration of human myoblasts comprise both soluble and insoluble moieties. This should be taken into account to optimize the design of therapeutic cell transplantation strategies by improving the migration of donor cells within the host tissue, a main issue regarding this approach.
Rados, Edita; Pittenauer, Ernst; Frank, Johannes; Varmuza, Kurt; Allmaier, Günter
2018-04-30
We have developed a target system which enables the use of only one target (i.e. target preparation set) for three different laser desorption ionization (LDI)/matrix-assisted laser desorption ionization (MALDI) mass spectrometric instruments. The focus was on analysing small biomolecules with LDI for future use of the system for the study of meteorite samples (carbonaceous chondrites) using devices with different mass spectrometric performance characteristics. Three compounds were selected due to their potential presence in meteoritic chondrites: tryptophan, 2-deoxy-d-ribose and triphenylene. They were prepared (with and without MALDI matrix, i.e. MALDI and LDI) and analysed with three different mass spectrometers (LinTOF/curved field RTOF, LinTOF/RTOF and QqRTOF). The ion sources of two of the instruments were run at high vacuum, and one at intermediate pressure. Two devices used a laser wavelength of 355 nm and one a wavelength of 337 nm. The developed target system operated smoothly with all devices. Tryptophan, 2-deoxy-d-ribose and triphenylene showed similar desorption/ionization behaviour for all instruments using the LDI mode. Interestingly, protonated tryptophan could be observed only with the LinTOF/curved field RTOF device in LDI and MALDI mode, while sodiated molecules were observed with all three instruments (in both ion modes). Deprotonated tryptophan was almost completely obscured by matrix ions in the MALDI mode whereas LDI yielded abundant deprotonated molecules. The presented target system allowed successful analyses of the three compounds using instruments from different vendors with only one preparation showing different analyser performance characteristics. The elemental composition with the QqRTOF analyser and the high-energy 20 keV collision-induced dissociation fragmentation will be important in identifying unknown compounds in chondrites. © 2018 The Authors. Rapid Communications in Mass Spectrometry Published by John Wiley & Sons Ltd.
Chen, Suming; Zheng, Huzhi; Wang, Jianing; Hou, Jian; He, Qing; Liu, Huihui; Xiong, Caiqiao; Kong, Xianglei; Nie, Zongxiu
2013-07-16
Carbon nanodots were applied for the first time as a new matrix for the analysis of low-molecular-weight compounds by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) in both positive- and negative-ion modes. A wide range of small molecules including amino acids, peptides, fatty acids, as well as β-agonists and neutral oligosaccharides were analyzed by MALDI MS with carbon nanodots as the matrix, and the lowest 0.2 fmol limits-of-detection were obtained for octadecanoic acid. Clear sodium and potassium adducts and deprotonated signals were produced in positive- and negative-ion modes. Furthermore, the glucose and uric acid in real samples were quantitatively determined by the internal standard method with the linear range of 0.5-9 mM and 0.1-1.8 mM (R(2) > 0.999), respectively. This work gives new insight into the application of carbon nanodots and provides a general approach for rapid analysis of low-molecular-weight compounds.
Integrins in bone metastasis formation and potential therapeutic implications.
Clëzardin, P
2009-11-01
Integrins constitute a family of cell surface receptors that are heterodimers composed of noncovalently associated alpha and beta subunits. Integrins bind to extracellular matrix proteins and immunogobulin superfamily molecules. They exert a stringent control on cell migration, survival and proliferation. However, their expression and functions are often deregulated in cancer, and many lines of evidence implicate them as key regulators during progression from primary tumor growth to metastasis. Here, we review the role of integrins in bone metastasis formation and present evidence that the use of integrin-targeted therapeutic agents may be an efficient strategy to block tumor metastasis.
Photoinduced orientation in natural rubber
NASA Astrophysics Data System (ADS)
de Souza, Nara C.; Cavalheri, Adriana S.; Brito, Jackeline B.; Job, Aldo E.; Oliveira, Osvaldo N.; Giacometti, José A.; Silva, Josmary R.
2012-04-01
Azobenzene molecules and their derivatives have been widely investigated for their potential applications in optical and electrooptical devices. We have prepared a new guest-host system from natural rubber (NR) impregnated with azobenzene derivative Sudan Red B (SRB). The effects of stretching and immersion time on photoinduced orientation were investigated by birefringence signal measurements. We have found that the molecular orientation increase when the samples are stretched and decrease with the increase of immersion time. The first behavior was explained by using the random coil model and the latter was attributed to increase of the aggregation of SRB into NR matrix.
Santoso, Yusdi; Kapanidis, Achillefs N.
2009-01-01
Gel electrophoresis is a standard biochemical technique used for separating biomolecules on the basis of size and charge. Despite the use of gels in early single-molecule experiments, gel electrophoresis has not been widely adopted for single-molecule fluorescence spectroscopy. We present a novel method that combines gel electrophoresis and single-molecule fluorescence spectroscopy to simultaneously purify and analyze biomolecules in a gel matrix. Our method, in-gel ALEX, uses non-denaturing gels to purify biomolecular complexes of interest from free components, aggregates, and non-specific complexes. The gel matrix also slows down translational diffusion of molecules, giving rise to long, high-resolution time traces without surface immobilization, which allow extended observations of conformational dynamics in a biologically friendly environment. We demonstrated the compatibility of this method with different types of single molecule spectroscopy techniques, including confocal detection and fluorescence-correlation spectroscopy. We demonstrated that in-gel ALEX can be used to study conformational dynamics at the millisecond timescale; by studying a DNA hairpin in gels, we directly observed fluorescence fluctuations due to conformational interconversion between folded and unfolded states. Our method is amenable to the addition of small molecules that can alter the equilibrium and dynamic properties of the system. In-gel ALEX will be a versatile tool for studying structures and dynamics of complex biomolecules and their assemblies. PMID:19863108
Bucher, Tabitha; Kartvelishvily, Elena; Kolodkin-Gal, Ilana
2016-10-09
This work assesses different methodologies to study the impact of small molecule biofilm inhibitors, such as D-amino acids, on the development and resilience of Bacillus subtilis biofilms. First, methods are presented that select for small molecule inhibitors with biofilm-specific targets in order to separate the effect of the small molecule inhibitors on planktonic growth from their effect on biofilm formation. Next, we focus on how inoculation conditions affect the sensitivity of multicellular, floating B. subtilis cultures to small molecule inhibitors. The results suggest that discrepancies in the reported effects of such inhibitors such as D-amino acids are due to inconsistent pre-culture conditions. Furthermore, a recently developed protocol is described for evaluating the contribution of small molecule treatments towards biofilm resistance to antibacterial substances. Lastly, scanning electron microscopy (SEM) techniques are presented to analyze the three-dimensional spatial arrangement of cells and their surrounding extracellular matrix in a B. subtilis biofilm. SEM facilitates insight into the three-dimensional biofilm architecture and the matrix texture. A combination of the methods described here can greatly assist the study of biofilm development in the presence and absence of biofilm inhibitors, and shed light on the mechanism of action of these inhibitors.
Fibrinogen, Riboflavin, and UVA to Immobilize a Corneal Flap – Molecular Mechanisms
Littlechild, Stacy L.; Zhang, Yuntao; Tomich, John M.; Conrad, Gary W.
2012-01-01
Purpose. Tissue glue containing fibrinogen (FIB) and riboflavin (RF), upon exposure to long wavelength ultraviolet light (UVA, 365 nM) has been proposed potentially to solve long-standing problems presented by corneal wound and epithelial ingrowth side-effects from laser-assisted in situ keratomileuis (LASIK). Data presented in a previous study demonstrated an ability of FIB + RF + UVA to adhere two stromal surfaces; however, to our knowledge no molecular mechanisms have been proposed to account for interactions occurring between corneal extracellular matrix (ECM) and tissue glue molecules. Here, we document several covalent and noncovalent interactions between these classes of macromolecules. Methods. SDS-PAGE and Western blot techniques were used to identify covalent interactions between tissue glue molecules and corneal ECM molecules in either the presence or absence of RF and UVA, in vitro and ex vivo. Surface plasmon resonance (SPR) was used to characterize noncovalent interactions, and obtain ka, kd, and KD binding affinity values. Results. SDS-PAGE and Western blot analyses indicated that covalent interactions occurred between neighboring FIB molecules, as well as between FIB and collagen type I (Coll-I) proteins (in vitro and ex vivo). These interactions occurred only in the presence of RF and UVA. SPR data demonstrated the ability of FIB to bind noncovalently to corneal stroma molecules, Coll-I, decorin, dermatan sulfate, and corneal basement membrane molecules, laminin and heparan sulfate – only in the presence of Zn2+. Conclusions. Covalent and (zinc-mediated) noncovalent mechanisms involving FIB and stromal ECM molecules contribute to the adhesion created by FIB + RF + UVA. PMID:22879413
Making molecular balloons in laser-induced explosive boiling of polymer solutions.
Leveugle, Elodie; Sellinger, Aaron; Fitz-Gerald, James M; Zhigilei, Leonid V
2007-05-25
The effect of the dynamic molecular rearrangements leading to compositional segregation is revealed in coarse-grained molecular dynamics simulations of short pulse laser interaction with a polymer solution in a volatile matrix. An internal release of matrix vapor at the onset of the explosive boiling of the overheated liquid is capable of pushing polymer molecules to the outskirts of a transient bubble, forming a polymer-rich surface layer enclosing the volatile matrix material. The results explain unexpected "deflated balloon" structures observed in films deposited by the matrix-assisted pulsed laser evaporation technique.
Spectroscopic studies of clusterization of methanol molecules isolated in a nitrogen matrix
NASA Astrophysics Data System (ADS)
Vaskivskyi, Ye.; Doroshenko, I.; Chernolevska, Ye.; Pogorelov, V.; Pitsevich, G.
2017-12-01
IR absorption spectra of methanol isolated in a nitrogen matrix are recorded at temperatures ranging from 9 to 34 K. The changes in the spectra with increasing matrix temperature are analyzed. Based on quantum-chemical calculations of the geometric and spectral parameters of different methanol clusters, the observed absorption bands are identified. The cluster composition of the sample is determined at each temperature. It is shown that as the matrix is heated there is a redistribution among the different cluster structures in the sample, from smaller to larger clusters.
Monte Carlo study of disorder in HMTA
NASA Astrophysics Data System (ADS)
Goossens, D. J.; Welberry, T. R.
2001-12-01
We investigate disordered solids by automated fitting of a Monte Carlo simulation of a crystal to observed single-crystal diffuse X-ray scattering. This method has been extended to the study of crystals of relatively large organic molecules by using a z-matrix to describe the molecules. This allows exploration of motions within molecules. We refer to the correlated thermal motion observed in benzil, and to the occupational and thermal disorder in the 1:1 adduct of hexamethylenetetramine and azelaic acid, HMTA. The technique is capable of giving insight into modes of vibration within molecules and correlated motions between molecules.
NASA Technical Reports Server (NTRS)
1988-01-01
Langley Research Center researchers invented an advanced polymer, a chemical compound formed by uniting many small molecules to create a complex molecule with different chemical properties. The material is a thermoplastic polyimide that resists solvents. Other polymers of this generic type are soluble in solvents, thus cannot be used where solvents are present. High Technology Services (HTS), Inc. licensed technology and is engaged in development and manufacture of high performance plastics, resins and composite materials. Techimer Materials Division is using technology for composite matrix resins that offer heat resistance and protection from radiation, electrical and chemical degradation. Applications of new polymer include molding resins, adhesives and matrix resins for fiber reinforced composites.
NASA Technical Reports Server (NTRS)
Gordon, W. A.
1975-01-01
Matrix effects related to the chemical form of analyzed materials were studied. An arc in argon was used which was buffered with silver chloride. The effect of chemical form was minimal for a variety of metals, oxides, and carbides representing the most refractory compounds and thermally stable metal-containing molecules. Only four of the most refractory materials known showed significant emission depressions due to incomplete volatilization in the arc system. These results are discussed in terms of vapor pressures of the solid materials placed on the anodes and dissociation reactions of the molecules in the gaseous environment.
Design of 3-D adipospheres for quantitative metabolic study
Akama, Takeshi; Leung, Brendan M.; Labuz, Joseph M.; Takayama, Shuichi; Chun, Tae-Hwa
2017-01-01
Quantitative assessment of adipose mitochondrial activity is critical for better understanding of adipose tissue function in obesity and diabetes. While the two-dimensional (2-D) tissue culture method has been sufficient to discover key molecules that regulate adipocyte differentiation and function, the method is insufficient to determine the role of extracellular matrix (ECM) molecules and their modifiers, such as matrix metalloproteinases (MMPs), in regulating adipocyte function in three-dimensional (3-D) in vivo-like microenvironments. By using a 3-D hanging drop tissue culture system, we are able to produce scalable 3-D adipospheres that are suitable for quantitative mitochondrial study in 3-D microenvironment. PMID:28244051
Coagulation of linear carbon molecules into nanoparticles: a molecular dynamics study
NASA Astrophysics Data System (ADS)
Yamaguchi, Yasutaka; Wakabayashi, Tomonari
2004-04-01
Using molecular dynamics (MD) simulations, the coagulation of carbon chain molecules that occurs on the subliming surface of a carbon-containing rare-gas matrix is investigated. Intermolecular connections with dangling bonds enhance the sublimation of the matrix and that results in the emission of a layer of nested carbon chains into vacuum at a velocity about 100 m/s. The following conversion from carbon sp- to more stable sp 2-type bonds heats up the carbon material above 3000 K. During this process, the nested carbon layer self-anneals via a graphitic mono-layer into a conjunct array of particles with a dimension about 10 nm.
Atom and Bond Fukui Functions and Matrices: A Hirshfeld-I Atoms-in-Molecule Approach.
Oña, Ofelia B; De Clercq, Olivier; Alcoba, Diego R; Torre, Alicia; Lain, Luis; Van Neck, Dimitri; Bultinck, Patrick
2016-09-19
The Fukui function is often used in its atom-condensed form by isolating it from the molecular Fukui function using a chosen weight function for the atom in the molecule. Recently, Fukui functions and matrices for both atoms and bonds separately were introduced for semiempirical and ab initio levels of theory using Hückel and Mulliken atoms-in-molecule models. In this work, a double partitioning method of the Fukui matrix is proposed within the Hirshfeld-I atoms-in-molecule framework. Diagonalizing the resulting atomic and bond matrices gives eigenvalues and eigenvectors (Fukui orbitals) describing the reactivity of atoms and bonds. The Fukui function is the diagonal element of the Fukui matrix and may be resolved in atom and bond contributions. The extra information contained in the atom and bond resolution of the Fukui matrices and functions is highlighted. The effect of the choice of weight function arising from the Hirshfeld-I approach to obtain atom- and bond-condensed Fukui functions is studied. A comparison of the results with those generated by using the Mulliken atoms-in-molecule approach shows low correlation between the two partitioning schemes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Stone, Bradley M.
1998-01-01
The Astrochemistry Group at NASA Ames Research Center is interested in the identification of large organic molecules in the interstellar medium Many smaller organic species (e.g. hydrocarbons, alcohols, etc.) have been previously identified by their radiofrequency signature due to molecular rotations. However, this becomes increasingly difficult to observe as the size of the molecule increases. Our group in interested in the identification of the carriers of the Diffuse Interstellar Bands (absorption features observed throughout the visible and near-infrared in the spectra of stars, due to species in the interstellar medium). Polycyclic Aromatic Hydrocarbons (PAHs) and related molecules are thought to be good candidates for these carriers. Laboratory experiments am performed at Ames to simulate the interstellar environment, and to compare spectra obtained from molecules in the laboratory to those derived astronomically. We are also interested in PAHs with respect to their possible connection to the UIR (Unidentified infrared) and ERE (Extended Red Emission) bands - emission features found to emanate from particular regions of our galaxy (e.g. Orion nebula, Red Rectangle, etc.). An old, "tried and proven spectroscopic technique, matrix isolation spectroscopy creates molecular conditions ideal for performing laboratory astrophysics.
Perić, M; Jerosimić, S; Mitić, M; Milovanović, M; Ranković, R
2015-05-07
In the present study, we prove the plausibility of a simple model for the Renner-Teller effect in tetra-atomic molecules with linear equilibrium geometry by ab initio calculations of the electronic energy surfaces and non-adiabatic matrix elements for the X(2)Πu state of C2H2 (+). This phenomenon is considered as a combination of the usual Renner-Teller effect, appearing in triatomic species, and a kind of the Jahn-Teller effect, similar to the original one arising in highly symmetric molecules. Only four parameters (plus the spin-orbit constant, if the spin effects are taken into account), which can be extracted from ab initio calculations carried out at five appropriate (planar) molecular geometries, are sufficient for building up the Hamiltonian matrix whose diagonalization results in the complete low-energy (bending) vibronic spectrum. The main result of the present study is the proof that the diabatization scheme, hidden beneath the apparent simplicity of the model, can safely be carried out, at small-amplitude bending vibrations, without cumbersome computation of non-adiabatic matrix elements at large number of molecular geometries.
NASA Astrophysics Data System (ADS)
Thallmair, Sebastian; Roos, Matthias K.; de Vivie-Riedle, Regina
2016-06-01
Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstrated for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.
Thallmair, Sebastian; Roos, Matthias K; de Vivie-Riedle, Regina
2016-06-21
Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstrated for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.
Electron-molecule scattering in a strong laser field: Two-center interference effects
NASA Astrophysics Data System (ADS)
Dakić, J.; Habibović, D.; Čerkić, A.; Busuladžić, M.; Milošević, D. B.
2017-10-01
Laser-assisted scattering of electrons on diatomic molecules is considered using the S -matrix theory within the second Born approximation. The first term of the expansion in powers of the scattering potential corresponds to the direct or single laser-assisted scattering of electrons on molecular targets, while the second term of this expansion corresponds to the laser-assisted rescattering or double scattering. The rescattered electrons may have considerably higher energies in the final state than those that scattered only once. For multicenter polyatomic molecules scattering and rescattering may happen at any center and in any order. All these cases contribute to the scattering amplitude and the interference of different contributions leads to an increase or a decrease of the differential cross section in particular electron energy regions. For diatomic molecules there are two such contributions for single scattering and four contributions for double scattering. Analyzing the spectra of the scattered electrons, we find two interesting effects. For certain molecular orientations, the plateaus in the electron energy spectrum, characteristic of laser-assisted electron-atom scattering, are replaced by a sequence of gradually declining maxima, caused by the two-center interference effects. The second effect is the appearance of symmetric U -shaped structures in the angle-resolved energy spectra, which are described very well by the analytical formulas we provide.
Kim, Eunjin; Kang, Hyunook; Choi, Insung; Song, Jihyeon; Mok, Hyejung; Jung, Woong; Yeo, Woon-Seok
2018-05-09
Detection and quantitation of flavonoids are relatively difficult compared to those of other small-molecule analytes because flavonoids undergo rapid metabolic processes, resulting in their elimination from the body. Here, we report an efficient enrichment method for facilitating the analysis of vicinal-diol-containing flavonoid molecules using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In our strategy, boronic-acid-functionalized polyacrylamide particles were used, where boronic acids bound to vicinal diols to form boronate monoesters at basic pH. This complex remained intact during the enrichment processes, and the vicinal-diol-containing flavonoids were easily separated by centrifugation and subsequent acidic treatments. The selectivity and limit of detection of our strategy were confirmed by mass spectrometry analysis, and the validity was assessed by performing the detection and quantitation of quercetin in mouse organs.
Diamond nanowires for highly sensitive matrix-free mass spectrometry analysis of small molecules.
Coffinier, Yannick; Szunerits, Sabine; Drobecq, Hervé; Melnyk, Oleg; Boukherroub, Rabah
2012-01-07
This paper reports on the use of boron-doped diamond nanowires (BDD NWs) as an inorganic substrate for matrix-free laser desorption/ionization mass spectrometry (LDI-MS) analysis of small molecules. The diamond nanowires are prepared by reactive ion etching (RIE) with oxygen plasma of highly boron-doped (the boron level is 10(19) B cm(-3)) or undoped nanocrystalline diamond substrates. The resulting diamond nanowires are coated with a thin silicon oxide layer that confers a superhydrophilic character to the surface. To minimize droplet spreading, the nanowires were chemically functionalized with octadecyltrichlorosilane (OTS) and then UV/ozone treated to reach a final water contact angle of 120°. The sub-bandgap absorption under UV laser irradiation and the heat confinement inside the nanowires allowed desorption/ionization, most likely via a thermal mechanism, and mass spectrometry analysis of small molecules. A detection limit of 200 zeptomole for verapamil was demonstrated.
Hierarchical and non-hierarchical mineralisation of collagen
Liu, Yan; Kim, Young-Kyung; Dai, Lin; Li, Nan; Khan, Sara; Pashley, David H.; Tay, Franklin R.
2010-01-01
Biomineralisation of collagen involves functional motifs incorporated in extracellular matrix protein molecules to accomplish the objectives of stabilising amorphous calcium phosphate into nanoprecursors and directing the nucleation and growth of apatite within collagen fibrils. Here we report the use of small inorganic polyphosphate molecules to template hierarchical intrafibrillar apatite assembly in reconstituted collagen in the presence of polyacrylic acid to sequester calcium and phosphate into transient amorphous nanophases. The use of polyphosphate without a sequestration analogue resulted only in randomly-oriented extrafibrillar precipitations along the fibrillar surface. Conversely, the use of polyacrylic acid without a templating analogue resulted only in non-hierarchical intrafibrillar mineralisation with continuous apatite strands instead of discrete crystallites. The ability of using simple non-protein molecules to recapitulate different levels of structural hierarchy in mineralised collagen signifies the ultimate simplicity in Nature’s biomineralisation design principles and challenges the need for using more complex recombinant matrix proteins in bioengineering applications. PMID:21040969
Matrix-isolation and ab initio study of HKrCCCl and HXeCCCl
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid, E-mail: leonid.khriachtchev@helsinki.fi
2015-12-28
We report on two new noble-gas molecules, HKrCCCl and HXeCCCl, prepared in low-temperature Kr and Xe matrices. These molecules are made by UV photolysis of HCCCl in the matrices and subsequent thermal annealing. The HCCCl precursor is produced by microwave discharge of a mixture of a matrix gas with trichloroethylene (HClC=CCl{sub 2}). The assignments of the new noble-gas molecules are supported by deuteration experiments and quantum chemical calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. No evidence of ClXeCCH, which is computationally reliably stable, is found in the experiments. ClKrCCH as well as themore » Ar compounds HArCCCl and ClArCCH are not observed either, which is in agreement with the calculations.« less
Extracellular Matrix and Redox Signaling in Cellular Responses to Stress.
Roberts, David D
2017-10-20
Cells in multicellular organisms communicate extensively with neighboring cells and distant organs using a variety of secreted proteins and small molecules. Cells also reside in a structural extracellular matrix (ECM), and changes in its composition, mechanical properties, and post-translational modifications provide additional layers of communication. This Forum addresses emerging mechanisms by which redox signaling controls and is controlled by changes in the ECM, focusing on the roles of matricellular proteins. These proteins engage specific cell surface signaling receptors, integrins, and proteoglycans to regulate the biosynthesis and catabolism of redox signaling molecules and the activation of their signal transducers. These signaling pathways, in turn, regulate the composition of ECM and its function. Covalent post-translational modifications of ECM by redox molecules further regulate its structure and function. Recent studies of acute injuries and chronic disease have identified important pathophysiological roles for this cross-talk and new therapeutic opportunities. Antioxid. Redox Signal. 27, 771-773.
ERIC Educational Resources Information Center
Kedney, Mollie G.; Strunk, Kevin B.; Giaquinto, Lisa M.; Wagner, Jennifer A.; Pollack, Sidney; Patton, Walter A.
2007-01-01
Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS or simply MALDI) has become ubiquitous in the identification and analysis of biomacromolecules. As a technique that allows for the molecular weight determination of otherwise nonvolatile molecules, MALDI has had a profound impact in the molecular…
Hashir, Muhammad Ahsan; Stecher, Guenther; Bakry, Rania; Kasemsook, Saowapak; Blassnig, Bernhard; Feuerstein, Isabel; Abel, Gudrun; Popp, Michael; Bobleter, Ortwin; Bonn, Guenther K
2007-01-01
Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF-MS) is a sensitive mass spectrometric technique which utilises acidic materials as matrices for laser energy absorption, desorption and ionisation of analytes. These matrix materials produce background signals particularly in the low-mass range and make the detection and identification of small molecules difficult and nearly impossible. To overcome this problem this paper introduces matrix-free material-enhanced laser desorption/ionisation mass spectrometry (mf-MELDI-MS) for the screening and analysis of small molecules such as carbohydrates. For this purpose, 4,4'-azo-dianiline was immobilised on silica gel enabling the absorption of laser energy sufficient for successful desorption and ionisation of low molecular weight compounds. The particle and pore sizes, the solvent system for suspension and the sample preparation procedures have been optimised. The newly synthesised MELDI material delivered excellent spectra with regard to signal-to-noise ratio and detection sensitivity. Finally, wheat straw degradation products and Salix alba L. plant extracts were analysed proving the high performance and excellent behaviour of the introduced material. Copyright (c) 2007 John Wiley & Sons, Ltd.
Electronic method for autofluorography of macromolecules on two-D matrices. [Patent application
Davidson, J.B.; Case, A.L.
1981-12-30
A method for detecting, localizing, and quantifying macromolecules contained in a two-dimensional matrix is provided which employs a television-based position sensitive detection system. A molecule-containing matrix may be produced by conventional means to produce spots of light at the molecule locations which are detected by the television system. The matrix, such as a gel matrix, is exposed to an electronic camera system including an image-intensifier and secondary electron conduction camera capable of light integrating times of many minutes. A light image stored in the form of a charge image on the camera tube target is scanned by conventional television techniques, digitized, and stored in a digital memory. Intensity of any point on the image may be determined from the number at the memory address of the point. The entire image may be displayed on a television monitor for inspection and photographing or individual spots may be analyzed through selected readout of the memory locations. Compared to conventional film exposure methods, the exposure time may be reduced 100 to 1000 times.
NASA Astrophysics Data System (ADS)
Zhao, Yan; Stratt, Richard M.
2018-05-01
Surprisingly long-ranged intermolecular correlations begin to appear in isotropic (orientationally disordered) phases of liquid crystal forming molecules when the temperature or density starts to close in on the boundary with the nematic (ordered) phase. Indeed, the presence of slowly relaxing, strongly orientationally correlated, sets of molecules under putatively disordered conditions ("pseudo-nematic domains") has been apparent for some time from light-scattering and optical-Kerr experiments. Still, a fully microscopic characterization of these domains has been lacking. We illustrate in this paper how pseudo-nematic domains can be studied in even relatively small computer simulations by looking for order-parameter tensor fluctuations much larger than one would expect from random matrix theory. To develop this idea, we show that random matrix theory offers an exact description of how the probability distribution for liquid-crystal order parameter tensors converges to its macroscopic-system limit. We then illustrate how domain properties can be inferred from finite-size-induced deviations from these random matrix predictions. A straightforward generalization of time-independent random matrix theory also allows us to prove that the analogous random matrix predictions for the time dependence of the order-parameter tensor are similarly exact in the macroscopic limit, and that relaxation behavior of the domains can be seen in the breakdown of the finite-size scaling required by that random-matrix theory.
A chemical proteomics approach reveals Hsp27 as a target for proapoptotic clerodane diterpenes.
Faiella, Laura; Piaz, Fabrizio Dal; Bisio, Angela; Tosco, Alessandra; De Tommasi, Nunziatina
2012-10-01
Clerodane diterpenoids are a class of naturally occurring molecules widely distributed in the Lamiaceae family. Neo-clerodane diterpenoids from Salvia ssp were recently described as compounds inhibiting the proliferation of human cancer cell lines. To gain new insights into molecular mechanism(s) underlying the antitumor potential of this class of compounds, we used a chemical proteomics approach to analyse the cellular interactome of hardwickiic acid (HAA) selected as a representative molecule. HAA was linked to an opportune 1,1'-carbonyldiimidazole modified by 1,12-dodecanediamine and then immobilized on a matrix support. The modified beads were then used as bait for fishing the potential partners of HAA in a U937 cell lysate. We identified heat shock protein 27 (Hsp27), an ATP-independent antiapoptotic chaperone characterized for its tumorigenic and metastatic properties and now referenced as a major therapeutic target in many types of cancer, as a major HAA partner. Here, we also report the study of HAA-Hsp27 interaction by means of a panel of chemical and biological approaches, including surface plasmon resonance measurements limited proteolysis, and biochemical assays. Our data suggest that HAA could provide a potential tool to develop strategies for the discovery of Hsp27 chemical inhibitors.
Direct Observation of Quantum Coherence in Single-Molecule Magnets
NASA Astrophysics Data System (ADS)
Schlegel, C.; van Slageren, J.; Manoli, M.; Brechin, E. K.; Dressel, M.
2008-10-01
Direct evidence of quantum coherence in a single-molecule magnet in a frozen solution is reported with coherence times as long as T2=630±30ns. We can strongly increase the coherence time by modifying the matrix in which the single-molecule magnets are embedded. The electron spins are coupled to the proton nuclear spins of both the molecule itself and, interestingly, also to those of the solvent. The clear observation of Rabi oscillations indicates that we can manipulate the spin coherently, an essential prerequisite for performing quantum computations.
Computational Study of Electron-Molecule Collisions Related to Low-Temperature Plasmas.
NASA Astrophysics Data System (ADS)
Huo, Winifred M.
1997-10-01
Computational study of electron-molecule collisions not only complements experimental measurements, but can also be used to investigate processes not readily accessible experimentally. A number of ab initio computational methods are available for this type of calculations. Here we describe a recently developed technique, the finite element Z-matrix method. Analogous to the R-matrix method, it partitions the space into regions and employs real matrix elements. However, unlike the implementation of the R-matrix method commonly used in atomic and molecular physics,(C. J. Gillan, J. Tennyson, and P. G. Burke, Chapter 10 in Computational Methods for Electron-Molecule Collisions), W. M. Huo and F. A. Gianturco, Editors, Plenum, New York (1995), p. 239. the Z-matrix method is fully variational.(D. Brown and J. C. Light, J. Chem. Phys. 101), 3723 (1994). In the present implementation, a mixed basis of finite elements and Gaussians is used to represent the continuum electron, thus offering full flexibility without imposing fixed boundary conditions. Numerical examples include the electron-impact dissociation of N2 via the metastable A^3Σ_u^+ state, a process which may be important in the lower thermosphere, and the dissociation of the CF radical, a process of interest to plasma etching. To understand the dissociation pathways, large scale quantum chemical calculations have been carried out for all target states which dissociate to the lowest five limits in the case of N_2, and to the lowest two limits in the case of CF. For N_2, the structural calculations clearly show the preference for predissociation if the initial state is the ground X^1Σ_g^+ state, but direct dissociation appears to be preferable if the initial state is the A^3Σ_u^+ state. Multi-configuration SCF target functions are used in the collisional calculation,
Whitby Mudstone, flow from matrix to fractures
NASA Astrophysics Data System (ADS)
Houben, Maartje; Hardebol, Nico; Barnhoorn, Auke; Boersma, Quinten; Peach, Colin; Bertotti, Giovanni; Drury, Martyn
2016-04-01
Fluid flow from matrix to well in shales would be faster if we account for the duality of the permeable medium considering a high permeable fracture network together with a tight matrix. To investigate how long and how far a gas molecule would have to travel through the matrix until it reaches an open connected fracture we investigated the permeability of the Whitby Mudstone (UK) matrix in combination with mapping the fracture network present in the current outcrops of the Whitby Mudstone at the Yorkshire coast. Matrix permeability was measured perpendicular to the bedding using a pressure step decay method on core samples and permeability values are in the microdarcy range. The natural fracture network present in the pavement shows a connected network with dominant NS and EW strikes, where the NS fractures are the main fracture set with an orthogonal fracture set EW. Fracture spacing relations in the pavements show that the average distance to the nearest fracture varies between 7 cm (EW) and 14 cm (NS), where 90% of the matrix is 30 cm away from the nearest fracture. By making some assumptions like; fracture network at depth is similar to what is exposed in the current pavements and open to flow, fracture network is at hydrostatic pressure at 3 km depth, overpressure between matrix and fractures is 10% and a matrix permeability perpendicular to the bedding of 0.1 microdarcy, we have calculated the time it takes for a gas molecule to travel to the nearest fracture. These input values give travel times up to 8 days for a distance of 14 cm. If the permeability is changed to 1 nanodarcy or 10 microdarcy travel times change to 2.2 years or 2 hours respectively.
NASA Astrophysics Data System (ADS)
Buldyreva, Jeanna
2013-06-01
Reliable modeling of radiative transfer in planetary atmospheres requires accounting for the collisional line mixing effects in the regions of closely spaced vibrotational lines as well as in the spectral wings. Because of too high CPU cost of calculations from ab initio potential energy surfaces (if available), the relaxation matrix describing the influence of collisions is usually built by dynamical scaling laws, such as Energy-Corrected Sudden law. Theoretical approaches currently used for calculation of absorption near the band center are based on the impact approximation (Markovian collisions without memory effects) and wings are modeled via introducing some empirical parameters [1,2]. Operating with the traditional non-symmetric metric in the Liouville space, these approaches need corrections of the ECS-modeled relaxation matrix elements ("relaxation times" and "renormalization procedure") in order to ensure the fundamental relations of detailed balance and sum rules.We present an extension to the infrared absorption case of the previously developed [3] for rototranslational Raman scattering spectra of linear molecules non-Markovian approach of ECS-type. Owing to the specific choice of symmetrized metric in the Liouville space, the relaxation matrix is corrected for initial bath-molecule correlations and satisfies non-Markovian sum rules and detailed balance. A few standard ECS parameters determined by fitting to experimental linewidths of the isotropic Q-branch enable i) retrieval of these isolated-line parameters for other spectroscopies (IR absorption and anisotropic Raman scattering); ii) reproducing of experimental intensities of these spectra. Besides including vibrational angular momenta in the IR bending shapes, Coriolis effects are also accounted for. The efficiency of the method is demonstrated on OCS-He and CO_2-CO_2 spectra up to 300 and 60 atm, respectively. F. Niro, C. Boulet, and J.-M. Hartmann, J. Quant. Spectrosc. Radiat. Transf. 88, 483 (2004). H. Tran, C. Boulet, S. Stefani, M. Snels, and G. Piccioni, J. Quant. Spectrosc. Radiat. Transf. 112, 925 (2011). J. Buldyreva and L. Bonamy, Phys. Rev. A 60, 370-376 (1999).
Design and characterization of a plastic optical fiber pH sensor
NASA Astrophysics Data System (ADS)
Ferreira, Licínio; Simões, Pedro; Carvalho, Rui S.; Lopes, Paulo; Ferreira, Mário
2013-11-01
In this paper are present the design and characterization of a pH sensor using plastic optical fiber (POF) technology and a material produced by the sol-gel process with TEOS (tetraethyl orthosilicate) to immobilize universal indicator of pH (comprised of Thymol Blue, Methyl Red, Bromothymol Blue and Phenolphthalein) inside the silica matrix. This matrix is positioned between two extensions of plastic optical fiber tightly positioned at each side with both fibers aligned and sharing a common optical axis. This set will work as a pH sensor since the matrix embedded with indicator and in the presence of a solution (basic or acid solution) will change the optical transmittance properties. The optical source is a superluminescent white LED and the receiver is a photodiode having a good and linear responsivity in the visible spectrum. This pH sensitive matrix has large pores which allow the diffusion of the surrounding fluid molecules into the matrix and thus the close contact of these to the indicator molecules. This contact causes the change of color of the whole matrix allowing proper colorimetric detection by the photodiode. This variation of color associated with the detector wavelength linear response is the base of operation of the proposed device. This pH sensor presents many advantages over the standard and commercial pH meters namely, lightweight, portability and a low cost.
Soft nanocomposites of gelatin and poly(3-hydroxybutyrate) nanoparticles for dual drug release.
Bini, Rafael A; Silva, Mônica F; Varanda, Laudemir C; da Silva, Marcelo A; Dreiss, Cécile A
2017-09-01
We developed a nanocomposite gel composed of gelatin and poly(3-hydroxybutyrate) polymeric nanoparticles (PNP) to be used as an injectable gel for the contemporaneous, dual sustained release of bioactive molecules. The hydrogel matrix was formed by a very simple process, using either the physical gelation of gelatin or the natural enzyme transglutaminase to covalently cross-link the gelatin chains in the presence of embedded PNP. Oscillatory rheological measurements showed that the addition of the PNP induced an increase in the storage modulus compared to pure gelatin gels, for both physical and chemical gels. Micrographs from scanning electron microscopy revealed that the presence of PNP disrupted the native structure of the gelatin chains in the hydrogel matrix. Dual drug encapsulation was achieved with curcumin (CM) in the PNP and naproxen sodium(NS) in the gelatin matrix. In vitro release studies showed that the hydrogel matrix acts both as a physical and chemical barrier, delaying the diffusion of the drugs. An initial burst release was observed in the first hours of the measurement, and around 90% was released on the third day for naproxen sodium. In free PNP, 82% of curcumin was relased after four days, while when PNP were embedded in the gelatin matrix only 40% was released over the same time period. Overall, these simple, sustainable soft nanocomposites show potential as an injectable co-sustained drug release system. Copyright © 2017 Elsevier B.V. All rights reserved.
Yin, Bin; Li, Ke-han; An, Tai; Chen, Tao; Peng, Xiao-zhong
2010-06-01
To investigate the molecular mechanism of nectin-like molecule 1 (NECL1) inhibiting the migration and invasion of U251 glioma cells. We infected U251 glioma cells with adeno-nectin-like molecule 1 (Ad-NECL1) or empty adenovirus (Ad). Transwell and wound healing assays were performed to observe the migration of U251 cells incubated with the cell supernatant from Ad-NECL1 or Ad infected U251 cells. DNA microarray was applied to screen the gene expression profile after the restoration of NECL1 in U251 glioma cell lines. The differential expression of osteopontin (OPN), a gene related to migration and invasion, was further analyzed with semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), Western blot, and immunohistochemistry. The restoration of NECL1 inhibited migration of U251 cells significantly (P<0.05). Altogether 195 genes were found differentially expressed by microarray, in which 175 were up-regulated and 20 down-regulated, including 9 extracellular matrix proteins involved in the migration of cells. Both mRNA and protein expressions of OPN, the most markedly reduced extracellular matrix protein, were found decreased in U251 cells after restoration of NECL1. Immunohistochemical assay also detected an increase of OPN in glioma tissues, related with the progressing of malignant grade. A link might exist between NECL1 and the extracellular matrix protein OPN in inhibiting the migration and invasion of U251 glioma cells.
He, Xiao-Mei; Ding, Jun; Yu, Lei; Hussain, Dilshad; Feng, Yu-Qi
2016-09-01
Quantitative analysis of small molecules by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been a challenging task due to matrix-derived interferences in low m/z region and poor reproducibility of MS signal response. In this study, we developed an approach by applying black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix for the quantitative analysis of small molecules for the first time. Black phosphorus-assisted laser desorption/ionization mass spectrometry (BP/ALDI-MS) showed clear background and exhibited superior detection sensitivity toward quaternary ammonium compounds compared to carbon-based materials. By combining stable isotope labeling (SIL) strategy with BP/ALDI-MS (SIL-BP/ALDI-MS), a variety of analytes labeled with quaternary ammonium group were sensitively detected. Moreover, the isotope-labeled forms of analytes also served as internal standards, which broadened the analyte coverage of BP/ALDI-MS and improved the reproducibility of MS signals. Based on these advantages, a reliable method for quantitative analysis of aldehydes from complex biological samples (saliva, urine, and serum) was successfully established. Good linearities were obtained for five aldehydes in the range of 0.1-20.0 μM with correlation coefficients (R (2)) larger than 0.9928. The LODs were found to be 20 to 100 nM. Reproducibility of the method was obtained with intra-day and inter-day relative standard deviations (RSDs) less than 10.4 %, and the recoveries in saliva samples ranged from 91.4 to 117.1 %. Taken together, the proposed SIL-BP/ALDI-MS strategy has proved to be a reliable tool for quantitative analysis of aldehydes from complex samples. Graphical Abstract An approach for the determination of small molecules was developed by using black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix.
Puri, Anu; Jang, Hyunbum; Yavlovich, Amichai; Masood, M. Athar; Veenstra, Timothy D.; Luna, Carlos; Aranda-Espinoza, Helim; Nussinov, Ruth; Blumenthal, Robert
2011-01-01
Photopolymerizable phospholipid DC8,9PC (1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine) exhibits unique assembly characteristics in the lipid bilayer. Due to the presence of the diacetylene groups, DC8,9PC undergoes polymerization upon UV (254 nm) exposure and assumes chromogenic properties. DC8,9PC photopolymerization in a gel phase matrix lipid 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) monitored by UV-VIS absorption spectroscopy occurred within 2 minutes after UV treatment, whereas no spectral shifts were observed when DC8,9PC was incorporated in a liquid phase matrix 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC). Liquid chromatography-tandem mass spectrometry analysis showed a decrease in DC8,9PC monomer in both DPPC and POPC environments without any change in matrix lipids in UV-treated samples. Molecular Dynamics (MD) simulations of DPPC/DC8,9PC and POPC/DC8,9PC bilayers indicate that the DC8,9PC molecules adjust to the thickness of the matrix lipid bilayer. Furthermore, motions of DC8,9PC in the gel phase bilayer are more restricted than in the fluid bilayer. The restricted motional flexibility of DC8,9PC (in the gel phase) enables the reactive diacetylenes in individual molecules to align and undergo polymerization, whereas the unrestricted motions in the fluid bilayer restrict polymerization due to the lack of appropriate alignment of the DC8,9PC fatty acyl chains. Fluorescence microscopy data indicates homogenous distribution of the lipid probe 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-lissamine rhodamine B sulfonyl ammonium salt (N-Rh-PE) in POPC/DC8,9PC monolayers, but domain formation in DPPC/DC8,9PC monolayers. These results show that the DC8,9PC molecules cluster and assume the preferred conformation in the gel phase matrix for UV-triggered polymerization reaction. PMID:22053903
Harvey, A K; Stack, S T; Chandrasekhar, S
1993-01-01
Interleukin 1 (IL-1) plays a dual role in cartilage matrix degeneration by promoting extracellular proteinase action such as the matrix metalloproteinases (increased degradation) and by suppressing the synthesis of extracellular matrix molecules (inhibition of repair). Platelet-derived growth factor (PDGF) is a wound-healing hormone which is released along with IL-1 during the inflammatory response. Since previous studies have shown that PDGF enhances IL-1 alpha effects on metalloproteinase activity, in this report, we have examined whether PDGF modifies IL-1 beta effects on cartilage proteoglycan synthesis. Initially, we confirmed that rabbit articular chondrocytes treated with IL-1 beta + PDGF induced higher proteinase activity, in comparison with IL-1-treated cells. We further observed that the increased proteinase activity correlated with an increase in the synthesis of collagenase/stromelysin proteins and a corresponding increase in the steady-state mRNA levels for both the enzymes. Studies on IL-1 receptor expression suggested that PDGF caused an increase in IL-1 receptor expression which, by augmenting the IL-1 response, may have led to the increase in proteinase induction. Analysis of proteoglycan synthesis confirmed that IL-1 reduced the incorporation of sulphated proteoglycan, aggrecan, into the extracellular matrix of chondrocytes, whereas PDGF stimulated it. However, cells treated with IL-1 + PDGF synthesized normal levels of aggrecan. This is in contrast with cells treated with IL-1 + fibroblast growth factor, in which case only proteinase activity was potentiated. The results allow us to conclude that (a) the two effector functions that play a role in matrix remodelling, namely matrix lysis (proteinase induction) and matrix repair (proteoglycan synthesis), occur via distinct pathways and (b) PDGF may play a crucial role in cartilage repair by initially causing matrix degradation followed by promoting new matrix synthesis. Images Figure 1 Figure 2 Figure 5 Figure 6 PMID:8503839
Mathews Griner, Lesley A.; Guha, Rajarshi; Shinn, Paul; Young, Ryan M.; Keller, Jonathan M.; Liu, Dongbo; Goldlust, Ian S.; Yasgar, Adam; McKnight, Crystal; Boxer, Matthew B.; Duveau, Damien Y.; Jiang, Jian-Kang; Michael, Sam; Mierzwa, Tim; Huang, Wenwei; Walsh, Martin J.; Mott, Bryan T.; Patel, Paresma; Leister, William; Maloney, David J.; Leclair, Christopher A.; Rai, Ganesha; Jadhav, Ajit; Peyser, Brian D.; Austin, Christopher P.; Martin, Scott E.; Simeonov, Anton; Ferrer, Marc; Staudt, Louis M.; Thomas, Craig J.
2014-01-01
The clinical development of drug combinations is typically achieved through trial-and-error or via insight gained through a detailed molecular understanding of dysregulated signaling pathways in a specific cancer type. Unbiased small-molecule combination (matrix) screening represents a high-throughput means to explore hundreds and even thousands of drug–drug pairs for potential investigation and translation. Here, we describe a high-throughput screening platform capable of testing compounds in pairwise matrix blocks for the rapid and systematic identification of synergistic, additive, and antagonistic drug combinations. We use this platform to define potential therapeutic combinations for the activated B-cell–like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL). We identify drugs with synergy, additivity, and antagonism with the Bruton’s tyrosine kinase inhibitor ibrutinib, which targets the chronic active B-cell receptor signaling that characterizes ABC DLBCL. Ibrutinib interacted favorably with a wide range of compounds, including inhibitors of the PI3K-AKT-mammalian target of rapamycin signaling cascade, other B-cell receptor pathway inhibitors, Bcl-2 family inhibitors, and several components of chemotherapy that is the standard of care for DLBCL. PMID:24469833
Kang, Sung Un; Choi, Jae Won; Chang, Jae Won; Kim, Kang Il; Kim, Yeon Soo; Park, Ju Kyeong; Kim, Yang Eun; Lee, Yun Sang; Yang, Sang Sik; Kim, Chul-Ho
2017-02-01
Advances in physics and biology have made it possible to apply non-thermal atmospheric pressure plasma (NTP) in the biomedical field. Although accumulating evidence suggests that NTP has various medicinal effects, such as facilitating skin wound healing on exposed tissue while minimizing undesirable tissue damage, the underlying molecular mechanisms are not fully understood. In this study, NTP generated from N 2 optimized wound healing in the scratch wound healing assay. In addition, matrix metalloproteinase (MMP)-9 expression and enzyme activity increased and the urokinase-type plasminogen activator (uPA) system was activated after NTP treatment. We also showed that NTP treatment increased Slug and TCF8/ZEB1 expression and decreased that of E-cadherin, suggesting induction of the epithelial-to-mesenchymal transition (EMT). The effect of N 2 NTP was verified on rat wound model. Taken together, these results suggest that N 2 NTP promotes wound healing by inducing the EMT and activating the MMP-9/uPA system. These findings show the therapeutic potential of NTP for skin wound healing. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Rowthu, Sriharitha; Balic, Edin E.; Hoffmann, Patrik
2017-12-01
Accomplishing mechanically robust omniphobic surfaces is a long-existing challenge, and can potentially find applications in bioengineering, tribology and paint industries. Slippery liquid impregnated mesoporous α-Al2O3 interfaces are achieved with water, alkanes, water based and oil based high viscosity acrylic paints. Incredibly high abrasion-resistance (wear coefficients ≤10-8 mm3 N-1 m-1) and ultra-low friction coefficients (≥0.025) are attained, attributing to the hard alumina matrix and continuous replenishment of perfluoropolyether aided by capillarity and surface diffusion processes. A variety of impregnating liquids employed suggest that large molecules, faster surface diffusion and lowest evaporation rate generate the rare combination of high wear-resistance and omniphobicity. It is noteworthy that these novel liquid impregnated Al2O3 composites exhibit outstanding load bearing capacity up to 350 MPa; three orders of magnitude higher than achievable by the state of the art omniphobic surfaces. Further, our developed thermodynamic calculations suggest that the relative thermodynamic stability of liquid impregnated composites is linearly proportional to the spreading coefficient (S) of the impregnating liquid with the matrix material and is an important tool for the selection of an appropriate matrix material for a given liquid.
Bourboulia, Dimitra; Stetler-Stevenson, William G.
2010-01-01
Cells adhere to one another and/or to matrices that surround them. Regulation of cell-cell (intercellular) and cell-matrix adhesion is tightly controlled in normal cells, however, defects in cell adhesion are common in the majority of humancancers. Multilateral communication among tumor cells with the extracellular matrix (ECM) and neighbor cells is accomplished through adhesion molecules, ECM components, proteolytic enzymes and their endogenous inhibitors. There is sufficient evidence to suggest that reduced adherence is a tumor cell propertyengaged during tumor progression. Tumor cells acquire the ability to change shape, detach and easily move through spaces disorganizing the normal tissue architecture. This property is due to changes in expression levels of adhesion molecules and/or due to elevated levels of secreted proteolytic enzymes, including matrix metalloproteinases (MMPs). Among other roles, MMPsdegrade the ECMand, therefore, prepare the path for tumor cells to migrate, invade and spread to distant secondary areas, where they form metastasis. Tissue Inhibitors of Metalloproteinases or TIMPs control MMP activities and, therefore, minimize matrix degradation. Both MMPs and TIMPs are involved in tissue remodeling and decisively regulate tumor cell progression including tumor angiogenesis. In this review, we describe and discuss data that support the important role of MMPs and TIMPs in cancer cell adhesion and tumor progression. PMID:20470890
Fares, Rafaelle Christine Gomes; Gomes, Juliana de Assis Silva; Garzoni, Luciana Ribeiro; Waghabi, Mariana Caldas; Saraiva, Roberto Magalhães; Medeiros, Nayara Ingrid; Oliveira-Prado, Roberta; Sangenis, Luiz Henrique Conde; Chambela, Mayara da Costa; de Araújo, Fernanda Fortes; Teixeira-Carvalho, Andréa; Damásio, Marcos Paulo; Valente, Vanessa Azevedo; Ferreira, Karine Silvestre; Sousa, Giovane Rodrigo; Rocha, Manoel Otávio da Costa
2013-01-01
Dilated chronic cardiomyopathy (DCC) from Chagas disease is associated with myocardial remodeling and interstitial fibrosis, resulting in extracellular matrix (ECM) changes. In this study, we characterized for the first time the serum matrix metalloproteinase 2 (MMP-2) and MMP-9 levels, as well as their main cell sources in peripheral blood mononuclear cells from patients presenting with the indeterminate (IND) or cardiac (CARD) clinical form of Chagas disease. Our results showed that serum levels of MMP-9 are associated with the severity of Chagas disease. The analysis of MMP production by T lymphocytes showed that CD8+ T cells are the main mononuclear leukocyte source of both MMP-2 and MMP-9 molecules. Using a new 3-dimensional model of fibrosis, we observed that sera from patients with Chagas disease induced an increase in the extracellular matrix components in cardiac spheroids. Furthermore, MMP-2 and MMP-9 showed different correlations with matrix proteins and inflammatory cytokines in patients with Chagas disease. Our results suggest that MMP-2 and MMP-9 show distinct activities in Chagas disease pathogenesis. While MMP-9 seems to be involved in the inflammation and cardiac remodeling of Chagas disease, MMP-2 does not correlate with inflammatory molecules. PMID:23856618
Immobilized fluid membranes for gas separation
Liu, Wei; Canfield, Nathan L; Zhang, Jian; Li, Xiaohong Shari; Zhang, Jiguang
2014-03-18
Provided herein are immobilized liquid membranes for gas separation, methods of preparing such membranes and uses thereof. In one example, the immobilized membrane includes a porous metallic host matrix and an immobilized liquid fluid (such as a silicone oil) that is immobilized within one or more pores included within the porous metallic host matrix. The immobilized liquid membrane is capable of selective permeation of one type of molecule (such as oxygen) over another type of molecule (such as water). In some examples, the selective membrane is incorporated into a device to supply oxygen from ambient air to the device for electrochemical reactions, and at the same time, to block water penetration and electrolyte loss from the device.
Statistical Analysis of Big Data on Pharmacogenomics
Fan, Jianqing; Liu, Han
2013-01-01
This paper discusses statistical methods for estimating complex correlation structure from large pharmacogenomic datasets. We selectively review several prominent statistical methods for estimating large covariance matrix for understanding correlation structure, inverse covariance matrix for network modeling, large-scale simultaneous tests for selecting significantly differently expressed genes and proteins and genetic markers for complex diseases, and high dimensional variable selection for identifying important molecules for understanding molecule mechanisms in pharmacogenomics. Their applications to gene network estimation and biomarker selection are used to illustrate the methodological power. Several new challenges of Big data analysis, including complex data distribution, missing data, measurement error, spurious correlation, endogeneity, and the need for robust statistical methods, are also discussed. PMID:23602905
Nanostructured transition metal oxides useful for water oxidation catalysis
Frei, Heinz M; Jiao, Feng
2013-12-24
The present invention provides for a composition comprising a nanostructured transition metal oxide capable of oxidizing two H.sub.2O molecules to obtain four protons. In some embodiments of the invention, the composition further comprises a porous matrix wherein the nanocluster of the transition metal oxide is embedded on and/or in the porous matrix.
Mahale, Alka; Fikri, Fatma; Al Hati, Khitam; Al Shahwan, Sami; Al Jadaan, Ibrahim; Al Katan, Hind; Khandekar, Rajiv; Maktabi, Azza; Edward, Deepak P
2017-01-01
Impervious encapsulation around Ahmed glaucoma valve (AGV) results in surgical failure raising intraocular pressure (IOP). Dysregulation of extracellular matrix (ECM) molecules and cellular factors might contribute to increased hydraulic resistance to aqueous drainage. Therefore, we examined these molecules in failed AGV capsular tissue. Immunostaining for ECM molecules (collagen I, collagen III, decorin, lumican, chondroitin sulfate, aggrecan and keratan sulfate) and cellular factors (αSMA and TGFβ) was performed on excised capsules from failed AGVs and control tenon's tissue. Staining intensity of ECM molecules was assessed using Image J. Cellular factors were assessed based on positive cell counts. Histopathologically two distinct layers were visible in capsules. The inner layer (proximal to the AGV) showed significant decrease in most ECM molecules compared to outer layer. Furthermore, collagen III (p = 0.004), decorin (p = 0.02), lumican (p = 0.01) and chondroitin sulfate (p = 0.02) was significantly less in inner layer compared to tenon's tissue. Outer layer labelling however was similar to control tenon's for most ECM molecules. Significantly increased cellular expression of αSMA (p = 0.02) and TGFβ (p = 0.008) was detected within capsular tissue compared to controls. Our results suggest profibrotic activity indicated by increased αSMA and TGFβ expression and decreased expression of proteoglycan (decorin and lumican) and glycosaminoglycans (chondroitin sulfate). Additionally, we observed decreased collagen III which might reflect increased myofibroblast contractility when coupled with increased TGFβ and αSMA expression. Together these events lead to tissue dysfunction potentially resulting in hydraulic resistance that may affect aqueous flow through the capsular wall.
Optical fingerprint of non-covalently functionalized transition metal dichalcogenides
NASA Astrophysics Data System (ADS)
Feierabend, Maja; Malic, Ermin; Knorr, Andreas; Berghäuser, Gunnar
2017-09-01
Atomically thin transition metal dichalcogenides (TMDs) hold promising potential for applications in optoelectronics. Due to their direct band gap and the extraordinarily strong Coulomb interaction, TMDs exhibit efficient light-matter coupling and tightly bound excitons. Moreover, large spin orbit coupling in combination with circular dichroism allows for spin and valley selective optical excitation. As atomically thin materials, they are very sensitive to changes in the surrounding environment. This motivates a functionalization approach, where external molecules are adsorbed to the materials surface to tailor its optical properties. Here, we apply the density matrix theory to investigate the potential of non-covalently functionalized monolayer TMDs. Considering exemplary molecules with a strong dipole moment, we predict spectral redshifts and the appearance of an additional side peak in the absorption spectrum of functionalized TMDs. We show that the molecular characteristics, e.g. coverage, orientation and dipole moment, crucially influence the optical properties of TMDs, leaving a unique optical fingerprint in the absorption spectrum. Furthermore, we find that the molecular dipole moments open a channel for coherent intervalley coupling between the high-symmetry K and K\\prime points which may create new possibilities for spin-valleytronics application.
NASA Astrophysics Data System (ADS)
Wall, Michael
2014-03-01
Experimental progress in generating and manipulating synthetic quantum systems, such as ultracold atoms and molecules in optical lattices, has revolutionized our understanding of quantum many-body phenomena and posed new challenges for modern numerical techniques. Ultracold molecules, in particular, feature long-range dipole-dipole interactions and a complex and selectively accessible internal structure of rotational and hyperfine states, leading to many-body models with long range interactions and many internal degrees of freedom. Additionally, the many-body physics of ultracold molecules is often probed far from equilibrium, and so algorithms which simulate quantum many-body dynamics are essential. Numerical methods which are to have significant impact in the design and understanding of such synthetic quantum materials must be able to adapt to a variety of different interactions, physical degrees of freedom, and out-of-equilibrium dynamical protocols. Matrix product state (MPS)-based methods, such as the density-matrix renormalization group (DMRG), have become the de facto standard for strongly interacting low-dimensional systems. Moreover, the flexibility of MPS-based methods makes them ideally suited both to generic, open source implementation as well as to studies of the quantum many-body dynamics of ultracold molecules. After introducing MPSs and variational algorithms using MPSs generally, I will discuss my own research using MPSs for many-body dynamics of long-range interacting systems. In addition, I will describe two open source implementations of MPS-based algorithms in which I was involved, as well as educational materials designed to help undergraduates and graduates perform research in computational quantum many-body physics using a variety of numerical methods including exact diagonalization and static and dynamic variational MPS methods. Finally, I will mention present research on ultracold molecules in optical lattices, such as the exploration of many-body physics with polyatomic molecules, and the next generation of open source matrix product state codes. This work was performed in the research group of Prof. Lincoln D. Carr.
FTIR Monitoring Of Curing Of Composites
NASA Technical Reports Server (NTRS)
Druy, Mark A.; Stevenson, William A.; Young, Philip R.
1990-01-01
Infrared-sensing optical fiber system developed to monitor principal infrared absorption bands resulting from vibrations of atoms and molecules as chemical bonds form when resin cured. System monitors resin chemistry more directly. Used to obtain Fourier transform infrared (FTIR) spectrum from graphite fiber/polyimide matrix resin prepreg. Embedded fiber optic FTIR sensor used to indicate state of cure of thermosetting composite material. Developed primarily to improve quality of advanced composites, many additional potential applications exist because principal of operation applicable to all organic materials and most inorganic gases. Includes monitoring integrities of composite materials in service, remote sensing of hazardous materials, and examination of processes in industrial reactors and furnaces.
NASA Astrophysics Data System (ADS)
Zhuo, Shuangmu; Chen, Jianxin; Xie, Shusen; Hong, Zhibin; Jiang, Xingshan
2009-03-01
Intrinsic two-photon excited fluorescence (TPEF) and second-harmonic generation (SHG) signals are shown to differentiate between normal and neoplastic human esophageal stroma. It was found that TPEF and SHG signals from normal and neoplastic stroma exhibit different organization features, providing quantitative information about the biomorphology and biochemistry of tissue. By comparing normal with neoplastic stroma, there were significant differences in collagen-related changes, elastin-related changes, and alteration in proportions of matrix molecules, giving insight into the stromal changes associated with cancer progression and providing substantial potential to be applied in vivo to the clinical diagnosis of epithelial precancers and cancers.
Measurement Of Molecular Mobilities Of Polymers
NASA Technical Reports Server (NTRS)
Kim, Soon Sam; Tsay, Fun-Dow
1989-01-01
New molecular-probe technique used to measure molecular mobility of polymer. Method based on use of time-resolved electron-spin resonance (ESR) spectroscopy to monitor decay of transient nutation amplitudes from photoexcited triplet states of probe molecules with which polymer is doped. The higher molecular mobility of polymer matrix, the faster nutation amplitudes of the probe molecules decay.
Friends Turned Foes: Angiogenic Growth Factors beyond Angiogenesis.
Matkar, Pratiek N; Ariyagunarajah, Ramya; Leong-Poi, Howard; Singh, Krishna K
2017-10-02
Angiogenesis, the formation of new blood vessels from pre-existing ones is a biological process that ensures an adequate blood flow is maintained to provide the cells with a sufficient supply of nutrients and oxygen within the body. Numerous soluble growth factors and inhibitors, cytokines, proteases as well as extracellular matrix proteins and adhesion molecules stringently regulate the multi-factorial process of angiogenesis. The properties and interactions of key angiogenic molecules such as vascular endothelial growth factors (VEGFs), fibroblast growth factors (FGFs) and angiopoietins have been investigated in great detail with respect to their molecular impact on angiogenesis. Since the discovery of angiogenic growth factors, much research has been focused on their biological actions and their potential use as therapeutic targets for angiogenic or anti-angiogenic strategies in a context-dependent manner depending on the pathologies. It is generally accepted that these factors play an indispensable role in angiogenesis. However, it is becoming increasingly evident that this is not their only role and it is likely that the angiogenic factors have important functions in a wider range of biological and pathological processes. The additional roles played by these molecules in numerous pathologies and biological processes beyond angiogenesis are discussed in this review.
Friends Turned Foes: Angiogenic Growth Factors beyond Angiogenesis
Matkar, Pratiek N.; Ariyagunarajah, Ramya; Leong-Poi, Howard; Singh, Krishna K.
2017-01-01
Angiogenesis, the formation of new blood vessels from pre-existing ones is a biological process that ensures an adequate blood flow is maintained to provide the cells with a sufficient supply of nutrients and oxygen within the body. Numerous soluble growth factors and inhibitors, cytokines, proteases as well as extracellular matrix proteins and adhesion molecules stringently regulate the multi-factorial process of angiogenesis. The properties and interactions of key angiogenic molecules such as vascular endothelial growth factors (VEGFs), fibroblast growth factors (FGFs) and angiopoietins have been investigated in great detail with respect to their molecular impact on angiogenesis. Since the discovery of angiogenic growth factors, much research has been focused on their biological actions and their potential use as therapeutic targets for angiogenic or anti-angiogenic strategies in a context-dependent manner depending on the pathologies. It is generally accepted that these factors play an indispensable role in angiogenesis. However, it is becoming increasingly evident that this is not their only role and it is likely that the angiogenic factors have important functions in a wider range of biological and pathological processes. The additional roles played by these molecules in numerous pathologies and biological processes beyond angiogenesis are discussed in this review. PMID:28974056
Sangboonruang, S; Thammasit, P; Intasai, N; Kasinrerk, W; Tayapiwatana, C; Tragoolpua, K
2014-06-01
Extracellular matrix metalloproteinase inducer (EMMPRIN) exhibits overexpression in various cancers and promotes cancer progression and metastasis via the interaction with its associated molecules. The scFv-M6-1B9 intrabody has a potential ability to reduce EMMPRIN cell surface expression. However, the subsequent effect of scFv-M6-1B9 intrabody-mediated EMMPRIN abatement on its related molecules, α3β1-integrin, MCT1, MMP-2 and MMP-9, is undefined. Our results demonstrated that the scFv-M6-1B9 intrabody efficiently decreased α3β1-integrin cell surface expression levels. In addition, intracellular accumulation of MCT1 and lactate were increased. These results lead to suppression of features characteristic for tumor progression, including cell migration, proliferation and invasion, in a colorectal cancer cell line (Caco-2) although there was no difference in MMP expression. Thus, EMMPRIN represents an attractive target molecule for the disruption of cancer proliferation and metastasis. An scFv-M6-1B9 intrabody-based approach could be relevant for cancer gene therapy.
Gopi, R; Ramanathan, N; Sundararajan, K
2014-07-24
The 1:1 hydrogen-bonded complex of fluoroform and hydrogen chloride was studied using matrix-isolation infrared spectroscopy and ab initio computations. Using B3LYP and MP2 levels of theory with 6-311++G(d,p) and aug-cc-pVDZ basis sets, the structures of the complexes and their energies were computed. For the 1:1 CHF3-HCl complexes, ab initio computations showed two minima, one cyclic and the other acyclic. The cyclic complex was found to have C-H · · · Cl and C-F · · · H interactions, where CHF3 and HCl sub-molecules act as proton donor and proton acceptor, respectively. The second minimum corresponded to an acyclic complex stabilized only by the C-F · · · H interaction, in which CHF3 is the proton acceptor. Experimentally, we could trap the 1:1 CHF3-HCl cyclic complex in an argon matrix, where a blue-shift in the C-H stretching mode of the CHF3 sub-molecule was observed. To understand the nature of the interactions, Atoms in Molecules and Natural Bond Orbital analyses were carried out to unravel the reasons for blue-shifting of the C-H stretching frequency in these complexes.
González, Oskar; van Vliet, Michael; Damen, Carola W N; van der Kloet, Frans M; Vreeken, Rob J; Hankemeier, Thomas
2015-06-16
The possible presence of matrix effect is one of the main concerns in liquid chromatography-mass spectrometry (LC-MS)-driven bioanalysis due to its impact on the reliability of the obtained quantitative results. Here we propose an approach to correct for the matrix effect in LC-MS with electrospray ionization using postcolumn infusion of eight internal standards (PCI-IS). We applied this approach to a generic ultraperformance liquid chromatography-time-of-flight (UHPLC-TOF) platform developed for small-molecule profiling with a main focus on drugs. Different urine samples were spiked with 19 drugs with different physicochemical properties and analyzed in order to study matrix effect (in absolute and relative terms). Furthermore, calibration curves for each analyte were constructed and quality control samples at different concentration levels were analyzed to check the applicability of this approach in quantitative analysis. The matrix effect profiles of the PCI-ISs were different: this confirms that the matrix effect is compound-dependent, and therefore the most suitable PCI-IS has to be chosen for each analyte. Chromatograms were reconstructed using analyte and PCI-IS responses, which were used to develop an optimized method which compensates for variation in ionization efficiency. The approach presented here improved the results in terms of matrix effect dramatically. Furthermore, calibration curves of higher quality are obtained, dynamic range is enhanced, and accuracy and precision of QC samples is increased. The use of PCI-ISs is a very promising step toward an analytical platform free of matrix effect, which can make LC-MS analysis even more successful, adding a higher reliability in quantification to its intrinsic high sensitivity and selectivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valdez, Carlos A.; Vu, Alexander K.
Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.
Mobasheri, Ali; Henrotin, Yves; Biesalski, Hans-Konrad; Shakibaei, Mehdi
2012-01-01
Interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) are key cytokines that drive the production of inflammatory mediators and matrix-degrading enzymes in osteoarthritis (OA). These proinflammatory cytokines bind to their respective cell surface receptors and activate inflammatory signaling pathways culminating with the activation of nuclear factor κB (NF-κB), a transcription factor that can be triggered by a host of stress-related stimuli including, excessive mechanical stress and ECM degradation products. Once activated, NF-κB regulates the expression of many cytokines, chemokines, adhesion molecules, inflammatory mediators, and several matrix-degrading enzymes. Therefore, proinflammatory cytokines, their cell surface receptors, NF-κB and downstream signaling pathways are therapeutic targets in OA. This paper critically reviews the recent literature and outlines the potential prophylactic properties of plant-derived phytochemicals such as curcumin and resveratrol for targeting NF-κB signaling and inflammation in OA to determine whether these phytochemicals can be used as functional foods.
Sharma, Vishal; Köllmer, Melanie; Szymusiak, Magdalena; Nitsche, Ludwig C; Gemeinhart, Richard A; Liu, Ying
2014-03-10
Heterogeneous toroidal-spiral particles (TSPs) were generated by polymer droplet sedimentation, interaction, and cross-linking. TSPs provide a platform for encapsulation and release of multiple compounds of different sizes and physicochemical properties. As a model system, we demonstrate the encapsulation and independently controlled release of an anti-VEGFR-2 antibody and irinotecan for the treatment of glioblastoma multiforme. The anti-VEGFR-2 antibody was released from the TS channels and its binding to HUVECs was confirmed by confocal microscopy and flow cytometry, suggesting active antibody encapsulation and release. Irinotecan, a small molecule drug, was released from the dense polymer matrix of poly(ethylene glycol) diacrylate (MW ~ 700 g/mol; PEGDA 700). Released irinotecan inhibited the proliferation of U251 malignant glioma cells. Since the therapeutic compounds are released through different pathways, specifically diffusion through the polymer matrix versus TS channels, the release rate can be controlled independently through the design of the structure and material of particle components.
Yoosefian, Mehdi; Etminan, Nazanin
2018-06-01
We have designed a novel nanobiosensor for in silico detecting proteins based on leucine/Pd-loaded single-walled carbon nanotube matrix. Density functional theory at the B3LYP/6-31G (d) level of theory was realized to analyze the geometrical and electronic structure of the proposed nanobiosensor. The solvent effects were investigated using the Tomasi's polarized continuum model. Atoms-in-molecules theory was used to study the nature of interactions by calculating the electron density ρ(r) and Laplacian at the bond critical points. Natural bond orbital analysis was performed to achieve a deep understanding of the nature of the interactions. The biosensor has potential application for high sensitive and rapid response to protein due to the chemical adsorption of L-leucine amino acid onto Pd-loaded single-walled carbon nanotube and reactive functional groups that can incorporate in hydrogen binding, hydrophobic interactions and van der Waals forces with the protein surface in detection process.
Gaudana, Ripal; Parenky, Ashwin; Vaishya, Ravi; Samanta, Swapan K; Mitra, Ashim K
2011-01-01
The objective of this study was to develop and characterize a nanoparticulate-based sustained release formulation of a water soluble dipeptide prodrug of dexamethasone, valine-valine-dexamethasone (VVD). Being hydrophilic in nature, it readily leaches out in the external aqueous medium and hence partitions poorly into the polymeric matrix resulting in minimal entrapment in nanoparticles. Hence, hydrophobic ion pairing (HIP) complexation of the prodrug was employed with dextran sulphate as a complexing polymer. A novel, solid in oil in water emulsion method was employed to encapsulate the prodrug in HIP complex form in poly(lactic-co-glycolic acid) matrix. Nanoparticles were characterized with respect to size, zeta potential, crystallinity of entrapped drug and surface morphology. A significant enhancement in the entrapment of the prodrug in nanoparticles was achieved. Finally, a simple yet novel method was developed which can also be applicable to encapsulate other charged hydrophilic molecules, such as peptides and proteins.
Engineering hydrogels as extracellular matrix mimics
Geckil, Hikmet; Xu, Feng; Zhang, Xiaohui; Moon, SangJun
2010-01-01
Extracellular matrix (ECM) is a complex cellular environment consisting of proteins, proteoglycans, and other soluble molecules. ECM provides structural support to mammalian cells and a regulatory milieu with a variety of important cell functions, including assembling cells into various tissues and organs, regulating growth and cell–cell communication. Developing a tailored in vitro cell culture environment that mimics the intricate and organized nanoscale meshwork of native ECM is desirable. Recent studies have shown the potential of hydrogels to mimic native ECM. Such an engineered native-like ECM is more likely to provide cells with rational cues for diagnostic and therapeutic studies. The research for novel biomaterials has led to an extension of the scope and techniques used to fabricate biomimetic hydrogel scaffolds for tissue engineering and regenerative medicine applications. In this article, we detail the progress of the current state-of-the-art engineering methods to create cell-encapsulating hydrogel tissue constructs as well as their applications in in vitro models in biomedicine. PMID:20394538
Lack of Collagen VI Promotes Wound-Induced Hair Growth.
Chen, Peiwen; Cescon, Matilde; Bonaldo, Paolo
2015-10-01
Collagen VI is an extracellular matrix molecule that is abundantly expressed in the skin. However, the role of collagen VI in hair follicle growth is unknown. Here, we show that collagen VI is strongly deposited in hair follicles, and is markedly upregulated by skin wounding. Lack of collagen VI in Col6a1(-/-) mice delays hair cycling and growth under physiological conditions, but promotes wound-induced hair regrowth without affecting skin regeneration. Conversely, addition of purified collagen VI rescues the abnormal wound-induced hair regrowth in Col6a1(-/-) mice. Mechanistic studies revealed that the increased wound-induced hair regrowth of Col6a1(-/-) mice is triggered by activation of the Wnt/β-catenin signaling pathway, and is abolished by inhibition of this pathway. These findings highlight the essential relationships between extracellular matrix (ECM) and hair follicle regeneration, and suggest that collagen VI could be a potential therapeutic target for hair loss and other skin-related diseases.
Hadler-Olsen, Elin; Winberg, Jan-Olof; Uhlin-Hansen, Lars
2013-08-01
Biomarkers are used as tools in cancer diagnostics and in treatment stratification. In most cancers, there are increased levels of one or several members of the matrix metalloproteinases (MMPs). This is a family of proteolytic enzymes that are involved in many phases of cancer progression, including angiogenesis, invasiveness, and metastasis. It has therefore been expected that MMPs could serve as both diagnostic and prognostic markers in cancer patients, but despite a huge number of studies, it has been difficult to establish MMPs as cancer biomarkers. In the present paper, we assess some of the challenges associated with MMP research as well as putative reasons for the conflicting data on the value of these enzymes as diagnostic and prognostic markers in cancer patients. We also review the prognostic value of a number of MMPs in patients with lung, colorectal, breast, and prostate cancers. The review also discusses MMPs as potential target molecules for therapeutic agents and new strategies for development of such drugs.
HO2 rovibrational eigenvalue studies for nonzero angular momentum
NASA Astrophysics Data System (ADS)
Wu, Xudong T.; Hayes, Edward F.
1997-08-01
An efficient parallel algorithm is reported for determining all bound rovibrational energy levels for the HO2 molecule for nonzero angular momentum values, J=1, 2, and 3. Performance tests on the CRAY T3D indicate that the algorithm scales almost linearly when up to 128 processors are used. Sustained performance levels of up to 3.8 Gflops have been achieved using 128 processors for J=3. The algorithm uses a direct product discrete variable representation (DVR) basis and the implicitly restarted Lanczos method (IRLM) of Sorensen to compute the eigenvalues of the polyatomic Hamiltonian. Since the IRLM is an iterative method, it does not require storage of the full Hamiltonian matrix—it only requires the multiplication of the Hamiltonian matrix by a vector. When the IRLM is combined with a formulation such as DVR, which produces a very sparse matrix, both memory and computation times can be reduced dramatically. This algorithm has the potential to achieve even higher performance levels for larger values of the total angular momentum.
Gaudana, Ripal; Parenky, Ashwin; Vaishya, Ravi; Samanta, Swapan K.; Mitra, Ashim K.
2015-01-01
The objective of this study was to develop and characterize a nanoparticulate-based sustained release formulation of a water soluble dipeptide prodrug of dexamethasone, valine–valine-dexamethasone (VVD). Being hydrophilic in nature, it readily leaches out in the external aqueous medium and hence partitions poorly into the polymeric matrix resulting in minimal entrapment in nanoparticles. Hence, hydrophobic ion pairing (HIP) complexation of the prodrug was employed with dextran sulphate as a complexing polymer. A novel, solid in oil in water emulsion method was employed to encapsulate the prodrug in HIP complex form in poly(lactic-co-glycolic acid) matrix. Nanoparticles were characterized with respect to size, zeta potential, crystallinity of entrapped drug and surface morphology. A significant enhancement in the entrapment of the prodrug in nanoparticles was achieved. Finally, a simple yet novel method was developed which can also be applicable to encapsulate other charged hydrophilic molecules, such as peptides and proteins. PMID:20939702
Laser electrospray mass spectrometry of adsorbed molecules at atmospheric pressure
NASA Astrophysics Data System (ADS)
Brady, John J.; Judge, Elizabeth J.; Simon, Kuriakose; Levis, Robert J.
2010-02-01
Atmospheric pressure mass analysis of solid phase biomolecules is performed using laser electrospray mass spectrometry (LEMS). A non-resonant femtosecond duration laser pulse vaporizes native samples at atmospheric pressure for subsequent electrospray ionization and transfer into a mass spectrometer. LEMS was used to detect a complex molecule (irinotecan HCl), a complex mixture (cold medicine formulation with active ingredients: acetaminophen, dextromethorphan HBr and doxylamine succinate), and a biological building block (deoxyguanosine) deposited on steel surfaces without a matrix molecule.
Lange, Jeffrey J; Culbertson, Christopher T; Higgins, Daniel A
2008-12-15
Single molecule microscopic and spectroscopic methods are employed to probe the mobility and physical entrapment of dye molecules in dry and solvent-loaded poly(dimethylsiloxane) (PDMS) films. PDMS films of approximately 220 nm thickness are prepared by spin casting dilute solutions of Sylgard 184 onto glass coverslips, followed by low temperature curing. A perylene diimide dye (BPPDI) is used to probe diffusion and molecule-matrix interactions. Two classes of dye-loaded samples are investigated: (i) those incorporating dye dispersed throughout the films ("in film" samples) and (ii) those in which the dye is restricted primarily to the PDMS surface ("on film" samples). Experiments are performed under dry nitrogen and at various levels of isopropyl alcohol (IPA) loading from the vapor phase. A PDMS-coated quartz-crystal microbalance is employed to monitor solvent loading and drying of the PDMS and to ensure equilibrium conditions are achieved. Single molecules are shown to be predominantly immobile under dry conditions and mostly mobile under IPA-saturated conditions. Quantitative methods for counting the fluorescent spots produced by immobile single molecules in optical images of the samples demonstrate that the population of mobile molecules increases nonlinearly with IPA loading. Even under IPA saturated conditions, the population of fixed molecules is found to be greater than zero and is greatest for "in film" samples. Fluorescence correlation spectroscopy is used to measure the apparent diffusion coefficient for the mobile molecules, yielding a mean value of D = 1.4(+/-0.4) x 10(-8) cm(2)/s that is virtually independent of IPA loading and sample class. It is concluded that a nonzero population of dye molecules is physically entrapped within the PDMS matrix under all conditions. The increase in the population of mobile molecules under high IPA conditions is attributed to the filling of film micropores with solvent, rather than by incorporation of molecularly dispersed solvent into the PDMS.
Schaeffer, Carolyn R.; Hoang, Tra-My N.; Sudbeck, Craig M.; Alawi, Malik; Tolo, Isaiah E.; Robinson, D. Ashley; Horswill, Alexander R.; Rohde, Holger
2016-01-01
ABSTRACT Staphylococcus epidermidis is a leading cause of hospital-associated infections, including those of intravascular catheters, cerebrospinal fluid shunts, and orthopedic implants. Multiple biofilm matrix molecules with heterogeneous characteristics have been identified, including proteinaceous, polysaccharide, and nucleic acid factors. Two of the best-studied components in S. epidermidis include accumulation-associated protein (Aap) and polysaccharide intercellular adhesin (PIA), produced by the enzymatic products of the icaADBC operon. Biofilm composition varies by strain as well as environmental conditions, and strains producing PIA-mediated biofilms are more robust. Clinically, biofilm-mediated infections occur in a variety of anatomical sites with diverse physiological properties. To test the hypothesis that matrix composition exhibits niche specificity, biofilm-related genetic and physical properties were compared between S. epidermidis strains isolated from high-shear and low-shear environments. Among a collection of 105 clinical strains, significantly more isolates from high-shear environments carried the icaADBC operon than did those from low-shear settings (43.9% versus 22.9%, P < 0.05), while there was no significant difference in the presence of aap (77.2% versus 75.0%, P > 0.05). Additionally, a significantly greater number of high-shear isolates were capable of forming biofilm in vitro in a microtiter assay (82.5% versus 45.8%, P < 0.0001). However, even among high-shear clinical isolates, less than half contained the icaADBC locus; therefore, we selected for ica-negative variants with increased attachment to abiotic surfaces to examine PIA-independent biofilm mechanisms. Sequencing of selected variants identified substitutions capable of enhancing biofilm formation in multiple genes, further highlighting the heterogeneity of S. epidermidis biofilm molecules and mechanisms. IMPORTANCE Staphylococcus epidermidis is a leading cause of infections related to biomaterials, mostly due to their ability to form biofilm. Biofilm accumulation mechanisms vary, including those that are dependent on specific proteins, environmental DNA (eDNA), or polysaccharide intercellular adhesin (PIA). We found that those isolates obtained from high-shear environments, such as the lumen of a catheter, are more likely to produce PIA-mediated biofilms than those isolates obtained from a low-shear biomaterial-related infection. This suggests that PIA functions as a mechanism that is protective against shear flow. Finally, we performed selection experiments documenting the heterogeneity of biofilm accumulation molecules that function in the absence of PIA, further documenting the biofilm-forming potential of S. epidermidis. PMID:27747298
Theoretical Studies of Spectroscopic Line Mixing in Remote Sensing Applications
NASA Astrophysics Data System (ADS)
Ma, Q.
2015-12-01
The phenomenon of collisional transfer of intensity due to line mixing has an increasing importance for atmospheric monitoring. From a theoretical point of view, all relevant information about the collisional processes is contained in the relaxation matrix where the diagonal elements give half-widths and shifts, and the off-diagonal elements correspond to line interferences. For simple systems such as those consisting of diatom-atom or diatom-diatom, accurate fully quantum calculations based on interaction potentials are feasible. However, fully quantum calculations become unrealistic for more complex systems. On the other hand, the semi-classical Robert-Bonamy (RB) formalism, which has been widely used to calculate half-widths and shifts for decades, fails in calculating the off-diagonal matrix elements. As a result, in order to simulate atmospheric spectra where the effects from line mixing are important, semi-empirical fitting or scaling laws such as the ECS and IOS models are commonly used. Recently, while scrutinizing the development of the RB formalism, we have found that these authors applied the isolated line approximation in their evaluating matrix elements of the Liouville scattering operator given in exponential form. Since the criterion of this assumption is so stringent, it is not valid for many systems of interest in atmospheric applications. Furthermore, it is this assumption that blocks the possibility to calculate the whole relaxation matrix at all. By eliminating this unjustified application, and accurately evaluating matrix elements of the exponential operators, we have developed a more capable formalism. With this new formalism, we are now able not only to reduce uncertainties for calculated half-widths and shifts, but also to remove a once insurmountable obstacle to calculate the whole relaxation matrix. This implies that we can address the line mixing with the semi-classical theory based on interaction potentials between molecular absorber and molecular perturber. We have applied this formalism to address the line mixing for Raman and infrared spectra of molecules such as N2, C2H2, CO2, NH3, and H2O. By carrying out rigorous calculations, our calculated relaxation matrices are in good agreement with both experimental data and results derived from the ECS model.
Backes, Sandra; Herrmann, Johannes M
2017-01-01
Mitochondria contain two aqueous subcompartments, the matrix and the intermembrane space (IMS). The matrix is enclosed by both the inner and outer mitochondrial membranes, whilst the IMS is sandwiched between the two. Proteins of the matrix are synthesized in the cytosol as preproteins, which contain amino-terminal matrix targeting sequences that mediate their translocation through translocases embedded in the outer and inner membrane. For these proteins, the translocation reaction is driven by the import motor which is part of the inner membrane translocase. The import motor employs matrix Hsp70 molecules and ATP hydrolysis to ratchet proteins into the mitochondrial matrix. Most IMS proteins lack presequences and instead utilize the IMS receptor Mia40, which facilitates their translocation across the outer membrane in a reaction that is coupled to the formation of disulfide bonds within the protein. This process requires neither ATP nor the mitochondrial membrane potential. Mia40 fulfills two roles: First, it acts as a holdase, which is crucial in the import of IMS proteins and second, it functions as a foldase, introducing disulfide bonds into newly imported proteins, which induces and stabilizes their natively folded state. For several Mia40 substrates, oxidative folding is an essential prerequisite for their assembly into oligomeric complexes. Interestingly, recent studies have shown that the two functions of Mia40 can be experimentally separated from each other by the use of specific mutants, hence providing a powerful new way to dissect the different physiological roles of Mia40. In this review we summarize the current knowledge relating to the mitochondrial matrix-targeting and the IMS-targeting/Mia40 pathway. Moreover, we discuss the mechanistic properties by which the mitochondrial import motor on the one hand and Mia40 on the other, drive the translocation of their substrates into the organelle. We propose that the lateral diffusion of Mia40 in the inner membrane and the oxidation-mediated folding of incoming polypeptides supports IMS import.
ERIC Educational Resources Information Center
Litofsky, Joshua; Viswanathan, Rama
2015-01-01
Matrix diagonalization, the key technique at the heart of modern computational chemistry for the numerical solution of the Schrödinger equation, can be easily introduced in the physical chemistry curriculum in a pedagogical context using simple Hückel molecular orbital theory for p bonding in molecules. We present details and results of…
Paracrine signaling in a bacterium.
López, Daniel; Vlamakis, Hera; Losick, Richard; Kolter, Roberto
2009-07-15
Cellular differentiation is triggered by extracellular signals that cause target cells to adopt a particular fate. Differentiation in bacteria typically involves autocrine signaling in which all cells in the population produce and respond to the same signal. Here we present evidence for paracrine signaling in bacterial populations-some cells produce a signal to which only certain target cells respond. Biofilm formation in Bacillus involves two centrally important signaling molecules, ComX and surfactin. ComX triggers the production of surfactin. In turn, surfactin causes a subpopulation of cells to produce an extracellular matrix. Cells that produced surfactin were themselves unable to respond to it. Likewise, once surfactin-responsive cells commenced matrix production, they no longer responded to ComX and could not become surfactin producers. Insensitivity to ComX was the consequence of the extracellular matrix as mutant cells unable to make matrix responded to both ComX and surfactin. Our results demonstrate that extracellular signaling was unidirectional, with one subpopulation producing a signal and a different subpopulation responding to it. Paracrine signaling in a bacterial population ensures the maintenance, over generations, of particular cell types even in the presence of molecules that would otherwise cause those cells to differentiate into other cell types.
Teoh, G; Anderson, K C
1997-02-01
Adhesion molecules play an important role in the growth regulation and migration of multiple myeloma (MM) cells. They mediate homing of MM cells to the bone marrow and MM cell to bone marrow stromal cell adhesion, with resultant interleukin-6 related autocrine and paracine growth and antiapoptotic affects. Their pattern of expression on tumor cells correlates with the development of plasma cell leukemia or extramedullary disease. Clinically, expression of adhesion molecules on tumor cells or in the serum has already shown prognostic utility. Finally, since adhesion molecules are involved at multiple steps in the pathogenesis of MM, therapeutic studies may target these molecules.
Bergman, Nina; Shevchenko, Denys; Bergquist, Jonas
2014-01-01
This review summarizes various approaches for the analysis of low molecular weight (LMW) compounds by different laser desorption/ionization mass spectrometry techniques (LDI-MS). It is common to use an agent to assist the ionization, and small molecules are normally difficult to analyze by, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS) using the common matrices available today, because the latter are generally small organic compounds themselves. This often results in severe suppression of analyte peaks, or interference of the matrix and analyte signals in the low mass region. However, intrinsic properties of several LDI techniques such as high sensitivity, low sample consumption, high tolerance towards salts and solid particles, and rapid analysis have stimulated scientists to develop methods to circumvent matrix-related issues in the analysis of LMW molecules. Recent developments within this field as well as historical considerations and future prospects are presented in this review.
Infrared spectra of group III A metal oxides
NASA Technical Reports Server (NTRS)
Lynch, D. A., Jr.
1972-01-01
The measurement of infrared frequencies of metal-oxygen species which could be formed in the matrix and to investigate with an oxygen-18 enrichment study the controversy on the vibrational assignments for the suboxide. Several new molecules, Al3O2, Ga3O, In3O, In4O2, IntaO, IntaO2, and In2WO4, were found by mass spectrometric sampling to exist in extremely minor concentrations in the vapor phase. The latter three species were formed by reaction with the crucible materials and were unimportant for an infrared analysis. The infrared spectroscopic measurements were obtained by the matrix isolation technique of molecular beam sampling. The MO2 species were formed by direct reaction between metal and O2 in the matrix. A C2v structure and an O-M-O bond angle near 40 deg was favored for these molecules by analogy with a similar investigation of the alkali metals. The vibrational frequencies which were determined are given.
Reticker-Flynn, Nathan E.; Braga Malta, David F.; Winslow, Monte M.; Lamar, John M.; Xu, Mary J.; Underhill, Gregory H.; Hynes, Richard O.; Jacks, Tyler E.; Bhatia, Sangeeta N.
2013-01-01
Extracellular matrix interactions play essential roles in normal physiology and many pathological processes. While the importance of ECM interactions in metastasis is well documented, systematic approaches to identify their roles in distinct stages of tumorigenesis have not been described. Here we report a novel screening platform capable of measuring phenotypic responses to combinations of ECM molecules. Using a genetic mouse model of lung adenocarcinoma, we measure the ECM-dependent adhesion of tumor-derived cells. Hierarchical clustering of the adhesion profiles differentiates metastatic cell lines from primary tumor lines. Furthermore, we uncovered that metastatic cells selectively associate with fibronectin when in combination with galectin-3, galectin-8, or laminin. We show that these molecules correlate with human disease and that their interactions are mediated in part by α3β1 integrin. Thus, our platform allowed us to interrogate interactions between metastatic cells and their microenvironments, and identified ECM and integrin interactions that could serve as therapeutic targets. PMID:23047680
NASA Astrophysics Data System (ADS)
Allwood, D. A.; Dyer, P. E.
2000-11-01
Fundamental photophysical parameters have been determined for several molecules that are commonly used as matrices, e.g. ferulic acid, within matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. Fluorescence quantum efficiencies ( φqe), singlet decay rates ( kl), vibrationless ground-singlet transition energies and average fluorescence wavelengths have been obtained from solid and solution samples by quantitative optical measurements. This new data will assist in modelling calculations of MALDI processes and in highlighting desirable characteristics of MALDI matrices. φqe may be as high as 0.59 whilst the radiative decay rate ( kf) appears to be within the (0.8-4)×10 8 s -1 range. Interestingly, α-cyano-4-hydroxycinnamic acid (α-CHC) has a very low φqe and fast non-radiative decay rate which would imply a rapid and efficient thermalisation of electronic excitation. This is in keeping with observations that α-CHC exhibits low threshold fluences for ion detection and the low fluences at which α-CHC tends to fragment.
NASA Technical Reports Server (NTRS)
Boulet, C.; Ma, Qiancheng; Tipping, R. H.
2015-01-01
Starting from the refined Robert-Bonamy formalism [Q. Ma, C. Boulet, and R. H. Tipping, J. Chem. Phys. 139, 034305 (2013)], we propose here an extension of line mixing studies to infrared absorptions of linear polyatomic molecules having stretching and bending modes. The present formalism does not neglect the internal degrees of freedom of the perturbing molecules, contrary to the energy corrected sudden (ECS) modeling, and enables one to calculate the whole relaxation matrix starting from the potential energy surface. Meanwhile, similar to the ECS modeling, the present formalism properly accounts for roles played by all the internal angular momenta in the coupling process, including the vibrational angular momentum. The formalism has been applied to the important case of CO2 broadened by N2. Applications to two kinds of vibrational bands (sigma yields sigma and sigma yields pi) have shown that the present results are in good agreement with both experimental data and results derived from the ECS model.
Simulation of phase equilibria
NASA Astrophysics Data System (ADS)
Martin, Marcus Gary
The focus of this thesis is on the use of configurational bias Monte Carlo in the Gibbs ensemble. Unlike Metropolis Monte Carlo, which is reviewed in chapter I, configurational bias Monte Carlo uses an underlying Markov chain transition matrix which is asymmetric in such a way that it is more likely to attempt to move to a molecular conformation which has a lower energy than to one with a higher energy. Chapter II explains how this enables efficient simulation of molecules with complex architectures (long chains and branched molecules) for coexisting fluid phases (liquid, vapor, or supercritical), and also presents several of our recent extensions to this method. In chapter III we discuss the development of the Transferable Potentials for Phase Equilibria United Atom (TraPPE-UA) force field which accurately describes the fluid phase coexistence for linear and branched alkanes. Finally, in the fourth chapter the methods and the force field are applied to systems ranging from supercritical extraction to gas chromatography to illustrate the power and versatility of our approach.
The gas phase structure of transition metal dihydrides
NASA Astrophysics Data System (ADS)
Demuynck, Jean; Schaefer, Henry F.
1980-01-01
ESR and infrared spectroscopic measurements on matrix isolated MnH2 and CrH2 have recently suggested that these simple molecules may be bent. This result would be the opposite of that found experimentally for the transition metal dihalides MX2, known to be linear. Here the geometrical structure of MnH2 has been investigated by molecular electronic structure theory. A large contracted Gaussian basis set [Mn(14s11p6p/9s8p3d), H(5s1p/3s1p)] was used in conjunction with self-consistent field and configuration interaction methods. These suggest that the 6A1 ground state of MnH2 is linear. Further studies of the 3A1 state (one of several low-lying states) of TiH2 also favor linearity, although this potential energy surface is extremely flat with respect to bending. Thus it appears probable that most MH2 molecules, like the related MX2 family, are linear.
Kong, Xianming; Li, Erwen; Squire, Kenny; Liu, Ye; Wu, Bo; Cheng, Li-Jing; Wang, Alan X
2017-11-01
Diatomite consists of fossilized remains of ancient diatoms and is a type of naturally abundant photonic crystal biosilica with multiple unique physical and chemical functionalities. In this paper, we explored the fluidic properties of diatomite as the matrix for on-chip chromatography and, simultaneously, the photonic crystal effects to enhance the plasmonic resonances of metallic nanoparticles for surface-enhanced Raman scattering (SERS) biosensing. The plasmonic nanoparticle-decorated diatomite biosilica provides a lab-on-a-chip capability to separate and detect small molecules from mixture samples with ultra-high detection sensitivity down to 1 ppm. We demonstrate the significant potential for biomedical applications by screening toxins in real biofluid, achieving simultaneous label-free biosensing of phenethylamine and miR21cDNA in human plasma with unprecedented sensitivity and specificity. To the best of our knowledge, this is the first time demonstration to detect target molecules from real biofluids by on-chip chromatography-SERS techniques. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Anandamide-ceramide interactions in a membrane environment: Molecular dynamic simulations data.
Di Scala, Coralie; Mazzarino, Morgane; Yahi, Nouara; Varini, Karine; Garmy, Nicolas; Fantini, Jacques; Chahinian, Henri
2017-10-01
Anandamide is a lipid neurotransmitter that interacts with various plasma membrane lipids. The data here consists of molecular dynamics simulations of anandamide, C18-ceramide and cholesterol performed in vacuo and within a hydrated palmitoyl-oleoyl-phosphatidylcholine (POPC)/cholesterol membrane. Several models of anandamide/cholesterol and anandamide/ceramide complexes are presented. The energy of interaction and the nature of the intermolecular forces involved in each of these complexes are detailed. The impact of water molecules hydrating the POPC/cholesterol membrane for the stability of the anandamide/cholesterol and anandamide/ceramide complexes is also analyzed. From a total number of 1920 water molecules stochatiscally merged with the lipid matrix, 48 were eventually redistributed around the polar head groups of the anandamide/ceramide complex, whereas only 15 reached with the anandamide/cholesterol complex. The interpretation of this dataset is presented in the accompanying article "Ceramide binding to anandamide increases its half-life and potentiates its cytotoxicity in human neuroblastoma cells" [1].
New trends in encapsulation of liposoluble vitamins.
Gonnet, M; Lethuaut, L; Boury, F
2010-09-15
Liposoluble vitamins (A, D, E, and K) and carotenoids have many benefits on health. They are provided mainly by foods. At pharmacological doses, they can also be used to treat skin diseases, several types of cancer or decrease oxidative stress. These molecules are sensitive to oxidation, thus encapsulation might constitute an appropriate mean to preserve their properties during storage and enhance their physiological potencies. Formulation processes have been adapted for sensitive molecule, limiting their exposure to high temperature, light or oxygen. Each administration pathway, oral, systemic, topical, transdermal and local, requires different particle sizes and release profile. Encapsulation can lead to greater efficiency allowing smaller administration doses thus diminishing potential hypervitaminosis syndrome appearance and side effects. Carrier formulation can be based on vitamin dissolution in lipid media and its stabilization by surfactant mixture, on its entrapment in a matrix or molecular system. Suitability of each type of carrier will be discussed for each pathway. 2010 Elsevier B.V. All rights reserved.
Sleno, Lekha; Volmer, Dietrich A
2006-01-01
Growing interest in the ability to conduct quantitative assays for small molecules by matrix-assisted laser desorption/ionization (MALDI) has been the driving force for several recent studies. This present work includes the investigation of internal standards for these analyses using a high-repetition rate MALDI triple quadrupole instrument. Certain physicochemical properties are assessed for predicting possible matches for internal standards for different small molecules. The importance of similar molecular weight of an internal standard to its analyte is seen through experiments with a series of acylcarnitines, having a fixed charge site and growing alkyl chain length. Both acetyl- and hexanoyl-carnitine were systematically assessed with several other acylcarnitine compounds as internal standards. The results clearly demonstrate that closely matched molecular weights between analyte and internal standard are essential for acceptable quantitation results. Using alpha-cyano-4-hydroxycinnamic acid as the organic matrix, the similarities between analyte and internal standard remain the most important parameter and not necessarily their even distribution within the solid sample spot. Several 4-quinolone antibiotics as well as a diverse group of pharmaceutical drugs were tested as internal standards for the 4-quinolone, ciprofloxacin. Quantitative results were shown using the solution-phase properties, log D and pKa, of these molecules. Their distribution coefficients, log D, are demonstrated as a fundamental parameter for similar crystallization patterns of analyte and internal standard. In the end, it was also possible to quantify ciprofloxacin using a drug from a different compound class, namely quinidine, having a similar log D value as the analyte. Copyright 2006 John Wiley & Sons, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cave, R.J.; Newton, M.D.; Kumar, K.
1995-12-07
The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thallmair, Sebastian; Lehrstuhl für BioMolekulare Optik, Ludwig-Maximilians-Universität München, D-80538 München; Roos, Matthias K.
Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstratedmore » for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.« less
Luciani, Paola; Deledda, Cristiana; Benvenuti, Susanna; Squecco, Roberta; Cellai, Ilaria; Fibbi, Benedetta; Marone, Ilaria Maddalena; Giuliani, Corinna; Modi, Giulia; Francini, Fabio; Vannelli, Gabriella Barbara; Peri, Alessandro
2013-01-01
Exendin-4 is a molecule currently used, in its synthetic form exenatide, for the treatment of type 2 diabetes mellitus. Exendin-4 binds and activates the Glucagon-Like Peptide-1 Receptor (GLP-1R), thus inducing insulin release. More recently, additional biological properties have been associated to molecules that belong to the GLP-1 family. For instance, Peptide YY and Vasoactive Intestinal Peptide have been found to affect cell adhesion and migration and our previous data have shown a considerable actin cytoskeleton rearrangement after exendin-4 treatment. However, no data are currently available on the effects of exendin-4 on tumor cell motility. The aim of this study was to investigate the effects of this molecule on cell adhesion, differentiation and migration in two neuroblastoma cell lines, SH-SY5Y and SK-N-AS. We first demonstrated, by Extra Cellular Matrix cell adhesion arrays, that exendin-4 increased cell adhesion, in particular on a vitronectin substrate. Subsequently, we found that this molecule induced a more differentiated phenotype, as assessed by i) the evaluation of neurite-like protrusions in 3D cell cultures, ii) the analysis of the expression of neuronal markers and iii) electrophysiological studies. Furthermore, we demonstrated that exendin-4 reduced cell migration and counteracted anchorage-independent growth in neuroblastoma cells. Overall, these data indicate for the first time that exendin-4 may have anti-tumoral properties.
Molecular docking based screening of compounds against VP40 from Ebola virus.
M Alam El-Din, Hanaa; A Loutfy, Samah; Fathy, Nasra; H Elberry, Mostafa; M Mayla, Ahmed; Kassem, Sara; Naqvi, Asif
2016-01-01
Ebola virus causes severe and often fatal hemorrhagic fevers in humans. The 2014 Ebola epidemic affected multiple countries. The virus matrix protein (VP40) plays a central role in virus assembly and budding. Since there is no FDA-approved vaccine or medicine against Ebola viral infection, discovering new compounds with different binding patterns against it is required. Therefore, we aim to identify small molecules that target the Arg 134 RNA binding and active site of VP40 protein. 1800 molecules were retrieved from PubChem compound database based on Structure Similarity and Conformers of pyrimidine-2, 4-dione. Molecular docking approach using Lamarckian Genetic Algorithm was carried out to find the potent inhibitors for VP40 based on calculated ligand-protein pairwise interaction energies. The grid maps representing the protein were calculated using auto grid and grid size was set to 60*60*60 points with grid spacing of 0.375 Ǻ. Ten independent docking runs were carried out for each ligand and results were clustered according to the 1.0 Ǻ RMSD criteria. The post-docking analysis showed that binding energies ranged from -8.87 to 0.6 Kcal/mol. We report 7 molecules, which showed promising ADMET results, LD-50, as well as H-bond interaction in the binding pocket. The small molecules discovered could act as potential inhibitors for VP40 and could interfere with virus assembly and budding process.
Molecular docking based screening of compounds against VP40 from Ebola virus
M Alam El-Din, Hanaa; A. Loutfy, Samah; Fathy, Nasra; H Elberry, Mostafa; M Mayla, Ahmed; Kassem, Sara; Naqvi, Asif
2016-01-01
Ebola virus causes severe and often fatal hemorrhagic fevers in humans. The 2014 Ebola epidemic affected multiple countries. The virus matrix protein (VP40) plays a central role in virus assembly and budding. Since there is no FDA-approved vaccine or medicine against Ebola viral infection, discovering new compounds with different binding patterns against it is required. Therefore, we aim to identify small molecules that target the Arg 134 RNA binding and active site of VP40 protein. 1800 molecules were retrieved from PubChem compound database based on Structure Similarity and Conformers of pyrimidine-2, 4-dione. Molecular docking approach using Lamarckian Genetic Algorithm was carried out to find the potent inhibitors for VP40 based on calculated ligand-protein pairwise interaction energies. The grid maps representing the protein were calculated using auto grid and grid size was set to 60*60*60 points with grid spacing of 0.375 Ǻ. Ten independent docking runs were carried out for each ligand and results were clustered according to the 1.0 Ǻ RMSD criteria. The post-docking analysis showed that binding energies ranged from -8.87 to 0.6 Kcal/mol. We report 7 molecules, which showed promising ADMET results, LD-50, as well as H-bond interaction in the binding pocket. The small molecules discovered could act as potential inhibitors for VP40 and could interfere with virus assembly and budding process. PMID:28149054
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
In Sickness and in Health: Perineuronal Nets and Synaptic Plasticity in Psychiatric Disorders
Pantazopoulos, Harry; Berretta, Sabina
2016-01-01
Rapidly emerging evidence implicates perineuronal nets (PNNs) and extracellular matrix (ECM) molecules that compose or interact with PNNs, in the pathophysiology of several psychiatric disorders. Studies on schizophrenia, autism spectrum disorders, mood disorders, Alzheimer's disease, and epilepsy point to the involvement of ECM molecules such as chondroitin sulfate proteoglycans, Reelin, and matrix metalloproteases, as well as their cell surface receptors. In many of these disorders, PNN abnormalities have also been reported. In the context of the “quadripartite” synapse concept, that is, the functional unit composed of the pre- and postsynaptic terminals, glial processes, and ECM, and of the role that PNNs and ECM molecules play in regulating synaptic functions and plasticity, these findings resonate with one of the most well-replicated aspects of the pathology of psychiatric disorders, that is, synaptic abnormalities. Here we review the evidence for PNN/ECM-related pathology in these disorders, with particular emphasis on schizophrenia, and discuss the hypothesis that such pathology may significantly contribute to synaptic dysfunction. PMID:26839720
Role of Mitochondrial Ca2+ in the Regulation of Cellular Energetics
Glancy, Brian; Balaban, Robert S.
2012-01-01
Calcium is an important signaling molecule involved in the regulation of many cellular functions. The large free energy in the Ca2+ ion membrane gradients make Ca2+ signaling inherently sensitive to the available cellular free energy, primarily in the form of ATP. In addition, Ca2+ regulates many cellular ATP consuming reactions such as muscle contraction, exocytosis, biosynthesis and neuronal signaling. Thus, Ca2+ becomes a logical candidate as a signaling molecule to modulate ATP hydrolysis and synthesis during changes in numerous forms of cellular work. Mitochondria are the primary source of aerobic energy production in mammalian cells and also maintain a large Ca2+ gradient across their inner membrane providing a signaling potential for this molecule. The demonstrated link between cytosolic and mitochondrial [Ca2+], identification of transport mechanisms as well as proximity of mitochondria to Ca2+ release sites further supports the notion that Ca2+ can be an important signaling molecule in the energy metabolism interplay of the cytosol with the mitochondria. Here we review sites within the mitochondria where Ca2+ plays a role in the regulation of ATP generation and potentially contributes to the orchestration of the cellular metabolic homeostasis. Early work on isolated enzymes pointed to several matrix dehydrogenases that are stimulated by Ca2+, which were confirmed in the intact mitochondrion as well as cellular and in vivo systems. However, studies in these intact systems suggested a more expansive influence of Ca2+ on mitochondrial energy conversion. Numerous non-invasive approaches monitoring NADH, mitochondrial membrane potential, oxygen consumption and workloads suggest significant Ca2+ effects on other elements of NADH generation as well as downstream elements of oxidative phosphorylation including the F1FO-ATPase and the cytochrome chain. These other potential elements of Ca2+ modification of mitochondrial energy conversion will be the focus of this review. Though most of specific molecular mechanisms have yet to be elucidated, it is clear that Ca2+ provides a balanced activation of mitochondrial energy metabolism which exceeds the alteration of dehydrogenases alone. PMID:22443365
Matrix-Assisted Laser Desorption Ionization Imaging Mass Spectrometry: In Situ Molecular Mapping
Angel, Peggi M.; Caprioli, Richard M.
2013-01-01
Matrix-assisted laser desorption ionization imaging mass spectrometry (IMS) is a relatively new imaging modality that allows mapping of a wide range of biomolecules within a thin tissue section. The technology uses a laser beam to directly desorb and ionize molecules from discrete locations on the tissue that are subsequently recorded in a mass spectrometer. IMS is distinguished by the ability to directly measure molecules in situ ranging from small metabolites to proteins, reporting hundreds to thousands of expression patterns from a single imaging experiment. This article reviews recent advances in IMS technology, applications, and experimental strategies that allow it to significantly aid in the discovery and understanding of molecular processes in biological and clinical samples. PMID:23259809
Simultaneous infrared and UV-visible absorption spectra of matrix-isolated carbon vapor
NASA Technical Reports Server (NTRS)
Kurtz, Joe; Huffman, Donald R.
1989-01-01
Carbon molecules were suggested as possible carriers of the diffuse interstellar bands. In particular, it was proposed that the 443 nm diffuse interstellar band is due to the same molecule which gives rise to the 447 nm absorption feature in argon matrix-isolated carbon vapor. If so, then an associated C-C stretching mode should be seen in the IR. By doing spectroscopy in both the IR and UV-visible regions on the same sample, the present work provides evidence for correlating UV-visible absorption features with those found in the IR. Early data indicates no correlation between the strongest IR feature (1997/cm) and the 447 nm band. Correlation with weaker IR features is being investigated.
Chakrabarti, Bornali; Bairagya, Hridoy R; Mishra, Deepak Kr; Chatterjee, Pradip Kumar; Mukhopadhyay, Bishnu P
2013-01-01
Human matrix metalloproteinase-8 (hMMP-8) plays a important role in the progression of colorectal cancer, metastasis, multiple sclerosis and rheumetoid arthritis. Extensive MD-simulation of the PDB and solvated structures of hMMP-8 has revealed the presence of few conserved water molecules around the catalytic and structural zinc (ZnC and ZnS) ions. The coordination of two conserved water molecules (W and WS) to ZnS and the H-bonding interaction of WS to S151 have indicated the plausible involvement of that metal ion in the catalytic process. Beside this the coupling of ZnC and ZnS metal ions (ZnC - W(H) (W(1))…..W(2) ….H(162) - ZnS) through two conserved hydrophilic centers (occupied by water molecules) may also provide some rational on the recognition of two zinc ions which were separated by ~13 Å in their X-ray structures. This unique recognition of both the Zn(+2) ions in the enzyme through conserved water molecules may be implemented/ exploited for the design of antiproteolytic agent using water mimic drug design protocol.
A two-step strategy to visually identify molecularly imprinted polymers for tagged proteins.
Brandis, Alexander; Partouche, Eran; Yechezkel, Tamar; Salitra, Yoseph; Shkoulev, Vladimir; Scherz, Avigdor; Grynszpan, Flavio
2017-08-01
A practical and relatively simple method to identify molecularly imprinted polymers capable of binding proteins via the molecular tagging (epitope-like) approach has been developed. In our two-step method, we first challenge a previously obtained anti-tag molecularly imprinted polymer with a small molecule including the said tag of choice (a biotin derivative as shown here or other) connected to a linker bound to a second biotin moiety. An avidin molecule partially decorated with fluorescent labels is then allowed to bind the available biotin derivative associated with the polymer matrix. At the end of this simple process, and after washing off all the low-affinity binding molecules from the polymer matrix, only suitable molecularly imprinted polymers binding avidin through its previously acquired small molecule tag (or epitope-like probe, in a general case) will remain fluorescent. For confirmation, we tested the selective performance of the anti-biotin molecularly imprinted polymer binding it to biotinylated alkaline phosphatase. Residual chemical activity of the enzyme on the molecularly imprinted polymer solid support was observed. In all cases, the corresponding nonimprinted polymer controls were inactive. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Identification and functional analysis of endothelial tip cell-enriched genes.
del Toro, Raquel; Prahst, Claudia; Mathivet, Thomas; Siegfried, Geraldine; Kaminker, Joshua S; Larrivee, Bruno; Breant, Christiane; Duarte, Antonio; Takakura, Nobuyuki; Fukamizu, Akiyoshi; Penninger, Josef; Eichmann, Anne
2010-11-11
Sprouting of developing blood vessels is mediated by specialized motile endothelial cells localized at the tips of growing capillaries. Following behind the tip cells, endothelial stalk cells form the capillary lumen and proliferate. Expression of the Notch ligand Delta-like-4 (Dll4) in tip cells suppresses tip cell fate in neighboring stalk cells via Notch signaling. In DLL4(+/-) mouse mutants, most retinal endothelial cells display morphologic features of tip cells. We hypothesized that these mouse mutants could be used to isolate tip cells and so to determine their genetic repertoire. Using transcriptome analysis of retinal endothelial cells isolated from DLL4(+/-) and wild-type mice, we identified 3 clusters of tip cell-enriched genes, encoding extracellular matrix degrading enzymes, basement membrane components, and secreted molecules. Secreted molecules endothelial-specific molecule 1, angiopoietin 2, and apelin bind to cognate receptors on endothelial stalk cells. Knockout mice and zebrafish morpholino knockdown of apelin showed delayed angiogenesis and reduced proliferation of stalk cells expressing the apelin receptor APJ. Thus, tip cells may regulate angiogenesis via matrix remodeling, production of basement membrane, and release of secreted molecules, some of which regulate stalk cell behavior.
Low energy electron-molecule scattering using the R-matrix method
NASA Astrophysics Data System (ADS)
Gorfinkiel, Jimena
2014-10-01
The study of electron-molecule collisions continues to attract significant interest stimulated, in no small part, by the need for collisional data to model a number of physical environments and applied processes (e.g. the modelling of focused electron beam induced deposition and the description of the interaction of radiation with biological matter). This need for electron scattering data (cross sections but also information on the temporary negative ions, TNI, that can be formed) has motivated the renewed development of theoretical methodology and their computational implementation. I will present the latest developments in the study of low energy electron scattering from molecules and molecular clusters using the R-matrix method. Recent calculations on electron collisions with biologically relevant molecules have shed light on the formation of core-excited TNI these larger targets. The picture that emerges is much more complex than previously thought. I will discuss some examples as well as current and future developments of the methodology and software in order to provide more accurate collisional data (in particular cross sections) for bigger targets. In collaboration with Zdenek Masin, The Open University. This work was partially supported by EPSRC.
Sorption of small molecules in polymeric media
NASA Astrophysics Data System (ADS)
Camboni, Federico; Sokolov, Igor M.
2016-12-01
We discuss the sorption of penetrant molecules from the gas phase by a polymeric medium within a model which is very close in spirit to the dual sorption mode model: the penetrant molecules are partly dissolved within the polymeric matrix, partly fill the preexisting voids. The only difference with the initial dual sorption mode situation is the assumption that the two populations of molecules are in equilibrium with each other. Applying basic thermodynamics principles we obtain the dependence of the penetrant concentration on the pressure in the gas phase and find that this is expressed via the Lambert W-function, a different functional form than the one proposed by dual sorption mode model. The Lambert-like isotherms appear universally at low and moderate pressures and originate from the assumption that the internal energy in a polymer-penetrant-void ternary mixture is (in the lowest order) a bilinear form in the concentrations of the three components. Fitting the existing data shows that in the domain of parameters where the dual sorption mode model is typically applied, the Lambert function, which describes the same behavior as the one proposed by the gas-polymer matrix model, fits the data equally well.
Gunasekar, Susheel K; Asnani, Mukta; Limbad, Chandani; Haghpanah, Jennifer S; Hom, Wendy; Barra, Hanna; Nanda, Soumya; Lu, Min; Montclare, Jin Kim
2009-09-15
The coiled-coil domain of cartilage oligomeric matrix protein (COMPcc) assembles into a homopentamer that naturally recognizes the small molecule 1,25-dihydroxyvitamin D(3) (vit D). To identify the residues critical for the structure, stability, oligomerization, and binding to vit D as well as two other small molecules, all-trans-retinol (ATR) and curcumin (CCM), here we perform an alanine scanning mutagenesis study. Ten residues lining the hydrophobic pocket of COMPcc were mutated into alanine; of the mutated residues, the N-terminal aliphatic residues L37, L44, V47, and L51 are responsible for maintaining the structure and function. Furthermore, two polar residues, T40 and Q54, within the N-terminal region when converted into alanine improve the alpha-helical structure, stability, and self-assembly behavior. Helical stability, oligomerization, and binding appear to be linked in a manner in which mutations that abolish helical structure and assembly bind poorly to vit D, ATR, and CCM. These results provide not only insight into COMPcc and its functional role but also useful guidelines for the design of stable, pentameric coiled-coils capable of selectively storing and delivering various small molecules.
NASA Technical Reports Server (NTRS)
1999-01-01
Understanding the origins of Life requires a good understanding of the physics and chemistry of biogenic low-z elements H, C, N, O, P, S in terrestrial environments, on Mars, on extraterrestrial bodies such as meteorite parent bodies and comets, and in interstellar space. In this Proposal five Tasks form a coherent program aimed at elucidating various aspects of low-z element geo- and cosmochemistry with special reference to the origin of Life on Earth and to the search for life on Mars, extant or extinct. (i) Formation of organic molecules, in particular oxygenated H-C-0 molecules or precursors thereof of the composition H(x)C(y)O(z)(n-), inside the hard matrix of structurally dense magmatic minerals; (ii) Formation of organic molecules inside the soft matrix of amorphous and crystalline water ice; (iii) Preservation of organic molecules in cherts and other siliceous rocks formed in hot spring or submarine hydrothermal vent environments; (iv) The nature of the elusive Martian soil oxidant; and (v) Prototype development of an XRD instrument, using a new patented XRD camera concept that utilizes a Charge Coupled Device (CCD) as a camera and as a energy-dispersive analyzer.
Joshi, Prasad Ramesh; Ramanathan, N; Sundararajan, K; Sankaran, K
2015-04-09
The weak interaction between PCl3 and CH3OH was investigated using matrix isolation infrared spectroscopy and ab initio computations. In a nitrogen matrix at low temperature, the noncovalent adduct was generated and characterized using Fourier transform infrared spectroscopy. Computations were performed at B3LYP/6-311++G(d,p), B3LYP/aug-cc-pVDZ, and MP2/6-311++G(d,p) levels of theory to optimize the possible geometries of PCl3-CH3OH adducts. Computations revealed two minima on the potential energy surface, of which, the global minimum is stabilized by a noncovalent P···O interaction, known as a pnictogen bonding (phosphorus bonding or P-bonding). The local minimum corresponded to a cyclic adduct, stabilized by the conventional hydrogen bonding (Cl···H-O and Cl···H-C interactions). Experimentally, 1:1 P-bonded PCl3-CH3OH adduct in nitrogen matrix was identified, where shifts in the P-Cl modes of PCl3, O-C, and O-H modes of CH3OH submolecules were observed. The observed vibrational frequencies of the P-bonded adduct in a nitrogen matrix agreed well with the computed frequencies. Furthermore, computations also predicted that the P-bonded adduct is stronger than H-bonded adduct by ∼1.56 kcal/mol. Atoms in molecules and natural bond orbital analyses were performed to understand the nature of interactions and effect of charge transfer interaction on the stability of the adducts.
Bourboulia, Dimitra; Stetler-Stevenson, William G
2010-06-01
Cells adhere to one another and/or to matrices that surround them. Regulation of cell-cell (intercellular) and cell-matrix adhesion is tightly controlled in normal cells, however, defects in cell adhesion are common in the majority of human cancers. Multilateral communication among tumor cells with the extracellular matrix (ECM) and neighbor cells is accomplished through adhesion molecules, ECM components, proteolytic enzymes and their endogenous inhibitors. There is sufficient evidence to suggest that reduced adherence is a tumor cell property engaged during tumor progression. Tumor cells acquire the ability to change shape, detach and easily move through spaces disorganizing the normal tissue architecture. This property is due to changes in expression levels of adhesion molecules and/or due to elevated levels of secreted proteolytic enzymes, including matrix metalloproteinases (MMPs). Among other roles, MMPs degrade the ECM and, therefore, prepare the path for tumor cells to migrate, invade and spread to distant secondary areas, where they form metastasis. Tissue inhibitors of metalloproteinases or TIMPs control MMP activities and, therefore, minimize matrix degradation. Both MMPs and TIMPs are involved in tissue remodeling and decisively regulate tumor cell progression including tumor angiogenesis. In this review, we describe and discuss data that support the important role of MMPs and TIMPs in cancer cell adhesion and tumor progression. Published by Elsevier Ltd.
Ben-Nun, M; Mills, J D; Hinde, R J; Winstead, C L; Boatz, J A; Gallup, G A; Langhoff, P W
2009-07-02
Recent progress is reported in development of ab initio computational methods for the electronic structures of molecules employing the many-electron eigenstates of constituent atoms in spectral-product forms. The approach provides a universal atomic-product description of the electronic structure of matter as an alternative to more commonly employed valence-bond- or molecular-orbital-based representations. The Hamiltonian matrix in this representation is seen to comprise a sum over atomic energies and a pairwise sum over Coulombic interaction terms that depend only on the separations of the individual atomic pairs. Overall electron antisymmetry can be enforced by unitary transformation when appropriate, rather than as a possibly encumbering or unnecessary global constraint. The matrix representative of the antisymmetrizer in the spectral-product basis, which is equivalent to the metric matrix of the corresponding explicitly antisymmetric basis, provides the required transformation to antisymmetric or linearly independent states after Hamiltonian evaluation. Particular attention is focused in the present report on properties of the metric matrix and on the atomic-product compositions of molecular eigenstates as described in the spectral-product representations. Illustrative calculations are reported for simple but prototypically important diatomic (H(2), CH) and triatomic (H(3), CH(2)) molecules employing algorithms and computer codes devised recently for this purpose. This particular implementation of the approach combines Slater-orbital-based one- and two-electron integral evaluations, valence-bond constructions of standard tableau functions and matrices, and transformations to atomic eigenstate-product representations. The calculated metric matrices and corresponding potential energy surfaces obtained in this way elucidate a number of aspects of the spectral-product development, including the nature of closure in the representation, the general redundancy or linear dependence of its explicitly antisymmetrized form, the convergence of the apparently disparate atomic-product and explicitly antisymmetrized atomic-product forms to a common invariant subspace, and the nature of a chemical bonding descriptor provided by the atomic-product compositions of molecular eigenstates. Concluding remarks indicate additional studies in progress and the prognosis for performing atomic spectral-product calculations more generally and efficiently.
Shi, Yu; Liu, Rui; Zhang, Si; Xia, Yin-Yan; Yang, Hai-Jie; Guo, Ke; Zeng, Qi; Feng, Zhi-Wei
2011-04-01
Neural cell adhesion molecule (NCAM) has been implicated in tumor metastasis yet its function in melanoma progression remains unclear. Here, we demonstrate that stably silencing NCAM expression in mouse melanoma B16F0 cells perturbs their cellular invasion and metastatic dissemination in vivo. The pro-invasive function of NCAM is exerted via dual mechanisms involving both cAMP-dependent protein kinase (PKA) and phosphatidylinositol 3-kinase (PI3K) pathways. Pharmacologic inhibition of PKA and PI3K leads to impaired cellular invasion. In contrast, forced expression of constitutively activated Akt, the major downstream target of PI3K, restores the defective cellular invasiveness of NCAM knock-down (KD) B16F0 cells. Furthermore, attenuation of either PKA or Akt activity in NCAM KD cells is shown to affect their common downstream target, transcription factor cAMP response element binding protein (CREB), which in turn down-regulates mRNA expression of matrix metalloproteinase-2 (MMP-2), thus contributes to impaired cellular invasion and metastasis of melanoma cells. Together, these findings indicate that NCAM potentiates cellular invasion and metastasis of melanoma cells through stimulation of PKA and PI3K signaling pathways thus suggesting the potential implication of anti-NCAM strategy in melanoma treatment. Copyright © 2011 Elsevier Ltd. All rights reserved.
TRAF3IP2 Mediates Aldosterone/Salt-Induced Cardiac Hypertrophy and Fibrosis
Sakamuri, Siva S.V.P; Valente, Anthony J.; Siddesha, Jalahalli M.; Delafontaine, Patrice; Siebenlist, Ulrich; Gardner, Jason D.; Chandrasekar, Bysani
2016-01-01
Aberrant activation of the renin-angiotensin-aldosterone system (RAAS) contributes to adverse cardiac remodeling and eventual failure. Here we investigated whether TRAF3-interacting Protein 2 (TRAF3IP2), a redox-sensitive cytoplasmic adaptor molecule and an upstream regulator of nuclear factor-κB (NF-κB) and activator protein-1 (AP-1), mediates aldosterone-induced cardiac hypertrophy and fibrosis. Wild type (WT) and TRAF3IP2-null mice were infused with aldosterone (0.2mg/kg/day) for 4 weeks along with 1%NaCl in drinking water. Aldosterone/salt, but not salt alone, upregulated TRAF3IP2 expression in WT mouse hearts. Aldosterone elevated blood pressure to a similar extent in both WT and TRAF3IP2-null groups. Importantly, TRAF3IP2 gene deletion attenuated aldosterone/salt-induced (i) p65 and c-Jun activation, (ii) extracellular matrix (collagen Iα1 and collagen 3α1), matrix metalloproteinase (MMP2), lysyl oxidase (LOX), inflammatory cytokine (IL-6 and IL-18), chemokine (CXCL1 and CXCL2), and adhesion molecule (ICAM1) gene expression in hearts, (iii) IL-6, IL-18, and MMP2 protein levels, (iv) systemic IL-6 and IL-18 levels, and (iv) cardiac hypertrophy and fibrosis. These results indicate that TRAF3IP2 is a critical signaling intermediate in aldosterone/salt-induced myocardial hypertrophy and fibrosis, and thus a potential therapeutic target in hypertensive heart disease. PMID:27040306
TRAF3IP2 mediates aldosterone/salt-induced cardiac hypertrophy and fibrosis.
Sakamuri, Siva S V P; Valente, Anthony J; Siddesha, Jalahalli M; Delafontaine, Patrice; Siebenlist, Ulrich; Gardner, Jason D; Bysani, Chandrasekar
2016-07-05
Aberrant activation of the renin-angiotensin-aldosterone system (RAAS) contributes to adverse cardiac remodeling and eventual failure. Here we investigated whether TRAF3 Interacting Protein 2 (TRAF3IP2), a redox-sensitive cytoplasmic adaptor molecule and an upstream regulator of nuclear factor-κB (NF-κB) and activator protein-1 (AP-1), mediates aldosterone-induced cardiac hypertrophy and fibrosis. Wild type (WT) and TRAF3IP2-null mice were infused with aldosterone (0.2 mg/kg/day) for 4 weeks along with 1%NaCl in drinking water. Aldosterone/salt, but not salt alone, upregulated TRAF3IP2 expression in WT mouse hearts. Further, aldosterone elevated blood pressure to a similar extent in both WT and TRAF3IP2-null groups. However, TRAF3IP2 gene deletion attenuated aldosterone/salt-induced (i) p65 and c-Jun activation, (ii) extracellular matrix (collagen Iα1 and collagen IIIα1), matrix metalloproteinase (MMP2), lysyl oxidase (LOX), inflammatory cytokine (IL-6 and IL-18), chemokine (CXCL1 and CXCL2), and adhesion molecule (ICAM1) mRNA expression in hearts, (iii) IL-6, IL-18, and MMP2 protein levels, (iv) systemic IL-6 and IL-18 levels, and (iv) cardiac hypertrophy and fibrosis. These results indicate that TRAF3IP2 is a critical signaling intermediate in aldosterone/salt-induced myocardial hypertrophy and fibrosis, and thus a potential therapeutic target in hypertensive heart disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Matrix elements of explicitly correlated Gaussian basis functions with arbitrary angular momentum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joyce, Tennesse; Varga, Kálmán
2016-05-14
A new algorithm for calculating the Hamiltonian matrix elements with all-electron explicitly correlated Gaussian functions for quantum-mechanical calculations of atoms with arbitrary angular momentum is presented. The calculations are checked on several excited states of three and four electron systems. The presented formalism can be used as unified framework for high accuracy calculations of properties of small atoms and molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liang, Binyong; Andrews, Lester S.; Li, Jun
2004-02-09
Uranium atoms excited by laser ablation react with CO in excess neon to produce the novel CUO molecule, which forms distinct Ng complexes (Ng = Ar, Kr, Xe) when the heavier noble gases are added. The CUO(Ng) complexes are identified through CO isotopic and Ng substitution on the neon matrix infrared spectra and by comparison to DFT frequency calculations. The U-C and U-O stretching frequencies of CUO(Ng) complexes are slightly red shifted from frequencies for the 1S+ CUO ground state, which identifies singlet ground state CUO(Ng) complexes. In solid neon the CUO molecule is also a complex CUO(Ne)n, and themore » CUO(Ne)n-1(Ng) complexes are likewise specified. The next singlet CUO(Ne)x(Ng)2 complexes in excess neon follow in like manner. However, the higher CUO(Ne)x(Ng)n complex (n = 3, 4) stretching modes approach pure argon matrix CUO(Ar)n values and isotopic behavior, which are characterized as triplet ground state complexes by DFT frequency calculations. This work suggests that the singlet-triplet crossing occurs with 3 Ar, 3 Kr or 4 Xe and a balance of Ne atoms coordinated to CUO in the neon matrix host.« less
Cairns, Andrew G; McQuaker, Stephen J; Murphy, Michael P; Hartley, Richard C
2015-01-01
Small molecules can be physicochemically targeted to mitochondria using the lipophilic alkyltriphenylphosphonium (TPP) group. Once in the mitochondria the TPP-conjugate can detect or influence processes within the mitochondrial matrix directly. Alternatively, the conjugate can behave as a prodrug, which is activated by release from the TPP group either using an internal or external instruction. Small molecules can be designed that can be used in any cell line, tissue or whole organism, allow temporal control, and be applied in a reversible dose-dependent fashion. An example is the detection and quantification of hydrogen peroxide in mitochondria of whole living organisms by MitoB. Hydrogen peroxide produced within the mitochondrial matrix is involved in signalling and implicated in the oxidative damage associated with aging and a wide range of age-associated conditions including cardiovascular disease, neurodegeneration, and cancer. MitoB accumulates in mitochondria and is converted into the exomarker, MitoP, by hydrogen peroxide in the mitochondrial matrix. The hydrogen peroxide concentration is determined from the ratio of MitoP to MitoB after a period of incubation, and this ratio is determined by mass spectrometry using d15-MitoP and d15-MitoB as standard. Here we describe the synthesis of MitoB and MitoP and the deuterated standards necessary for this method of quantification.
Hoogenboom, Jacob P; van Dijk, Erik M H P; Hernando, Jordi; van Hulst, Niek F; García-Parajó, María F
2005-08-26
We exploit the strong excitonic coupling in a superradiant trimer molecule to distinguish between long-lived collective dark states and photobleaching events. The population and depopulation kinetics of the dark states in a single molecule follow power-law statistics over 5 orders of magnitude in time. This result is consistent with the formation of a radical unit via electron tunneling to a time-varying distribution of trapping sites in the surrounding polymer matrix. We furthermore demonstrate that this radicalization process forms the dominant pathway for molecular photobleaching.
Derivation of the chemical-equilibrium rate coefficient using scattering theory
NASA Technical Reports Server (NTRS)
Mickens, R. E.
1977-01-01
Scattering theory is applied to derive the equilibrium rate coefficient for a general homogeneous chemical reaction involving ideal gases. The reaction rate is expressed in terms of the product of a number of normalized momentum distribution functions, the product of the number of molecules with a given internal energy state, and the spin-averaged T-matrix elements. An expression for momentum distribution at equilibrium for an arbitrary molecule is presented, and the number of molecules with a given internal-energy state is represented by an expression which includes the partition function.
Saladino, Silvia; Salamone, Monica; Ghersi, Giulio
2017-09-01
Tumor angiogenesis is a multiphasic process, having the extracellular matrix remodeling as critical step. Different classes of proteolytic enzymes in matrix digestion/remodeling are involved. The role of lytic enzymes and their activation mode have not been completely elucidated. Herein, the crosstalk between endothelia and tumor cells, by realization of bi- and three-dimensional endothelial and breast cancer cells co-cultures, were studied in vitro. Particularly, the effects of two tumor conditioned media (TCM) were assessed about endothelial proliferation, migration, and invasiveness. An increase in expression of pro-MMP9 was detected when endothelial cells were cultured in the presence of both TCM; such as an up-regulation of MMP1 and MMP14 and a down-regulation of MMP7. Moreover the increased MMP2 gene expression from one of them and the stimulation MMP3 synthesis from the other one were observed; an increases of β3-integrin, VEGFA, and DPP4 molecules were detected when endothelia cells are cultured with both TCM. The selection/characterization of elements present in conditioned media from breast cancer cells differently affect endothelial cells, make them potential effectors useful in breast cancer treatment. © 2017 International Federation for Cell Biology.
Lapinski, Leszek; Gerega, Anna; Sobolewski, Andrzej L; Nowak, Maciej J
2008-01-17
Photochemical transformations of N-hydroxypyridine-2(1H)-thione and its deuterated isotopologue were studied using the matrix-isolation technique. Low-temperature Ar and N2 matrixes containing monomers of this compound were irradiated with continuous-wave near-UV light. Photogeneration of two products was observed in these experiments. The relative population of these photogenerated species was found to be dependent on the wavelength of the UV light used for irradiation. By comparison of the IR spectra of the photoproducts with the spectra simulated theoretically at the DFT(B3LYP)/6-311++G(d, p) level, the final and the intermediate products were identified as rotameric forms of 2-hydroxysulfanyl-pyridine. This is the first report on generation of this thioperoxy derivative of pyridine. The mechanism of photogeneration of 2-hydroxysulfanyl-pyridine involves a photoinduced cleavage of the N-O bond in N-hydroxypyridine-2(1H)-thione, generation of the .OH radical weakly bound with the remaining pyridylthiyl radical, and recombination of these two radicals by formation of the new -S-O- bond. A theoretical model supporting this interpretation was constructed on the basis of approximate coupled cluster (CC2) calculations of the potential energy surfaces of the ground and first excited singlet electronic states of the system. After electronic excitation of the monomeric N-hydroxypyridine-2(1H)-thione, the molecule evolves to the conical intersection with the potential energy surface of the ground state and then to the global minimum corresponding to 2-hydroxysulfanyl-pyridine.
Gajarsa, Jason J; Kloner, Robert A
2011-01-01
As more patients survive myocardial infarctions, the incidence of heart failure increases. After an infarction, the human heart undergoes a series of structural changes, which are governed by cellular and molecular mechanisms in a pathological metamorphosis termed "remodeling." This review will discuss the current developments in our understanding of these molecular and cellular events in remodeling and the various pharmacological, cellular and device therapies used to treat, and potentially retard, this condition. Specifically, this paper will examine the neurohormonal activity of the renin-angiotensin-aldosterone axis and its molecular effects on the heart. The emerging understanding of the extra-cellular matrix and the various active molecules within it, such as the matrix metalloproteinases, elicits new appreciation for their role in cardiac remodeling and as possible future therapeutic targets. Cell therapy with stem cells is another recent therapy with great potential in improving post-infarcted hearts. Lastly, the cellular and molecular effects of left ventricular assist devices on remodeling will be reviewed. Our increasing knowledge of the cellular and molecular mechanisms underlying cardiac remodeling enables us not only to better understand how our more successful therapies, like angiotensin-converting enzyme inhibitors, work, but also to explore new therapies of the future.
Regulation of Corneal Stroma Extracellular Matrix Assembly
Chen, Shoujun; Mienaltowski, Michael J.; Birk, David E.
2014-01-01
The transparent cornea is the major refractive element of the eye. A finely controlled assembly of the stromal extracellular matrix is critical to corneal function, as well as in establishing the appropriate mechanical stability required to maintain corneal shape and curvature. In the stroma, homogeneous, small diameter collagen fibrils, regularly packed with a highly ordered hierarchical organization, are essential for function. This review focuses on corneal stroma assembly and the regulation of collagen fibrillogenesis. Corneal collagen fibrillogenesis involves multiple molecules interacting in sequential steps, as well as interactions between keratocytes and stroma matrix components. The stroma has the highest collagen V:I ratio in the body. Collagen V regulates the nucleation of protofibril assembly, thus controlling the number of fibrils and assembly of smaller diameter fibrils in the stroma. The corneal stroma is also enriched in small leucine-rich proteoglycans (SLRPs) that cooperate in a temporal and spatial manner to regulate linear and lateral collagen fibril growth. In addition, the fibril-associated collagens (FACITs) such as collagen XII and collagen XIV have roles in the regulation of fibril packing and inter-lamellar interactions. A communicating keratocyte network contributes to the overall and long-range regulation of stromal extracellular matrix assembly, by creating micro-domains where the sequential steps in stromal matrix assembly are controlled. Keratocytes control the synthesis of extracellular matrix components, which interact with the keratocytes dynamically to coordinate the regulatory steps into a cohesive process. Mutations or deficiencies in stromal regulatory molecules result in altered interactions and deficiencies in both transparency and refraction, leading to corneal stroma pathobiology such as stromal dystrophies, cornea plana and keratoconus. PMID:25819456
Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie
2016-12-21
The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.
Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie
2017-02-03
The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.
Wallace, Ian S.
2015-01-01
The monosaccharide L-fucose (L-Fuc) is a common component of plant cell wall polysaccharides and other plant glycans, including the hemicellulose xyloglucan, pectic rhamnogalacturonan-I (RG-I) and rhamnogalacturonan-II (RG-II), arabinogalactan proteins, and N-linked glycans. Mutations compromising the biosynthesis of many plant cell wall polysaccharides are lethal, and as a result, small molecule inhibitors of plant cell wall polysaccharide biosynthesis have been developed because these molecules can be applied at defined concentrations and developmental stages. In this study, we characterize novel small molecule inhibitors of plant fucosylation. 2-fluoro-L-fucose (2F-Fuc) analogs caused severe growth phenotypes when applied to Arabidopsis seedlings, including reduced root growth and altered root morphology. These phenotypic defects were dependent upon the L-Fuc salvage pathway enzyme L-Fucose Kinase/ GDP-L-Fucose Pyrophosphorylase (FKGP), suggesting that 2F-Fuc is metabolically converted to the sugar nucleotide GDP-2F-Fuc, which serves as the active inhibitory molecule. The L-Fuc content of cell wall matrix polysaccharides was reduced in plants treated with 2F-Fuc, suggesting that this molecule inhibits the incorporation of L-Fuc into these polysaccharides. Additionally, phenotypic defects induced by 2F-Fuc treatment could be partially relieved by the exogenous application of boric acid, suggesting that 2F-Fuc inhibits RG-II biosynthesis. Overall, the results presented here suggest that 2F-Fuc is a metabolically incorporated inhibitor of plant cellular fucosylation events, and potentially suggest that other 2-fluorinated monosaccharides could serve as useful chemical probes for the inhibition of cell wall polysaccharide biosynthesis. PMID:26414071
NASA Astrophysics Data System (ADS)
Ochsenfeld, Christian; Head-Gordon, Martin
1997-05-01
To exploit the exponential decay found in numerical studies for the density matrix and its derivative with respect to nuclear displacements, we reformulate the coupled perturbed self-consistent field (CPSCF) equations and a quadratically convergent SCF (QCSCF) method for Hartree-Fock and density functional theory within a local density matrix-based scheme. Our D-CPSCF (density matrix-based CPSCF) and D-QCSCF schemes open the way for exploiting sparsity and to achieve asymptotically linear scaling of computational complexity with molecular size ( M), in case of D-CPSCF for all O( M) derivative densities. Furthermore, these methods are even for small molecules strongly competitive to conventional algorithms.
Kuwahara, Go; Hashimoto, Takuya; Tsuneki, Masayuki; Yamamoto, Kota; Assi, Roland; Foster, Trenton R; Hanisch, Jesse J; Bai, Hualong; Hu, Haidi; Protack, Clinton D; Hall, Michael R; Schardt, John S; Jay, Steven M; Madri, Joseph A; Kodama, Shohta; Dardik, Alan
2017-06-01
Arteriovenous fistulae (AVF) remain the optimal conduit for hemodialysis access but continue to demonstrate poor patency and poor rates of maturation. We hypothesized that CD44, a widely expressed cellular adhesion molecule that serves as a major receptor for extracellular matrix components, promotes wall thickening and extracellular matrix deposition during AVF maturation. AVF were created via needle puncture in wild-type C57BL/6J and CD44 knockout mice. CD44 mRNA and protein expression was increased in wild-type AVF. CD44 knockout mice showed no increase in AVF wall thickness (8.9 versus 26.8 μm; P =0.0114), collagen density, and hyaluronic acid density, but similar elastin density when compared with control AVF. CD44 knockout mice also showed no increase in vascular cell adhesion molecule-1 expression, intercellular adhesion molecule-1 expression, and monocyte chemoattractant protein-1 expression in the AVF compared with controls; there were also no increased M2 macrophage markers (transglutaminase-2: 81.5-fold, P =0.0015; interleukin-10: 7.6-fold, P =0.0450) in CD44 knockout mice. Delivery of monocyte chemoattractant protein-1 to CD44 knockout mice rescued the phenotype with thicker AVF walls (27.2 versus 14.7 μm; P =0.0306), increased collagen density (2.4-fold; P =0.0432), and increased number of M2 macrophages (2.1-fold; P =0.0335). CD44 promotes accumulation of M2 macrophages, extracellular matrix deposition, and wall thickening during AVF maturation. These data show the association of M2 macrophages with wall thickening during AVF maturation and suggest that enhancing CD44 activity may be a strategy to increase AVF maturation. © 2017 American Heart Association, Inc.
NASA Technical Reports Server (NTRS)
Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.
2001-01-01
Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.
A novel intravaginal ring to prevent HIV-1, HSV-2, HPV, and unintended pregnancy.
Ugaonkar, Shweta R; Wesenberg, Asa; Wilk, Jolanta; Seidor, Samantha; Mizenina, Olga; Kizima, Larisa; Rodriguez, Aixa; Zhang, Shimin; Levendosky, Keith; Kenney, Jessica; Aravantinou, Meropi; Derby, Nina; Grasperge, Brooke; Gettie, Agegnehu; Blanchard, James; Kumar, Narender; Roberts, Kevin; Robbiani, Melissa; Fernández-Romero, José A; Zydowsky, Thomas M
2015-09-10
Women urgently need a self-initiated, multipurpose prevention technology (MPT) that simultaneously reduces their risk of acquiring HIV-1, HSV-2, and HPV (latter two associated with increased risk of HIV-1 acquisition) and prevents unintended pregnancy. Here, we describe a novel core-matrix intravaginal ring (IVR), the MZCL IVR, which effectively delivered the MZC combination microbicide and a contraceptive. The MZCL IVR contains four active pharmaceutical ingredients (APIs): MIV-150 (targets HIV-1), zinc acetate (ZA; targets HIV-1 and HSV-2), carrageenan (CG; targets HPV and HSV-2), and levonorgestrel (LNG; targets unintended pregnancy). The elastomeric IVR body (matrix) was produced by hot melt extrusion of the non-water swellable elastomer, ethylene vinyl acetate (EVA-28), containing the hydrophobic small molecules, MIV-150 and LNG. The solid hydrophilic core, embedded within the IVR by compression, contained the small molecule ZA and the macromolecule CG. Hydrated ZA/CG from the core was released by diffusion via a pore on the IVR while the MIV-150/LNG diffused from the matrix continuously for 94 days (d) in vitro and up to 28 d (study period) in macaques. The APIs released in vitro and in vivo were active against HIV-1ADA-M, HSV-2, and HPV16 PsV in cell-based assays. Serum LNG was at levels associated with local contraceptive effects. The results demonstrate proof-of-concept of a novel core-matrix IVR for sustained and simultaneous delivery of diverse molecules for the prevention of HIV, HSV-2 and HPV acquisition, as well as unintended pregnancy. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Advanced Mass Spectrometry Technologies for the Study of Microbial Pathogenesis
Moore, Jessica L.; Caprioli, Richard M.; Skaar, Eric P.
2014-01-01
Matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) has been successfully applied to the field of microbial pathogenesis with promising results, principally in diagnostic microbiology to rapidly identify bacteria based on the molecular profiles of small cell populations. Direct profiling of molecules from serum and tissue samples by MALDI MS providesa means to study the pathogen-host interaction and to discover potential markers of infection. Systematic molecular profiling across tissue sections represents a new imaging modality, enabling regiospecific molecular measurements to be made in situ, in both two- and three-dimensional analyses. Herein, we briefly summarize work that employs MALDI MS to study the pathogenesis of microbial infection. PMID:24997399
Quantitative Single-Cell mRNA Analysis in Hydrogel Beads.
Rakszewska, Agata; Stolper, Rosa J; Kolasa, Anna B; Piruska, Aigars; Huck, Wilhelm T S
2016-06-01
In recent years, technologies capable of analyzing single cells have emerged that are transforming many fields of biological research. Herein we report how DNA-functionalized hydrogel beads can serve as a matrix to capture mRNA from lysed single cells. mRNA quantification free of pre-amplification bias is ensured by using padlock probes and rolling circle amplification followed by hybridization with fluorescent probes. The number of transcripts in individual cells is assessed by simply counting fluorescent dots inside gel beads. The method extends the potential of existing techniques and provides a general platform for capturing molecules of interest from single cells. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tarana, Michal; JILA, University of Colorado and NIST, Boulder, Colorado 80309-0440; Houfek, Karel
We present a study of dissociative electron attachment and vibrational excitation processes in electron collisions with the CF{sub 3}Cl molecule. The calculations are based on the two-dimensional nuclear dynamics including the C-Cl symmetric stretch coordinate and the CF{sub 3} symmetric deformation (umbrella) coordinate. The complex potential energy surfaces are calculated using the ab initio R-matrix method. The results for dissociative attachment and vibrational excitation of the umbrella mode agree quite well with experiment whereas the cross section for excitation of the C-Cl symmetric stretch vibrations is about a factor-of-three too low in comparison with experimental data.
Conformations and charge distributions of diazocyclopropanes
NASA Astrophysics Data System (ADS)
Borges, Itamar, Jr.
Three diazo-substituted cyclopropane compounds, which have been suggested as new potential high energy compounds, were studied employing the B3LYP-DFT/6-31G(d,p) method. Geometries were optimized. Distributed multipole analysis, computed from the B3LYP-DFT/6-31G(d,p) density matrix, was used to describe the details of the molecular charge distribution of the three molecules. It was verified that electron withdrawing from the C ring atoms and charge build-up on the N atoms bonded to the ring increased with the number of diazo groups. These effects were related to increased sensitivity to impact and easiness of C bond N bond breaking in the three compounds.
Bian, Juan; Olesik, Susan V
2017-03-27
Polyacrylonitrile/Nafion®/carbon nanotube (PAN/Nafion®/CNT) composite nanofibers were prepared using electrospinning. These electrospun nanofibers were studied as possible substrates for surface-assisted laser desorption/ionization (SALDI) and matrix-enhanced surface-assisted laser desorption/ionization time-of-flight mass spectrometry (ME-SALDI/TOF-MS) for the first time in this paper. Electrospinning provides this novel substrate with a uniform morphology and a narrow size distribution, where CNTs were evenly and firmly immobilized on polymeric nanofibers. The results show that PAN/Nafion®/CNT nanofibrous mats are good substrates for the analysis of both small drug molecules and high molecular weight polymers with high sensitivity. Markedly improved reproducibility was observed relative to MALDI. Due to the composite formation between the polymers and the CNTs, no contamination of the carbon nanotubes to the mass spectrometer was observed. Furthermore, electrospun nanofibers used as SALDI substrates greatly extended the duration of ion signals of target analytes compared to the MALDI matrix. The proposed SALDI approach was successfully used to quantify small drug molecules with no interference in the low mass range. The results show that verapamil could be detected with a surface concentration of 220 femtomoles, indicating the high detection sensitivity of this method. Analysis of peptides and proteins with the electrospun composite substrate using matrix assisted-SALDI was improved and a low limit of detection of approximately 6 femtomoles was obtained for IgG. Both SALDI and ME-SALDI analyses displayed high reproducibility with %RSD ≤ 9% for small drug molecules and %RSD ≤ 14% for synthetic polymers and proteins.
NASA Astrophysics Data System (ADS)
Heaps, Charles W.; Schatz, George C.
2017-06-01
A computational method to model diffraction-limited images from super-resolution surface-enhanced Raman scattering microscopy is introduced. Despite significant experimental progress in plasmon-based super-resolution imaging, theoretical predictions of the diffraction limited images remain a challenge. The method is used to calculate localization errors and image intensities for a single spherical gold nanoparticle-molecule system. The light scattering is calculated using a modification of generalized Mie (T-matrix) theory with a point dipole source and diffraction limited images are calculated using vectorial diffraction theory. The calculation produces the multipole expansion for each emitter and the coherent superposition of all fields. Imaging the constituent fields in addition to the total field provides new insight into the strong coupling between the molecule and the nanoparticle. Regardless of whether the molecular dipole moment is oriented parallel or perpendicular to the nanoparticle surface, the anisotropic excitation distorts the center of the nanoparticle as measured by the point spread function by approximately fifty percent of the particle radius toward to the molecule. Inspection of the nanoparticle multipoles reveals that distortion arises from a weak quadrupole resonance interfering with the dipole field in the nanoparticle. When the nanoparticle-molecule fields are in-phase, the distorted nanoparticle field dominates the observed image. When out-of-phase, the nanoparticle and molecule are of comparable intensity and interference between the two emitters dominates the observed image. The method is also applied to different wavelengths and particle radii. At off-resonant wavelengths, the method predicts images closer to the molecule not because of relative intensities but because of greater distortion in the nanoparticle. The method is a promising approach to improving the understanding of plasmon-enhanced super-resolution experiments.
Yan, Yuanwei; Bejoy, Julie; Xia, Junfei; Guan, Jingjiao; Zhou, Yi; Li, Yan
2016-09-15
Appropriate neural patterning of human induced pluripotent stem cells (hiPSCs) is critical to generate specific neural cells/tissues and even mini-brains that are physiologically relevant to model neurological diseases. However, the capacity of signaling factors that regulate 3-D neural tissue patterning in vitro and differential responses of the resulting neural populations to various biomolecules have not yet been fully understood. By tuning neural patterning of hiPSCs with small molecules targeting sonic hedgehog (SHH) signaling, this study generated different 3-D neuronal cultures that were mainly comprised of either cortical glutamatergic neurons or motor neurons. Abundant glutamatergic neurons were observed following the treatment with an antagonist of SHH signaling, cyclopamine, while Islet-1 and HB9-expressing motor neurons were enriched by an SHH agonist, purmorphamine. In neurons derived with different neural patterning factors, whole-cell patch clamp recordings showed similar voltage-gated Na(+)/K(+) currents, depolarization-evoked action potentials and spontaneous excitatory post-synaptic currents. Moreover, these different neuronal populations exhibited differential responses to three classes of biomolecules, including (1) matrix metalloproteinase inhibitors that affect extracellular matrix remodeling; (2) N-methyl-d-aspartate that induces general neurotoxicity; and (3) amyloid β (1-42) oligomers that cause neuronal subtype-specific neurotoxicity. This study should advance our understanding of hiPSC self-organization and neural tissue development and provide a transformative approach to establish 3-D models for neurological disease modeling and drug discovery. Appropriate neural patterning of human induced pluripotent stem cells (hiPSCs) is critical to generate specific neural cells, tissues and even mini-brains that are physiologically relevant to model neurological diseases. However, the capability of sonic hedgehog-related small molecules to tune different neuronal subtypes in 3-D differentiation from hiPSCs and the differential cellular responses of region-specific neuronal subtypes to various biomolecules have not been fully investigated. By tuning neural patterning of hiPSCs with small molecules targeting sonic hedgehog signaling, this study provides knowledge on the differential susceptibility of region-specific neuronal subtypes derived from hiPSCs to different biomolecules in extracellular matrix remodeling and neurotoxicity. The findings are significant for understanding 3-D neural patterning of hiPSCs for the applications in brain organoid formation, neurological disease modeling, and drug discovery. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Lunde, Ida G; Herum, Kate M; Carlson, Cathrine C; Christensen, Geir
2016-09-01
Heart disease is a deadly syndrome affecting millions worldwide. It reflects an unmet clinical need, and the disease mechanisms are poorly understood. Cardiac fibrosis is central to heart disease. The four-membered family of transmembrane proteoglycans, syndecan-1 to -4, is believed to regulate fibrosis. We review the current literature concerning syndecans in cardiac fibrosis. Syndecan expression is up-regulated in response to pro-inflammatory stimuli in various forms of heart disease with fibrosis. Mice lacking syndecan-1 and -4 show reduced activation of pro-fibrotic signaling and increased cardiac rupture upon infarction indicating an important role for these molecules. Whereas the short cytoplasmic tail of syndecans regulates signaling, their extracellular part, substituted with heparan sulfate glycosaminoglycan chains, binds a plethora of extracellular matrix (ECM) molecules involved in fibrosis, e.g., collagens, growth factors, cytokines, and immune cell adhesion proteins. Full-length syndecans induce pro-fibrotic signaling, increasing the expression of collagens, myofibroblast differentiation factors, ECM enzymes, growth factors, and immune cell adhesion molecules, thereby also increasing cardiac stiffness and preventing cardiac rupture. Upon pro-inflammatory stimuli, syndecan ectodomains are enzymatically released from heart cells (syndecan shedding). Shed ectodomains affect the expression of ECM molecules, promoting ECM degradation and cardiac rupture upon myocardial infarction. Blood levels of shed syndecan-1 and -4 ectodomains are associated with hospitalization, mortality, and heart remodeling in patients with heart failure. Improved understanding of syndecans and their modifying enzymes in cardiac fibrosis might contribute to the development of compounds with therapeutic potential, and enzymatically shed syndecan ectodomains might constitute a future prognostic tool for heart diseases with fibrosis. Graphical Abstract Graphical abstract summarizing the contents of the current review on syndecans in cardiac fibrosis. The heart is subjected to various forms of pathological stimuli, e.g., myocardial infarction, hypertension, valvular stenosis, infection, or an inherited genetic mutation, triggering responses in cells resident in the heart. Here, we focus on the responses of cardiac fibroblasts directing changes in the extracellular matrix resulting in cardiac fibrosis. A family of four transmembrane proteoglycans, syndecan-1 to -4, is expressed in the cell membrane of cardiac fibroblasts and is generally up-regulated in response to the above-mentioned pathological stimuli. Syndecans carry glycosaminoglycan chains on their extracellular domain, binding a plethora of molecules involved in fibrosis, e.g., growth factors, cytokines, immune cell adhesion proteins, and pathogens. Syndecans have a short cytoplasmic tail involved in pro-fibrotic signaling. The signaling and cellular processes governed by syndecans in the heart in response to pathological stimuli regulate important aspects of extracellular matrix remodeling and fibrosis and have mainly been studied in cardiac remodeling in response to cardiac infarction and pressure overload. In general, adequate timing and the quantity and quality of fibrosis are absolutely crucial for heart function and survival, determining cardiac stiffness, contractility, compliance, probability of rupture, dilation, and diastolic and systolic function. Syndecan-1 and -4 have mainly been studied in the heart and are discussed in this review (LV left ventricle).
Bromo-oxidation reaction in enzyme-entrapped alginate hollow microfibers
Asthana, Amit; Lee, Kwang Ho; Shin, Su-Jung; Perumal, Jayakumar; Butler, Lauren; Lee, Sang-Hoon; Kim, Dong-Pyo
2011-01-01
In this article, the authors present the fabrication of an enzyme-entrapped alginate hollow fiber using a microfluidic device. Further use of enzyme-entrapped alginate hollow fibers as a biocatalytic microchemical reactor for chemical synthesis is also deliberated in this article. To ensure that there is no enzyme leaching from the fiber, fiber surfaces were coated with chitosan. To confine the mobility of reactants and products within the porous hollow fibers the entire fibers were embedded into a transparent polydimethylsiloxane (PDMS) matrix which also works as a support matrix. A vanadium-containing bromoperoxidase enzyme isolated from Corallina confusa was used as a model enzyme to demonstrate the use of these alginate hollow-fiber reactors in bromo-oxidation of phenol red to bromophenol blue at different dye flow rates. Stability of the entrapped enzyme at different temperatures and the effect of the chitosan coating on the reaction conversion were also studied. It was observed that molecules as big as 27 kDa can be retained in the matrix after coating with chitosan while molecules with molecular-weight of around 378 Da can still diffuse in and out of the matrix. The kinetic conversion rate in this microfluidic bioreactor was more than 41-fold faster when compared with the standard test-tube procedure. PMID:21799723
Knöös, Patrik; Wahlgren, Marie; Topgaard, Daniel; Ulvenlund, Stefan; Piculell, Lennart
2014-08-14
A combination of NMR chemical shift imaging and self-diffusion experiments is shown to give a detailed molecular picture of the events that occur when tablets of hydrophobically modified poly(acrylic acid) loaded with a drug (griseofulvin) swell in water in the presence or absence of surfactant (sodium octylbenzenesulfonate). The hydrophobic substituents on the polymer bind and trap the surfactant molecules in mixed micelles, leading to a slow effective surfactant transport that occurs via a small fraction of individually dissolved surfactant molecules in the water domain. Because of the efficient binding of surfactant, the penetrating water is found to diffuse past the penetrating surfactant into the polymer matrix, pushing the surfactant front outward as the matrix swells. The added surfactant has little effect on the transport of drug because both undissolved solid drug and surfactant-solubilized drug function as reservoirs that essentially follow the polymer as it swells. However, the added surfactant nevertheless has a strong indirect effect on the release of griseofulvin, through the effect of the surfactant on the solubility and erosion of the polymer matrix. The surfactant effectively solubilizes the hydrophobically modified polymer, making it fully miscible with water, leading to a more pronounced swelling and a slower erosion of the polymer matrix.
Bovine serum albumin adsorption on functionalized porous silicon surfaces
NASA Astrophysics Data System (ADS)
Tay, Li-Lin; Rowell, Nelson L.; Lockwood, David J.; Boukherroub, Rabah
2004-10-01
The large surface area within porous Si (pSi) and its strong room temperature photoluminescence (PL) make it an ideal host for biological sensors. In particular, the development of pSi-based optical sensors for DNA, enzyme and other biochemical molecules have become of great interest. Here, we demonstrate that the in-situ monitoring of the pSi PL behaviour can be used as a positive identification of bovine serum albumin (BSA) protein adsorption inside the porous matrix. Electrochemically prepared pSi films were first functionalized with undecylenic acid to produce an organic monolayer covalently attached to the porous silicon surfaces. The acid terminal group also provided favourable BSA binding sites on the pSi matrix sidewalls. In-situ PL spectra showed a gradual red shift (up to 12 meV) in the PL peak energy due to the protein incorporation into the porous matrix. The PL then exhibited a continuous blue shift after saturation of the protein molecules in the pores. This blue shift of the PL peak frequency and a steady increase in the PL intensity is evidence of surface oxidation. Comparing the specular reflectance obtained by Fourier transform infrared spectroscopy (FTIR) before and after BSA incubation confirmed the adsorption of protein in the pSi matrix.
Takayama, Mitsuo; Nagoshi, Keishiro; Iimuro, Ryunosuke; Inatomi, Kazuma
2014-01-01
A factor for estimating the flexibility of proteins is described that uses a cleavage method of “in-source decay (ISD)” coupled with matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). The MALDI-ISD spectra of bovine serum albumin (BSA), myoglobin and thioredoxin show discontinuous intense ion peaks originating from one-side preferential cleavage at the N-Cα bond of Xxx-Asp, Xxx-Asn, Xxx-Cys and Gly-Xxx residues. Consistent with these observations, Asp, Asn and Gly residues are also identified by other flexibility measures such as B-factor, turn preference, protection and fluorescence decay factors, while Asp, Asn, Cys and Gly residues are identified by turn preference factor based on X-ray crystallography. The results suggest that protein molecules embedded in/on MALDI matrix crystals partly maintain α-helix and that the reason some of the residues are more susceptible to ISD (Asp, Asn, Cys and Gly) and others less so (Ile and Val) is because of accessibility of the peptide backbone to hydrogen-radicals from matrix molecules. The hydrogen-radical accessibility in MALDI-ISD could therefore be adopted as a factor for measuring protein flexibility. PMID:24828203
Kolb, Florian; Schmoltner, Kerstin; Huth, Michael; Hohenau, Andreas; Krenn, Joachim; Klug, Andreas; List, Emil J W; Plank, Harald
2013-08-02
The development of simple gas sensing concepts is still of great interest for science and technology. The demands on an ideal device would be a single-step fabrication method providing a device which is sensitive, analyte-selective, quantitative, and reversible without special operating/reformation conditions such as high temperatures or special environments. In this study we demonstrate a new gas sensing concept based on a nanosized PtC metal-matrix system fabricated in a single step via focused electron beam induced deposition (FEBID). The sensors react selectively on polar H2O molecules quantitatively and reversibly without any special reformation conditions after detection events, whereas non-polar species (O2, CO2, N2) produce no response. The key elements are isolated Pt nanograins (2-3 nm) which are embedded in a dielectric carbon matrix. The electrical transport in such materials is based on tunneling effects in the correlated variable range hopping regime, where the dielectric carbon matrix screens the electric field between the particles, which governs the final conductivity. The specific change of these dielectric properties by the physisorption of polar gas molecules (H2O) can change the tunneling probability and thus the overall conductivity, allowing their application as a simple and straightforward sensing concept.
A Versatile Click-Compatible Monolignol Probe to Study Lignin Deposition in Plant Cell Walls
Pandey, Jyotsna L.; Wang, Bo; Diehl, Brett G.; Richard, Tom L.; Chen, Gong; Anderson, Charles T.
2015-01-01
Lignin plays important structural and functional roles in plants by forming a hydrophobic matrix in secondary cell walls that enhances mechanical strength and resists microbial decay. While the importance of the lignin matrix is well documented and the biosynthetic pathways for monolignols are known, the process by which lignin precursors or monolignols are transported and polymerized to form this matrix remains a subject of considerable debate. In this study, we have synthesized and tested an analog of coniferyl alcohol that has been modified to contain an ethynyl group at the C-3 position. This modification enables fluorescent tagging and imaging of this molecule after its incorporation into plant tissue by click chemistry-assisted covalent labeling with a fluorescent azide dye, and confers a distinct Raman signature that could be used for Raman imaging. We found that this monolignol analog is incorporated into in vitro-polymerized dehydrogenation polymer (DHP) lignin and into root epidermal cell walls of 4-day-old Arabidopsis seedlings. Incorporation of the analog in stem sections of 6-week-old Arabidopsis thaliana plants and labeling with an Alexa-594 azide dye revealed the precise locations of new lignin polymerization. Results from this study indicate that this molecule can provide high-resolution localization of lignification during plant cell wall maturation and lignin matrix assembly. PMID:25884205
Integrins, tensegrity, and mechanotransduction.
Ingber, D E
1997-06-01
Physical forces, such as those due to gravity, play an important role in tissue development and remodeling. Yet, little is known about how individual cells sense mechanical signals or how they transduce them into a chemical response. Rather than listing the numerous signal pathways that have been found to be sensitive to mechanical stimulation, we need to place potential molecular signaling mechanisms within the context of the entire cell. The model presented is based on the concept that cells use tensegrity architecture to organize their cytoskeleton and stabilize their form. Studies with stick and string tensegrity cell models predict that living cells are hard-wired to respond immediately to external mechanical stresses. This hard-wiring exists in the form of discrete cytoskeletal filament networks that mechanically couple specific cell surface receptors, such as integrins, to nuclear matrix scaffolds and to potential transducing molecules that physically associate with the cytoskeleton. If these signaling molecules do function in a "solid-state", then mechanical stresses may be transduced into biochemical responses through force-dependent changes in cytoskeletal geometry or through local alterations in thermodynamic or kinetic parameters. Changes in cytoskeletal tension (prestress) also may play a role in signal amplification and adaptation. Recent experimental results are described which provide direct support for the tensegrity theory.
Simple model for molecular scattering
NASA Astrophysics Data System (ADS)
Mehta, Nirav; Ticknor, Christopher; Hazzard, Kaden
2017-04-01
The collisions of ultracold molecules are qualitatively different from the collisions of ultracold atoms due to the high density of bimolecular resonances near the collision energy. We present results from a simple N-channel scattering model with square-well channel potentials and constant channel couplings (inside the well) designed to reproduce essential features of chaotic molecular scattering. The potential depths and channel splittings are tuned to reproduce the appropriate density of states for the short-range bimolecular collision complex (BCC), which affords a direct comparison of the resulting level-spacing distribution to that expected from random matrix theory (RMT), namely the so-called Wigner surmise. The density of states also sets the scale for the rate of dissociation from the BCC to free molecules, as approximated by transition state theory (TST). Our model affords a semi-analytic solution for the scattering amplitude in the open channel, and a determinantal equation for the eigenenergies of the short-ranged BCC. It is likely the simplest finite-ranged scattering model that can be compared to expectations from the approximations of RMT, and TST. The validity of these approximations has implications for the many-channel Hubbard model recently developed. This research was funded in part by the National Science Foundation under Grant No. NSF PHY-1125915.
Integrins, tensegrity, and mechanotransduction
NASA Technical Reports Server (NTRS)
Ingber, D. E.
1997-01-01
Physical forces, such as those due to gravity, play an important role in tissue development and remodeling. Yet, little is known about how individual cells sense mechanical signals or how they transduce them into a chemical response. Rather than listing the numerous signal pathways that have been found to be sensitive to mechanical stimulation, we need to place potential molecular signaling mechanisms within the context of the entire cell. The model presented is based on the concept that cells use tensegrity architecture to organize their cytoskeleton and stabilize their form. Studies with stick and string tensegrity cell models predict that living cells are hard-wired to respond immediately to external mechanical stresses. This hard-wiring exists in the form of discrete cytoskeletal filament networks that mechanically couple specific cell surface receptors, such as integrins, to nuclear matrix scaffolds and to potential transducing molecules that physically associate with the cytoskeleton. If these signaling molecules do function in a "solid-state", then mechanical stresses may be transduced into biochemical responses through force-dependent changes in cytoskeletal geometry or through local alterations in thermodynamic or kinetic parameters. Changes in cytoskeletal tension (prestress) also may play a role in signal amplification and adaptation. Recent experimental results are described which provide direct support for the tensegrity theory.
Han, Jong-Min; Li, Hua; Cho, Moon-Hee; Baek, Seung-Hwa; Lee, Chul-Ho; Park, Ho-Yong; Jeong, Tae-Sook
2017-01-01
Soy-leaf extracts exert their cardioprotective effects by inducing endothelium-dependent vasodilation in the arteries, and they favorably modulate the serum lipid profile. In this study, we investigated the atheroprotective effects of an ethanol extract of soy leaf (ESL) in human umbilical vein endothelial cells (HUVECs) and high-cholesterol diet (HCD)-fed low-density lipoprotein receptor deficient (LDLR−/−) mice. ESL induced the expression of Krüppel-like factor 2 (KLF2), an endothelial transcription factor, and endothelial nitric oxide synthase (eNOS), and suppressed the expression of vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) through moderate inflammatory signal activation, not only in tumor necrosis factor-α (TNF-α)-stimulated HUVECs but also in 7-ketocholesterol (7-KC)-stimulated HUVECs. ESL supplementation reduced aortic lesion formation in Western diet-fed LDLR−/− mice by 46% (p < 0.01) compared to the HCD group. ESL also markedly decreased the aortic expression levels of VCAM-1, ICAM-1, monocyte chemotactic protein-1 (MCP-1), TNF-α, IL-6, IL-1β, matrix metallopeptidase 9 (MMP-9), and fractalkine, while the expression of KLF2 was significantly increased. These results suggest that ESL supplementation has potential for preventing HCD-induced atherosclerosis effectively. PMID:28208647
An R-matrix study of electron induced processes in BF3 plasma
NASA Astrophysics Data System (ADS)
Gupta, Dhanoj; Chakrabarti, Kalyan; Yoon, Jung-Sik; Song, Mi-Young
2017-12-01
An R-matrix formalism is used to study electron collision with the BF3 molecule using Quantemol-N, a computational system for electron molecule collisions which uses the molecular R-matrix method. Several target models are tested for BF3 in its equilibrium geometry, and the results are presented for the best model. Scattering calculations are then performed to yield resonance parameters, elastic, differential, excitation, and momentum transfer cross sections. The results for all the cross sections are compared with the experimental and theoretical data, and a good agreement is obtained. The resonances have been detected at 3.79 and 13.58 eV, with the ionization threshold being 15.7 eV. We have also estimated the absolute dissociative electron attachment (DEA) cross section for the F- ion production from BF3, which is a maiden attempt. The peak of the DEA is at around 13.5 eV, which is well supported by the resonance detected at 13.58 eV. The cross sections reported here find a variety of applications in the plasma technology.
Expression analysis of extracellular matrix components in brush biopsies of oral lesions.
Driemel, Oliver; Kosmehl, Hartwig; Rosenhahn, Julia; Berndt, Alexander; Reichert, Torsten E; Zardi, Luciano; Dahse, Regine
2007-01-01
Oral brush biopsies have proved to be a promising new non-invasive methodology in the diagnosis of oral lesions. The extracellular matrix (ECM) molecules gamma2 chain of laminin-5 (L5gamma2), tenascin-c (Tn-C) and the fibronectin isoform containing EDB (EDB-fn) are involved in matrix remodeling during malignant transformation in oral carcinoma. Expression of L5gamma2, Tn-C and EDB-fn was analysed in brush biopsy-obtained cells of benign inflammatory or hyperproliferative lesions and primary oral squamous cell carcinoma (OSCC) using the Roche LightCycler 2.0 System. Oral carcinoma are detectable with mRNA resynthesis of the ECM molecules L5gamma2 and Tn-C in oral brush biopsies. EDB-fn mRNA was not detected--the stroma myofibroblasts are apparently a preferential source of EDB-fn and sampling by oral brush biopsy harvests epithelial cells and does not reach the cells which do express EDB-fn. The performance of gene expression analysis in brush biopsies is limited by a high RNase activity in the oral cavity.
Infrared Spectroscopy of Matrix-Isolated Neutral and Ionized Anthracoronene in Argon.
de Barros, A L F; Mattioda, A L; Korsmeyer, J M; Ricca, A
2018-03-08
The matrix-isolated mid-IR (MIR) spectrum of neutral and ionized anthracoronene (C 36 H 18 , AnthCor) in argon has been measured experimentally, compared to the spectrum of its parent molecules, coronene and anthracene, and analyzed by comparison to a theoretical spectrum computed using density functional theory (DFT). The experimental and theoretical band positions generally agree within 0-10 cm -1 . Anthracoronene exhibits extremely intense cation and anion bands around 1330 and 1318 cm -1 . The intensity of these two bands approaches what is traditionally observed over the entire 1000-1600 cm -1 range for a typical PAH cation or anion. The matrix-isolated near-IR (NIR) through overlap region (OVR) spectrum of ionized AnthCor in argon has been reported for the first time and compared to the spectrum of its parent molecules, coronene and anthracene. The spectrum of AnthCor contains a very strong electronic transition around 6175 cm -1 , placing it outside the range of the electronic transitions typically observed for PAHs. Anthracoronene is one of the few PAHs studied to date which has exhibited the formation of anions upon UV photolysis.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Microenvironment Influences Interaction of Signaling Molecules | Center for Cancer Research
Tumor progression depends not only on events that occur within cancer cells but also on the interaction of cancer cells with their environment, which can regulate tumor growth and metastasis and modulate the formation of new blood vessels to nourish the tumor. All cells communicate with other cells around them, including endothelial cells (the cells that make up blood vessels). They also interact with the extracellular matrix (ECM), a network of sugars and proteins that supports cells. Communication between neighboring cells and molecules often occurs through interaction among and between molecules on the cell surface and molecules of the ECM. Defining these interactions should facilitate the development of novel approaches to limit tumor progression.
Shimoyama, S; Gansauge, F; Gansauge, S; Oohara, T; Beger, H G
1995-12-01
The aim of this study was to elucidate the expression and distribution patterns of both integrins and extracellular matrix (ECM) molecules in chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC) compared with normal pancreas (NP). Expression of nine alpha-subunits (alpha 2-alpha 6, alpha V, alpha L, alpha M, and alpha X), four beta-subunits (beta 1, beta 3-beta 5), and four ECM molecules (type IV collagen, laminin, fibronectin, and vitronectin) was investigated immunohistochemically. In CP, all integrins except alpha V showed nearly the same staining patterns compared with NP. Some acinar cells in CP expressed alpha V. Whereas alpha 2, alpha 3, and alpha 6 expression was stronger and diffuse, no alpha 5 expression was seen in PC. Basement membrane (BM) showed continuous staining in CP, whereas it showed discontinuous/absent staining in PC with antitype IV collagen, laminin, and vitronectin antibodies. Some carcinoma cells showed reverse correlation between alpha 2, alpha 3, and alpha 6 expression and type IV collagen and laminin expression. Fibronectin showed diffuse stromal expression in CP and PC. Some acinar cells or duct cells in CP carcinoma cells in PC showed intracellular VN expression. These results suggest that these integrins and ECM molecules are involved in inflammatory and malignant processes in pancreas.
Line Lists for LiF and LiCl in the X^{1}Σ^{+} State
NASA Astrophysics Data System (ADS)
Bittner, Dror M.; Bernath, Peter F.
2017-06-01
Alkali-containing molecules are expected to be present in the atmospheres of exoplanets such as rocky super-Earths as well as in cool dwarf stars. Line lists for LiF and LiCl in their X^{1}Σ^{+} ground states have been calculated using LeRoy's LEVEL program. The potential energy functions, including the effects of the breakdown of the Born-Oppenheimer approximation, are obtained by direct fitting the experimental infrared vibration-rotation and microwave pure rotation data with extended Morse oscillator potentials using LeRoy's dPotFit program. The transition dipole matrix elements and line intensities were obtained with LEVEL using a dipole moment function from a high level ab initio calculation. Phil. Trans. R. Soc. A 372, 20130087 (2014) Astrophys. J. 519, 793 (1999) J. Quant. Spectrosc. Radiat. Transfer 186, 167 (2017) J. Quant. Spectrosc. Radiat. Transfer 186, 179 (2017)
Molecular cues for development and regeneration of salivary glands
Liu, Fei; Wang, Songlin
2015-01-01
The hypofunction of salivary glands caused by Sjögren’s Syndrome or radiotherapy for head and neck cancer significantly compromises the quality of life of millions patients. Currently no curative treatment is available for the irreversible hyposalivation, whereas regenerative strategies targeting salivary stem/progenitor cells are promising. However, the success of these strategies is constrained by the lack of insights on the molecular cues of salivary gland regeneration. Recent advances in the molecular controls of salivary gland morphogenesis provided valuable clues for identifying potential regenerative cues. A complicated network of signaling molecules between epithelia, mesenchyme, endothelia, extracellular matrix and innervating nerves orchestrate the salivary gland organogenesis. Here we discuss the roles of several cross-talking intercellular signaling pathways, i.e., FGF, Wnt, Hedgehog, Eda, Notch, Chrm1/HB-EGF and Laminin/Integrin pathways, in the development of salivary glands and their potentials to promote salivary regeneration. PMID:24189993
Water-based preparation of spider silk films as drug delivery matrices.
Agostini, Elisa; Winter, Gerhard; Engert, Julia
2015-09-10
The main focus of this work was to obtain a drug delivery matrix characterized by biocompatibility, water insolubility and good mechanical properties. Moreover the preparation process has to be compatible with protein encapsulation and the obtained matrix should be able to sustain release a model protein. Spider silk proteins represent exceptional natural polymers due to their mechanical properties in combination with biocompatibility. As both hydrophobic and slowly biodegrading biopolymers, recombinant spider silk proteins fulfill the required properties for a drug delivery system. In this work, we present the preparation of eADF4(C16) films as drug delivery matrices without the use of any organic solvent. Water-based spider silk films were characterized in terms of protein secondary structure, thermal stability, zeta-potential, solubility, mechanical properties, and water absorption and desorption. Additionally, this study includes an evaluation of their application as a drug delivery system for both small molecular weight drugs and high molecular weight molecules such as proteins. Our investigation focused on possible improvements in the film's mechanical properties including plasticizers in the film matrix. Furthermore, different film designs were prepared, such as: monolayer, coated monolayer, multilayer (sandwich), and coated multilayer. The release of the model protein BSA from these new systems was studied. Results indicated that spider silk films are a promising protein drug delivery matrix, capable of releasing the model protein over 90 days with a release profile close to zero order kinetic. Such films could be used for several pharmaceutical and medical purposes, especially when mechanical strength of a drug eluting matrix is of high importance. Copyright © 2015 Elsevier B.V. All rights reserved.
Tailorable Release of Small Molecules Utilizing Plant Viral Nanoparticles and Fibrous Matrix
NASA Astrophysics Data System (ADS)
Cao, Jing
We have engineered Red clover necrotic mosaic virus (RCNMV) derived plant viral nanoparticles (PVNs) within a fibrous matrix to optimize its application for delivery and controlled release of active ingredients. RCNMV's structure and unique response to divalent cation depletion and re-addition enables the infusion of small molecules into its viral capsid through a pore formation mechanism. While this PVN technology shows a potential use in nano-scale therapeutic drug delivery, its inherent molecular dynamics to environmental stimuli places a constraint on its application and functionality as a vehicle for tailorable release of loading cargo. In this study, we enhance the understanding of the PVN technology by elucidating its mechanism for loading and triggered release of doxorubicin (Dox), a chemotherapeutic drug for breast cancer. Of critical importance is the methodology for manipulation of Dox's loading capacity and its binding location on either the exterior or interior of the virion capsid. The ability to control the active ingredient binding location provides an additional approach of tunable release from the PVN delivery vehicle besides its inherent pH- and ion- responsive release of loading cargo. The efficacious and controlled release strategy for agricultural active ingredients, such as nematicides, is also a large social need right now. Crop infestation of plant parasite nematodes causes in excess of 157 billion in worldwide crop damage annually. If an effective control strategy for these pests could be developed, it is estimated that the current market for effective nematicides is between 700 million and $1 billion each year worldwide. In this study, we report on the utilization of PVN technology to encapsulate the biological nematicide, abamectin (Abm), within the PVN's interior capsid (PVNAbm). Creating PVNAbm addresses Abm's issues of soil immobility while rendering a controlled release strategy for its bioavailability to root knot nematodes (RKNs). The encapsulation by a PVN carrier also improves the stability of Abm as well as further isolates its toxicity from the end-user. We used this crop treatment methodology by applying PVNAbm to tomato seedlings that we artificially inoculated with RKN M. hapla. We show that the zone of root protection from RKN that is limited by free Abm in the soil is improved; contributing to the enhanced nematicide performance in crop protection. Lignocellulosic materials were engineered as a supporting fibrous matrix to distribute PVNAbm or free Abm in a field-deployable matrix. This enables a cost-effective, environmentally sound method for simply applying the crop protection agent at the point of seed planting. An approach designed to be useful for smallholder farmers in East Africa regions. In addition, the chemical and physical properties of the fibrous matrix provide an additional release mechanism for transporting active ingredients. Varying the source of lignocellulosic materials and pre-processing pulping methods results in fibrous matrices with distinct difference in their cargo release rate for both Abm in free form or encapsulated in PVN. The relative slow and sustainable cargo release is achieved by incorporating with banana lignocellulosic matrix that contains higher amount of lignin in the bulk, which enables a delayed and long-term activity against nematodes. On the other hand, the decreased amount of lignin in abaca lignocellulosic matrix give rise to a burst release of loaded Abm or PVNAbm, which exhibits a simultaneous effectiveness against nematodes, but compromises the crop protection around the growing plant in the long-term. In summary, our work demonstrates the potential for utilization of a PVN-matrix hybrid system for active ingredient delivery, where manipulating the properties and interactions among these components, active ingredient, PVN and fibrous matrix, provides unlimited possibilities for the tailorable release of active ingredients in any given application.
NASA Astrophysics Data System (ADS)
Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.
2017-07-01
In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.
Kleiner, Isabelle; Hougen, Jon T.
2015-01-01
A new hybrid-model fitting program for methylamine-like molecules has been developed, based on an effective Hamiltonian in which the ammonia-like inversion motion is treated using a tunneling formalism, while the internal-rotation motion is treated using an explicit kinetic energy operator and potential energy function. The Hamiltonian in the computer program is set up as a 2×2 partitioned matrix, where each diagonal block contains a traditional torsion-rotation Hamiltonian (as in the earlier program BELGI), and the two off-diagonal blocks contain tunneling terms. This hybrid formulation permits the use of the permutation-inversion group G6 (isomorphic to C3v) for terms in the two diagonal blocks, but requires G12 for terms in the off-diagonal blocks. The first application of the new program is to 2-methylmalonaldehyde. Microwave data for this molecule were previously fit using an all-tunneling Hamiltonian formalism to treat both large-amplitude-motions. For 2-methylmalonaldehyde, the hybrid program achieves the same quality of fit as was obtained with the all-tunneling program, but fits with the hybrid program eliminate a large discrepancy between internal rotation barriers in the OH and OD isotopologs of 2-methylmalonaldehyde that arose in fits with the all-tunneling program. This large isotopic shift in internal rotation barrier is thus almost certainly an artifact of the all-tunneling model. Other molecules for application of the hybrid program are mentioned. PMID:26439709
Molecular imaging of rheumatoid arthritis: emerging markers, tools, and techniques
2014-01-01
Early diagnosis and effective monitoring of rheumatoid arthritis (RA) are important for a positive outcome. Instant treatment often results in faster reduction of inflammation and, as a consequence, less structural damage. Anatomical imaging techniques have been in use for a long time, facilitating diagnosis and monitoring of RA. However, mere imaging of anatomical structures provides little information on the processes preceding changes in synovial tissue, cartilage, and bone. Molecular imaging might facilitate more effective diagnosis and monitoring in addition to providing new information on the disease pathogenesis. A limiting factor in the development of new molecular imaging techniques is the availability of suitable probes. Here, we review which cells and molecules can be targeted in the RA joint and discuss the advances that have been made in imaging of arthritis with a focus on such molecular targets as folate receptor, F4/80, macrophage mannose receptor, E-selectin, intercellular adhesion molecule-1, phosphatidylserine, and matrix metalloproteinases. In addition, we discuss a new tool that is being introduced in the field, namely the use of nanobodies as tracers. Finally, we describe additional molecules displaying specific features in joint inflammation and propose these as potential new molecular imaging targets, more specifically receptor activator of nuclear factor κB and its ligand, chemokine receptors, vascular cell adhesion molecule-1, αVβ3 integrin, P2X7 receptor, suppression of tumorigenicity 2, dendritic cell-specific transmembrane protein, and osteoclast-stimulatory transmembrane protein. PMID:25099015
The Histochemistry and Cell Biology omnium-gatherum: the year 2015 in review.
Taatjes, Douglas J; Roth, Jürgen
2016-03-01
We provide here our annual review/synopsis of all of the articles published in Histochemistry and Cell Biology (HCB) for the preceding year. In 2015, HCB published 102 articles, representing a wide variety of topics and methodologies. For ease of access to these differing topics, we have created categories, as determined by the types of articles presented to provide a quick index representing the general areas covered. This year, these categories include: (1) advances in methodologies; (2) molecules in health and disease; (3) organelles, subcellular structures, and compartments; (4) the nucleus; (5) stem cells and tissue engineering; (6) cell cultures: properties and capabilities; (7) connective tissues and extracellular matrix; (8) developmental biology; (9) nervous system; (10) musculoskeletal system; (11) respiratory and cardiovascular system; (12) liver and gastrointestinal tract; and (13) male and female reproductive systems. Of note, the categories proceed from methods development, to molecules, intracellular compartments, stem cells and cell culture, extracellular matrix, developmental biology, and finishing with various organ systems, hopefully presenting a logical journey from methods to organismal molecules, cells, and whole tissue systems.
Lee, Nam-Suk; Shin, Hoon-Kyu; Kwon, Young-Soo
2015-02-01
An ultrahigh vacuum scanning tunneling microscopy (UHV-STM) and a scanning tunneling spectroscopy (STS) are used measure the rectification property of self-assembled viologen single molecules (VC8SH, VC10SH, HSC8VC8SH, and HSC10VC10SH) in the previous study. Using STM we observe viologen single molecules in the self-assembled octanethiol (OT) SAM matrix. In the OT matrix a mixed phase that includes a c(4 x 2) superlattice of high-density standing up-phase is observed. We indicate high peak current-like rectifications at + 1.68 V(VC8SH), + 1.56 V(VC10SH), + 1.14 V(HSC8VC8SH), and + 1.04 V(HSC10VC10SH) based on the experiment implemented in this study. In addition, transition voltages (Vtrans) from direct tunneling to the Fowler-Nordheim tunneling are presented at 1.08 V(VC8SH), 0.97 V(VC10SH), 0.99 V(HSC8VC8SH), and 0.89 V(HSC1VC1SH).
Thomas, Phillip S.
2017-01-01
We propose a method for solving the vibrational Schrödinger equation with which one can compute spectra for molecules with more than ten atoms. It uses sum-of-product (SOP) basis functions stored in a canonical polyadic tensor format and generated by evaluating matrix-vector products. By doing a sequence of partial optimizations, in each of which the factors in a SOP basis function for a single coordinate are optimized, the rank of the basis functions is reduced as matrix-vector products are computed. This is better than using an alternating least squares method to reduce the rank, as is done in the reduced-rank block power method. Partial optimization is better because it speeds up the calculation by about an order of magnitude and allows one to significantly reduce the memory cost. We demonstrate the effectiveness of the new method by computing vibrational spectra of two molecules, ethylene oxide (C2H4O) and cyclopentadiene (C5H6), with 7 and 11 atoms, respectively. PMID:28571348
Nabeshima, Kazuki; Iwasaki, Hiroshi; Koga, Kaori; Hojo, Hironobu; Suzumiya, Junji; Kikuchi, Masahiro
2006-07-01
Emmprin (basigin, CD147) is a cell surface glycoprotein that belongs to the immunoglobulin superfamily. It is highly expressed on the surface of tumor cells and stimulates adjacent fibroblasts or tumor cells to produce matrix metalloproteinases. Moreover, it has recently been shown that emmprin also stimulates expression of vascular endothelial growth factor and hyaluronan, which leads to angiogenesis and anchorage-independent growth/multidrug resistance, respectively. These findings have made emmprin an important molecule in tumor progression and, thus, more attractive as a target for antitumor treatment. However, other functions of emmprin, including as an activator of T cells, a chaperone for monocarboxylate transporters, a receptor for cyclophilin A and a neural recognition molecule, are also being identified in physiological and pathological conditions. Therefore, it is essential to develop specific means to control particular functions of emmprin, for which elucidation of each mechanism is crucial. This review will discuss the role of emmprin in tumor progression and recent advances in the molecular mechanisms of diverse phenomena regulated by emmprin.
Thomas, Phillip S; Carrington, Tucker
2017-05-28
We propose a method for solving the vibrational Schrödinger equation with which one can compute spectra for molecules with more than ten atoms. It uses sum-of-product (SOP) basis functions stored in a canonical polyadic tensor format and generated by evaluating matrix-vector products. By doing a sequence of partial optimizations, in each of which the factors in a SOP basis function for a single coordinate are optimized, the rank of the basis functions is reduced as matrix-vector products are computed. This is better than using an alternating least squares method to reduce the rank, as is done in the reduced-rank block power method. Partial optimization is better because it speeds up the calculation by about an order of magnitude and allows one to significantly reduce the memory cost. We demonstrate the effectiveness of the new method by computing vibrational spectra of two molecules, ethylene oxide (C 2 H 4 O) and cyclopentadiene (C 5 H 6 ), with 7 and 11 atoms, respectively.
Soluble adhesion molecules in human cancers: sources and fates.
van Kilsdonk, Jeroen W J; van Kempen, Léon C L T; van Muijen, Goos N P; Ruiter, Dirk J; Swart, Guido W M
2010-06-01
Adhesion molecules endow tumor cells with the necessary cell-cell contacts and cell-matrix interactions. As such, adhesion molecules are involved in cell signalling, proliferation and tumor growth. Rearrangements in the adhesion repertoire allow tumor cells to migrate, invade and form metastases. Besides these membrane-bound adhesion molecules several soluble adhesion molecules are detected in the supernatant of tumor cell lines and patient body fluids. Truncated soluble adhesion molecules can be generated by several conventional mechanisms, including alternative splicing of mRNA transcripts, chromosomal translocation, and extracellular proteolytic ectodomain shedding. Secretion of vesicles (ectosomes and exosomes) is an alternative mechanism mediating the release of full-length adhesion molecules. Soluble adhesion molecules function as modulators of cell adhesion, induce proteolytic activity and facilitate cell signalling. Additionally, adhesion molecules present on secreted vesicles might be involved in the vesicle-target cell interaction. Based on currently available data, released soluble adhesion molecules contribute to cancer progression and therefore should not be regarded as unrelated and non-functional side products of tumor progression. 2010 Elsevier GmbH. All rights reserved.
Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M
2016-04-01
The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.
Polymeric lithography editor: Editing lithographic errors with nanoporous polymeric probes
Rajasekaran, Pradeep Ramiah; Zhou, Chuanhong; Dasari, Mallika; Voss, Kay-Obbe; Trautmann, Christina; Kohli, Punit
2017-01-01
A new lithographic editing system with an ability to erase and rectify errors in microscale with real-time optical feedback is demonstrated. The erasing probe is a conically shaped hydrogel (tip size, ca. 500 nm) template-synthesized from track-etched conical glass wafers. The “nanosponge” hydrogel probe “erases” patterns by hydrating and absorbing molecules into a porous hydrogel matrix via diffusion analogous to a wet sponge. The presence of an interfacial liquid water layer between the hydrogel tip and the substrate during erasing enables frictionless, uninterrupted translation of the eraser on the substrate. The erasing capacity of the hydrogel is extremely high because of the large free volume of the hydrogel matrix. The fast frictionless translocation and interfacial hydration resulted in an extremely high erasing rate (~785 μm2/s), which is two to three orders of magnitude higher in comparison with the atomic force microscopy–based erasing (~0.1 μm2/s) experiments. The high precision and accuracy of the polymeric lithography editor (PLE) system stemmed from coupling piezoelectric actuators to an inverted optical microscope. Subsequently after erasing the patterns using agarose erasers, a polydimethylsiloxane probe fabricated from the same conical track-etched template was used to precisely redeposit molecules of interest at the erased spots. PLE also provides a continuous optical feedback throughout the entire molecular editing process—writing, erasing, and rewriting. To demonstrate its potential in device fabrication, we used PLE to electrochemically erase metallic copper thin film, forming an interdigitated array of microelectrodes for the fabrication of a functional microphotodetector device. High-throughput dot and line erasing, writing with the conical “wet nanosponge,” and continuous optical feedback make PLE complementary to the existing catalog of nanolithographic/microlithographic and three-dimensional printing techniques. This new PLE technique will potentially open up many new and exciting avenues in lithography, which remain unexplored due to the inherent limitations in error rectification capabilities of the existing lithographic techniques. PMID:28630898
Bergethon, Peter R; Kindler, Dean D; Hallock, Kevin; Blease, Susan; Toselli, Paul
2013-07-01
In normal development and pathology, the vascular system depends on complex interactions between cellular elements, biochemical molecules, and physical forces. The electrokinetic vascular streaming potential (EVSP) is an endogenous extremely low frequency (ELF) electrical field resulting from blood flowing past the vessel wall. While generally unrecognized, it is a ubiquitous electrical biophysical force to which the vascular tree is exposed. Extracellular matrix elastin plays a central role in normal blood vessel function and in the development of atherosclerosis. It was hypothesized that ELF fields of low amplitude would alter elastin accumulation, supporting a link between the EVSP and the biology of vascular smooth muscle cells. Neonatal rat aortic smooth muscle cell cultures were exposed chronically to electrical fields characteristic of the EVSP. Extracellular protein accumulation, DNA content, and electron microscopic (EM) evaluation were performed after 2 weeks of exposure. Stimulated cultures showed no significant change in cellular proliferation as measured by the DNA concentration. The per-DNA normalized protein in the extracellular matrix was unchanged while extracellular elastin accumulation decreased 38% on average. EM analysis showed that the stimulated cells had a 2.85-fold increase in mitochondrial number. These results support the formulation that ELF fields are a potential factor in both normal vessel biology and in the pathogenesis of atherosclerotic diseases including heart disease, stroke, and peripheral vascular disease. Copyright © 2013 Wiley Periodicals, Inc.
A simple water model in the presence of inert Lennard-Jones obstacles II: the hydrophobic effect
NASA Astrophysics Data System (ADS)
Kurtjak, Mario; Urbic, Tomaz
2015-04-01
Using Monte Carlo computer simulations, hydrophobic effect for a non-polar particle with the diameter of a water molecule was studied in water, confined within a disordered matrix. Freely mobile two-dimensional Mercedes-Benz water was put in a disordered, but fixed, matrix of Lennard-Jones disks. Influence of temperature and matrix properties on the thermodynamic quantities of a non-polar solute solvation was studied. The hydrophobic effect is changed by the presence of the obstacles. Smaller matrix particles change the solute-water structure and thermodynamics drastically, as it was also observed for the properties of pure confined water. The study is bringing new scientific important observations in understanding the role of hydrophobic forces under confinement.
Microtechnologies for studying the role of mechanics in axon growth and guidance
Kilinc, Devrim; Blasiak, Agata; Lee, Gil U.
2015-01-01
The guidance of axons to their proper targets is not only a crucial event in neurodevelopment, but also a potential therapeutic target for neural repair. Axon guidance is mediated by various chemo- and haptotactic cues, as well as the mechanical interactions between the cytoskeleton and the extracellular matrix (ECM). Axonal growth cones, dynamic ends of growing axons, convert external stimuli to biochemical signals, which, in turn, are translated into behavior, e.g., turning or retraction, via cytoskeleton–matrix linkages. Despite the inherent mechanical nature of the problem, the role of mechanics in axon guidance is poorly understood. Recent years has witnessed the application of a range of microtechnologies in neurobiology, from microfluidic circuits to single molecule force spectroscopy. In this mini-review, we describe microtechnologies geared towards dissecting the mechanical aspects of axon guidance, divided into three categories: controlling the growth cone microenvironment, stimulating growth cones with externally applied forces, and measuring forces exerted by the growth cones. A particular emphasis is given to those studies that combine multiple techniques, as dictated by the complexity of the problem. PMID:26283918
Microtechnologies for studying the role of mechanics in axon growth and guidance.
Kilinc, Devrim; Blasiak, Agata; Lee, Gil U
2015-01-01
The guidance of axons to their proper targets is not only a crucial event in neurodevelopment, but also a potential therapeutic target for neural repair. Axon guidance is mediated by various chemo- and haptotactic cues, as well as the mechanical interactions between the cytoskeleton and the extracellular matrix (ECM). Axonal growth cones, dynamic ends of growing axons, convert external stimuli to biochemical signals, which, in turn, are translated into behavior, e.g., turning or retraction, via cytoskeleton-matrix linkages. Despite the inherent mechanical nature of the problem, the role of mechanics in axon guidance is poorly understood. Recent years has witnessed the application of a range of microtechnologies in neurobiology, from microfluidic circuits to single molecule force spectroscopy. In this mini-review, we describe microtechnologies geared towards dissecting the mechanical aspects of axon guidance, divided into three categories: controlling the growth cone microenvironment, stimulating growth cones with externally applied forces, and measuring forces exerted by the growth cones. A particular emphasis is given to those studies that combine multiple techniques, as dictated by the complexity of the problem.
Wiig, Helge; Gyenge, Christina; Iversen, Per Ole; Gullberg, Donald; Tenstad, Olav
2008-05-01
The interstitial space is a dynamic microenvironment that consists of interstitial fluid and structural molecules of the extracellular matrix, such as glycosaminoglycans (hyaluronan and proteoglycans) and collagen. Macromolecules can distribute in the interstitium only in those spaces unoccupied by structural components, a phenomenon called interstitial exclusion. The exclusion phenomenon has direct consequences for plasma volume regulation. Early studies have assigned a major role to collagen as an excluding agent that accounts for the sterical (geometrical) exclusion. More recently, it has been shown that the contribution of negatively charged glycosaminoglycans might also be significant, resulting in an additional electrostatical exclusion effect. This charge effect may be of importance for drug uptake and suggests that either the glycosaminoglycans or the net charge of macromolecular substances to be delivered may be targeted to increase the available volume and uptake of macromolecular therapeutic agents in tumor tissue. Here, we provide an overview of the structural components of the interstitium and discuss the importance the sterical and electrostatical components have on the dynamics of transcapillary fluid exchange.
2009-12-10
sites of integrin-clustering that link the actin cytoskeleton to the extracellular matrix (ECM; (Burridge et al., 1988)). The primary functions of...Hall, 1992). Furthermore, in fibroblasts, focal adhesion kinase (FAK), a key FA signaling molecule, is necessary for mechanosensing (Geiger et al...promotes FAK activation through phosphorylation on Y397 and Y925, followed by FAK- dependent extracellular signal-regulated kinase (ERK) phosphorylation
NASA Astrophysics Data System (ADS)
Caflisch, Robert G.
1988-09-01
An argument is given that the model of Buda, Florio, and Giaquinta (BFG)[Phys. Rev. B 35, 2021 (1987)] for anisotropic molecules on a square lattice is inappropriate in that context, because it confuses anisotropy of the lattice with the anisotropy of the molecule. The importance of this is made clear by noting the absence (in BFG) of a dilute isotropic phase. Such a phase is unavoidable on very general grounds. Comments are made about an alternative realization of their results and an alternative class of models for anisotropic molecules.
Regulation of corneal stroma extracellular matrix assembly.
Chen, Shoujun; Mienaltowski, Michael J; Birk, David E
2015-04-01
The transparent cornea is the major refractive element of the eye. A finely controlled assembly of the stromal extracellular matrix is critical to corneal function, as well as in establishing the appropriate mechanical stability required to maintain corneal shape and curvature. In the stroma, homogeneous, small diameter collagen fibrils, regularly packed with a highly ordered hierarchical organization, are essential for function. This review focuses on corneal stroma assembly and the regulation of collagen fibrillogenesis. Corneal collagen fibrillogenesis involves multiple molecules interacting in sequential steps, as well as interactions between keratocytes and stroma matrix components. The stroma has the highest collagen V:I ratio in the body. Collagen V regulates the nucleation of protofibril assembly, thus controlling the number of fibrils and assembly of smaller diameter fibrils in the stroma. The corneal stroma is also enriched in small leucine-rich proteoglycans (SLRPs) that cooperate in a temporal and spatial manner to regulate linear and lateral collagen fibril growth. In addition, the fibril-associated collagens (FACITs) such as collagen XII and collagen XIV have roles in the regulation of fibril packing and inter-lamellar interactions. A communicating keratocyte network contributes to the overall and long-range regulation of stromal extracellular matrix assembly, by creating micro-domains where the sequential steps in stromal matrix assembly are controlled. Keratocytes control the synthesis of extracellular matrix components, which interact with the keratocytes dynamically to coordinate the regulatory steps into a cohesive process. Mutations or deficiencies in stromal regulatory molecules result in altered interactions and deficiencies in both transparency and refraction, leading to corneal stroma pathobiology such as stromal dystrophies, cornea plana and keratoconus. Copyright © 2014 Elsevier Ltd. All rights reserved.
Biophysical Stimuli: A Review of Electrical and Mechanical Stimulation in Hyaline Cartilage.
Vaca-González, Juan J; Guevara, Johana M; Moncayo, Miguel A; Castro-Abril, Hector; Hata, Yoshie; Garzón-Alvarado, Diego A
2017-09-01
Objective Hyaline cartilage degenerative pathologies induce morphologic and biomechanical changes resulting in cartilage tissue damage. In pursuit of therapeutic options, electrical and mechanical stimulation have been proposed for improving tissue engineering approaches for cartilage repair. The purpose of this review was to highlight the effect of electrical stimulation and mechanical stimuli in chondrocyte behavior. Design Different information sources and the MEDLINE database were systematically revised to summarize the different contributions for the past 40 years. Results It has been shown that electric stimulation may increase cell proliferation and stimulate the synthesis of molecules associated with the extracellular matrix of the articular cartilage, such as collagen type II, aggrecan and glycosaminoglycans, while mechanical loads trigger anabolic and catabolic responses in chondrocytes. Conclusion The biophysical stimuli can increase cell proliferation and stimulate molecules associated with hyaline cartilage extracellular matrix maintenance.
NASA Astrophysics Data System (ADS)
Dobbyn, Abigail J.; Knowles, Peter J.
A number of established techniques for obtaining diabatic electronic states in small molecules are critically compared for the example of the X and B states in the water molecule, which contribute to the two lowest-energy conical intersections. Integration of the coupling matrix elements and analysis of configuration mixing coefficients both produce reliable diabatic states globally. Methods relying on diagonalization of dipole moment and angular momentum operators are shown to fail in large regions of coordinate space. However, the use of transition angular momentum matrix elements involving the A state, which is degenerate with B at the conical intersections, is successful globally, provided that an appropriate choice of coordinates is made. Long range damping of non-adiabatic coupling to give correct asymptotic mixing angles also is investigated.
The Infrared Spectrum of Matrix Isolated Aminoacetonitrile: A Precursor to the Amino Acid Glycine
NASA Technical Reports Server (NTRS)
Bernstein, Max P.; Bauschlicher, Charles W., Jr.; Sandford, Scott A.
2003-01-01
We present infrared (IR) spectral data from matrix isolation experiments and density functional theory calculations on the pre-biologically interesting molecule aminoacetonitrile, a precursor to glycine. We find that this nitrile has an unusually weak nitrile (C=N) stretch in the infrared, in contrast to expectations based on measurements and models of other nitriles under astrophysical conditions. The absence of an observable nitrile absorption feature in the infrared will make the IR search for this molecule considerably more difficult, and will raise estimates of upper limits on nitriles in interstellar and outer Solar System ices. This is also of relevance to assessing the formation routes of the amino acid glycine, since aminoacetonitrile is the putative precursor to glycine via the Strecker synthesis, the mechanism postulated to have produced the amino acids in meteorites.
Molecular t-matrices for Low-Energy Electron Diffraction (TMOL v1.1)
NASA Astrophysics Data System (ADS)
Blanco-Rey, Maria; de Andres, Pedro; Held, Georg; King, David A.
2004-08-01
We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided. Program summaryTitle of program: TMOL Catalogue number: ADUF Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADUF Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland. Computers: Alpha ev6-21264 (700 MHz) and Pentium-IV. Operating systems: Digital UNIX V5.0 and Linux (Red Hat 8.0). Programming language: FORTRAN-90/95 (Compaq True64 compiler, and Intel Fortran Compiler 7.0 for Linux). High-speed storage required for the test run: minimum 64 Mbytes, it can grow to more depending on the system considered. Disk storage required: None. No. of bits in a word: 64 and 32. No. of lines in distributed program, including test data etc.: 5404 No. of bytes in distributed program, including test data etc.: 59 856 Distribution format: tar.gz Nature of problem: We describe the FORTRAN-90 program TMOL (v1.1) for the computation of non-diagonal scattering t-matrices for molecules or any other poly-atomic sub-unit of surface structures. These matrices can be used in an standard Low-Energy Electron Diffraction program, such as LEED90 or CLEED. Method of solution: A general non-diagonal t-matrix is assumed for the atoms or more general scatterers forming the molecule. The molecular t-matrix is solved adding the possible intramolecular multiple scattering events using Green's propagator formalism. The resulting t-matrix is referred to the mass centre of the molecule and can be easily translated with these propagators and rotated applying Wigner matrices. Typical running time: Calculating the t-matrix for a single energy takes a few seconds. Time depends on the maximum angular momentum quantum number, lmax, and the number of scatterers in the molecule, N. Running time scales as lmax6 and N3. References: [1] S. Andersson, J.B. Pendry, J. Phys. C: Solid St. Phys. 13 (1980) 3547. [2] A. Gonis, W.H. Butler, Multiple Scattering in Solids, Springer-Verlag, Berlin/New York, 2000.
Theoretical Studies of Spectroscopic Line Mixing in Remote Sensing Applications
NASA Technical Reports Server (NTRS)
Ma, Q.; Boulet, C.; Tipping, R. H.
2015-01-01
The phenomenon of collisional transfer of intensity due to line mixing has an increasing importance for atmospheric monitoring. From a theoretical point of view, all relevant information about the collisional processes is contained in the relaxation matrix where the diagonal elements give half-widths and shifts, and the off-diagonal elements correspond to line interferences. For simple systems such as those consisting of diatom-atom or diatom-diatom, accurate fully quantum calculations based on interaction potentials are feasible. However, fully quantum calculations become unrealistic for more complex systems. On the other hand, the semi-classical Robert-Bonamy (RB) formalism, which has been widely used to calculate half-widths and shifts for decades, fails in calculating the off-diagonal matrix elements. As a result, in order to simulate atmospheric spectra where the effects from line mixing are important, semi-empirical fitting or scaling laws such as the ECS (Energy-Corrected Sudden) and IOS (Infinite-Order Sudden) models are commonly used. Recently, while scrutinizing the development of the RB formalism, we have found that these authors applied the isolated line approximation in their evaluating matrix elements of the Liouville scattering operator given in exponential form. Since the criterion of this assumption is so stringent, it is not valid for many systems of interest in atmospheric applications. Furthermore, it is this assumption that blocks the possibility to calculate the whole relaxation matrix at all. By eliminating this unjustified application, and accurately evaluating matrix elements of the exponential operators, we have developed a more capable formalism. With this new formalism, we are now able not only to reduce uncertainties for calculated half-widths and shifts, but also to remove a once insurmountable obstacle to calculate the whole relaxation matrix. This implies that we can address the line mixing with the semi-classical theory based on interaction potentials between molecular absorber and molecular perturber. We have applied this formalism to address the line mixing for Raman and infrared spectra of molecules such as N2, C2H2, CO2, NH3, and H2O. By carrying out rigorous calculations, our calculated relaxation matrices are in good agreement with both experimental data and results derived from the ECS model.
Horiguchi, Kotaro; Fujiwara, Ken; Ilmiawati, Cimi; Kikuchi, Motoshi; Tsukada, Takehiro; Kouki, Tom; Yashiro, Takashi
2011-07-01
Folliculostellate (FS) cells in the anterior pituitary gland are believed to have multifunctional properties. Using transgenic rats that express green fluorescent protein (GFP) specifically in FS cells in the anterior pituitary gland (S100b-GFP rats), we recently revealed that FS cells in primary culture exhibited marked proliferation in the presence of laminin, an extracellular matrix (ECM) component of the basement membrane. In a process referred to as matricrine action, FS cells receive ECM as a signal through their receptors, which results in morphological and functional changes. In this study, we investigated matricrine signaling in FS cells and observed that the proliferation of FS cells is mediated by integrin β1, which is involved in various signaling pathways for cell migration and proliferation in response to ECM. Then, we analyzed downstream events of the integrin β1 signaling pathway in the proliferation of FS cells and identified caveolin 3 as a potential candidate molecule. Caveolin 3 is a membrane protein that binds cholesterol and a number of signaling molecules that interact with integrin β1. Using specific small interfering RNA of caveolin 3, the proliferation of FS cells was inhibited. Furthermore, caveolin 3 drove activation of the mitogen-activated protein kinase (MAPK) signaling cascades, which resulted in upregulation of cyclin D1 in FS cells. These findings suggest that matricrine signaling in the proliferation of FS cells was transduced by a caveolin 3-mediated integrin β1 signaling pathway and subsequent activation of the MAPK pathway. © 2011 Society for Endocrinology
Hassmann-Poznańska, Elżbieta; Taranta, Andrzej; Bialuk, Izabela; Poznańska, Maria; Zajączkiewicz, Hanna; Winnicka, Maria Małgorzata
2013-10-01
The goal of this work was to identify genes, known to be involved in the skin wound healing, that express differentially in the healthy and injured tympanic membrane (TM), and designate the molecules potentially beneficial for treatment of TM perforation. The molecular mechanisms controlling the course of TM regeneration are far from being elucidated. Twenty rats had their tympanic membranes perforated, while four served as a control. Animals were sacrificed on either days 1, 2, 3, 5 and 10 post injury, and TMs were immediately dissected and frozen in liquid nitrogen. Total TM RNA was isolated and reversely transcribed. qPCR was performed using Rat Wound Healing RT(2) Profiler PCR Array (QIAGEN) containing primers for 84 genes. Statistically significant changes in the expression of 42 genes were found in various stages of TM healing. The increased expression of genes taking part in the inflammatory reaction (interleukin 6, granulocyte and macrophage chemotactic proteins) was observed from day 2. The expression of several genes of extracellular matrix components and their remodeling enzymes was also changed. Among growth factor genes: Vegfa, Igf1 and Hbegf showed increased expression at the beginning of the healing process, while Hgf expression was highest on day 3. Several changes in the expression of genes involved in remodeling of extracellular matrix point to important role of connective tissue in TM healing. The molecules accelerating this process, like HbEGF and HGF, seem to be good candidates for further evaluation of their possible use in clinical treatment. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Ren, Xinxin; Liu, Jia; Zhang, Chengsen; Luo, Hai
2013-03-15
With the rapid development of ambient mass spectrometry, the hybrid laser-based ambient ionization methods which can generate multiply charged ions of large biomolecules and also characterize small molecules with good signal-to-noise in both positive and negative ion modes are of particular interest. An ambient ionization method termed high-voltage-assisted laser desorption ionization (HALDI) is developed, in which a 1064 nm laser is used to desorb various liquid samples from the sample target biased at a high potential without the need for an organic matrix. The pre-charged liquid samples are desorbed by the laser to form small charged droplets which may undergo an electrospray-like ionization process to produce multiply charged ions of large biomolecules. Various samples including proteins, oligonucleotides (ODNs), drugs, whole milk and chicken eggs have been analyzed by HALDI-MS in both positive and negative ion mode with little or no sample preparation. In addition, HALDI can generate intense signals with better signal-to-noise in negative ion mode than laser desorption spay post-ionization (LDSPI) from the same samples, such as ODNs and some carboxylic-group-containing small drug molecules. HALDI-MS can directly analyze a variety of liquid samples including proteins, ODNs, pharmaceuticals and biological fluids in both positive and negative ion mode without the use of an organic matrix. This technique may be further developed into a useful tool for rapid analysis in many different fields such as pharmaceutical, food, and biological sciences. Copyright © 2013 John Wiley & Sons, Ltd.
Liu, Yuyuan; Li, Weiwei; Liu, Hong; Peng, Youming; Yang, Qiu; Xiao, Li; Liu, Yinghong; Liu, Fuyou
2014-03-01
In this study, we investigated the effect of small interfering RNA (siRNA) of connective tissue growth factor (CTGF) by pRetro-Super (PRS) retrovirus vector on the expression of CTGF and related extracellular matrix molecules in human renal proximal tubular cells (HKCs) induced by high glucose, to provide help for renal tubulointerstitial fibrosis therapy. HKCs were exposed to d-glucose to observe their dose and time effect, while the mannitol as osmotic control. Retrovirus producing CTGF siRNA were constructed from the inverted oligonucleotides and transferred into packaging cell line PT67 with lipofectamine, and the virus supernatant was used to infect HKC. The expression of CTGF, fibronectin (FN) and collagen-type I (col1) were measured by semi-quantitative RT-PCR and Western blot. In response to high glucose, CTGF expression in HKCs was increased in a dose- and time-dependent manner, whereas the increase did not occur in the osmotic control. Introduction of PRS-CTGF-siRNA resulted in the significant reduction of CTGF, FN, col1 mRNA (p < 0.01, respectively) and CTGF, col1 protein (p < 0.05, respectively) expression, while PRS void vector group did not have these effects (p > 0.05). CTGF siRNA therapy can effectively reduce the levels of CTGF, FN and col1 induced by high glucose in cultured HKCs, which suggested that it may be a potential therapeutic strategy to prevent the renal interstitial fibrosis in the future.
Ma, Q; Boulet, C
2016-06-14
The Robert-Bonamy formalism has been commonly used to calculate half-widths and shifts of spectral lines for decades. This formalism is based on several approximations. Among them, two have not been fully addressed: the isolated line approximation and the neglect of coupling between the translational and internal motions. Recently, we have shown that the isolated line approximation is not necessary in developing semi-classical line shape theories. Based on this progress, we have been able to develop a new formalism that enables not only to reduce uncertainties on calculated half-widths and shifts, but also to model line mixing effects on spectra starting from the knowledge of the intermolecular potential. In our previous studies, the new formalism had been applied to linear and asymmetric-top molecules. In the present study, the method has been extended to symmetric-top molecules with inversion symmetry. As expected, the inversion splitting induces a complete failure of the isolated line approximation. We have calculated the complex relaxation matrices of self-broadened NH3. The half-widths and shifts in the ν1 and the pure rotational bands are reported in the present paper. When compared with measurements, the calculated half-widths match the experimental data very well, since the inapplicable isolated line approximation has been removed. With respect to the shifts, only qualitative results are obtained and discussed. Calculated off-diagonal elements of the relaxation matrix and a comparison with the observed line mixing effects are reported in the companion paper (Paper II).
NASA Technical Reports Server (NTRS)
Ma, Q.; Boulet, C.
2016-01-01
The Robert-Bonamy formalism has been commonly used to calculate half-widths and shifts of spectral lines for decades. This formalism is based on several approximations. Among them, two have not been fully addressed: the isolated line approximation and the neglect of coupling between the translational and internal motions. Recently, we have shown that the isolated line approximation is not necessary in developing semi-classical line shape theories. Based on this progress, we have been able to develop a new formalism that enables not only to reduce uncertainties on calculated half-widths and shifts, but also to model line mixing effects on spectra starting from the knowledge of the intermolecular potential. In our previous studies, the new formalism had been applied to linear and asymmetric-top molecules. In the present study, the method has been extended to symmetric-top molecules with inversion symmetry. As expected, the inversion splitting induces a complete failure of the isolated line approximation. We have calculated the complex relaxation matrices of selfbroadened NH3. The half-widths and shifts in the ?1 and the pure rotational bands are reported in the present paper. When compared with measurements, the calculated half-widths match the experimental data very well, since the inapplicable isolated line approximation has been removed. With respect to the shifts, only qualitative results are obtained and discussed. Calculated off-diagonal elements of the relaxation matrix and a comparison with the observed line mixing effects are reported in the companion paper (Paper II).
Dynamic interactions between cells and their extracellular matrix mediate embryonic development.
Goody, Michelle F; Henry, Clarissa A
2010-06-01
Cells and their surrounding extracellular matrix microenvironment interact throughout all stages of life. Understanding the continuously changing scope of cell-matrix interactions in vivo is crucial to garner insights into both congenital birth defects and disease progression. A current challenge in the field of developmental biology is to adapt in vitro tools and rapidly evolving imaging technology to study cell-matrix interactions in a complex 4-D environment. In this review, we highlight the dynamic modulation of cell-matrix interactions during development. We propose that individual cell-matrix adhesion proteins are best considered as complex proteins that can play multiple, often seemingly contradictory roles, depending upon the context of the microenvironment. In addition, cell-matrix proteins can also exert different short versus long term effects. It is thus important to consider cell behavior in light of the microenvironment because of the constant and dynamic reciprocal interactions occurring between them. Finally, we suggest that analysis of cell-matrix interactions at multiple levels (molecules, cells, tissues) in vivo is critical for an integrated understanding because different information can be acquired from all size scales. Copyright 2010 Wiley-Liss, Inc.
1998-09-14
repopulation. These and other growth factors interacting with cell adhesion molecules andlor matrix molecules would be expected to mediate oligodendrocyte...oligodendrocyte lineage, along with a closely related CCHC zinc finger, is expressed in developing neurons in the mammalian central nervous system. J...repopulate and remyelinate demyelinated lesions. In vitro studies have shown that platelet- derived growth factor (PDGF) induces proliferation
Vibrational spectra (FT-IR, Raman and MI-IR) of α- and β-alanine
NASA Astrophysics Data System (ADS)
Rosado, Mário Túlio S.; Duarte, Maria Leonor R. S.; Fausto, Rui
1997-06-01
The vibrational spectra of α- and β-alaine molecules in both their zwitterionic and neutral forms are studied by FT-IR, Raman and MI-IR spectroscopy. Together with results from theoretical SCF-MO ab initio calculations, the spectroscopic data obtained under the various experimental conditions used in this study (crystalline phase; low temperature matrix isolated molecules) enable to undertake a detailed assignment of the vibrational spectra of the studied compounds.
NASA Astrophysics Data System (ADS)
Greenman, Loren; Lucchese, Robert R.; McCurdy, C. William
2017-11-01
The complex Kohn variational method for electron-polyatomic-molecule scattering is formulated using an overset-grid representation of the scattering wave function. The overset grid consists of a central grid and multiple dense atom-centered subgrids that allow the simultaneous spherical expansions of the wave function about multiple centers. Scattering boundary conditions are enforced by using a basis formed by the repeated application of the free-particle Green's function and potential Ĝ0+V ̂ on the overset grid in a Born-Arnoldi solution of the working equations. The theory is shown to be equivalent to a specific Padé approximant to the T matrix and has rapid convergence properties, in both the number of numerical basis functions employed and the number of partial waves employed in the spherical expansions. The method is demonstrated in calculations on methane and CF4 in the static-exchange approximation and compared in detail with calculations performed with the numerical Schwinger variational approach based on single-center expansions. An efficient procedure for operating with the free-particle Green's function and exchange operators (to which no approximation is made) is also described.
Microbial Nanoculture as an Artificial Microniche
NASA Astrophysics Data System (ADS)
Niepa, Tagbo H. R.; Hou, Likai; Jiang, Hongyuan; Goulian, Mark; Koo, Hyun; Stebe, Kathleen J.; Lee, Daeyeon
2016-08-01
Microbes self-organize in microcolonies while transitioning to a sessile form within a protective biofilm matrix. To enable the detailed study of microbial dynamics within these microcolonies, new sessile culture systems are needed that sequester cells and mimic their complex growth conditions and interactions. We present a new nanoliter-scale sessile culture system that is easily implemented via microfluidics-enabled fabrication. Hundreds of thousands of these nanocultures can be easily generated and imaged using conventional or confocal microscopy. Each nanoculture begins as a several nanoliter droplet of suspended cells, encapsulated by a polydimethylsiloxane (PDMS) membrane. The PDMS shell provides long-lasting mechanical support, enabling long term study, and is selectively permeable to small molecules including antibiotics, signaling molecules and functional fluorescent probes. Thus, as microcolonies mature within the nanocultures, they can be stressed or interrogated using selected probes to characterize cell physiological properties, antibiotic susceptibilities, and antagonistic interactions. We demonstrate this platform by investigating broad ranges of microcolony dynamics, including direct and indirect bacterial-fungal interactions. This versatile new tool has broad potential for addressing biological questions associated with drug resistance, chronic infections, microbiome dynamics, and antibiotic discovery.
Microbial Nanoculture as an Artificial Microniche
Niepa, Tagbo H. R.; Hou, Likai; Jiang, Hongyuan; Goulian, Mark; Koo, Hyun; Stebe, Kathleen J.; Lee, Daeyeon
2016-01-01
Microbes self-organize in microcolonies while transitioning to a sessile form within a protective biofilm matrix. To enable the detailed study of microbial dynamics within these microcolonies, new sessile culture systems are needed that sequester cells and mimic their complex growth conditions and interactions. We present a new nanoliter-scale sessile culture system that is easily implemented via microfluidics-enabled fabrication. Hundreds of thousands of these nanocultures can be easily generated and imaged using conventional or confocal microscopy. Each nanoculture begins as a several nanoliter droplet of suspended cells, encapsulated by a polydimethylsiloxane (PDMS) membrane. The PDMS shell provides long-lasting mechanical support, enabling long term study, and is selectively permeable to small molecules including antibiotics, signaling molecules and functional fluorescent probes. Thus, as microcolonies mature within the nanocultures, they can be stressed or interrogated using selected probes to characterize cell physiological properties, antibiotic susceptibilities, and antagonistic interactions. We demonstrate this platform by investigating broad ranges of microcolony dynamics, including direct and indirect bacterial-fungal interactions. This versatile new tool has broad potential for addressing biological questions associated with drug resistance, chronic infections, microbiome dynamics, and antibiotic discovery. PMID:27476816
Chin, Jefferson; Wood, Elizabeth; Peters, Grace S; Drexler, Dieter M
2016-02-01
In the early stages of drug discovery, high-throughput screening (HTS) of compound libraries against pharmaceutical targets is a common method to identify potential lead molecules. For these HTS campaigns to be efficient and successful, continuous quality control of the compound collection is necessary and crucial. However, the large number of compound samples and the limited sample amount pose unique challenges. Presented here is a proof-of-concept study for a novel process flow for the quality control screening of small-molecule compound libraries that consumes only minimal amounts of samples and affords compound-specific molecular data. This process employs an acoustic sample deposition (ASD) technique for the offline sample preparation by depositing nanoliter volumes in an array format onto microscope glass slides followed by matrix-assisted laser desorption/ionization mass spectrometric (MALDI-MS) analysis. An initial study of a 384-compound array employing the ASD-MALDI-MS workflow resulted in a 75% first-pass positive identification rate with an analysis time of <1 s per sample. © 2015 Society for Laboratory Automation and Screening.
NASA Astrophysics Data System (ADS)
Madhurantakam, Sasya; Karnam, Jayanth Babu; Rayappan, John Bosco Balaguru; Krishnan, Uma Maheswari
2017-11-01
Carbon nanotubes (CNTs) have been extensively explored for a diverse range of applications due to their unique electrical and mechanical properties. CNT-incorporated electrochemical sensors have exhibited enhanced sensitivity towards the analyte molecule due to the excellent electron transfer properties of CNTs. In addition, CNTs possess a large surface area-to-volume ratio that favours the adhesion of analyte molecules as well as enhances the electroactive area. Most of the electrochemical sensors have employed CNTs as a nano-interface to promote electron transfer and as an immobilization matrix for enzymes. The present work explores the potential of CNTs to serve as a catalytic interface for the enzymeless quantification of glucose. The figure of merits for the enzymeless sensor was comparable to the performance of several enzyme-based sensors reported in literature. The developed sensor was successfully employed to determine the glucose utilization of unstimulated and stimulated macrophages. The significant difference in the glucose utilization levels in activated macrophages and quiescent cells observed in the present investigation opens up the possibilities of new avenues for effective medical diagnosis of inflammatory disorders.
Microbial Nanoculture as an Artificial Microniche.
Niepa, Tagbo H R; Hou, Likai; Jiang, Hongyuan; Goulian, Mark; Koo, Hyun; Stebe, Kathleen J; Lee, Daeyeon
2016-08-01
Microbes self-organize in microcolonies while transitioning to a sessile form within a protective biofilm matrix. To enable the detailed study of microbial dynamics within these microcolonies, new sessile culture systems are needed that sequester cells and mimic their complex growth conditions and interactions. We present a new nanoliter-scale sessile culture system that is easily implemented via microfluidics-enabled fabrication. Hundreds of thousands of these nanocultures can be easily generated and imaged using conventional or confocal microscopy. Each nanoculture begins as a several nanoliter droplet of suspended cells, encapsulated by a polydimethylsiloxane (PDMS) membrane. The PDMS shell provides long-lasting mechanical support, enabling long term study, and is selectively permeable to small molecules including antibiotics, signaling molecules and functional fluorescent probes. Thus, as microcolonies mature within the nanocultures, they can be stressed or interrogated using selected probes to characterize cell physiological properties, antibiotic susceptibilities, and antagonistic interactions. We demonstrate this platform by investigating broad ranges of microcolony dynamics, including direct and indirect bacterial-fungal interactions. This versatile new tool has broad potential for addressing biological questions associated with drug resistance, chronic infections, microbiome dynamics, and antibiotic discovery.
Hydrogel Droplet Microfluidics for High-Throughput Single Molecule/Cell Analysis.
Zhu, Zhi; Yang, Chaoyong James
2017-01-17
Heterogeneity among individual molecules and cells has posed significant challenges to traditional bulk assays, due to the assumption of average behavior, which would lose important biological information in heterogeneity and result in a misleading interpretation. Single molecule/cell analysis has become an important and emerging field in biological and biomedical research for insights into heterogeneity between large populations at high resolution. Compared with the ensemble bulk method, single molecule/cell analysis explores the information on time trajectories, conformational states, and interactions of individual molecules/cells, all key factors in the study of chemical and biological reaction pathways. Various powerful techniques have been developed for single molecule/cell analysis, including flow cytometry, atomic force microscopy, optical and magnetic tweezers, single-molecule fluorescence spectroscopy, and so forth. However, some of them have the low-throughput issue that has to analyze single molecules/cells one by one. Flow cytometry is a widely used high-throughput technique for single cell analysis but lacks the ability for intercellular interaction study and local environment control. Droplet microfluidics becomes attractive for single molecule/cell manipulation because single molecules/cells can be individually encased in monodisperse microdroplets, allowing high-throughput analysis and manipulation with precise control of the local environment. Moreover, hydrogels, cross-linked polymer networks that swell in the presence of water, have been introduced into droplet microfluidic systems as hydrogel droplet microfluidics. By replacing an aqueous phase with a monomer or polymer solution, hydrogel droplets can be generated on microfluidic chips for encapsulation of single molecules/cells according to the Poisson distribution. The sol-gel transition property endows the hydrogel droplets with new functionalities and diversified applications in single molecule/cell analysis. The hydrogel can act as a 3D cell culture matrix to mimic the extracellular environment for long-term single cell culture, which allows further heterogeneity study in proliferation, drug screening, and metastasis at the single-cell level. The sol-gel transition allows reactions in solution to be performed rapidly and efficiently with product storage in the gel for flexible downstream manipulation and analysis. More importantly, controllable sol-gel regulation provides a new way to maintain phenotype-genotype linkages in the hydrogel matrix for high throughput molecular evolution. In this Account, we will review the hydrogel droplet generation on microfluidics, single molecule/cell encapsulation in hydrogel droplets, as well as the progress made by our group and others in the application of hydrogel droplet microfluidics for single molecule/cell analysis, including single cell culture, single molecule/cell detection, single cell sequencing, and molecular evolution.
Montoya, Gonzalo; Arenas, Jesús; Romo, Enrique; Zeichner-David, Margarita; Alvarez, Marco; Narayanan, A Sampath; Velázquez, Ulises; Mercado, Gabriela; Arzate, Higinio
2014-12-01
Cementum extracellular matrix is similar to other mineralized tissues; however, this unique tissue contains molecules only present in cementum. A cDNA of these molecules, cementum attachment protein (hrPTPLa/CAP) was cloned and expressed in a prokaryotic system. This molecule is an alternative splicing of protein tyrosine phosphatase-like A (PTPLa). In this study, we wanted to determine the structural and functional characteristics of this protein. Our results indicate that hrPTPLa/CAP contains a 43.2% α-helix, 8.9% β-sheet, 2% β-turn and 45.9% random coil secondary structure. Dynamic light scattering shows that this molecule has a size distribution of 4.8 nm and aggregates as an estimated mass of 137 kDa species. AFM characterization and FE-SEM studies indicate that this protein self-assembles into nanospheres with sizes ranging from 7.0 to 27 nm in diameter. Functional studies demonstrate that hrPTPLa/CAP promotes hydroxyapatite crystal nucleation: EDS analysis revealed that hrPTPLa/CAP-induced crystals had a 1.59 ± 0.06 Ca/P ratio. Further confirmation with MicroRaman spectrometry and TEM confirm the presence of hydroxyapatite. In vivo studies using critical-size defects in rat cranium showed that hrPTPLa/CAP promoted 73% ± 2.19% and 87% ± 1.97% new bone formation at 4 and 8 weeks respectively. Although originally identified in cementum, PTPLa/CAP is very effective at inducing bone repair and healing and therefore this novel molecule has a great potential to be used for mineralized tissue bioengineering and tissue regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krasnoshchekov, Sergey V.; Stepanov, Nikolay F.
2013-11-14
In the theory of anharmonic vibrations of a polyatomic molecule, mixing the zero-order vibrational states due to cubic, quartic and higher-order terms in the potential energy expansion leads to the appearance of more-or-less isolated blocks of states (also called polyads), connected through multiple resonances. Such polyads of states can be characterized by a common secondary integer quantum number. This polyad quantum number is defined as a linear combination of the zero-order vibrational quantum numbers, attributed to normal modes, multiplied by non-negative integer polyad coefficients, which are subject to definition for any particular molecule. According to Kellman's method [J. Chem. Phys.more » 93, 6630 (1990)], the corresponding formalism can be conveniently described using vector algebra. In the present work, a systematic consideration of polyad quantum numbers is given in the framework of the canonical Van Vleck perturbation theory (CVPT) and its numerical-analytic operator implementation for reducing the Hamiltonian to the quasi-diagonal form, earlier developed by the authors. It is shown that CVPT provides a convenient method for the systematic identification of essential resonances and the definition of a polyad quantum number. The method presented is generally suitable for molecules of significant size and complexity, as illustrated by several examples of molecules up to six atoms. The polyad quantum number technique is very useful for assembling comprehensive basis sets for the matrix representation of the Hamiltonian after removal of all non-resonance terms by CVPT. In addition, the classification of anharmonic energy levels according to their polyad quantum numbers provides an additional means for the interpretation of observed vibrational spectra.« less
NASA Astrophysics Data System (ADS)
Berry, Jamal Ihsan
The desorption of biomolecules from frozen aqueous solutions on metal substrates with femtosecond laser pulses is presented for the first time. Unlike previous studies using nanosecond pulses, this approach produces high quality mass spectra of biomolecules repeatedly and reproducibly. This novel technique allows analysis of biomolecules directly from their native frozen environments. The motivation for this technique stems from molecular dynamics computer simulations comparing nanosecond and picosecond heating of water overlayers frozen on Au substrates which demonstrate large water cluster formation and ejection upon substrate heating within ultrashort timescales. As the frozen aqueous matrix and analyte molecules are transparent at the wavelengths used, the laser energy is primarily absorbed by the substrate, causing rapid heating and explosive boiling of the ice overlayer, followed by the ejection of ice clusters and the entrained analyte molecule. Spectral characteristics at a relatively high fluence of 10 J/cm 2 reveal the presence of large molecular weight metal clusters when a gold substrate is employed, with smaller cluster species observed from frozen aqueous solutions on Ag, Cu, and Pb substrates. The presence of the metal clusters is indicative of an evaporative cooling mechanism which stabiles cluster ion formation and the ejection of biomolecules from frozen aqueous solutions. Solvation is necessary as the presence of metal clusters and biomolecular ion signals are not observed from bare metal substrates in absence of the frozen overlayer. The potential for mass spectrometric imaging with femtosecond LDI of frozen samples is also presented. The initial results for the characterization of peptides and peptoids linked to combinatorial beads frozen in ice and the assay of frozen brain tissue from the serotonin transporter gene knockout mouse via LDI imaging are discussed. Images of very good quality and resolution are obtained with 400 nm, 200 fs pulses at a fluence of 1.25 J/cm2 . An attractive feature of this technique is that images are acquired within minutes for large sample areas. Additionally, the images obtained with femtosecond laser desorption are high in lateral resolution with the laser capable of being focused to a spot size of 30 mum. Femtosecond laser desorption from ice is unique in that unlike matrix assisted laser desorption ionization mass spectrometry, it does not employ an organic UV absorbing matrix to desorb molecular ions. Instead, the laser energy is absorbed by the metal substrate causing explosive boiling and ejection of the frozen overlayer. This approach is significant in that femtosecond laser desorption possess the potential of analyzing and assaying biomolecules directly from their frozen native environments. This technique was developed to compliment existing ToF-SIMS imaging capability for analysis of tissue and cells, as well as other biological systems of interest.
Addressing individual metal ion centers in supramolecules by STS
NASA Astrophysics Data System (ADS)
Alam, M. S.; Ako, A. M.; Ruben, M.; Thompson, L. K.; Lehn, J.-M.
2005-03-01
As the information of STM measurements arises from electronic structure, separating information on the topography is not straightforward for complex molecules. Scanning tunneling spectroscopy (STS) measurements give information about the molecular energy levels, which are next to the molecules Fermi level. Using a home built STM working under ambient conditions, we succeeded to combine high resolution topography mapping with simultaneous current-voltage characteristics (STS) measurements on single molecules deposited on highly oriented pyrolytic graphite surfaces. We present our recent results on grid-type molecules [Co4L4] (L=4,6-bis(2',2''-bipyridyl-6-yl)pyrimidine) and [Mn9L6] (L=2POAP-2H) as well as on ring-shaped Fe ion chains [Fe6Cl6L6] (L=1-Ecosyliminodiethanol). Small, regular molecule clusters as well as separated single molecules were observed. We found a rather large contrast at the expected location of the metal centers in our molecules, i.e. the location of the individual metal ions in their organic matrix is directly addressable by STS.
The roles of cell adhesion molecules in tumor suppression and cell migration: a new paradox.
Moh, Mei Chung; Shen, Shali
2009-01-01
In addition to mediating cell adhesion, many cell adhesion molecules act as tumor suppressors. These proteins are capable of restricting cell growth mainly through contact inhibition. Alterations of these cell adhesion molecules are a common event in cancer. The resulting loss of cell-cell and/or cell-extracellular matrix adhesion promotes cell growth as well as tumor dissemination. Therefore, it is conventionally accepted that cell adhesion molecules that function as tumor suppressors are also involved in limiting tumor cell migration. Paradoxically, in 2005, we identified an immunoglobulin superfamily cell adhesion molecule hepaCAM that is able to suppress cancer cell growth and yet induce migration. Almost concurrently, CEACAM1 was verified to co-function as a tumor suppressor and invasion promoter. To date, the reason and mechanism responsible for this exceptional phenomenon remain unclear. Nevertheless, the emergence of these intriguing cell adhesion molecules with conflicting roles may open a new chapter to the biological significance of cell adhesion molecules.
Extracellular Matrix and Dermal Fibroblast Function in the Healing Wound
Tracy, Lauren E.; Minasian, Raquel A.; Caterson, E.J.
2016-01-01
Significance: Fibroblasts play a critical role in normal wound healing. Various extracellular matrix (ECM) components, including collagens, fibrin, fibronectin, proteoglycans, glycosaminoglycans, and matricellular proteins, can be considered potent protagonists of fibroblast survival, migration, and metabolism. Recent Advances: Advances in tissue culture, tissue engineering, and ex vivo models have made the examination and precise measurements of ECM components in wound healing possible. Likewise, the development of specific transgenic animal models has created the opportunity to characterize the role of various ECM molecules in healing wounds. In addition, the recent characterization of new ECM molecules, including matricellular proteins, dermatopontin, and FACIT collagens (Fibril-Associated Collagens with Interrupted Triple helices), further demonstrates our cursory knowledge of the ECM in coordinated wound healing. Critical Issues: The manipulation and augmentation of ECM components in the healing wound is emerging in patient care, as demonstrated by the use of acellular dermal matrices, tissue scaffolds, and wound dressings or topical products bearing ECM proteins such as collagen, hyaluronan (HA), or elastin. Once thought of as neutral structural proteins, these molecules are now known to directly influence many aspects of cellular wound healing. Future Directions: The role that ECM molecules, such as CCN2, osteopontin, and secreted protein, acidic and rich in cysteine, play in signaling homing of fibroblast progenitor cells to sites of injury invites future research as we continue investigating the heterotopic origin of certain populations of fibroblasts in a healing wound. Likewise, research into differently sized fragments of the same polymeric ECM molecule is warranted as we learn that fragments of molecules such as HA and tenascin-C can have opposing effects on dermal fibroblasts. PMID:26989578
Multilayer white lighting polymer light-emitting diodes
NASA Astrophysics Data System (ADS)
Gong, Xiong; Wang, Shu; Heeger, Alan J.
2006-08-01
Organic and polymer light-emitting diodes (OLEDs/PLEDs) that emit white light are of interest and potential importance for use in active matrix displays (with color filters) and because they might eventually be used for solid-state lighting. In such applications, large-area devices and low-cost of manufacturing will be major issues. We demonstrated that high performance multilayer white emitting PLEDs can be fabricated by using a blend of luminescent semiconducting polymers and organometallic complexes as the emission layer, and water-soluble (or ethanol-soluble) polymers/small molecules (for example, PVK-SO 3Li) as the hole injection/transport layer (HIL/HTL) and water-soluble (or ethanol-soluble) polymers/small molecules (for example, t-Bu-PBD-SO 3Na) as the electron injection/transport layer (EIL/HTL). Each layer is spin-cast sequentially from solutions. Illumination quality light is obtained with stable Commission Internationale d'Eclairage coordinates, stable color temperatures, and stable high color rendering indices, all close to those of "pure" white. The multilayer white-emitting PLEDs exhibit luminous efficiency of 21 cd/A, power efficiency of 6 lm/W at a current density of 23 mA/cm2 with luminance of 5.5 x 10 4 cd/m2 at 16 V. By using water-soluble (ethanol-soluble) polymers/small molecules as HIL/HTL and polymers/small molecules as EIL/ETL, the interfacial mixing problem is solved (the emissive polymer layer is soluble in organic solvents, but not in water/ ethanol). As a result, this device architecture and process technology can potentially be used for printing large-area multiplayer light sources and for other applications in "plastic" electronics. More important, the promise of producing large areas of high quality white light with low-cost manufacturing technology makes the white multilayer white-emitting PLEDs attractive for the development of solid state light sources.
Roles of Heparan Sulfate Sulfation in Dentinogenesis*
Hayano, Satoru; Kurosaka, Hiroshi; Yanagita, Takeshi; Kalus, Ina; Milz, Fabian; Ishihara, Yoshihito; Islam, Md. Nurul; Kawanabe, Noriaki; Saito, Masahiro; Kamioka, Hiroshi; Adachi, Taiji; Dierks, Thomas; Yamashiro, Takashi
2012-01-01
Cell surface heparan sulfate (HS) is an essential regulator of cell signaling and development. HS traps signaling molecules, like Wnt in the glycosaminoglycan side chains of HS proteoglycans (HSPGs), and regulates their functions. Endosulfatases Sulf1 and Sulf2 are secreted at the cell surface to selectively remove 6-O-sulfate groups from HSPGs, thereby modifying the affinity of cell surface HSPGs for its ligands. This study provides molecular evidence for the functional roles of HSPG sulfation and desulfation in dentinogenesis. We show that odontogenic cells are highly sulfated on the cell surface and become desulfated during their differentiation to odontoblasts, which produce tooth dentin. Sulf1/Sulf2 double null mutant mice exhibit a thin dentin matrix and short roots combined with reduced expression of dentin sialophosphoprotein (Dspp) mRNA, encoding a dentin-specific extracellular matrix precursor protein, whereas single Sulf mutants do not show such defective phenotypes. In odontoblast cell lines, Dspp mRNA expression is potentiated by the activation of the Wnt canonical signaling pathway. In addition, pharmacological interference with HS sulfation promotes Dspp mRNA expression through activation of Wnt signaling. On the contrary, the silencing of Sulf suppresses the Wnt signaling pathway and subsequently Dspp mRNA expression. We also show that Wnt10a protein binds to cell surface HSPGs in odontoblasts, and interference with HS sulfation decreases the binding affinity of Wnt10a for HSPGs, which facilitates the binding of Wnt10a to its receptor and potentiates the Wnt signaling pathway, thereby up-regulating Dspp mRNA expression. These results demonstrate that Sulf-mediated desulfation of cellular HSPGs is an important modification that is critical for the activation of the Wnt signaling in odontoblasts and for production of the dentin matrix. PMID:22351753
Wound healing potential of adipose tissue stem cell extract
DOE Office of Scientific and Technical Information (OSTI.GOV)
Na, You Kyung; Ban, Jae-Jun; Lee, Mijung
Adipose tissue stem cells (ATSCs) are considered as a promising source in the field of cell therapy and regenerative medicine. In addition to direct cell replacement using stem cells, intercellular molecule exchange by stem cell secretory factors showed beneficial effects by reducing tissue damage and augmentation of endogenous repair. Delayed cutaneous wound healing is implicated in many conditions such as diabetes, aging, stress and alcohol consumption. However, the effects of cell-free extract of ATSCs (ATSC-Ex) containing secretome on wound healing process have not been investigated. In this study, ATSC-Ex was topically applied on the cutaneous wound and healing speed wasmore » examined. As a result, wound closure was much faster in the cell-free extract treated wound than control wound at 4, 6, 8 days after application of ATSC-Ex. Dermal fibroblast proliferation, migration and extracellular matrix (ECM) production are critical aspects of wound healing, and the effects of ATSC-Ex on human dermal fibroblast (HDF) was examined. ATSC-Ex augmented HDF proliferation in a dose-dependent manner and migration ability was enhanced by extract treatment. Representative ECM proteins, collagen type I and matrix metalloproteinase-1, are significantly up-regulated by treatment of ATSC-Ex. Our results suggest that the ATSC-Ex have improving effect of wound healing and can be the potential therapeutic candidate for cutaneous wound healing. - Highlights: • Topical application of ATSC-Ex results in faster wound closure than normal wound in vivo. • ATSC-Ex enhances dermal fibroblast proliferation, migration and extracellular matrix production. • This study suggests that ATSC-Ex is an effective source to augment wound healing.« less
Matta*, Chérif F
2014-01-01
The electron density and the electrostatic potential are fundamentally related to the molecular hamiltonian, and hence are the ultimate source of all properties in the ground- and excited-states. The advantages of using molecular descriptors derived from these fundamental scalar fields, both accessible from theory and from experiment, in the formulation of quantitative structure-to-activity and structure-to-property relationships, collectively abbreviated as QSAR, are discussed. A few such descriptors encode for a wide variety of properties including, for example, electronic transition energies, pKa's, rates of ester hydrolysis, NMR chemical shifts, DNA dimers binding energies, π-stacking energies, toxicological indices, cytotoxicities, hepatotoxicities, carcinogenicities, partial molar volumes, partition coefficients (log P), hydrogen bond donor capacities, enzyme–substrate complementarities, bioisosterism, and regularities in the genetic code. Electronic fingerprinting from the topological analysis of the electron density is shown to be comparable and possibly superior to Hammett constants and can be used in conjunction with traditional bulk and liposolubility descriptors to accurately predict biological activities. A new class of descriptors obtained from the quantum theory of atoms in molecules' (QTAIM) localization and delocalization indices and bond properties, cast in matrix format, is shown to quantify transferability and molecular similarity meaningfully. Properties such as “interacting quantum atoms (IQA)” energies which are expressible into an interaction matrix of two body terms (and diagonal one body “self” terms, as IQA energies) can be used in the same manner. The proposed QSAR-type studies based on similarity distances derived from such matrix representatives of molecular structure necessitate extensive investigation before their utility is unequivocally established. © 2014 The Author and the Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:24777743
New Concepts on Pathogenesis and Diagnosis of Liver Fibrosis; A Review Article
Ebrahimi, Hedyeh; Naderian, Mohammadreza; Sohrabpour, Amir Ali
2016-01-01
Liver fibrosis is a potentially reversible response to hepatic insults, triggered by different chronic diseases most importantly viral hepatitis, alcoholic, and nonalcoholic fatty liver disease. In the course of the chronic liver disease, hepatic fibrogenesis may develop, which is attributed to various types of cells, molecules, and pathways. Activated hepatic stellate cell (HSC), the primary source of extracellular matrix (ECM), is fundamental in pathophysiology of fibrogenesis, and thus is the most attractable target for reversing liver fibrosis. Although, liver biopsy has long been considered as the gold standard for diagnosis and staging of hepatic fibrosis, assessing progression and regression by biopsy is hampered by its limitations. We provide recent views on noninvasive approaches including serum biomarkers and radiologic techniques. PMID:27698966
BRD4 inhibition for the treatment of pathological organ fibrosis
Stratton, Matthew S.; Haldar, Saptarsi M.; McKinsey, Timothy A.
2017-01-01
Fibrosis is defined as excess deposition of extracellular matrix, resulting in tissue scarring and organ dysfunction. It is estimated that 45% of deaths in the developed world are due to fibrosis-induced organ failure. Despite the well-accepted role of fibrosis in the pathogenesis of numerous diseases, there are only two US Food and Drug Administration–approved anti-fibrotic therapies, both of which are currently restricted to the treatment of pulmonary fibrosis. Thus, organ fibrosis represents a massive unmet medical need. Here, we review recent findings suggesting that an epigenetic regulatory protein, BRD4, is a nodal effector of organ fibrosis, and we highlight the potential of small-molecule BRD4 inhibitors for the treatment of diverse fibrotic diseases. PMID:28721198
Hard template synthesis of metal nanowires
Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori
2014-01-01
Metal nanowires (NWs) have attracted much attention because of their high electron conductivity, optical transmittance, and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production of composite devices. The resulting NWs are immobilized and spatially arranged, as dictated by the ordered porous structure of the template. This avoids the NWs from aggregating, which is common for NWs prepared with soft templates in solution. Herein, the hard template synthesis of metal NWs is reviewed, and the resulting structures, properties and potential applications are discussed. PMID:25453031
Hard template synthesis of metal nanowires
NASA Astrophysics Data System (ADS)
Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori
2014-11-01
Metal nanowires (NWs) have attracted much attention because of their high electron conductivity, optical transmittance and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production of composite devices. The resulting NWs are immobilized and spatially arranged, as dictated by the ordered porous structure of the template. This avoids the NWs from aggregating, which is common for NWs prepared with soft templates in solution. Herein, the hard template synthesis of metal NWs is reviewed, and the resulting structures, properties and potential applications are discussed.
Hard template synthesis of metal nanowires.
Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori
2014-01-01
Metal nanowires (NWs) have attracted much attention because of their high electron conductivity, optical transmittance, and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production of composite devices. The resulting NWs are immobilized and spatially arranged, as dictated by the ordered porous structure of the template. This avoids the NWs from aggregating, which is common for NWs prepared with soft templates in solution. Herein, the hard template synthesis of metal NWs is reviewed, and the resulting structures, properties and potential applications are discussed.
The time-dependent density matrix renormalisation group method
NASA Astrophysics Data System (ADS)
Ma, Haibo; Luo, Zhen; Yao, Yao
2018-04-01
Substantial progress of the time-dependent density matrix renormalisation group (t-DMRG) method in the recent 15 years is reviewed in this paper. By integrating the time evolution with the sweep procedures in density matrix renormalisation group (DMRG), t-DMRG provides an efficient tool for real-time simulations of the quantum dynamics for one-dimensional (1D) or quasi-1D strongly correlated systems with a large number of degrees of freedom. In the illustrative applications, the t-DMRG approach is applied to investigate the nonadiabatic processes in realistic chemical systems, including exciton dissociation and triplet fission in polymers and molecular aggregates as well as internal conversion in pyrazine molecule.
USDA-ARS?s Scientific Manuscript database
Immunoassays are analytical methods that employ antibodies or molecules derived from antibodies for the essential binding reactions. The choice of immunoassay system for food safety analysis depends on the analyte, the matrix, and the requirements of the analysis (speed, throughput, sensitivity, spe...
NASA Astrophysics Data System (ADS)
Szopa, C.; Millan, M.; Buch, A.; Freissinet, C.; Guzman, M.; Glavin, D. P.; Mahaffy, P. R.; Navarro-Gonzalez, R.
2017-12-01
The search for organic molecules at the Mars surface is a key objective to assess the potential for habitability of the planet and to find biomarkers. Both the past Viking landers and the Curiosity rover of today carry onboard instruments based on gas chromatography coupled to mass spectrometry with the aim to analyze the content of organics present in soil or rock samples. These instruments analyze the volatile compounds released from the samples submitted to thermal or chemical treatments. Even though these sample preparation processes are commonly used on Earth for their efficient extraction of organic materials from mineral matrixes, the presence of oxychlorines recently discovered in the Mars soil [1, 2] makes the process for space applications more complex and the results more difficult to interpret. Indeed, the release of volatile inorganic reactive molecules from oxychlorines during the sample heating process induces reactions of chlorination and oxidation of the organic molecules. For this reason, in an effort to contribute to the interpretation of the results obtained with the Viking/GCMS, and the MSL/SAM experiment our team currently operates on Mars, we started to study systematically the thermal reactivity of a series of organic molecules, of interest for Mars and life purposes, mixed with oxychlorines either detected or potentially present in the soil of Mars [3]. In this presentation, we will mainly focus on two sets of results that were obtained while studying the reactivity of calcium perchlorates with polyaromatic hydrocarbons, amino acids and carboxylic acids under pyrolytic conditions similar to those used in the SAM experiment. First of all, we will show the dependence of reactivity on the temperature of sublimation and decomposition of the individual components in the mixture and, secondly, we will discuss the detection of aromatic chlorinated species by SAM in samples collected at the Cumberland site from the results obtained in this study. [1] Kounaves et al. (2010), JGR 115; [2] Glavin et al. (2013), JGR 181; [3] Sutter et al., JGR (in press);
Dissociative Electron Attachment to Rovibrationally Excited Molecules
1987-08-31
obtained in some recent papers.4’ - In Sec. IV of the present L,(0, (00 paper we will obtain some general recursion relations among where these matrix... general five-term From the generating function of Hermite polynomials , recursion relation (32) is obtained which is valid for the matrix elements of...for the generation of the functions for increasing 1. One convenient way to evaluate a Q, function is to write it in terms of Gaussian hypergeometric
Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju
2016-08-01
Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone-related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.-Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone-related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. © FASEB.
Gruen, Dieter M.
2000-01-01
A 213 nm laser beam is capable of single photon ablative photodecomposition for the removal of a polymer or biological material substrate. Breaking the molecular bonds and displacing the molecules away from the substrate in a very short time period results in most of the laser photon energy being carried away by the displaced molecules, thus minimizing thermal damage to the substrate. The incident laser beam may be unfocussed and is preferably produced by quintupling the 1064 nm radiation from a Nd:YAG solid state laser, i.e., at 213 nm. In one application, the 213 nm laser beam is expanded in cross section and directed through a plurality of small beta barium borate (BBO) crystals for increasing the energy per photon of the laser radiation directed onto the substrate. The BBO crystals are arranged in a crystal matrix array to provide a large laser beam transmission area capable of accommodating high energy laser radiation without damaging the BBO crystals. The BBO crystal matrix array may also be used with 266 nm laser radiation for carrying out single or multi photon ablative photodecomposition. The BBO crystal matrix array may also be used in an optical parametric oscillator mode to generate high power tunable laser radiation in the range of 210-400 nm.
Ryumin, Pavel; Cramer, Rainer
2018-07-12
New liquid atmospheric pressure (AP) matrix-assisted laser desorption/ionization (MALDI) matrices that produce predominantly multiply charged ions have been developed and evaluated with respect to their performance for peptide and protein analysis by mass spectrometry (MS). Both the chromophore and the viscous support liquid in these matrices were optimized for highest MS signal intensity, S/N values and maximum charge state. The best performance in both protein and peptide analysis was achieved employing light diols as matrix support liquids (e.g. ethylene glycol and propylene glycol). Investigating the influence of the chromophore, it was found that 2,5-dihydroxybenzoic acid resulted in a higher analyte ion signal intensity for the analysis of small peptides; however, larger molecules (>17 kDa) were undetectable. For larger molecules, a sample preparation based on α-cyano-4-hydroxycinnammic acid as the chromophore was developed and multiply protonated analytes with charge states of more than 50 were detected. Thus, for the first time it was possible to detect with MALDI MS proteins as large as ∼80 kDa with a high number of charge states, i.e. m/z values below 2000. Systematic investigations of various matrix support liquids have revealed a linear dependency between laser threshold energy and surface tension of the liquid MALDI sample. Copyright © 2018 Elsevier B.V. All rights reserved.
Campbell, Kayleen; Craig, Duncan Q M; McNally, Tony
2008-11-03
Composites of paracetamol loaded poly(ethylene glycol) (PEG) with a naturally derived and partially synthetic layered silicate (nanoclay) were prepared using hot-melt extrusion. The extent of dispersion and distribution of the paracetamol and nanoclay in the PEG matrix was examined using a combination of field emission scanning electron microscopy (FESEM), high resolution transmission electron microscopy (HRTEM) and wide-angle X-ray diffraction (WAXD). The paracetamol polymorph was shown to be well dispersed in the PEG matrix and the nanocomposite to have a predominately intercalated and partially exfoliated morphology. The form 1 monoclinic polymorph of the paracetamol was unaltered after the melt mixing process. The crystalline behaviour of the PEG on addition of both paracetamol and nanoclay was investigated using differential scanning calorimetry (DSC) and polarised hot-stage optical microscopy. The crystalline content of PEG decreased by up to 20% when both drug and nanoclay were melt blended with PEG, but the average PEG spherulite size increased by a factor of 4. The time taken for 100% release of paracetamol from the PEG matrix and corresponding diffusion coefficients were significantly retarded on addition of low loadings of both naturally occurring and partially synthetic nanoclays. The dispersed layered silicate platelets encase the paracetamol molecules, retarding diffusion and altering the dissolution behaviour of the drug molecule in the PEG matrix.
Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju
2016-01-01
Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone–related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo. In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.—Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. PMID:27075243
Matrix stiffness-modulated proliferation and secretory function of the airway smooth muscle cells.
Shkumatov, Artem; Thompson, Michael; Choi, Kyoung M; Sicard, Delphine; Baek, Kwanghyun; Kim, Dong Hyun; Tschumperlin, Daniel J; Prakash, Y S; Kong, Hyunjoon
2015-06-01
Multiple pulmonary conditions are characterized by an abnormal misbalance between various tissue components, for example, an increase in the fibrous connective tissue and loss/increase in extracellular matrix proteins (ECM). Such tissue remodeling may adversely impact physiological function of airway smooth muscle cells (ASMCs) responsible for contraction of airways and release of a variety of bioactive molecules. However, few efforts have been made to understand the potentially significant impact of tissue remodeling on ASMCs. Therefore, this study reports how ASMCs respond to a change in mechanical stiffness of a matrix, to which ASMCs adhere because mechanical stiffness of the remodeled airways is often different from the physiological stiffness. Accordingly, using atomic force microscopy (AFM) measurements, we found that the elastic modulus of the mouse bronchus has an arithmetic mean of 23.1 ± 14 kPa (SD) (median 18.6 kPa). By culturing ASMCs on collagen-conjugated polyacrylamide hydrogels with controlled elastic moduli, we found that gels designed to be softer than average airway tissue significantly increased cellular secretion of vascular endothelial growth factor (VEGF). Conversely, gels stiffer than average airways stimulated cell proliferation, while reducing VEGF secretion and agonist-induced calcium responses of ASMCs. These dependencies of cellular activities on elastic modulus of the gel were correlated with changes in the expression of integrin-β1 and integrin-linked kinase (ILK). Overall, the results of this study demonstrate that changes in matrix mechanics alter cell proliferation, calcium signaling, and proangiogenic functions in ASMCs. Copyright © 2015 the American Physiological Society.
Alì, Greta; Borrelli, Nicla; Riccardo, Giannini; Proietti, Agnese; Pelliccioni, Serena; Niccoli, Cristina; Boldrini, Laura; Lucchi, Marco; Mussi, Alfredo; Fontanini, Gabriella
2013-11-01
Malignant pleural mesothelioma (MPM) is a highly aggressive neoplasm associated with asbestos exposure. Currently, the molecular mechanisms that induce MPM development are still unknown. The purpose of this study was to identify new molecular biomarkers for mesothelial carcinogenesis. We analyzed a panel of 84 genes involved in extracellular matrix remodeling and cell adhesion by polymerase chain reaction (PCR) array in 15 samples of epithelioid mesothelioma and 10 samples of reactive mesothelial hyperplasia (MH; 3 of 25 samples were inadequate for mRNA analysis). To validate the differentially expressed genes identified by PCR array, we analyzed 27 more samples by immunohistochemistry, in addition to the 25 samples already studied. Twenty-five genes were differentially expressed in MPM and MH by PCR array. Of these we studied matrix metalloproteinase 7 (MMP7), MMP14, CD44, and integrin, alpha3 expression by immunohistochemistry in 26 epithelioid MPM and 26 MH samples from the entire series of 52 cases. We observed higher MMP14 and integrin, alpha3 expression in MPM samples compared with MH samples (p = 0.000002 and p = 0.000002, respectively). Conversely, CD44 expression was low in most (57.7%) mesothelioma samples but only in 11.5% of the MH samples (p = 0.0013). As regards MMP7, we did not observe differential expression between MH and MPM samples. We have extensively studied genes involved in cell adhesion and extracellular matrix remodeling in MPM and MH samples, gaining new insight into the pathophysiology of mesothelioma. Moreover, our data suggest that these factors could be potential biomarkers for MPM.
Echenique, Pablo; Alonso, J L
2006-07-30
A set of rules is defined to systematically number the groups and the atoms of polypeptides in a modular manner. Supported by this numeration, a set of internal coordinates is defined. These coordinates (termed Systematic, Approximately Separable, and Modular Internal Coordinates--SASMIC) are straightforwardly written in Z-matrix form and may be directly implemented in typical Quantum Chemistry packages. A number of Perl scripts that automatically generate the Z-matrix files are provided as supplementary material. The main difference with most Z-matrix-like coordinates normally used in the literature is that normal dihedral angles ("principal dihedrals" in this work) are only used to fix the orientation of whole groups and a different type of dihedrals, termed "phase dihedrals," are used to describe the covalent structure inside the groups. This physical approach allows to approximately separate soft and hard movements of the molecule using only topological information and to directly implement constraints. As an application, we use the coordinates defined and ab initio quantum mechanical calculations to assess the commonly assumed approximation of the free energy, obtained from "integrating out" the side chain degree of freedom chi, by the Potential Energy Surface (PES) in the protected dipeptide HCO-L-Ala-NH2. We also present a subbox of the Hessian matrix in two different sets of coordinates to illustrate the approximate separation of soft and hard movements when the coordinates defined in this work are used. (PACS: 87.14.Ee, 87.15.-v, 87.15.Aa, 87.15.Cc) 2006 Wiley Periodicals, Inc.
Löfgren, Maria; Ekman, Stina; Svala, Emilia; Lindahl, Anders; Ley, Cecilia; Skiöldebrand, Eva
2014-01-01
Formation of synovial joints includes phenotypic changes of the chondrocytes and the organisation of their extracellular matrix is regulated by different factors and signalling pathways. Increased knowledge of the normal processes involved in joint development may be used to identify similar regulatory mechanisms during pathological conditions in the joint. Samples of the distal radius were collected from prenatal and postnatal equine growth plates, zones of Ranvier and articular cartilage with the aim of identifying Notch signalling components and cells with stem cell-like characteristics and to follow changes in matrix protein localisation during joint development. The localisation of the Notch signalling components Notch1, Delta4, Hes1, Notch dysregulating protein epidermal growth factor-like domain 7 (EGFL7), the stem cell-indicating factor Stro-1 and the matrix molecules cartilage oligomeric matrix protein (COMP), fibromodulin, matrilin-1 and chondroadherin were studied using immunohistochemistry. Spatial changes in protein localisations during cartilage maturation were observed for Notch signalling components and matrix molecules, with increased pericellular localisation indicating new synthesis and involvement of these proteins in the formation of the joint. However, it was not possible to characterise the phenotype of the chondrocytes based on their surrounding matrix during normal chondrogenesis. The zone of Ranvier was identified in all horses and characterised as an area expressing Stro-1, EGFL7 and chondroadherin with an absence of COMP and Notch signalling. Stro-1 was also present in cells close to the perichondrium, in the articular cartilage and in the fetal resting zone, indicating stem cell-like characteristics of these cells. The presence of stem cells in the articular cartilage will be of importance for the repair of damaged cartilage. Perivascular chondrocytes and hypertrophic cells of the cartilage bone interface displayed positive staining for EGFL7, which is a novel finding and suggests a role of EGFL7 in the vascular infiltration of growth cartilage. PMID:25175365
Vest, Katherine E.; Leary, Scot C.; Winge, Dennis R.; Cobine, Paul A.
2013-01-01
Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria. PMID:23846699
Vest, Katherine E; Leary, Scot C; Winge, Dennis R; Cobine, Paul A
2013-08-16
Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria.
NASA Astrophysics Data System (ADS)
Jia, Chun-Sheng; Liang, Guang-Chuan; Peng, Xiao-Long; Tang, Hong-Ming; Zhang, Lie-Hui
2014-06-01
By employing the dissociation energy and the equilibrium bond length for a diatomic molecule as explicit parameters, we generate an improved form of the Williams-Poulios potential energy model. It is found that the negative Williams-Poulios potential model is equivalent to the Manning-Rosen potential model for diatomic molecules. We observe that the Manning-Rosen potential is superior to the Morse potential in reproducing the interaction potential energy curves for the {{a}3 Σu+} state of the 6Li2 molecule and the {{X}1 sum+} state of the SiF+ molecule.
NASA Astrophysics Data System (ADS)
Yan, Hong; Xu, Ning; Huang, Wen-Yi; Han, Huan-Mei; Xiao, Shou-Jun
2009-03-01
An improved DIOS (desorption ionization on porous silicon) method for laser desorption/ionization mass spectrometry (LDI MS) by electroless plating of silver nanoparticles (AgNPs) on porous silicon (PSi) was developed. By addition of 4-aminothiophenol (4-ATP) into the AgNO3 plating solution, the plating speed can be slowed down and simultaneously 4-ATP self-assembled monolayers (SAMs) on AgNPs (4-ATP/AgNPs) were formed. Both AgNPs and 4-ATP/AgNPs coated PSi substrates present much higher stability, sensitivity and reproducibility for LDI MS than the un-treated porous silicon ones. Their shelf life in air was tested for several weeks to a month and their mass spectra still displayed the same high quality and sensitivity as the freshly prepared ones. And more 4-ATP SAMs partly play a role of matrix to increase the ionization efficiency. A small organic molecule of tetrapyridinporphyrin (TPyP), oligomers of polyethylene glycol (PEG 400 and 2300), and a peptide of oxytocin were used as examples to demonstrate the feasibility of the silver-plated PSi as a matrix-free-like method for LDI MS. This approach can obtain limits of detection to femtomoles for TPyP, subpicomoles for oxytocin, and picomoles for PEG 400 and 2300, comparable to the traditional matrix method and much better than the DIOS method. It simplifies the sample preparation as a matrix-free-like method without addition of matrix molecules and homogenizes the sample spread over the spot for better and more even mass signals.