Science.gov

Sample records for maturity alpha amylase

  1. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  2. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  3. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  4. Bakers' asthma caused by alpha amylase.

    PubMed

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  5. Additive-dominance genetic model analyses for late-maturity alpha-amylase activity in a bread wheat factorial crossing population.

    PubMed

    Rasul, Golam; Glover, Karl D; Krishnan, Padmanaban G; Wu, Jixiang; Berzonsky, William A; Ibrahim, Amir M H

    2015-12-01

    Elevated level of late maturity α-amylase activity (LMAA) can result in low falling number scores, reduced grain quality, and downgrade of wheat (Triticum aestivum L.) class. A mating population was developed by crossing parents with different levels of LMAA. The F2 and F3 hybrids and their parents were evaluated for LMAA, and data were analyzed using the R software package 'qgtools' integrated with an additive-dominance genetic model and a mixed linear model approach. Simulated results showed high testing powers for additive and additive × environment variances, and comparatively low powers for dominance and dominance × environment variances. All variance components and their proportions to the phenotypic variance for the parents and hybrids were significant except for the dominance × environment variance. The estimated narrow-sense heritability and broad-sense heritability for LMAA were 14 and 54%, respectively. High significant negative additive effects for parents suggest that spring wheat cultivars 'Lancer' and 'Chester' can serve as good general combiners, and that 'Kinsman' and 'Seri-82' had negative specific combining ability in some hybrids despite of their own significant positive additive effects, suggesting they can be used as parents to reduce LMAA levels. Seri-82 showed very good general combining ability effect when used as a male parent, indicating the importance of reciprocal effects. High significant negative dominance effects and high-parent heterosis for hybrids demonstrated that the specific hybrid combinations; Chester × Kinsman, 'Lerma52' × Lancer, Lerma52 × 'LoSprout' and 'Janz' × Seri-82 could be generated to produce cultivars with significantly reduced LMAA level.

  6. On the mechanism of alpha-amylase.

    PubMed

    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique

    2003-10-01

    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  7. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  8. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  9. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  10. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza

    2016-01-01

    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  11. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    2000-07-01

    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

  12. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.

    PubMed

    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R

    2002-10-23

    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry.

  13. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  14. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  15. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  16. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].

    PubMed

    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K

    1982-11-01

    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  17. Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein

    SciTech Connect

    Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. )

    1993-04-01

    Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

  18. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  19. Optimization of alpha-amylase application in raw sugar manufacture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentration sin raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  20. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    PubMed

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  1. New substrate specificity of modified porcine pancreatic alpha-amylase.

    PubMed

    Ishikawa, K; Hirata, H

    1989-08-01

    Conversion of the substrate specificity of porcine pancreatic alpha-amylase (PPA) was studied using chemical modification of His residues. Diethyl pyrocarbonate modified His residues in PPA and the activity of the modified PPA for the hydrolysis of the alpha-D-(1,4)glucoside bond in starch or oligosaccharides decreased to less than 1% of that of the native enzyme. However, the activity for the hydrolysis of the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides was increased by chemical modification. When the modified PPA was incubated with a proteinaceous alpha-amylase inhibitor (Mr 60,000) purified from white kidney bean (Phaseolus vulgaris), it bound to the inhibitor. As a result, the remaining less than 1% hydrolytic activity of the modified PPA for starch disappeared completely but that for p-nitrophenyl oligosaccharides remained unaltered. The hydrolytic activity of the native PPA for the alpha-D-(1,4)glucoside bond in oligosaccharides was stronger than that between p-nitrophenyl and oligosaccharides in p-nitrophenyl oligosaccharides. Therefore, when p-nitrophenyl oligosaccharides (three to five glucose residues) were used as substrates for the native PPA, the alpha-D-(1,4)glucoside bonds in the oligosaccharides were hydrolyzed. However, the modified PPA-inhibitor complex hydrolyzed only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides. The above results reveal that, by chemical modification with diethyl pyrocarbonate and biochemical modification with an amylase inhibitor, amylase can be converted to a new exo-type enzyme which hydrolyzes only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides.

  2. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds.

    PubMed

    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B

    2008-09-01

    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature.

  3. The alpha-amylase from the yellow meal worm: complete primary structure, crystallization and preliminary X-ray analysis.

    PubMed

    Strobl, S; Gomis-Rüth, F X; Maskos, K; Frank, G; Huber, R; Glockshuber, R

    1997-06-02

    The alpha-amylase from Tenebrio molitor larvae (TMA) was purified from a crude larval extract. After removal of the N-terminal pyroglutamate residue and identification of the following 17 residues by Edman sequencing, the cDNA of mature TMA was cloned from larval mRNA. The encoded enzyme consists of 471 amino acid residues and has 57-79% sequence identity to other insect alpha-amylases and also shows high homology to the mammalian enzymes. TMA was crystallized in form of well-ordered orthorhombic crystals of space group P2(1)2(1)2(1) diffracting beyond 1.6 A resolution with unit cell dimensions of a = 51.24 A, b = 93.46 A, c = 96.95 A. TMA may serve as model system for the future analysis of interactions between insect alpha-amylase and proteinaceous plant inhibitors on the molecular level.

  4. [The contribution of different alpha-amylase isoenzymes of the commodity grain spring wheat in the formation of falling number values].

    PubMed

    Mamytova, N S; Kuzovlev, V A; Khakimzhanov, A A; Fursov, O V

    2014-01-01

    The participation of various isoenzymes of alpha-amylase in the formation of falling number values of the commodity grain of wheat grown in the Republic of Kazakhstan was investigated. It was found that active isoenzymes alpha-AMY1 and alpha-AMY2 of the embryonic shield were present in the grain with an index over 200. A significant decrease in the falling number depended mainly on the synthesis of alpha-AMY1 and alpha-AMY2 isoenzymes in the aleurone layer. In the grain, isoenzymes with high isoelectric points (p1 > or = 7.3) were found; these isoenzymes belong to alpha-amylase or late maturing or alpha-amylase of practically mature grains. It was discovered that the exogenous hormone (gibberellic acid) induced synthesis of alpha-amylase isoenzymes of scutellum, whole caryopses, and aleurone. It was shown that the impact of exogenous gibberellic acid on the activity and structure of alpha-amylase is reduced in grain with a low falling number.

  5. A circularly permuted alpha-amylase-type alpha/beta-barrel structure in glucan-synthesizing glucosyltransferases.

    PubMed

    MacGregor, E A; Jespersen, H M; Svensson, B

    1996-01-15

    A motif of amino acid residues, located at the active site and specific beta-strands in alpha-amylases, is recognized in alpha-1,3- and alpha-1,6-glucan-synthesizing glucosyltransferases, leading to the conclusion that these enzymes contain an alpha/beta-barrel closely related to the (beta/alpha)8-fold of the alpha-amylase superfamily. The secondary structure elements of the transferase barrel, however, are circularly permuted to start with an alpha-helix equivalent to helix 3 in the alpha-amylases. Thus, the transferase counterpart of the long third beta-->alpha connection--constituting a domain in the alpha-amylases--is divided to precede and succeed the barrel. This architectural arrangement may be coupled to sucrose scission and glucosyl transfer. The involvement in the mechanism in glucosyltransferases of active site residues recurring in amylolytic enzymes is discussed.

  6. Crystal and molecular structure of barley alpha-amylase.

    PubMed

    Kadziola, A; Abe, J; Svensson, B; Haser, R

    1994-05-27

    The three-dimensional structure of barley malt alpha-amylase (isoform AMY2-2) was determined by multiple isomorphous replacement using three heavy-atom derivatives and solvent flattening. The model was refined using a combination of simulated annealing and conventional restrained least-squares crystallographic refinement to an R-factor of 0.153 based on 18,303 independent reflections with F(o) > sigma(F(o)) between 10 and 2.8 A resolution, with root-mean-square deviations of 0.016 A and 3.3 degrees from ideal bond lengths and bond angles, respectively. The final model consists of 403 amino acid residues, three calcium ions and 153 water molecules. The polypeptide chain folds into three domains: a central domain forming a (beta alpha)8-barrel of 286 residues, with a protruding irregular structured loop domain of 64 residues (domain B) connecting strand beta 3 and helix alpha 3 of the barrel, and a C-terminal domain of 53 residues forming a five stranded anti-parallel beta-sheet. Unlike the previously known alpha-amylase structures, AMY2-2 contains three Ca2+ binding sites co-ordinated by seven or eight oxygen atoms from carboxylate groups, main-chain carbonyl atoms and water molecules, all calcium ions being bound to domain B and therefore essential for the structural integrity of that domain. Two of the Ca2+ sites are located only 7.0 A apart with one Asp residue serving as ligand for both. One Ca2+ site located at about 20 A from the other two was found to be exchangeable with Eu3+. By homology with other alpha-amylases, some important active site residues are identified as Asp179, Glu204 and Asp289, and are situated at the C-terminal end of the central beta-barrel. A starch granule binding site, previously identified as Trp276 and Trp277, is situated on alpha-helix 6 in the central (beta alpha)8-barrel, at the surface of the enzyme. This binding site region is associated with a considerable disruption of the (beta alpha)8-barrel 8-fold symmetry.

  7. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.

    PubMed

    Svensson, B

    1994-05-01

    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  8. alpha-Amylase: an ideal representative of thermostable enzymes.

    PubMed

    Prakash, Om; Jaiswal, Nivedita

    2010-04-01

    The conditions prevailing in the industrial applications in which enzymes are used are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand to improve the stability of enzymes and to meet the requirements set by specific applications. In this respect, thermostable enzymes have been proposed to be industrially relevant. In this review, alpha-amylase, a well-established representative of thermostable enzymes, providing an attractive model for the investigation of the structural basis of thermostability of proteins, has been discussed.

  9. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.

    PubMed

    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S

    2010-04-01

    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing.

  10. Genetic analyses using GGE model and a mixed linear model approach, and stability analyses using AMMI bi-plot for late-maturity alpha-amylase activity in bread wheat genotypes.

    PubMed

    Rasul, Golam; Glover, Karl D; Krishnan, Padmanaban G; Wu, Jixiang; Berzonsky, William A; Fofana, Bourlaye

    2017-03-17

    Low falling number and discounting grain when it is downgraded in class are the consequences of excessive late-maturity α-amylase activity (LMAA) in bread wheat (Triticum aestivum L.). Grain expressing high LMAA produces poorer quality bread products. To effectively breed for low LMAA, it is necessary to understand what genes control it and how they are expressed, particularly when genotypes are grown in different environments. In this study, an International Collection (IC) of 18 spring wheat genotypes and another set of 15 spring wheat cultivars adapted to South Dakota (SD), USA were assessed to characterize the genetic component of LMAA over 5 and 13 environments, respectively. The data were analysed using a GGE model with a mixed linear model approach and stability analysis was presented using an AMMI bi-plot on R software. All estimated variance components and their proportions to the total phenotypic variance were highly significant for both sets of genotypes, which were validated by the AMMI model analysis. Broad-sense heritability for LMAA was higher in SD adapted cultivars (53%) compared to that in IC (49%). Significant genetic effects and stability analyses showed some genotypes, e.g. 'Lancer', 'Chester' and 'LoSprout' from IC, and 'Alsen', 'Traverse' and 'Forefront' from SD cultivars could be used as parents to develop new cultivars expressing low levels of LMAA. Stability analysis using an AMMI bi-plot revealed that 'Chester', 'Lancer' and 'Advance' were the most stable across environments, while in contrast, 'Kinsman', 'Lerma52' and 'Traverse' exhibited the lowest stability for LMAA across environments.

  11. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  12. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  13. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  14. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    PubMed

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants.

  15. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    PubMed Central

    Wan, Cynthia; Couture-Lalande, Marie-Ève; Narain, Tasha A.; Lebel, Sophie; Bielajew, Catherine

    2016-01-01

    The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39) = 17.95, p < 0.001 and F (1, 37) = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes. PMID:27023572

  16. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  17. Structure activity relationships of flavonoids as potent alpha-amylase inhibitors.

    PubMed

    Yuan, Erdong; Liu, Benguo; Wei, Qingyi; Yang, Jiguo; Chen, Lei; Li, Qiong

    2014-08-01

    The effects of three flavonoids (quercetin, luteolin, diosmetin) on alpha-amylase were examined by enzymatic kinetics and fluorescence spectroscopy. The three test flavonoids were non-competitive inhibitors of the enzyme. Addition of flavonoids led to fluorescence quenching of alpha-amylase. The quenching was initiated from the formation of a complex between the flavonoids and the enzyme, corresponding to a static quenching process. An alpha-amylase molecule provides a binding site for the test flavonoid. The main binding force was hydrophobic. The decreasing order of inhibition of alpha-amylase by flavonoids and the binding force was luteolin, diosmetin, and quercetin. It is demonstrated that hydroxylation in ring C and methylation of the hydroxyl group in ring B of flavonoids may weaken the binding affinities to alpha-amylase.

  18. Crystal structure determination and inhibition studies of a novel xylanase and alpha-amylase inhibitor protein (XAIP) from Scadoxus multiflorus.

    PubMed

    Kumar, Sanjit; Singh, Nagendra; Sinha, Mau; Dube, Divya; Singh, S Baskar; Bhushan, Asha; Kaur, Punit; Srinivasan, Alagiri; Sharma, Sujata; Singh, Tej P

    2010-07-01

    A novel plant protein isolated from the underground bulbs of Scadoxus multiflorus, xylanase and alpha-amylase inhibitor protein (XAIP), inhibits two structurally and functionally unrelated enzymes: xylanase and alpha-amylase. The mature protein contains 272 amino acid residues which show sequence identities of 48% to the plant chitinase hevamine and 36% to xylanase inhibitor protein-I, a double-headed inhibitor of GH10 and GH11 xylanases. However, unlike hevamine, it is enzymatically inactive and, unlike xylanase inhibitor protein-I, it inhibits two functionally different classes of enzyme. The crystal structure of XAIP has been determined at 2.0 A resolution and refined to R(cryst) and R(free) factors of 15.2% and 18.6%, respectively. The polypeptide chain of XAIP adopts a modified triosephosphate isomerase barrel fold with eight beta-strands in the inner circle and nine alpha-helices forming the outer ring. The structure contains three cis peptide bonds: Gly33-Phe34, Tyr159-Pro160 and Trp253-Asp254. Although hevamine has a long accessible carbohydrate-binding channel, in XAIP this channel is almost completely filled with the side-chains of residues Phe13, Pro77, Lys78 and Trp253. Solution studies indicate that XAIP inhibits GH11 family xylanases and GH13 family alpha-amylases through two independent binding sites located on opposite surfaces of the protein. Comparison of the structure of XAIP with that of xylanase inhibitor protein-I, and docking studies, suggest that loops alpha3-beta4 and alpha4-beta5 may be involved in the binding of GH11 xylanase, and that helix alpha7 and loop beta6-alpha6 are suitable for the interaction with alpha-amylase.

  19. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  20. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    PubMed

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  1. Ca-binding to Bacillus licheniformis alpha-amylase (BLA).

    PubMed

    Nazmi, Ali Reza; Reinisch, Timm; Hinz, Hans-Jürgen

    2006-09-01

    Ca-induced renaturation of Bacillus licheniformis alpha-amylase in the presence of urea has been employed to determine the binding constants of the ion. The native enzyme is folded at 3M urea while the Ca-depleted protein is largely unfolded at this denaturant concentration. Refolding of the protein has been monitored by circular dichroism and the titration curves have been analyzed assuming a model of three independent binding sites. The stoichiometry has been taken from X-ray studies. The refolded protein exhibits a secondary structure that is similar but not identical to that of the native protein. The binding constants have been used to construct a phase diagram that illustrates the contribution of Ca-binding to the resistance against urea unfolding.

  2. A quantitative assessment of the importance of barley seed alpha-amylase, beta-amylase, debranching enzyme, and alpha-glucosidase in starch degradation.

    PubMed

    Sun, Z T; Henson, C A

    1991-02-01

    Extracts of germinated barley (Hordeum vulgare L.) seeds of 41 different genotypes were analyzed for their activities of alpha-amylase, beta-amylase, alpha-glucosidase, and debranching enzyme and for their abilities to hydrolyze boiled soluble starch, nonboiled soluble starch, and starch granules extracted from barley seeds with water. Linear correlation analysis, used to quantitate the interactions between the seven parameters, revealed that boiled soluble starch was not a good substrate for predicting activities of enzymes functioning in in vivo starch hydrolysis as the extracts' abilities to hydrolyze boiled soluble starch was not correlated with their abilities to hydrolyze native starch granules. Activities of alpha-amylase and alpha-glucosidase were positively and significantly correlated with the seed extracts' abilities to hydrolyze all three starches. beta-Amylase was only significantly correlated with hydrolysis of boiled soluble starch. No significant correlations existed between debranching enzyme activity and hydrolysis of any of the three starches. Interactions between the four enzymes as they functioned together to hydrolyze the three types of starch were evaluated by path coefficient analysis. alpha-Amylase contributed to hydrolyses of all three starches primarily by its direct effect (noninteractive component). This direct contribution increased as the substrate progressed from the completely artificial boiled soluble starch, to the most physiologically significant substrate, native starch granules. alpha-Glucosidase contributed to the hydrolysis of boiled soluble starch primarily by its direct effect (noninteractive) yet contributed to starch granule hydrolysis primarily via its interaction with alpha-amylase (indirect effect). The contribution of beta-amylase to hydrolysis of boiled soluble starch was direct and it did not contribute significantly to hydrolysis of native starch granules.

  3. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    DTIC Science & Technology

    2011-04-01

    Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...stress-related conditions. The findings suggest that measuring salivary α- amylase levels may help to determine a Soldier’s resilience or risk of

  4. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  5. Capillary electrophoresis as a screening tool for alpha amylase inhibitors in plant extracts

    PubMed Central

    Hamdan, Imad I.; Afifi, Fatima U.

    2010-01-01

    Capillary electrophoresis (CE) method was developed for screening plant extract for potential alpha amylase (AA) inhibitory activity. The method was validated against a well established UV method. Overall, the proposed method was shown able to detect plants with significant alpha amylase inhibitory activity but not those with rather clinically insignificant activities. Fifty plant species were screened using both the proposed CE method and the UV method and seven plant species were found to possess significant AA inhibitory activities. Two plant species were proved to have alpha amylase inhibitory activity for the first time. PMID:24115900

  6. Alpha-amylase production is induced by sulfuric acid in rice aleurone cells.

    PubMed

    Mitsunaga, Shin-ichiro; Kobayashi, Midori; Fukui, Satoe; Fukuoka, Kayoko; Kawakami, Osamu; Yamaguchi, Junji; Ohshima, Masahiro; Mitsui, Toshiaki

    2007-12-01

    The hydrolytic enzyme alpha-amylase (EC 3.2.1.1) is produced mainly in aleurone cells of germinating cereals, and the phytohormone gibberellin (GA) is essential for its induction. However, in rice (Oryza sativa L.), sulfuric acid (H(2)SO(4)) induces alpha-amylase production in aleurone tissue even in the absence of GA. Here, the pre-treatment of rice aleurone cells with H(2)SO(4) and incubation in water induced alpha-amylase activity, as if the cells had been incubated in GA solution.

  7. [Study of the effect of Pb2+ on alpha-amylase activity by spectroscopy].

    PubMed

    Hong, Fa-shui

    2003-06-01

    The activity of alpha-amylase from porcine pancreas was enhanced under the treatment by Pb2+ at low concentration (0.5-4 mumol.L-1), but was inhibited by Pb2+ at high concentration (above 4 mumol.L-1). Pb2+ at high concentration could competitively displace Ca2+ from alpha-amylase. The EXAFS demonstrated that Pb2+ was bound to the active site of alpha-amylase, the coordination atom was oxygen, the coordination number was 2, and the Pb-O bond length was 0.234 nm. Circular dichroism spectra showed that the secondary structure of trypsin was greatly changed by Pb2+ at high concentration, as alpha-helix, beta-turn and random coil contents decreased, while beta-sheet, aromatic and disulfide bond contents increased. It was suggested that Pb2+ was bound to result in an alpha-amylase conformational change, and the enzyme activity decreased.

  8. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  9. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  10. Digestive alpha-amylases from Tecia solanivora larvae (Lepidoptera: Gelechiidae): response to pH, temperature and plant amylase inhibitors.

    PubMed

    Valencia-Jiménez, A; Arboleda, J W; López Avila, A; Grossi-de-Sá, M F

    2008-12-01

    The biochemical properties of the digestive alpha-amylase from Tecia solanivora larvae, an important and invasive insect pest of potato (Solanum tuberosum), were studied. This insect has three major digestive alpha-amylases with isoelectric points 5.30, 5.70 and 5.98, respectively, which were separated using native and isoelectric focusing gels. The alpha-amylase activity has an optimum pH between 7.0 and 10.0 with a peak at pH 9.0. The enzymes are stable when heated to 50 degrees C and were inhibited by proteinaceous inhibitors from Phaseolus coccineus (70% inhibition) and P. vulgaris cv. Radical (87% inhibition) at pH 6.0. The inhibitors present in an amaranth hybrid inhibited 80% of the activity at pH 9.0. The results show that the alpha-amylase inhibitor from amaranth seeds may be a better candidate to make genetically-modified potatoes resistant to this insect than inhibitors from common bean seeds.

  11. Adolescents' increasing stress response to social evaluation: pubertal effects on cortisol and alpha-amylase during public speaking.

    PubMed

    van den Bos, Esther; de Rooij, Mark; Miers, Anne C; Bokhorst, Caroline L; Westenberg, P Michiel

    2014-01-01

    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden Public Speaking Task twice, with a 2-year interval (N = 217; age at Time 1: 8-17 years). The results support an increase in sensitivity to social evaluation during adolescence. The overall cortisol and alpha-amylase responses increased-both between and within participants-and were more strongly related to self-reported pubertal development than to age. The cortisol response shifted from speech delivery toward anticipation. The alpha-amylase response increased in both phases.

  12. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  13. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].

    PubMed

    Avdiiuk, K V; Varbanets', L D

    2013-01-01

    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  14. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation

    PubMed Central

    Raul, Dibyangana; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α-amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30–70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques. PMID:24672727

  15. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  16. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.

    PubMed

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  17. Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch

    SciTech Connect

    Fujii, M.; Kawamura, Y.

    1985-03-01

    Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

  18. A functional raw starch-binding domain of barley alpha-amylase expressed in Escherichia coli.

    PubMed

    Tibbot, B K; Wong, D W; Robertson, G H

    2000-11-01

    The mature form of barley seed low-pI alpha-amylase (BAA1) possesses a raw starch-binding site in addition to the catalytic site. A truncated cDNA encoding the C-terminal region (aa 281-414) and containing the proposed raw starch-binding domain (SBD) but lacking Trp278/Trp279, a previously proposed starch granule-binding site, was synthesized via PCR and expressed in Escherichia coli as an N-terminal His-Tag fusion protein. SBD was produced in the form of insoluble inclusion bodies that were extracted with urea and successfully refolded into a soluble form via dialysis. To determine binding, SBD was purified by affinity chromatography with cycloheptaamylose as ligand cross-linked to Sepharose. This work demonstrates that a SBD is located in the C-terminal region and retains sufficient function in the absence of the N-terminal, catalytic, and Trp278/279 regions.

  19. Skin-prick tests for hypersensitivity to alpha-amylase preparations.

    PubMed

    Moneo, I; Alday, E; Sanchez-Agudo, L; Curiel, G; Lucena, R; Calatrava, J M

    1995-06-01

    Twenty-five asthmatic subjects with suspected alpha-amylase hypersensitivity were studied by skin-prick tests, a capture ELISA, immunoblotting and bronchial provocation tests. At the same time, different amylases were analysed by SDS-PAGE and immunoblotting using a polyclonal rabbit antiserum. Eight patients showed a positive bronchial response to amylase. Seven of them had positive skin-prick tests, with this method being the most sensitive approach for diagnosis. However, in four cases, skin tests were also positive although the patients had a negative provocation test, thus demonstrating that skin tests are not specific. ELISA and blotting showed similar results in terms of sensitivity and specificity. The enzymes used by the workers included several antigens besides alpha-amylase. The rabbit antiserum to alpha-amylase detected a protein in a wheat flour extract. In one case, the IgE antibodies were specific only for a contaminant of lower molecular weight than amylase. These facts suggest that proteins from the culture medium could be responsible for some cases of amylase hypersensitivity, making the diagnosis difficult. The presence of amylase in another enzymatic extract, a protease produced by Aspergillus oryzae, was proved by means of skin tests and immunoblotting, thus demonstrating the allergenic properties of this enzymatic preparation.

  20. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  1. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  2. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    PubMed

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  3. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.

    PubMed

    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul

    2009-10-31

    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  4. Characterization of alpha-Amylase from Shoots and Cotyledons of Pea (Pisum sativum L.) Seedlings.

    PubMed

    Beers, E P; Duke, S H

    1990-04-01

    The most abundant alpha-amylase (EC 3.2.1.1) in shoots and cotyledons from pea (Pisum sativum L.) seedlings was purified 6700-and 850-fold, respectively, utilizing affinity (amylose and cycloheptaamylose) and gel filtration chromatography and ultrafiltration. This alpha-amylase contributed at least 79 and 15% of the total amylolytic activity in seedling cotyledons and shoots, respectively. The enzyme was identified as an alpha-amylase by polarimetry, substrate specificity, and end product analyses. The purified alpha-amylases from shoots and cotyledons appear identical. Both are 43.5 kilodalton monomers with pls of 4.5, broad pH activity optima from 5.5 to 6.5, and nearly identical substrate specificities. They produce identical one-dimensional peptide fingerprints following partial proteolysis in the presence of SDS. Calcium is required for activity and thermal stability of this amylase. The enzyme cannot attack maltodextrins with degrees of polymerization below that of maltotetraose, and hydrolysis of intact starch granules was detected only after prolonged incubation. It best utilizes soluble starch as substrate. Glucose and maltose are the major end products of the enzyme with amylose as substrate. This alpha-amylase appears to be secreted, in that it is at least partially localized in the apoplast of shoots. The native enzyme exhibits a high degree of resistance to degradation by proteinase K, trypsin/chymostrypsin, thermolysin, and Staphylococcus aureus V8 protease. It does not appear to be a high-mannose-type glycoprotein. Common cell wall constituents (e.g. beta-glucan) are not substrates of the enzyme. A very low amount of this alpha-amylase appears to be associated with chloroplasts; however, it is unclear whether this activity is contamination or alpha-amylase which is integrally associated with the chloroplast.

  5. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.

    PubMed

    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho

    2002-09-01

    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  6. alpha-Amylase is not required for breakdown of transitory starch in Arabidopsis leaves.

    PubMed

    Yu, Tien-Shin; Zeeman, Samuel C; Thorneycroft, David; Fulton, Daniel C; Dunstan, Hannah; Lue, Wei-Ling; Hegemann, Björn; Tung, Shu-Yun; Umemoto, Takayuki; Chapple, Andrew; Tsai, Der-Long; Wang, Shue-Mei; Smith, Alison M; Chen, Jychian; Smith, Steven M

    2005-03-18

    The Arabidopsis thaliana genome encodes three alpha-amylase-like proteins (AtAMY1, AtAMY2, and AtAMY3). Only AtAMY3 has a predicted N-terminal transit peptide for plastidial localization. AtAMY3 is an unusually large alpha-amylase (93.5 kDa) with the C-terminal half showing similarity to other known alpha-amylases. When expressed in Escherichia coli, both the whole AtAMY3 protein and the C-terminal half alone show alpha-amylase activity. We show that AtAMY3 is localized in chloroplasts. The starch-excess mutant of Arabidopsis sex4, previously shown to have reduced plastidial alpha-amylase activity, is deficient in AtAMY3 protein. Unexpectedly, T-DNA knock-out mutants of AtAMY3 have the same diurnal pattern of transitory starch metabolism as the wild type. These results show that AtAMY3 is not required for transitory starch breakdown and that the starch-excess phenotype of the sex4 mutant is not caused simply by deficiency of AtAMY3 protein. Knock-out mutants in the predicted non-plastidial alpha-amylases AtAMY1 and AtAMY2 were also isolated, and these displayed normal starch breakdown in the dark as expected for extraplastidial amylases. Furthermore, all three AtAMY double knock-out mutant combinations and the triple knock-out degraded their leaf starch normally. We conclude that alpha-amylase is not necessary for transitory starch breakdown in Arabidopsis leaves.

  7. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  8. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  9. Purification and characterization of the extracellular. alpha. -amylase from Clostridium acetobutylicum ATCC 824

    SciTech Connect

    Paquet, V.; Croux, C.; Goma, G.; Soucaille, P. )

    1991-01-01

    The extracellular {alpha}-amylase (1,4-{alpha}-D-glucanglucanohydrolase; EC 3.2.1.1) from Clostridium acetobutylicum ATCC 824 was purified to homogeneity by anion-exchange chromatography (Mono Q) and gel filtration (Superose 12). The enzyme had an isoelectric point of 4.7 and a molecular weight of 84,000, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It was a monomeric protein, the 19-amino-acid N terminus of which displayed 42% homology with the Bacillus subtilis saccharifying {alpha}-amylase. The amino acid composition of the enzyme showed a high number of acidic and hydrophobic residues and only one cysteine residue per mole. The activity of the {alpha}-amylase was not stimulated by calcium ions (or other metal ions) or inhibited by EDTA, although the enzyme contained seven calcium atoms per molecule. {alpha}-Amylase activity on soluble starch was optimal at pH 5.6 and 45{degree}C. The {alpha}-amylase was stable at an acidic pH but very sensitive to thermal inactivation. It hydrolyzed soluble starch, with a K{sub m} of 3.6 g {center dot} liter{sup {minus}1} and a K{sub cat} of 122 mol of reducing sugars {center dot} s{sup {minus}1} {center dot} mol{sup {minus}1}. The {alpha}-amylase showed greater activity with high-molecular-weight substrates than with low-molecular-weight maltooligosaccharides, hydrolyzed glycogen and pullulan slowly, but did not hydrolyze dextran or cyclodextrins. The major end products of maltohexaose degradation were glucose, maltose, and maltotriose; maltotetraose and maltopentaose were formed as intermediate products. Twenty seven percent of the glucoamylase activity generally detected in the culture supernatant of C. acetobutylicum can be attributed to the {alpha}-amylase.

  10. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    PubMed Central

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  11. Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution.

    PubMed

    Strobl, S; Maskos, K; Betz, M; Wiegand, G; Huber, R; Gomis-Rüth, F X; Glockshuber, R

    1998-05-08

    The three-dimensional structure of the alpha-amylase from Tenebrio molitor larvae (TMA) has been determined by molecular replacement techniques using diffraction data of a crystal of space group P212121 (a=51.24 A; b=93.46 A; c=96.95 A). The structure has been refined to a crystallographic R-factor of 17.7% for 58,219 independent reflections in the 7.0 to 1.64 A resolution range, with root-mean-square deviations of 0.008 A for bond lengths and 1.482 degrees for bond angles. The final model comprises all 471 residues of TMA, 261 water molecules, one calcium cation and one chloride anion. The electron density confirms that the N-terminal glutamine residue has undergone a post-transitional modification resulting in a stable 5-oxo-proline residue. The X-ray structure of TMA provides the first three-dimensional model of an insect alpha-amylase. The monomeric enzyme exhibits an elongated shape approximately 75 Ax46 Ax40 A and consists of three distinct domains, in line with models for alpha-amylases from microbial, plant and mammalian origin. However, the structure of TMA reflects in the substrate and inhibitor binding region a remarkable difference from mammalian alpha-amylases: the lack of a highly flexible, glycine-rich loop, which has been proposed to be involved in a "trap-release" mechanism of substrate hydrolysis by mammalian alpha-amylases. The structural differences between alpha-amylases of various origins might explain the specificity of inhibitors directed exclusively against insect alpha-amylases.

  12. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

    PubMed

    Rasiah, Indira A; Rehm, Bernd H A

    2009-04-01

    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  13. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes.

    PubMed

    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir Ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra

    2014-01-01

    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bacillus subtilis (70°C) and Bacillus KSM K38 (55°C) and Eukaryotes i.e. Aspergillus oryzae (60°C) were selected from NCBI. Primary structure composition analysis and Conserved sequence analysis were conducted through Bio Edit tools. Results from BioEdit shown only three conserved regions of base pairs and least similarity in MSA of the above mentioned alpha amylases. In Mega 5.1 Phylogeny of thermo stable alpha amylases of Kingdom Archea, Prokaryotes and Eukaryote was handled by Neighbor-Joining (NJ) algorithm. Mega 5.1 phylogenetic results suggested that alpha amylases of thermo stable organisms i.e. Pyrococcus furiosus (100-105°C), Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C) and Bacillus amyloliquefaciens (72°C) are more distantly related as compared to less thermo stable organisms. By keeping in mind the characteristics of most thermo stable alpha amylases novel and improved features can be introduced in less thermo stable alpha amylases so that they become more thermo tolerant and productive for industry.

  14. Selective inhibition of histidine-modified pancreatic alpha-amylase by proteinaceous inhibitor from Phaseolus vulgaris.

    PubMed

    Nakatani, H

    1988-06-01

    Chemical modification of two histidine residues of porcine pancreatic alpha-amylase (EC 3.2.1.1) by diethyl pyrocarbonate in the presence of a high concentration of maltotriose caused a decrease of amylase activity and an increase of maltosidase activity (hydrolysis of p-nitrophenyl-alpha-maltoside). By binding a proteinaceous inhibitor from Phaseolus vulgaris (white kidney bean) with the modified enzyme, the amylase activity was further decreased but the maltosidase activity was retained to about 100% that of the native enzyme. Both amylase and maltosidase activities of the native enzyme were almost completely inhibited by the proteinaceous inhibitor. The increase of maltosidase activity by histidine modification was due to an increase of kcat, whereas the Km value was not changed; but binding of the proteinous inhibitor affected mainly the Km value of the modified enzyme.

  15. X-ray crystallographic analyses of pig pancreatic alpha-amylase with limit dextrin, oligosaccharide, and alpha-cyclodextrin.

    PubMed

    Larson, Steven B; Day, John S; McPherson, Alexander

    2010-04-13

    Further refinement of the model using maximum likelihood procedures and reevaluation of the native electron density map has shown that crystals of pig pancreatic alpha-amylase, whose structure we reported more than 15 years ago, in fact contain a substantial amount of carbohydrate. The carbohydrate fragments are the products of glycogen digestion carried out as an essential step of the protein's purification procedure. In particular, the substrate-binding cleft contains a limit dextrin of six glucose residues, one of which contains both alpha-(1,4) and alpha-(1,6) linkages to contiguous residues. The disaccharide in the original model, shared between two amylase molecules in the crystal lattice, but also occupying a portion of the substrate-binding cleft, is now seen to be a tetrasaccharide. There are, in addition, several other probable monosaccharide binding sites. Furthermore, we have further reviewed our X-ray diffraction analysis of alpha-amylase complexed with alpha-cyclodextrin. alpha-Amylase binds three cyclodextrin molecules. Glucose residues of two of the rings superimpose upon the limit dextrin and the tetrasaccharide. The limit dextrin superimposes in large part upon linear oligosaccharide inhibitors visualized by other investigators. By comprehensive integration of these complexes we have constructed a model for the binding of polysaccharides having the helical character known to be present in natural substrates such as starch and glycogen.

  16. Action of Bacillus subtilis alpha-amylase on native wheat starch.

    PubMed

    Colonna, P; Buléon, A; Lemarié, F

    1988-06-05

    Native starch granules from wheat have been subjected to enzymatic depolymerization with an alpha-amylase from Bacillus subtilis. Crystallites made from short-chain amylose and residues from mild acid hydrolysis have been also tested. Electron microscopy, particle size analysis, DSC, and x-ray diffractometry reveal that enzymatic degradation occurs granule by granule. Gel permeation chromatography shows off the macromolecular nature of the remaining material. In contrast, acid erodes simultaneously all the granules, leading to a splitting into small particles. Crystalline fractions are completely degraded by alpha-amylase. These results support evidence for an active disentanglement of chains, carried out by the different subsites of alpha-amylase molecules. A simple mathematical treatment is proposed to explain the results of the kinetics.

  17. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  18. Structural characterization of an alpha-amylase inhibitor from a wild common bean (Phaseolus vulgaris): insight into the common structural features of leguminous alpha-amylase inhibitors.

    PubMed

    Nakaguchi, T; Arakawa, T; Philo, J S; Wen, J; Ishimoto, M; Yamaguchi, H

    1997-02-01

    The primary structures of two subunits of an alpha-amylase inhibitor (alpha AI-2) from a wild common bean (Phaseolus vulgaris) were revealed by a comparison of the amino acid sequence previously deduced from the nucleotide sequence with the amino- and carboxyl-terminal amino acid sequences determined by conventional methods. The polypeptide molecular weight of alpha AI-2 obtained by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that alpha AI-2 has the subunit stoichiometry of an alpha 2 beta 2 complex. These structural features were closely similar to those recently elucidated for a white kidney bean (P. vulgaris) alpha-amylase inhibitor, which is quite different in the inhibitory specificity from alpha AI-2. The post-translational processing of the precursor glycoproteins to form the tetrameric structure appeared to require an Arg residue close to the processing site. Further, the proper associations of the subunits into the tetrameric structures seemed to be strictly controlled by a few amino acids on the subunit interfaces.

  19. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the alpha-amylase family.

    PubMed

    Park, K H; Kim, T J; Cheong, T K; Kim, J W; Oh, B H; Svensson, B

    2000-05-23

    Cyclomaltodextrinase (CDase, EC 3.2.1.54), maltogenic amylase (EC 3. 2.1.133), and neopullulanase (EC 3.2.1.135) are reported to be capable of hydrolyzing all or two of the following three types of substrates: cyclomaltodextrins (CDs); pullulan; and starch. These enzymes hydrolyze CDs and starch to maltose and pullulan to panose by cleavage of alpha-1,4 glycosidic bonds whereas alpha-amylases essentially lack activity on CDs and pullulan. They also catalyze transglycosylation of oligosaccharides to the C3-, C4- or C6-hydroxyl groups of various acceptor sugar molecules. The present review surveys the biochemical, enzymatic, and structural properties of three types of such enzymes as defined based on the substrate specificity toward the CDs: type I, cyclomaltodextrinase and maltogenic amylase that hydrolyze CDs much faster than pullulan and starch; type II, Thermoactinomyces vulgaris amylase II (TVA II) that hydrolyzes CDs much less efficiently than pullulan; and type III, neopullulanase that hydrolyzes pullulan efficiently, but remains to be reported to hydrolyze CDs. These three types of enzymes exhibit 40-60% amino acid sequence identity. They occur in the cytoplasm of bacteria and have molecular masses from 62 to 90 kDa which are slightly larger than those of most alpha-amylases. Multiple amino acid sequence alignment and crystal structures of maltogenic amylase and TVA II reveal the presence of an N-terminal extension of approximately 130 residues not found in alpha-amylases. This unique N-terminal domain as seen in the crystal structures apparently contributes to the active site structure leading to the distinct substrate specificity through a dimer formation. In aqueous solution, most of these enzymes show a monomer-dimer equilibrium. The present review discusses the multiple specificity in the light of the oligomerization and the molecular structures arriving at a clarified enzyme classification. Finally, a physiological role of the enzymes is proposed.

  20. Artificial chaperone-assisted refolding of chemically denatured alpha-amylase.

    PubMed

    Yazdanparast, Razieh; Khodagholi, Fariba; Khodarahmi, Reza

    2005-06-01

    It is now well established that alpha-cyclodextrin (alpha-CD) is a valuable folding agent in refolding processes of several denatured enzyme solutions. The refolding of Gu-HCl denatured alpha-amylase in the dilution-additive mode revealed that alpha-CD enhanced the refolding yield by 20-30% depending upon alpha-CD concentration. However, the refolding efficiency of the Gu-HCl denatured alpha-amylase through the artificial chaperone-assisted method indicated that alpha-CD enhanced the activity recovery of denatured alpha-amylase by almost 50% and also increased the reactivation rate constant relative to the unassisted control sample. The higher refolding efficiency should be due to different mechanism played by alpha-CD in this technique. In addition, our data indicated that higher refolding yields are obtained when the residual Gu-HCl concentration is low in the refolding environment and when the capture agent is removed not in a stepwise manner from the protein-detergent complexes in the stripping step of the whole process. Collectively, the results of this investigation expand the range of procedural variations used to refold different denatured proteins through artificial chaperone-assisted method.

  1. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  2. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-03-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch.

  3. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  4. Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

    PubMed

    Attia, M S; Al-Radadi, Najlaa S

    2016-12-15

    A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases.

  5. Production, purification and characterization of an extracellular alpha-amylase enzyme isolated from Aspergillus flavus.

    PubMed

    Abou-Zeid, A M

    1997-01-01

    Filamentous fungi isolated from cereals were screened for their ability to produce alpha-amylase (1,4-alpha-glucan glucanohydrolase, EC 3.2.1.1). A selected strain identified as Aspergillus flavus showed high enzymatic activity. A single extracellular alpha-amylase was purified to homogeneity by a starch adsorption method. The molecular weight (M(r)) of the A. flavus alpha-amylase was approximately 75,000 +/- 3,000 by polyacrylamide gel electrophoresis (PAGE) and that of the subunit was approximately 75,000 +/- 3000 SDS-PAGE. The optimal activity of the purified enzyme was achieved at pH 7.0 and 30 degrees C. K+ ions increased the alpha-amylase activity, but Mg2+ did not greatly affect enzyme activity. Mn2+, Zn2+, Cu2+ and Fe3+ ions strongly inhibited the enzyme activity. The products of hydrolysis of native starch by the A. flavus enzyme were mainly glucose as well as unidentified oligosaccharides.

  6. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  7. Protective mechanism of the Mexican bean weevil against high levels of alpha-amylase inhibitor in the common bean.

    PubMed

    Ishimoto, M; Chrispeels, M J

    1996-06-01

    Alpha-amylase inhibitor (alpha AI) protects seeds of the common bean (Phaseolus vulgaris) against predation by certain species of bruchids such as the cowpea weevil (Callosobruchus maculatus) and the azuki bean weevil (Callosobruchus chinensis), but not against predation by the bean weevil (Acanthoscelides obtectus) or the Mexican bean weevil (Zabrotes subfasciatus), insects that are common in the Americas. We characterized the interaction of alpha AI-1 present in seeds of the common bean, of a different isoform, alpha AI-2, present in seeds of wild common bean accessions, and of two homologs, alpha AI-Pa present in seeds of the tepary bean (Phaseolus acutifolius) and alpha AI-Pc in seeds of the scarlet runner bean (Phaseolus coccineus), with the midgut extracts of several bruchids. The extract of the Z. subfasciatus larvae rapidly digests and inactivates alpha AI-1 and alpha AI-Pc, but not alpha AI-2 or alpha AI-Pa. The digestion is caused by a serine protease. A single proteolytic cleavage in the beta subunit of alpha AI-1 occurs at the active site of the protein. When degradation is prevented, alpha AI-1 and alpha AI-Pc do not inhibit the alpha-amylase of Z. subfasciatus, although they are effective against the alpha-amylase of C. chinensis. Alpha AI-2 and alpha AI-Pa, on the other hand, do inhibit the alpha-amylase of Z. subfasciatus, suggesting that they are good candidates for genetic engineering to achieve resistance to Z. subfasciatus.

  8. Validation of an assay for quantification of alpha-amylase in saliva of sheep

    PubMed Central

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-01-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  9. Validation of an assay for quantification of alpha-amylase in saliva of sheep.

    PubMed

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-07-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep.

  10. Optimization of Alpha-Amylase Application in U.S. Factories

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  11. The noncatalytic triad of alpha-amylases: a novel structural motif involved in conformational stability.

    PubMed

    Marx, Jean-Claude; Poncin, Johan; Simorre, Jean-Pierre; Ramteke, Pramod W; Feller, Georges

    2008-02-01

    Chloride-activated alpha-amylases contain a noncatalytic triad, independent of the glycosidic active site, perfectly mimicking the catalytic triad of serine-proteases and of other active serine hydrolytic enzymes. Mutagenesis of Glu, His, and Ser residues in various alpha-amylases shows that this pattern is a structural determinant of the enzyme conformation that cannot be altered without losing the intrinsic stability of the protein. (1)H-(15)N NMR spectra of a bacterial alpha-amylase reveal proton signals that are identical with the NMR signature of catalytic triads and especially a deshielded proton involving a protonated histidine and displaying properties similar to that of a low barrier hydrogen bond. It is proposed that the H-bond between His and Glu of the noncatalytic triad is an unusually strong interaction, responsible for the observed NMR signal and for the weak stability of the triad mutants. Furthermore, a stringent template-based search of the Protein Data Bank demonstrated that this motif is not restricted to alpha-amylases, but is also found in 80 structures from 33 different proteins, amongst which SH2 domain-containing proteins are the best representatives.

  12. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  13. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  14. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    ERIC Educational Resources Information Center

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2010-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  15. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    PubMed

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing.

  16. Structure of Bacillus amyloliquefaciens alpha-amylase at high resolution: implications for thermal stability.

    PubMed

    Alikhajeh, Jahan; Khajeh, Khosro; Ranjbar, Bijan; Naderi-Manesh, Hossein; Lin, Yi Hung; Liu, Enhung; Guan, Hong Hsiang; Hsieh, Yin Cheng; Chuankhayan, Phimonphan; Huang, Yen Chieh; Jeyaraman, Jeyakanthan; Liu, Ming Yih; Chen, Chun Jung

    2010-02-01

    The crystal structure of Bacillus amyloliquefaciens alpha-amylase (BAA) at 1.4 A resolution revealed ambiguities in the thermal adaptation of homologous proteins in this family. The final model of BAA is composed of two molecules in a back-to-back orientation, which is likely to be a consequence of crystal packing. Despite a high degree of identity, comparison of the structure of BAA with those of other liquefying-type alpha-amylases indicated moderate discrepancies at the secondary-structural level. Moreover, a domain-displacement survey using anisotropic B-factor and domain-motion analyses implied a significant contribution of domain B to the total flexibility of BAA, while visual inspection of the structure superimposed with that of B. licheniformis alpha-amylase (BLA) indicated higher flexibility of the latter in the central domain A. Therefore, it is suggested that domain B may play an important role in liquefying alpha-amylases, as its rigidity offers a substantial improvement in thermostability in BLA compared with BAA.

  17. [Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars].

    PubMed

    Netsvetaev, V P; Badaeva, E D

    2014-07-01

    The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in Tris-glycine (pH 8.3) system in wheat cultivars with different genome composition. We show that durum wheat (Triticum durum, 2n=4x=28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in common wheat zymograms (Triticum aestivum, 2n=6x=42, BBAADD). A similar pattern is observed in a synthetic allohexaploid carrying the BBAA genomes of wheat and the HchHch genome of barley (Hordeum chilense). Our method of electrophoresis fails to reveal additional variants of alpha-amylase encoded by the barley genome, although C-banding analysis confirms the genomic structure BBAAHChHCh of this allopolyploid. The electrophoretic spectrum of the spring common wheat cultivar Dobrynya with the wheat-Agropyron translocation 7DL-7AiL contains all of the alpha-amylase isoenzymes typical for common wheat (2n=6x=42, BBAADD) except for the zymotype encoded by the long arm of chromosome 7D. This observation confirms the results of cytogenetic analysis that identified a 7DL-7AiL translocation in this cultivar. No additional alpha-amylase isoenzymes encoded by Agropyron chromosome have been observed. Our data indicate that analysis of wheat-alien hybrids or introgressive forms should be carried out using a complex of different methods.

  18. Beta-thiomaltosides as active site probes for alpha-amylase.

    PubMed

    Stankiewicz, P J; Cascio, D; McPherson, A

    1983-12-01

    A series of substituted 1-thio-beta-D-maltopyranosides was synthesized and confirmed by elemental analysis, optical rotation, NMR, and liquid chromatography. These compounds were shown by several biochemical techniques to bind to the active site of alpha-amylase. Steady-state kinetic studies showed the compounds to be competitive inhibitors, with affinities lying within the range of the natural ligands, maltose and maltotriose. Affinity chromatography employing p-aminophenyl-1-thio-beta-D-maltopyranoside linked to Sepharose provides a relatively simple procedure for alpha-amylase purification. The binding of p-bromphenyl-1-thio-beta-D-maltoside was observed in crystals of alpha-amylase using X-ray crystallography, and through the use of difference Fourier analysis its interaction at 5.0-A resolution with the active site of the enzyme has been visualized. The inhibitor binds in a long, deep cleft that divides the two major domains of the enzyme. These studies are believed to provide a first step toward the rational design of ligands for the physiological regulation of starch breakdown and utilization through modulation of alpha-amylase activity.

  19. Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine

    SciTech Connect

    Zhang, Q.; Tsukagoshi, N.; Miyashiro, S.; Udaka, S.

    1983-07-01

    The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth. Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. (Refs. 10).

  20. ALPHA-AMYLASE ACTIVITY IN VARIOUS CONCENTRATIONS OF THE IONIC LIQUID, 1-BUTYL-3-METHYLIMIDAZOLIUM CHLORIDE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  1. Affinity labeling of soybean beta-amylase with 2',3'-epoxypropyl alpha-D-glucopyranoside.

    PubMed

    Isoda, Y; Nitta, Y

    1986-06-01

    The synthesized 2',3'-epoxypropyl alpha-D-glucopyranoside (alpha-EPG) inactivated soybean beta-amylase completely. The incorporation of alpha-EPG into the enzyme at 92% inactivation was 1.1 mol per mol of enzyme, as determined by using 14C-labeled alpha-EPG. The inactivation obeyed saturation kinetics of a two-step mechanism. The dissociation constant of alpha-EPG-enzyme complex and the rate constant of the irreversible inactivation step were estimated to be 119 mM and 1.14 X 10(-3)s-1, respectively. alpha-Cyclodextrin, a competitive inhibitor of this enzyme, protected the enzyme against the inactivation by alpha-EPG in a competitive manner. This suggests that alpha-EPG binds to the active site of the enzyme. The above results indicate that alpha-EPG acts on soybean beta-amylase as an affinity labeling reagent. It was also shown that an essential SH group near the active site, but not the catalytic one, scarcely participated in the inactivation by alpha-EPG.

  2. Thermodynamic stability of a cold-active alpha-amylase from the Antarctic bacterium Alteromonas haloplanctis.

    PubMed

    Feller, G; d'Amico, D; Gerday, C

    1999-04-06

    The thermal stability of the cold-active alpha-amylase (AHA) secreted by the Antarctic bacterium Alteromonas haloplanctis has been investigated by intrinsic fluorescence, circular dichroism, and differential scanning calorimetry. It was found that this heat-labile enzyme is the largest known multidomain protein exhibiting a reversible two-state unfolding, as demonstrated by the recovery of DeltaHcal values after consecutive calorimetric transitions, a DeltaHcal/DeltaHeff ratio close to unity, and the independence of unfolding thermodynamic parameters of scan rates. By contrast, the mesophilic alpha-amylases investigated here (from porcine pancreas, human salivary glands, yellow meal beetle, Bacillus amyloliquefaciens, and Bacillus licheniformis) unfold irreversibly according to a non-two-state mechanism. Unlike mesophilic alpha-amylases, the melting point of AHA is independent of calcium and chloride binding while the allosteric and structural functions of these ions are conserved. The thermostability of AHA at optimal conditions is characterized by a Tm of 43.7 degrees C, a DeltaHcal of 238 kcal mol-1, and a DeltaCp of 8.47 kcal mol-1 K-1. These values were used to calculate the Gibbs free energy of unfolding over a wide range of temperatures. This stability curve shows that (a) the specific DeltaGmax of AHA [22 cal (mol of residue)-1] is 4 times lower than that of mesophilic alpha-amylases, (b) group hydration plays a crucial role in the enzyme flexibility at low temperatures, (c) the temperature of cold unfolding closely corresponds to the lower limit of bacterial growth, and (d) the recombinant heat-labile enzyme can be expressed in mesophilic hosts at moderate temperatures. It is also argued that the cold-active alpha-amylase has evolved toward the lowest possible conformational stability of its native state.

  3. Complete sequence, subunit structure, and complexes with pancreatic alpha-amylase of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Kasahara, K; Hayashi, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    1996-07-01

    The complete amino acid sequence of a white kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor (PHA-I), which is composed of two kinds of glycopolypeptide subunits, alpha and beta, was established by conventional methods. The polypeptide molecular weight of PHA-I determined by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that PHA-I has the subunit stoichiometry of (alpha beta)2 complex. Inhibition test of PHA-I with increasing amounts of porcine pancreatic alpha-amylase (PPA) suggested that an inactive 2:1 complex is formed between PPA and PHA-I. In fact, two complexes differing from each other in the molar ratio of PPA to PHA-I were separated by gel filtration, and molecular weight estimation by the light-scattering technique confirmed that they are complexes of PHA-I with one or two PPA molecules. The binding of PPA to PHA-I appeared to follow simple binomial statistics, suggesting that two binding sites on PHA-I are independent and of high affinity for PPA.

  4. Concurrent attenuated reactivity of alpha-amylase and cortisol is related to disruptive behavior in male adolescents.

    PubMed

    de Vries-Bouw, Marjan; Jansen, Lucres; Vermeiren, Robert; Doreleijers, Theo; van de Ven, Peter; Popma, Arne

    2012-06-01

    Attenuated reactivity of salivary alpha-amylase has been proposed as a specific sympathetic marker of disruptive behavior in juveniles and may have additional value to studying other autonomic parameters and hypothalamic-pituitary-adrenal axis activity. Investigating the interrelationships between neurobiological parameters in relation to juvenile disruptive behavior may enhance insight into the complex mechanisms at play. We investigated salivary alpha-amylase, cortisol, heart rate (HR), and heart rate variability (HRV) in response to a standardized public speaking task, and examined interactions between these parameters in relation to disruptive behavior. Participants were 48 delinquent male adolescents (mean age 18.4 years, SD 0.9), with and without a disruptive behavior disorder (resp. DP+, DP-) and 16 matched normal controls (NC). A structured psychiatric interview as well as the Youth Self Report and Child Behavior Checklist were administered to assess disruptive behavior. Alpha-amylase and cortisol reactivity, but not HR or HRV, showed significant inverse associations with dimensional measures of disruptive behavior. Moreover, both cortisol and alpha-amylase reactivity were significantly lower in the DP+ group as compared to the NC group. The mentioned relationships remained present when nicotine use was entered as a covariate. Combining alpha-amylase and cortisol in one model explained a larger part of the variance of disruptive behavior than either single parameter. There were no interactions between alpha-amylase and cortisol or HRV in relation to disruptive behavior. Attenuated alpha-amylase responsivity to stress is a correlate of disruptive behavior in late-adolescent males. Although nicotine use explains a considerable part of the variance of disruptive behavior, both alpha-amylase and cortisol are related to disruptive behavior, over and above the effect of nicotine use. Combining alpha-amylase and cortisol improved insight into neurobiological

  5. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    PubMed

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  6. [Alpha-amylase as an occupational allergen in baking industry employees].

    PubMed

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Structure and sequence based analysis of alpha-amylase evolution.

    PubMed

    Singh, Swati; Guruprasad, Lalitha

    2014-01-01

    α-Amylases hydrolyze α- 1,4-glycosidic bonds during assimilation of biological macromolecules. The amino acid sequences of these enzymes in thousands of diverse organisms are known and the 3D structures of several proteins have been solved. The 3D structure analysis of these universal enzymes from diverse organisms has been studied by the generation of phylogenetic trees and structure based sequence analysis to generate a metric for the degree of conservation that is responsible for individual speciation. Greater similarities are observed between reference NCBI tree and structure based phylogenetic tree compared to sequence based phylogenetic tree indicating that structures truly represent the functional aspects of proteins than from the sequence information alone. We report differences in the profile specific conserved and insertion/deletion regions, factors responsible for the Ca(2+) and Cl(-) ion binding and the disulfide connectivity pattern that discriminate the enzymes over evolution.

  8. Molecular structure of a barley alpha-amylase-inhibitor complex: implications for starch binding and catalysis.

    PubMed

    Kadziola, A; Søgaard, M; Svensson, B; Haser, R

    1998-04-24

    alpha-Amylases are widely occurring, multidomain proteins with a catalytic (beta/alpha)8-barrel. In barley alpha-amylase, insight into the catalytic mechanism is gained from the X-ray crystal structure of its molecular complex with acarbose, a pseudotetrasaccharide that acts like a transition-state analogue and which is shown to bind at two specific regions of the enzyme. The structure of the complex has been refined to an R-factor of 15.1% for all observations with Fo>sigma(Fo) between 10 and 2.8 A resolution. A difference Fourier map produced after refinement of the native structure against the data of the acarbose complex clearly revealed density corresponding to two oligosaccharide-binding sites. One of these is defined as the surface-located starch granule-binding site characteristic of cereal alpha-amylases. It involves stacking of two acarbose rings on Trp276 and Trp277. The other binding region is the active site covering subsites -1, +1 and +2. Here, Glu204 is positioned to act in general acid/base catalysis protonating the glucosidic oxygen atom assisted by Asp289. A water molecule that bridges Glu204 and Asp289 is found at the entrance cavity containing a total of five water molecules. This water molecule is proposed to reprotonate Glu204 and supply the hydroxyl ion for nucleophilic attack on the glucosyl C1 atom. Asp 179 acts as the nucleophile that can bind covalently to the substrate intermediate after bond cleavage. The present complex structure together with the conservation of active-site residues among alpha-amylases and related enzymes, are consistent with a common catalytic mechanism for this class of retaining carbohydrases.

  9. Dual feeding strategy for the production of alpha-amylase by Bacillus caldolyticus using complex media.

    PubMed

    Schwab, Karima; Bader, Johannes; Brokamp, Christian; Popović, Milan K; Bajpai, Rakesh; Berovic, Marin

    2009-10-01

    In this study, the objective was to investigate an exponential feeding strategy for fed-batch production of thermostable alpha-amylase (E.C. 3.2.1.1.) from the Bacillus caldolyticus (DSM405). The parameters for establishing compositions of feed media and feeding rate were obtained by statistical analysis of batch and continuous shake flask experiments. These parameters were casitone to starch ratio of 2.67g(casitone)g(starch)(-1), maintenance coefficient 0.174g(casitone)g(DW)(-1)h(-1), cell yield 0.62g(DW)g(casitone)(-1) and mu(opt)=0.2h(-1). The exponentially fed fermentation resulted in yield of 120Uml(-1) alpha-amylase that was thermostable up to 105 degrees C. Results of the exponentially fed fermentation have been discussed in the light of a feed-back controlled fed-batch fermentation reported earlier by the authors. A comparison of the temperature and pH effects on amylase produced by B. caldolyticus and on several other commercially available amylases has also been presented.

  10. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  11. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  12. Diurnal profiles of salivary cortisol and alpha-amylase change across the adult lifespan: evidence from repeated daily life assessments.

    PubMed

    Nater, Urs M; Hoppmann, Christiane A; Scott, Stacey B

    2013-12-01

    Salivary cortisol and alpha-amylase are known to have distinctive diurnal profiles. However, little is known about systematic changes in these biomarkers across the adult lifespan. In a study of 185 participants (aged 20-81 years), time-stamped salivary cortisol and alpha-amylase were collected 7 times/day over 10 days. Samples were taken upon waking, 30 min later, and then approximately every 3 h until 9 pm. Multilevel models showed that older age was associated with increased daily cortisol secretion as indicated by greater area under the curve, attenuated wake-evening slopes, and more pronounced cortisol awakening responses. Further, older age was related to greater daily alpha-amylase output and attenuated wake-evening slopes. No age differences were observed regarding the alpha-amylase awakening response. Our findings may contribute to a better understanding of age-related differences in functioning of stress-related systems.

  13. Production and characterization of a thermostable alpha-amylase from Nocardiopsis sp. endophyte of yam bean.

    PubMed

    Stamford, T L; Stamford, N P; Coelho, L C; Araújo, J M

    2001-01-01

    Thermostable amylolytic enzymes have been currently investigated to improve industrial processes of starch degradation. Studies on production of alpha-amylase by Nocardiopsis sp., an endophytic actinomycete isolated from yam bean (Pachyrhizus erosus L. Urban), showed that higher enzyme levels were obtained at the end of the logarithmic growth phase after incubation for 72 h at pH 8.6. Maximum activity of alpha-amylase was obtained at pH 5.0 and 70 degrees C. The isolated enzyme exhibited thermostable properties as indicated by retention of 100% of residual activity at 70 degrees C, and 50% of residual activity at 90 degrees C for 10 min. Extracellular enzyme from Nocardiopsis sp. was purified by fractional precipitation with ammonium sulphate. After 60% saturation produced 1130 U mg-1 protein and yield was 28% with purification 2.7-fold. The enzyme produced by Nocardiopsis sp. has potential for industrial applications.

  14. Three alpha-amylases from malted finger millet (Ragi, Eleusine coracana, Indaf-15)--purification and partial characterization.

    PubMed

    Nirmala, M; Muralikrishna, G

    2003-01-01

    Three alpha-amylases (E.C. 3.2.1.1) were purified to apparent homogeneity from 72 h finger millet malt by three step purification via fractional acetone precipitation, DEAE-Sephacel ion exchange and Sephacryl S-200 gel permeation chromatographies with a recovery of 6.5, 2.9, 9.6% and fold purification of 26, 17 and 31, respectively. alpha-Nature of these amylases was identified by their ability to rapidly reduce the viscosity of starch solution and also in liberating oligosaccharides of higher D.P. and were accordingly designated as amylases alpha-1((b)), alpha-2 and alpha-3, respectively. These amylases, having a molecular weight of 45+/-2 kDa were found to be monomeric. The pH and temperature optima of these alpha-amylases were found to be in the range of 5.0-5.5 and 45-50 degrees C, respectively. K(m) values of these amylases for various cereal starches varied between 0.59 and 1.43%. Carbodiimide (50 mM) and metal ions such as Al(3+), Fe(2+), and Hg(2+) (5 mM) have completely inhibited these enzymes at 45 degrees C. Amino acid analysis of these enzymes indicated high amounts of glycine which is an unusual feature of these enzymes.

  15. Alpha-amylase from mung beans (Vigna radiata)--correlation of biochemical properties and tertiary structure by homology modelling.

    PubMed

    Tripathi, Pallavi; Lo Leggio, Leila; Mansfeld, Johanna; Ulbrich-Hofmann, Renate; Kayastha, Arvind M

    2007-06-01

    Alpha-amylase from germinated mung beans (Vigna radiata) has been purified 600-fold to electrophoretic homogeneity and a final specific activity of 437 U/mg. SDS-PAGE of the final preparation revealed a single protein band of 46 kDa. The optimum pH was 5.6. The energy of activation was determined to be 7.03 kcal/mol in the temperature range 15-55 degrees C. Km for starch was 1.6 mg/mL in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 70 degrees C showed first-order kinetics with rate constant (k) equal to 0.005 min(-1). Mung bean alpha-amylase showed high specificity for its primary substrate starch. Addition of EDTA (10 mM) caused irreversible loss of activity. Mung bean alpha-amylase is inhibited in a non-competitive manner by heavy metal ions, for example, mercury with a Ki of 110 microM. Homology modelling studies with mung bean alpha-amylase using barley alpha-amylases Amy 1 and Amy 2 as templates showed a very similar structure as expected from the high sequence identity. The model showed that alpha-amylase from mung beans has no sugar-binding site, instead it has a methionine. Furthermore, instead of two tryptophans, it has Val(277) and Lys(278), which are the conserved residues, important for proper folding and conformational stability.

  16. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  17. Production and properties of alpha-amylase from Penicillium chrysogenum and its application in starch hydrolysis.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2005-01-01

    Fungi were screened for their ability to produce alpha-amylase by a plate culture method. Penicillium chrysogenum showed high enzymatic activity. Alpha-amylase production by P. chrysogenum cultivated in liquid media containing maltose (2%) reached its maximum at 6-8 days, at 30 degrees C, with a level of 155 U ml(-1). Some general properties of the enzyme were investigated. The optimum reaction pH and temperature were 5.0 and 30-40 degrees C, respectively. The enzyme was stable at a pH range from 5.0-6.0 and at 30 degrees C for 20 min and the enzyme's 92.1% activity's was retained at 40 degrees C for 20 min without substrate. Hydrolysis products of the enzyme were maltose, unidefined oligosaccharides, and a trace amount of glucose. Alpha-amylase of P. chrysogenum hydrolysed starches from different sources. The best hydrolysis was determined (98.69%) in soluble starch for 15 minute at 30 degrees C.

  18. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112].

    PubMed

    Mariani, D D; Lorda, G; Balatti, A P

    2000-01-01

    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  19. Study of serum lipase, alpha-amylase and pancreatic amylose in gall-stone diseases.

    PubMed

    Bera, Swati; Bhattacharyya, Swati; Ghose, Bikash C; Bera, Tapas; Mukhopadhyay, Surajit K; Saha, Mita

    2011-09-01

    Silent gall-stone causes significant morbidity and mortality and its incidence in India as well as in whole world is on the rise. It has positive correlation with development of carcinoma gall bladder. So far no predictive study has been done to show its correlation with biochemical markers. The present study has been aimed to establish whether simple enzymatic markers can predict association with cholelithiasis. Study group has been selected from the patients attending general surgery OPD of a tertiary healthcare centre with complaints of vague abdominal pain, flatulence and dyspepsia. A total of 61 cases (male = 18, female = 43) were studied and data matched with age and sex matched control. The biochemical markers studied are serum alkaline phosphatase, serum lipase, serum alpha-amylase and serum pancreatic amylase. Patients with obstructive cholelithiasis, duct stones, pancreatic insufficiency and malignancy are excluded from the study. The results were analysed by Student's t-test. Alkaline phosphatase in all the above mentioned cases was not significantly different from the control group (40 female, 21 male healthy individuals). A significant association was found out with serum alpha-amylase (p < 0.05) and a highly significant association was found out with pancreatic amylase (p < 0.001). Results of serum lipase however were inconclusive (p = 0.1). Pancreatic amylase can be estimated at a reasonable cost and costwise may prove to be a marker of gall-stone diseases which are in many cases silent preventing further complications and chances of Malignancy especially where alkaline phosphatase isinconclusive.

  20. Development and validation of a monoclonal based immunoassay for the measurement of fungal alpha-amylase: focus on peak exposures.

    PubMed

    Elms, J; Denniss, S; Smith, M; Evans, P G; Wiley, K; Griffin, P; Curran, A D

    2001-03-01

    The inhalation of flour dust has been implicated in the induction of sensitisation and elicitation of respiratory symptoms, such as asthma in bakers. In addition to the cereal allergens present in wheat flour, enzymes in flour improvers, in particular fungal alpha-amylase, are now known to be a significant cause of respiratory allergy in the baking industry.A monoclonal antibody based enzyme-linked immunoassay (ELISA) was developed using two monoclonal antibodies that recognised two distinct epitopes of the fungal alpha-amylase enzyme. The ELISA had an inter-assay variation of 12.0% at 1360 pg/ml and 12.8% at 564 pg/ml and intra-assay variation of 4.9% at 1340 pg/ml and 6.1% at 504 pg/ml. The assay had a sensitivity of 200 pg/ml. Competitive inhibition assays confirmed that the monoclonal antibodies had no cross reactivity with other enzymes used in the baking industry and could distinguish added fungal alpha-amylase from cereal amylase. We assessed the levels of exposure to dust, total protein and fungal alpha-amylase in four UK bakeries ranging in size and technical capabilities. Within the bakeries we surveyed, workers were exposed to variable levels of inhalable dust (0.8-39.8 mg/m3), total protein (0-5.7 mg/m3) and fungal alpha-amylase (0-29.8 ng/m3). Consecutive 15 min personal samples taken over a 1 h period demonstrated that the ELISA could measure fungal alpha-amylase exposure in such a 15 min period. Short term peak exposures to fungal alpha-amylase could be identified which may contribute to the sensitisation in individuals who appear to have low exposure levels if measured over a full shift period.

  1. Interaction of europium and curium with alpha-amylase.

    PubMed

    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert

    2016-06-07

    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  2. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  3. Purification by expanded bed adsorption and characterization of an alpha-amylases FORILASE NTL from A. niger.

    PubMed

    Toledo, A L; Severo, J B; Souza, R R; Campos, E S; Santana, J C C; Tambourgi, E B

    2007-02-01

    In this work the purification and biochemistry characterization of alpha-amylases from Aspergillus niger (FORILASE NTL) were studied. The effects of expansion degree of resin bed on enzyme purification by expanded bed adsorption (EBA) have also been studied. Residence time distributions (RTD) studies were done to achieve the optimal conditions of the amylases recovery on ion-exchange resin, and glucose solution was used as a new tracer. Results showed that height equivalent of the theoretical plates (HETP), axial dispersion and the Prandt number increased with bed height, bed voidage and linear velocity. The adsorption capacity of alpha-amylases, on the resin, increased with bed height and the best condition was at four-expansion degree. alpha-Amylase characterization showed that this enzyme has high affinity with soluble starch, good hydrolysis potential and molecular weight of 116 kDa.

  4. Solution structure of the main alpha-amylase inhibitor from amaranth seeds.

    PubMed

    Martins, J C; Enassar, M; Willem, R; Wieruzeski, J M; Lippens, G; Wodak, S J

    2001-04-01

    The most abundant alpha-amylase inhibitor (AAI) present in the seeds of Amaranthus hypochondriacus, a variety of the Mexican crop plant amaranth, is the smallest polypeptide (32 residues) known to inhibit alpha-amylase activity of insect larvae while leaving that of mammals unaffected. In solution, 1H NMR reveals that AAI isolated from amaranth seeds adopts a major trans (70%) and minor cis (30%) conformation, resulting from slow cis-trans isomerization of the Val15-Pro16 peptide bond. Both solution structures have been determined using 2D 1H-NMR spectroscopy and XPLOR followed by restrained energy refinement in the consistent-valence force field. For the major isomer, a total of 563 distance restraints, including 55 medium-range and 173 long-range ones, were available from the NOESY spectra. This rather large number of constraints from a protein of such a small size results from a compact fold, imposed through three disulfide bridges arranged in a cysteine-knot motif. The structure of the minor cis isomer has also been determined using a smaller constraint set. It reveals a different backbone conformation in the Pro10-Pro20 segment, while preserving the overall global fold. The energy-refined ensemble of the major isomer, consisting of 20 low-energy conformers with an average backbone rmsd of 0.29 +/- 0.19 A and no violations larger than 0.4 A, represents a considerable improvement in precision over a previously reported and independently performed calculation on AAI obtained through solid-phase synthesis, which was determined with only half the number of medium-range and long-range restraints reported here, and featured the trans isomer only. The resulting differences in ensemble precision have been quantified locally and globally, indicating that, for regions of the backbone and a good fraction of the side chains, the conformation is better defined in the new solution structure. Structural comparison of the solution structure with the X-ray structure of the

  5. Chewing bread: impact on alpha-amylase secretion and oral digestion.

    PubMed

    Joubert, Marianne; Septier, Chantal; Brignot, Hélène; Salles, Christian; Panouillé, Maud; Feron, Gilles; Tournier, Carole

    2017-02-22

    During chewing, saliva helps in preparing the food bolus by agglomerating the formed particles, and it initiates enzymatic food breakdown. However, limited information is actually available on the adaptation of saliva composition during the oral processing of complex foods, especially for foods that are sensitive to salivary enzymes. We addressed this question in the context of starch-based products and salivary alpha-amylase. The objectives were two-fold: (1) to determine if salivary alpha-amylase secretion can be modulated by the bread type and (2) to evaluate the contribution of the oral phase in bread enzymatic breakdown. Mouthfuls of three different wheat breads (industrial, artisan and whole-meal breads) were chewed by twelve subjects. Saliva samples were collected at rest and at different times corresponding to 33, 66 and 100% of the individual's chewing sequence. Alpha-amylase activity and total protein content were determined for all saliva samples that were collected. Additionally, the salivary maltose concentration was measured as a marker of bread enzymatic digestion. Boluses were collected at the swallowing time to evaluate the saliva uptake. Chewing industrial bread induced higher saliva uptake than the other breads despite a similar chewing duration. The evolution of salivary amylase activity tended to depend on the type of bread and was highly influenced by a large degree of inter- and intra-subject variability. The protein and maltose concentration steadily increased during chewing as a result of bread breakdown. The salivary protein concentration was mainly affected by the release of the water-soluble proteins of the bread. The salivary maltose concentration was found to be significantly lower for the whole-meal bread. When considering the weight of the mouthful, enzymatic breakdown was found to be most efficient for the breads ranking from industrial > artisan > whole-meal.

  6. Interaction of wheat monomeric and dimeric protein inhibitors with alpha-amylase from yellow mealworm (Tenebrio molitor L. larva).

    PubMed

    Buonocore, V; Gramenzi, F; Pace, W; Petrucci, T; Poerio, E; Silano, V

    1980-06-01

    The highly purified alpha-amylase from Tenebrio molitor L. larva (yellow mealworm) reversibly combines with two closely related homogeneous glycoprotein inhibitors, one dimeric (termed 'inhibitor 0.19') and one monomeric (termed 'inhibitor 0.28'), from wheat flour. As established by means of difference spectroscopy and kinetic studies, molar combining ratios for the amylase--inhibitor-0.19 and amylase-inhibitor-0.28 complexes were 1:1 and 1:2 respectively. Two amylase--inhibitor-0.19 complexes with slightly different retention volumes on Bio-Gel P-300 and only one amylase--inhibitor-0.28 complex were observed. Dissociation constants of the amylase--inhibitor-0.19 and amylase--inhibitor-0.28 complexes were 0.85 nM and 0.13 nM respectively. A strong tendency of both complexes to precipitate under an ultracentrifugal field was observed; the minimum molecular weight calculated for the two complexes under such conditions was approx. 95 000. The two complexes showed difference spectra indicating involvement of structurally related or identical tryptophyl side chains in the binding of inhibitors 0.28 and 0.19 to the amylase. A model summarizing the main features of the inhibition of the insect amylase by the two wheat protein inhibitors is proposed.

  7. Properties and applications of starch-converting enzymes of the alpha-amylase family.

    PubMed

    van der Maarel, Marc J E C; van der Veen, Bart; Uitdehaag, Joost C M; Leemhuis, Hans; Dijkhuizen, L

    2002-03-28

    Starch is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. A large-scale starch processing industry has emerged in the last century. In the past decades, we have seen a shift from the acid hydrolysis of starch to the use of starch-converting enzymes in the production of maltodextrin, modified starches, or glucose and fructose syrups. Currently, these enzymes comprise about 30% of the world's enzyme production. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-staling agents in baking. A number of these starch-converting enzymes belong to a single family: the alpha-amylase family or family13 glycosyl hydrolases. This group of enzymes share a number of common characteristics such as a (beta/alpha)(8) barrel structure, the hydrolysis or formation of glycosidic bonds in the alpha conformation, and a number of conserved amino acid residues in the active site. As many as 21 different reaction and product specificities are found in this family. Currently, 25 three-dimensional (3D) structures of a few members of the alpha-amylase family have been determined using protein crystallization and X-ray crystallography. These data in combination with site-directed mutagenesis studies have helped to better understand the interactions between the substrate or product molecule and the different amino acids found in and around the active site. This review illustrates the reaction and product diversity found within the alpha-amylase family, the mechanistic principles deduced from structure-function relationship structures, and the use of the enzymes of this family in industrial applications.

  8. Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10.

    PubMed

    Ezeji, Thaddeus C; Bahl, Hubert

    2006-08-20

    The alpha-amylase (1, 4-alpha-d-glucanohydrolase; EC 3.2.1.1) and alpha-glucosidase (alpha-d-glucoside glucohydrolase; EC 3.2.1.20) secreted by Geobacillus thermodenitrificans HRO10 were purified to homogeneity (13.6-fold; 11.5% yield and 25.4-fold; 32.0% yield, respectively) through a series of steps. The molecular weight of alpha-amylase was 58kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The alpha-amylase activity on potato starch was optimal at pH 5.5 and 80 degrees Celsius. In the presence of Ca(2+), the alpha-amylase had residual activity of more than 92% after 1h of incubation at 70 degrees Celsius. The alpha-amylase did not lose any activity in the presence of phytate (a selective alpha-amylase inhibitor) at concentrations as high as 10mM, rather it retained 90% maximal activity after 1h of incubation at 70 degrees Celsius. EGTA and EDTA were strong inhibitory substances of the enzyme. The alpha-amylase hydrolyzed soluble starch at 80 degrees Celsius, with a K(m) of 3.05mgml(-1) and a V(max) of 7.35Uml(-1). The molecular weight of alpha-glucosidase was approximately 45kDa, as determined by SDS-PAGE. The enzyme activity was optimal at pH 6.5-7.5 and 55 degrees Celsius. Phytate did not inhibit G. thermodenitrificans HRO10 alpha-glucosidase activity, whereas pCMB was a potent inhibitor of the enzyme. The alpha-glucosidase exhibited Michaelis-Menten kinetics with maltose at 55 degrees Celsius (K(m): 17mM; V(max): 23micromolmin(-1)mg(-1)). Thin-layer chromatography studies with G. thermodenitrificans HRO10 alpha-amylase and alpha-glucosidase showed an excellent synergistic action and did not reveal any transglycosylation catalyzed reaction by the alpha-glucosidase.

  9. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase.

    PubMed

    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana; Leos-Rivas, Catalina

    2016-01-01

    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity.

  10. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase

    PubMed Central

    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana

    2016-01-01

    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity. PMID:27478477

  11. Refined molecular structure of pig pancreatic alpha-amylase at 2.1 A resolution.

    PubMed

    Larson, S B; Greenwood, A; Cascio, D; Day, J; McPherson, A

    1994-02-04

    The structure of pig pancreatic alpha-amylase has been determined by X-ray diffraction analysis using multiple isomorphous replacement in a crystal of space group P2(1)2(1)2(1) (a = 70.6 A, b = 114.8 A, c = 118.8 A) containing nearly 75% solvent. The structure was refined by simulated annealing and Powell minimization, as monitored by 2Fo-Fc difference Fourier syntheses, to a conventional R of 0.168 at 2.1 A resolution. The final model consists of all 496 amino acid residues, a chloride and a calcium ion, 145 water molecules and an endogenous disaccharide molecule that contiguously links protein molecules related by the 2(1) crystallographic operator along x. The protein is composed of a large domain (amino acid residues 1 to 403) featuring a central alpha ta-barrel of eight parallel strands and connecting helices with a prominent excursion between strand beta 3 and helix alpha 3 (amino acid residues 100 to 168). The final 93 amino acid residues at the carboxyl terminus form a second small domain consisting of a compact Greek key beta-barrel. The domains are tightly associated through hydrophobic interfaces. The beta 3/alpha 3 excursion and portions of the central alpha/beta-barrel provide four protein ligands to the tightly bound Ca ion; three water molecules complete the coordination. The Cl- ion is bound within one end of the alpha/beta-barrel by two arginine residues in a manner suggesting a plausible mechanism for its allosteric activation of the enzyme. A crystalline complex of the pancreatic alpha-amylase with alpha-cyclodextrin, a cyclic substrate analog of six glucose residues, reveals, in difference Fourier maps, three unique binding sites. One of the alpha-cyclodextrin sites is near the center of the long polysaccharide binding cleft that traverses one end of the alpha/beta-barrel, another is at the extreme of this cleft. By symmetry this can also be considered as two half sites located at the extremes of the active site cleft. This latter alpha

  12. Transformation of Bacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B. subtilis var. amylosacchariticus.

    PubMed

    Yoneda, Y; Yamane, K; Yamaguchi, K; Nagata, Y; Maruo, B

    1974-12-01

    Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC 3.2.1.1.) in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.

  13. Digestive alpha-amylases of the flour moth Ephestia kuehniella--adaptation to alkaline environment and plant inhibitors.

    PubMed

    Pytelková, Jana; Hubert, Jan; Lepsík, Martin; Sobotník, Jan; Sindelka, Radek; Krízková, Iva; Horn, Martin; Mares, Michael

    2009-07-01

    The digestive tract of lepidopteran insects is extremely alkaline. In the present work, molecular adaptation of amylolytic enzymes to this environment was investigated in the flour moth Ephestia kuehniella, an important stored-product pest. Three digestive alpha-amylases [Ephestia kuehniella alpha-amylase isoenzymes 1-3 (EkAmy1-3)] with an alkaline pH optimum were purified from larvae and biochemically characterized. These isoenzymes differ significantly in their sensitivity to alpha-amylase inhibitors of plant origin that are directed against herbivores as antifeedants. Such functional variability renders the amylolytic system less vulnerable to suppression by plant defensive molecules. Moreover, we found that expression of alpha-amylases is upregulated in larvae feeding on a diet enriched with an alpha-amylase inhibitor. The alpha-amylases are secreted into the larval midgut by an exocytotic mechanism, as revealed by immunogold microscopy. The cDNA sequence of EkAmy3 was determined, and a homology model of EkAmy3 was built in order to analyze the structural features responsible for adaptation to alkaline pH. First, the overall fold was found to be stabilized by remodeling of ion pairs. Second, molecular simulations supported by activity measurements showed that EkAmy3 does not bind a Cl(-), owing to an Arg-to-Gln mutation in a conserved binding site. The Cl(-)-binding residues are in contact with the catalytic residues, and this change might help to fine-tune the catalytic pK(a) values to an alkaline pH optimum. We conclude that lepidopteran alpha-amylases are evolutionarily adapted in terms of structure and expression dynamics for effective functioning in the digestive system.

  14. Electron microscopic investigation of the diffusion of Bacillus licheniformis alpha-amylase into corn starch granules.

    PubMed

    Helbert, W; Schülein, M; Henrissat, B

    1996-10-01

    A method for the direct electron microscopic observation of amylases in interaction with starch granules is presented. The technique involves immuno-gold labeling of the enzymes and cross-sectioning of hydrated starch granules. This approach allows the analysis of the internal degradation of starch with a concomitant visualization of enzymes at the sites of hydrolysis. The visualization of enzymes at the surface, inside the channel and inside the core of the degraded granules shows that the alpha-amylase molecules first proceed from the surface toward the center (centripetal hydrolysis). Then the core is completely degraded from within by erosion of its periphery (centrifugal hydrolysis). In the first case (centripetal hydrolysis), the enzymes act by progressing along the polysaccharide chains. By contrast, the centrifugal hydrolysis leads to even erosion, indicative of a more diffusive motion of the enzymes.

  15. Effects of metals on {alpha}-amylase activity in the digestive gland of the green mussel, Perna viridis L.

    SciTech Connect

    Yan, T.; Teo, L.H.; Sin, Y.M.

    1996-04-01

    A number of digestive enzymes in the green mussel, Perna viridis L., have been reported, and {alpha}-amylase is believed to have a higher activity than the others. Small plankton, on which the green mussel feeds, may supply plenty of starch and glycogen. They may be an important source of nutrients for the green mussel and the ability of the latter to make good use of them depends mainly on the activities of amylase. The effect of heavy metals on amylase activity is also important as the ability of the mussel`s digestive gland to accumulate these metals is well known. High concentrations of heavy metals, especially lead, have been observed in the water around Singapore. The in vitro inhibition of some metals on the activities of digestive enzymes from the green mussel has been observed, but kinetic properties of the inhibition and the in vivo inhibition of the heavy metals on digestive enzymes are little understood. In the present study, in vitro inhibition of four metals (Pb, Cd, Zn and Hg) on the activity of {alpha}-amylase from the digestive gland of the green mussel will be compared. Their effects on the K{sub M} and V{sub max} values of {alpha}-amylase will also be compared. Finally, lead is either added to the food or water, to see how it affects the activity of {alpha}-amylase and how this effect acts in combination with starvation. 12 refs., 3 figs., 3 tabs.

  16. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  17. Domain B protruding at the third beta strand of the alpha/beta barrel in barley alpha-amylase confers distinct isozyme-specific properties.

    PubMed

    Rodenburg, K W; Juge, N; Guo, X J; Søgaard, M; Chaix, J C; Svensson, B

    1994-04-01

    alpha-Amylases belong to the alpha/beta-barrel protein family in which the active site is created by residues located at the C-terminus of the beta strands and in the helix-connecting loops extending from these ends. In the alpha-amylase family, a small separate domain B protrudes at the C-terminus of the third beta strand of the (beta/alpha)8-barrel framework. The 80% identical barley alpha-amylase isozymes 1 and 2 (AMY1 and AMY2, respectively) differ in substrate affinity and turnover rate, CaCl2 stimulation of activity, sensitivity to the endogenous 21-kDa alpha-amylase/subtilisin inhibitor, and stability at low pH. To identify regions that confer these isozyme-specific variations, AMY1-AMY2 hybrid cDNAs were generated by in vivo homologous recombination in yeast. The hybrids AMY1-(1-90)-AMY2-(90-403) and AMY1-(1-161)-AMY2-(161-403) characterized in this study contain the 90-residue and 161-residue N-terminal sequences, respectively, of AMY1 and complementary C-terminal regions of AMY2. AMY1-(1-90)-AMY2-(90-403) comprises the 60-amino-acid domain B of AMY2 and resembles this isozyme in sensitivity to alpha-amylase/subtilisin inhibitor and its low affinity for the substrates p-nitrophenyl alpha-D-maltoheptaoside, amylose and the inhibitor acarbose. Only AMY1-(1-161)-AMY2-(161-403) and AMY1, which both share domain B, are stable at low pH. However, AMY2 and both hybrid AMY species, but not AMY1, show maximum enzyme activity on insoluble blue starch at approximately 10 mM CaCl2. Domain B thus determines several functional and stability properties that distinguish the barley alpha-amylase isozymes.

  18. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    NASA Technical Reports Server (NTRS)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter

    2003-01-01

    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  19. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.

    PubMed

    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K

    1986-04-01

    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  20. Purification and characterization of alpha-amylase from safflower (Carthamus tinctorius L.) germinating seeds.

    PubMed

    Ben Elarbi, Mosbah; Khemiri, Halima; Jridi, Taoufik; Ben Hamida, Jeannette

    2009-05-01

    alpha-Amylase (alpha-1-4 D-glucan glucanohydrolase EC 3.2.1.1) crude extract was obtained from safflower (Carthamus tinctorius L.) cotyledons excised from 5-day-old dark grown seedlings. The enzyme was purified by precipitating the crude extract with ammonium sulphate at 20-60% saturation, and then by subjecting this fraction to affinity chromatography on a beta-cyclodextrin-Sepharose 6B column. The active fraction was dialysed and concentrated. An overall purification of about 131 folds with an activity yield of 81.25% was achieved. The molecular mass of purified enzyme determined by SDS-PAGE was 35 kD. When the purified alpha-amylase was subjected to gel electrophoresis followed by negative staining, only one band of active protein was detected. Its maximal activity was in the pH 6.0 and at a temperature of 55 degrees C. This enzyme was activated by Ca(2+) and inhibited by Fe(2+).

  1. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  2. [Effect of dental alloys on salivary alkaline and acid phosphatase, alpha amylase K+, Na+, and Cl-].

    PubMed

    Todorov, I; Saprjanova, M

    1977-04-01

    Comparative studied were performed in healthy subjects without metals in their oral cavities and in individuals having different metal alloys (gold, steel, amalgam) in their mouths and presenting with various complaints such as xerostomia, burning mucosa, etc. It was found that the contents of alkaline and acid phosphatases, alpha-amylase, K+, Na+ and Cl- in saliva increased significantly with the increase in total corrosion potential when non-precious metal alloys, especially different types of alloys, were present. Parallel to this, the frequency and the intensity of the complaints increased.

  3. Crystal structure of thermostable alpha-amylase from Bacillus licheniformis refined at 1.7 A resolution.

    PubMed

    Hwang, K Y; Song, H K; Chang, C; Lee, J; Lee, S Y; Kim, K K; Choe, S; Sweet, R M; Suh, S W

    1997-04-30

    alpha-Amylases (alpha-1,4-glucan-4-glucanohydrolase, E.C.3.2.1.1) catalyze the cleavage of alpha-1, 4-glucosidic linkages of starch components, glycogen, and various oligosaccharides. Thermostable alpha-amylases from Bacillus species are of great industrial importance in the production of corn syrup or dextrose. Thermostable alpha-amylase from Bacillus licheniformis, a monomeric enzyme with molecular mass of 55,200 Da (483 amino acid residues), shows a remarkable heat stability. This enzyme provides an attractive model for investigating the structural basis for thermostability of proteins. The three-dimensional structure of thermostable alpha-amylase from Bacillus licheniformis has been determined by the multiple isomorphous replacement method of X-ray crystallography. The structure has been refined to a crystallographic R-factor of 19.9% for 58,601 independent reflections with F0 > 2 sigma F0 between 8.0 and 1.7 A resolution, with root mean square deviations of 0.013 A from ideal bond lengths and 1.72 degrees from ideal bond angles. The final model consists of 469 amino acid residues and 294 water molecules. Missing from the model are the N- and C-termini and the segment between Trp182 and Asn192. Like other alpha-amylases, the polypeptide chain folds into three distinct domains. The first domain (domain A), consisting of 291 residues (from residue 3 to 103 and 207 to 396), forms a (beta/alpha)8-barrel structure. The second domain (domain B), consisting of residues 104 to 206, is inserted between the third beta-strand and the third alpha-helix of domain A. The third C-terminal domain (domain C), consisting of residues 397 to 482, folds into an eight-stranded antiparallel beta-barrel. Neither calcium ion nor chloride ion is located near the active site. This study reveals the architecture of the thermostable alpha-amylase from Bacillus licheniformis. By homology with other alpha-amylases, important active site residues can be identified as Asp231, Glu261, and Asp

  4. Transgenic cowpea (Vigna unguiculata) seeds expressing a bean alpha-amylase inhibitor 1 confer resistance to storage pests, bruchid beetles.

    PubMed

    Solleti, Siva Kumar; Bakshi, Souvika; Purkayastha, Jubilee; Panda, Sanjib Kumar; Sahoo, Lingaraj

    2008-12-01

    Cowpea is one of the important grain legumes. Storage pests, Callosobruchus maculatus and C. chinensis cause severe damage to the cowpea seeds during storage. We employ a highly efficient Agrobacterium-mediated cowpea transformation method for introduction of the bean (Phaseolus vulgaris) alpha-amylase inhibitor-1 (alphaAI-1) gene into a commercially important Indian cowpea cultivar, Pusa Komal and generated fertile transgenic plants. The use of constitutive expression of additional vir genes in resident pSB1 vector in Agrobacterium strain LBA4404, thiol compounds during cocultivation and a geneticin based selection system resulted in twofold increase in stable transformation frequency. Expression of alphaAI-1 gene under bean phytohemagglutinin promoter results in accumulation of alphaAI-1 in transgenic seeds. The transgenic protein was active as an inhibitor of porcine alpha-amylase in vitro. Transgenic cowpeas expressing alphaAI-1 strongly inhibited the development of C. maculatus and C. chinensis in insect bioassays.

  5. The production of a new fungal alpha-amylase degraded the raw starch by means of solid-state fermentation.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2010-01-01

    In this study, it was intended to produce a new fungal amylase by solid-state fermentation and purification and also to determine some of its biochemical properties. It was found that Penicillium brevicompactum had the best enzyme activity according to screening methods with amylase degrading raw starch, and P. brevicompactum was selected as the amylase source. Wheat bran, rice husks, and sunflower oil meal were tested to determine the best solid substrate. Wheat bran was determined as the best of these. The fermentation conditions were optimized for the production of amylase. The optimum fermentation conditions were found to be an initial moisture level for the solid substrate of 55%, moistening agent of 0.1 M sodium phosphate buffer (pH 5.0), incubation period of 7 d, inoculum concentration of 2.5 mL, and incubation temperature at 30 degrees C. Penicillium brevicompactum alpha-amylase was purified 45.98 times by the starch affinity method. The K(m) and V(max) values of alpha-amylase for soluble starch were 5.71 mg/mL and 666.6 U/mL, respectively. This amylase showed maximum activity at between 30 and 50 degrees C and at pH 5.0. Initial enzyme activity was kept at 100% after incubation at 30 degrees C for 45 min. Enzyme was stable in the pH range of 4.0-5.0. This enzyme was activated by Mn(2+), Cu(2+), and Na(+) ions, and was inhibited by Mg(2+), K(+), Fe(3+), and ethylenediamine tetraacetic acid (EDTA). The molecular mass of P. brevicompactum alpha-amylase was found to be 32.5 kD by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis.

  6. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  7. The effect of calcium binding on the unfolding barrier: A kinetic study on homologous alpha-amylases.

    PubMed

    Kumari, Arpana; Rosenkranz, Tobias; Kayastha, Arvind M; Fitter, Jörg

    2010-09-01

    Extreme thermostabilities of proteins can be achieved by binding co-factors to the protein structures. For various alpha-amylases protein stabilization upon calcium binding is a well-known phenomenon. In the present study the mechanism of stabilization of three homologous alpha-amylases was investigated by measuring the unfolding kinetics with CD spectroscopy. For this purpose thermal unfolding kinetics of calcium saturated and calcium depleted enzymes were analyzed by means of Eyring-plots. The free energy change between the native and the transition state which characterized the unfolding barrier height was found to be proportional to the number of calcium ions bound to the protein structures. For the most thermostable alpha-amylases calcium binding caused a significant increase in the enthalpy change, which was partly compensated by increased entropy changes.

  8. Multiple time courses of salivary alpha-amylase and dimensions of affect in adolescence.

    PubMed

    Doane, Leah D; Van Lenten, Scott A

    2014-11-01

    Previous research has illustrated associations among daily experiences, emotions and stress-responding physiological systems. Recently, investigators have examined salivary alpha-amylase (sAA), a surrogate marker of the autonomic nervous system, and its associations with affect. The current study examined associations among affective valence, arousal and sAA across three different time courses at the momentary, daily and inter-individual level to understand varying influences of adolescents' daily emotional experiences on sAA reactivity and diurnal sAA activity. Adolescents (N=82) provided salivary samples and diary reports of affect and experiences five times a day for three consecutive days. They also completed self-report questionnaires on trait affect. Findings from multilevel growth curves demonstrated that adolescents in our sample displayed typical sAA diurnal rhythms with levels dropping 30 min after waking and then increasing across the day to a peak in the late afternoon. Within person momentary experiences of high arousal positive affect were associated with momentary sAA reactivity. Prior day experiences of high arousal negative affect were associated with a greater amylase awakening response (i.e., greater decrease) and flatter slopes the next day. Trait positive affect was also associated with flatter sAA slopes. Our findings suggest that both affective arousal and valence should be accounted for when examining differences in sAA reactivity and diurnal patterns. Further, our results indicated that emotion-physiology transactions among adolescents occur over varying time scales for salivary alpha-amylase as well as cortisol.

  9. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.

    PubMed

    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk

    2003-11-01

    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  10. Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.

    PubMed

    Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy

    2009-08-01

    An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

  11. Alpha amylase assisted synthesis of TiO₂ nanoparticles: structural characterization and application as antibacterial agents.

    PubMed

    Ahmad, Razi; Mohsin, Mohd; Ahmad, Tokeer; Sardar, Meryam

    2015-01-01

    The enzyme alpha amylase was used as the sole reducing and capping agent for the synthesis of TiO2 nanoparticles. The biosynthesized nanoparticles were characterized by X-ray diffraction (XRD) and transmission electron microscopic (TEM) methods. The XRD data confirms the monophasic crystalline nature of the nanoparticles formed. TEM data shows that the morphology of nanoparticles depends upon the enzyme concentration used at the time of synthesis. The presence of alpha amylase on TiO2 nanoparticles was confirmed by FTIR. The nanoparticles were investigated for their antibacterial effect on Staphylococcus aureus and Escherichia coli. The minimum inhibitory concentration value of the TiO2 nanoparticles was found to be 62.50 μg/ml for both the bacterial strains. The inhibition was further confirmed using disc diffusion assay. It is evident from the zone of inhibition that TiO2 nanoparticles possess potent bactericidal activity. Further, growth curve study shows effect of inhibitory concentration of TiO2 nanoparticles against S. aureus and E. coli. Confocal microscopy and TEM investigation confirm that nanoparticles were disrupting the bacterial cell wall.

  12. A comparison of ghrelin, glucose, alpha-amylase and protein levels in saliva from diabetics.

    PubMed

    Aydin, Suleyman

    2007-01-31

    During the past decade, many salivary parameters have been used to characterize disease states. Ghrelin (GAH) is recently-discovered peptide hormone secreted mainly from the stomach but also produced in a number of other tissues including salivary glands. The aim of this work was to examine the relationship between active (aGAH) and inactive (dGAH) ghrelin in the saliva and other salivary parameters in type II diabetic patients and healthy controls. Salivary parameters were assessed in a single measurement of unstimulated whole saliva from 20 obese and 20 non-obese type II diabetes patients, and in 22 healthy controls. Total protein and alpha-amylase were determined by colorimetric methods, and glucose by the glucose-oxidase method. Saliva aGAH and dGAH levels were measured using a commercial radioimmunoassay (RIA) kit. Salivary concentrations of aGAH and dGAH ghrelin were more markedly decreased in obese diabetic subjects than in the two other groups. Glucose and alpha-amylase levels were higher in diabetic subjects than in controls. Furthermore, there were correlations between GAH levels and BMI, and between GAH and blood pressure. However, there was no marked variability in saliva flow rates among the groups. These results indicate that measurement of salivary GAH and its relationship to other salivary parameters might help to provide insight into the role of ghrelin in diabetes.

  13. Cortisol, salivary alpha-amylase and children's perceptions of their social networks.

    PubMed

    Ponzi, Davide; Muehlenbein, Michael P; Geary, David C; Flinn, Mark V

    2016-01-01

    In recent years there has been a growing interest in the use of social network analysis in biobehavioral research. Despite the well-established importance of social relationships in influencing human behavior and health, little is known about how children's perception of their immediate social relationships correlates with biological parameters of stress. In this study we explore the association between two measures of children's personal social networks, perceived network size and perceived network density, with two biomarkers of stress, cortisol and salivary alpha-amylase. Forty children (mean age = 8.30, min age = 5, and max age = 12) were interviewed to collect information about their friendships and three samples of saliva were collected. Our results show that children characterized by a lower pre-interview cortisol concentration and a lower salivary alpha-amylase reactivity to the interview reported the highest density of friendships. We discuss this result in light of the multisystem approach to the study of children's behavioral outcomes, emphasizing that future work of this kind is needed in order to understand the cognitive and biological mechanisms underlying children's and adolescents' social perceptual biases.

  14. The effects of autonomy support on salivary alpha-amylase: The role of individual differences.

    PubMed

    Sieber, Vanda; Schüler, Julia; Wegner, Mirko

    2016-12-01

    The empirical evidence for the relationship between autonomy-supportive environments and physiological stress is inconsistent. Whereas some studies report a decrease in stress in autonomy-supportive environments, other studies show a negative effect of autonomy on physiological stress. As previous research has not considered individual differences within this relationship, the present research aims to close this empirical gap by proposing that an implicit autonomy disposition, which is defined as a dispositional preference for self-determination, serves as a moderator. In an experiment, we tested whether the autonomy disposition moderates the effect of different teaching styles (controlling, autonomy-supportive, and neutral) on the acute physiological stress response (salivary alpha-amylase) in adolescents (N=69). The study revealed that participants with a high implicit autonomy disposition displayed lower salivary alpha-amylase responses when exposed to autonomy-supportive vignettes compared to when they were exposed to controlling or neutral teaching styles. The opposite pattern was found in students with a low implicit autonomy disposition. The results illustrate that experimentally induced variations in autonomy support lead to different physiological stress responses, depending on individual differences in the implicit autonomy disposition.

  15. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family.

    PubMed

    Skov, L K; Mirza, O; Henriksen, A; De Montalk, G P; Remaud-Simeon, M; Sarçabal, P; Willemot, R M; Monsan, P; Gajhede, M

    2001-07-06

    Amylosucrase (E.C. 2.4.1.4) is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N-terminal domain that is not similar to any known fold, a (beta/alpha)(8)-barrel A-domain, B- and B'-domains displaying alpha/beta-structure, and a C-terminal eight-stranded beta-sheet domain. In contrast to other Family 13 hydrolases that have the active site in the bottom of a large cleft, the active site of amylosucrase is at the bottom of a pocket at the molecular surface. A substrate binding site resembling the amylase 2 subsite is not found in amylosucrase. The site is blocked by a salt bridge between residues in the second and eight loops of the (beta/alpha)(8)-barrel. The result is an exo-acting enzyme. Loop 7 in the amylosucrase barrel is prolonged compared with the loop structure found in other hydrolases, and this insertion (forming domain B') is suggested to be important for the polymer synthase activity of the enzyme. The topology of the B'-domain creates an active site entrance with several ravines in the molecular surface that could be used specifically by the substrates/products (sucrose, glucan polymer, and fructose) that have to get in and out of the active site pocket.

  16. Isolation and characterization of the subunits of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Yamaguchi, H

    1991-11-01

    An alpha-amylase inhibitor (PHA-I) of the white kidney bean (Phaseolus vulgaris) was found to be composed of two kinds of subunits and they were isolated on a size-exclusion column by HPLC under denaturing conditions. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide map between these subunit polypeptides. The alpha-subunit contained 28% by weight of carbohydrate, mainly made up of high mannose-type oligosacharides, whereas the sugar moiety of the beta-subunit amounted to 7% by weight and seemed to be predominantly composed of xylomannose-type oligosaccharides. By SDS-PAGE following deglycosylation, the molecular weights of the polypeptides of alpha- and beta-subunits were shown to be 7,800 and 14,000, respectively. These values were consistent with molecular sizes obtained for alpha- and beta-subunits by gel permeation HPLC in 6 M guanidine hydrochloride. The molecular weight of the native PHA-I, 28,800, obtained by gel permeation HPLC under non-denaturing conditions, suggested a heterodimeric structure for PHA-I.

  17. Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

    PubMed

    Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

    2015-10-01

    Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact.

  18. Automated docking of alpha-(1-->4)- and alpha-(1-->6)-linked glucosyl trisaccharides and maltopentaose into the soybean beta-amylase active site.

    PubMed

    Rockey, W M; Laederach, A; Reilly, P J

    2000-08-01

    The Lamarckian genetic algorithm of AutoDock 3.0 was used to dock alpha-maltotriose, methyl alpha-panoside, methyl alpha-isopanoside, methyl alpha-isomaltotrioside, methyl alpha-(6(1)-alpha-glucopyranosyl)-maltoside, and alpha-maltopentaose into the closed and, except for alpha-maltopentaose, into the open conformation of the soybean beta-amylase active site. In the closed conformation, the hinged flap at the mouth of the active site closes over the substrate. The nonreducing end of alpha-maltotriose docks preferentially to subsites -2 or +1, the latter yielding nonproductive binding. Some ligands dock into less optimal conformations with the nonreducing end at subsite -1. The reducing-end glucosyl residue of nonproductively-bound alpha-maltotriose is close to residue Gln194, which likely contributes to binding to subsite +3. In the open conformation, the substrate hydrogen-bonds with several residues of the open flap. When the flap closes, the substrate productively docks if the nonreducing end is near subsites -2 or -1. Trisaccharides with alpha-(1-->6) bonds do not successfully dock except for methyl alpha-isopanoside, whose first and second glucosyl rings dock exceptionally well into subsites -2 and -1. The alpha-(1-->6) bond between the second and third glucosyl units causes the latter to be improperly positioned into subsite +1; the fact that isopanose is not a substrate of beta-amylase indicates that binding to this subsite is critical for hydrolysis.

  19. Action pattern of human pancreatic and salivary alpha-amylase on 1,4-alpha-D-nitrophenylmaltooligosaccharides. 1,4-alpha-D-nitrophenylmaltooligosaccharides as substrates of alpha-amylse, I.

    PubMed

    Wallenfels, K; Laule, G; Meltzer, B

    1982-08-01

    High performance liquid chromatography (HPLC) was used to monitor the purity of the substrates and to establish the patterns of hydrolysis of ortho- and para-nitrophenylmaltooligosaccharides (2-7 glucose residues) catalysed by human pancreatic and salivary alpha-amylase. Separation of the reaction products from the remaining substrate was performed on a TSK-G-2000 PW or a RP18 column. By measuring the quantitative distribution of products, and assuming a 5-subsite model for the active site of alpha-amylase, differential activities for the hydrolysis of the different glycosidic bonds in the 2 series of substrates were deduced. A highly sensitive coupled continuous assay system is based on the formation of phenyloligosaccharides with 1-4 glucose residues by the action of the amylase under test, coupled to hydrolysis of these products by yeast alpha-glucosidase. The most suitable test substrates were shown to be para-nitrophenyl-alpha-D-maltotetraoside and -pentaoside. Direct production of nitrophenol from ortho-nitrophenyl-alpha-D-maltotrioside is recommended for the measurement of the alpha-amylase activity of pancreatic and salivary gland secretions and extracts.

  20. Bean alpha-amylase inhibitors in transgenic peas inhibit development of pea weevil larvae.

    PubMed

    de Sousa-Majer, Maria José; Hardie, Darryl C; Turner, Neil C; Higgins, Thomas J V

    2007-08-01

    This glasshouse study used an improved larval measurement procedure to evaluate the impact of transgenic pea, Pisum sativum L., seeds expressing a-amylase inhibitor (AI)-1 or -2 proteins on pea weevil, Bruchus pisorum L. Seeds of transgenic 'Laura' and 'Greenfeast' peas expressing alpha-(AI)-1 reduced pea weevil survival by 93-98%. Larval mortality occurred at an early instar. Conversely, in nontransgenic cultivars, approximately 98-99% of the pea weevils emerged as adults. By measuring the head capsule size, we determined that larvae died at the first to early third instar in alpha-(AI)-1 transgenic peas, indicating that this inhibitor is highly effective in controlling this insect. By contrast, transgenic Laura and 'Dundale' expressing alpha-(AI)-2 did not affect pea weevil survival, but they did delay larval development. After 77 d of development, the head capsule size indicated that the larvae were still at the third instar stage in transgenic alpha-(AI)-2 peas, whereas adult bruchids had developed in the nontransgenic peas.

  1. Structural investigation and homology modeling studies of native and truncated forms of alpha-amylases from Sclerotinia sclerotiorum.

    PubMed

    Ben Abdelmalek, Imen; Urdaci, Maria Camino; Ben Ali, Mamdouh; Denayrolles, Muriel; Chaignepain, Stephane; Limam, Ferid; Bejar, Samir; Marzouki, Mohamed Nejib

    2009-11-01

    The filamentous ascomycete Sclerotinia sclerotiorum is well known for its ability to produce a large variety of hydrolytic enzymes for the degradation of plant polysaccharide material. Two alpha-amylases designated as ScAmy54 and ScAmy43 were biochemically characterized and predicted to play an important role in starch degradation. Those enzymes produce specific oligosaccharides, essentially maltotriose, that have a considerable commercial interest. The primary structures of the two enzymes were analyzed by N-terminal sequencing, MALDI-TOF mass spectrometry, and cDNA cloning, and implied that the two proteins have the same N-terminal catalytic domain and ScAmy43 was produced from ScAmy54 by truncation of 96 amino acids at the carboxyl-terminal region. The result of genomic analysis suggested that the two enzymes originated from the same alpha-amylase gene and that truncation of ScAmy54 to ScAmy43 occurred probably during the S. sclerotiorum cultivation. The structural gene of ScAmy54 consisted of 9 exons and 8 introns, containing a single 1,500-bp open reading frame encoding 499 amino acids including a signal peptide of 21 amino acids. ScAmy54 exhibited high amino acid identity to other liquefying fungal alpha-amylases, essentially in the four conserved regions and in the putative catalytic triad. A 3D structure model of ScAmy54 and ScAmy43 was built using the 3D structure of 2guy from A. niger as template. ScAmy54 with three domains A, B, and C, including the well-known (beta/alpha)8-barrel motif in domain A, has a typical structure of the alpha-amylase family. ScAmy43 composed only of domains A and B constitutes a smallest fungal alpha-amylase with only a catalytic domain.

  2. Alpha-amylase from germinating soybean (Glycine max) seeds--purification, characterization and sequential similarity of conserved and catalytic amino acid residues.

    PubMed

    Kumari, Arpana; Singh, Vinay Kumar; Fitter, Jörg; Polen, Tino; Kayastha, Arvind M

    2010-10-01

    Starch hydrolyzing amylase from germinated soybeans seeds (Glycine max) has been purified 400-fold to electrophoretic homogeneity with a final specific activity of 384 units/mg. SDS-PAGE of the final preparation revealed a single protein band of 100 kDa, whereas molecular mass was determined to be 84 kDa by MALDI-TOF and gel filtration on Superdex-200 (FPLC). The enzyme exhibited maximum activity at pH 5.5 and a pI value of 4.85. The energy of activation was determined to be 6.09 kcal/mol in the temperature range 25-85 degrees C. Apparent Michaelis constant (K(m)((app))) for starch was 0.71 mg/mL and turnover number (k(cat)) was 280 s(-1) in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 85 degrees C showed first-order kinetics with rate constant (k) equal to 0.0063 min(-1). Soybean alpha-amylase showed high specificity for its primary substrate starch. High similarity of soybean alpha-amylase with known amylases suggests that this alpha-amylase belongs to glycosyl hydrolase family 13. Cereal alpha-amylases have gained importance due to their compatibility for biotechnological applications. Wide availability and easy purification protocol make soybean as an attractive alternative for plant alpha-amylase. Soybean can be used as commercially viable source of alpha-amylase for various industrial applications.

  3. Purification and characterization of alpha-amylase from Bacillus licheniformis CUMC305

    SciTech Connect

    Krishnan, T.; Chandra, A.K.

    1983-08-01

    Alpha-amylase produced by Bacillus licheniformis CUMC305 was purified 212-fold with a 42% yield through a series of four steps. The purified enzyme was homogeneous as shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and discontinuous gel electrophoresis. The purified enzyme showed maximal activity at 90 degrees C and pH 9.0, and 91% of this activity remained at 100 degrees C. In the presence of substrate (soluble starch), the alpha-amylase enzyme was fully stable after a 4-hour incubation at 100 degrees C. The enzyme showed 100% stability in the pH range 7 to 9; 95% stability at pH 10; and 84, 74, 68, and 50% stability at pH values of 6, 5, 4, and 3, respectively, after 18 hours of treatment. The activation energy for this enzyme was calculated as 5.1 x 10 to the power of 5 J/mol. The molecular weight was estimated to be 28,000 by sodium dodecyl sulfate-gel electrophoresis. The relative rates of hydrolysis of soluble starch, amylose, amylopectin, and glycogen were 1.27, 1.8, 1.94, and 2.28 mg/ml, respectively. Vmax values for hydrolysis of these substrates were calculated as 0.738, 1.08, 0.8, and 0.5 mg of maltose/ml per min, respectively. Of the cations, Na+, Ca(2+), and Mg(2+), showed stimulatory effect, wheras Hg(2+), Cu(2+), Ni(2+), Zn(2+), Ag+, Fe(2+), Co(2+), Cd(2+), Al(3+), and Mn(2+) were inhibitory. Of the anions, azide, F-, SO/sub 3/(2-), SO/sub 4/(3-), S/sub 2/O/sub 3/(2-), MoO/sub 4/(2-), and Wo/sub 4/(2-) showed an excitant effect. p-Chloromercuribenzoic acid and sodium iodoacetate were inhibitory, whereas cysteine, reduced glutathione, thiourea, beta-mercaptoethanol, and sodium glycerophosphate afforded protection to enzyme activity. Alpha-amylase was fairly resistant to EDTA treatment at 30 degrees C, but heating at 90 degrees C in presence of EDTA resulted in the complete loss of enzyme activity. (Refs. 32).

  4. Neohesperidin dihydrochalcone: presentation of a small molecule activator of mammalian alpha-amylase as an allosteric effector.

    PubMed

    Kashani-Amin, Elaheh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2013-03-18

    Flavonoids and their precursor trans-chalcone have been reported as inhibitors of mammalian alpha-amylase. With regard to this background, neohesperidin dihydrochalcone (NHDC) effect was investigated toward porcine pancreatic alpha-amylase (PPA), and found to be an activator of the enzyme. The maximal activation (up to threefold) was found to occur at 4.8mM of NHDC, which could be considered to have a high activation profile, with regard to the alpha and beta parameters (alpha<1

  5. Maltose effects on barley malt diastatic power enzyme activity and thermostability at high isothermal mashing temperature: II. Alpha-amylase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maltose, the primary product of starch degradation during mashing, has the potential as a compatible solute to affect the activity of and increase the thermostability of barley malt alpha-amylase activity at high temperatures used in mashing and temperatures above those normally used in mashing. To ...

  6. Identification of essential amino acid residues of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Takahashi, T; Hiramoto, S; Wato, S; Nishimoto, T; Wada, Y; Nagai, K; Yamaguchi, H

    1999-11-01

    Kidney bean (Phaseolus vulgaris) alpha-amylase inhibitors, which are bivalent inhibitors with the subunit stoichiometry of (alphabeta)(2) complex, have been inferred to contain unique arginine, tryptophan, and tyrosine residues essential for the inhibitory activity. To test the validity of this inference, an attempt was made to identify the essential amino acid residues of a white kidney bean (P. vulgaris) alpha-amylase inhibitor (PHA-I) by using the chemical modification technique combined with amino acid sequencing and mass spectrometry. Exhaustive modification of the arginine residues by phenylglyoxal did not lead to a marked loss of activity, suggesting that no arginine residue is directly associated with the inhibitory activity. N-Bromosuccinimide treatment of PHA-I in the presence or absence of a substrate alpha-amylase revealed the involvement of two tryptophan residues in alpha-amylase inhibition, and they were identified as Trp188 of the beta-subunit by amino acid sequencing and mass spectrometry of lysylendopeptidase peptides. Further, two tyrosine residues were preferentially modified either by N-acetylimidazole or by tetranitromethane, resulting in a concomitant loss of most of the PHA-I activity. Amino acid sequencing of the lysylendopeptidase peptides from a tetranitromethane-modified PHA-I identified Tyr186 of the beta-subunit as an essential residue.

  7. Relationship Between Meditation Depth and Waking Salivary Alpha-Amylase Secretion Among Long-Term MBSR Instructors.

    PubMed

    Haslam, Alyson; Wirth, Michael D; Robb, Sara Wagner

    2016-09-28

    The purpose of this study was to characterize sympathetic activity by using waking salivary alpha-amylase (sAA) concentrations in a group of long-term meditation instructors and to examine the association between meditation (depth, dose and duration) and the waking alpha-amylase response. Salivary alpha-amylase samples were collected (immediately upon waking and at 15-min, 30-min and 45-min intervals after waking) from mindfulness-based stress reduction instructors to determine both the area under the curve and the awakening slope (difference in alpha-amylase concentrations between waking and 30-min post-waking). It was determined through general linear models that neither years of meditation nor meditation dose were associated with the awakening sAA slope, but higher scores for meditation depth (greater depth) was associated with a more negative (or steeper) awakening slope [Quartile (Q)1: -7 versus Q4: -21 U/mL; p = 0.06], in fully adjusted models. Older age (p = 0.04) and a later time of waking (p < 0.01) also were associated with less negative awakening slope values. Smoking was associated with lower area under the curve values (smokers: 1716 U/mL versus nonsmokers: 2107 U/mL; p = 0.05) in fully adjusted models. The results suggest a 'healthy' sAA waking slope among individuals who meditate more deeply. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children

    ERIC Educational Resources Information Center

    Kidd, Sharon A.; Corbett, Blythe A.; Granger, Douglas A.; Boyce, W. Thomas; Anders, Thomas F.; Tager, Ira B.

    2012-01-01

    We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in preschool-aged children with autism (AUT) and typically developing children (TYP). Fifty-two subjects (26 AUT and 26 TYP) were enrolled. Salivary samples were obtained at waking, midday, and bedtime on two consecutive days at three phases…

  9. Alpha-Amylase Inhibition and Antioxidative Capacity of Some Antidiabetic Plants Used by the Traditional Healers in Southeastern Nigeria

    PubMed Central

    Oyedemi, Blessing O.; Ijeh, Ifeoma I.; Ohanyerem, Princemartins E.; Aiyegoro, Olayinka A.

    2017-01-01

    Oxidative stress plays a significant role in the pathogenesis of metabolic syndrome including diabetes mellitus (DM). The inhibition of alpha-amylase is an important therapeutic target in the regulation of postprandial increase of blood glucose in diabetic patients. The present study investigated the alpha-amylase inhibitory and antioxidant potential of selected herbal drugs used in the treatment of DM by the traditional healers in Isiala Mbano and Ikwuano regions of southeastern Nigeria. Antioxidant activity was evaluated in terms of free radical scavenging, reducing power, and total phenolic (TPC) and flavonoid content (TFC) in consonance with the TLC profiling. The results showed that methanol crude extracts from Anacardium occidentale (AO) and Ceiba pentandra (CP) recorded higher TPC and TFC, potent free radical scavenging, and efficient reducing power (RP) as compared with other plant samples. All the plant extracts exhibited a relative alpha-amylase inhibition apart from Strophanthus hispidus (SH) extract with a negative effect. We discovered a mild to weak correlation between alpha-amylase inhibition or antioxidative capacity and the total phenol or flavonoid content. At least in part, the results obtained in this work support the traditional use of certain plant species in the treatment of patients with DM. PMID:28367491

  10. The green tea polyphenol (-)-epigallocatechin gallate precipitates salivary proteins including alpha-amylase: biochemical implications for oral health.

    PubMed

    Hara, Kumiko; Ohara, Masaru; Hayashi, Ikue; Hino, Takamune; Nishimura, Rumi; Iwasaki, Yoriko; Ogawa, Tetsuji; Ohyama, Yoshihiko; Sugiyama, Masaru; Amano, Hideaki

    2012-04-01

    Green tea is a popular drink throughout the world, and it contains various components, including the green tea polyphenol (-)-epigallocatechin gallate (EGCG). Tea interacts with saliva upon entering the mouth, so the interaction between saliva and EGCG interested us, especially with respect to EGCG-protein binding. SDS-PAGE revealed that several salivary proteins were precipitated after adding EGCG to saliva. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) peptide mass fingerprinting indicated that the major proteins precipitated by EGCG were alpha-amylase, S100, and cystatins. Surface plasmon resonance revealed that EGCG bound to alpha-amylase at dissociation constant (K(d)) = 2.74 × 10(-6) M, suggesting that EGCG interacts with salivary proteins with a relatively strong affinity. In addition, EGCG inhibited the activity of alpha-amylase by non-competitive inhibition, indicating that EGCG is effective at inhibiting the formation of fermentable carbohydrates involved in caries formation. Interestingly, alpha-amylase reduced the antimicrobial activity of EGCG against the periodontal bacterium Aggregatibacter actinomycetemcomitans. Therefore, we considered that EGCG-salivary protein interactions might have both protective and detrimental effects with respect to oral health.

  11. Permissive role of the acidification caused by wheat aleurone layers upon. alpha. -amylase induction by GA sub 3

    SciTech Connect

    Rodriguez-Campos, E.; Bernal-Lugo, I.; Hamabata, A. )

    1989-04-01

    Wheat aleurone has the capacity of acidifying the incubation medium in 1 to 2 pH units. The {alpha}-amylase induction by GA{sub 3} in isolated wheat aleurone layers is strongly dependent on acidic pH of the medium (pH < 5). To examine possible mechanisms {sup 35}-Met incorporation into proteins and {alpha}-amylase, in the presence of GA{sub 3} and Ca{sup 2+} at pH, 4, 5 and 6 was studied. Although {sup 35}-Met uptake decreased markedly ({approx} 90%) at pH 4 in thepresence of GA{sub 3}, incorporation into total protein did not change significantly from other conditions. Auto-radiography of SDS-PAGE showed that most of the amino acid was in the {alpha}-amylase band, meaning that the effect of acidic pH is specific for GA{sub 3} actions on aleurone tissue. On the other hand, an increase of protonated GA{sub 3} diffusion could be ruled out. Also, there was not {alpha}-amylase inactivation at pH 6. These findings point out to the important physiological role of the acidification caused by the aleurone.

  12. Effects of alpha-amylases from different sources on the firming of concentrated wheat starch gels: relationship to bread staling.

    PubMed

    Palacios, Hernan R; Schwarz, Paul B; D'Appolonia, Bert L

    2004-09-22

    The firming and carbohydrate fractions of concentrated starch gels supplemented with four alpha-amylases from different sources were evaluated. Correlations were found between the firmness data and results for the carbohydrate fractions extracted from the gels. The thermostable (TBA) and intermediate temperature stability (ISBA) bacterial alpha-amylases were most effective in decreasing the rate of firming. The cereal alpha-amylase at the high level (CAH) was also effective. The CAH produced the largest quantity of dextrins at storage time zero and the thermostable bacterial alpha-amylase at the high level (TBAH) after storage for 5 days. None of the maltooligosaccharides appeared to be responsible for the decreased rate of firming of the gels. The results indicated that the TBA and ISBA most effectively inhibited firming because they degraded the external branches and the intercluster regions of amylopectin during storage. Consideration of previously reported differential scanning calorimetry and X-ray crystallography results leads to the conclusion that the antifirming action of the TBA and ISBA is due to their ability to degrade the amylopectin and amorphous regions of the gels during storage, which inhibits the formation of double helices and decreases the strength of the starch gel matrix. Gels supplemented with the TBA and ISBA were most crystalline but firmed to a lesser extent. These results are similar to those previously reported by other researchers for bread and strongly suggest that starch retrogradation plays a primary role in bread staling.

  13. Alpha-amylase inhibitors selected from a combinatorial library of a cellulose binding domain scaffold.

    PubMed

    Lehtiö, J; Teeri, T T; Nygren, P A

    2000-11-15

    A disulfide bridge-constrained cellulose binding domain (CBD(WT)) derived from the cellobiohydrolase Cel7A from Trichoderma reesei has been investigated for use in scaffold engineering to obtain novel binding proteins. The gene encoding the wild-type 36 aa CBD(WT) domain was first inserted into a phagemid vector and shown to be functionally displayed on M13 filamentous phage as a protein III fusion protein with retained cellulose binding activity. A combinatorial library comprising 46 million variants of the CBD domain was constructed through randomization of 11 positions located at the domain surface and distributed over three separate beta-sheets of the domain. Using the enzyme porcine alpha-amylase (PPA) as target in biopannings, two CBD variants showing selective binding to the enzyme were characterized. Reduction and iodoacetamide blocking of cysteine residues in selected CBD variants resulted in a loss of binding activity, indicating a conformation dependent binding. Interestingly, further studies showed that the selected CBD variants were capable of competing with the binding of the amylase inhibitor acarbose to the enzyme. In addition, the enzyme activity could be partially inhibited by addition of soluble protein, suggesting that the selected CBD variants bind to the active site of the enzyme.

  14. The structure of human pancreatic alpha-amylase at 1.8 A resolution and comparisons with related enzymes.

    PubMed

    Brayer, G D; Luo, Y; Withers, S G

    1995-09-01

    The structure of human pancreatic alpha-amylase has been determined to 1.8 A resolution using X-ray diffraction techniques. This enzyme is found to be composed of three structural domains. The largest is Domain A (residues 1-99, 169-404), which forms a central eight-stranded parallel beta-barrel, to one end of which are located the active site residues Asp 197, Glu 233, and Asp 300. Also found in this vicinity is a bound chloride ion that forms ligand interactions to Arg 195, Asn 298, and Arg 337. Domain B is the smallest (residues 100-168) and serves to form a calcium binding site against the wall of the beta-barrel of Domain A. Protein groups making ligand interactions to this calcium include Asn 100, Arg 158, Asp 167, and His 201. Domain C (residues 405-496) is made up of anti-parallel beta-structure and is only loosely associated with Domains A and B. It is notable that the N-terminal glutamine residue of human pancreatic alpha-amylase undergoes a posttranslational modification to form a stable pyrrolidone derivative that may provide protection against other digestive enzymes. Structure-based comparisons of human pancreatic alpha-amylase with functionally related enzymes serve to emphasize three points. Firstly, despite this approach facilitating primary sequence alignments with respect to the numerous insertions and deletions present, overall there is only approximately 15% sequence homology between the mammalian and fungal alpha-amylases. Secondly, in contrast, these same studies indicate that significant structural homology is present and of the order of approximately 70%. Thirdly, the positioning of Domain C can vary considerably between alpha-amylases. In terms of the more closely related porcine enzyme, there are four regions of polypeptide chain (residues 237-250, 304-310, 346-354, and 458-461) with significantly different conformations from those in human pancreatic alpha-amylase. At least two of these could play a role in observed differential

  15. Characterization of. alpha. -amylase-inhibitor, a lectin-like protein in the seeds of Phaseolus vulgaris

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1990-03-01

    The common bean, Phaseolus vulgaris, contains a glycoprotein that inhibits the activity of mammalian and insect {alpha}-amylases but not of plant {alpha}-amylases. It is therefore classified as an antifeedant or seed defense protein. In P. vulgaris cv Greensleeves, {alpha}-amylase inhibitor ({alpha}Al) is present in embryonic axes and cotyledons, but not in other organs of the plant. The protein is synthesized during the same time period that phaseolin and phytohemagglutinin are made and also accumulates in the protein storage vacuoles (protein bodies). All the glycoforms have complex glycans that are resistant to removal by endoglycosidase H, indicating transport of the protein through the Golgi apparatus. The two different polypeptides correspond to the N-terminal and C-terminal halves of a lectin-like protein encoded by an already identified gene or a gene closely related to it. The primary translation product of {alpha}Al is a polypeptide of M{sub r} 28,000. Immunologically cross-reacting glycopolypeptides of M{sub r} 30,000 to 35,000 are present in the endoplasmic reticulum, while the smaller polypeptides (M{sub r} 15,000-19,000) accumulate in protein storage vacuoles (protein bodies). Together these data indicate that {alpha}Al is a typical bean lectin-type protein that is synthesized on the rough endoplasmic reticulum, modified in the Golgi, and transported to the protein storage vacuoles.

  16. Purification and characterization of extracellular alpha-amylase and glucoamylase from the yeast Candida antarctica CBS 6678.

    PubMed

    De Mot, R; Verachtert, H

    1987-05-04

    An alpha-amylase and a glucoamylase were purified to homogeneity from the culture fluid of beta-cyclodextrin-grown Candida antarctica CBS 6678 by protamine sulfate treatment, ammonium sulfate precipitation, gel filtration (Sephadex G-75 sf, Ultrogel AcA 54), DEAE-Sephacel chromatography, hydroxyapatite chromatography and affinity chromatography on acarbose--AH-Sepharose 4B. Both enzymes were monomeric glycoproteins with fairly different amino acid compositions. Their apparent relative molecular mass, sedimentation coefficient (Szero20,w), isoelectric point, absorption coefficient (280 nm), pH and temperature optima were estimated as 48,500, 4.7 S, 10.1, 1.74 cm2 mg-1, 4.2 and 57 degrees C, respectively, for glucoamylase and as 50,000, 4.9 S, 10.3, 1.53 cm2 mg-1, 4.2 and 62 degrees C, respectively, for alpha-amylase. Kinetic analyses indicated that both enzymes preferentially hydrolyzed high-molecular-mass substrates, including some raw starches. alpha-Amylase was active on cyclodextrins, whereas debranching activity was demonstrated for glucoamylase. Trestatins were potent inhibitors of both alpha-amylase (Ki less than 1 microM) and glucoamylase (Ki less than 0.1 microM), being more effective than Bay e 4609 (Ki less than 10 microM). Glucoamylase was selectivity and strongly inhibited by acarbose (Ki less than 0.1 microM). Activity of the latter enzyme was also affected by 1-deoxynojirimycin (Ki less than 1 mM), maltitol and amino alcohols (Ki less than 10 mM). Unlike alpha-amylase, glucoamylase adsorbed strongly onto raw starch, the adsorption site being non-identical with the active site.

  17. Self-compassionate young adults show lower salivary alpha-amylase responses to repeated psychosocial stress

    PubMed Central

    Breines, Juliana G.; McInnis, Christine M.; Kuras, Yuliya I.; Thoma, Myriam V.; Gianferante, Danielle; Hanlin, Luke; Chen, Xuejie; Rohleder, Nicolas

    2015-01-01

    In this study we tested the hypothesis that participants higher in dispositional self-compassion would show lower stress-induced reactivity of salivary alpha-amylase (sAA), a marker of sympathetic nervous system activation. Thirty-three healthy participants (18–34 years old) were exposed to a standardized laboratory stressor on two consecutive days. Self-compassion, self-esteem, and demographic factors were assessed by questionnaire and sAA was assessed at baseline and at 1, 10, 30, and 60 minutes following each stressor. Self-compassion was a significant negative predictor of sAA responses on both days. This relationship remained significant when controlling for self-esteem, subjective distress, age, gender, ethnicity, and Body Mass Index (BMI). These results suggest that self-compassion may serve as a protective factor against stress-induced physiological changes that have implications for health. PMID:26005394

  18. Multi-site substrate binding and interplay in barley alpha-amylase 1.

    PubMed

    Nielsen, Morten Munch; Seo, Eun-Seong; Bozonnet, Sophie; Aghajari, Nushin; Robert, Xavier; Haser, Richard; Svensson, Birte

    2008-07-23

    Certain starch hydrolases possess secondary carbohydrate binding sites outside of the active site, suggesting that multi-site substrate interactions are functionally significant. In barley alpha-amylase both Tyr380, situated on a remote non-catalytic domain, and Tyr105 in subsite -6 of the active site cleft are principal carbohydrate binding residues. The dual active site/secondary site mutants Y105A/Y380A and Y105A/Y380M show that each of Tyr380 and Tyr105 is important, albeit not essential for binding, degradation, and multiple attack on polysaccharides, while Tyr105 predominates in oligosaccharide hydrolysis. Additional delicate structure/function relationships of the secondary site are uncovered using Y380A/H395A, Y380A, and H395A AMY1 mutants.

  19. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  20. Cell-associated alpha-amylases of butyrate-producing Firmicute bacteria from the human colon.

    PubMed

    Ramsay, Alan G; Scott, Karen P; Martin, Jenny C; Rincon, Marco T; Flint, Harry J

    2006-11-01

    Selected butyrate-producing bacteria from the human colon that are related to Roseburia spp. and Butyrivibrio fibrisolvens showed a good ability to utilize a variety of starches for growth when compared with the Gram-negative amylolytic anaerobe Bacteroides thetaiotaomicron. A major cell-associated amylase of high molecular mass (140-210 kDa) was detected in each strain by SDS-PAGE zymogram analysis, and genes corresponding to these enzymes were analysed for two representative strains. Amy13B from But. fibrisolvens 16/4 is a multi-domain enzyme of 144.6 kDa that includes a family 13 glycoside hydrolase domain, and duplicated family 26 carbohydrate-binding modules. Amy13A (182.4 kDa), from Roseburia inulinivorans A2-194, also includes a family 13 domain, which is preceded by two repeat units of approximately 116 aa rich in aromatic residues, an isoamylase N-terminal domain, a pullulanase-associated domain, and an additional unidentified domain. Both Amy13A and Amy13B have N-terminal signal peptides and C-terminal cell-wall sorting signals, including a modified LPXTG motif similar to that involved in interactions with the cell surface in other Gram-positive bacteria, a hydrophobic transmembrane segment, and a basic C terminus. The overexpressed family 13 domains showed an absolute requirement for Mg2+ or Ca2+ for activity, and functioned as 1,4-alpha-glucanohydrolases (alpha-amylases; EC 3.2.1.1). These major starch-degrading enzymes thus appear to be anchored to the cell wall in this important group of human gut bacteria.

  1. Structural analysis of a chimeric bacterial alpha-amylase. High-resolution analysis of native and ligand complexes.

    PubMed

    Brzozowski, A M; Lawson, D M; Turkenburg, J P; Bisgaard-Frantzen, H; Svendsen, A; Borchert, T V; Dauter, Z; Wilson, K S; Davies, G J

    2000-08-08

    Several chimeric alpha-amylases genes were constructed by an in vivo recombination technique from the Bacillus amyloliquefaciens and Bacillus licheniformis genes. One of the fusion amylases (hereafter BA2), consisting of residues 1-300 from B. amyloliquefaciens and 301-483 from B. licheniformis, has been extensively studied by X-ray crystallography at resolutions between 2.2 and 1.7 A. The 3-dimensional structure of the native enzyme was solved by multiple isomorphous replacement, and refined at a resolution of 1.7 A. It consists of 483 amino acids, organized similarly to the known B. lichiniformis alpha-amylase structure [Machius et al. (1995) J. Mol. Biol. 246, 545-559], but features 4 bound calcium ions. Two of these form part of a linear cluster of three ions, the central ion being attributed to sodium. This cluster lies at the junction of the A and B domains with one calcium of the cluster structurally equivalent to the major Ca(2+) binding site of fungal alpha-amylases. The third calcium ion is found at the interface of the A and C domains. BA2 contains a fourth calcium site, not observed in the B. licheniformis alpha-amylase structure. It is found on the C domain where it bridges the two beta-sheets. Three acid residues (Glu261, Asp328, and Asp231) form an active site similar to that seen in other amylases. In the presence of TRIS buffer, a single molecule of TRIS occupies the -1 subsite of the enzyme where it is coordinated by the three active-center carboxylates. Kinetic data reveal that BA2 displays properties intermediate to those of its parents. Data for crystals soaked in maltooligosaccharides reveal the presence of a maltotriose binding site on the N-terminal face of the (beta/alpha)(8) barrel of the molecule, not previously described for any alpha-amylase structure, the biological function of which is unclear. Data for a complex soaked with the tetrasaccharide inhibitor acarbose, at 1.9 A, reveal a decasaccharide moiety, spanning the -7 to +3

  2. Plant cell calcium-rich environment enhances thermostability of recombinantly produced alpha-amylase from the hyperthermophilic bacterium Thermotoga maritime.

    PubMed

    Santa-Maria, Monica C; Chou, Chung-Jung; Yencho, G Craig; Haigler, Candace H; Thompson, William F; Kelly, Robert M; Sosinski, Bryon

    2009-12-01

    In the industrial processing of starch for sugar syrup and ethanol production, a liquefaction step is involved where starch is initially solubilized at high temperature and partially hydrolyzed with a thermostable and thermoactive alpha-amylase. Most amylases require calcium as a cofactor for their activity and stability, therefore calcium, along with the thermostable enzyme, are typically added to the starch mixture during enzymatic liquefaction, thereby increasing process costs. An attractive alternative would be to produce the enzyme directly in the tissue to be treated. In a proof of concept study, tobacco cell cultures were used as model system to test in planta production of a hyperthermophilic alpha-amylase from Thermotoga maritima. While comparable biochemical properties to recombinant production in Escherichia coli were observed, thermostability of the plant-produced alpha-amylase benefited significantly from high intrinsic calcium levels in the tobacco cells. The plant-made enzyme retained 85% of its initial activity after 3 h incubation at 100 degrees C, whereas the E. coli-produced enzyme was completely inactivated after 30 min under the same conditions. The addition of Ca(2+) or plant cell extracts from tobacco and sweetpotato to the E. coli-produced enzyme resulted in a similar stabilization, demonstrating the importance of a calcium-rich environment for thermostability, as well as the advantage of producing this enzyme directly in plant cells where calcium is readily available.

  3. A single residue mutation abolishes attachment of the CBM26 starch-binding domain from Lactobacillus amylovorus alpha-amylase.

    PubMed

    Rodríguez-Sanoja, Romina; Oviedo, N; Escalante, L; Ruiz, B; Sánchez, S

    2009-03-01

    Starch is degraded by amylases that frequently have a modular structure composed of a catalytic domain and at least one non-catalytic domain that is involved in polysaccharide binding. The C-terminal domain from the Lactobacillus amylovorus alpha-amylase has an unusual architecture composed of five tandem starch-binding domains (SBDs). These domains belong to family 26 in the carbohydrate-binding modules (CBM) classification. It has been reported that members of this family have only one site for starch binding, where aromatic amino acids perform the binding function. In SBDs, fold similarities are better conserved than sequences; nevertheless, it is possible to identify in CBM26 members at least two aromatic residues highly conserved. We attempt to explain polysaccharide recognition for the L. amylovorus alpha-amylase SBD through site-directed mutagenesis of aromatic amino acids. Three amino acids were identified as essential for binding, two tyrosines and one tryptophan. Y18L and Y20L mutations were found to decrease the SBD binding capacity, but unexpectedly, the mutation at W32L led to a total loss of affinity, either with linear or ramified substrates. The critical role of Trp 32 in substrate binding confirms the presence of just one binding site in each alpha-amylase SBD.

  4. Rubusuaviins A-F, monomeric and oligomeric ellagitannins from Chinese sweet tea and their alpha-amylase inhibitory activity.

    PubMed

    Li, Haizhou; Tanaka, Takashi; Zhang, Ying-Jun; Yang, Chong-Ren; Kouno, Isao

    2007-09-01

    Six new ellagitannins herein, rubusuaviins A-F, were isolated from the aqueous acetone extract of Chinese sweet tea (Tien-cha, dried leaves of Rubus suavissimus S. LEE) together with seven known tannins. Rubusuaviin A was characterized as 1-O-galloyl-2,3-O-(S)-HHDP-4,6-O-(S)-sanguisorboyl-beta-D-glucopyranose. Rubusuaviins B, C, and E are dimeric, trimeric, and tetrameric ellagitannins, respectively, in which the sanguisorboyl groups were connected ellagitannin units. Rubusuaviins D and F were desgalloyl derivatives of rubusuaviins C and E, respectively. The inhibition of alpha-amylase activity by rubusuaviins and related ellagitannins was compared. Ellagitannins with beta-galloyl groups at the glucose C-1 positions showed stronger inhibition compared with the alpha-galloyl and desgalloyl compounds. The molecular weight of these compounds was not important for the inhibition of alpha-amylase activity.

  5. Putative implication of alpha-amylase loop 7 in the mechanism of substrate binding and reaction products release.

    PubMed

    André, G; Tran, V

    2004-10-05

    Alpha-amylases are widespread endo-enzymes involved in the hydrolysis of internal alpha-(1,4) glycosidic linkages of starch polymers. Molecular modeling of amylose-amylase interactions is a step toward enzymatic mechanism understanding and rational design of new enzymes. From the crystallographic complex of barley alpha-amylase AMY2-acarbose, the static aspects of amylose-amylase docking have been characterized with a model of maltododecaose (DP12) (G. André, A. Buléon, R. Haser, and V. Tran, Biopolymers 1999, Vol. 50, pp. 751-762; G. André and V. Tran, Special Publication no. 246 1999, The Royal Society of Chemistry, H. J. Gilbert, G. J. Davies, B. Henrissat, and B. Svensson, Eds., Cambridge, pp. 165-174). These studies, consistent with the experimental subsite mapping (K. Bak-Jensen, G. André, V. Tran, and B. Svensson, Journal of Biological Chemistry, to be published), propose a propagation scheme for an amylose chain in the active cleft of AMY2. The topographical overview of alpha-amylases identified loop 7 as a conserved segment flanking the active site. Since some crystallographic experiments suspected its high flexibility, its putative motion was explored through a robotic scheme, an alternate route to dynamics simulations that consume CPU time. The present article describes the characteristics of the flexibility of loop 7: location and motion in AMY2. A back-and-forth motion with a large amplitude of more than 0.6 nm was evaluated. This movement could be triggered by two hinge residues. It results in the loop flipping over the active site to enhance the docking of the native helical substrate through specific interactions, it positions the catalytic residues, it distorts the substrate towards its transition state geometry, and finally monitors the release of the products after hydrolysis. The residues involved in the process are now rational mutation points in the hands of molecular biologists.

  6. Structures of Thermoactinomyces vulgaris R-47 alpha-amylase II complexed with substrate analogues.

    PubMed

    Yokota, T; Tonozuka, T; Shimura, Y; Ichikawa, K; Kamitori, S; Sakano, Y

    2001-03-01

    The structures of Thermoactinomyces vulgaris R-47 alpha-amylase II mutant (d325nTVA II) complexed with substrate analogues, methyl beta-cyclodextrin (m beta-CD) and maltohexaose (G6), were solved by X-ray diffraction at 3.2 A and 3.3 A resolution, respectively. In d325nTVA II-m beta-CD complex, the orientation and binding-position of beta-CD in TVA II were identical to those in cyclodextin glucanotransferase (CGTase). The active site residues were essentialy conserved, while there are no residues corresponding to Tyr89, Phe183, and His233 of CGTase in TVA II. In d325nTVA II-G6 complex, the electron density maps of two glucosyl units at the non-reducing end were disordered and invisible. The four glucosyl units of G6 were bound to TVA II as in CGTase, while the others were not stacked and were probably flexible. The residues of TVA II corresponding to Tyr89, Lys232, and His233 of CGTase were completely lacking. These results suggest that the lack of the residues related to alpha-glucan and CD-stacking causes the functional distinctions between CGTase and TVA II.

  7. Relationship of sequence and structure to specificity in the alpha-amylase family of enzymes.

    PubMed

    MacGregor, E A; Janecek, S; Svensson, B

    2001-03-09

    The hydrolases and transferases that constitute the alpha-amylase family are multidomain proteins, but each has a catalytic domain in the form of a (beta/alpha)(8)-barrel, with the active site being at the C-terminal end of the barrel beta-strands. Although the enzymes are believed to share the same catalytic acids and a common mechanism of action, they have been assigned to three separate families - 13, 70 and 77 - in the classification scheme for glycoside hydrolases and transferases that is based on amino acid sequence similarities. Each enzyme has one glutamic acid and two aspartic acid residues necessary for activity, while most enzymes of the family also contain two histidine residues critical for transition state stabilisation. These five residues occur in four short sequences conserved throughout the family, and within such sequences some key amino acid residues are related to enzyme specificity. A table is given showing motifs distinctive for each specificity as extracted from 316 sequences, which should aid in identifying the enzyme from primary structure information. Where appropriate, existing problems with identification of some enzymes of the family are pointed out. For enzymes of known three-dimensional structure, action is discussed in terms of molecular architecture. The sequence-specificity and structure-specificity relationships described may provide useful pointers for rational protein engineering.

  8. Effects of a dietary Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle.

    PubMed

    Tricarico, J M; Abney, M D; Galyean, M L; Rivera, J D; Hanson, K C; McLeod, K R; Harmon, D L

    2007-03-01

    Three experiments were conducted to examine the effects of an Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle. In Exp. 1, 120 crossbred steers were used in a randomized complete block design to evaluate the effects of roughage source (alfalfa hay vs. cottonseed hulls) and supplemental alpha-amylase at 950 dextrinizing units (DU)/kg of DM. Significant roughage source x alpha-amylase interactions (P < 0.05) were observed for performance. In steers fed cottonseed hulls, supplemental alpha-amylase increased ADG through d 28 and 112 and tended (P < 0.15) to increase ADG in all other periods. The increases in ADG were related to increased DMI and efficiency of gain during the initial 28-d period but were primarily related to increased DMI as the feeding period progressed. Supplemental alpha-amylase increased (P = 0.02) the LM area across both roughage sources. In Exp. 2, 96 crossbred heifers were used in a randomized complete block design with a 2 x 3 factorial arrangement of treatments to evaluate the effects of corn processing (dry cracked vs. high moisture) and supplemental alpha-amylase concentration (0, 580, or 1,160 DU/kg of DM). Alpha-amylase supplementation increased DMI (P = 0.05) and ADG (P = 0.03) during the initial 28 d on feed and carcass-adjusted ADG (P = 0.04) across corn processing methods. Longissimus muscle area was greatest (quadratic effect, P = 0.04), and yield grade was least (quadratic effect, P = 0.02) in heifers fed 580 DU of alpha-amylase/kg of DM across corn processing methods. In Exp. 3, 56 crossbred steers were used in a randomized complete block design to evaluate the effects of supplemental alpha-amylase (930 DU/kg of DM) on performance when DMI was restricted to yield a programmed ADG. Alpha-amylase supplementation did not affect performance when DMI was restricted. We conclude that dietary alpha-amylase supplementation of finishing beef diets may result in

  9. Structures of sugar chains of the subunits of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Yamaguchi, H; Funaoka, H; Iwamoto, H

    1992-03-01

    The structures of asparagine-linked oligosaccharides in the subunits of an alpha-amylase inhibitor from the white kidney bean (Phaseolus vulgaris) were determined. Glycopeptides obtained from each subunit were treated with hydrazine, then N-acetylated. The oligosaccharides thus liberated were labeled with 2-aminopyridine at their reducing ends and purified by gel-permeation, reverse-phase, and size-fractionation HPLC. The structures of seven oligosaccharides from the alpha-subunit and eight oligosaccharides from the beta-subunit were determined by a combination of composition and molecular size analyses, exo- and endoglycosidase digestions, partial acetolysis, and 1H-NMR spectroscopy. The major glycan chains in the alpha-subunit were Man alpha 1-6(Man alpha 1-3)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)-Man beta 1-4GlcNAc beta 1-4GlcNAc and (Man alpha 1-2)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)Man alpha 1-6 (Man alpha 1-2Man alpha 1-2Man alpha 1-3)Man beta 1-4GlcNAc beta 1-4GlcNAc, while a glycan chain Man alpha 1-6(Man alpha 1-3)(Xyl beta 1-2)Man beta 1-4GlcNAc beta 1-4GlcNAc comprised more than 70% of the sugar moiety of the beta-subunit.

  10. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional alpha-amylase/subtilisin inhibitor from Oryza sativa.

    PubMed

    Lin, Yi Hung; Peng, Wen Yan; Huang, Yen Chieh; Guan, Hong Hsiang; Hsieh, Ying Cheng; Liu, Ming Yih; Chang, Tschining; Chen, Chun Jung

    2006-08-01

    Rice bifunctional alpha-amylase/subtilisin inhibitor (RASI) can inhibit both alpha-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 angstroms resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P2(1)2(1)2, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 angstroms. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%.

  11. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).

    PubMed

    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima

    2006-09-01

    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  12. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  13. Hyperthermostable, Ca(2+)-independent, and high maltose-forming alpha-amylase production by an extreme thermophile Geobacillus thermoleovorans: whole cell immobilization.

    PubMed

    Rao, J L Uma Maheswar; Satyanarayana, T

    2009-11-01

    The synthesis of extracellular alpha-amylase in Geobacillus thermoleovorans was constitutive. The enzyme was secreted in metabolizable carbon sources as well as non-metabolizable synthetic analogues of glucose, but the titers were higher in the former than that in the latter. G. thermoleovorans is a fast-growing facultatively anaerobic bacterium that grows under both aerobic and anaerobic conditions and produces an extracellular amylolytic enzyme alpha-amylase with the by-product of lactic acid. G. thermoleovorans is a rich source of various novel thermostable biocatalysts for different industrial applications. alpha-Amylase synthesis was subject to catabolite repression in the presence of high concentrations of glucose. The addition of cAMP to the medium containing glucose did not result in the repression of alpha-amylase synthesis. The addition of maltose (1%) to the starch arginine medium resulted in a twofold enhancement in enzyme titers. Polyurethane foam (PUF)-immobilized cells secreted alpha-amylase, which was higher than that with the free cells. PUF appeared to be a better matrix for immobilization of the thermophilic bacterium than the other commonly used matrices. The repeated use of PUF-immobilized cells was possible over 15 cycles with a sustained alpha-amylase secretion. The use of this enzyme in starch saccharification eliminates the addition of Ca(2+) in starch liquefaction and its subsequent removal by ion exchangers from the product streams.

  14. Sociodemographic Risk, Parenting, and Effortful Control: Relations to Salivary Alpha-amylase and Cortisol in Early Childhood

    PubMed Central

    Taylor, Zoe E.; Spinrad, Tracy L.; VanSchyndel, Sarah K.; Eisenberg, Nancy; Huynh, Jacqueline; Sulik, Michael J.; Granger, Douglas A.

    2012-01-01

    Early sociodemographic risk, parenting, and temperament were examined as predictors of the activity of children’s (N = 148; 81 boys, 67 girls) hypothalamic-pituitary-adrenal axis and autonomic nervous system. Demographic risk was assessed at 18 months (T1), intrusive-overcontrolling parenting and effortful control were assessed at 30 months (T2), and salivary cortisol and alpha-amylase were collected at 72 (T3) months of age. Demographic risk at T1 predicted lower levels of children’s effortful control and higher levels of mothers’ intrusive-overcontrolling parenting at T2. Intrusive-overcontrolling parenting at T2 predicted higher levels of children’s cortisol and alpha-amylase at T3, but effortful control did not uniquely predict children’s cortisol or alpha-amylase. Findings support the open nature of stress responsive physiological systems to influence by features of the early caregiving environment and underscore the utility of including measures of these systems in prevention trials designed to influence child outcomes by modifying parenting behavior. PMID:22949301

  15. Fed-batch optimization of alpha-amylase and protease-producing Bacillus subtilis using Markov chain methods.

    PubMed

    Skolpap, Wanwisa; Scharer, J M; Douglas, P L; Moo-Young, M

    2004-06-20

    A stoichiometry-based model for the fed-batch culture of the recombinant bacterium Bacillus subtilis ATCC 6051a, producing extracellular alpha-amylase as a desirable product and proteases as undesirable products, was developed and verified. The model was then used for optimizing the feeding schedule in fed-batch culture. To handle higher-order model equations (14 state variables), an optimization methodology for the dual-enzyme system is proposed by integrating Pontryagin's optimum principle with fermentation measurements. Markov chain Monte Carlo (MCMC) procedures were appropriate for model parameter and decision variable estimation by using a priori parameter distributions reflecting the experimental results. Using a simplified Metropolis-Hastings algorithm, the specific productivity of alpha-amylase was maximized and the optimum path was confirmed by experimentation. The optimization process predicted a further 14% improvement of alpha-amylase productivity that could not be realized because of the onset of sporulation. Among the decision variables, the switching time from batch to fed-batch operation (t(s)) was the most sensitive decision variable.

  16. Crystal structure of calcium-depleted Bacillus licheniformis alpha-amylase at 2.2 A resolution.

    PubMed

    Machius, M; Wiegand, G; Huber, R

    1995-03-03

    The three-dimensional structure of the calcium-free form of Bacillus licheniformis alpha-amylase (BLA) has been determined by multiple isomorphous replacement in a crystal of space group P4(3)2(1)2 (a = b = 119.6 A, c = 85.4 A). The structure was refined using restrained crystallographic refinement to an R-factor of 0.177 for 28,147 independent reflections with intensities FObs > 0 at 2.2 A resolution, with root mean square deviations of 0.008 A and 1.4 degrees from ideal bond lengths and bond angles, respectively. The final model contains 469 residue, 237 water molecules, and one chloride ion. The segment between Trp182 and Asn192 could not be located in the electron density, nor could the N and C termini. Cleavage of the calcium-free form of BLA was observed after Glu189, due to a Glu-C endopeptidase present in trace amounts in the preparation. BLA did not crystallize without this cleavage under the conditions applied. BLA exhibits the characteristic overall topological fold observed for other alpha-amylases and related amylolytic enzymes: a central domain A containing an alpha/beta-barrel with a large protrusion between beta-strand 3 and alpha-helix 3 (domain B) and a C-terminal greek key motif (domain C). Unlike in the other enzymes, domain B possesses a beta-sheet made up of six loosely connected, twisted beta-strands forming a kind of a barrel with a large hole in the interior. Topological comparisons to TAKA-amylase, pig pancreatic alpha-amylase and cyclodextrin glycosyltransferase reveal a very high structural equivalence for large portions of the proteins and an exceptionally pronounced structural similarity for calcium binding, chloride binding and the active site. None of the theories proposed to explain the enhanced thermostability of BLA showed a satisfactory correlation with the three-dimensional structure. Instead, sequence comparisons to the less thermostable bacterial alpha-amylase from Bacillus amyloliquefaciens (BAA) indicate that some ionic

  17. Continuous automated assay of alpha-amylase release from superfused rat salivary gland.

    PubMed

    Templeton, D

    1980-11-01

    A method of continuous automated amylase assay is described. This relies on the absorption of iodine by starch to produce a blue color that can be quantified colorimetrically. Digestion of the starch by amylase released from parotid tissue slices reduces the intensity of the color formed, allowing quantification of the amylase released. The assay in sensitive to 0.05 U/amylase/ml and linear up to 13 U/ml. Typical tissue responses to acetyl-beta-methylcholine and isoprenaline are presented.

  18. Job categories and their effect on exposure to fungal alpha-amylase and inhalable dust in the U.K. baking industry.

    PubMed

    Elms, Joanne; Beckett, Paul; Griffin, Peter; Evans, Paul; Sams, Craig; Roff, Martin; Curran, Andrew D

    2003-01-01

    Enzymes in flour improver, in particular fungal alpha-amylase, are known to be a significant cause of respiratory allergy in the baking industry. This study measured total inhalable dust and fungal alpha-amylase exposures in U.K. bakeries, mills, and a flour improver production and packing facility and determined whether assignment of job description could identify individuals with the highest exposures to fungal alpha-amylase and inhalable dust. A total of 117 personal samples were taken for workers in 19 bakeries, 2 mills, and a flour improver production and packing facility and were analyzed using a monoclonal based immunoassay. Occupational hygiene surveys were undertaken for each site to assign job description and identify individuals who worked directly with flour improvers. Analysis of exposure data identified that mixers and weighers from large bakeries had the highest exposures to both inhalable dust and fungal alpha-amylase among the different categories of bakery workers (p<.01). Currently, the maximum exposure limit for flour dust in the United Kingdom is 10 mg/m(3) (8-hour time-weighted average reference period). In this study 25% of the total dust results for bakers exceeded 10 mg/m(3), and interestingly, 63% of the individuals with exposure levels exceeding 10 mg/m(3) were weighers and mixers. Individuals who worked directly with flour improvers were exposed to higher levels of both inhalable dust and fungal alpha-amylase (p<.01) than those who were not directly handling these products. Before sensitive immunoassays were utilized for the detection of specific inhalable allergens, gravimetric analysis was often used as a surrogate. There was a weak relationship between inhalable dust and fungal alpha-amylase exposures; however, inhalable dust levels could not be used to predict amylase exposures, which highlights the importance of measuring both inhalable dust and fungal alpha-amylase exposures.

  19. Salivary Alpha-Amylase Activity and Salivary Flow Rate in Young Adults

    PubMed Central

    Arhakis, Aristidis; Karagiannis, Vasilis; Kalfas, Sotirios

    2013-01-01

    The secretion of salivary alpha-amylase (sAA) is more associated with psychoneuroendocrinological response to stress than with the flow rate and age. The aim of this cross sectional study is to build an explanatory model based on patterns of relationship between age 20-39 in resting and stimulated saliva under no stressful condition in healthy volunteers. Both resting and stimulated saliva were collected from 40 subjects. The sAA values were log-transformed, the normality assumption was verified with the Shapiro-Wilk test and the reliability of the measurements was estimated by the Pearsons’ r correlation coefficient. The estimated model was based on the theory of the Linear Mixed Models. Significant mean changes were observed in flow rate and sAA activity between resting and stimulated saliva. The final model consists of two components, the first revealed a positive correlation between age and sAA while the second one revealed a negative correlation between the interaction of age × flow rate in its condition (resting or stimulated saliva), with sAA. Both flow rate and age influence sAA activity. PMID:23524385

  20. Harsh discipline and behavior problems: the moderating effects of cortisol and alpha-amylase.

    PubMed

    Chen, Frances R; Raine, Adrian; Rudo-Hutt, Anna S; Glenn, Andrea L; Soyfer, Liana; Granger, Douglas A

    2015-01-01

    Numerous studies link harsh discipline to adjustment problems in youth, yet not all individuals exposed to harsh discipline develop behavior problems. Contemporary theory suggests that this relationship could be moderated by individual differences in environmentally sensitive biological systems. This study investigated whether the interaction between hypothalamic-pituitary-adrenal (HPA) activity and autonomic nervous system (ANS) arousal moderated the link between harsh discipline and behavior problems. Three saliva samples were collected on a single day from 425 inner city youth (50% male, age 11-12 years, 80% African American) and were later assayed for cortisol (HPA) and alpha-amylase (ANS). Problem behavior was assessed by self- and parent-report using the Child Behavior Checklist. Youth also reported the level of harsh discipline that they experienced. Harsh discipline was positively associated with externalizing and internalizing problems only when there were asymmetrical profiles of HPA activity and ANS arousal. This pattern was evident for boys but not girls. Findings are discussed in relation to prevailing theories suggesting that biological susceptibility translates adversity into risk for behavior problems.

  1. Salivary Alpha-amylase and Cortisol in Toddlers: Differential Relations to Affective Behavior

    PubMed Central

    Fortunato, Christine K.; Dribin, Amy E.; Granger, Douglas A.; Buss, Kristin A.

    2008-01-01

    This study applies a non-invasive and multi-system measurement approach (using salivary analytes) to examine associations between the psychobiology of the stress response and affective behavior in toddlers. Eighty-seven two-year-olds (48 females) participated in laboratory tasks designed to elicit emotions and behavior ranging from pleasure/approach to fear/withdrawal. Saliva samples were collected pre-task and immediately post-task, and assayed for markers of sympathetic nervous system (alpha-amylase or sAA) and hypothalamic-pituitary-adrenal axis (cortisol) activity. Individual differences in sAA were positively associated with approach behavior and positive affect; whereas, cortisol was positively associated with negative affect and withdrawal behavior. The findings suggest that individual differences in sAA may covary specifically with positive affect and approach behaviors or the predominant emotional state across a series of tasks. The results are discussed with respect to advancing biosocial models of the concomitants and correlates of young children’s affective behaviors. PMID:18688807

  2. Salivary Alpha-Amylase Enzyme, Psychological Disorders, and Life Quality in Patients with Recurrent Aphthous Stomatitis

    PubMed Central

    Cardoso, Juliana Andrade; dos Santos Junior, André Avelino; Nunes, Maria Lucia Tiellet; de Figueiredo, Maria Antonia Zancanaro; Cherubini, Karen

    2017-01-01

    Objective. The aim of this study was to evaluate stress, anxiety, and salivary alpha-amylase (SAA) activity in patients with recurrent aphthous stomatitis (RAS). The impact of this disease on the life quality was also evaluated. Design. Twenty-two patients with RAS and controls, matched by sex and age, were selected. Stress and anxiety were assessed using Lipp's Inventory of Stress Symptoms and Beck Anxiety Inventory. Life quality was assessed through the World Health Organization Quality of Life-bref (WHOQOL-BREF) and the Oral Health Impact Profile-14 (OHIP-14). Saliva samples were collected in the morning and afternoon and the SAA activity was analyzed by enzymatic kinetic method. Results. No significant difference was observed between the groups regarding the SAA activity (p = 0.306). Patients with RAS had higher scores of anxiety (p = 0.016). The scores of WHOQOL-BREF were significantly lower in patients with RAS. The values obtained through OHIP-14 were significantly higher in these patients (p = 0.002). Conclusion. RAS negatively affects the life quality. Patients with the disease have higher levels of anxiety, suggesting its association with the etiopathogenesis of RAS.

  3. Salivary nitric oxide and alpha-amylase as indexes of training intensity and load.

    PubMed

    Diaz, M M; Bocanegra, O L; Teixeira, R R; Soares, S S; Espindola, F S

    2013-01-01

    This study examined the variation in salivary nitric oxide (NO), alpha-amylase (sAA) and serum markers of muscle injury during 21 weeks of training in elite swimmers. Samples of saliva and blood were collected once a month during 5 months from 11 male professional athletes during their regular training season. The variation in each marker throughout the 21 weeks was compared with the dynamics of training volume, intensity and load. Unstimulated whole saliva was assessed for NO and sAA whereas venous blood was assessed for lactate dehydrogenase, creatine kinase, and γ-glutamyltransferase. Nitric oxide and sAA showed a proportional response to the intensity of training. However, whereas the concentration of NO increased across the 21 weeks, the activity of sAA decreased. Similar variations in the concentration of NO and the markers of muscle injury were also observed. The higher concentration of NO might be attributed to changes in haemodynamics and muscle regenerative processes. On the other hand, autonomic regulation towards parasympathetic predominance might have been responsible for the decrease in sAA activity. These findings provide appealing evidence for the utilization of salivary constituents in sports medicine to monitor training programmes.

  4. Directed evolution of a maltogenic alpha-amylase from Bacillus sp. TS-25.

    PubMed

    Jones, Aubrey; Lamsa, Michael; Frandsen, Torben P; Spendler, Tina; Harris, Paul; Sloma, Alan; Xu, Feng; Nielsen, Jack Bech; Cherry, Joel R

    2008-04-30

    Directed evolution coupled with a high-throughput robotic screen was employed to broaden the industrial use of the maltogenic alpha-amylase Novamyl from Bacillus sp. TS-25. Wild-type Novamyl is currently used in the baking industry as an anti-staling agent in breads baked at neutral or near neutral pH. However, the enzyme is rapidly inactivated during the baking process of bread made with low pH recipes and Novamyl thus has very limited beneficial effect for this particular application. In an effort to improve the performance of Novamyl for low pH bread applications such as sourdough and rye, two error-prone PCR libraries were generated, expressed in Bacillus subtilis and screened for variants with improved thermal stability and activity under low pH conditions. Variants exhibiting improved performance were iteratively recombined using DNA shuffling to create two generations of libraries. Relative to wild-type Novamyl, a number of the resulting variants exhibited more than 10 degrees C increase in thermal stability at pH 4.5, one of which demonstrated substantial anti-staling properties in low pH breads.

  5. Autonomic markers associated with generalized social phobia symptoms: heart rate variability and salivary alpha-amylase.

    PubMed

    García-Rubio, María J; Espín, Laura; Hidalgo, Vanesa; Salvador, Alicia; Gómez-Amor, Jesús

    2017-01-01

    The study of autonomic nervous system changes associated with generalized social phobia (GSP) disorder has increased in recent years, showing contradictory results. The present study aimed to evaluate how young people with GSP reacted before, during, and after exposure to the Trier Stress Social Test (TSST), focusing on their autonomic changes (heart rate variability (HRV) and salivary alpha-amylase (sAA)) compared to a control group (non-GSP). Some psychological variables were also considered. Sex was specifically studied as a possible modulator of autonomic fluctuations and psychological state. Eighty young people were randomly distributed into two counterbalanced situations: stress condition (N = 18 and 21 for GSP and non-GSP, respectively) and control condition (N = 21 and 20 for GSP and non-GSP, respectively), where cardiovascular variables were continuously recorded. Psychological questionnaires about mood and perceived stress were filled out, and five saliva samples were collected to analyze sAA. GSP participants showed higher values on low- and high-frequency ratios (HR domains), compared to non-GSP people, during exposure to the TSST, but no differences were observed after the stressor. Furthermore, the two groups did not differ in sAA. Importantly, positive affect in GSP participants was modulated by sex. The present study suggests that the balance between high- and low-frequency domains of HRV is a key cardiovascular marker reflecting the stress response of GSP people, as well the importance of sex in positive affect when facing a stressful situation.

  6. Diurnal alpha amylase patterns in adolescents: associations with puberty and momentary mood states.

    PubMed

    Adam, Emma K; Till Hoyt, Lindsay; Granger, Douglas A

    2011-12-01

    Salivary alpha amylase (sAA) has been proposed as a marker of autonomic nervous system activity. Few studies have examined sAA basal activity and reactivity in naturalistic settings, or developmental changes in sAA. In 50 adolescents, diary-reported moods and sAA levels were gathered across two typical weekdays. As in adults, basal sAA levels were low at waking and increased across the day. More advanced pubertal development was associated with higher waking sAA levels; males had smaller sAA increases across the day. High arousal positive emotions (feeling strong, active, excited) were associated with acute sAA increases; high arousal negative emotions (angry, stressed, nervous, worried) predicted sAA increases among youth with high average levels of these emotions. Findings suggest that basal sAA levels increase with puberty, and that acute sAA increases may reflect levels of emotional arousal, including high arousal positive emotions, rather than being specific to stress or emotions of negative valence.

  7. Inhibition of human salivary alpha-amylase by glucopyranosylidene-spiro-thiohydantoin.

    PubMed

    Gyémánt, Gyöngyi; Kandra, Lili; Nagy, Veronika; Somsák, László

    2003-12-12

    This study is the first report on the effectiveness and specificity of glucopyranosylidene-spiro-thiohydantoin (G-TH) inhibitor on the 2-chloro-4-nitrophenyl-4-O-beta-D-galactopyranosyl-maltoside (GalG(2)CNP) hydrolysis catalysed by human salivary alpha-amylase (HSA). The inhibition of hydrolysis is a mixed-noncompetitive type. In any case, only one molecule of inhibitor binds to HSA. Since our substrate and inhibitor are small molecules the long enough active site facilitates accommodating both of them simultaneously. However, the product formation can be excluded from enzyme-substrate-inhibitor complex (ESI) since Dixon plots are linear. Kinetic constants calculated from secondary plots and nonlinear regression are almost entirely equal, confirming the fidelity of the suggested model. Kinetic constants (K(1i)=7.3mM, L(1i)=2.84 mM) show that G-TH is not such a potent inhibitor of HSA as acarbose and indicate higher stability for ESI than for enzyme-inhibitor complex.

  8. Effect of temperature on subsite map of Bacillus licheniformis alpha-amylase.

    PubMed

    Kandra, Lili; Remenyik, Judit; Gyémánt, Gyöngyi; Lipták, A

    2006-09-01

    To elucidate how temperature effects subsite mapping of a thermostable alpha-amylase from Bacillus licheniformis (BLA), a comparative study was performed by using 2-chloro-4-nitrophenyl (CNP) beta-maltooligosides with degree of polymerisation (DP) 4-10 as model substrates. Action patterns, cleavage frequencies and subsite binding energies were determined at 50 degrees C, 80 degrees C and 100 degrees C. Subsite map at 80 degrees C indicates more favourable bindings compared to the hydrolysis at 50 degrees C. Hydrolysis at 100 degrees C resulted in a clear shift in the product pattern and suggests significant differences in the active site architecture. Two preferred cleavage modes were seen for all substrates in which subsite (+2) and (+3) were dominant, but CNP-G1 was never formed. In the preferred binding mode of shorter oligomers, CNP-G2 serves as the leaving group (79%, 50%, 59% and 62% from CNP-G4, CNP-G5, CNP-G6 and CNP-G7, respectively), while CNP-G3 is the dominant hydrolysis product from CNP-G8, CNP-G9, and CNP-Gl0 (62%, 68% and 64%, respectively). The high binding energy value (-17.5 kJ/mol) found at subsite (+2) is consistent with the significant formation of CNP-G2. Subsite mapping at 80 degrees C and 100 degrees C confirms that there are no further binding sites despite the presence of longer products.

  9. Conversion of the maltogenic alpha-amylase Novamyl into a CGTase.

    PubMed

    Beier, L; Svendsen, A; Andersen, C; Frandsen, T P; Borchert, T V; Cherry, J R

    2000-07-01

    Novamyl is a thermostable five-domain maltogenic alpha-amylase that shows sequence and structural homology with the cyclodextrin glycosyltransferases (CGTases). Comparing X-ray crystal structures of Novamyl and CGTases, two major differences in the active site cleft were observed: Novamyl contains a loop insertion consisting of five residues (residues 191-195) and the location of an aromatic residue known to be essential to obtain an efficient cyclization reaction. To convert Novamyl into a cyclodextrin (CD)-producing enzyme, the loop was deleted and two substitutions, F188L and T189Y, were introduced. Unlike the parent Novamyl, the obtained variant is able to produce beta-CD and showed an overall conversion of starch to CD of 9%, compared with CGTases which are able to convert up to 40%. The lower conversion compared with the CGTase is probably due to additional differences in the active site cleft and in the starch-binding E domain. A variant with only the five-residue loop deleted was not able to form beta-CD.

  10. Children's cortisol and salivary alpha-amylase interact to predict attention bias to threatening stimuli.

    PubMed

    Ursache, Alexandra; Blair, Clancy

    2015-01-01

    Physiological responses to threat occur through both the autonomic nervous system (ANS) and the hypothalamic pituitary adrenal (HPA) axis. Activity in these systems can be measured through salivary alpha-amylase (sAA) and salivary cortisol, respectively. Theoretical work and empirical studies have suggested the importance of examining the coordination of these systems in relation to cognitive functioning and behavior problems. Less is known, however, about whether these systems interactively predict more automatic aspects of attention processing such as attention toward emotionally salient threatening stimuli. We used a dot probe task to assess attention bias toward threatening stimuli in 347 kindergarten children. Cortisol and sAA were assayed from saliva samples collected prior to children's participation in assessments on a subsequent day. Using regression analyses, we examined relations of sAA and cortisol to attention bias. Results indicate that cortisol and sAA interact in predicting attention bias. Higher levels of cortisol predicted greater bias toward threat for children who had high levels of sAA, but predicted greater bias away from threat for children who had low levels of sAA. These results suggest that greater symmetry in HPA and ANS functioning is associated with greater reliance on automatic attention processes in the face of threat.

  11. Calcium-binding parameter of Bacillus amyloliquefaciens alpha-amylase determined by inactivation kinetics.

    PubMed Central

    Tanaka, Atsushi; Hoshino, Eiichi

    2002-01-01

    The irreversible thermal inactivation and the thermodynamics of calcium ion binding of Bacillus amyloliquefaciens alpha-amylase in the absence of substrates were studied. The enzyme inactivation on heating was apparently followed by first-order kinetics. The enzyme was stabilized with an increased concentration of calcium ion and thus the inactivation was highly dependent on the state of calcium binding. The activation parameter for the inactivation suggests an unfolding of the enzyme protein upon heating. Values of both the activation enthalpy and entropy were increased with a higher calcium ion concentration. An inactivation kinetic model is based on the assumption of a two-stage unfolding transition in which the bivalent ion dissociation occurs in the first step followed by the secondary structural unfolding. This simple kinetic model provides both a qualitative and quantitative interpretation of calcium ion binding to the enzyme and its effect on the inactivation properties. The specific approximations of the kinetic model were strictly followed in the analysis to calculate the apparent inactivation rate at each calcium ion concentration in terms of the calcium-binding parameters. The enthalpy and entropy changes for the calcium ion binding were calculated to be -149 kJ/mol and -360 J.mol(-1).K(-1) respectively and these values suggest a strong enthalpic affinity for the bivalent ion binding to the enzyme protein. The thermodynamical interpretation attempts to provide clear relations between the terms of an apparent inactivation rate and the calcium binding. PMID:12049626

  12. Amylases in Pea Tissues with Reduced Chloroplast Density and/or Function.

    PubMed

    Saeed, M; Duke, S H

    1990-12-01

    Pea (Pisum sativum L.) tissues with reduced chloroplast density (e.g. petals and stems) or function (i.e. senescent leaves and leaves darkened for prolonged periods) were surveyed to determine whether tissues with genetically or environmentally reduced chloroplast density and/or function also have significantly different amylolytic enzyme activities and/or isoform patterns than leaf tissues with totally competent chloroplasts. Native PAGE followed by electrophoretically blotting through a starch or beta-limit dextrin containing gel and KI/I(2) staining revealed that the primary amylases in leaves, stems, petals, and roots were the primarily vacuolar beta-amylase (EC 3.2.1.2) and the primarily apoplastic alpha-amylase (EC 3.2.1.1). Among tissues of light grown pea plants, petals contained the highest levels of total amylolytic (primarily beta-amylase) activity and considerably higher ratios of beta- to alpha-amylase. In aerial tissues there was an inverse relationship between chlorophyll and starch concentration, and beta-amylase activity. In sections of petals and stems there was a pronounced inverse relationship between chlorophyll concentration and the activity of alpha-amylase. Senescing leaves of pea, as determined by age, and protein and chlorophyll content, contained 3.8-fold (fresh weight basis) and 32-fold (protein basis) higher alpha-amylase activity than fully mature leaves. Leaves maintained in darkness for 12 days displayed a 14-fold (fresh weight basis) increase in alpha-amylase activity over those grown under continuous light. In senescence and prolonged darkness studies, the alpha-amylase that was greatly increased in activity was the primarily apoplastic alpha-amylase. These studies indicate that there is a pronounced inverse relationship between chloroplast function and levels of apoplastic alpha-amylase activity and in some cases an inverse relationship between chloroplast density and/or function and vacuolar beta-amylase activity.

  13. Analysis of the extreme diversity of salivary alpha-amylase isoforms generated by physiological proteolysis using liquid chromatography-tandem mass spectrometry.

    PubMed

    Bailey, Ulla-Maja; Punyadeera, Chamindie; Cooper-White, Justin J; Schulz, Benjamin L

    2012-12-12

    Saliva is a crucial biofluid for oral health and is also of increasing importance as a non-invasive source of disease biomarkers. Salivary alpha-amylase is an abundant protein in saliva, and changes in amylase expression have been previously associated with a variety of diseases and conditions. Salivary alpha-amylase is subject to a high diversity of post-translational modifications, including physiological proteolysis in the oral cavity. Here we developed methodology for rapid sample preparation and non-targeted LC-ESI-MS/MS analysis of saliva from healthy subjects and observed an extreme diversity of alpha-amylase proteolytic isoforms. Our results emphasize the importance of consideration of post-translational events such as proteolysis in proteomic studies, biomarker discovery and validation, particularly in saliva.

  14. Structure of waxy maize starch hydrolyzed by maltogenic alpha-amylase in relation to its retrogradation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maltogenic a-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different...

  15. Production and characterization of alpha-amylase from mango kernel by Fusarium solani NAIMCC-F-02956 using submerged fermentation.

    PubMed

    Kumar, Devendra; Yadav, Kaushlesh K; Muthukumar, M; Garg, Neelima

    2013-11-01

    Microbial production of enzymes using low valued agro industrial wastes is gaining importance globally. Mango is one of the major fruit processed into a variety of products. During processing 40-50% of solid waste is generated in form of peel and stones. After decortications of mango stone, kernel is obtained which is a rich source of starch (upto 60%). It was utilized as a substrate for alpha-amylase production using Fusarium soloni. Maximum alpha-amylase production (0.889 U g(-1)) was recorded using a substrate concentration of 5% (w/v), pH-4 and temperature 30 degrees C on 9th day of incubation. Supplementation of production medium with micronutrients viz., Ca2+, Fe2+ or Mg2+ improved the enzyme production while, Zn2+, B3+ or Mn2+ ions exhibited inhibitory effect. The extracellular protein was precipitated by ammonium sulphate up to 70% saturation, dialyzed and purified (27.84 fold) by gel-exclusion (Sephadex G-75) chromatography. Protein profiling on 12% SDS-PAGE revealed three bands corresponding to 26, 27 and 30 kDa molecular sizes. The optimum amylase activity was achieved at pH 5.0 at 40 degrees C. The Michaelis constant (KM), Vmax and activation energy (-Ea) were found to be 3.7 mg ml(-1), 0.24 U mg(-1) and 42.39 kJ mole(-1), respectively.

  16. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum.

    PubMed

    Kim, Kyung-Tae; Rioux, Laurie-Eve; Turgeon, Sylvie L

    2014-02-01

    Fucoidan is a water-soluble, negatively charged, biologically active polysaccharide found in great abundance in brown marine algae. However, the inhibition of α-amylase and α-glucosidase by fucoidan derived from two algal species (Ascophyllum nodosum and Fucus vesiculosus) harvested at different periods (accounting for seasonal and yearly variations) has never been investigated. It was found that fucoidans inhibited α-glucosidase differently, depending on the algal species from which it was extracted and the algae's season of harvest. Fucoidan extracted from A. nodosum was a more potent inhibitor of α-glucosidase, with an IC50 ranging from 0.013 to 0.047 mg/mL, than the inhibition by fucoidan extracted from F. vesiculosus (IC50=0.049 mg/mL). In contrast, fucoidan extracted from F. vesiculosus did not inhibit α-amylase activity, while fucoidan from A. nodosum decreased α-amylase activity by 7-100% at 5 mg/mL depending upon the algae harvest period. An IC50 of 0.12-4.64 mg/mL for fucoidan from A. nodosum was found for the α-amylase inhibition. The ability of fucoidan to inhibit α-amylase and α-glucosidase thus varies according to the algae species and harvest period. A. nodosum is more suitable than F. vesiculosus as a source of fucoidan to inhibit α-amylase and α-glucosidase activities. Their potential benefits towards Type 2 diabetes management should be further investigated.

  17. Host-mediated induction of alpha-amylases by larvae of the Mexican bean weevil Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae) is irreversible and observed from the initiation of the feeding period.

    PubMed

    Bifano, Thaís D; Samuels, Richard I; Alexandre, Daniel; Silva, Carlos P

    2010-08-01

    Larvae of Zabrotes subfasciatus secrete alpha-amylases that are insensitive to the alpha-amylase inhibitor found in seeds of Phaseolus vulgaris. By analyzing amylase activities during larval development on P. vulgaris, we detected activity of the constitutive amylase and the two inducible amylase isoforms at all stages. When larvae were transferred from the non alpha-amylase inhibitor containing seeds of Vigna unguiculata to P. vulgaris, the inducible alpha-amylases were expressed at the same level as in control larvae fed on P. vulgaris. Interestingly, when larvae were transferred from seeds of P. vulgaris to those of V. unguiculata, inducible alpha-amylases continued to be expressed at a level similar to that found in control larvae fed P. vulgaris continuously. When 10-day-old larvae were removed from seeds of V. unguiculata and transferred into capsules containing flour of P. vulgaris cotyledons, and thus maintained until completing 17 days (age when the larvae stopped feeding), we could detect higher activity of the inducible alpha-amylases. However, when larvae of the same age were transferred from P. vulgaris into capsules containing flour of V. unguiculata, the inducible alpha-amylases remained up-regulated. These results suggest that the larvae of Z. subfasciatus have the ability to induce insensitive amylases early in their development. A short period of feeding on P. vulgaris cotyledon flour was sufficient to irreversibly induce the inducible alpha-amylase isoforms. Incubations of brush border membrane vesicles with the alpha-amylase inhibitor 1 from P. vulgaris suggest that the inhibitor is recognized by putative receptors found in the midgut microvillar membranes.

  18. Salivary alpha amylase and salivary cortisol response to fluid consumption in exercising athletes

    PubMed Central

    Horvath, PJ; Kazial, KA

    2015-01-01

    The objective of the study was to examine salivary biomarker response to fluid consumption in exercising athletes. Exercise induces stress on the body and salivary alpha amylase (sAA) and salivary cortisol are useful biomarkers for activity in the sympathoadrenal medullary system and the hypothalamic pituitary adrenal axis which are involved in the stress response. Fifteen college students were given 150 ml and 500 ml of water on different days and blinded to fluid condition. The exercise protocol was identical for both fluid conditions using absolute exercise intensities ranging from moderate to high. Saliva was collected prior to exercise, post moderate and post high intensities and analyzed by Salimetrics assays. Exercise was significant for sAA with values different between pre-exercise (85 ± 10 U · ml−1) and high intensity (284 ± 30 U · ml−1) as well as between moderate intensity (204 ± 32 U · ml−1) and high intensity. There was no difference in sAA values between fluid conditions at either intensity. Exercise intensity and fluid condition were each significant for cortisol. Cortisol values were different between pre-exercise (0.30 ± 0.03 ug · dL−1) and high intensity (0.45 ± 0.05 ug · dL−1) as well as between moderate intensity (0.33 ± 0.04 ug · dL−1) and high intensity. Moderate exercise intensity cortisol was lower in the 500 ml condition (0.33 ± 0.03 ug · dL−1) compared with the 150 ml condition (0.38 ± 0.03 ug · dL−1). This altered physiological response due to fluid consumption could influence sport performance and should be considered. In addition, future sport and exercise studies should control for fluid consumption. PMID:26681828

  19. Elevated Salivary Alpha Amylase in Adolescent Sexual Abuse Survivors with Posttraumatic Stress Disorder Symptoms

    PubMed Central

    Strawn, Jeffrey R.; Out, Dorothee; Granger, Douglas A.; Putnam, Frank W.

    2015-01-01

    Abstract Objective: Little is known regarding neuroendocrine responses in adolescent girls with posttraumatic stress disorder (PTSD) who have experienced sexual abuse. Therefore, we collected saliva samples three times daily for 3 days to assess concentrations of salivary alpha amylase (sAA) – a surrogate marker for autonomic nervous system (ANS) activity and, in particular, sympathetic activity – in sexually abused adolescent girls. Methods: Twenty-four girls (mean age: 15±1.4 years) who had experienced recent sexual abuse (i.e., sexual abuse occurred 1–6 months prior to study enrollment) and 12 healthy comparison subjects (mean age: 14.8±1.3 years) completed a structured interview and assessments to ascertain symptoms of posttraumatic stress, then collected saliva at home upon awakening, 30 minutes after waking, and at 5 p.m. on three consecutive school days. Results: For sexually abused girls, total PTSD symptoms were associated with higher overall morning levels of sAA (r[20]=0.51, p=0.02), a finding driven by intrusive symptoms (r[20]=0.43, p<0.05) and hyperarousal symptoms (r[20]=0.58, p=0.01). There were no significant differences in diurnal sAA secretion between the sexually abused girls and healthy comparison adolescents. Conclusions: Overall morning concentrations of sAA in sexually abused girls are associated with overall PTSD severity as well as symptoms of hyperarousal and intrusive symptoms, possibly reflecting symptom-linked increases in ANS tone. These data raise the possibility that alterations in ANS activity are related to the pathophysiology of sexual abuse-related PTSD in adolescent girls, and may inform therapeutic interventions (e.g., antiadrenergic medications). PMID:25803321

  20. Alpha-amylase reactivity in relation to psychopathic traits in adults.

    PubMed

    Glenn, Andrea L; Remmel, Rheanna J; Raine, Adrian; Schug, Robert A; Gao, Yu; Granger, Douglas A

    2015-04-01

    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n=158) of adult males (M age=36.81, range=22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, 'fight or flight', component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis.

  1. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.

    PubMed

    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M

    2014-10-01

    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  2. Alpha-Amylase Reactivity in Relation to Psychopathic Traits in Adults

    PubMed Central

    Glenn, Andrea L.; Remmel, Rheanna J.; Raine, Adrian; Schug, Robert A.; Gao, Yu; Granger, Douglas A.

    2015-01-01

    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n = 158) of adult males (M age = 36.81, range = 22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, ‘fight or flight’, component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis. PMID:25662339

  3. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  4. Optimized conditions for determining activity concentration of alpha-amylase in serum, with 1,4-alpha-D-4-nitrophenylmaltoheptaoside as substrate.

    PubMed

    Rauscher, E; Neumann, U; Schaich, E; von Bülow, S; Wahlefeld, A W

    1985-01-01

    We describe a method for measuring the catalytic activity of alpha-amylase (EC 3.2.1.1) in serum and urine, by use of a defined substrate: 1,4-alpha, D-4-nitrophenyl maltoheptaoside. We use a phosphate buffer of pH 7.10, containing chloride as activator and alpha-glucosidase (EC 3.2.1.20) as the auxiliary enzyme. After a lag phase of 4 min at 25 degrees C or 30 degrees C, or 3 min at 37 degrees C, the increase of absorption of 4-nitrophenol is measured at 410 nm or 405 nm. The pH value of the assay mixture is a compromise between optimum pH for the alpha-amylase reaction, shortest possible lag phase, and an acceptable absorptivity of 4-nitrophenol. Because the dissociation of 4-nitrophenol depends strongly on pH and temperature, we determined its absorptivity with various combinations of these variables in the assay. Heparin-treated plasma can be used, but not EDTA, fluoride, or citrate. Lipemia, hemoglobin less than or equal to mumol/L, bilirubin less than or equal to 170 mumol/L, glucose less than or equal to 100 mmol/L, and ascorbic acid less than or equal to 1 mmol/L of sample do not interfere in the assay.

  5. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )

    1990-02-01

    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  6. The psychosocial stress-induced increase in salivary alpha-amylase is independent of saliva flow rate.

    PubMed

    Rohleder, Nicolas; Wolf, Jutta M; Maldonado, Enrique F; Kirschbaum, Clemens

    2006-11-01

    The stress response of salivary alpha-amylase (sAA) has been suggested as an index for sympathetic nervous system activation. However, concurrent inhibition of the parasympathetic nervous system is discussed as a confounder due to suppression of saliva flow rate. Here we set out to test the influence of stress-induced changes in flow rate on sAA secretion. Twenty-six subjects underwent the Trier Social Stress Test and a control condition. Saliva was sampled by passive drooling or salivettes. Saliva flow rate, sAA levels and output, salivary cortisol, and heart rate variability were measured. Flow rate increased only when sampled by passive drooling. Stress-induced increases in amylase levels were correlated with increases of amylase output but not with flow rate. Results indicate that flow rate is not a confounder of stress-induced sAA activation and suggest that valid measurements of sAA can be obtained by salivettes without the need for assessment of flow rate.

  7. Salivary Alpha-Amylase and Cortisol Among Pentecostals on a Worship and Nonworship Day

    PubMed Central

    LYNN, CHRISTOPHER DANA; PARIS, JASON; FRYE, CHERYL ANNE; SCHELL, LAWRENCE M.

    2013-01-01

    Objectives This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. Methods As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York’s mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. Results There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Conclusions Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. Am. J. Hum. Biol. 22:819–822, 2010. PMID:20878966

  8. Comparison of the wild-type alpha-amylase and its variant enzymes in Bacillus amyloliquefaciens in activity and thermal stability, and insights into engineering the thermal stability of bacillus alpha-amylase.

    PubMed

    Lee, Seunjae; Mouri, Yoshiki; Minoda, Masashi; Oneda, Hiroshi; Inouye, Kuniyo

    2006-06-01

    The starch hydrolysis activity and thermal stability of Bacillus amyloliquefaciens alpha-amylase (wild-type enzyme or WT) and its variant enzymes, designated as M77, M111, and 21B, were compared. All have an optimal pH at around 6, as well as almost the same reaction rates and Km and kcat values. The optimal temperature in the absence of Ca2+ ions is 60 degrees C for WT and M77 and 40 degrees C for M111 and 21B. Those of M111 and 21B rose to 50-60 degrees C upon the addition of 5 mM CaCl2, while those of WT and M77 did not change. The dissociation constants Kd for Ca2+ to WT and M77 are much lower than those of M111 and 21B. Asp233 in WT is replaced by Asn in M111 and 21B, while it is retained in M77, suggesting that Asp233 is involved in the thermal stability of the enzyme through Ca2+ ion binding. These findings provide insight into engineering the thermal stability of B. amyloliquefaciens alpha-amylase, which would be useful for its applications in the baking industry and in glucose manufacturing.

  9. Synthesis and processing of Escherichia coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase in E. coli: the role of signal peptidase I.

    PubMed

    van Dijl, J M; Smith, H; Bron, S; Venema, G

    1988-09-01

    A mutant of Escherichia coli, in which signal peptidase I synthesis can be regulated, was constructed. The mutant was used to study the effects of signal peptidase I limitation on the synthesis and efficiency of processing of two proteins: the periplasmic E. coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase, which also accumulates in the periplasm of E. coli. Signal peptidase I limitation resulted in reduced rates of processing of pre-beta-lactamase and in strong inhibition of synthesis of alpha-amylase. The data suggest that beta-lactamase is processed post-translationally and that an intimate relationship exists between the synthesis and processing of alpha-amylase.

  10. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft.

    PubMed

    Kandra, Lili; Hachem, Maher Abou; Gyémánt, Gyöngyi; Kramhøft, Birte; Svensson, Birte

    2006-09-18

    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites as binding barriers. Barley alpha-amylase 1 mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in alpha-amylases.

  11. Decreased salivary alpha-amylase levels are associated with performance deficits during sleep loss.

    PubMed

    Pajcin, Maja; Banks, Siobhan; White, Jason M; Dorrian, Jill; Paech, Gemma M; Grant, Crystal; Johnson, Kayla; Tooley, Katie; Fidock, Justin; Kamimori, Gary H; Della Vedova, Chris B

    2017-04-01

    During sleep deprivation, neurobehavioral functions requiring sustained levels of attention and alertness are significantly impaired. Discrepancies between subjective measures of sleepiness and objective performance during sustained operations have led to interest in physiological monitoring of operator performance. Alertness, vigilance, and arousal are modulated by the wake-promoting actions of the central noradrenergic system. Salivary alpha-amylase (sAA) has been proposed as a sensitive peripheral measure of noradrenergic activity, but limited research has investigated the relationship between sAA and performance. In a laboratory-controlled environment, we investigated the relationship between sAA levels, subjective sleepiness, and performance during two days (50h) of total sleep deprivation. Beginning at 09:00, twelve healthy participants (5 females) aged 22.5±2.5years (mean±SD) provided saliva samples, recorded ratings of subjective sleepiness, completed a brief 3-min psychomotor vigilance task (PVT-B) and performed a 40-min simulated driving task, at regular 3h intervals during wakefulness. Ratings of subjective sleepiness exhibited a constant linear increase (p<0.001) during sleep deprivation. In contrast, sAA levels showed a marked diurnal profile, with levels increasing during the day (p<0.001) and steadily declining in the evening and early-morning (p<0.001). PVT-B (mean reaction time and mean slowest 10% reaction time) and simulated driving performance (speed deviation and lane deviation) also exhibited diurnal profiles across the two days of sleep deprivation. Performance peaked in the afternoon (p<0.001) and then steadily worsened as wakefulness continued into the evening and early-morning (p<0.001). Further analysis revealed that higher sAA levels in the hour preceding each performance assessment were associated with better PVT-B and driving performance (p<0.001). These findings suggest that sAA measures may be suitable indicators of performance

  12. Salivary cortisol and alpha-amylase reactivity to taekwondo competition in children.

    PubMed

    Capranica, Laura; Lupo, Corrado; Cortis, Cristina; Chiodo, Salvatore; Cibelli, Giuseppe; Tessitore, Antonio

    2012-02-01

    The aim of this study was to evaluate the effects of an official taekwondo competition (three 1-min rounds with a 1-min recovery in-between) on heart rate (HR), salivary alpha-amylase (sAA), and salivary-free cortisol (sC) in children. Parental consent was obtained for 12 young (10.4 ± 0.2 years) male taekwondo athletes. Saliva sample were collected 15 min before and 1 min after an official taekwondo competition, and at 30, 60, and 90 min of the recovery period. To evaluate the exercise intensity during the competition, HR was measured and expressed as a percentage of individuals HR(peak). Athletes spent 78% of the time working at HR > 90% HR(max), with significant increases from round 1 to round 2 and 3. Peak sAA observed at the end of the match (169.6 ± 47.0 U/mL) was different (P = 0.0001) from the other samplings (pre-competition 55.0 ± 14.0 U/mL, 30-min recovery 80.4 ± 17.7 U/mL, 60-min recovery 50.5 ± 7.6 U/ml; 90-min recovery 53.2 ± 9.6 U/mL). Peak sC values observed at 30-min recovery (17.9 ± 3.5 nmol/L) were different (P < 0.0001) from pre-competition (5.6 ± 0.9 nmol/L), post-competition (9.0 ± 2.0 nmol/L), 60-min recovery (10.3 ± 2.6 nmol/L) and 90-min recovery (4.2 ± 0.8 nmol/L) values. These findings confirm that taekwondo competitions pose a high stress on young athletes. The different sAA and sC reactions in response to the physical stressor mirror the faster reactivity of the sympathetic-adrenomedullary system relatively to the hypothalamic-pituitary-adrenocortical system, respectively. This experimental paradigm might represent a useful model for further research on the effects of various stressors (i.e., training and competition) in taekwondo athletes.

  13. Crystal structure of a catalytic-site mutant alpha-amylase from Bacillus subtilis complexed with maltopentaose.

    PubMed

    Fujimoto, Z; Takase, K; Doui, N; Momma, M; Matsumoto, T; Mizuno, H

    1998-03-27

    The X-ray crystal structure of a catalytic-site mutant EQ208 [Glu208-->Gln] of alpha-amylase from Bacillus subtilis cocrystallized with maltopentaose (G5) and acarbose has been determined by multiple isomorphous replacement at 2.5 A resolution. Restrained crystallographic refinement has resulted in an R-factor of 19.8% in the 7.0 to 2.5 A resolution range. EQ208 consists of three domains containing a (beta/alpha)8-barrel as observed in other alpha-amylases. Clear connected density corresponding to a pentasaccharide was observed, which was considered as the G5 molecule based on the high affinity of EQ208 for G5 that could replace pre-bound acarbose or a possible transglycosylation product of acarbose. The conformation around the third alpha-(1,4)-glucosidic bond makes a sharp turn, allowing the substrate to fit into the L-shaped cleft. Aromatic residues build the walls of the substrate binding cleft and leucine residues form the inner curvature of the cleft. The amide nitrogen of Gln208 forms a hydrogen bond with the glucosidic oxygen in the scissile bond between Glc3 and Glc4 (Glc1 is the non-reducing end glucose residue of the substrate). This hydrogen-bonding manner may correspond to that of the protonated state of Glu208 in the initial kinetic complex between wild-type enzyme and substrate. The amide oxygen of Gln208 is anchored by two hydrogen bonds with Ala177 and a water molecule, assisting to make the amide proton point precisely to the place of the catalytic attack. The carboxyl oxygen atoms of the other catalytic-site residues Asp176 and Asp269 form hydrogen bonds with the oxygen atoms of Glc3. The carboxyl group of Asp176 has non-bonded contacts to the anomeric carbon atom and to the endocyclic oxygen atom of Glc3. These results suggest that Glu208 acts as a general acid and Asp176 as a general base. Glc3 forms seven hydrogen bonds with the surrounding protein groups and a stacking interaction with Tyr62, which is consistent with the fact that Glc3 has

  14. Study of phenolic content and urease and alpha-amylase inhibitory activities of methanolic extract of Rumex acetosella roots and its sub-fractions in different solvents.

    PubMed

    Ahmed, Dildar; Mughal, Qaria Mumtaz; Younas, Saba; Ikram, Muhammad

    2013-05-01

    The present study aimed to establish relationship between urease and alpha-amylase inhibitory activities on the one hand and on the other between anti-enzymatic activities and total phenolic contents of the methanolic extract of roots of Rumex acetosella and its fractions in various solvents. The methanolic extract and its fractions in chloroform, ethyl acetate, n-butanol and water showed remarkable inhibitory activities against both urease and alpha-amylase, there was a close correspondence between urease and alpha-amylase inhibitory activities of the plant samples. The n-butanol fraction which had the highest total phenolic content (252.19 ± 2.32 µg of Gallic Acid Equivalents/mg of dry mass of the sample) showed prominent activity against both urease and alpha-amylase indicating a possible role of phenolics in inhibiting the activities of these enzymes. The samples displayed enzyme inhibitory activities in a dose dependent manner and their effectiveness was comparable with that of the standards, thiourea (for urease) and acarbose (for alpha-amylase). The samples were manifold more effective against urease than alpha-amylase; 2.8 mg/mL of MeOH extract produced about 81% inhibition in alpha-amylase activity, while only 10 µg/mL of the extract was required to create the same inhibition in urease activity. The IC50 values of methanolic, chloroform, ethyl acetate, n-butanolic, aqueous and standard solutions were 1.29, 1.31, 1.90, 1.38, 0.85 and 1.20 (mg/mL) respectively against alpha-amylase and 0.99, 3.89, 1.76, 0.91, 0.85 and 0.97 (μg/mL) respectively against urease. The total phenolic content in MeOH, hexane, chloroform, ethyl acetate, n-butanol and water fractions was 108.88 ± 2.65, 43.70 ± 1.90, 34.44 ± 2.30, 230.71 ± 1.78, 252.19 ± 2.32 and 94.07 ± 2.25 respectively.

  15. Collecting saliva and measuring salivary cortisol and alpha-amylase in frail community residing older adults via family caregivers.

    PubMed

    Hodgson, Nancy A; Granger, Douglas A

    2013-12-18

    Salivary measures have emerged in bio-behavioral research that are easy-to-collect, minimally invasive, and relatively inexpensive biologic markers of stress. This article we present the steps for collection and analysis of two salivary assays in research with frail, community residing older adults-salivary cortisol and salivary alpha amylase. The field of salivary bioscience is rapidly advancing and the purpose of this presentation is to provide an update on the developments for investigators interested in integrating these measures into research on aging. Strategies are presented for instructing family caregivers in collecting saliva in the home, and for conducting laboratory analyses of salivary analytes that have demonstrated feasibility, high compliance, and yield quality specimens. The protocol for sample collection includes: (1) consistent use of collection materials; (2) standardized methods that promote adherence and minimize subject burden; and (3) procedures for controlling certain confounding agents. We also provide strategies for laboratory analyses include: (1) saliva handling and processing; (2) salivary cortisol and salivary alpha amylase assay procedures; and (3) analytic considerations.

  16. Characterization of BGTG-1, a tergal gland-secreted alpha-amylase, from the German cockroach, Blattella germanica (L.).

    PubMed

    Saltzmann, K D; Saltzmann, K A; Neal, J J; Scharf, M E; Bennett, G W

    2006-08-01

    The protein fraction of the German cockroach, Blattella germanica (L.), tergal gland secretion was examined. SDS-PAGE separation of proteins present in B. germanica tergal gland secretion revealed a tergal gland-secreted protein, BGTG-1, at approximately 63 kDa. BGTG-1 first appeared in tergal gland secretion at 2 days postimaginal moult and the amount of protein observed increased through day 5. A 2051 bp cDNA sequence, bgtg-1, was obtained by RACE polymerase chain reaction and contains a 1494 bp ORF encoding a predicted protein of 498 amino acids. In a Northern hybridization experiment using total RNA from B. germanica tergal gland tissue, a (32)P-labelled bgtg-1 probe hybridized to an RNA approximately 2000 bp and confirmed the 2051 bp cDNA size obtained by RACE PCR. Using the BLASTx sequence similarity search tool, the top match to the bgtg-1 ORF was found to be an alpha-amylase from Drosophila kikkawai (e-value = 1 x 10(-178)). Alignment of the bgtg-1 deduced protein sequence with alpha-amylases from fruit fly, Drosophila melanogaster, honey bee, Apis mellifera (L.) and yellow mealworm, Tenebrio molitor (L.), revealed conserved residues throughout the ORF and sequence identities ranging from 58.4 to 58.2%. Using a gel-based assay, degradation of starch by native BGTG-1 was demonstrated in vitro and we propose that BGTG-1 may be involved in processing phagostimulatory sugars present in B. germanica tergal gland secretion.

  17. Investigation on the effects of three X-->histidine replacements on thermostability of alpha-amylase from Bacillus amyloliquefaciens.

    PubMed

    Haghani, Karimeh; Khajeh, Khosro; Naderi-Manesh, Hossein; Ranjbar, Bijan

    2012-05-01

    Bacillus licheniformis alpha-amylase (BLA), a thermophilic counterpart of Bacillus amyloliquefaciens alpha-amylase (BAA), is an appropriate model for the design of stabilizing mutations in BAA. BLA has 10 more histidines than BAA. Considering this prominent difference, in the present study, three out of these positions (I34, Q67, and P407; located in the thermostability determinant 1 region and Ca-III binding site of BAA) were replaced with histidine in BAA, using the site-directed mutagenesis technique. The results showed that the thermostability of P407H and Q67H mutants had increased, but no significant changes were observed in their kinetic parameters compared to that of the wild type. I34H replacement resulted in complete loss of enzyme activity. Moreover, fluorescence and circular dichroism data indicated a more rigid structure for the P407H variant compared with that of the wild-type BAA. However, the flexibility of Q67H and I34H mutants increased in comparison with that of wild-type enzyme.

  18. Improvement in lactic acid production from starch using alpha-amylase-secreting Lactococcus lactis cells adapted to maltose or starch.

    PubMed

    Okano, Kenji; Kimura, Sakurako; Narita, Junya; Fukuda, Hideki; Kondo, Akihiko

    2007-07-01

    To achieve direct and efficient lactic acid production from starch, a genetically modified Lactococcus lactis IL 1403 secreting alpha-amylase, which was obtained from Streptococcus bovis 148, was constructed. Using this strain, the fermentation of soluble starch was achieved, although its rate was far from efficient (0.09 g l(-1) h(-1) lactate). High-performance liquid chromatography revealed that maltose accumulated during fermentation, and this was thought to lead to inefficient fermentation. To accelerate maltose consumption, starch fermentation was examined using L. lactis cells adapted to maltose instead of glucose. This led to a decrease in the amount of maltose accumulation in the culture, and, as a result, a more rapid fermentation was accomplished (1.31 g l(-1) h(-1) lactate). Maximum volumetric lactate productivity was further increased (1.57 g l(-1) h(-1) lactate) using cells adapted to starch, and a high yield of lactate (0.89 g of lactate per gram of consumed sugar) of high optical purity (99.2% of L: -lactate) was achieved. In this study, we propose a new approach to lactate production by alpha-amylase-secreting L. lactis that allows efficient fermentation from starch using cells adapted to maltose or starch before fermentation.

  19. New action pattern of a maltose-forming alpha-amylase from Streptomyces sp. and its possible application in bakery.

    PubMed

    Ammar, Youssef Ben; Matsubara, Takayoshi; Ito, Kazuo; Iizuka, Masaru; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Minamiura, Noshi

    2002-11-30

    An a-Amylase (EC 3.2.1.1) was purified that catalyses the production of a high level of maltose from starch without the attendant production of glucose. The enzyme was produced extracellularly by thermophilic Streptomyces sp. that was isolated from Thailand's soil. Purification was achieved by alcohol precipitation, DEAE-Cellulose, and Gel filtration chromatographies. The purified enzyme exhibited maximum activity at pH 6-7 and 60 degrees C. It had a relative molecular mass of 45 kDa, as determined by SDS-PAGE. The hydrolysis products from starch had alpha-anomeric forms, as determined by 1H-NMR. This maltose-forming alpha-Amylase completely hydrolyzed the soluble starch to produce a high level of maltose, representing up to 90%. It hydrolyzed maltotetrose and maltotriose to primarily produce maltose (82% and 62% respectively) without the attendant production of glucose. The high maltose level as a final end-product from starch and maltooligosaccharides, and the unique action pattern of this enzyme, indicate an unusual maltose-forming system. After the addition of the enzyme in the bread-baking process, the bread's volume increased and kept its softness longer than when the bread had no enzyme.

  20. SusG: a unique cell-membrane-associated alpha-amylase from a prominent human gut symbiont targets complex starch molecules.

    PubMed

    Koropatkin, Nicole M; Smith, Thomas J

    2010-02-10

    SusG is an alpha-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  1. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    SciTech Connect

    Koropatkin, Nicole M.; Smith, Thomas J.

    2010-09-21

    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  2. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  3. Homology modeling and molecular dynamics study on Schwanniomyces occidentalis alpha-amylase.

    PubMed

    Sefidbakht, Yahya; Ranaei Siadat, Omid; Taheri, Fatemeh

    2017-02-01

    With consumers growing increasingly aware of environmental issues, industries find enzymes as a reasonable alternative over physical conditions and chemical catalysts. Amylases are important hydrolase enzymes, which have been widely used in variety of industrial process such as pharmaceutical, food, and fermentation industries. Among amylases α-Amylase is in maximum demand due to its wide range of applications. The homology modeling study on Schwanniomyces occidentalis amylase (AMY1, UniProt identifier number: P19269) was performed by Modeller using Aspergillus oryzae (6TAA) as the template. The resulting structure was analyzed for validity and subjected to 14 ns of molecular dynamics (MD) simulation trough GROMACS. The validity of obtained model may represent that utilized OPLS force field is suitable for calcium-containing enzymes. DSSP secondary structure and contact map analysis represent the conservation of domain A TIM barrel feature together with calcium ion coordination sphere. Investigating the covariance matrix followed by principle component analyses for the first five eigenvectors of both trajectories indicate a little more flexibility for AMY1 structure. The electrostatic calculation for the final structures shows similar isoelectric point and superimposed buffering zone in the 5-8 pH range.

  4. Effect of alpha-tocopherol and ascorbic acid on bovine oocyte in vitro maturation.

    PubMed

    Dalvit, G; Llanes, S P; Descalzo, A; Insani, M; Beconi, M; Cetica, P

    2005-04-01

    In vitro culture results in higher oxygen concentrations than in vivo environments, leading to an increased level of reactive oxygen species (ROS) that cause lipid peroxidation of cellular membranes. Alpha-tocopherol (active form of vitamin E) is an antioxidant that protects mammalian cells against lipid peroxidation, which is regenerated by ascorbic acid. The aim of this study was to determine the effect of the addition of alpha-tocopherol and/or ascorbic acid to the maturation medium on bovine oocyte in vitro maturation (IVM) and subsequently on in vitro fertilization (IVF) and embryo development. Cumulus-oocyte complexes (COCs) were matured in Medium 199 (control), and with the addition of alpha-tocopherol and/or ascorbic acid. The concentration of alpha-tocopherol in COCs was determined by high-performance liquid chromatography (HPLC). IVF and in vitro culture (IVC) were carried out in modified synthetic oviductal fluid (mSOF). The quantity of alpha-tocopherol naturally present in COCs diminished by half during IVM (p < 0.05), although in the presence of ascorbic acid it remained constant. A greater amount of alpha-tocopherol was detected in COCs matured in medium supplemented with this antioxidant (p < 0.05), but the addition of alpha-tocopherol plus ascorbic acid maintained higher levels of alpha-tocopherol (p < 0.05). Significant differences were not observed in the percentages of nuclear maturation and fertilization among different treatments. The presence of alpha-tocopherol or ascorbic acid in the maturation medium failed to modify the percentage of blastocysts obtained, unlike the addition of both antioxidants when a significant decrease was observed (p < 0.05). Absorbic acid maintained the antioxidant capacity of the alpha-tocopherol incorporated to COC membranes during IVM. The active form of vitamin E during maturation impaired the acquisition of oocyte developmental competence.

  5. Temperature adaptations in psychrophilic, mesophilic and thermophilic chloride-dependent alpha-amylases.

    PubMed

    Cipolla, Alexandre; Delbrassine, François; Da Lage, Jean-Luc; Feller, Georges

    2012-09-01

    The functional and structural adaptations to temperature have been addressed in homologous chloride-dependent α-amylases from a psychrophilic Antarctic bacterium, the ectothermic fruit fly, the homeothermic pig and from a thermophilic actinomycete. This series covers nearly all temperatures encountered by living organisms. We report a striking continuum in the functional properties of these enzymes coupled to their structural stability and related to the thermal regime of the source organism. In particular, thermal stability recorded by intrinsic fluorescence, circular dichroism and differential scanning calorimetry appears to be a compromise between the requirement for a stable native state and the proper structural dynamics to sustain the function at the environmental/physiological temperatures. The thermodependence of activity, the kinetic parameters, the activations parameters and fluorescence quenching support these activity-stability relationships in the investigated α-amylases.

  6. Effects of sorghum (Sorghum bicolor (L.) Moench) tannins on alpha-amylase activity and in vitro digestibility of starch in raw and processed flours

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effect of condensed tannins (CT) on in vitro starch digestibility in cooked, wholegrain sorghum flours and on corn starch was investigated. CT extracts were also tested for their inhibitory effect on alpha-amylases. Rapidly digestible starch, slowly digestible starch, and resistant starch were n...

  7. Salivary Alpha Amylase and Cortisol Levels in Children with Global Developmental Delay and Their Relation with the Expectation of Dental Care and Behavior during the Intervention

    ERIC Educational Resources Information Center

    dos Santos, Marcio Jose Possari; Bernabe, Daniel Galera; Nakamune, Ana Claudia de Melo Stevanato; Perri, Silvia Helena Venturoli; de Aguiar, Sandra Maria Herondina Coelho Avila; de Oliveira, Sandra Helena Penha

    2012-01-01

    The purpose of this study was to analyze the alpha-amylase (sAA) and cortisol levels in children with Global developmental delay (GDD) before and after dental treatment and its association with the children's behavior during treatment. The morning salivary cortisol levels and activity of sAA of 33 children with GDD were evaluated before and after…

  8. General Subject 2. Report to ICUMSA on the determination of carry-over alpha-amylase activity in white and refined sugars by a spectrophotometric method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A report is given on a new industrial method for the determination of carry-over alpha-amylase activity in raw and refined sugars, as well as a recommendation. In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) s...

  9. Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

    ERIC Educational Resources Information Center

    Marini, Isabella

    2005-01-01

    Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

  10. In vitro and in vivo inhibition of alpha-amylases of stored-product mite Acarus siro.

    PubMed

    Hubert, Jan; Dolecková-Maresová, Lucie; Hýblová, Jana; Kudlíková, Iva; Stejskal, Václav; Mares, Michael

    2005-01-01

    The stored-product mites are the most abundant and frequent group of pests living on the stored food products in Europe. They endanger public health since they produce allergens and transmit mycotoxin-producing fungi. Novel acaricidal compounds with inhibitory effects on the digestive enzymes of arthropods are a safe alternative to the traditional neurotoxic pesticides used for control of the stored-product pests. In this work, we explored the properties of acarbose, the low molecular weight inhibitor of alpha-amylases (AI), as a novel acaricide candidate for protection of the stored products from infestation by Acarus siro (Acari: Acaridae). In vitro analysis revealed that AI blocked efficiently the enzymatic activity of digestive amylases of A. siro, and decreased the physiological capacity of mite's gut in utilizing a starch component of grain flour. In vivo experiments showed that AI suppressed the population growth of A. siro. The mites were kept for three weeks on experimental diet enriched by AI in concentration range of 0.005 to 0.25%. Population growth of A. siro was negatively correlated with the content of AI in the treated diet with a half-population dose of 0.125%. The suppressive effect of AIs on stored-product mites is discussed in the context of their potential application in GMO crops.

  11. Bioactive compounds from Carissa opaca roots and xanthine oxidase and alpha-amylase inhibitory activities of their methanolic extract and its fractions in different solvents

    PubMed Central

    Saeed, Ramsha; Ahmed, Dildar

    2015-01-01

    Background: Carissa opaca is known for its many ethnomedicinal uses. There was a need to study its bioactivities and identify its phytochemicals. Objective: The objective was to isolate and identify phytochemicals from roots of C. opaca and to evaluate xanthine oxidase (XO) and alpha-amylase inhibitory activities of their methanolic extract and its fractions. Materials and Methods: Methanolic extract of finely divided powder of roots of C. opaca was obtained by cold maceration, followed by its fractionation to obtain hexane, chloroform, ethyl acetate, n-butanolic, and aqueous fractions. Phytochemicals screening was done by standard protocols. XO and alpha-amylase inhibitory activities of the methanolic extract and its fractions were studied. The most active ethyl acetate fraction was subjected to the column and thin layer chromatography to isolate its compounds, which were identified by gas chromatography-mass spectrometry and high-performance liquid chromatography comparison. Results: Methanolic extract displayed significant activity against both the enzymes with IC50 of 156.0 mg/mL and 5.6 mg/mL for XO and alpha-amylase, respectively. Ethyl acetate fraction showed highest activity against both the enzymes with IC50 of 129 mg/mL and 4.9 mg/mL for XO and alpha-amylase, respectively. Chloroform fraction had IC50 of 154.2 mg/mL and 5.5 mg/mL for XO and alpha-amylase, respectively. Aqueous fraction exhibited significant efficacy against alpha-amylase (IC50 5.0 mg/mL). Hexane fraction showed good activity against alpha-amylase in a dose-dependent manner but exhibited opposite trend against XO. The compounds isolated from ethyl acetate fraction included limonene, vanillin, lupeol, rutin, quercetin, b-sitosterol, Vitamin E, 2-hydroxyacetophenone, naphthalenone, 2,3,3-trimethyl-2-(3-methylbuta-1,3-dienyl)-6-methylenecyclohexanone, and 2-benzenedicarboxylic acid, mono(2-ethylhexyl) ester. Conclusions: Moderately polar phytochemicals of C. opaca roots possess exploitable

  12. One-step enzymatic hydrolysis of starch using a recombinant strain of Saccharomyces cerevisiae producing alpha-amylase, glucoamylase and pullulanase.

    PubMed

    Janse, B J; Pretorius, I S

    1995-03-01

    A recombinant strain of Saccharomyces cerevisiae was constructed that contained the genes encoding a bacterial alpha-amylase (AMY1), a yeast glucoamylase (STA2) and a bacterial pullulanase (pulA). The Bacillus amyloliquefaciens alpha-amylase and S. cerevisiae var. diastaticus glucoamylase genes were expressed in S. cerevisiae using their native promoters and the encoded enzymes secreted under direction of their native leader sequences. In contrast, the Klebsiella pneumoniae pullulanase gene was placed under the control of the yeast alcohol dehydrogenase gene promoter (ADC1P) and secreted using the yeast mating pheromone alpha-factor secretion signal (MF alpha 1S). Transcription termination of the pullulanase gene was effected by the yeast tryptophan synthase gene terminator (TRP5T), whereas termination of the glucoamylase and alpha-amylase genes was directed by their native terminators. Pullulanase (PUL1) produced by recombinant yeasts containing ADC1P MF alpha 1S pulA TRP5T (designated PUL1) was further characterized and compared to its bacterial counterpart (PulA). The different genes were introduced into S. cerevisiae in different combinations and the various amylolytic Saccharomyces transformants compared to Schwanniomyces occidentalis. Introduction of PUL1 into a S. cerevisiae strain containing both STA2 and AMY1, resulted in 99% assimilation of starch.

  13. Purification and characterization of novel raw-starch-digesting and cold-adapted alpha-amylases from Eisenia foetida.

    PubMed

    Ueda, Mitsuhiro; Asano, Tomohiko; Nakazawa, Masami; Miyatake, Kazutaka; Inouye, Kuniyo

    2008-05-01

    Novel raw-starch-digesting and cold-adapted alpha-amylases (Amy I and Amy II) from the earthworm Eisenia foetida were purified to electrophoretically homogeneous states. The molecular weights of both purified enzymes were estimated to be 60,000 by SDS-PAGE. The enzymes were most active at pH 5.5 and 50 degrees C and stable at pH 7.0-9.0 and 50-60 degrees C. Both Amy I and II exhibited activities at 10 degrees C. The enzymes were inhibited by metal ions Cu(2+), Fe(2+), and Hg(2+), and hydrolyzed raw starch into glucose, maltose and maltotriose as end products.

  14. Major water-soluble polyphenols, proanthocyanidins, in leaves of persimmon (Diospyros kaki) and their alpha-amylase inhibitory activity.

    PubMed

    Kawakami, Kayoko; Aketa, Saiko; Nakanami, Mitsuhiro; Iizuka, Shinzo; Hirayama, Masao

    2010-01-01

    The amounts and compositions of polyphenol in persimmon leaves and persimmon leaf tea were investigated. The predominant polyphenols in fresh leaves were water-soluble, and the contents reached a maximum (2.40% w/w) in June, and then gradually decreased. Separation of them followed by thiolytic degradation revealed that the major components were unique proanthocyanidin oligomers consisting of four heterogeneous extension units, including epigallocatechin-3-O-gallate. Persimmon leaf tea also contained similar proanthocyanidins with similar compositional units. Oral administration of starch with polyphenol concentrate of persimmon leaf tea resulted in a significant and dose-dependent decrease in the blood glucose level in Wistar rats. This effect is considered to be due to inhibition of pancreas alpha-amylase. These results indicate that persimmon leaf tea containing peculiar proanthocyanidins has a significant role in suppressing blood glucose elevation after starch intake, and that the best harvest time is June.

  15. Alpha-amylase production by Streptomyces erumpens MTCC 7317 in solid state fermentation using response surface methodology (RSM).

    PubMed

    Kar, Shaktimay; Ray, Ramesh C; Mohapatra, Uma B

    2008-01-01

    Production of alpha-amylase under solid state fermentation by Streptomyces erumpens MTCC 7317 has been investigated using different agro-industrial residues, i.e. cassava bagasse, sugarcane bagasse and wheat bran; wheat bran was found to be the best substrate. Among different nitrogen source supplemented to wheat bran, beef extract or peptone (1%) showed maximum enzyme production. Response surface methodology was used to evaluate the effect of main process parameters as incubation period (48 h), moisture holding capacity (70%), pH (7.0) and temperature (50 degrees C) on enzyme production by applying a full factorial central composite design. The maximum hydrolysis of soluble starch (90%) and cassava starch (75%) was obtained with the application of 4 ml (approximately 12096 U) of S. erumpens crude enzyme after 5 h of incubation.

  16. Alpha-Amylase Starch Binding Domains: Cooperative Effects of Binding to Starch Granules of Multiple Tandemly Arranged Domains▿

    PubMed Central

    Guillén, D.; Santiago, M.; Linares, L.; Pérez, R.; Morlon, J.; Ruiz, B.; Sánchez, S.; Rodríguez-Sanoja, R.

    2007-01-01

    The Lactobacillus amylovorus alpha-amylase starch binding domain (SBD) is a functional domain responsible for binding to insoluble starch. Structurally, this domain is dissimilar from other reported SBDs because it is composed of five identical tandem modules of 91 amino acids each. To understand adsorption phenomena specific to this SBD, the importance of their modular arrangement in relationship to binding ability was investigated. Peptides corresponding to one, two, three, four, or five modules were expressed as His-tagged proteins. Protein binding assays showed an increased capacity of adsorption as a function of the number of modules, suggesting that each unit of the SBD may act in an additive or synergic way to optimize binding to raw starch. PMID:17468268

  17. Effect of gelatinization and hydrolysis conditions on the selectivity of starch hydrolysis with alpha-amylase from Bacillus licheniformis.

    PubMed

    Baks, Tim; Bruins, Marieke E; Matser, Ariette M; Janssen, Anja E M; Boom, Remko M

    2008-01-23

    Enzymatic hydrolysis of starch can be used to obtain various valuable hydrolyzates with different compositions. The effects of starch pretreatment, enzyme addition point, and hydrolysis conditions on the hydrolyzate composition and reaction rate during wheat starch hydrolysis with alpha-amylase from Bacillus licheniformis were compared. Suspensions of native starch or starch gelatinized at different conditions either with or without enzyme were hydrolyzed. During hydrolysis, the oligosaccharide concentration, the dextrose equivalent, and the enzyme activity were determined. We found that the hydrolyzate composition was affected by the type of starch pretreatment and the enzyme addition point but that it was just minimally affected by the pressure applied during hydrolysis, as long as gelatinization was complete. The differences between hydrolysis of thermally gelatinized, high-pressure gelatinized, and native starch were explained by considering the granule structure and the specific surface area of the granules. These results show that the hydrolyzate composition can be influenced by choosing different process sequences and conditions.

  18. Self-compassion training modulates alpha-amylase, heart rate variability, and subjective responses to social evaluative threat in women

    PubMed Central

    Arch, Joanna J.; Brown, Kirk Warren; Dean, Derek J.; Landy, Lauren N.; Brown, Kimberley; Laudenslager, Mark L.

    2014-01-01

    A growing body of research has revealed that social evaluative stressors trigger biological and psychological responses that in chronic forms have been linked to aging and disease. Recent research suggests that self-compassion may protect the self from typical defensive responses to evaluation. We investigated whether brief training in self-compassion moderated biopsychological responses to the Trier Social Stress Test (TSST) in women. Compared to attention (placebo) and no-training control conditions, brief self-compassion training diminished sympathetic (salivary alpha-amylase), cardiac parasympathetic, and subjective anxiety responses, though not HPA-axis (salivary cortisol) responses to the TSST. Self-compassion training also led to greater self-compassion under threat relative to the control groups. In that social stress pervades modern life, self-compassion represents a promising approach to diminishing its potentially negative psychological and biological effects. PMID:24636501

  19. Alpha-amylase starch binding domains: cooperative effects of binding to starch granules of multiple tandemly arranged domains.

    PubMed

    Guillén, D; Santiago, M; Linares, L; Pérez, R; Morlon, J; Ruiz, B; Sánchez, S; Rodríguez-Sanoja, R

    2007-06-01

    The Lactobacillus amylovorus alpha-amylase starch binding domain (SBD) is a functional domain responsible for binding to insoluble starch. Structurally, this domain is dissimilar from other reported SBDs because it is composed of five identical tandem modules of 91 amino acids each. To understand adsorption phenomena specific to this SBD, the importance of their modular arrangement in relationship to binding ability was investigated. Peptides corresponding to one, two, three, four, or five modules were expressed as His-tagged proteins. Protein binding assays showed an increased capacity of adsorption as a function of the number of modules, suggesting that each unit of the SBD may act in an additive or synergic way to optimize binding to raw starch.

  20. Effects of early life adversity on cortisol/salivary alpha-amylase symmetry in free-ranging juvenile rhesus macaques.

    PubMed

    Petrullo, Lauren A; Mandalaywala, Tara M; Parker, Karen J; Maestripieri, Dario; Higham, James P

    2016-11-01

    Early life adversity (ELA) affects physiological and behavioral development. One key component is the relationship between the developing Hypothalamic-Pituitary-Adrenal (HPA) axis and the Sympathetic Nervous System (SNS). Recent studies suggest a relationship between early life adversity and asymmetry in cortisol (a measure of HPA activation) and salivary alpha-amylase (sAA: a correlate of SNS activation) responses to stress among human children, but to our knowledge there have been no comparable studies in nonhumans. Here, we investigate the responses of these two analytes in "low stress" and "high stress" situations in free-ranging juvenile rhesus macaques (Macaca mulatta) on Cayo Santiago, Puerto Rico. Behavioral data on maternal maltreatment were collected during the first 3months of life to determine individual rates of ELA, and saliva samples were collected from subjects noninvasively during juvenility. Irrespective of ELA, salivary alpha-amylase levels were lower in low stress situations and higher in high stress situations. For cortisol however, high ELA subjects exhibited higher low stress concentrations and blunted acute responses during high stress situations compared to moderate and low ELA subjects. Cortisol and sAA values were positively correlated among low ELA subjects, suggesting symmetry, but were uncorrelated or negatively correlated among moderate and high ELA subjects, suggesting asymmetry in these individuals. These findings indicate dysregulation of the stress response among juveniles maltreated during infancy: specifically, attenuated cortisol reactivity coupled with typical sAA reactivity characterize the stress response profiles of juveniles exposed to higher rates of ELA during the first 3months of life.

  1. The starch-bound alpha-amylase/trypsin-inhibitors in Avena.

    PubMed

    Gazza, Laura; Gazzelloni, Gloria; Taddei, Federica; Latini, Arianna; Muccilli, Vera; Alfieri, Michela; Conti, Salvatore; Redaelli, Rita; Pogna, Norberto E

    2016-12-01

    Oat kernels exhibit an extra-soft texture, a trait recently demonstrated to be largely modulated by starch-bound tryptophan-rich 2S proteins, the vromindolines. In this study, fractionation by two-dimensional electrophoresis of starch-bound proteins in 25 oat (Avena sativa) cultivars and 11 diploid or tetraploid Avena species revealed novel 2S proteins called Avena α-amylase/trypsin-inhibitors (AATI) because of their sequence similarity with wheat α-amylase/trypsin inhibitors. Thirty-seven AATI polypeptides, about 14 kDa in size, were split into three families named AATI-1, AATI-2, and AATI-3 with different primary structures and isoelectric points. AATI-1 and AATI-2 proteins showed 55.5-60.0 % sequence similarity with wheat α-amylase inhibitors CM1, CM2, and CM16, which have been found to cause innate immunity responses in celiac disease and non-celiac gluten sensitivity. Diploid A-genome and tetraploid AC-genome oat species possess three and five genes encoding for the AATI proteins, respectively, whereas hexaploid A. sativa exhibits 12 genes dispersed over the A-, C-, and D-genomes. Some AATI proteins expressed in hexaploid oats were assigned to the A-genome based on similarity to their counterparts in diploid species, contributing to further clarify the genetic origin of hexaploid oats. Moreover, AATI may interact with starch-bound vromindolines in determining the extra-soft texture of oat kernels and, due to their balanced amino acid compositions, may contribute to the biological value of oat proteins in a positive manner.

  2. Significant differences in the activities of alpha-amylases in the absence and presence of polyethylene glycol assayed on eight starches solubilized by two methods.

    PubMed

    Mukerjea, Rupendra; Slocum, Giles; Mukerjea, Romila; Robyt, John F

    2006-09-04

    Starch is a reserve chemical source of the energy of the sun found in plants as a water-insoluble granule that differs in their chemical and physical properties, depending on the source. The granules can be solubilized by heating in water or by treatment with various reagents, such as 1M NaOH. alpha-Amylases are widely distributed enzymes that initiate the hydrolysis of starch into low molecular weight maltodextrins. We recently found that the activities of a single alpha-amylase on two different starches were significantly different. We then determined the activities of Bacillus amyloliquefaciens and porcine pancreas alpha-amylases, using eight different starches, solubilized by two methods: autoclaving at 121 degrees C and 1M NaOH at 20 degrees C. There were significant differences in the activities of both of the amylases on all eight of the starches. Previously, it had been found that polyethylene glycol (PEG) stabilized and activated the activities of both enzymes, using a soluble amylose as the substrate. Addition of PEG to the enzymes greatly increased the activities on the eight starches, but the activities still differed significantly. The different activities with the starches were hypothesized as differences in the amounts of secondary and tertiary structures that are partially retained when the different starches are solubilized; the activities on addition of PEG is hypothesized as the formation of highly active species from a series of less active forms.

  3. Improved activity and modulated action pattern obtained by random mutagenesis at the fourth beta-alpha loop involved in substrate binding to the catalytic (beta/alpha)8-barrel domain of barley alpha-amylase 1.

    PubMed

    Matsui, I; Svensson, B

    1997-09-05

    The functionality of the sequence Arg183-Gly184-Tyr185 of the substrate binding fourth beta-alpha loop in the (beta/alpha)8-barrel of barley alpha-amylase isozyme 1 (AMY1) was studied by random mutagenesis. A motif of polar Gly184 hydrophobic residues was present in active mutants, selected by starch plate screening of yeast transformants. Gly184 was important, probably due to the carbonyl group binding to Ca2+ and the spatial proximity of Phe181. Mutation of both flanking residues as in Ser183-Gly184-Met185 (SGM-) and TGL-AMY1 decreased the Ca2+ affinity. SGM-AMY1 has 2-fold increased activity for amylose but reduced activity on maltooligosaccharides, whereas KGY-AMY1 has up to 3-fold elevated activity toward the oligosaccharides. TGL-AMY1 has modest activity on all substrates. Shifted action pattern on maltooligosaccharides for NGY-, SGM-, and TGL-AMY1 support that Arg183 in wild type is located at subsites +1 and +2, accommodating two sugar rings toward the reducing end from the site of cleavage. In the crystal structure of barley alpha-amylase 2 (AMY2), Lys182 (equivalent to AMY1 Arg183) is hydrogen-bonded with sugar OH-3 in subsite +2. Higher Ki app for acarbose inhibition of KGY-AMY1 and parent AMY1 compared with the other mutants suggests favorable substrate interactions for Arg/Lys183. KGY-AMY1 was not inhibited by the AMY2-specific proteinaceous barley alpha-amylase/subtilisin inhibitor, although Lys182 of AMY2 is salt-linked to the inhibitor.

  4. A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.

    PubMed

    Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T

    1999-02-01

    Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.

  5. AmyA, an alpha-amylase with beta-cyclodextrin-forming activity, and AmyB from the thermoalkaliphilic organism Anaerobranca gottschalkii: two alpha-amylases adapted to their different cellular localizations.

    PubMed

    Ballschmiter, Meike; Armbrecht, Martin; Ivanova, Krasimira; Antranikian, Garabed; Liebl, Wolfgang

    2005-07-01

    Two alpha-amylase genes from the thermophilic alkaliphile Anaerobranca gottschalkii were cloned, and the corresponding enzymes, AmyA and AmyB, were investigated after purification of the recombinant proteins. Based on their amino acid sequences, AmyA is proposed to be a lipoprotein with extracellular localization and thus is exposed to the alkaline milieu, while AmyB apparently represents a cytoplasmic enzyme. The amino acid sequences of both enzymes bear high similarity to those of GHF13 proteins. The different cellular localizations of AmyA and AmyB are reflected in their physicochemical properties. The alkaline pH optimum (pH 8), as well as the broad pH range, of AmyA activity (more than 50% activity between pH 6 and pH 9.5) mirrors the conditions that are encountered by an extracellular enzyme exposed to the medium of A. gottschalkii, which grows between pH 6 and pH 10.5. AmyB, on the other hand, has a narrow pH range with a slightly acidic pH optimum at 6 to 6.5, which is presumably close to the pH in the cytoplasm. Also, the intracellular AmyB is less tolerant of high temperatures than the extracellular AmyA. While AmyA has a half-life of 48 h at 70 degrees C, AmyB has a half-life of only about 10 min at that temperature, perhaps due to the lack of stabilizing constituents of the cytoplasm. AmyA and AmyB were very similar with respect to their substrate specificity profiles, clearly preferring amylose over amylopectin, pullulan, and glycogen. Both enzymes also hydrolyzed alpha-, beta-, and gamma-cyclodextrin. Very interestingly, AmyA, but not AmyB, displayed high transglycosylation activity on maltooligosaccharides and also had significant beta-cyclodextrin glycosyltransferase (CGTase) activity. CGTase activity has not been reported for typical alpha-amylases before. The mechanism of cyclodextrin formation by AmyA is unknown.

  6. Effects of alpha-amylase reaction mechanisms on analysis of resistant-starch contents.

    PubMed

    Moore, Samuel A; Ai, Yongfeng; Chang, Fengdan; Jane, Jay-lin

    2015-01-22

    This study aimed to understand differences in the resistant starch (RS) contents of native and modified starches obtained using two standard methods of RS content analysis: AOAC Method 991.43 and 2002.02. The largest differences were observed in native potato starch, cross-linked wheat distarch phosphate, and high-amylose corn starch stearic-acid complex (RS5) between using AOAC Method 991.43 with Bacillus licheniformis α-amylase (BL) and AOAC Method 2002.02 with porcine pancreatic α-amylase (PPA). To determine possible reasons for these differences, we hydrolyzed raw-starch granules with BL and PPA with equal activity at pH 6.9 and 37°C for up to 84 h and observed the starch granules displayed distinct morphological differences after the hydrolysis. Starches hydrolyzed by BL showed erosion on the surface of the granules; those hydrolyzed by PPA showed pitting on granule surfaces. These results suggested that enzyme reaction mechanisms, including the sizes of the binding sites and the reaction patterns of the two enzymes, contributed to the differences in the RS contents obtained using different methods of RS analysis.

  7. [Study on immobilized cells for producing alpha-amylase by using polyving alcohol as the carrier(II): The effect of fermentating conditions on the ability producing alpha-amylase of the cells immobilized with polyving alcohol as the corrier and continuous fermentation of the immobilized cells in CSTR].

    PubMed

    Liu, Z; Wang, J; Li, Z

    1998-03-01

    The effects of fermentating conditions on the ability of immobilized cells with PVA as carrier for producing alpha-amylase were studied. The continuous fermentation with the immobilized cells were tested in continuous flow stirred tank reactor (CSTR). The results showed that the adaptability of the immobilized Bacillus substilis to pH increased after immobilization. In CSTR, the immobilized cells can be fermentated continuously for 360 hrs and the activity of alpha-amylase can be kept on the level of about 170 u/ml.

  8. Association of Tenebrio molitor L. alpha-amylase with two protein inhibitors--one monomeric, one dimeric--from wheat flour. Differential scanning calorimetric comparison of heat stabilities.

    PubMed

    Silano, V; Zahnley, J C

    1978-03-28

    Thermal stabilization resulting from protein . protein association between two protein inhibitors (coded as 0.19, a dimer, and 0.28, a monomer) from wheat flour and the alpha-amylase from Tenebrio molitor L. (yellow mealworm) larvae was investigated by differential scanning calorimetry (heating rate 10 degrees C/min). Thermograms (plots of heat flow vs. temperature) for the two inhibitors showed broad endothermic peaks with the same extrema (denaturation temperatures) at 93 degrees C, and equal, small enthalpies of denaturation (2 cal/g). The amylase produced a sharp endotherm at 70.5 degrees C, but a larger enthalpy change on denaturation (6 cal/g). The amylase . inhibitor complexes differed in thermal stability, but both showed significant stabilization relative to free enzyme. The complex formed with monomeric inhibitor 0.28 showed a higher denaturation temperature (85.0 degrees C) than that formed with dimeric inhibitor 0.19 (80.5 degrees C). This order of stabilization agrees with the relative affinities of the inhibitors for the amylase. These thermograms are consistent with previous results which indicated that 1 mol of amylase binds 1 mol of inhibitor 0.19.

  9. Heterologous expression of Thermobifida fusca thermostable alpha-amylase in Yarrowia lipolytica and its application in boiling stable resistant sago starch preparation.

    PubMed

    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying

    2010-09-01

    A gene encoding the thermostable alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced, and cloned into Yarrowia lipolytica P01g host strain using the vector pYLSC1 allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 730 U/l in the Hinton flask culture broth. It is higher than that observed in P. pastoris expression system and E. coli expression system. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis and this agrees with the predicted size based on the nucleotide sequence. About 70% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 72-h treatment, the DP(w) of raw sago starch obviously decreased from 830,945 to 237,092. The boiling stable resistant starch content of the sago starch increased from 8.3 to 18.1%. The starch recovery rate was 71%.

  10. Expression of Thermobifida fusca thermostable raw starch digesting alpha-amylase in Pichia pastoris and its application in raw sago starch hydrolysis.

    PubMed

    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying

    2010-04-01

    A gene encoding the thermostable raw starch digesting alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced and cloned into Pichia pastoris X-33 host strain using the vector pGAPZalphaA, allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 510 U/l in the Hinton flask culture broth. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo-beta-N-acetylglycosaminidase H, and this agrees with the predicted size based on the nucleotide sequence. About 75% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 48-h treatment, the DPw of raw sago starch obviously decreased from 830,945 to 378,732. The surface of starch granules was rough, and some granules displayed deep cavities.

  11. Porcine pancreatic alpha-amylase hydrolysis of native starch granules as a function of granule surface area.

    PubMed

    Kong, Byoung-Wook; Kim, Jung-In; Kim, Myo-Jeong; Kim, Jae Cherl

    2003-01-01

    Porcine pancreatic alpha-amylase activity on native starch granules is more accurately described as a function of surface area of the granules rather than of substrate concentration. The apparent K(m) of alpha-amylolysis of native starch from potato, maize, and rice expressed as a function of substrate concentration was largest for potato with a single value of V(max). However, the ratio of the slope of a Lineweaver-Burk plot to that of rice for enzymatic hydrolysis of native potato and maize starch were 7.78 and 2.58, respectively, which were very close to the ratio of surface area per mass of the two starch granules to that of rice. Therefore, the reciprocal of initial velocity was a linear function of the reciprocal of surface area for each starch granule. Surface area was calculated assuming the starch granules were spherical. The values obtained by this calculation were in good agreement with the value obtained by the photomicrographic method. By comparing enzymatic digestion of native maize granules to that of rice granules, it was concluded that the presence of pores in maize granules appeared to significantly affect overall rate of digestion after sufficient reaction time, but not at the very initial stage of hydrolysis.

  12. Structure of starch binding domains of halophilic alpha-amylase at low pH.

    PubMed

    Yamaguchi, Rui; Ishibashi, Matsujiro; Tokunaga, Hiroko; Arakawa, Tsutomu; Tokunaga, Masao

    2013-07-01

    The solubility and structural properties of halophilic proteins are ascribed to their abundant acidic residues, resulting in large net negative charges at neutral pH. This study examined the effects of low pH, i.e., reduction of net negative charges on the structural properties of starch binding domain (SBD) of halophilic Kocuria varians α-amylase. Titration to pH 2.1 caused loss of 233 nm peak characteristic of aromatic interactions present in the native SBD at neutral pH and resulted in the spectrum with a 216 nm valley characteristic of β-sheet. The low pH β-sheet structure was stable against heat treatment. The addition of NaCl and trifluoroethanol resulted in decrease and increase of the 216 nm signal, without altering the spectral shape. These structural properties were significantly different from those of the native protein.

  13. Enzymatic degradation products from a marine polysaccharide YCP with different immunological activity and binding affinity to macrophages, hydrolyzed by alpha-amylases from different origins.

    PubMed

    Ren, Min; Yan, Wei; Yao, Wenbing; Jin, Lei; Gao, Xiangdong

    2010-04-01

    YCP is a marine polysaccharide with anti-tumor and immune-modulating effects. This study evaluated the effect of enzymatic degradation of YCP by alpha-amylases from different origins on its immunological activity and binding ability to the macrophages. YCP was hydrolyzed by alpha-amylases isolated from Aspergillus oryzae, Bacillus licheniformis, Barley malt, and Porcine pancreas respectively, then four fragments with unique molecular weight (termed: YCP-Ao, YCP-Bl, YCP-Bm, and YCP-Pp, respectively) were obtained. The four fragments showed different immunological activity and the ability to bind to macrophages. Among them, YCP-Ao possessed almost equivalent immunological activity compared to the original YCP, while such properties were not retained in YCP-Bl. Our further study showed that YCP-Ao prevented YCP from binding to macrophages. In conclusion, YCP-Ao and YCP might have similar active regions.

  14. Continuous extraction of alpha- and beta-amylases from Zea mays malt in a PEG4000/CaCl2 ATPS.

    PubMed

    Biazus, J P M; Santana, J C C; Souza, R R; Jordão, E; Tambourgi, E B

    2007-10-15

    In the present work, alpha- and beta-amylase enzymes from Zea mays malt were recovered by continuous extraction in a PEG/CaCl2 aqueous two-phase system (ATPS). The influences of the flux rate (RQ), free area of vane (A(free)) and vane rotation (RV) on enzyme recovery were studied by optimization using response surface methodology (RSM). The protein content and enzyme activity were measured from time to time in the extract and refined fluxes. RSM curves showed a squared dependence of recovery index with the RQ, A(free) and RV. The best system for recovering the maize malt enzymes was with low vane rotation and flux rate and high free area of vane. Alpha- and beta-amylases were purified 130-fold in the salt-rich phase.

  15. Calcium binding in. alpha. -amylases: An X-ray diffraction study at 2. 1- angstrom resolution of two enzymes from Aspergillus

    SciTech Connect

    Boel, E.; Jensen, V.J.; Petersen, S.B.; Thim, L. Woldike, H.F. ); Brady, L.; Brzozowski, AM.; Derewenda, Z.; Dodson, G.G.; Swift, H. )

    1990-07-03

    X-ray diffraction analysis (at 2.1-{angstrom} resolution) of an acid alpha-amylase from Aspergillus niger allowed a detailed description of the stereochemistry of the calcium-binding sites. The primary site (which is essential in maintaining proper folding around the active site) contains a tightly bound Ca{sup 2+} with an unusually high number of eight ligands. A secondary binding site was identified at the bottom of the substrate binding cleft; it involves the residues presumed to play a catalytic role (Asp206 and Glu230). This explains the inhibitory effect of calcium observed at higher concentrations. Neutral Aspergillus oryzae (TAKA) {alpha}-amylase was also refined in a new crystal at 2.1-{angstrom} resolution. The structure of this homologous (over 80%) enzyme and addition kinetic studies support all the structural conclusions regarding both calcium-binding sites.

  16. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  17. Purification and characterization of the beta-trefoil fold protein barley alpha-amylase/subtilisin inhibitor overexpressed in Escherichia coli.

    PubMed

    Bønsager, Birgit C; Praetorius-Ibba, Mette; Nielsen, Peter K; Svensson, Birte

    2003-08-01

    Barley alpha-amylase/subtilisin inhibitor (BASI) is a beta-trefoil fold protein related to soybean trypsin inhibitor (Kunitz) and inhibits barley alpha-amylase isozyme 2 (AMY2), which is de novo synthesized in the seed during germination. Recombinant BASI was produced in Escherichia coli in an untagged form (untagged rBASI), in two His(6)-tag forms (His(6)-rBASI and His(6)-Xa-rBASI), and in an intein-CBD-tagged form (rBASI (intein)). The yields per liter culture after purification were (i) 25 mgl(-1) His(6)-rBASI; (ii) 6 mgl(-1) rBASI purified after cleavage of His(6)-Xa-rBASI by Factor Xa; (iii) 3 mgl(-1) untagged rBASI; and (iv) 0.2 mgl(-1) rBASI after a chitin-column and autohydrolysis of the rBASI-intein-CBD. In Pichia pastoris, rBASI was secreted at 0.1 mgl(-1). The recombinant BASI forms and natural seed BASI (sBASI) all had an identical isoelectric point of 7.2 and a mass of 19,879 Da, as determined by mass spectrometry. The fold of rBASI from the different preparations was confirmed by circular dichroism spectroscopy and rBASI (intein), His(6)-rBASI, and sBASI inhibited AMY2 catalyzed starch hydrolysis with K(i) of 0.10, 0.06, and 0.09 nM, respectively. Surface plasmon resonance analysis of the formation of AMY2/rBASI (intein) gave k(on)=1.3x10(5)M(-1)s(-1), k(off)=1.4x10(-4)s(-1), and K(D)=1.1 nM, and of the savinase-His(6)-rBASI complex k(on)=21.0x10(4)M(-1)s(-1), k(off)=53.0x10(-4)s(-1), and K(D)=25.0 nM, in agreement with sBASI values. K(i) was 77 and 65 nM for inhibition of savinase activity by His(6)-rBASI and sBASI, respectively.

  18. Quantifying the impact of exogenous abscisic acid and gibberellins on pre-maturity α-amylase formation in developing wheat grains

    PubMed Central

    Kondhare, Kirtikumar R.; Hedden, Peter; Kettlewell, Peter S.; Farrell, Aidan D.; Monaghan, James M.

    2014-01-01

    To study the role of abscisic acid (ABA) and gibberellins (GA) in pre-maturity α-amylase (PMA) formation in developing wheat grain, two glasshouse experiments were conducted under controlled conditions in the highly PMA-susceptible genotype Rialto. The first, determined the relative efficacy of applying hormone solutions by injection into the peduncle compared to direct application to the intact grain. The second, examined the effects of each hormone, applied by either method, at mid-grain development on PMA in mature grains. In the first experiment, tritiated ABA (3H-ABA) and gibberellic acid (3H-GA3) were diluted with unlabelled ABA (100 µM) and GA3 (50 µM), respectively, and applied at mid-grain development using both methods. Spikes were harvested after 24, 48 and 72 h from application, and hormone taken up by grains was determined. After 72 h, the uptake per grain in terms of hormones applied was approximately 13% for ABA and 8% for GA3 when applied onto the grains, and approximately 17% for ABA and 5% for GA3 when applied by injection. In the second experiment, applied ABA reduced, whereas applied GA3 increased α-amylase activity. This confirmed that exogenously applied ABA and GA were absorbed in sufficient amounts to alter grain metabolism and impact on PMA. PMID:24942128

  19. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.

    PubMed

    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji

    2007-10-01

    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  20. Improvement of cloned [alpha]-amylase gene expression in fed-batch culture of recombinant Saccharomyces cerevisiae by regulating both glucose and ethanol concentrations using a fuzzy controller

    SciTech Connect

    Shiba, Sumihisa; Nishida, Yoshio; Park, Y.S.; Iijima, Shinji; Kobayashi, Takeshi . Dept. of Biotechnology)

    1994-11-05

    The effect of ethanol concentration on cloned gene expression in recombinant Saccharomyces cerevisiae strain 20B-12 containing one of two plasmids, pNA3 and pNA7, was investigated in batch cultures. Plasmids pNA3 and pNA7 contain the [alpha]-amylase gene under the control of the SUC2 or PGK promoter, respectively. When the ethanol concentration was controlled at 2 to 5 g/L, the gene expressions were two times higher than those at 20 g/L ethanol. To increase the gene expression by maintaining both the ethanol and glucose concentrations at low levels, a fuzzy controller was developed. The concentrations of glucose and ethanol were controlled simultaneously at 0.15 and 2 g/L, respectively, in the production phase using the fuzzy controller in fed-batch culture. The synthesis of [alpha]-amylase was induced by the low glucose concentration and maintained at a high level of activity by regulating the ethanol concentration at 2 g/L. The secretory [alpha]-amylase activities of cells harboring plasmids pNA3 and pNA7 in fed-batch culture were 175 and 392 U/mL, and their maximal specific activities 7.7 and 12.4 U/mg dry cells, respectively. These values are two to three times higher in activity and three to four times higher in specific activity than those obtained when glucose only was controlled.

  1. Crystal structure of Thermoactinomyces vulgaris R-47 alpha-amylase II (TVAII) hydrolyzing cyclodextrins and pullulan at 2.6 A resolution.

    PubMed

    Kamitori, S; Kondo, S; Okuyama, K; Yokota, T; Shimura, Y; Tonozuka, T; Sakano, Y

    1999-04-16

    The crystal structure of Thermoactinomyces vulgaris R-47 alpha-Amylase II (TVAII) has been determined by multiple isomorphous replacement at 2.6 A resolution. TVAII was crystallized in an orthorhombic system with the space group P212121 and the cell dimensions a=118.5 A, b=119.5 A, c=114.5 A. There are two molecules in an asymmetric unit, related by the non-crystallographic 2-fold symmetry. Diffraction data were collected at 113 K and the cell dimensions reduced to a=114.6 A, b=117.9 A, c=114.2 A, and the model was refined against 7.0-2.6 A resolution data giving an R-factor of 0.204 (Rfree=0.272). The final model consists of 1170 amino acid residues (two molecules) and 478 water molecules with good chemical geometry. TVAII has three domains, A, B, and C, like other alpha-amylases. Domain A with a (beta/alpha)8 barrel structure and domain C with a beta-sandwich structure are very similar to those found in other alpha-amylases. Additionally, TVAII has an extra domain N composed of 121 amino acid residues at the N-terminal site, which has a beta-barrel-like structure consisting of seven antiparallel beta-strands. Domain N is one of the driving forces in the formation of the dimer structure of TVAII, but its role in the enzyme activity is still not clear. TVAII does not have the Ca2+ binding site that connects domains A and B in other alpha-amylases, rather the NZ atom of Lys299 of TVAII serves as the connector between these domains. TVAII can hydrolyze cyclodextrins and pullulan as well as starch. Based on a structural comparison with the complex between a mutant cyclodextrin glucanotransferase and a beta-cyclodextrin derivative, Phe286 located at domain B is considered the residue most likely to recognize the hydrophobic cavity of cyclodextrins. The active-site cleft of TVAII is wider and shallower than that of other alpha-amylases, and seems to be suitable for the binding of pullulan which is expected not to adopt the helical structure of amylose.

  2. A fluid response: Alpha-amylase reactions to acute laboratory stress are related to sample timing and saliva flow rate.

    PubMed

    Nagy, Tamás; van Lien, René; Willemsen, Gonneke; Proctor, Gordon; Efting, Marieke; Fülöp, Márta; Bárdos, György; Veerman, Enno C I; Bosch, Jos A

    2015-07-01

    Salivary alpha-amylase (sAA) is used as a sympathetic (SNS) stress marker, though its release is likely co-determined by SNS and parasympathetic (PNS) activation. The SNS and PNS show asynchronous changes during acute stressors, and sAA responses may thus vary with sample timing. Thirty-four participants underwent an eight-minute memory task (MT) and cold pressor task (CPT). Cardiovascular SNS (pre-ejection period, blood pressure) and PNS (heart rate variability) activity were monitored continuously. Unstimulated saliva was collected repeatedly during and after each laboratory stressor, and sAA concentration (U/ml) and secretion (U/minute) determined. Both stressors increased anxiety. The MT caused an immediate and continued cardiac SNS activation, but sAA concentration increased at task cessation only (+54%); i.e., when there was SNS-PNS co-activation. During the MT sAA secretion even decreased (-35%) in conjunction with flow rate and vagal tone. The CPT robustly increased blood pressure but not sAA. In summary, sAA fluctuations did not parallel changes in cardiac SNS activity or anxiety. sAA responses seem contingent on sample timing and flow rate, likely involving both SNS and PNS influences. Verification using other stressors and contexts seems warranted.

  3. Evaluation of column flotation in the downstream processing of fermentation products: recovery of a genetically engineered alpha-amylase.

    PubMed

    Miranda, E A; Berglund, K A

    1993-01-01

    Flotation is a simple, inexpensive, and versatile unit operation with a largely unexplored potential in biotechnology. There is a general lack of research concerning biotechnological applications in this area, especially in the recovery of fermentation products. Moreover, the few reports in the literature do not consider the modern concept of column flotation as practiced in the mineral industry. We report herein the application of column flotation for the recovery of a Bacillus stearothermophilus alpha-amylase expressed in Escherichia coli by the use of a food-grade polymer, (hydroxypropyl)methylcellulose (HPMC), and ammonium sulfate. First, the enzyme was removed from the liquid phase by partition to a salted-out HPMC phase. The enzyme-containing polymer flocs were then floated from the liquid. Recovery of active enzyme was as high as 90%, with throughput as high as 94 m3/(h.m2). The floatability of the enzyme from a periplasmic extract was higher than extracellular enzyme in the broth due to the presence of depressors of molecular weight lower than 10,000 in the broth.

  4. Aging diurnal rhythms and chronic stress: Distinct alteration of diurnal rhythmicity of salivary alpha-amylase and cortisol.

    PubMed

    Strahler, Jana; Berndt, Christiane; Kirschbaum, Clemens; Rohleder, Nicolas

    2010-05-01

    The present study assessed diurnal profiles of salivary alpha-amylase (sAA), proposed as a marker of autonomic activity, and salivary cortisol in competitive ballroom dancers as well as age- and sex-matched controls to investigate age-related changes of basal activity and potential chronic psychosocial stress-related alterations. According to the Allostatic Load (AL) hypothesis of a cumulative wear and tear of the body we expected to see physiological accumulation of the effects of stress and age especially pronounced in older dancers. Dancers and controls collected five saliva samples throughout the day. Daily overall output of sAA was elevated in older adults while there was no effect of age on mean cortisol levels. Alterations of diurnal rhythms were only seen in younger male dancers showing a flattened diurnal profile of sAA and younger dancers and female older dancers showing a blunted diurnal rhythmicity of cortisol. Furthermore, we found a negative correlation between summary indices of basal sAA and the amount of physical activity. In conclusion, higher overall output of sAA in older adults is in line with the phenomenon of a sympathetic "drive" with increasing age. Furthermore, a lower output of sAA in people who are more physical active is in line with the hypothesis of an exercise-induced decrease of sympathetic activity. Overall, our study does not support the AL hypothesis, but rather highlights the importance of regular physical activity and social environment in promoting health.

  5. A dispersion model for predicting the extent of starch liquefaction by Bacillus licheniformis alpha-amylase during reactive extrusion.

    PubMed

    Komolprasert, V; Ofoli, R Y

    1991-03-25

    A Baker-Perkins corotating twin screw extruder was used as a bioreactor to hydrolyze pregelantinized corn starch by themophilic Bacillus licheniformis alpha-amylase. The extruder was modeled as a tube, and characterized as a closed system. This characterization is not in the thermodynamic sense; rather, it relates to the profile of a tracer fluid upon entry to and exit from the reaction zone. The reaction kinetics were modeled by a modified first-order equation, which allowed the dispersion equation to be solved analytically with the Danckwerts boundary condition. Data from several extrusion runs were super-imposed to obtain a profile to evaluate the model. The dispersion number, determined from the first and second moments of the RTD curve, was primarily a function of the length of the reaction zone. There was good agreement between predictions and experimental data, especially at low dispersion numbers. In general, the axial dispersion model appears to be suitable for analysis of enzymatic reactions of up to 30% conversion. At a fixed flow rate and constant temperature, the extent of starch conversion depends significantly on moisture content, residence time and enzyme dosage, but not on screw speed.

  6. Evening salivary alpha-amylase, major depressive disorder, and antidepressant use in the Netherlands Study of Depression and Anxiety (NESDA).

    PubMed

    Veen, Gerthe; Giltay, Erik J; Licht, Carmilla M M; Vreeburg, Sophie A; Cobbaert, Christa M; Penninx, Brenda W J H; Zitman, Frans G

    2013-06-30

    Salivary alpha-amylase (sAA) may be a suitable index for sympathetic activity and dysregulation of the autonomic nervous system. The relationship between antidepressants and depression with sAA levels was studied, since antidepressants were previously shown to have a profound impact on heart rate variability as an ANS indicator. Data are from 1692 participants of the Netherlands Study of Depression and Anxiety (NESDA) who were recruited from the community, general practice, and specialized mental health care. Differences in evening sAA levels were examined between patient groups (i.e., 752 current major depressive disorder [MDD], 611 remitted MDD, and 329 healthy controls) and between 46 tricyclic antidepressant (TCA) users, 307 selective serotonin reuptake inhibitor (SSRI) users, 97 users of another antidepressant, and 1242 non-users. Each participant sampled twice at 22.00h and 23.00h. In multivariable analysis, there was a trend over the three groups with increasing sAA levels from controls to remitted MDD to current MDD that approached significance. Furthermore, in comparison to non-users of antidepressants, TCA rather than SSRI users showed higher sAA levels, that persisted after multivariable adjustment. The present study shows that higher evening sAA levels in depressed patients, indicative of an increased sympathetic activity, may be induced by TCAs.

  7. Role of disulfide bridges in the activity and stability of a cold-active alpha-amylase.

    PubMed

    Siddiqui, Khawar Sohail; Poljak, Anne; Guilhaus, Michael; Feller, Georges; D'Amico, Salvino; Gerday, Charles; Cavicchioli, Ricardo

    2005-09-01

    The cold-adapted alpha-amylase from Pseudoalteromonas haloplanktis unfolds reversibly and cooperatively according to a two-state mechanism at 30 degrees C and unfolds reversibly and sequentially with two transitions at temperatures below 12 degrees C. To examine the role of the four disulfide bridges in activity and conformational stability of the enzyme, the eight cysteine residues were reduced with beta-mercaptoethanol or chemically modified using iodoacetamide or iodoacetic acid. Matrix-assisted laser desorption-time of flight mass spectrometry analysis confirmed that all of the cysteines were modified. The iodoacetamide-modified enzyme reversibly folded/unfolded and retained approximately one-third of its activity. Removal of all disulfide bonds resulted in stabilization of the least stable region of the enzyme (including the active site), with a concomitant decrease in activity (increase in activation enthalpy). Disulfide bond removal had a greater impact on enzyme activity than on stability (particularly the active-site region). The functional role of the disulfide bridges appears to be to prevent the active site from developing ionic interactions. Overall, the study demonstrated that none of the four disulfide bonds are important in stabilizing the native structure of enzyme, and instead, they appear to promote a localized destabilization to preserve activity.

  8. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  9. Effects of Cardiorespiratory Fitness and Obesity on Salivary Secretory IgA and Alpha-Amylase in South African Children

    PubMed Central

    Starzak, Dorota E.; Konkol, Kristen F.; McKune, Andrew J.

    2016-01-01

    This study examined whether cardiorespiratory fitness (CRF) and body composition are associated with salivary secretory immunoglobulin A (SIgA), a mucosal immunity marker, and salivary alpha-amylase (sAA), a marker of stress-related sympathetic nervous system (SNS) activity, in South African children. Morning (7:30–8:00 a.m.) saliva samples were collected from 132 children (10.05 ± 1.68 years old, 74 females, 58 males). Body composition, resting blood pressure, and predicted maximal aerobic capacity (VO2max) were determined, and SIgA and sAA were quantified. Obese children had significantly higher sAA compared with overweight and normal weight children (p < 0.01). SIgA secretion rate was significantly lower in obese and overweight vs. normal weight children (p < 0.01). Multiple-linear regression analysis revealed that body mass index (BMI) (p < 0.05) and diastolic blood pressure (DBP) (p < 0.05) were independent predictors of sAA with CRF acting as a mitigator. Age and BMI predicted SIgA secretion rate (p < 0.05) with BMI (p < 0.001) found to be an independent predictor of SIgA secretion rate. Obesity, based on BMI, was associated with elevated SNS activity and lowered mucosal immunity. CRF-mitigated sympathetic activation was not associated with mucosal immunity. PMID:27483329

  10. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.

    PubMed Central

    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M

    2000-01-01

    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III. PMID:10947962

  11. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.

    PubMed

    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M

    2000-09-01

    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III.

  12. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  13. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  14. Structure-activity relationship of benzoxazinones and related compounds with respect to the growth inhibition and alpha-amylase activity in cress seedlings.

    PubMed

    Kato-Noguchi, Hisashi; Macías, Francisco A; Molinillo, José M G

    2010-10-15

    Benzoxazinones and their degradation compounds inhibited root growth and alpha-amylase activity in cress seedlings. The inhibitory activity of these compounds was divided into three groups: the high active group; 2,4-dihydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2,4-dihydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, the moderate active group; 7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, (2H)-1,4-benzoxazin-3(4H)-one, 6-methoxy-benzoxazolin-2(3H)-one, benzoxazolin-2(3H)-one and 2-amino-phenoxazine-3-one, and the low active group; 2-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-amino-7-hydroxyphenoxazine-3-one and 2-amino-7-methoxyphenoxazine-3-one. The structure-activity of these compounds suggests that compounds that have benzoxazinone skeletons are the most active structure, and a hydroxyl group at position C-2 on the benzoxazinone skeleton may not affect inhibitory activity, whereas a hydroxyl group at position N-4 on the skeleton is essential for inhibitory activity. However, the concentration-response curves of these compounds and the I(50) values (the concentrations required for 50% inhibition) for root growth and alpha-amylase indicated that root growth was positively correlated with the alpha-amylase activity in the seedlings. alpha-Amylase is required not only for seed germination, but also subsequent seedling growth until photosynthesis is sufficient to support seedling growth. Therefore, these results suggest that the compounds studied here may inhibit the root growth of cress seedlings by inhibiting alpha-amylase activity.

  15. Association of alpha-amylase and the R1 protein with starch granules precedes the initiation of net starch degradation in turions of Spirodela polyrhiza.

    PubMed

    Reimann, Rezarta; Ritte, Gerhard; Steup, Martin; Appenroth, Klaus-J

    2002-01-01

    In turions of Spirodela polyrhiza (L.) Schleiden, net degradation of storage starch is controlled by a special low fluence response of phytochrome requiring illumination for several days. This light effect has been used to study protein-starch interactions that occur prior to and during net degradation of starch. Following various pretreatments on S. polyrhiza turions, native starch granules were isolated and two fractions of starch-related proteins were distinguished: proteins enclosed within the starch particles (starch-internalized proteins) and those attached to the surface (starch-associated proteins). The pattern of starch-associated proteins as resolved by SDS-PAGE was more complex than that of starch-internalized proteins and varied depending upon the pretreatment of the turions. Two starch associated proteins were identified immunochemically as alpha-amylase (EC 3.2.1.1) and the R1 protein (Lorberth et al. (1998) Nature Biotechnology 16: 473-477). Dark-pretreatment of non-dormant turions does not induce starch net degradation. Under these conditions, alpha-amylase and R1 were bound to the surface of the starch granules. Continuous illumination with red light induces a rapid degradation of starch. Within the first 24 h of illumination the level of starch-associated alpha-amylase transiently increased and subsequently decreased rapidly. Similarly, the amount of the starch-associated R1 also decreased during illumination. The dissociation of both alpha-amylase and R1 from the starch granules preceded the decrease in starch content. However, binding of the two proteins to starch granules remained unchanged when the turions did not perform net starch degradation (as observed during continuous darkness, orthophosphate deficiency, or dormancy of the turions). Thus, during net starch degradation, so far unidentified changes are postulated to occur at the surface of the starch particles that are relevant for protein binding. This conclusion was supported by in

  16. Purification, characterization, and partial primary sequence of a major-maltotriose-producing alpha-amylase, ScAmy43, from Sclerotinia sclerotiorum.

    PubMed

    Ben Abdelmalek-Khedher, Imen; Urdaci, Maria Camino; Limam, Ferid; Schmitter, Jean Marie; Marzouki, M Nejib; Bressollier, Philippe

    2008-09-01

    A novel alpha-amylase (alpha-1,4-alpha-D-glucan glucanohydrolase, E.C. 3.2.1.1), ScAmy43, was found in the culture medium of the phytopathogenic fungus Sclerotinia sclerotiorum grown on oats flour. Purified to homogeneity, ScAmy43 appeared as a 43 kDa monomeric enzyme, as estimated by SDS-PAGE and Superdex 75 gel filtration. The MALDI peptide mass fingerprint of ScAmy43 tryptic digest as well as internal sequence analyses indicate that the enzyme has an original primary structure when compared with other fungal alpha- amylases. However, the sequence of the 12 N-terminal residues is homologous with those of Aspergillus awamori and Aspergillus kawachii amylases, suggesting that the new enzyme belongs to the same GH13 glycosyl hydrolase family. Assayed with soluble starch as substrate, this enzyme displayed optimal activity at pH 4 and 55oC with an apparent Km value of 1.66 mg/ml and Vmax of 0.1 micromol glucose x min-1 x ml-1. ScAmy43 activity was strongly inhibited by Cu2+, Mn2+, and Ba2+, moderately by Fe2+, and was only weakly affected by Ca2+ addition. However, since EDTA and EGTA did not inhibit ScAmy43 activity, this enzyme is probably not a metalloprotein. DTT and beta-mercaptoethanol strongly increased the enzyme activity. Starting with soluble starch as substrate, the end products were mainly maltotriose, suggesting for this enzyme an endo action.

  17. Isolation and characterization of the subunits of a heat-labile alpha-amylase inhibitor from Phaseolus vulgaris white kidney bean.

    PubMed

    Yamaguchi, H

    1993-02-01

    The heat-labile one of the two alpha-amylase inhibitors of the white kidney bean (Phaseolus vulgaris) was found to be composed of three kinds of subunits, and they were isolated and characterized. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide maps between the alpha- and beta-subunit polypeptides. The alpha-subunit contained 30% by weight of carbohydrate, mainly made up of high mannose-oligosaccharides, and the sugar moiety of the beta-subunit amounted 7% and appeared to be predominantly composed of xylomannose-type oligosaccharides. The largest subunit, gamma, was very similar in molecular features to a postulated alpha beta-dimer and its N-terminal sequence coincided with that of the alpha-subunit. The molecular weights of the polypeptides of alpha, beta-, and gamma-subunits were shown to be 7,800, 14,000, and 22,000, respectively, by SDS-PAGE. It seemed likely that the alpha- and beta-subunits are common to both of the inhibitors and that the heat-lability of this inhibitor arises from the gamma-subunit.

  18. Immediate Effects of Traditional Thai Massage on Psychological Stress as Indicated by Salivary Alpha-Amylase Levels in Healthy Persons.

    PubMed

    Sripongngam, Thanarat; Eungpinichpong, Wichai; Sirivongs, Dhavee; Kanpittaya, Jaturat; Tangvoraphonkchai, Kamonwan; Chanaboon, Sutin

    2015-10-05

    BACKGROUND Stress can cause psychological and physiological changes. Many studies revealed that massage can decrease stress. However, traditional Thai massage has not been well researched in this regard. The purpose of this study was to investigate the immediate effects of traditional Thai massage (TTM) on salivary alpha-amylase levels (sAA), heart rate variability (HRV), autonomic nervous system (ANS) function, and plasma renin activity (PRA). MATERIAL AND METHODS Twenty-nine healthy participants were randomly allocated into either a traditional Thai massage (TTM) group or Control (C) group, after which they were switched to the other group with a 2-week wash-out period. Each of them was given a 10-minute mental arithmetic test to induce psychological stress before a 1-hour session of TTM or rest. RESULTS Within-groups comparison revealed that sAA was significantly decreased (p<0.05) in the TTM group but not in the C group. HRV and ANS function were significantly increased (p<0.05) and PRA was significantly decreased (p<0.05) in both groups. However, low frequency per high frequency ratio (LF/HF ratio) and ANS balance status were not changed. Only sAA was found to be significantly different between groups (p<0.05). CONCLUSIONS We conclude that both TTM and rest can reduce psychological stress, as indicated by decreased sAA levels, increased parasympathetic activity, decreased sympathetic activity, and decreased PRA. However, TTM may have a modest effect on stress reduction as indicated by a reduced sAA.

  19. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    PubMed Central

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  20. Differences in Salivary Alpha-Amylase and Cortisol Responsiveness following Exposure to Electrical Stimulation versus the Trier Social Stress Tests

    PubMed Central

    Maruyama, Yoshihiro; Kawano, Aimi; Okamoto, Shizuko; Ando, Tomoko; Ishitobi, Yoshinobu; Tanaka, Yoshihiro; Inoue, Ayako; Imanaga, Junko; Kanehisa, Masayuki; Higuma, Haruka; Ninomiya, Taiga; Tsuru, Jusen; Hanada, Hiroaki; Akiyoshi, Jotaro

    2012-01-01

    Background Cortisol is an essential hormone in the regulation of the stress response along the HPA axis, and salivary cortisol has been used as a measure of free circulating cortisol levels. Recently, salivary alpha-amylase (sAA) has also emerged as a novel biomarker for psychosocial stress responsiveness within the sympathetic adrenomedullary (SAM) system. Principal Findings We measured sAA and salivary cortisol in healthy volunteers after exposure to the Trier Social Stress Test (TSST) and electric stimulation stress. One hundred forty-nine healthy volunteers participated in this study. All subjects were exposed to both the TSST and electric stimulation stress on separate days. We measured sAA and salivary cortisol levels three times immediately before, immediately after, and 20 min after the stress challenge. The State (STAI-S) and Trait (STAI-T) versions of the Spielberger Anxiety Inventory test and the Profile of Mood State (POMS) tests were administered to participants before the electrical stimulation and TSST protocols. We also measured HF, LF and LF/HF Heart Rate Variability ratio immediately after electrical stimulation and TSST exposure. Following TSST exposure or electrical stimulation, sAA levels displayed a rapid increase and recovery, returning to baseline levels 20 min after the stress challenge. Salivary cortisol responses showed a delayed increase, which remained significantly elevated from baseline levels 20 min after the stress challenge. Analyses revealed no differences between men and women with regard to their sAA response to the challenges (TSST or electric stimulations), while we found significantly higher salivary cortisol responses to the TSST in females. We also found that younger subjects tended to display higher sAA activity. Salivary cortisol levels were significantly correlated with the strength of the applied electrical stimulation. Conclusions These preliminary results suggest that the HPA axis (but not the SAM system) may show

  1. Increased alpha-amylase response to an acute psychosocial stress challenge in healthy adults with childhood adversity.

    PubMed

    Kuras, Yuliya I; McInnis, Christine M; Thoma, Myriam V; Chen, Xuejie; Hanlin, Luke; Gianferante, Danielle; Rohleder, Nicolas

    2017-01-01

    Childhood adversity is highly prevalent and linked to lasting psychological and physiological consequences. A potential mechanism for negative health outcomes is altered stress reactivity. While previous research has addressed associations of childhood adversity with stress system reactivity, sympathetic nervous system (SNS) stress reactivity is understudied. We therefore set out here to examining salivary alpha-amylase (sAA) reactivity in relation with childhood adversity. Forty-one healthy adult subjects (n = 24 male; n = 17 female) aged 18-34 years underwent the Trier Social Stress Test (TSST) and completed the Childhood Trauma Questionnaire (CTQ). Saliva for measurement of sAA was collected at three time points; before the TSST, immediately after, and 10 min post-TSST. We found that those with childhood trauma had a higher overall sAA response to the TSST, as seen in a repeated measures ANOVA (CTQ by time interaction: F(1.8,71.5) = 6.46, p = .01) and an independent samples t-test indicating higher sAA baseline to peak response (t = 3.22, p = .003). There was also a positive correlation between sAA reactivity and the CTQ subscales of childhood physical abuse (r = .46, p = .005) and emotional abuse (r = .37, p = .024). Healthy adults with low-to-moderate childhood adversity had a heightened sAA response immediately following the stressor. Higher SNS reactivity could be a link to negative health outcomes in adults with early adversity. Future research should address whether altered sAA reactivity is predictive of negative health outcomes in those with childhood adversity.

  2. Polymer masked-unmasked protein therapy. 1. Bioresponsive dextrin-trypsin and -melanocyte stimulating hormone conjugates designed for alpha-amylase activation.

    PubMed

    Duncan, Ruth; Gilbert, Helena R P; Carbajo, Rodrigo J; Vicent, María J

    2008-04-01

    Polymer-protein conjugation, particularly PEGylation, is well-established as a means of increasing circulation time, reducing antigenicity, and improving the stability of protein therapeutics. However, PEG has limitations including lack of polymer biodegradability, and conjugation can diminish or modify protein activity. The aim of this study was to explore a novel approach for polymer-protein modification called polymer-masking-unmasking-protein therapy (PUMPT), the hypothesis being that conjugation of a biodegradable polymer to a protein would protect it and mask activity in transit, while enabling controlled reinstatement of activity at the target site by triggered degradation of the polymeric component. To test this hypothesis, dextrin (alpha-1,4 polyglucose, a natural polymer degraded by alpha-amylase) was conjugated to trypsin as a model enzyme or to melanocyte stimulating hormone (MSH) as a model receptor-binding ligand. The effect of dextrin molecular weight (7700, and 47200 g/mol) and degree of succinoylation (9-32 mol %) on its ability to mask/unmask trypsin activity was assessed using N-benzoyl-L-arginine-p-nitroanilide (L-BAPNA). Dextrin conjugation reduced enzyme activity by 34-69% depending on the molecular weight and degree of succinoylation of dextrin. However, incubation with alpha-amylase led to reinstatement of activity to a maximum of 92-115%. The highest molecular dextrin (26 mol % succinoylation) gave optimum trypsin masking-unmasking. This intermediate was used to synthesize a dextrin-MSH conjugate (dextrin Mw = 47200 g/mol; MSH content 37 wt %), and its biological activity (+/-alpha-amylase) was assessed by measuring melanin production by murine melanoma (B16F10) cells. Conjugation reduced melanin production to 11%, but addition of alpha-amylase was able to restore activity to 33% of the control value. These were the first studies to confirm the potential of PUMPT for further application to clinically important protein therapeutics. The

  3. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.

    PubMed Central

    Buisson, G; Duée, E; Haser, R; Payan, F

    1987-01-01

    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 5. Fig. 7. PMID:3502087

  4. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.

    PubMed

    Buisson, G; Duée, E; Haser, R; Payan, F

    1987-12-20

    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): a review of clinical studies on weight loss and glycemic control.

    PubMed

    Barrett, Marilyn L; Udani, Jay K

    2011-03-17

    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity.

  6. Double-sided staining with a gold probe and silver enhancement to detect alpha-amylase and sugar moieties in the mouse salivary glands.

    PubMed

    Menghi, G; Marchetti, L; Bondi, A M; Accili, D; Sabbieti, M G; Materazzi, G

    1999-07-01

    In the present study we report the development of an ultrastructural electron microscopic double-sided staining technique that, using gold probes of 10 nm and enhancement of the gold signal by silver amplification, allows the demonstration of two antigenic sites on the same section. The labeling was carried out in the following manner: one face of uncoated floating grids was incubated with an antibody directed to alpha-amylase, followed by a secondary gold-labeled antibody, amplification of gold particles, drying and carbon coating; subsequently, the reverse face of the same grid, was processed for lectin cytochemistry, with and without sialidase digestion, and it was incubated with HRP-conjugated lectins, anti-HRP antibody and protein-A gold. Also the reverse sequence of steps and amplification of gold signal after the first or second labeling were experimented. The resultant small and large particles revealed different distributional patterns of antigenic sites on the opposite faces of the same tissue section. The transparency of the resin-embedded ultrathin sections in the electron beam allowed the simultaneous visualization of the gold probes of different sizes present on the two faces. The analysis of immunolabeling revealed that the alpha-amylase is chiefly secreted by the parotid and submandibular glands. The application of this double-sided staining technique also indicated that, when present in glycosylated form, the alpha-amylase enzyme does not contain sialic acid in the submandibular and sublingual glands; conversely, its location on the electron-dense areas of target granules in the parotid acinar cells seems to suggest that a sialylated isoenzymatic form can occur within these granule regions where sialic, acid linked to beta-galactose, was found to be located.

  7. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): A review of clinical studies on weight loss and glycemic control

    PubMed Central

    2011-01-01

    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity. PMID:21414227

  8. The effect of single and repeated bouts of prolonged cycling and circadian variation on saliva flow rate, immunoglobulin A and alpha-amylase responses.

    PubMed

    Li, Tzai-Li; Gleeson, Michael

    2004-01-01

    The purpose of this study was to establish the effect of exercise at different times of day on saliva flow rate, immunoglobulin A (sIgA) concentration and secretion rate, and alpha-amylase activity, and to establish how these parameters change following a second exercise bout performed on the same day. In a counterbalanced design, eight male volunteers participated in three experimental trials separated by at least 4 days. On the trial with afternoon exercise only, the participants cycled for 2 h at 60% VO2max starting at 14:00 h. On the other two trials, participants performed either two bouts of exercise at 60% VO2max for 2 h (the first started at 09:00 h and the second started at 14:00 h) or a separate resting trial. Unstimulated saliva samples were obtained 10 min before exercise, after 58 - 60 min and during the last 2 min of exercise, and at 1 h and 2 h after exercise. Venous blood samples were taken 5 min before exercise and immediately after exercise for both bouts. Participants remained fasted between 23:00 h on the day before the trials and 18:00 h on the day of the trial. Circadian variations were found in sIgA concentration, which decreased with time from its highest value in the early morning to its lowest value in the evening, and salivary alpha-amylase secretion rate, which increased from its lowest value in the morning to its highest value in the late afternoon. Cycling at 60% VO2max for 2 h significantly decreased saliva flow rate, increased sIgA concentration and alpha-amylase activity, but did not influence sIgA secretion rate. Performing prolonged cycling at different times of day did not differentially affect the salivary and plasma hormonal responses in the short term. Performance of a second prolonged exercise bout elicited a greater plasma stress hormone response but did not appear to compromise oral immunity acutely. These findings also suggest that, in terms of saliva secretion, sIgA and alpha-amylase responses, a 3 h rest is enough to

  9. Change in location and processing of inhibin alpha-subunit precursors during sexual maturation of the Djungarian hamster testis.

    PubMed

    Tuohimaa, P; Bläuer, M; Bergmann, M; Aumüller, G

    1993-02-01

    Immunohistochemical location and immunoblot of inhibin alpha-subunit peptides were analyzed in the testis of the Djungarian hamster from days 0-31 of postnatal development using a specific antibody. An intense immunoreaction was observed in the centrally located T1 prespermatogonia at day 0. The staining intensity decreased gradually in the spermatogonia when they make contact with the basal lamina at days 8-10. At days 13 and 15 there is no staining. Thereafter the immunoreactivity in Sertoli cells as well as in A spermatogonia gradually increased, being highest in sexually mature animals. The intensity of alpha-subunit staining in the seminiferous tubules was stage specific, being strongest at stages III and IV. Immunoblot analysis of testis homogenates with the anti-INH alpha 1-32 antibody showed several bands: 88K, 80K, and 43K in immature hamster testis (0-, 2-, 6-, 8-, or 10-day-old). In the adult hamster (31-day-old) 88K, 80K, 28K, and 20K bands were seen, but no 43K band. Dimeric inhibin was not detected. The 43-44K band most likely corresponds to the pro-alpha N alpha C, the 28K band to intermediate forms between alpha N alpha C and alpha C (alpha I alpha C), and the 20K band to mature alpha-subunit (alpha C). The shift from the immature pattern to mature occurs at about 20 days of age. Freezing of the samples was deleterious to alpha C, since it could be detected only in freshly homogenized samples. The results suggest that prespermatogonia produce predominantly monomeric alpha-subunit precursor pro-alpha N alpha C, whereas the mature Sertoli cells as well as A spermatogonia contain mainly monomeric alpha I alpha C. The alpha-inhibin precursors may act as auto-/paracrine regulators of spermatogenesis. Our results suggest that different alpha-subunit precursors, pro-alpha N alpha C and alpha I alpha C, might be involved in the differentiation and maintenance of spermatogenesis, respectively. The posttranslational processing of alpha-subunit precursors

  10. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment.

    PubMed

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

    2015-01-01

    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold-adapted enzymes, as did comparison of the kinetic parameters K m and k cat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes.

  11. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  12. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  13. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  14. Asymmetry in children's salivary cortisol and alpha-amylase in the context of marital conflict: links to children's emotional security and adjustment.

    PubMed

    Koss, Kalsea J; George, Melissa R W; Cummings, E Mark; Davies, Patrick T; El-Sheikh, Mona; Cicchetti, Dante

    2014-05-01

    Recent research supports the promise of examining interactive models of physiological processes on children's adjustment. The present study investigates interactions between children's autonomic nervous system activity and adrenocortical functioning in the context of marital discord; specifically, testing models of concurrent responses proposed by Bauer et al. ([2002] Developmental and Behavioral Pediatrics 23:102-113) in the prediction of children's behavioral responses to conflict and adjustment. Asymmetry and symmetry in children's salivary alpha-amylase and cortisol were examined in 195 children (M age = 8 years) in response to viewing conflict vignettes. Results were partially consistent with an interactive model in the context of high marital discord; asymmetry among higher alpha-amylase and lower cortisol related to higher emotional insecurity and concurrent and subsequent maladjustment. In contrast, patterns of symmetrical responses were related to greater maladjustment for children exposed to lower levels of marital discord, supporting an additive model. Findings support the importance of a multisystem approach to investigating the adaptiveness of children's physiological stress responses, while also highlighting the value of considering physiological responses in the context of family risk.

  15. In silico analysis of the thermodynamic stability changes of psychrophilic and mesophilic alpha-amylases upon exhaustive single-site mutations.

    PubMed

    Gilis, Dimitri

    2006-01-01

    Identifying sequence modifications that distinguish psychrophilic from mesophilic proteins is important for designing enzymes with different thermodynamic stabilities and to understand the underlying mechanisms. The PoPMuSiC algorithm is used to introduce, in silico, all the single-site mutations in four mesophilic and one psychrophilic chloride-dependent alpha-amylases and to evaluate the changes in thermodynamic stability. The analysis of the distribution of the sequence positions that could be stabilized upon mutation shows a clear difference between the three domains of psychrophilic and mesophilic alpha-amylases. Most of the mutations stabilizing the psychrophilic enzyme are found in domains B and C, contrary to the mesophilic proteins where they are preferentially situated in the catalytic domain A. Moreover, the calculations show that the environment of some residues responsible for the activity of the psychrophilic protein has evolved to reinforce favorable interactions with these residues. In the second part, these results are exploited to propose rationally designed mutations that are predicted to confer to the psychrophilic enzyme mesophilic-like thermodynamic properties. Interestingly, most of the mutations found in domain C strengthen the interactions with domain A, in agreement with suggestions made on the basis of structural analyses. Although this study focuses on single-site mutations, the thermodynamic effects of the recommended mutations should be additive if the mutated residues are not close in space.

  16. Insecticidal effects of extracts of seven plant species on larval development, alpha-amylase activity and offspring production of Tribolium castaneum (Herbst) (Insecta: Coleoptera: Tenebrionidae).

    PubMed

    Jbilou, R; Amri, H; Bouayad, N; Ghailani, N; Ennabili, A; Sayah, F

    2008-03-01

    Bioinsecticidal effects of methanol extracts from seven plant species on Tribolium castaneum were investigated. Centaurium erythraea, Peganum harmala, Ajuga iva, Aristolochia baetica, Pteridium aquilinum and Raphanus raphanistrum extracts inhibit growth of larvae. C. erythraea was the most toxic with 63% mortality 10 days after treatment, followed by P. harmala with 58%. C. erythraea and P. aquilinum reduce the emergence rate respectively of 66% and 19%. The duration of larval period was shortened by Launaea arborescens, P. aquilinum and A. iva extracts, whereas R. raphanistrum and P. harmala extracts extend the larval period when compared to the control. Extracts of C. erythraea, P. harmala, A. iva and A. baetica inhibited F1 progeny production. Larvae possess three alpha-amylase isoforms as determined by SDS-PAGE. Larvae fed on treated diet had lower alpha-amylase activity than larvae feed on untreated diet. C. erythraea and P. harmala are the most potent extracts. These plant extracts could be useful to reduce seed damage caused by this pest species.

  17. Improving production of hyperthermostable and high maltose-forming alpha-amylase by an extreme thermophile Geobacillus thermoleovorans using response surface methodology and its applications.

    PubMed

    Uma Maheswar Rao, J L; Satyanarayana, T

    2007-01-01

    By cultivating Geobacillus thermoleovorans in shake flasks containing cane molasses medium at 70 degrees C, the fermentation variables were optimized by 'one variable at a time' approach followed by response surface methodology (RSM). The statistical model was obtained by central composite design (CCD) using three variables (cane-molasses, urea and inoculum density). An overall 1.6- and 2.1-fold increase in enzyme production was achieved in the optimized medium in shake flasks and fermenter, respectively. The alpha-amylase titre increased significantly in cane-molasses medium (60 U ml(-1)) as compared to that in the synthetic medium (26 U ml(-1)). Thus the cost of enzyme produced in cane molasses medium (0.823 euros per million U) was much lower than that produced in the synthetic starch-yeast extract-tryptone medium (18.52 euros per million U). The shelf life of bread was improved by supplementing dough with alpha-amylase, and thus, the enzyme was found to be useful in preventing the staling of bread. Reducing sugars liberated from 20% and 30% raw pearl millet starch were fermented to ethanol; ethanol production levels attained were 35.40 and 28.0 g l(-1), respectively.

  18. Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Both (Porcine and bacterial) starch degrading enzymes highly valued by the biotechnology industry. (Porcine) A major target for protein engineering and the study of diabetes, obesity and dental care. (Bacterial) Major industrial and biotechnology interest used in brewing, baking, and food processing. World's number one industrial protein.

  19. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents

    PubMed Central

    Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki′ 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia. PMID:26469405

  20. The 'pair of sugar tongs' site on the non-catalytic domain C of barley alpha-amylase participates in substrate binding and activity.

    PubMed

    Bozonnet, Sophie; Jensen, Morten T; Nielsen, Morten M; Aghajari, Nushin; Jensen, Malene H; Kramhøft, Birte; Willemoës, Martin; Tranier, Samuel; Haser, Richard; Svensson, Birte

    2007-10-01

    Some starch-degrading enzymes accommodate carbohydrates at sites situated at a certain distance from the active site. In the crystal structure of barley alpha-amylase 1, oligosaccharide is thus bound to the 'sugar tongs' site. This site on the non-catalytic domain C in the C-terminal part of the molecule contains a key residue, Tyr380, which has numerous contacts with the oligosaccharide. The mutant enzymes Y380A and Y380M failed to bind to beta-cyclodextrin-Sepharose, a starch-mimic resin used for alpha-amylase affinity purification. The K(d) for beta-cyclodextrin binding to Y380A and Y380M was 1.4 mm compared to 0.20-0.25 mm for the wild-type, S378P and S378T enzymes. The substitution in the S378P enzyme mimics Pro376 in the barley alpha-amylase 2 isozyme, which in spite of its conserved Tyr378 did not bind oligosaccharide at the 'sugar tongs' in the structure. Crystal structures of both wild-type and S378P enzymes, but not the Y380A enzyme, showed binding of the pseudotetrasaccharide acarbose at the 'sugar tongs' site. The 'sugar tongs' site also contributed importantly to the adsorption to starch granules, as Kd = 0.47 mg.mL(-1) for the wild-type enzyme increased to 5.9 mg.mL(-1) for Y380A, which moreover catalyzed the release of soluble oligosaccharides from starch granules with only 10% of the wild-type activity. beta-cyclodextrin both inhibited binding to and suppressed activity on starch granules for wild-type and S378P enzymes, but did not affect these properties of Y380A, reflecting the functional role of Tyr380. In addition, the Y380A enzyme hydrolyzed amylose with reduced multiple attack, emphasizing that the 'sugar tongs' participates in multivalent binding of polysaccharide substrates.

  1. New approach for separating Bacillus subtilis metalloprotease and alpha-amylase by affinity chromatography and for purifying neutral protease by hydrophobic chromatography.

    PubMed

    Lauer, I; Bonnewitz, B; Meunier, A; Beverini, M

    2000-01-14

    Proteases are commonly used in the biscuit and cracker industry as processing aids. They cause moderate hydrolysis of gluten proteins and improve dough rheology to better control product texture and crunchiness. Commercial bacterial proteases are derived from Bacillus fermentation broth. As filtration and ultrafiltration are carried out as the only recovery steps, these preparations contain also alpha-amylase and beta-glucanase as the main side activities. The aim of this study is to purify and characterize the Bacillus subtilis metalloprotease from a commercial preparation, in order to study separately the impact of the protease activity with regards to its functionality on biscuit properties. Purification was achieved by means of affinity chromatography on Cibacron Blue and HIC as a polishing step. Affinity appeared to be the most appropriate matrix for large scale purification while ion exchange chromatography was inefficient in terms of recovery yields. The crude product was first loaded on a Hi Trap Blue column (34 microm, Pharmacia Biotech); elution was carried out with a gradient of NaCl in the presence of 1 mM ZnCl2. This step was only efficient in the presence of Zn cations, because this salt promoted both protease stabilization resulting in high recovery yields and also complexation of amylase units into dimers resulting in amylase retention on the column and a better separation of the 3 activities. Beta-glucanase was mostly non retained on the column and a part was coeluted with the protease. This protease fraction was then loaded on a Resource Phe column (15 microm, Pharmacia Biotech) in a last step of polishing. Elution was carried out with a linear gradient of 100-0% ammonium sulfate 1.3 M; protease was eluted at the beginning of the gradient and well separated from amylase and glucanase trace impurities. The homogeneity of the purified protease was confirmed by SDS-PAGE, which showed that its MW was about 38. pH and temperature optima were also

  2. Free cortisol and salivary alpha-amylase levels during a six-hour-water immersion in healthy young men

    NASA Astrophysics Data System (ADS)

    Rohleder, N.; Wirth, D.; Fraßl, W.; Kowoll, R.; Schlemmer, M.; Vogler, S.; Kirsch, K. A.; Kirschbaum, C.; Gunga, H.-C.

    2005-08-01

    Limited data are available on the response of stress systems to microgravity. Increased activity of stress systems is reported during space flight, but unchanged or decreased activity during simulated microgravity. We here investigated the impact of head-out water immersion on the activity of the hypothalamus-pituitary-adrenal (HPA) axis and the sympathetic-adrenal-medullary (SAM) system.Eight healthy young men were exposed to a six-hour water immersion in a thermo neutral bath and a control condition. Saliva samples were taken before, during, and after interventions to assess cortisol as an index for HPA axis activity, and salivary α-amylase as an index for SAM system activity.Cortisol levels uniformly decreased during both conditions. Amylase levels increased during both conditions, but were significantly lower during the first half of water immersion compared to the control condition.In conclusion, the HPA axis is not influenced by simulated microgravity, while SAM system activity shows initial decreases during water immersion.

  3. Enzymatic Properties of an Alkaline and Chelator Resistant alpha-amylase from the Alkaliphilic Bacillus sp. Isolate L1711

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    An alkaliphilic amylase producing bacterium, Bacillus sp. strain L 711, was selected among 13 soda lakes isolates. When grown at pH 10.5 and 37 C, strain L711 produced multiple forms of amylases in the culture broth. One of these, BAA, was purified from the culture supernatant by QAE column chromatography and preparative native gel electrophoresis. The molecular weight of BAA was determined to be 51 kDa by denaturing gel electrophoresis. The pH optima for activity below and above 40 C were 9.5 - 10.0 and 7.0 - 7.5 respectively. BAA was stable in the pH range 6-11 and was completely inactivated at 55 C. The thermostability was not increased in the presence of Ca(2+). The enzyme was strongly inhibited by Ca(2+), Zn(2+), Mg(2+), Mn(2+), Ba(2+) and Cu(2+), whereas the presence of Na(+), Co(2+) and EDTA (10 mM) enhanced enzymatic activity. The K(sub m), and specific activity of BAA on soluble starch were 1.9 mg/ml and 18.5 U/mg respectively. The main end products of hydrolysis were maltotetraose, maltose and glucose.

  4. The carboxyl-terminal valine residues of proTGF alpha are required for its efficient maturation and intracellular routing.

    PubMed Central

    Briley, G P; Hissong, M A; Chiu, M L; Lee, D C

    1997-01-01

    Soluble forms of transforming growth factor-alpha (TGF alpha) are derived by proteolytic processing of an integral membrane glycoprotein precursor (pro TGF alpha). Previous studies indicated that phorbol ester-induced cleavage of pro TGF alpha in CHO cells is dependent on the presence of a valine residue located at the carboxyl terminus of the precursor's cytoplasmic domain. We reassessed this requirement with epitope-tagged constructs introduced into transformed rat liver epithelial cells that normally express and process TGF alpha. We found that pro TGF alpha mutants lacking the terminal valine residues showed greatly reduced maturation to the fully glycosylated form. Additionally, they were present at substantially reduced levels on the cell surface and, instead, accumulated in the endoplasmic reticulum. Consistent with these results, enzyme-linked immunosorbent assay (ELISA) and Western blot analyses revealed little or no soluble TGF alpha in medium conditioned by cells expressing the mutant constructs. Finally, a truncated pro TGF alpha mutant lacking most of the cytoplasmic domain but retaining a carboxyl-terminal valine was processed and cleaved in a near-normal manner. These results, some of which were reproduced in CHO cells, indicate that the predominant effect of the carboxyl-terminal valines is to ensure normal maturation and routing of the precursor. Images PMID:9285829

  5. Direct fermentation of raw starch using a Kluyveromyces marxianus strain that expresses glucoamylase and alpha-amylase to produce ethanol.

    PubMed

    Wang, Rongliang; Wang, Dongmei; Gao, Xiaolian; Hong, Jiong

    2014-01-01

    Raw starch and raw cassava tuber powder were directly and efficiently fermented at elevated temperatures to produce ethanol using the thermotolerant yeast Kluyveromyces marxianus that expresses α-amylase from Aspergillus oryzae as well as α-amylase and glucoamylase from Debaryomyces occidentalis. Among the constructed K. marxianus strains, YRL 009 had the highest efficiency in direct starch fermentation. Raw starch from corn, potato, cassava, or wheat can be fermented at temperatures higher than 40°C. At the optimal fermentation temperature 42°C, YRL 009 produced 66.52 g/L ethanol from 200 g/L cassava starch, which was the highest production among the selected raw starches. This production increased to 79.75 g/L ethanol with a 78.3% theoretical yield (with all cassava starch were consumed) from raw cassava starch at higher initial cell densities. Fermentation was also carried out at 45 and 48°C. By using 200 g/L raw cassava starch, 137.11 and 87.71 g/L sugar were consumed with 55.36 and 32.16 g/L ethanol produced, respectively. Furthermore, this strain could directly ferment 200 g/L nonsterile raw cassava tuber powder (containing 178.52 g/L cassava starch) without additional nutritional supplements to produce 69.73 g/L ethanol by consuming 166.07 g/L sugar at 42°C. YRL 009, which has consolidated bioprocessing ability, is the best strain for fermenting starches at elevated temperatures that has been reported to date.

  6. Measurements of salivary alpha amylase and salivary cortisol in hominoid primates reveal within-species consistency and between-species differences.

    PubMed

    Behringer, Verena; Borchers, Claudia; Deschner, Tobias; Möstl, Erich; Selzer, Dieter; Hohmann, Gottfried

    2013-01-01

    Salivary alpha amylase (sAA) is the most abundant enzyme in saliva. Studies in humans found variation in enzymatic activity of sAA across populations that could be linked to the copy number of loci for salivary amylase (AMY1), which was seen as an adaptive response to the intake of dietary starch. In addition to diet dependent variation, differences in sAA activity have been related to social stress. In a previous study, we found evidence for stress-induced variation in sAA activity in the bonobos, a hominoid primate that is closely related to humans. In this study, we explored patterns of variation in sAA activity in bonobos and three other hominoid primates, chimpanzee, gorilla, and orangutan to (a) examine if within-species differences in sAA activity found in bonobos are characteristic for hominoids and (b) assess the extent of variation in sAA activity between different species. The results revealed species-differences in sAA activity with gorillas and orangutans having higher basal sAA activity when compared to Pan. To assess the impact of stress, sAA values were related to cortisol levels measured in the same saliva samples. Gorillas and orangutans had low salivary cortisol concentrations and the highest cortisol concentration was found in samples from male bonobos, the group that also showed the highest sAA activity. Considering published information, the differences in sAA activity correspond with differences in AMY1 copy numbers and match with general features of natural diet. Studies on sAA activity have the potential to complement molecular studies and may contribute to research on feeding ecology and nutrition.

  7. Study of starch fermentation at low pH by Lactobacillus fermentum Ogi E1 reveals uncoupling between growth and alpha-amylase production at pH 4.0.

    PubMed

    Calderon Santoyo, M; Loiseau, G; Rodriguez Sanoja, R; Guyot, J P

    2003-01-15

    Lactobacillus fermentum Ogi E1 is an amylolytic heterofermentative lactic acid bacterium previously isolated from ogi, a Benin maize sourdough. In the present study, the effect of different pH between 3.5 and 6.0 on starch fermentation products and alpha-amylase production was investigated. Whereas a pH of 5.0 was optimum for specific growth rate and lactic acid production, growth was only slightly affected at suboptimal pH of 4.0 and 6.0. Over a pH range of 6.0 to 3.5, yields of product formation from substrate and of biomass relative to ATP were constant. These results showed that L. fermentum Ogi E1 was particularly acid tolerant, and well adapted to the acid conditions that develop during natural fermentation of cereal doughs. This acid tolerance may partly explain the dominance of L. fermentum in various traditional African sourdoughs. Surprisingly, alpha-amylase production, unlike growth, dropped dramatically when the strain was cultivated at pH 4.0 with starch. With maltose as substrate, the yield of alpha-amylase relative to biomass remained unchanged at pH 4.0 and 5.0, unlike that observed with starch. Based on the distribution of enzyme activity between extra- and intracellular fractions and fermentation kinetics, it appears that starch was first hydrolyzed into dextrins by alpha-amylase activity, and maltose was produced from dextrins by extracellular enzyme activity, transferred into the cell and then hydrolyzed into glucose by intracellular alpha-glucosidase.

  8. Brucella suis prevents human dendritic cell maturation and antigen presentation through regulation of tumor necrosis factor alpha secretion.

    PubMed

    Billard, Elisabeth; Dornand, Jacques; Gross, Antoine

    2007-10-01

    Brucella is a facultative intracellular pathogen and the etiological agent of brucellosis. In some cases, human brucellosis results in a persistent infection that may reactivate years after the initial exposure. The mechanisms by which the parasite evades clearance by the immune response to chronically infect its host are unknown. We recently demonstrated that dendritic cells (DCs), which are critical components of adaptive immunity, are highly susceptible to Brucella infection and are a preferential niche for the development of the bacteria. Here, we report that in contrast to several intracellular bacteria, Brucella prevented the infected DCs from engaging in their maturation process and impaired their capacities to present antigen to naïve T cells and to secrete interleukin-12. Moreover, Brucella-infected DCs failed to release tumor necrosis factor alpha (TNF-alpha), a defect involving the bacterial protein Omp25. Exogenous TNF-alpha addition to Brucella-infected DCs restored cell maturation and allowed them to present antigens. Two avirulent mutants of B. suis, B. suis bvrR and B. suis omp25 mutants, which do not express the Omp25 protein, triggered TNF-alpha production upon DC invasion. Cells infected with these mutants subsequently matured and acquired the ability to present antigens, two properties which were dramatically impaired by addition of anti-TNF-alpha antibodies. In light of these data, we propose a model in which virulent Brucella alters the maturation and functions of DCs through Omp25-dependent control of TNF-alpha production. This model defines a specific evasion strategy of the bacteria by which they can escape the immune response to chronically infect their host.

  9. Effect of In Vitro Maturation Technique and Alpha Lipoic Acid Supplementation on Oocyte Maturation Rate: Focus on Oxidative Status of Oocytes

    PubMed Central

    Zavareh, Saeed; Karimi, Isaac; Salehnia, Mojdeh; Rahnama, Ali

    2016-01-01

    Background Therapeutic potential of in vitro maturation (IVM) in infertility is growing with great promise. Although significant progress is obtained in recent years, existing IVM protocols are far from favorable results. The first aim of this study was to investigate whether two step IVM manner change reactive oxygen species (ROS) and total anti- oxidant capacity (TAC) levels. The second aim was to find the effect of alpha lipoic acid (ALA) supplementation on oocyte maturation rate and on ROS/TAC levels during IVM. Materials and Methods In this experimental study, mouse germinal vesicle (GV) oocytes divided into cumulus denuded oocytes (DOs) and cumulus oocyte complexes (COCs) groups. GVs were matured in vitro in the presence or absence of ALA only for 18 hours (control) or with pre-culture of forskolin plus cilostamide for an additional 18 hours. Matured oocytes obtained following 18 and 36 hours based on experimental design. In parallel, the ROS and TAC levels were measured at different time (0, 18 and 36 hours) by 2',7'-dichlorodihydrofluorescein (DCFH) probe and ferric reducing/antioxidant power (FRAP) assay, respectively. Results Maturation rate of COCs was significantly higher than DOs in control group (P<0.05), while there was no significant difference between COCs and DOs when were pre-cultured with forskolin plus cilostamide. ROS and TAC levels was increased and decreased respectively in DOs after 18 hours while in COCs did not change at 18 hours and showed a significant increase and decrease respectively at 36 hours (P<0.05). ROS and TAC levels in the presence of ALA were significantly decreased and increased respectively after 36 hours (P<0.05) whereas, maturation rates of COCs and DOs were similar to their corresponding control groups. Conclusion ALA decreased ROS and increased TAC but could not affect maturation rate of both COCs and DOs in one or two step IVM manner. PMID:26985332

  10. Adolescents' Increasing Stress Response to Social Evaluation: Pubertal Effects on Cortisol and Alpha-Amylase during Public Speaking

    ERIC Educational Resources Information Center

    van den Bos, Esther; de Rooij, Mark; Miers, Anne C.; Bokhorst, Caroline L.; Westenberg, P. Michiel

    2014-01-01

    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden…

  11. [Mechanism of amylase action on glucoside starch bonds].

    PubMed

    Zherebtsov, N A; Zabelina, L F; Ektoba, A I

    1976-12-01

    Functional groups of glucoamylase and alpha-amylase from Asp. awamori, alpha-amylase from Asp. oryzae and alpha- and beta-amylases from barley malt are identified. Kinetic curves of the activity dependency on pH, values of ionization heats and photooxidative inactivation draw to the conclusion that carboxyl-imidazole system enters into the active site of the enzymes. A hypothetic mechanism of hydrolysis of alpha-1,4-glucoside bond in starch molecule by alpha- and beta-amylases and of alpha-1,4- and alpha-1,6-glucoside bonds by glucoamylase is given. A theory of induced correspondence of enzyme and substrate satisfactorily explains the specificity of the enzyme action and the cause of complete starch convertion into glucose under glucoamylase action and of terminal starch hydrolysis by alpha- and beta-amylases.

  12. Differences in saliva collection location and disparities in baseline and diurnal rhythms of alpha-amylase: a preliminary note of caution.

    PubMed

    Harmon, Amanda G; Towe-Goodman, Nissa R; Fortunato, Christine K; Granger, Douglas A

    2008-11-01

    Identified in the early 1980s as a surrogate marker of the sympathetic nervous system component of the stress response, there has been renewed interest in measuring salivary alpha-amylase (sAA) to test biosocial models of stress vulnerability. This brief report presents studies that document that oral fluids from the parotid and submandibular gland areas had higher sAA values than did whole saliva specimens, and sAA values in whole saliva were higher than levels measured in oral fluids from the sublingual gland area. sAA in oral fluids from the parotid and submandibular gland areas showed the highest and more pronounced diurnal variation than levels in whole saliva, and sAA in sublingual saliva showed the lowest and shallowest diurnal variation. When this source of inherent variability in sAA activity levels is not controlled for by collecting oral fluids consistently from specific gland areas, the detection of individual differences, associations between sAA and "behavioral" variables, and intra-individual change in sAA levels may be compromised. Awareness, and management, of this ubiquitous source of measurement error in sAA are essential to ensure the success of future research on the correlates and concomitants of sAA levels, stress-related reactivity and recovery, and diurnal variation.

  13. Mind your thoughts: associations between self-generated thoughts and stress-induced and baseline levels of cortisol and alpha-amylase.

    PubMed

    Engert, Veronika; Smallwood, Jonathan; Singer, Tania

    2014-12-01

    Stress is a major health burden in today's society. Research shows that negative cognitive styles are associated with increased stress reactivity, low mood and accelerated cellular aging. Our study sought to unravel the relationship between the content of self-generated thoughts and psychosocial stress measured in terms of hypothalamic-pituitary-adrenal axis and sympathetic activity. Features of self-generated thoughts were assessed using thought sampling while participants performed cognitive tasks following a stress induction or in a baseline condition. More negatively toned emotional thoughts and more social temporal thoughts with a past focus were associated with increased cortisol and alpha-amylase levels, both after stress and at baseline. More social temporal thoughts with a future focus, on the other hand, had an overall attenuating effect on the levels of both stress markers. Our results indicate a fundamental link between the thoughts and stress levels we experience. Understanding the mechanisms governing this mind-body association may have important implications for understanding and counteracting the high incidence of stress-related disorders in today's society.

  14. Effects of a high-pressure treatment on the wheat alpha-amylase inhibitor and its relationship to elimination of allergenicity

    NASA Astrophysics Data System (ADS)

    Yamamoto, S.; Takanohashi, K.; Hara, T.; Odani, S.; Suzuki, A.; Nishiumi, T.

    2010-03-01

    In this study, the effects of high-pressure treatment on structure and allergeincity of alpha amylase inhibitor (a-AI) were investigated. The pressure-induced structural changes of α-AI were estimated by fluorescence spectra and by fourth derivative UV-spectroscopy for probed tyrosine residues and by circular dichroism (CD) spectroscopy. The changes in the tertiary structure detected by fluorescence spectra and by fourth derivative UV-spectroscopy under high pressure were indicated at over 300 MPa. Measurements of CD spectroscopy suggested that the effects of a high-pressure treatment on changes in the secondary structure of α-AI were little. From our results, pressure-induced changes of the α-AI structure were not apparent. On the other hands, the IgE-specific binding activities of pressurized α-AI to sera from allergic patients against wheat, which is estimated by observations of dot-blotting, were decreased by high-pressure treatment. It is known that the pressure-induced elimination of allergenicity is related to the tertiary structural changes of allergen molecules. This study are suspected that the epitopes of α-AI do not contain tyrosine residues, and thus the decrease of IgE-specific binding activities is probably caused by the tertiary structural changes of these parts of α-AI.

  15. Introduction of raw starch-binding domains into Bacillus subtilis alpha-amylase by fusion with the starch-binding domain of Bacillus cyclomaltodextrin glucanotransferase.

    PubMed

    Ohdan, K; Kuriki, T; Takata, H; Kaneko, H; Okada, S

    2000-07-01

    We constructed two types of chimeric enzymes, Ch1 Amy and Ch2 Amy. Ch1 Amy consisted of a catalytic domain of Bacillus subtilis X-23 alpha-amylase (Ba-S) and the raw starch-binding domain (domain E) of Bacillus A2-5a cyclomaltodextrin glucanotransferase (A2-5a CGT). Ch2 Amy consisted of Ba-S and D (function unknown) plus E domains of A2-5a CGT. Ch1 Amy acquired raw starch-binding and -digesting abilities which were not present in the catalytic part (Ba-S). Furthermore, the specific activity of Ch1 Amy was almost identical when enzyme activity was evaluated on a molar basis. Although Ch2 Amy exhibited even higher raw starch-binding and -digesting abilities than Ch1 Amy, the specific activity was lower than that of Ba-S. We did not detect any differences in other enzymatic characteristics (amylolytic pattern, transglycosylation ability, effects of pH, and temperature on stability and activity) among Ba-S, Ch1 Amy, and Ch2 Amy.

  16. Salivary alpha-amylase and cortisol in infancy and toddlerhood: direct and indirect relations with executive functioning and academic ability in childhood.

    PubMed

    Berry, Daniel; Blair, Clancy; Willoughby, Michael; Granger, Douglas A

    2012-10-01

    Using data from a predominantly low-income, population-based prospective longitudinal sample of 1292 children followed from birth, indicators of children's autonomic (salivary alpha-amylase; sAA) and hypothalamic-pituitary-adrenal (HPA) axis (salivary cortisol) activity at 7, 15, and 24 months of age were found to predict executive functioning at 36-months and academic achievement in pre-kindergarten. The findings suggested that the respective cortisol and sAA effects on executive functioning and academic achievement were interactive. Optimal developmental outcomes were associated with asymmetrical cortisol/sAA profiles. Higher cortisol levels were predictive of lower executive functioning and academic abilities, but only for those with concurrently moderate to high levels of sAA. In contrast, higher sAA concentrations were predictive of better executive functioning and academic abilities, but only for those with concurrently moderate to low levels of cortisol. These relations were statistically identical across infancy and toddlerhood. The conditional effects of cortisol and sAA on pre-kindergarten academic achievement were mediated fully by links between these early physiological indicators and executive functioning.

  17. Lysosomal alpha-glucosidase: cell-specific processing and altered maturation in HT-29 colon cancer cells.

    PubMed Central

    Francí, C; Egea, G; Arribas, R; Reuser, A J; Real, F X

    1996-01-01

    We have previously described the abnormal localization of resident Golgi proteins and O-glycans in the rough endoplasmic reticulum of mucin-secreting HT-29 M6 colon cancer cells, suggesting altered protein trafficking in these cells [Egea, Francí, Gambús, Lesuffleur, Zweibaum and Real (1993) J. Cell Sci. 105, 819-830]. In the present work, we have chosen lysosomal alpha-glucosidase as a reporter to examine the intracellular traffic of glycoproteins in M6 cells. We have compared the synthesis and processing of alpha-glucosidase in mucin-secreting M6 cells and in Caco-2 colon cancer cells, the latter resembling normal absorptive intestinal epithelium. Our results show that alpha-glucosidase processing and secretion is markedly delayed in M6 cells as compared to Caco-2 cells or normal fibroblasts, and this delay is caused by an accumulation of alpha-glucosidase precursor form in the trans-Golgi network. Furthermore, treatment in Caco-2 cells with brefeldin A led to changes in alpha-glucosidase maturation similar to those observed in untreated M6 cells. To determine whether altered processing occurs in other cultured cells, a panel of cancer cell lines and cultures from normal exocrine pancreas were examined. In pancreas-derived cultures, alpha-glucosidase showed a processing pattern different from that described until now. Only HT-29 cells and HT-29-derived subpopulations displayed a defect in alpha-glucosidase maturation. In conclusion, alpha-glucosidase processing is more diverse than has previously been described; this finding may have tissue-specific functional implications. PMID:8660303

  18. Two secondary carbohydrate binding sites on the surface of barley alpha-amylase 1 have distinct functions and display synergy in hydrolysis of starch granules.

    PubMed

    Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte

    2009-08-18

    Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.

  19. Expression of embryonic fibronectin isoform EIIIA parallels alpha-smooth muscle actin in maturing and diseased kidney.

    PubMed

    Barnes, V L; Musa, J; Mitchell, R J; Barnes, J L

    1999-06-01

    In this study we examined if an association exists between expression of an alternatively spliced "embryonic" fibronectin isoform EIIIA (Fn-EIIIA) and alpha-smooth muscle actin (alpha-SMA) in the maturing and adult rat kidney and in two unrelated models of glomerular disease, passive accelerated anti-glomerular basement membrane (GBM) nephritis and Habu venom (HV)-induced proliferative glomerulonephritis, using immunohistochemistry and in situ hybridization. Fn-EIIIA and alpha-SMA proteins were abundantly expressed in mesangium and in periglomerular and peritubular interstitium of 20-day embryonic and 7-day (D-7) postnatal kidneys in regions of tubule and glomerular development. Staining was markedly reduced in these structures in maturing juvenile (D-14) kidney and was largely lost in adult kidney. Expression of Fn-EIIIA and alpha-SMA was reinitiated in the mesangium and the periglomerular and peritubular interstitium in both models and was also observed in glomerular crescents in anti-GBM nephritis. Increased expression of Fn-EIIIA mRNA by in situ hybridization corresponded to the localization of protein staining. Dual labeling experiments verified co-localization of Fn-EIIIA and alpha-SMA, showing a strong correlation of staining between location and staining intensity during kidney development, maturation, and disease. Expression of EIIIA mRNA corresponded to protein expression in developing and diseased kidneys and was lost in adult kidney. These studies show a recapitulation of the co-expression of Fn-EIIIA and alpha-SMA in anti-GBM disease and suggest a functional link for these two proteins.

  20. Xenopus Gq alpha subunit activates the phosphatidylinositol pathway in Xenopus oocytes but does not consistently induce oocyte maturation.

    PubMed Central

    Guttridge, K L; Smith, L D; Miledi, R

    1995-01-01

    We cloned the Xenopus laevis form of Gq alpha subunit to study its effects on oocyte maturation. Injection of Xenopus Gq alpha mRNA into stage 6 oocytes activated the phospholipase C/phosphatidylinositol pathway. The oocyte membrane became permeable to calcium ions and was able to generate transient inward currents (T(in)), due to the opening of Ca(2+)-dependent Cl- channels. The T(in) amplitude developed over several hours and disappeared by 24 hr. Diacylglycerol levels were found to parallel the appearance and disappearance of the T(in). The concurrent decline of T(in) values and diacylglycerol was not due to a failure in the synthesis of Gq alpha protein, which was produced continuously for > 24 hr. After Xenopus Gq alpha mRNA injection, germinal vesicle breakdown (GVBD) was variable (0-100%) in stage 6 oocytes, whereas none of the stage 4 oocytes underwent GVBD. In contrast, stage 6 oocytes injected with mRNA encoding the Go alpha G protein consistently underwent GVBD but did not acquire T(in). Our results show that activation of phospholipase C is not an absolute requisite for the induction of maturation, although in oocytes of some frogs phospholipase C activation can trigger a pathway to GVBD. Images Fig. 7 PMID:7877971

  1. The importance of starch and sucrose digestion in nutritive biology of synanthropic acaridid mites: alpha-amylases and alpha-glucosidases are suitable targets for inhibitor-based strategies of mite control.

    PubMed

    Erban, Tomas; Erbanova, Michaela; Nesvorna, Marta; Hubert, Jan

    2009-07-01

    The adaptation of nine species of mites that infest stored products for starch utilization was tested by (1) enzymatic analysis using feces and whole mite extracts, (2) biotests, and (3) inhibition experiments. Acarus siro, Aleuroglyphus ovatus, and Tyroborus lini were associated with the starch-type substrates and maltose, with higher enzymatic activities observed in whole mite extracts. Lepidoglyphus destructor was associated with the same substrates but had higher activities in feces. Dermatophagoides farinae, Chortoglyphus arcuatus, and Caloglyphus redickorzevi were associated with sucrose. Tyrophagus putrescentiae and Carpoglyphus lactis had low or intermediate enzymatic activity on the tested substrates. Biotests on starch additive diets showed accelerated growth of species associated with the starch-type substrates. The inhibitor acarbose suppressed starch hydrolysis and growth of the mites. We suggest that the species with higher starch hydrolytic activity in feces were more tolerant to acarbose, and alpha-amylase and alpha-glucosidase of synanthropic mites are suitable targets for inhibitor-based strategies of mite control.

  2. Addition of interferon-alpha to a standard maturation cocktail induces CD38 up-regulation and increases dendritic cell function.

    PubMed

    Trepiakas, Redas; Pedersen, Anders Elm; Met, Ozcan; Svane, Inge Marie

    2009-04-06

    Monocyte-derived dendritic cells (DCs) are used as adjuvant cells in cancer immunotherapy and have shown promising results. In order to obtain full functional capacity, these DCs need to be maturated, and the current "gold standard" for this process is maturation with TNF-alpha, IL-1beta, IL-6 and PGE(2) used for generating standard DCs (sDC). Several studies indicate that IFN-alpha might also be important for DC differentiation and maturation. In this study, we tested the effect of IFN-alpha alone or as addition to the gold standard sDC cocktail. We observed that maturation by IFN-alpha differs from sDC maturation: The major phenotypic change after IFN-alpha maturation was dose-dependent up-regulation of CD38 but not CD83, while sDCs expressed the opposite profile with low CD38 and high CD83 expression. Similarly, maturation by Poly I:C leads to CD38high, CD83low DCs indicating a functional relationship between CD38, IFN-alpha and TLR3. Thus, CD38 appear to be a relevant marker for activation by TLR3 or IFN-alpha. Addition of IFN-alpha to the sDC cocktail results in up-regulation of both CD38 and CD83 and improved capacity for induction of autologous T-cell responses despite few other changes in DC phenotype and cytokine secretion. Our observations suggest that IFN-alpha could be included in maturation protocols for clinical grade DCs used for immunotherapy against cancer and should be included if DCs are used for CD8+ T-cell stimulation in vitro.

  3. Who is stressed? A pilot study of salivary cortisol and alpha-amylase concentrations in agoraphobic patients and their novice therapists undergoing in vivo exposure.

    PubMed

    Schumacher, Sarah; Gaudlitz, Katharina; Plag, Jens; Miller, Robert; Kirschbaum, Clemens; Fehm, Lydia; Fydrich, Thomas; Ströhle, Andreas

    2014-11-01

    In cognitive behavioural therapy of phobic anxiety, in vivo exposure is considered as an effective treatment strategy. Apparently, it involves the experience of stress and anxiety in patients. Given the therapist's role during exposure sessions, it is conceivable that the performance is also accompanied with the experience of stress in therapists, especially when unversed in conducting psychotherapy. Studies confirmed that cognitive behavioural therapists tend to avoid therapist-guided in vivo exposure. The objective of this study was the simultaneous investigation of therapist's and patient's stress response during in vivo exposure. Therefore, 23 agoraphobic patients and their 23 treating therapists in training provided five saliva samples during an in vivo exposure and five samples during an ordinary therapy session. Before and during exposure session, subjective evaluations of stress and anxiety were assessed. Results suggested that therapists reported similar levels of perceived stress as patients before exposure. Both groups displayed significantly elevated salivary cortisol (sC) levels during exposure compared to the control session and a trend for alterations in salivary alpha-amylase (sAA) activity was found. Therapists reached peak concentrations of sC before start of the intervention followed by a decline during exposure, while patients displayed peak levels of cortisol secretion after 60 min of exposure. In vivo exposure seems to be a demanding intervention not only for the patient, but also for therapists in training. However, it was also demonstrated that physiological and subjective stress rather decrease during the intervention and that both groups rated exposure to be substantially successful. Based on the presented results, another potential factor contributing to the under-usage of exposure treatment is conceivable and needs to be addressed in future research.

  4. Age Differences of Salivary Alpha-Amylase Levels of Basal and Acute Responses to Citric Acid Stimulation Between Chinese Children and Adults

    PubMed Central

    Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong

    2015-01-01

    It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults. PMID:26635626

  5. Treatment with anti-LFA-1 alpha monoclonal antibody selectively interferes with the maturation of CD4- 8+ thymocytes.

    PubMed

    Revilla, C; González, A L; Conde, C; López-Hoyos, M; Merino, J

    1997-04-01

    Maturation of T lymphocytes in the thymus is driven by signals provided by soluble factors and by the direct interaction between thymocytes and stromal cells. Although the interaction between T-cell receptor (TCR) and major histocompalibility complex (MHC) molecules on stromal cells is crucial for T-cell development, other accessory molecules seem to play a role in this process. In order to better understand the role of lymphocyte function-associated antigen-1 (LFA-1) and intercellular adhesion molecule-1 (ICAM-1) molecules in thymocyte maturation, mice were treated from birth with saturating doses of non-cytolytic-specific monoclonal antibodies. The effect of this treatment on thymocyte subpopulations and the expression of CD3 and TCR-alpha beta by these cells was investigated by flow cytometry. Our data demonstrated that the effective saturation of LFA-1 alpha chain in the thymus, but not ICAM-I or LFA-I beta chain, selectively interfered with the maturation of CD8+ T cells, as manifested by a marked reduction in the frequency of CD4-8+ thymocytes expressing high levels of CD3 and TCR-alpha beta. This selective reduction was also observed in peripheral blood mononuclear cells and spleen cells. The analysis of the frequencies of various V beta TCR showed that CD4-8+ thymocytes were globally affected by the treatment. These results underline the importance of the interaction between LFA-1 and its ligands in the maturation of CD8+ T cells and document the existence of different molecular requirements for the differentiation of CD4+ and CD8+ T cells.

  6. Enhanced antifungal and insect α-amylase inhibitory activities of Alpha-TvD1, a peptide variant of Tephrosia villosa defensin (TvD1) generated through in vitro mutagenesis.

    PubMed

    Vijayan, S; Imani, J; Tanneeru, K; Guruprasad, L; Kogel, K H; Kirti, P B

    2012-02-01

    TvD1 is a small, cationic, and highly stable defensin from the weedy legume, Tephrosia villosa with demonstrated in vitro antifungal activity. We show here peptide modifications in TvD1 that lead to enhanced antifungal activities. Three peptide variants, S32R, D37R, and Alpha-TvD1 (-G-M-T-R-T-) with variations in and around the β2-β3 loop region that imposes the two β-strands, β2 and β3 were generated through in vitro mutagenesis. Alpha-TvD1 exhibited enhanced antifungal activity against the fungal pathogens, Fusarium culmorum and Fusarium oxysporum with respective IC(50) values of 2.5 μM and 3.0 μM, when compared to S32R (<5.0 μM and >5.0 μM), D37R (5.5 μM and 4.5 μM), and the wild type TvD1 (6.5 μM). Because of the enhanced antifungal activity, this variant peptide was characterized further. Growth of F. culmorum in the presence of Alpha-TvD1 showed deformities in hyphal walls and nuclear damage. With respect to the plant pathogenic bacterium, Pseudomonas syringae pv. tomato strain DC3000, both Alpha-TvD1 and the wild type TvD1 showed comparable antibacterial activity. Both wild type TvD1 and Alpha-TvD1 displayed inhibitory activity against the α-amylase of the mealworm beetle, Tenebrio molitor (TMA) with the latter showing enhanced activity. The human salivary as well as barley α-amylase activities were not inhibited even at concentrations of up to 50 μM, which has been predicted to be due to differences in the pocket size and the size of the interacting loops. Present study shows that the variant Alpha-TvD1 exhibits enhanced antifungal as well as insect α-amylase inhibitory activity.

  7. Effect of chronic training on heart rate variability, salivary IgA and salivary alpha-amylase in elite swimmers with a disability.

    PubMed

    Edmonds, Rohan; Burkett, Brendan; Leicht, Anthony; McKean, Mark

    2015-01-01

    The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic

  8. Novel prediction method of beer foam stability using protein Z, barley dimeric alpha-amylase inhibitor-1 (BDAI-1) and yeast thioredoxin.

    PubMed

    Iimure, Takashi; Takoi, Kiyoshi; Kaneko, Takafumi; Kihara, Makoto; Hayashi, Katsuhiro; Ito, Kazutoshi; Sato, Kazuhiro; Takeda, Kazuyoshi

    2008-09-24

    Foam stability is an important quality trait of beer. Our previous results of two-dimensional gel electrophoresis (2DE) analyses of beer proteins implied a relationship between barley dimeric alpha-amylase inhibitor-1 (BDAI-1) and beer foam stability as judged by the NIBEM-T analyzer. To develop a novel prediction method of beer foam stability under different conditions of barley cultivar and malt modification, multiple linear regression analysis was applied. The spot intensities of major beer proteins on 2DE gel were quantified and used as explanatory variables. The foam stabilities of 25 beer samples each brewed from malt with different malt modification in one of the three cultivars (cultivars A, B, and C) were explained by the spot intensities of BDAI-1 at the 5% significance level ( r = 0.421). Furthermore, two other major protein spots (b0 and b5) were observed on the 2DE gels of Japanese commercial beer samples with different foam stability. Then, multiple regression for foam stability was calculated using these three spot intensities as explanatory variables. As a result, 72.1% of the beer foam stability in 25 beer samples was explained by a novel multiple regression equation calculated using spot b0 and BDAI-1 as positive explanatory variables and spot b5 as a negative variable. To verify the validity of the multiple regression equation and the explanatory variables, the beer foam stability in practical beer samples was analyzed. As a result, 81.5% of the beer foam stability in 10 Japanese commercial beer samples was also explained by using spot b0 and BDAI-1 as positive explanatory variables and spot b5 as a negative variable. Mass spectrometry analyses followed by database searches revealed that protein spots b0 and b5 were identified as protein Z originated from barley and thioredoxin originated from yeast, respectively. These results confirm that BDAI-1 and protein Z are foam-positive factors and identify yeast thioredoxin as a possible novel foam

  9. Temperature impacts the multiple attack action of amylases.

    PubMed

    Bijttebier, Annabel; Goesaert, Hans; Delcour, Jan A

    2007-03-01

    The action pattern of several amylases was studied at 35, 50, and 70 degrees C using potato amylose, a soluble (Red Starch) and insoluble (cross-linked amylose) chromophoric substrate. With potato amylose as substrate, Bacillus stearothermophilus alpha-amylase (BStA) and porcine pancreatic alpha-amylase displayed a high degree of multiple attack (DMA, i.e., the number of bonds broken during the lifetime of an enzyme-substrate complex minus one), the fungal alpha-amylase from Aspergillus oryzae a low DMA, and the alpha-amylases from B. licheniformis, Thermoactinomyces vulgaris, B. amyloliquifaciens, and B. subtilis an intermediate DMA. These data are discussed in relation to structural properties of the enzymes. The level of multiple attack (LMA), based on the relation between the drop in iodine binding of amylose and the increase in total reducing value, proved to be a good alternative for DMA measurements. The LMA of the endo-amylases increased with temperature to a degree depending on the amylase. In contrast, BStA showed a decreased LMA when temperature was raised. Furthermore, different enzymes had different activities on Red Starch and cross-linked amylose. Hence, next to the temperature, the action pattern of alpha-amylases is influenced by structural parameters of the starch substrate.

  10. Short-term exposure to 17alpha-ethynylestradiol decreases the fertility of sexually maturing male rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Schultz, Irv R.; Skillman, Ann D.; Nicolas, Jean-Marc; Cyr, Daniel G.; Nagler, James J.

    2003-06-01

    The synthetic estrogen 17alpha-ethynylestradiol (EE2) is a commonly used oral contraceptive that has been increasingly detected in sewage effluents. This study determined whether EE2 exposure adversely affected reproduction in sexually maturing male rainbow trout (Oncorhynchus mykiss). We exposed male trout to graded water concentrations of EE2 (10, 100, and 1,000 ng/ L) for 62 d leading up to the time of spawning. Semen and blood plasma samples were removed from each fish. Semen was used to fertilize groups of eggs from one nonexposed female. As a measure of fertility, eggs were incubated for 28 d after fertilization to determine the proportion that attained the eyed stage of embryonic development. Additional endpoints also measured included sperm motility, spermatocrit, gonadosomatic and hepatosomatic indices, testis histology, and circulating plasma levels of the sex steroids 17alpha, 20beta-dihydroxyprogesterone (17,20-DHP) and 11-ketotestosterone (11-KT). Exposure to 1,000 ng/L of EE2 caused complete mortality of the treatment group by day 57. Exposure to lower EE2 water concentrations (10 and 100 ng/L) caused an increase in sperm density, while a significant reduction in testis mass was observed only in the 100-ng/L exposure group. Most significantly, semen harvested from fish exposed to 10 and 100 ng/L EE2 caused an approximately 50% reduction in the number of eggs attaining the eyed stage of embryonic development. Plasma levels of 17,20-DHP in exposed fish were roughly twice the level of the controls, while levels of 11-KT were significantly reduced in fish exposed to 100 ng/L EE2. These results suggest that sexually maturing male rainbow trout are susceptible to detrimental reproductive effects of short-term exposures to environmentally relevant levels of EE2.

  11. Intramuscular injections of male pheromone 5 alpha-androstenol change the secretory ovarian function in gilts during sexual maturation.

    PubMed

    Stefańczyk-Krzymowska, Stanisława; Krzymowski, Tadeusz; Wasowska, Barbara; Jana, Barbara; Słomiński, Jarosław

    2003-11-01

    In addition to the standard olfactory pathway typical for signaling pheromones, the existence of a humoral pathway for the priming action of pheromones has been earlier postulated. In this study in vivo experiment was performed to establish whether intramuscular injections of boar pheromone, 5 alpha-androstenol (5 alpha-androst-16-en-3-ol), might change the development and secretory function of the ovarian follicles during sexual maturation of gilts. Gilts from groups I (n=15) and II (n=13) received androstenol (10 microg/gilt/injection; i.m.) three times a week from day 192 to 234 of age. Similar, control gilts (group C; n=13) received saline. Additionally, the nasal cavity of animals from group II was irrigated with zinc sulfate solution to depress olfactory function. The reproductive organs and follicular fluid were collected on day 240 of age. There were no significant differences among groups concerning the weight of the ovary and uterus, the length of the uterine horns and intensity of cytochrome P450(scc) and P450(arom) immunoexpression. However, gilts treated with boar pheromone had a higher (p<0.01) total number of follicles > 3 mm in diameter and a lower index of atresia. In addition, androstenol-treated animals were characterized by higher concentrations of progesterone (the 1-3 mm and 3-6 mm follicles; p<0.01 and 0.001, respectively) and estradiol (follicles 3-6 mm; p<0.001) than those of controls. The results of the present study demonstrate that intramuscular injections of androstenol stimulate the development and secretory function of the ovarian follicles in gilts during sexual maturation. They also support the hypothesis that androstenol, as a priming boar pheromone, may influence reproductive processes in female pigs acting as a chemical signal via humoral pathway.

  12. Synergistic effect of Aspergillus tubingensis CTM 507 glucose oxidase in presence of ascorbic acid and alpha amylase on dough properties, baking quality and shelf life of bread.

    PubMed

    Kriaa, Mouna; Ouhibi, Rabeb; Graba, Héla; Besbes, Souhail; Jardak, Mohamed; Kammoun, Radhouane

    2016-02-01

    The impact of Aspergillus tubingensis glucose oxidase (GOD) in combination with α-amylase and ascorbic acid on dough properties, qualities and shelf life of bread was investigated. Regression models of alveograph and texture parameters of dough and bread were adjusted. Indeed, the mixture of GOD (44 %) and ascorbic acid (56 %) on flour containing basal improver showed its potential as a corrective action to get better functional and rheological properties of dough and bread texture. Furthermore, wheat flour containing basal additives and enriched with GOD (63.8 %), ascorbic acid (32 %) and α- amylase (4.2 %) led to high technological bread making parameters, to decrease the crumb firmness and chewiness and to improve elasticity, adhesion, cohesion and specific volume of bread. In addition to that, the optimized formulation addition significantly reduced water activity and therefore decreased bread susceptibility to microbial spoilage. These findings demonstrated that GOD could partially substitute not only ascorbic acid but also α-amylase. The generated models allowed to predict the behavior of wheat flour containing additives in the range of values tested and to define the additives formula that led to desired rheological and baking qualities of dough. This fact provides new perspectives to compensate flour quality deficiencies at the moment of selecting raw materials and technological parameters reducing the production costs and facilitating gluten free products development. Graphical abstractᅟ.

  13. A single amino-acid substitution toggles chloride dependence of the alpha-amylase paralog amyrel in Drosophila melanogaster and Drosophila virilis species.

    PubMed

    Claisse, Gaëlle; Feller, Georges; Bonneau, Magalie; Da Lage, Jean-Luc

    2016-08-01

    In animals, most α-amylases are chloride-dependent enzymes. A chloride ion is required for allosteric activation and is coordinated by one asparagine and two arginine side chains. Whereas the asparagine and one arginine are strictly conserved, the main chloride binding arginine is replaced by a glutamine in some rare instances, resulting in the loss of chloride binding and activation. Amyrel is a distant paralogue of α-amylase in Diptera, which was not characterized biochemically to date. Amyrel shows both substitutions depending on the species. In Drosophila melanogaster, an arginine is present in the sequence but in Drosophila virilis, a glutamine occurs at this position. We have investigated basic enzymological parameters and the dependence to chloride of Amyrel of both species, produced in yeast, and in mutants substituting arginine to glutamine or glutamine to arginine. We found that the amylolytic activity of Amyrel is about thirty times weaker than the classical Drosophila α-amylase, and that the substitution of the arginine by a glutamine in D. melanogaster suppressed the chloride-dependence but was detrimental to activity. In contrast, changing the glutamine into an arginine rendered D. virilis Amyrel chloride-dependent, and interestingly, significantly increased its catalytic efficiency. These results show that the chloride ion is not mandatory for Amyrel but stimulates the reaction rate. The possible phylogenetic origin of the arginine/glutamine substitution is also discussed.

  14. Casein kinase 1 alpha regulates chromosome congression and separation during mouse oocyte meiotic maturation and early embryo development.

    PubMed

    Wang, Lu; Lu, Angeleem; Zhou, Hong-Xia; Sun, Ran; Zhao, Jie; Zhou, Cheng-Jie; Shen, Jiang-Peng; Wu, Sha-Na; Liang, Cheng-Guang

    2013-01-01

    Casein kinase I alpha (CK1α) is a member of serine/threonine protein kinase, generally present in all eukaryotes. In mammals, CK1α regulates the transition from interphase to metaphase in mitosis. However, little is known about its role in meiosis. Here we examined Ck1α mRNA and protein expression, as well as its subcellular localization in mouse oocytes from germinal vesicle to the late 1-cell stage. Our results showed that the expression level of CK1α was increased in metaphase. Immunostaining results showed that CK1α colocalized with condensed chromosomes during oocyte meiotic maturation and early embryo development. We used the loss-of-function approach by employing CK1α specific morpholino injection to block the function of CK1α. This functional blocking leads to failure of polar body 1 (PB1) extrusion, chromosome misalignment and MII plate incrassation. We further found that D4476, a specific and efficient CK1 inhibitor, decreased the rate of PB1 extrusion. Moreover, D4476 resulted in giant polar body extrusion, oocyte pro-MI arrest, chromosome congression failure and impairment of embryo developmental potential. In addition, we employed pyrvinium pamoate (PP), an allosteric activator of CK1α, to enhance CK1α activity in oocytes. Supplementation of PP induced oocyte meiotic maturation failure, severe congression abnormalities and misalignment of chromosomes. Taken together, our study for the first time demonstrates that CK1α is required for chromosome alignment and segregation during oocyte meiotic maturation and early embryo development.

  15. Effect of the lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) on the alpha-amylase secretion of rat pancreas in vitro and in vivo.

    PubMed

    Mikkat, U; Damm, I; Schröder, G; Schmidt, K; Wirth, C; Weber, H; Jonas, L

    1998-05-01

    Lectins are able to bind to cholecystokinin (CCK) receptors and other glycosylated membrane proteins. The lectins wheat germ agglutinin (WGA) and Ulex europaeus agglutinin (UEA-I) are used for affinity chromatography to isolate the highly glycosylated CCK-A receptor of pancreatic acinar cells. According to the working hypothesis that lectin binding to the CCK receptor should alter the ligand-receptor interaction, the effect of WGA and UEA-I on CCK-8-induced enzyme secretion was studied on isolated rat pancreatic acini in vitro. In vitro both lectins showed a dosage-dependent inhibition of CCK-8-induced alpha-amylase secretion of acini over 60 min. WGA showed a strong inhibitory effect on amylase secretion, approximately 40%, in vitro. UEA-I caused a smaller, but significant decrease, approximately 20%, in enzyme secretion of isolated acini. Additionally, both lectins inhibited cerulein/secretin- or cerulein-induced pancreatic secretion of rats in vivo, but not after secretin alone. The results are discussed with respect to a possible influence of both lectins on the interaction of CCK or cerulein with the CCK-A receptor.

  16. P-selectin mRNA is expressed at a later phase of megakaryocyte maturation than mRNAs for von Willebrand factor and glycoprotein Ib-alpha.

    PubMed

    Schick, P K; Konkle, B A; He, X; Thornton, R D

    1993-05-01

    The assembly of alpha-granules occurs exclusively in megakaryocytes because platelets have limited capacity for the synthesis of macromolecules. Thus far, alpha-granule development in megakaryocytes has been primarily evaluated by ultrastructural studies. The aim of the study was to obtain molecular and biochemical evidence for the expression of selected alpha-granule proteins in megakaryocytes. Guinea pig megakaryocytes were purified and separated into subgroups at different phases of maturation by the Celsep procedure (Schick et al. Blood 1989;73:1801-8). Guinea pig-specific probes for P-selectin, von Willebrand factor (vWF), glycoprotein Ib-alpha (GpIb-alpha), and phosphoglycerate kinase were prepared by using the polymerase chain reaction. By Northern blot analysis, P-selectin messenger ribonucleic acid (mRNA) was primarily expressed in the mature megakaryocyte Celsep subgroup, whereas vWF and GpIb-alpha mRNA were expressed at all phases of megakaryocyte maturation. In situ hybridization confirmed that P-selectin mRNA was primarily expressed at later stages of cytoplasmic maturation: 14% +/- 6.2% of stage I, 35.5% +/- 6.1% of stage II, 72% +/- 5.2% of stage III, and 47.0% +/- 3.3% of stage IV megakaryocytes expressed P-selectin mRNA. Thus, the expression of mRNA for P-selectin appeared to peak in stage III cells. In contrast vWF mRNA was expressed in immature megakaryocytes and persisted throughout megakaryocyte maturation. In situ hybridization did not demonstrate a relationship between the expression of mRNA for P-selectin or vWF with megakaryocyte ploidy.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Lactase persistence and augmented salivary alpha-amylase gene copy numbers might have been selected by the combined toxic effects of gluten and (food born) pathogens.

    PubMed

    Pruimboom, Leo; Fox, Tom; Muskiet, Frits A J

    2014-03-01

    Various positively selected adaptations to new nutrients have been identified. Lactase persistence is among the best known, conferring the ability for drinking milk at post weaning age. An augmented number of amylase gene (AMY1) copies, giving rise to higher salivary amylase activity, has been implicated in the consumption of starch-rich foods. Higher AMY1 copy numbers have been demonstrated in populations with recent histories of starchy-rich diets. It is however questionable whether the resulting polymorphisms have exerted positive selection only by providing easily available sources of macro and micronutrients. Humans have explored new environments more than any other animal. Novel environments challenge the host, but especially its immune system with new climatic conditions, food and especially pathogens. With the advent of the agricultural revolution and the concurrent domestication of cattle came new pathogens. We contend that specific new food ingredients (e.g., gluten) and novel pathogens drove selection for lactase persistence and higher AMY gene copy numbers. Both adaptations provide ample glucose for activating the sodium glucose-dependent co-transporter 1 (SGLT1), which is the principal glucose, sodium and water transporter in the gastro-intestinal tract. Their rapid uptake confers protection against potentially lethal dehydration, hyponatremia and ultimately multiple organ failure. Oral rehydration therapy aims at SGLT1 activity and is the current treatment of choice for chronic diarrhoea and vomiting. We hypothesize that lifelong lactase activity and rapid starch digestion should be looked at as the evolutionary covalent of oral rehydration therapy.

  18. Enzymatic Properties of an Alkaline and Chelator Resistant Proportional to alpha-Amylase from the Alkaliphilic Bacillus sp. Isolate L1711

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    An alkaliphilic amylase producing bacterium, Bacillus sp. strain L1711, was selected among 13 soda lakes isolates. When grown at pH 10.5 and 370 C, strain L1711 produced multiple forms of amylases in the culture broth. One of these, BAA, was purified from the culture supernatant by QAE column chromatography and preparative native gel electrophoresis. The molecular weight of BAA was determined to be 51 kDa by denaturing gel electrophoresis. The pH optima for activity below and above 40 C were 9.5-10.0 and 7.0-7.5 respectively. BAA was stable in the pH range 6-11 and was completely inactivated at 55?C. The thermostability was not increased in the presence of Ca(2+). The enzyme was strongly inhibited by Ca(2+), Zn(2+), Mg(2+), Mn(2+), Ba(2+) and Cu(2+), whereas the presence of Na(+), Co2+ and EDTA (10 mM) enhanced enzymatic activity. The K(sub m) and specific activity of BAA on soluble starch were 1.9 mg/ml and 18.5 U/mg respectively. The main end products of hydrolysis were maltotetraose, maltose and glucose .

  19. Response to water deficit and high temperature of transgenic peas (Pisum sativum L.) containing a seed-specific alpha-amylase inhibitor and the subsequent effects on pea weevil (Bruchus pisorum L.) survival.

    PubMed

    Sousa-Majer, Maria José de; Turner, Neil C; Hardie, Darryl C; Morton, Roger L; Lamont, Byron; Higgins, Thomas J V

    2004-02-01

    The effects of water deficit and high temperature on the production of alpha-amylase inhibitor 1 (alpha-AI-1) were studied in transgenic peas (Pisum sativum L.) that were developed to control the seed-feeding pea weevil (Bruchus pisorum L., Coleoptera: Bruchidae). Transgenic and non-transgenic plants were subjected to water-deficit and high-temperature treatments under controlled conditions in the glasshouse and growth cabinet, beginning 1 week after the first pods were formed. In the water-deficit treatments, the peas were either adequately watered (control) or water was withheld after first pod formation. The high-temperature experiments were performed in two growth cabinets, one maintained at 27/22 degrees C (control) and one at 32/27 degrees C day/night temperatures, with the vapour pressure deficit maintained at 1.3 kPa. The plants exposure to high temperatures and water deficit produced 27% and 79% fewer seeds, respectively, than the controls. In the transgenic peas the level of alpha-AI-1 as a percentage of total protein was not influenced by water stress, but was reduced on average by 36.3% (the range in two experiments was 11-50%) in the high-temperature treatment. Transgenic and non-transgenic pods of plants grown at 27/22 degrees C and 32/27 degrees C were inoculated with pea weevil eggs to evaluate whether the reduction in level of alpha-AI-1 in the transgenic pea seeds affected pea weevil development and survival. At the higher temperatures, 39% of adult pea weevil emerged, compared to 1.2% in the transgenic peas grown at the lower temperatures, indicating that high temperature reduced the protective capacity of the transgenic peas.

  20. The effect of VEGF on the temporal-spatial change of alpha-tubulin and cortical granules of ovine oocytes matured in vitro.

    PubMed

    Cao, Xin; Zhou, Ping; Luo, Hailing; Zhao, Youzhang; Shi, Guoqing

    2009-07-01

    The effects of vascular endothelial growth factor (VEGF) on the temporal-spatial change of alpha-tubulin and cortical granules (CGs) in ovine oocytes matured in vitro were studied using human recombinant VEGF(165) at 5 ng/ml in maturation media. Immunofluorescence, confocal microscopy and orcein staining were used to evaluate cell cycle-dependent modifications in nuclear configuration, quality of the metaphase II oocytes, microtubule organizing centers (MTOCs) translocation, temporal and spatial redistribution of alpha-tubulin and CGs in ovine oocytes undergoing in vitro maturation. The percentage of oocytes that reached metaphase II (M-II) in the VEGF-treated and the control groups were 87.08% and 80.03% (P=0.077) at 18 h and 87.42% and 83.89% (P=0.28) at 24h, respectively. The percentages of oocytes displaying a normal distribution of alpha-tubulin and chromosomes in M-II increased significantly (P=0.015) in the VEGF group (77.50%) compared to the control (62.60%). The percentage of oocytes with CGs transfering completely in cortex was significantly higher (P=0.002) in the VEGF group (79.24%) than in the control group (60.97%). VEGF promoted the MTOCs domains to disappear from the cortex and stimulated assembly of alpha-tubulin around chromosome domains when germinal vesicle breakdown (GVBD) was commencing. In conclusion, VEGF may improve the quality of nuclear and cytoplasmic maturation of ovine oocytes in vitro by its effect on temporal and spatial translocation or redistribution of alpha-tubulin and CGs and on the normal distribution of nuclear configuration.

  1. Characterization and comparative analysis of psychrophilic and mesophilic alpha-amylases from Euplotes species: a contribution to the understanding of enzyme thermal adaptation.

    PubMed

    Yang, Guang; Yang, Guang; Aprile, Lino; Turturo, Vincenzo; Pucciarelli, Sandra; Pucciarelli, Stefania; Miceli, Cristina

    2013-09-06

    The eukaryotic α-amylase isolated from the psychrophilic ciliated protozoon Euplotes focardii (EfAmy) was expressed in Escherichia coli and biochemically characterized. Its enzymatic activity was compared to that of the homologous protein from the mesophilic congeneric species Euplotes crassus (EcAmy). The comparison of the amino acid composition and the surface residue composition of the two enzymes indicated a preference for tiny residues and the avoidance of charged, aromatic and hydrophobic residues in EfAmy. Our comparative homology modeling study reveals a lack of surface salt bridges, a decreased number of the surface charged residues, decreased hydrogen bonds and bound ions, and a reduction of aromatic-sulfur interactions, cationic-π interactions and disulfide interactions in EfAmy. In contrast, sequence alignment and homology modeling showed five unconserved prolines located on the surface loops of EcAmy. By analyzing amylolytic activity towards soluble starch as the substrate, we determined the temperature and pH dependence, thermostability and kinetic parameters of these two enzymes. We demonstrated that EfAmy shows the characteristics of a psychrophilic α-amylase, such as the highest hydrolytic activity at low temperatures and high thermolability. In contrast, the EcAmy showed mesophilic characteristics with the highest activity at moderate temperatures and a more than 2-fold increased half-life at 50°C compared to EfAmy. The kcat and KM values of EfAmy were higher than those of the mesophilic EcAmy at all tested temperatures. Furthermore, both EfAmy and EcAmy showed maximum activities at pH 9 and maintained high activities in the presence of surfactants. These results suggest the potential applications of EfAmy and EcAmy as ingredients in detergents for industrial applications.

  2. Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

    SciTech Connect

    Kooptiwut, Suwattanee; Sujjitjoon, Jatuporn; Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron; Semprasert, Namoiy; Furuta, Hiroto; Nanjo, Kishio; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

    2009-05-22

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

  3. Elevated Salivary Alpha-Amylase Level, Association Between Depression and Disease Activity, and Stress as a Predictor of Disease Flare in Systemic Lupus Erythematosus

    PubMed Central

    Jung, Ju-Yang; Nam, Jin-Young; Kim, Hyoun-Ah; Suh, Chang-Hee

    2015-01-01

    Abstract Psychological stress has been shown to trigger systemic lupus erythematosus (SLE). However, objective evidence of symptom aggravation due to mental stress is difficult to identify. We aimed to investigate the relationship between SLE disease activity and mental stress, and the usefulness of saliva as an assessment index for stress in patients with SLE. We prospectively assessed the salivary stress hormone and disease-related biomarkers, and questionnaire data regarding stress and depression in 100 patients with SLE and 49 sex- and age-matched normal controls (NCs). Patients with SLE had higher mean salivary α-amylase levels (5.7 ± 4.6 U/mL vs 2.7 ± 2.5 U/mL, P < 0.001), anti-chromatin antibody levels (25.3 ± 22.9 U/mL vs 15.9 ± 10.9 U/mL, P < 0.001), and Beck Depression Index (BDI) scores (11.1 ± 9.2 vs 5.3 ± 5.1, P < 0.001) than NCs. However, salivary cortisol levels and Perceived Stress Scale (PSS) scores did not differ between the groups. The BDI scores correlated with the SLE disease activity index (SLEDAI) scores (r = 0.253, P = 0.011) and erythrocyte sedimentation rates (r = 0.234, P = 0.019). SLE patients with the highest-quartile PSS scores had significantly increased SLEDAI scores compared to those with the lowest-quartile PSS scores after 4 to 5 months’ follow-up. Moreover, SLE patients with elevated SLEDAI scores had higher baseline PSS scores. Patients with SLE showed uncoupling of the sympathetic nervous system and hypothalamic–pituitary–adrenal axis; higher salivary α-amylase and no different cortisol levels compared with NCs. Also, patients with SLE were more depressed, which correlated with disease activity. Furthermore, perceived stress was not correlated with disease activity; however, disease activity worsened several months later with elevated perceived stress levels. PMID:26222848

  4. Alteration of consciousness via diverse photo-acoustic stimulatory patterns. Phenomenology and effect on salivary flow rate, alpha-amylase and total protein levels.

    PubMed

    Beck, Anita; Fábián, Gábor; Fejérdy, Pál; Krause, Wolf-Rainer; Hermann, Péter; Módos, Károly; Varga, Gábor; Fábián, Tibor Károly

    2015-12-01

    Long-term photo-acoustic stimulation is used for the induction of altered states of consciousness for both therapeutic and experimental purposes. Long-term photo-acoustic stimulation also leads to changes in the composition of saliva which have a key contribution to the efficiency of this technique in easing mucosal symptoms of oral psychosomatic patients. The aim of this study is to find out whether there is any cumulative effect of repeated stimulation and whether there are any detectable differences between diverse stimulatory patterns of long lasting photo-acoustic stimulation on the phenomenology of the appearing trance state and on salivary secretion. There was significant cumulative effect in relation with the appearance of day dreaming as phenomenological parameter, and in relation with protein output and amylase/protein ratio as salivary parameter. Pattern specific effect was detectable in relation with salivary flow rate only. Although our results clearly indicate the existence of certain cumulative and stimulation-pattern specific effects of repeated photo-acoustic stimulation, the absolute values of all these effects were relatively small in this study. Therefore, in spite of their theoretical importance there are no direct clinical consequences of these findings. However, our data do not exclude at all the possibility that repeated stimulation with other stimulatory parameters may lead to more pronounced effects. Further studies are needed to make clear conclusion in this respect.

  5. Determining the relationship of acute stress, anxiety, and salivary alpha-amylase level with performance of student nurse anesthetists during human-based anesthesia simulator training.

    PubMed

    McKay, Kelly A Chiffer; Buen, John E; Bohan, Kevin J; Maye, John P

    2010-08-01

    Managing stress for student nurse anesthetists represents a multifaceted educational concern for anesthesia educators. Our purpose was to determine the relationship between physiologic measures of stress and performance of student nurse anesthetists during anesthesia simulator training. Following institutional review board approval, 78 students were enrolled from a nurse anesthesia program. A prospective descriptive design was used to compare baseline, acute, and recovery measurements of stress with performance scores of students during an induction and intubation sequence in a patient simulator. Performance scores were stratified into low-, moderate-, and high-performing groups based on scores received from trained observers. A statistically significant difference in physiologic measures of stress was detected between baseline and acute levels of salivary a-amylase (P = .017), heart rate (P = .003), and anxiety levels (P = .001). No significant differences were found when measures of stress were compared with performance of low, moderate, or high performers. This investigation revealed remarkable findings regarding the relationship between stress and student performance. Analysis of the descriptive statistics and means of each group suggests that low performers have increased stress and perform poorly, whereas high performers have increased stress and perform superbly, and moderate performers have modest stress and perform moderately.

  6. Association of Job Strain With Cortisol and Alpha-Amylase Among Shift-Working Health Care Professionals in Laboratory and Field.

    PubMed

    Karhula, Kati; Härmä, Mikko; Sallinen, Mikael; Lindholm, Harri; Hirvonen, Ari; Elovainio, Marko; Kivimäki, Mika; Vahtera, Jussi; Puttonen, Sampsa

    2016-01-01

    Although the prevalence of work-related stress has increased, knowledge on the contributions of that stress to long-term adverse health effects is still lacking. Stress biomarkers can reveal early signs of negative health effects, but no previous studies have measured both acute stress reactions and long-term exposure to job strain using both salivary cortisol and α-amylase (AA). The present study examines the association between job strain and these biomarkers among shift-working female health care professionals in the laboratory and the field. The 95 participants were recruited from hospital wards categorized in either the top (high job strain [HJS] group, n = 42) or the bottom quartile of job strain (low job strain [LJS] group, n = 53), as rated by survey responses. Participants' self-perceived job strain was at least as high or low as the ward's average estimation. Saliva samples were collected during the Trier Social Stress Test (TSST), preselected morning and night shifts, and a day off. There was a larger increase in the cortisol concentration of participants in the HJS than in the LJS group (2.27- vs. 1.48-fold, respectively, nonsignificant) during the TSST. Participants in the HJS group also had higher salivary AA levels 30 min after awakening on the morning-shift day than those in the LJS group (p = .02), whereas the salivary cortisol awakening response on the day off was higher in the LJS group (p = .05, education as a covariate). The remaining stress-biomarker results did not differ significantly between groups. These data suggest that HJS in shift-working health care professionals is weakly associated with changes in stress biomarkers.

  7. The influence of barley malt protein modification on beer foam stability and their relationship to the barley dimeric alpha-amylase inhibitor-I (BDAI-I) as a possible foam-promoting protein.

    PubMed

    Okada, Yoshihiro; Iimure, Takashi; Takoi, Kiyoshi; Kaneko, Takafumi; Kihara, Makoto; Hayashi, Katsuhiro; Ito, Kazutoshi; Sato, Kazuhiro; Takeda, Kazuyoshi

    2008-02-27

    The foam stability of beer is one of the important key factors in evaluating the quality of beer. The purpose of this study was to investigate the relationship between the level of malt modification (degradation of protein, starch, and so on) and the beer foam stability. This was achieved by examining foam-promoting proteins using two-dimensional gel electrophoresis (2DE). We found that the foam stability of beer samples brewed from the barley malts of cultivars B and C decreased as the level of malt modification increased; however, the foam stability of cultivar A did not change. To identify the property providing the increased foam stability of cultivar A, we analyzed beer proteins using 2DE. We analyzed three fractions that could contain beer foam-promoting proteins, namely, beer whole proteins, salt-precipitated proteins, and the proteins concentrated from beer foam. As a result, we found that in cultivar A, some protein spots did not change in any of these three protein fractions even when the level of malt modification increased, although the corresponding protein spots in cultivars B and C decreased. We analyzed these protein spots by peptide mass finger printing using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. As a result, all of these spots were identified as barley dimeric alpha-amylase inhibitor-I (BDAI-I). These results suggest that BDAI-I is an important contributor to beer foam stability.

  8. Efficient production of optically pure D-lactic acid from raw corn starch by using a genetically modified L-lactate dehydrogenase gene-deficient and alpha-amylase-secreting Lactobacillus plantarum strain.

    PubMed

    Okano, Kenji; Zhang, Qiao; Shinkawa, Satoru; Yoshida, Shogo; Tanaka, Tsutomu; Fukuda, Hideki; Kondo, Akihiko

    2009-01-01

    In order to achieve direct and efficient fermentation of optically pure D-lactic acid from raw corn starch, we constructed L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum and introduced a plasmid encoding Streptococcus bovis 148 alpha-amylase (AmyA). The resulting strain produced only D-lactic acid from glucose and successfully expressed amyA. With the aid of secreting AmyA, direct D-lactic acid fermentation from raw corn starch was accomplished. After 48 h of fermentation, 73.2 g/liter of lactic acid was produced with a high yield (0.85 g per g of consumed sugar) and an optical purity of 99.6%. Moreover, a strain replacing the ldhL1 gene with an amyA-secreting expression cassette was constructed. Using this strain, direct D-lactic acid fermentation from raw corn starch was accomplished in the absence of selective pressure by antibiotics. This is the first report of direct D-lactic acid fermentation from raw starch.

  9. Tomato fruit size, maturity and alpha-tomatine content influence the performance of larvae of potato tuber moth Phthorimaea operculella (Lepidoptera: Gelechiidae).

    PubMed

    Mulatu, B; Applebaum, S W; Kerem, Z; Coll, M

    2006-04-01

    Various physical and chemical properties of host plants influence insect larval performance and subsequent adult fitness. Tomato plants are relatively new hosts to the potato tuber moth, Phthorimaea operculella (Zeller), with the fruit being its preferred feeding site. However, it is unclear how the biochemical and physical properties of tomato fruits relate to potato tuber moth performance. Significant amounts of alpha-tomatine were detected in maturing green and ripening fruits of cherry (cv. Ceres) and processing (cv. Serio) types of tomatoes whereas none was detected in a fresh market variety (cv. Marglobe), at comparable stages. alpha-Tomatine is negatively and significantly correlated with development rate (head capsule size) of larvae reared in the fruits of the cherry and processing type tomatoes. Generally, survival, growth and development were significantly superior for larvae reared in the ripening fruits of the fresh market cultivar. At this stage, the fruits of this cultivar are also the largest. Based on these results it is concluded that fruit alpha-tomatine content, as well as fruit size and maturity, all affect performance of P. operculella larvae in the fruits of cultivated tomatoes.

  10. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  11. Amide proton exchange in the. cap alpha. -amylase polypeptide inhibitor tendamistat studied by two-dimensional /sup 1/H nuclear magnetic resonance

    SciTech Connect

    Wang, O.; Kline, A.D.; Wuethrich, K.

    1987-10-06

    The individual amide proton exchange rates in Tendamistat at pH 3.0 and 50/sup 0/C were measured by using two-dimensional ..cap alpha..H nuclear magnetic resonance. Overall, it was found that the distribution of exchange rates along the sequence is dominated by the interstrand hydrogen bonds of the ..beta..-sheet structures. The slowly exchanging protons in the core of the two ..beta..-sheets were shown to exchange via an EX2 mechanism. Further analysis of the data indicates that different large-scale structure fluctuations are responsible for the exchange from the two ..beta..-sheets, even though the three-dimensional structure of Tendamistat appears to consist of a single structural domain.

  12. Fagopyritol B1, O-alpha-D-galactopyranosyl-(1-->2)-D-chiro-inositol, a galactosyl cyclitol in maturing buckwheat seeds associated with desiccation tolerance.

    PubMed

    Horbowicz, M; Brenac, P; Obendorf, R L

    1998-05-01

    O-alpha-D-Galactopyranosyl-(1-->2)-D-chiro-inositol, herein named fagopyritol B1, was identified as a major soluble carbohydrate (40% of total) in buckwheat (Fagopyrum esculentum Moench, Polygonaceae) embryos. Analysis of hydrolysis products of purified compounds and of the crude extract led to the conclusion that buckwheat embryos have five alpha-galactosyl D-chiro-inositols: fagopyritol A1 and fagopyritol B1 (mono-galactosyl D-chiro-inositol isomers), fagopyritol A2 and fagopyritol B2 (di-galactosyl D-chiro-inositol isomers), and fagopyritol B3 (tri-galactosyl D-chiro-inositol). Other soluble carbohydrates analyzed by high-resolution gas chromatography included sucrose (42% of total), D-chiro-inositol, myo-inositol, galactinol, raffinose and stachyose (1% of total), but no reducing sugars. All fagopyritols were readily hydrolyzed by alpha-galactosidase (EC 3.2.1.22) from green coffee bean, demonstrating alpha-galactosyl linkage. Retention time of fagopyritol B1 was identical to the retention time of O-alpha-D-galactopyranosyl-(1-->2)-D-chiro-inositol from soybean (Glycine max (L.) Merrill, Leguminosae), suggesting that the alpha-galactosyl linkage is to the 2-position of D-chiro-inositol. Accumulation of fagopyritol B1 was associated with acquisition of desiccation tolerance during seed development and maturation in planta, and loss of fagopyritol B1 correlated with loss of desiccation tolerance during germination. Embryos of seeds grown at 18 degrees C, a condition that favors enhanced seed vigor and storability, had a sucrose-to-fagopyritol B1 ratio of 0.8 compared to a ratio of 2.46 for seeds grown at 25 degrees C. We propose that fagopyritol B1 facilitates desiccation tolerance and storability of buckwheat seeds.

  13. Study of the Role of Cytosolic Phospholipase A2 Alpha in Eicosanoid Generation and Thymocyte Maturation in the Thymus

    PubMed Central

    Rousseau, Matthieu; Naika, Gajendra S.; Perron, Jean; Jacques, Frederic; Gelb, Michael H.; Boilard, Eric

    2015-01-01

    The thymus is a primary lymphoid organ, home of maturation and selection of thymocytes for generation of functional T-cells. Multiple factors are involved throughout the different stages of the maturation process to tightly regulate T-cell production. The metabolism of arachidonic acid by cyclooxygenases, lipoxygenases and specific isomerases generates eicosanoids, lipid mediators capable of triggering cellular responses. In this study, we determined the profile of expression of the eicosanoids present in the mouse thymus at different stages of thymocyte development. As the group IVA cytosolic phospholipase A2 (cPLA2α) catalyzes the hydrolysis of phospholipids, thereby generating arachidonic acid, we further verified its contribution by including cPLA2α deficient mice to our investigations. We found that a vast array of eicosanoids is expressed in the thymus, which expression is substantially modulated through thymocyte development. The cPLA2α was dispensable in the generation of most eicosanoids in the thymus and consistently, the ablation of the cPLA2α gene in mouse thymus and the culture of thymuses from human newborns in presence of the cPLA2α inhibitor pyrrophenone did not impact thymocyte maturation. This study provides information on the eicosanoid repertoire present during thymocyte development and suggests that thymocyte maturation can occur independently of cPLA2α. PMID:25969996

  14. Study of the role of cytosolic phospholipase A2 alpha in eicosanoid generation and thymocyte maturation in the thymus.

    PubMed

    Rousseau, Matthieu; Naika, Gajendra S; Perron, Jean; Jacques, Frederic; Gelb, Michael H; Boilard, Eric

    2015-01-01

    The thymus is a primary lymphoid organ, home of maturation and selection of thymocytes for generation of functional T-cells. Multiple factors are involved throughout the different stages of the maturation process to tightly regulate T-cell production. The metabolism of arachidonic acid by cyclooxygenases, lipoxygenases and specific isomerases generates eicosanoids, lipid mediators capable of triggering cellular responses. In this study, we determined the profile of expression of the eicosanoids present in the mouse thymus at different stages of thymocyte development. As the group IVA cytosolic phospholipase A2 (cPLA2α) catalyzes the hydrolysis of phospholipids, thereby generating arachidonic acid, we further verified its contribution by including cPLA2α deficient mice to our investigations. We found that a vast array of eicosanoids is expressed in the thymus, which expression is substantially modulated through thymocyte development. The cPLA2α was dispensable in the generation of most eicosanoids in the thymus and consistently, the ablation of the cPLA2α gene in mouse thymus and the culture of thymuses from human newborns in presence of the cPLA2α inhibitor pyrrophenone did not impact thymocyte maturation. This study provides information on the eicosanoid repertoire present during thymocyte development and suggests that thymocyte maturation can occur independently of cPLA2α.

  15. Activity and cellular localization of amylases of rabbit cecal bacteria.

    PubMed

    Sirotek, K; Marounek, M; Suchorská, O

    2006-01-01

    Five 11-week-old rabbits, fed a commercial granulated feed, were slaughtered and cecal starch-degrading bacteria enumerated; total concentration of cultivable bacteria utilizing starch averaged 5.5 x 10(10) CFU/g. The activity and cellular localization of amylases was determined in 9 bacteria identified as Actinomyces israeli (strains AA2 and AD4), Bacteroides spp. (strain AA3), Dichelobacter nodosus (strain AA4), Mitsuokella multiacidus (strain AA6), Eubacterium spp. (strains AA7 and AB2), Clostridium spp. (strains AD1 and AA5). Four strains (AA3, AA4, AA5, AD4) produced extracellular amylases with an activity of 26-35 micromol of reducing sugars per h per mg of protein; in five strains (AA2, AA6, AA7, AB2, AD1) amylases were membrane-bound with an activity of 14-18 micromol of reducing sugars per h per mg of protein. All strains exhibited a low intracellular amylolytic activity. The pH optimum of amylases was 6.8-7.0. In strains producing extracellular amylases a substantial loss of viscosity was observed during incubations of cultivation supernatant with starch, similar to viscosity reduction in starch solutions treated with alpha-amylase; this indicates an endo-type (random cleavage) of extracellular amylase reaction in the bacteria under study. No strain possessed glucoamylase activity.

  16. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    ERIC Educational Resources Information Center

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  17. Recombinant human follicle-stimulating hormone and transforming growth factor-alpha enhance in vitro maturation of porcine oocytes.

    PubMed

    Mito, Tomomi; Yoshioka, Koji; Noguchi, Michiko; Yamashita, Shoko; Hoshi, Hiroyoshi

    2013-07-01

    The biological functions of recombinant human follicle-stimulating hormone (FSH) and transforming growth factor-α (TGF-α) on in vitro maturation of porcine oocytes were investigated. Cumulus-oocyte complexes were matured in defined porcine oocyte medium containing 0-0.1 IU/ml FSH in the presence or absence of 10 ng/ml TGF-α. The percentage of oocytes reaching metaphase II was significantly higher with the addition of 0.01-0.1 IU/ml FSH compared with no addition, and was further enhanced in the presence of TGF-α. The rates of sperm penetration and blastocyst formation were significantly higher with the addition of 0.05-0.1 IU/ml FSH compared with no addition after in vitro fertilization and embryo culture. There was no beneficial effect of FSH and TGF-α on nuclear maturation of denuded oocytes. The specific EGF receptor inhibitor, AG1478, completely inhibited TGF-α-induced meiotic resumption, but did not completely prevent the stimulatory effect of FSH. Addition of both FSH and TGF-α significantly enhanced cumulus expansion compared with no addition. When cumulus expansion-related genes (HAS2, HAPLN1, and VCAN) mRNA expression in COCs was measured during in vitro maturaiton, addition of both of FSH and TGF-α upregulated the expression of HAS2 mRNA after 20 hr culture and HAPLN1 mRNA after 44 hr culture compared with no addition. Expression of VCAN mRNA was significantly higher in the presence of FSH compared with addition of TGF-α alone. These results suggest that FSH and TGF-α synergistically enhance porcine oocyte maturation via cumulus cells, and act through different signaling pathways.

  18. Preimplantation development and expression of Hsp-70 and Bax genes in bovine blastocysts derived from oocytes matured in alpha-MEM supplemented with growth factors and synthetic macromolecules.

    PubMed

    Vireque, A A; Camargo, L S A; Serapião, R V; Rosa E Silva, A A M; Watanabe, Y F; Ferreira, E M; Navarro, P A A S; Martins, W P; Ferriani, R A

    2009-03-01

    In vitro culture conditions affect both the maternal and embryonic expression of genes and is likely to alter both oocyte and embryo developmental competence. The search for better and less variable culture conditions simulating those in vivo has led to the development of defined culture media, with lower impact on the molecular reprogramming of oocytes and embryos. We evaluated embryo development and relative abundance (RA) of Hsp-70 and Bax transcripts in bovine blastocysts produced from oocytes matured in a chemically defined IVM system with synthetic polymers. Immature cumulus oocyte complexes (COCs) were matured for 22-24h in alpha-MEM supplemented with IGF-1, insulin, 0.1% polyvinyl alcohol (PVA), or 0.1% polyvinylpyrrolidone (PVP), but without FSH or LH. The control group consisted of COCs matured in TCM plus FSH and 10% estrous cow serum. After fertilization, presumptive zygotes were co-cultured with cumulus cells until 224 h post-insemination. Total RNA was isolated from embryo pools, reverse transcribed into cDNA, and subjected to transcript analysis by real-time PCR. Cleavage rate was higher (P<0.05) for the control group (68.3%) than for the PVA (54.4%) and PVP-40 (58.3%) groups. Nevertheless, there was no difference among the PVA, PVP-40 and control groups in blastocyst or hatching rates. Similarly, no difference in relative abundance of Hsp-70 and Bax transcripts was detected in comparison to the control group. We inferred that bovine oocytes can be matured in serum- and gonadotrophin-free medium supplemented with PVA or PVP, enriched with IGF-I and insulin, without altering post-cleavage development and relative abundance of some genes associated with stress and apoptosis.

  19. [Maturation of the cervix uteri using prostaglandin F2 alpha before induction of labor in pathologic pregnancies].

    PubMed

    Maria, B; Fayette, E; Stampf, F; Gandon, C; Gantrel, J; Barrat, J

    1983-01-01

    It is possible to induce labour in pathological pregnancies after artificial ripening of the cervix. The present study concerns 70 patients (45 primipara, 25 multipara). The main pathologies are hypertension of pregnancy and pregnancies past dates. Prostaglandin F2 alpha has been used with a Tylose gel containing 5 mg of PGF2 alpha introduced by the extra-amniotic route. The cervical change was noted using Bishop's score. The mean increase of the cervical score was 0.8 with the first PGF2 alpha gel. The total mean increase was 1.2. Two cases of hyperstimulation of the uterus were observed and they led to Caesarean section. Prostaglandin gel induced labour in 56% of the patients. The mean time between the introduction of the gel and the delivery was 14 h for primipara and 10 h for multipara. Other patients were induced with oxytocin on the following day. Epidural analgesia was widely used in this study (in 64% of cases). The mean duration of labour was 6 h 10 for primipara and 4 h 30 for multipara. 30% of the patients needed Caesarean section but there was a marked difference between primipara (36%) and multipara (4%). After a review of the literature the authors conclude that it is useful to ripen the cervix prostaglandin but, as foreign authors do, they think that PGE2 should be more efficient.

  20. Crystal structure of a maltogenic amylase provides insights into a catalytic versatility.

    PubMed

    Kim, J S; Cha, S S; Kim, H J; Kim, T J; Ha, N C; Oh, S T; Cho, H S; Cho, M J; Kim, M J; Lee, H S; Kim, J W; Choi, K Y; Park, K H; Oh, B H

    1999-09-10

    Amylases catalyze the hydrolysis of starch material and play central roles in carbohydrate metabolism. Compared with many different amylases that are able to hydrolyze only alpha-D-(1,4)-glycosidic bonds, maltogenic amylases exhibit catalytic versatility: hydrolysis of alpha-D-(1,4)- and alpha-D-(1,6)-glycosidic bonds and transglycosylation of oligosaccharides to C3-, C4-, or C6-hydroxyl groups of various acceptor mono- or disaccharides. It has been speculated that the catalytic property of the enzymes is linked to the additional approximately 130 residues at the N terminus that are absent in other typical alpha-amylases. The crystal structure of a maltogenic amylase from a Thermus strain was determined at 2.8 A. The structure, an analytical centrifugation, and a size exclusion column chromatography proved that the enzyme is a dimer in solution. The N-terminal segment of the enzyme folds into a distinct domain and comprises the enzyme active site together with the central (alpha/beta)(8) barrel of the adjacent subunit. The active site is a narrow and deep cleft suitable for binding cyclodextrins, which are the preferred substrates to other starch materials. At the bottom of the active site cleft, an extra space, absent in the other typical alpha-amylases, is present whose size is comparable with that of a disaccharide. The space is most likely to host an acceptor molecule for the transglycosylation and to allow binding of a branched oligosaccharide for hydrolysis of alpha-D-(1,4)-glycosidic or alpha-D-(1,6)-glycosidic bond. The (alpha/beta)(8) barrel of the enzyme is the preserved scaffold in all the known amylases. The structure represents a novel example of how an enzyme acquires a different substrate profile and a catalytic versatility from a common active site and represents a framework for explaining the catalytic activities of transglycosylation and hydrolysis of alpha-D-(1,6)-glycosidic bond.

  1. Evidence that maturation of the N-linked glycans of the respiratory syncytial virus (RSV) glycoproteins is required for virus-mediated cell fusion: The effect of {alpha}-mannosidase inhibitors on RSV infectivity

    SciTech Connect

    McDonald, Terence P.; Jeffree, Chris E.; Li, Ping; Rixon, Helen W. McL.; Brown, Gaie; Aitken, James D.; MacLellan, Kirsty; Sugrue, Richard J. . E-mail: rjsugrue@ntu.edu.sg

    2006-07-05

    Glycan heterogeneity of the respiratory syncytial virus (RSV) fusion (F) protein was demonstrated by proteomics. The effect of maturation of the virus glycoproteins-associated glycans on virus infectivity was therefore examined using the {alpha}-mannosidase inhibitors deoxymannojirimycin (DMJ) and swainsonine (SW). In the presence of SW the N-linked glycans on the F protein appeared in a partially mature form, whereas in the presence of DMJ no maturation of the glycans was observed. Neither inhibitor had a significant effect on G protein processing or on the formation of progeny virus. Although the level of infectious virus and syncytia formation was not significantly affected by SW-treatment, DMJ-treatment correlated with a one hundred-fold reduction in virus infectivity. Our data suggest that glycan maturation of the RSV glycoproteins, in particular those on the F protein, is an important step in virus maturation and is required for virus infectivity.

  2. I kappa B kinase alpha (IKKα) activity is required for functional maturation of dendritic cells and acquired immunity to infection.

    PubMed

    Mancino, Alessandra; Habbeddine, Mohamed; Johnson, Ella; Luron, Lionel; Bebien, Magali; Memet, Sylvie; Fong, Carol; Bajenoff, Marc; Wu, Xuefeng; Karin, Michael; Caamano, Jorge; Chi, Hongbo; Seed, Michael; Lawrence, Toby

    2013-03-20

    Dendritic cells (DC) are required for priming antigen-specific T cells and acquired immunity to many important human pathogens, including Mycobacteriuim tuberculosis (TB) and influenza. However, inappropriate priming of auto-reactive T cells is linked with autoimmune disease. Understanding the molecular mechanisms that regulate the priming and activation of naïve T cells is critical for development of new improved vaccines and understanding the pathogenesis of autoimmune diseases. The serine/threonine kinase IKKα (CHUK) has previously been shown to have anti-inflammatory activity and inhibit innate immunity. Here, we show that IKKα is required in DC for priming antigen-specific T cells and acquired immunity to the human pathogen Listeria monocytogenes. We describe a new role for IKKα in regulation of IRF3 activity and the functional maturation of DC. This presents a unique role for IKKα in dampening inflammation while simultaneously promoting adaptive immunity that could have important implications for the development of new vaccine adjuvants and treatment of autoimmune diseases.

  3. Purification and Characterization of Pea Epicotyl beta-Amylase.

    PubMed

    Lizotte, P A; Henson, C A; Duke, S H

    1990-03-01

    The most abundant beta-amylase (EC 3.2.1.2) in pea (Pisum sativum L.) was purified greater than 880-fold from epicotyls of etiolated germinating seedlings by anion exchange and gel filtration chromatography, glycogen precipitation, and preparative electrophoresis. The electrophoretic mobility and relative abundance of this beta-amylase are the same as that of an exoamylase previously reported to be primarily vacuolar. The enzyme was determined to be a beta-amylase by end product analysis and by its inability to hydrolyze beta-limit dextrin and to release dye from starch azure. Pea beta-amylase is an approximate 55 to 57 kilodalton monomer with a pl of 4.35, a pH optimum of 6.0 (soluble starch substrate), an Arrhenius energy of activation of 6.28 kilocalories per mole, and a K(m) of 1.67 milligrams per milliliter (soluble starch). The enzyme is strongly inhibited by heavy metals, p-chloromer-curiphenylsulfonic acid and N-ethylmaleimide, but much less strongly by iodoacetamide and iodoacetic acid, indicating cysteinyl sulfhydryls are not directly involved in catalysis. Pea beta-amylase is competitively inhibited by its end product, maltose, with a K(i) of 11.5 millimolar. The enzyme is partially inhibited by Schardinger maltodextrins, with alpha-cyclohexaamylose being a stronger inhibitor than beta-cycloheptaamylose. Moderately branched glucans (e.g. amylopectin) were better substrates for pea beta-amylase than less branched or non-branched (amyloses) or highly branched (glycogens) glucans. The enzyme failed to hydrolyze native starch grains from pea and glucans smaller than maltotetraose. The mechanism of pea beta-amylase is the multichain type. Possible roles of pea beta-amylase in cellular glucan metabolism are discussed.

  4. Detergent-compatible bacterial amylases.

    PubMed

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  5. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  6. Phage display selects for amylases with improved low pH starch-binding.

    PubMed

    Verhaert, Raymond M D; Beekwilder, Jules; Olsthoorn, René; van Duin, Jan; Quax, Wim J

    2002-06-13

    Directed evolution of secreted industrial enzymes is hampered by the lack of powerful selection techniques. We have explored surface display to select for enzyme variants with improved binding performance on complex polymeric substrates. By a combination of saturation mutagenesis and phage display we selected alpha-amylase variants, which have the ability to bind starch substrate at industrially preferred low pH conditions. First we displayed active alpha-amylase on the surface of phage fd. Secondly we developed a selection system that is based on the ability of alpha-amylase displaying phages to bind to cross-linked starch. This system was used to probe the involvement of specific beta-strands in substrate interaction. Finally, a saturated library of alpha-amylase mutants with one or more amino acid residues changed in their Cbeta4 starch-binding domain was subjected to phage display selection. Mutant molecules with good starch-binding and hydrolytic capacity could be isolated from the phage library by repeated binding and elution of phage particles at lowered pH value. Apart from the wild type alpha-amylase a specific subset of variants, with only changes in three out of the seven possible positions, was selected. All selected variants could hydrolyse starch and heptamaltose at low pH. Interestingly, variants were found with a starch hydrolysis ratio at pH 4.5/7.5 that is improved relative to the wild type alpha-amylase. These data demonstrate that useful alpha-amylase mutants can be selected via surface display on the basis of their binding properties to starch at lowered pH values.

  7. Sweet potato beta-amylase. Primary structure and identification of the active-site glutamyl residue.

    PubMed

    Toda, H; Nitta, Y; Asanami, S; Kim, J P; Sakiyama, F

    1993-08-15

    The complete amino acid sequence of a subunit of sweet potato beta-amylase, a homotetramer, was established by sequence analysis of peptides obtained by digestions with Achromobacter protease I and Staphylococcus aureus V8 protease and by cyanogen bromide cleavage of the S-carboxymethylated subunit. The subunit of the enzyme is a single polypeptide consisting of 498 amino acid residues. It showed 50-60% identity in the amino acid sequence with those of beta-amylases from soybean and barley, while it about 25% with those of three bacterial beta-amylases deduced from the cDNA sequences. Sweet potato beta-amylase was completely inactivated with 2,3-epoxypropyl alpha-D-[U-14C]glucopyranoside. Sequence analysis of the inactivated enzyme revealed that Glu187 was specifically esterified by the affinity labeling with the above reagent, proposing that Glu187 is a potent candidate involved directly in the catalysis with this plant beta-amylase.

  8. Enzymatic synthesis of a selective inhibitor for alpha-glucosidases: alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen.

    PubMed

    Lee, Young-Su; Lee, Myoung-Hee; Lee, Hee-Seob; Lee, Seung-Jae; Kim, Young-Wan; Zhang, Ran; Withers, Stephen G; Kim, Kwan Soo; Lee, Sung-Joon; Park, Kwan-Hwa

    2008-07-09

    Here, we describe the enzymatic synthesis of novel inhibitors using acarviosine-glucose as a donor and 3-alpha-D-glucopyranosylpropen (alphaGP) as an acceptor. Maltogenic amylase from Thermus sp. (ThMA) catalyzed the transglycosylation of the acarviosine moiety to alphaGP. The two major reaction products were isolated using chromatographies. Structural analyses revealed that acarviosine was transferred to either C-7 or C-9 of the alphaGP, which correspond to C-4 and C-6 of glucose. Both inhibited rat intestine alpha-glucosidase competitively but displayed a mixed-type inhibition mode against human pancreatic alpha-amylase. The alpha-acarviosinyl-(1-->7)-3-alpha-D-glucopyranosylpropen showed weaker inhibition potency than acarbose against both alpha-glycosidases. In contrast, the alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen exhibited a 3.0-fold improved inhibition potency against rat intestine alpha-glucosidase with 0.3-fold inhibition potency against human pancreatic alpha-amylase relative to acarbose. In conclusion, alpha-acarviosinyl-(1-->9)-3-alpha-D-glucopyranosylpropen is a novel alpha-glucosidase-selective inhibitor with 10-fold enhanced selectivity toward alpha-glucosidase over alpha-amylase relative to acarbose, and it could be applied as a potent hypoglycemic agent.

  9. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    PubMed

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-07-31

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds.

  10. Beta-amylase-resistant amylose. Effect of urea on the limited hydrolysis of amylose by beta-amylase.

    PubMed

    Patil, N B

    1976-02-01

    Amylose prepared from starch dispersed in 10M-urea, pH6.2, was found to be resistant to the action of beta-amylase and phosphorylase, though it was degraded by alpha-amylase. Amylose isolated by conventional methods was similarly refractory after urea treatment, and was hydrolysed by beta-amylase to the extent of 32-35%; it had no inhibitory effect towards beta-amylase. The physical and chemical properties of the modified amylose were in general comparable with those of normal amylose with a beta-amylolysis limit of 94-98%. Starch and amylopectin were unaffected by urea treatment, i.e. the presence of amylopectin protected amylose against changes induced in it by urea. It is speculated that urea treatment "freezes" amylose molecules in a conformation that renders non-reducing termini inaccessible to the active site of the exo-enzymes. Such changes may limit the degradative action of beta-amylase and phosphorylase.

  11. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    PubMed

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization.

  12. Kinetic studies of amylase and biomass production by Calvatia gigantea

    SciTech Connect

    Kekos, D.; Macris, B.J.

    1987-01-01

    Production of alpha-amylase (alpha-4, glucan 4-glucanohydrolase, EC 3.2.1.1) by microorganisms has been practiced for many years in small and large scale operations and the literature on this enzyme is voluminous. Aspergillus niger and Aspergillus oryzae have been reported as the main fungal species used for commercial production of the enzyme. On the other hand, large volumes of low-cost agricultural products such as acorn (the perisperm-free dry seed contains approximately 60% starch) are wasted in many countries and provide a challenge to biotechnology to efficiently utilize these rich sources of starch for the production of high added value products like enzymes. C. gigantea is an edible puffball excreting high levels of alpha-amylase when cultivated on different sources of starch containing elevated quantities of toxic tannic compounds. This fungus has been employed for the production of microbial protein from wastes and acorns containing high levels of toxic tannic compounds. The same fungus was also reported to grow on both hydrolyzable and condensed tannins as sole carbon sources. The present work was undertaken to investigate certain kinetic characteristics of alpha-amylase and biomass production by C. gigantea grown on soluble and acorn starch in a lab fermenter. (Refs. 18).

  13. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    PubMed

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  14. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    PubMed Central

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  15. Marine Microbial Amylases: Properties and Applications.

    PubMed

    Suriya, J; Bharathiraja, S; Krishnan, M; Manivasagan, P; Kim, S-K

    2016-01-01

    Amylases are crucial enzymes which hydrolyze internal glycosidic linkages in starch and produce as primary products dextrins and oligosaccharides. Amylases are classified into α-amylase, β-amylase, and glucoamylase based on their three-dimensional structures, reaction mechanisms, and amino acid sequences. Amylases have innumerable applications in clinical, medical, and analytical chemistries as well as in food, detergent, textile, brewing, and distilling industries. Amylases can be produced from plants, animals, and microbial sources. Due to the advantages in microbial production, it meets commercial needs. The pervasive nature, easy production, and wide range of applications make amylase an industrially pivotal enzyme. This chapter will focus on amylases found in marine microorganisms, their potential industrial applications, and how these enzymes can be improved to the required bioprocessing conditions.

  16. Isolation and characterization of Taka-amylase A apoprotein deglycosylated by digestion with almond glycopeptidase immobilized on Sepharose.

    PubMed

    Takahashi, N; Toda, H; Nishibe, H; Yamamoto, K

    1982-10-05

    Taka-amylase A (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1), which contains a single asparagine-linked oligosaccharide unit, was digested with almond glycopeptidase immobilized on Sepharose 6B at 20 degrees C for 4 h. A maximum of 10% of the parent protein was isolated as apoprotein by column chromatography on Con-A Sepharose. The characteristics of the apoprotein were compared to those of the native Taka-amylase A. The removal of the sugar chain from Taka-amylase. A caused no change in the pH-activity profile or in kinetic parameters of the hydrolysis of soluble starch. The stability of the apoprotein toward changing pH and digestion by proteases did not show any appreciable difference from that of the native Taka-amylase. These results suggest that the carbohydrate moiety of Taka-amylase A is not an essential participant in the catalysis.

  17. The thyroid hormone receptor gene (c-erbA alpha) is expressed in advance of thyroid gland maturation during the early embryonic development of Xenopus laevis.

    PubMed Central

    Banker, D E; Bigler, J; Eisenman, R N

    1991-01-01

    The c-erbA proto-oncogene encodes the thyroid hormone receptor, a ligand-dependent transcription factor which plays an important role in vertebrate growth and development. To define the role of the thyroid hormone receptor in developmental processes, we have begun studying c-erbA gene expression during the ontogeny of Xenopus laevis, an organism in which thyroid hormone has well-documented effects on morphogenesis. Using polymerase chain reactions (PCR) as a sensitive assay of specific gene expression, we found that polyadenylated erbA alpha RNA is present in Xenopus cells at early developmental stages, including the fertilized egg, blastula, gastrula, and neurula. By performing erbA alpha-specific PCR on reverse-transcribed RNAs from high-density sucrose gradient fractions prepared from early-stage embryos, we have demonstrated that these erbA transcripts are recruited to polysomes. Therefore, erbA is expressed in Xenopus development prior to the appearance of the thyroid gland anlage in tailbud-stage embryos. This implies that erbA alpha/thyroid hormone receptors may play ligand-independent roles during the early development of X. laevis. Quantitative PCR revealed a greater than 25-fold range in the steady-state levels of polyadenylated erbA alpha RNA across early stages of development, as expressed relative to equimolar amounts of total embryonic RNA. Substantial increases in the levels of erbA alpha RNA were noted at stages well after the onset of zygotic transcription at the mid-blastula transition, with accumulation of erbA alpha transcripts reaching a relative maximum in advance of metamorphosis. We also show that erbA alpha RNAs are expressed unequally across Xenopus neural tube embryos. This differential expression continues through later stages of development, including metamorphosis. This finding suggests that erbA alpha/thyroid hormone receptors may play roles in tissue-specific processes across all of Xenopus development. Images PMID:1656222

  18. The sensitivity and specificity of the RSID-saliva kit for the detection of human salivary amylase in the Forensic Science Laboratory, Dublin, Ireland.

    PubMed

    Casey, David G; Price, Judy

    2010-01-30

    We demonstrate here that the RSID-saliva test can be used as a test for human salivary alpha-amylase on samples routinely examined in forensic casework. We show that the RSID-saliva test detects salivary alpha-amylase at lower concentrations than the Phadebas Quantitative test, that the RSID-saliva test does not cross-react with forensically important human fluids and that the RSID-saliva test can be successfully integrated into the whole swab semen extraction method.

  19. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  20. Characterization of dedifferentiating human mature adipocytes from the visceral and subcutaneous fat compartments: fibroblast-activation protein alpha and dipeptidyl peptidase 4 as major components of matrix remodeling.

    PubMed

    Lessard, Julie; Pelletier, Mélissa; Biertho, Laurent; Biron, Simon; Marceau, Simon; Hould, Frédéric-Simon; Lebel, Stéfane; Moustarah, Fady; Lescelleur, Odette; Marceau, Picard; Tchernof, André

    2015-01-01

    Mature adipocytes can reverse their phenotype to become fibroblast-like cells. This is achieved by ceiling culture and the resulting cells, called dedifferentiated fat (DFAT) cells, are multipotent. Beyond the potential value of these cells for regenerative medicine, the dedifferentiation process itself raises many questions about cellular plasticity and the pathways implicated in cell behavior. This work has been performed with the objective of obtaining new information on adipocyte dedifferentiation, especially pertaining to new targets that may be involved in cellular fate changes. To do so, omental and subcutaneous mature adipocytes sampled from severely obese subjects have been dedifferentiated by ceiling culture. An experimental design with various time points along the dedifferentiation process has been utilized to better understand this process. Cell size, gene and protein expression as well as cytokine secretion were investigated. Il-6, IL-8, SerpinE1 and VEGF secretion were increased during dedifferentiation, whereas MIF-1 secretion was transiently increased. A marked decrease in expression of mature adipocyte transcripts (PPARγ2, C/EBPα, LPL and Adiponectin) was detected early in the process. In addition, some matrix remodeling transcripts (FAP, DPP4, MMP1 and TGFβ1) were rapidly and strongly up-regulated. FAP and DPP4 proteins were simultaneously induced in dedifferentiating mature adipocytes supporting a potential role for these enzymes in adipose tissue remodeling and cell plasticity.

  1. Characterization of Dedifferentiating Human Mature Adipocytes from the Visceral and Subcutaneous Fat Compartments: Fibroblast-Activation Protein Alpha and Dipeptidyl Peptidase 4 as Major Components of Matrix Remodeling

    PubMed Central

    Lessard, Julie; Pelletier, Mélissa; Biertho, Laurent; Biron, Simon; Marceau, Simon; Hould, Frédéric-Simon; Lebel, Stéfane; Moustarah, Fady; Lescelleur, Odette; Marceau, Picard; Tchernof, André

    2015-01-01

    Mature adipocytes can reverse their phenotype to become fibroblast-like cells. This is achieved by ceiling culture and the resulting cells, called dedifferentiated fat (DFAT) cells, are multipotent. Beyond the potential value of these cells for regenerative medicine, the dedifferentiation process itself raises many questions about cellular plasticity and the pathways implicated in cell behavior. This work has been performed with the objective of obtaining new information on adipocyte dedifferentiation, especially pertaining to new targets that may be involved in cellular fate changes. To do so, omental and subcutaneous mature adipocytes sampled from severely obese subjects have been dedifferentiated by ceiling culture. An experimental design with various time points along the dedifferentiation process has been utilized to better understand this process. Cell size, gene and protein expression as well as cytokine secretion were investigated. Il-6, IL-8, SerpinE1 and VEGF secretion were increased during dedifferentiation, whereas MIF-1 secretion was transiently increased. A marked decrease in expression of mature adipocyte transcripts (PPARγ2, C/EBPα, LPL and Adiponectin) was detected early in the process. In addition, some matrix remodeling transcripts (FAP, DPP4, MMP1 and TGFβ1) were rapidly and strongly up-regulated. FAP and DPP4 proteins were simultaneously induced in dedifferentiating mature adipocytes supporting a potential role for these enzymes in adipose tissue remodeling and cell plasticity. PMID:25816202

  2. Coupled reactions of immobilized enzymes and immobilized substrates: clinical application as exemplified by amylase assay.

    PubMed

    Barabino, R C; Gray, D N; Keyes, M H

    1978-08-01

    We described a partitioned enzyme-sensor system, which incorporates an immoblized substrate and three or more discrete immobilized enzymes. This instrument measures alpha-amylase activity by passing the solution containing alpha-amylase over a column packed with immobilized starch. The resulting oligosaccharides are successively exposed to a column or columns containing immobolized glucose oxidase, catalase, glucoamylase or maltase, and glucose oxidase. The resulting hydrogen peroxide is detected by a three-electrode amperometric cell. All immobilized reagents were immobilized on a particulate, porous alumina to allow rapid and constant flow rate. With use of less than optimum immobilized reagents, alpha-amylase activity has been measured from about 5 to 200 kU/liter with a 50 microliter sample size. Lack of sensitivity is predominantly attributable to the low activity and low stability of immobilized maltase and glucoamylase. We believe that a clinical test using this system is feasible and desirable because the immobilized reagent system should allow for testing of alpha-amylase with excellent precision, convenience to the operator, and low cost.

  3. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  4. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some US refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the US sugar industry to control starch have intermediate temperature stability (up to 85 ...

  5. Amylase and chitinase genes in Streptomyces lividans are regulated by reg1, a pleiotropic regulatory gene.

    PubMed Central

    Nguyen, J; Francou, F; Virolle, M J; Guérineau, M

    1997-01-01

    A regulatory gene, reg1, was identified in Streptomyces lividans. It encodes a 345-amino-acid protein (Reg1) which contains a helix-turn-helix DNA-binding motif in the N-terminal region. Reg1 exhibits similarity with the LacI/GalR family members over the entire sequence. It displays 95% identity with MalR (the repressor of malE in S. coelicolor), 65% identity with ORF-Sl (a putative regulatory gene of alpha-amylase of S. limosus), and 31% identity with CcpA (the carbon catabolite repressor in Bacillus subtilis). In S. lividans, the chromosomal disruption of reg1 affected the expression of several genes. The production of alpha-amylases of S. lividans and that of the alpha-amylase of S. limosus in S. lividans were enhanced in the reg1 mutant strains and relieved of carbon catabolite repression. As a result, the transcription level of the alpha-amylase of S. limosus was noticeably increased in the reg1 mutant strain. Moreover, the induction of chitinase production in S. lividans was relieved of carbon catabolite repression by glucose in the reg1 mutant strain, while the induction by chitin was lost. Therefore, reg1 can be regarded as a pleiotropic regulatory gene in S. lividans. PMID:9335287

  6. Expression and mutation of soybean beta-amylase in Escherichia coli.

    PubMed

    Totsuka, A; Fukazawa, C

    1993-06-15

    The cDNA clones corresponding to soybean beta-amylase mRNA were isolated and sequenced. The cDNA contained an open-reading frame composed of 496 amino acids. The comparison of the amino acid sequence deduced from the cDNA with the N-terminal peptide sequence from mature enzyme proved that beta-amylase had no leader sequence. Employing the cDNA, the beta-amylase was directly synthesized in Escherichia coli by the expression vector pKK233-2 controlled by the tac promoter. The enzyme activity detected in E. coli lysate drastically increased with a lower cultivation temperature, and the total activity and specific activity of the enzyme in E. coli lysate cultured at 13 degrees C was 130-fold and 280-fold, respectively, the value at 37 degrees C. The enzyme produced in E. coli was purified by the affinity column chromatography of cyclomaltohexaose-immobilized Sepharose 6B. Employing the established expression and purification system of the enzyme, the functional ionizable groups in the active site were searched. His93, involving an imidazole, and Asp348, involving a carboxylate, in the highly conserved regions within the beta-amylases were replaced by Arg (H93R) and Ash (D348N) by site-directed mutagenesis, respectively. All beta-amylases, including the non-mutant and mutant beta-amylases, produced in E. coli exhibited lower Vmax values than that of beta-amylase isolated conventionally from soybean seeds. Especially the Vmax value of [H93R]beta-amylase was reduced drastically compared to that of the non-mutant; however, none of them lost their enzyme activities completely. Therefore, neither His93 nor Asp348 may participate in the catalytic reaction directly.

  7. Purification and characterization of amylases from small abalone (Sulculus diversicolor aquatilis).

    PubMed

    Tsao, Ching-Yu; Pan, Yun-Zu; Jiang, Shann-Tzong

    2003-02-12

    Amylases II-1 and II-2 with molecular weights of 55.7 and 65 kDa, respectively, were purified to electrophoretical homogeneity from small abalone (Sulculus diversicolor aquatilis) by ammonium sulfate fractionation, Sepharose CL-6B, CM-Sepharose CL-6B, and Sephacryl S-100 chromatographs. They had optimal temperatures of 45 and 50 degrees C and an optimal pH of 6.0. The purified amylases were stable at pH 5.0-8.0 and 6.0-8.0, respectively. They were completely or partially inhibited by Hg(2+), Cu(2+), Cd(2+), Zn(2+), iodoacetamide, phenylmethanesulfonyl fluoride, and N-ethylmaleimide, suggesting the existence of cysteine at their active sites. Digestion tests against various polysaccharides suggested that the purified amylases II-1 and II-2 are neoamylases which can hydrolyze both alpha-1,4 and alpha-1,6 glucosidic bonds. Amylase II-2 might be an exo- and II-1 an endo-/exo-amylase.

  8. Existence of hydroxylated MWCNTs demotes the catalysis effect of amylases against starch degradation.

    PubMed

    Sekar, Gajalakshmi; Sivakumar, Amaravathy; Mukherjee, Amitava; Chandrasekaran, Natarajan

    2016-05-01

    Possible interaction between amylase and Multi Walled Carbon Nanotubes (MWCNTs) has been elucidated with spectroscopic methods. Hyperchromism of the UV-visible spectra of amylase-CNT conjugates suggested ground state complex formation between them. On contrary, the decreasing fluorescence emission spectra revealed the fate of quenching mechanism to be static. Stoke shift observed from the synchronous and 3D spectra suggested the possibilities of disturbances to the aromatic micro-environment of amylases by OH-MWCNTS. FTIR and FT-Raman spectra showed alteration in the amide I band, that corresponds to their effect on alpha-helical structures. Loss of alpha-helical structures and alteration in the dichroic band again revealed possible conformational change and effect towards the stability of polypeptide backbone structures. In addition, the shift observed in the SPR band and FTIR peaks of CNTs-amylase conjugates suggested possible alteration in their optical and structural properties. On the functional aspect, amylase activity on starch degradation and hydrolysis were found to be decreased in the presence of CNTs.

  9. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  10. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  11. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  12. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  13. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  14. Concerted evolution of human amylase genes

    SciTech Connect

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  15. Encapsulation of amylase in colloidosomes.

    PubMed

    Keen, Polly H R; Slater, Nigel K H; Routh, Alexander F

    2014-03-04

    Aqueous core colloidosomes encapsulating the enzyme amylase were manufactured with a shell comprising polymer latex particles of diameter 153 nm. The colloidosomes were sealed with calcium carbonate by precipitation between an inner phase of Na2CO3 and an outer phase of CaCl2. This seal allowed the retention of small molecules, such as dyes, as well as larger enzyme molecules, for several months. The encapsulated material could be released by dissolution of the CaCO3 with acid, upon a large dilution in water, or by applying a sufficient shear. The degree of release could be controlled since the greater the mass of CaCO3 precipitated onto the colloidosome shell, the greater the dilution or shear required to achieve release. The calcium carbonate seal protected encapsulated amylase from the detrimental effects of components in a liquid laundry detergent for several months so that, on triggered release, the enzyme retained its high activity.

  16. Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development

    PubMed Central

    Whan, Alex; Dielen, Anne-Sophie; Mieog, Jos; Bowerman, Andrew F.; Robinson, Hannah M.; Byrne, Keren; Colgrave, Michelle; Larkin, Philip J.; Howitt, Crispin A.; Morell, Matthew K.; Ral, Jean-Philippe

    2014-01-01

    Wheat starch degradation requires the synergistic action of different amylolytic enzymes. Our spatio-temporal study of wheat α-amylases throughout grain development shows that AMY3 is the most abundant isoform compared with the other known α-amylases. Endosperm-specific over-expression of AMY3 resulted in an increase of total α-amylase activity in harvested grains. Unexpectedly, increased activity did not have a significant impact on starch content or composition but led to an increase of soluble carbohydrate (mainly sucrose) in dry grain. In AMY3 overexpression lines (A3OE), germination was slightly delayed and triacylglycerol (TAG) content was increased in the endosperm of mature grain. Despite increased AMY3 transcript and protein content throughout grain development, alterations of α-amylase activity and starch granule degradation were not detected until grain maturation, suggesting a post-translational inhibition of α-amylase activity in the endosperm during the starch filling period. These findings show unexpected effects of a high level of α-amylase on grain development and composition, notably in carbon partitioning and TAG accumulation, and suggest the presence of a hitherto unknown regulatory pathway during grain filling. PMID:25053646

  17. Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development.

    PubMed

    Whan, Alex; Dielen, Anne-Sophie; Mieog, Jos; Bowerman, Andrew F; Robinson, Hannah M; Byrne, Keren; Colgrave, Michelle; Larkin, Philip J; Howitt, Crispin A; Morell, Matthew K; Ral, Jean-Philippe

    2014-10-01

    Wheat starch degradation requires the synergistic action of different amylolytic enzymes. Our spatio-temporal study of wheat α-amylases throughout grain development shows that AMY3 is the most abundant isoform compared with the other known α-amylases. Endosperm-specific over-expression of AMY3 resulted in an increase of total α-amylase activity in harvested grains. Unexpectedly, increased activity did not have a significant impact on starch content or composition but led to an increase of soluble carbohydrate (mainly sucrose) in dry grain. In AMY3 overexpression lines (A3OE), germination was slightly delayed and triacylglycerol (TAG) content was increased in the endosperm of mature grain. Despite increased AMY3 transcript and protein content throughout grain development, alterations of α-amylase activity and starch granule degradation were not detected until grain maturation, suggesting a post-translational inhibition of α-amylase activity in the endosperm during the starch filling period. These findings show unexpected effects of a high level of α-amylase on grain development and composition, notably in carbon partitioning and TAG accumulation, and suggest the presence of a hitherto unknown regulatory pathway during grain filling.

  18. Crystal structure of recombinant soybean beta-amylase complexed with beta-cyclodextrin.

    PubMed

    Adachi, M; Mikami, B; Katsube, T; Utsumi, S

    1998-07-31

    In order to study the interaction of soybean beta-amylase with substrate, we solved the crystal structure of beta-cyclodextrin-enzyme complex and compared it with that of alpha-cyclodextrin-enzyme complex. The enzyme was expressed in Escherichia coli at a high level as a soluble and catalytically active protein. The purified recombinant enzyme had properties nearly identical to those of native soybean beta-amylase and formed the same crystals as the native enzyme. The crystal structure of recombinant enzyme complexed with beta-cyclodextrin was refined at 2. 07-A resolution with a final crystallographic R value of 15.8% (Rfree = 21.1%). The root mean square deviation in the position of C-alpha atoms between this recombinant enzyme and the native enzyme was 0.22 A. These results indicate that the expression system established here is suitable for studying structure-function relationships of beta-amylase. The conformation of the bound beta-cyclodextrin takes an ellipsoid shape in contrast to the circular shape of the bound alpha-cyclodextrin. The cyclodextrins shared mainly two glucose binding sites, 3 and 4. The glucose residue 4 was slightly shifted from the maltose binding site. This suggests that the binding site of the cyclodextrins is important for its holding of a cleaved substrate, which enables the multiple attack mechanism of beta-amylase.

  19. Reduced embryonic survival in rainbow trout resulting from paternal exposure to the environmental estrogen 17 alpha- ethynylestradiol during late sexual maturation

    SciTech Connect

    Brown, Kim H.; Schultz, Irvin R.; Nagler, James J.

    2007-11-01

    Exposure of fishes to environmental estrogens is known to affect sexual development and spawning, but little information exists regarding effects on gametes. This study evaluated embryonic survival of offspring from male rainbow trout (Oncorhynchus mykiss) exposed to 17a-ethynylestradiol (EE2)using an in vitro fertilization protocol. Males were exposed at either 1800 or 6700 degree days (8d) (i.e. 161 or 587 days post-fertilization (dpf)) to test for effects on testes linked to reproductive ontogeny. At 18008d, fish were beginning testicular differentiation and were exposed to 109 ng EE2/l for 21 days. At 67008d, fish have testes containing spermatocytes and spermatids and were exposed for 56 days to either 0.8, 8.3, or 65 ng EE2/l. Semen was collected at full sexual maturity in each group and used to fertilize eggs pooled from several non-exposed females. Significant decreases in embryonic survival were observed only with the 67008d exposure. In 0.8 and 8.3 ng EE2/l treatments, embryo survival was significantly reduced at 19 dpf when compared with the control. In contrast, an immediate decrease in embryonic survival at 0.5 dpf was observed in the 65 ng EE2/l treatment. Blood samples collected at spawning from 67008d exposed males revealed a significant decrease in 11-ketotestosterone and a significant increase in luteinizing hormone levels for the 65 ng EE2/l treatment when compared with the other treatment groups. Results indicate that sexually maturing male rainbow trout are susceptible to EE2 exposure with these fish exhibiting two possible mechanisms of reduced embryonic survival through sperm varying dependant

  20. Redox regulation of a novel plastid-targeted beta-amylase of Arabidopsis.

    PubMed

    Sparla, Francesca; Costa, Alex; Lo Schiavo, Fiorella; Pupillo, Paolo; Trost, Paolo

    2006-07-01

    Nine genes of Arabidopsis (Arabidopsis thaliana) encode for beta-amylase isozymes. Six members of the family are predicted to be extrachloroplastic isozymes and three contain predicted plastid transit peptides. Among the latter, chloroplast-targeted beta-amylase (At4g17090) and thioredoxin-regulated beta-amylase (TR-BAMY; At3g23920; this work) are experimentally demonstrated to be targeted to plastids. Recombinant TR-BAMY was catalytically active only when expressed as a mature protein, i.e. with no transit peptide. Mature TR-BAMY was a monomer of 60 kD, hydrolyzing soluble starch with optimal activity between pH 6.0 and 8.0. The activity of recombinant TR-BAMY was strictly dependent on redox potential with an Em,7.0 of -302 +/- 14 mV. Thioredoxins f1, m1, and y1 of Arabidopsis were all able to mediate the reductive activation of oxidized TR-BAMY. Site-specific mutants showed that TR-BAMY oxidative inhibition depended on the formation of a disulfide bridge between Cys-32 and Cys-470. Consistent with TR-BAMY redox dependency, total beta-amylase activity in Arabidopsis chloroplasts was partially redox regulated and required reducing conditions for full activation. In Arabidopsis, TR-BAMY transcripts were detected in leaves, roots, flowers, pollen, and seeds. TR-BAMY may be the only beta-amylase of nonphotosynthetic plastids suggesting a redox regulation of starch metabolism in these organelles. In leaves, where chloroplast-targeted beta-amylase is involved in physiological degradation of starch in the dark, TR-BAMY is proposed to participate to a redox-regulated pathway of starch degradation under specific stress conditions.

  1. Effect of limited proteolysis in the 8th loop of the barrel and of antibodies on porcine pancreas amylase activity.

    PubMed

    Desseaux, V; Payan, F; Ajandouz, E H; Svensson, B; Haser, R; Marchis-Mouren, G

    1991-11-15

    The porcine pancreatic alpha-amylase is a (beta/alpha)8-barrel protein, containing domains A and B (peptide sequence 1-403) and a distinct C-domain (peptide sequence 404-496). Separation of the terminal C-domain from the A and B domains has been attempted by limited proteolysis in the hinge region. Subtilisin was found to hydrolyse amylase between residues 369 and 370 situated in the loop between the eighth beta-strand and alpha-helix. The cleaved amylase was isolated by chromatofocusing and found to retain about 60% of the activity of the native enzyme, while the isolated fragments were inactive. Antigen binding fragments prepared from polyclonal antibodies to native amylase and the CNBr-fragment P1 (peptide sequence 395-496) respectively, were tested for influence on the enzyme activity. Antibodies directed against P1 had no effect whereas antibodies against the peptide sequence 1-394 and amylase respectively inhibited hydrolysis of substrates having four or more glucose residues but not of shorter oligomaltosides. Crystallographic analysis revealed that changes in the region of residue 369 might affect the conformation of the active site as well as of a second binding site. This site, located on the enzyme surface, is proposed to be required for the hydrolysis of larger substrates.

  2. Exercise upregulates salivary amylase in humans (Review)

    PubMed Central

    KOIBUCHI, ERI; SUZUKI, YOSHIO

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  3. Rhizopus microsporus var. rhizopodiformis: a thermotolerant fungus with potential for production of thermostable amylases.

    PubMed

    Peixoto, Simone C; Jorge, João A; Terenzi, Héctor F; Polizeli, Maria de Lourdes T M

    2003-12-01

    The effect of several nutritional and environmental parameters on growth and amylase production from Rhizopus microsporus var. rhizopodiformis was analysed. This fungus was isolated from soil of the Brazilian "cerrado" and produced high levels of amylolytic activity at 45 degrees C in liquid medium supplemented with starch, sugar cane bagasse, oat meal or cassava flour. Glucose in the culture medium drastically repressed the amylolytic activity. The products of hydrolysis were analysed by thin layer chromatography, and glucose was detected as the main component. The amylolytic activity hydrolysed several substrates, such as amylopectin, amylase, glycogen, pullulan, starch, and maltose. Glucose was always the main end product detected by high-pressure liquid chromatography analysis. These results indicated that the amylolytic activity studied is a glucoamylase, but there were also low levels of alpha-amylase. As compared to other fungi, R. microsporus var. rhizopodiformis can be considered an efficient producer of thermostable amylases, using raw residues of low cost as substrates. This information is of technological value, considering the importance of amylases for industrial hydrolysis.

  4. Two sulfhydryl groups near the active site of soybean beta-amylase.

    PubMed

    Mikami, B; Nomura, K; Morita, Y

    1994-01-01

    The less reactive SH groups of soybean beta-amylase, SH4, SH5, and SH6, were modified with p-chloromercuribenzoic acid or N-ethylmaleimide, after the reactive SH groups, SH1, SH2, and SH3, were blocked with 5,5'-dithiobis-(2-nitrobenzoic acid) and cyanide. The enzyme activity decreased, accompanied by the modification of SH4. alpha-Cyclodextrin protected SH4 from the modification more effectively than maltose. The SH4-modified enzyme still bound to glucose, maltose, and alpha-cyclodextrin. SH4 was concerned with neither the catalysis nor substrate binding but its large substituent affected the substrate binding site. The sequencing of the 5-(iodoacetoamidoethyl)-aminoaphthalene-1-sulfonate-labeled peptides showed that SH4, SH5, and SH6 are Cys343, Cys82, and Cys208, respectively. Comparison of the primary structure of beta-amylases also showed that the sequence around SH4 (Cys343), as well as SH2 (Cys95), is strongly conserved between higher plant and bacterial beta-amylases. These results agree with the structure model deduced from X-ray crystallography of soybean beta-amylase.

  5. Characterization of recombinant β-amylases from Oryza sativa.

    PubMed

    Koide, Tomojiro; Ohnishi, Yasuo; Horinouchi, Sueharu

    2011-01-01

    Four putative β-amylase genes found in the Oryza sativa cDNA sequence database (KOME) were expressed in Escherichia coli. Recombinant proteins from two of these genes showed β-amylase activity. Similarly to β-amylases from other plants, the optimum pH of the recombinant rice β-amylases was about 5.5-6.0, but they exhibited inferior heat stability to soybean β-amylase.

  6. Biotechnological Processes in Microbial Amylase Production

    PubMed Central

    Arshad, M. K. Md; Lakshmipriya, Thangavel; Hashim, Uda; Chinni, Suresh V.

    2017-01-01

    Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales. PMID:28280725

  7. Changes in plasma inhibin A levels during sexual maturation in the female chicken and the effects of active immunization against inhibin alpha-subunit on reproductive hormone profiles and ovarian function.

    PubMed

    Lovell, T M; Knight, P G; Groome, N P; Gladwell, R T

    2001-01-01

    Inhibins and activins are firmly implicated in the control of pituitary FSH secretion and ovarian follicular development in mammals. As in mammals, inhibin A and activin A are expressed in the preovulatory follicles of birds, and a defined ovulation cycle for inhibin A has recently been demonstrated in the laying hen. To investigate further the role of inhibin-related proteins in developing pullets, circulating concentrations of inhibin A, inhibin B, total immunoreactive inhibin alpha-subunit (ir-alpha), activin A, LH, FSH, and progesterone were measured from the juvenile state through to sexual maturity in 22 birds. In the 11 birds assigned to control groups, plasma inhibin A levels were low from 7 to 13 wk of age rising about threefold to a peak at Week 19 after which levels fell slightly to a plateau level characteristic of adult hens. Plasma inhibin A levels were negatively correlated with FSH (r = -0. 33; P: < 0.001) and positively correlated with progesterone (r = 0. 67; P: < 0.001) and ir-alpha (r = 0.53; P: < 0.001). Plasma ir-alpha levels were much higher than inhibin A levels although the relative differences varied with age. Plasma levels of inhibin B and activin A were below assay detection limits at all times. The remaining group of 11 birds was actively immunized (IMM) against a synthetic chicken inhibin alpha-subunit peptide (amino acids 1-26). The IMM generated circulating antibodies that bound native bovine inhibin A but altered neither plasma FSH nor progesterone levels relative to control birds at any stage of development nor the timing of first oviposition in week 19. Apart from a transient decline 1 wk after primary IMM, plasma LH concentrations did not differ from controls. Comparison of the numbers and size-class distribution of ovarian follicles at 29 wk showed an approximate twofold increase in the number of 8- to 9.9-mm-diameter follicles (control; 1.82 +/- 0.44 vs. IMM; 3.91 +/- 0.89; P: < 0.05), a size class that corresponds to follicles

  8. Allotides: Proline-Rich Cystine Knot α-Amylase Inhibitors from Allamanda cathartica.

    PubMed

    Nguyen, Phuong Q T; Luu, Thuy T; Bai, Yang; Nguyen, Giang K T; Pervushin, Konstantin; Tam, James P

    2015-04-24

    Cystine knot α-amylase inhibitors belong to a knottin family of peptidyl inhibitors of 30-32 residues and contain two to four prolines. Thus far, only four members of the group of cystine knot α-amylase inhibitors have been characterized. Herein, the discovery and characterization of five cystine knot α-amylase inhibitors, allotides C1-C5 (Ac1-Ac5) (1-5), from the medicinal plant Allamanda cathartica are reported using both proteomic and genomic methods. Proteomic analysis showed that 1-5 are 30 amino acids in length with three or four proline residues. NMR determination of 4 revealed that it has two cis- and one trans-proline residues and adopts two equally populated conformations in solution. Determination of disulfide connectivity of 2 by differential S-reduction and S-alkylation provided clues of its unfolding process. Genomic analysis showed that allotide precursors contain a three-domain arrangement commonly found in plant cystine knot peptides with conserved residues flanking the processing sites of the mature allotide domain. This work expands the number of known cystine knot α-amylase inhibitors and furthers the understanding of both the structural and biological diversity of this type of knottin family.

  9. Contribution of mucosal maltase-glucoamylase activities to mouse small intestinal starch alpha-glucogenesis.

    PubMed

    Quezada-Calvillo, Roberto; Robayo-Torres, Claudia C; Opekun, Antone R; Sen, Partha; Ao, Zihua; Hamaker, Bruce R; Quaroni, Andrea; Brayer, Gary D; Wattler, Sigrid; Nehls, Michael C; Sterchi, Erwin E; Nichols, Buford L

    2007-07-01

    Digestion of starch requires activities provided by 6 interactive small intestinal enzymes. Two of these are luminal endo-glucosidases named alpha-amylases. Four are exo-glucosidases bound to the luminal surface of enterocytes. These mucosal activities were identified as 4 different maltases. Two maltase activities were associated with sucrase-isomaltase. Two remaining maltases, lacking other identifying activities, were named maltase-glucoamylase. These 4 activities are better described as alpha-glucosidases because they digest all linear starch oligosaccharides to glucose. Because confusion persists about the relative roles of these 6 enzymes, we ablated maltase-glucoamylase gene expression by homologous recombination in Sv/129 mice. We assayed the alpha-glucogenic activities of the jejunal mucosa with and without added recombinant pancreatic alpha-amylase, using a range of food starch substrates. Compared with wild-type mucosa, null mucosa or alpha-amylase alone had little alpha-glucogenic activity. alpha-Amylase amplified wild-type and null mucosal alpha-glucogenesis. alpha-Amylase amplification was most potent against amylose and model resistant starches but was inactive against its final product limit-dextrin and its constituent glucosides. Both sucrase-isomaltase and maltase-glucoamylase were active with limit-dextrin substrate. These mucosal assays were corroborated by a 13C-limit-dextrin breath test. In conclusion, the global effect of maltase-glucoamylase ablation was a slowing of rates of mucosal alpha-glucogenesis. Maltase-glucoamylase determined rates of digestion of starch in normal mice and alpha-amylase served as an amplifier for mucosal starch digestion. Acarbose inhibition was most potent against maltase-glucoamylase activities of the wild-type mouse. The consortium of 6 interactive enzymes appears to be a mechanism for adaptation of alpha-glucogenesis to a wide range of food starches.

  10. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    PubMed Central

    Cotârleţ, Mihaela; Negoiţă, Teodor Gh.; Bahrim, Gabriela E.; Stougaard, Peter

    2011-01-01

    The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20°C, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20°C. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures. PMID:24031702

  11. Structure of a Bacillus halmapalus family 13 ά-amylase, BHA, in complex with an acarbose-derived nonasaccharide at 2.1 A resolution

    SciTech Connect

    Davies,G.; Brzozowski, A.; Dauter, Z.; Rasmussen, M.; Borchert, T.; Wilson, K.

    2005-01-01

    The enzymatic digestion of starch by {alpha}-amylases is one of the key biotechnological reactions of recent times. In the search for industrial biocatalysts, the family GH13 {alpha}-amylase BHA from Bacillus halmapalus has been cloned and expressed. The three-dimensional structure at 2.1 Angstrom resolution has been determined in complex with the (pseudo)tetrasaccharide inhibitor acarbose. Acarbose is found bound as a nonasaccharide transglycosylation product spanning the -6 to +3 subsites. Careful inspection of electron density suggests that the bound ligand could not have been formed through successive transglycosylations of acarbose and must also have featured maltose or maltooligosaccharides as an acceptor.

  12. Automated docking of maltose, 2-deoxymaltose, and maltotetraose into the soybean beta-amylase active site.

    PubMed

    Laederach, A; Dowd, M K; Coutinho, P M; Reilly, P J

    1999-11-01

    In this study, products and substrates were docked into the active site of beta-amylase using the simulated annealing algorithm AutoDock. Lowest-energy conformers reproduced known crystallographic atom positions within 0.4 to 0.8 A rmsd. Docking studies were carried out with both open and closed configurations of the beta-amylase mobile flap, a loop comprising residues 96 to 103. Ligands with two rings docked within the cleft near the active site when the flap was open, but those with four rings did not. The flap must be closed for alpha-maltotetraose to adopt a conformation allowing it to dock near the crystallographically determined subsites. The closed flap is necessary for productive but not for nonproductive binding, and therefore it plays a essential role in catalysis. The gain in total binding energy upon closing of the flap for alpha-maltose docked to subsites -2, -1 and +1, +2 is about 22 kcal/mol, indicating more favorable interactions are possible with the flap closed. Larger intermolecular interaction energies are observed for two alpha-maltose molecules docked to subsites -2, -1 and +1, +2 than for one alpha-maltotetraose molecule docked from subsites -2 to +2, suggesting that it is only upon cleavage of the alpha-1,4 linkage that optimal closed-flap binding can occur with the crytallographically determined enzyme structure.

  13. Enzyme-synthesized highly branched maltodextrins have slow glucose generation at the mucosal alpha-glucosidase level and are slowly digestible "in vivo"

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For digestion of starch in humans, alpha-amylase first hydrolyzes starch molecules to produce alpha-limit dextrins, followed by complete hydrolysis to glucose by the mucosal alpha-glucosidases in the small intestine. It is known that alpha-1,6 linkages in starch are hydrolyzed at a lower rate than a...

  14. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    PubMed

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation.

  15. Engineering high α-amylase levels in wheat grain lowers Falling Number but improves baking properties.

    PubMed

    Ral, Jean-Philippe; Whan, Alex; Larroque, Oscar; Leyne, Emmett; Pritchard, Jeni; Dielen, Anne-Sophie; Howitt, Crispin A; Morell, Matthew K; Newberry, Marcus

    2016-01-01

    Late maturity α-amylase (LMA) and preharvest sprouting (PHS) are genetic defects in wheat. They are both characterized by the expression of specific isoforms of α-amylase in particular genotypes in the grain prior to harvest. The enhanced expression of α-amylase in both LMA and PHS results in a reduction in Falling Number (FN), a test of gel viscosity, and subsequent downgrading of the grain, along with a reduced price for growers. The FN test is unable to distinguish between LMA and PHS; thus, both defects are treated similarly when grain is traded. However, in PHS-affected grains, proteases and other degradative process are activated, and this has been shown to have a negative impact on end product quality. No studies have been conducted to determine whether LMA is detrimental to end product quality. This work demonstrated that wheat in which an isoform α-amylase (TaAmy3) was overexpressed in the endosperm of developing grain to levels of up to 100-fold higher than the wild-type resulted in low FN similar to those seen in LMA- or PHS-affected grains. This increase had no detrimental effect on starch structure, flour composition and enhanced baking quality, in small-scale 10-g baking tests. In these small-scale tests, overexpression of TaAmy3 led to increased loaf volume and Maillard-related browning to levels higher than those in control flours when baking improver was added. These findings raise questions as to the validity of the assumption that (i) LMA is detrimental to end product quality and (ii) a low FN is always indicative of a reduction in quality. This work suggests the need for a better understanding of the impact of elevated expression of specific α-amylase on end product quality.

  16. [Microbe amylases: characteristic, properties and practical use].

    PubMed

    Kubrak, O I; Lushchak, V I

    2007-01-01

    Current data concerning structure, properties and methods of purification ofmicrobial amylolytic enzymes are summarized in this paper. A short characteristic of the main methods of amylase activity measuring is presented, the advantages and disadvantages of each method are shown. It is proposed that novel techniques of enzyme immobilization stabilize the structure of amylases and allow their multiple uses. Scientific interest to amylases is analyzed that is explained by a number of their unique properties such as thermostability and pH-tolerance. Authors have demonstrated some examples of the practical using ofamylases in different fields of industry: textile, paper, food industries, brewing and wine-making. The prospects of their possible using in detergent preparing for laundries and dishwashers are presented. It is supposed that future investigations in this trend for isolating new amrnylases from native producers will be developed.

  17. Unexpected high digestion rate of cooked starch by the Ct-Maltase-Glucoamylase small intestine mucosal alpha-glucosidase subunit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For starch digestion to glucose, two luminal alpha-amylases and four gut mucosal alpha-glucosidase subunits are employed. The aim of this research was to investigate, for the first time, direct digestion capability of individual mucosal alpha-glucosidases on cooked (gelatinized) starch. Gelatinized ...

  18. Crystal structure of beta-amylase from Bacillus cereus var. mycoides at 2.2 A resolution.

    PubMed

    Oyama, T; Kusunoki, M; Kishimoto, Y; Takasaki, Y; Nitta, Y

    1999-06-01

    The crystal structure of beta-amylase from Bacillus cereus var. mycoides was determined by the multiple isomorphous replacement method. The structure was refined to a final R-factor of 0.186 for 102,807 independent reflections with F/sigma(F) > or = 2.0 at 2.2 A resolution with root-mean-square deviations from ideality in bond lengths, and bond angles of 0.014 A and 3.00 degrees, respectively. The asymmetric unit comprises four molecules exhibiting a dimer-of-dimers structure. The enzyme, however, acts as a monomer in solution. The beta-amylase molecule folds into three domains; the first one is the N-terminal catalytic domain with a (beta/alpha)8 barrel, the second one is the excursion part from the first one, and the third one is the C-terminal domain with two almost anti-parallel beta-sheets. The active site cleft, including two putative catalytic residues (Glu172 and Glu367), is located on the carboxyl side of the central beta-sheet in the (beta/alpha)8 barrel, as in most amylases. The active site structure of the enzyme resembles that of soybean beta-amylase with slight differences. One calcium ion is bound per molecule far from the active site. The C-terminal domain has a fold similar to the raw starch binding domains of cyclodextrin glycosyltransferase and glucoamylase.

  19. Detection of pulmonary amylase activity in exhaled breath condensate.

    PubMed

    Zweifel, M; Rechsteiner, T; Hofer, M; Boehler, A

    2013-12-01

    Amylase activity in exhaled breath condensate (EBC) is usually interpreted as an indication of oropharyngeal contamination despite the fact that amylase can be found in pulmonary excretions. The aim of this study was to recruit and refine an amylase assay in order to detect amylase activity in any EBC sample and to develop a method to identify EBC samples containing amylase of pulmonary origin. EBC was collected from 40 volunteers with an EcoScreen condenser. Amylase assays and methods to discriminate between oropharyngeal and pulmonary proteins were tested and developed using matched EBC and saliva samples. Our refined 2-chloro-4-nitrophenyl-α-D-maltotriosid (CNP-G3) assay was 40-fold more sensitive than the most sensitive commercial assay and allowed detection of amylase activity in 30 µl of EBC. We developed a dot-blot assay which allowed detection of salivary protein in saliva diluted up to 150 000-fold. By plotting amylase activity against staining intensity we identified a few EBC samples with high amylase activity which were aligned with diluted saliva. We believe that EBC samples aligned with diluted saliva contain amylase activity introduced during EBC collection and that all other EBC samples contain amylase activity of pulmonary origin and are basically free of oropharyngeal protein contamination.

  20. Aleppo tannin: structural analysis and salivary amylase inhibition.

    PubMed

    Zajácz, Agnes; Gyémánt, Gyöngyi; Vittori, Natale; Kandra, Lili

    2007-04-09

    The effectiveness and specificity of a tannin inhibition on human salivary amylase (HSA) catalyzed hydrolysis was studied using 2-chloro-4-nitrophenyl 4-O-beta-D-galactopyranosyl-alpha-maltoside (GalG(2)-CNP) and amylose substrates. Aleppo tannin was isolated from the gall nut of Aleppo oak. This tannin is a gallotannin, in which glucose is esterified with gallic acids. This is the first kinetic report, which details the inhibitory effects of this compound on HSA. A mixed non-competitive type inhibition has been observed on both substrates. The extent of inhibition is markedly dependent on the substrate-type. Kinetic constants were calculated from Lineweaver-Burk secondary plots for GalG(2)-CNP (K(EI) 0.82 microg mL(-1), K(ESI) 3.3 microg mL(-1)). This indicates a 1:1 binding ratio of inhibitor-enzyme and/or inhibitor-enzyme-substrate complex. When amylose was the substrate the binding ratio of inhibitor to enzyme-substrate complex was found to be 2:1, with the binding constants of K(EI) 17.4 microg mL(-1), K(ESI) 14.9 microg mL(-1), K(ESI(2)) 9.6 microg mL(-1). Presumably, the tannin inhibitor can bind not only to HSA, but to the amylose substrate, as well. Kinetic data suggest that Aleppo tannin is a more efficient amylase inhibitor than the recently studied other tannin with quinic acid core (GalG(2)-CNP: K(EI) 9.0 microg mL(-1), K(ESI) 47.9 microg mL(-1)).

  1. Expression of β-Amylase from Alfalfa Taproots1

    PubMed Central

    Gana, Joyce A.; Kalengamaliro, Newton E.; Cunningham, Suzanne M.; Volenec, Jeffrey J.

    1998-01-01

    Alfalfa (Medicago sativa L.) roots contain large quantities of β-amylase, but little is known about its role in vivo. We studied this by isolating a β-amylase cDNA and by examining signals that affect its expression. The β-amylase cDNA encoded a 55.95-kD polypeptide with a deduced amino acid sequence showing high similarity to other plant β-amylases. Starch concentrations, β-amylase activities, and β-amylase mRNA levels were measured in roots of alfalfa after defoliation, in suspension-cultured cells incubated in sucrose-rich or -deprived media, and in roots of cold-acclimated germ plasms. Starch levels, β-amylase activities, and β-amylase transcripts were reduced significantly in roots of defoliated plants and in sucrose-deprived cell cultures. β-Amylase transcript was high in roots of intact plants but could not be detected 2 to 8 d after defoliation. β-Amylase transcript levels increased in roots between September and October and then declined 10-fold in November and December after shoots were killed by frost. Alfalfa roots contain greater β-amylase transcript levels compared with roots of sweetclover (Melilotus officinalis L.), red clover (Trifolium pratense L.), and birdsfoot trefoil (Lotus corniculatus L.). Southern analysis indicated that β-amylase is present as a multigene family in alfalfa. Our results show no clear association between β-amylase activity or transcript abundance and starch hydrolysis in alfalfa roots. The great abundance of β-amylase and its unexpected patterns of gene expression and protein accumulation support our current belief that this protein serves a storage function in roots of this perennial species. PMID:9847126

  2. Removal of the four C-terminal glycine-rich repeats enhances the thermostability and substrate binding affinity of barley beta-amylase.

    PubMed

    Ma, Y F; Eglinton, J K; Evans, D E; Logue, S J; Langridge, P

    2000-11-07

    Barley beta-amylase undergoes proteolytic cleavage in the C-terminal region after germination. The implication of the cleavage in the enzyme's characteristics is unclear. With purified native beta-amylases from both mature barley grain and germinated barley, we found that the beta-amylase from germinated barley had significantly higher thermostability and substrate binding affinity for starch than that from mature barley grain. To better understand the effect of the proteolytic cleavage on the enzyme's thermostability and substrate binding affinity for starch, recombinant barley beta-amylases with specific deletions at the C-terminal tail were generated. The complete deletion of the four C-terminal glycine-rich repeats significantly increased the enzyme's thermostability, but an incomplete deletion with one repeat remaining did not change the thermostability. Although different C-terminal deletions affect the thermostability differently, they all increased the enzyme's affinity for starch. The possible reasons for the increased thermostability and substrate binding affinity, due to the removal of the four C-terminal glycine-rich repeats, are discussed in terms of the three-dimensional structure of beta-amylase.

  3. Full-fledged proteomic analysis of bioactive wheat amylase inhibitors by a 3-D analytical technique: Identification of new heterodimeric aggregation states.

    PubMed

    Zoccatelli, Gianni; Dalla Pellegrina, Chiara; Mosconi, Silvia; Consolini, Marica; Veneri, Gianluca; Chignola, Roberto; Peruffo, Angelo; Rizzi, Corrado

    2007-02-01

    Wheat proteinaceous alpha-amylase inhibitors (alpha-AIs) are increasingly investigated for their agronomical role as natural defence molecules of plants against the attack of insects and pests, but also for their effects on human health. The wheat genomes code for several bioactive alpha-AIs that share sequence homology, but differ in their specificity against alpha-amylases from different species and for their aggregation states. Wheat alpha-AIs are traditionally classified as belonging to the three classes of tetrameric, homodimeric and monomeric forms, each class being constituted by a number of polypeptides that display different electrophoretic mobilities. Here we describe a proteomic approach for the identification of bioactive alpha-AIs from wheat and, in particular, a 3-D technique that allows to best identify and characterize the dimeric fraction. The technique takes advantage of the thermal resistance of alpha-AIs (resistant to T > 70 degrees C) and consists in the separation of protein mixtures by 2-D polyacrylamide/starch electrophoresis under nondissociating PAGE (ND-PAGE, first dimension) and dissociating (urea-PAGE or U-PAGE second dimension) conditions, followed by in-gel spontaneous reaggregation of protein complexes and identification of the alpha-amylase inhibitory activity (antizymogram, third dimension) using enzymes from human salivary glands and from the larvae of Tenebrio molitor coleopter (yellow mealworm). Dimeric alpha-AIs from Triticum aestivum (bread wheat) were observed to exist as heterodimers. The formation of heterodimeric complexes was also confirmed by in vitro reaggregation assays carried out on RP-HPLC purified wheat dimeric alpha-AIs, and their bioactivity assayed by antizymogram analysis. The present 3-D analytical technique can be exploited for fast, full-fledged identification and characterization of wheat alpha-AIs.

  4. Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus.

    PubMed

    Wang, Shihui; Jeyaseelan, Jenasia; Liu, Yun; Qin, Wensheng

    2016-09-01

    The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

  5. Abdominal pain and a raised amylase? It's not always pancreatitis. . .

    PubMed

    Oluwatowoju, I O; Abu, O E; Lawson, G

    2013-01-01

    We report the case of a 72 year old man with a history of COPD and heavy alcohol consumption who was initially diagnosed with acute pancreatitis based on a presentation with epigastric pain and elevated serum amylase. Review of his notes revealed several previous similar admissions and extensive normal investigations apart from persistently elevated amylase. Further analysis showed evidence of macroamylasaemia which accounted for the apparently high serum amylase level.

  6. Structure of raw starch-digesting Bacillus cereus beta-amylase complexed with maltose.

    PubMed

    Mikami, B; Adachi, M; Kage, T; Sarikaya, E; Nanmori, T; Shinke, R; Utsumi, S

    1999-06-01

    The crystals of beta-amylase from Bacillus cereus belong to space group P21 with the following cell dimensions: a = 57.70 A, b = 92.87 A, c = 65.93 A, and beta =101.95 degrees. The structures of free and maltose-bound beta-amylases were determined by X-ray crystallography at 2.1 and 2.5 A with R-factors of 0.170 and 0.164, respectively. The final model of the maltose-bound form comprises 516 amino acid residues, four maltose molecules, 275 water molecules, one Ca2+, one acetate, and one sulfate ion. The enzyme consists of a core (beta/alpha)8-barrel domain (residues 5-434) and a C-terminal starch-binding domain (residues 435-613). Besides the active site in the core where two maltose molecules are bound in tandem, two novel maltose-binding sites were found in the core L4 region and in the C-terminal domain. The structure of the core domain is similar to that of soybean beta-amylase except for the L4 maltose-binding site, whereas the C-terminal domain has the same secondary structure as domain E of cyclodextrin glucosyltransferase. These two maltose-binding sites are 32-36 A apart from the active site. These results indicate that the ability of B. cereus beta-amylase to digest raw starch can be attributed to the additional two maltose-binding sites.

  7. Activated effect of lignin on α-amylase.

    PubMed

    Zhang, Juan; Cui, Jun-Hui; Yin, Tingting; Sun, Lizhou; Li, Genxi

    2013-12-01

    This paper reports a new kind of activator of α-amylase, lignin, which can greatly increase α-amylase activity. The promoted ratio of lignin is even much higher than that of chloride ion, the traditional activator of α-amylase. Further experimental results reveal that lignin may interact with α-amylase to form a 1:1 complex with a binding constant of 4.47×10(5) M(-1). The binding is spontaneous and lignin/α-amylase complex formation is an exothermal reaction. Hydrogen bonding plays a key role and non-radiation energy transfers from α-amylase to lignin in the binding process. Lignin, combining with α-amylase, conforms to a first-order exponential decay function. The formation of the lignin/α-amylase complex results in the reduction of α-helical content from 57.7% to 53.9%, the increase of the polarity around tryptophan residues, the decrease of the hydrophobicity, and the enlargement of protein granule volume. This work will give a deeper insight into lignin as a kind of dietary fibre, known as an important food functional factor. Furthermore, it also contributes to the exploration of an activator of α-amylase, used in the food industry.

  8. Thermal adaptation of α-amylases: a review.

    PubMed

    Hiteshi, Kalpana; Gupta, Reena

    2014-11-01

    The temperature adaptation of α-amylase can be gained by different adjustments in protein structure with consecutive effects on the stability and flexibility of the protein. In this review, meso, thermo and cold-active α-amylases have been compared with respect to their structure and intramolecular interactions. With decrease in temperature, the number of ionic interactions also decreases, leading to greater flexibility of proteins. It has also been observed that the proline and arginine content is higher in thermophilic amylases as compared to meso and psychrophilic amylases, increasing the rigidity and structural stability of protein molecule.

  9. Variation in amylase activities in radish (Raphanus sativus) cultivars.

    PubMed

    Hara, Masakazu; Ito, Fumio; Asai, Tatsuo; Kuboi, Toru

    2009-09-01

    The radish (Raphanus sativus) is a root vegetable of the Brassicaceae family which shows amylolytic activity in the taproot. However, there is little information about differences in these amylolytic activities among radish cultivars. We analyzed the amylase activities and starch contents of 7 kinds of radish cultivars. The Koshin cultivar showed the highest amylase activity, with a level approximately 6 times higher than that of the Sobutori cultivar, which had the lowest. Cultivars with higher amylase activities showed higher starch contents. These results suggest that there are intraspecies variations in amylolytic activities in radishes, and positive correlations between amylase activity and starch content.

  10. Serum Amylase in Bulimia Nervosa and Purging Disorder: Differentiating the Association with Binge Eating versus Purging Behavior

    PubMed Central

    Wolfe, Barbara E.; Jimerson, David C.; Smith, Adrian; Keel, Pamela K.

    2011-01-01

    Objective Elevated serum amylase levels in bulimia nervosa (BN), associated with increased salivary gland size and self-induced vomiting in some patients, provide a possible marker of symptom severity. The goal of this study was to assess whether serum hyperamylasemia in BN is more closely associated with binge eating episodes involving consumption of large amounts of food or with purging behavior. Method Participants included women with BN (n=26); women with “purging disorder” (PD), a subtype of EDNOS characterized by recurrent purging in the absence of objectively large binge eating episodes (n=14); and healthy non-eating disorder female controls (n=32). There were no significant differences in age or body mass index (BMI) across groups. The clinical groups reported similar frequency of self-induced vomiting behavior and were free of psychotropic medications. Serum samples were obtained after overnight fast and were assayed for alpha-amylase by enzymatic method. Results Serum amylase levels were significantly elevated in BN (60.7 ± 25.4 international units [IU]/liter, mean ± sd) in comparison to PD (44.7 ± 17.1 IU/L, p < 02) and to Controls (49.3 ± 15.8, p < .05). Conclusion These findings provide evidence to suggest that it is recurrent binge eating involving large amounts of food, rather than self-induced vomiting, which contributes to elevated serum amylase values in BN. PMID:21781981

  11. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    PubMed

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii.

  12. Maltal binding mechanism and a role of the mobile loop of soybean beta-amylase.

    PubMed

    Kunikata, T; Nishimura, S; Nitta, Y

    1996-07-01

    The inhibition of hydration of maltal (alpha-D-glucopyranosyl-(1-->4)-2-deoxy-D-glucal) catalyzed by soybean beta-amylase with 4-O-alpha-D-glucopyranosyl-(1-->4)-1-deoxynojirimycin (GDN) was investigated at 25 degrees C and at pH 5.4. As the concentrations of GDN used were comparable to that of the enzyme, Henderson's treatment was applied to this system. It was found that two maltal molecules bind to the enzyme according to a random mechanism and GDN inhibits the hydration of maltal competitively at subsites 1 and 2, and noncompetitively at the other site. On the basis of this result, it was inferred that the role of the mobile loop of this enzyme is to create a convenient catalytic environment for the hydration, and the closing of the active site by the mobile loop is induced by the binding of maltal.

  13. Production of amylase by Aspergillus foetidus on rice flour medium and characterization of the enzyme.

    PubMed

    Michelena, V V; Castillo, F J

    1984-06-01

    Aspergillus foetidus ATCC 10254 was selected from nine starch-utilizing microorganisms for its high amylolytic activity. This mould produced high levels of extracellular alpha-amylase in rice starch medium and degraded the available starch efficiently. Optimal conditions for enzyme production on 2.0% rice medium included 28 degrees C, initial pH of 6.6, and supplementations with 0.02% NaNO2, 0.08% KH2PO4, and 0.08% corn steep liquor. Eleven-fold purification of the enzyme was obtained after ammonium sulphate and ethanol precipitations from spent medium. The molecular weight was estimated at 41 500. Optimum pH and temperature for enzyme activity were 5.0 and 45 degrees C. Michaelis-Menten constants were 1.14 mg/ml on amylopectin, 2.19 mg/ml on soluble starch and 7.65 mg/ml on amylose. Amylose produced substrate inhibition while glucose or maltose did not inhibit the enzyme. This alpha-amylase may be used as a saccharifying enzyme for rice starch. Aspergillus foetidus ATCC 10254 also presents a potential for treatment of starch-containing waste waters.

  14. The Amylase Project: Creating a Classroom of Biotechnologists.

    ERIC Educational Resources Information Center

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  15. Mapping the intestinal alpha-glucogenic enzyme specificities of starch digesting maltase-glucoamylase and sucrase-isomaltase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inhibition of intestinal alpha-glucosidases and pancreatic alpha-amylases is an approach to controlling blood glucose and serum insulin levels in individuals with Type II diabetes. The two human intestinal glucosidases are maltase-glucoamylase and sucrase-isomaltase. Each incorporates two family 31 ...

  16. Modulation of starch digestion for slow glucose release through "toggling" of activities of mucosal "alpha"-glucosidases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch digestion involves the breakdown by alpha-amylase to small linear and branched malto-oligosaccharides, which are in turn hydrolyzed to glucose by the mucosal alpha-glucosidases, maltase-glucoamylase (MGAM) and sucrase-isomaltase (SI). MGAM and SI are anchored to the small intestinal brush-bor...

  17. Crystal structure of a maltotetraose-forming exo-amylase from Pseudomonas stutzeri.

    PubMed

    Morishita, Y; Hasegawa, K; Matsuura, Y; Katsube, Y; Kubota, M; Sakai, S

    1997-04-04

    The three-dimensional structure of an exo-type alpha-amylase from Pseudomonas stutzeri which degrades starch from its non-reducing end to produce maltotetraose has been determined by X-ray structure analysis. The catalytic domain of this enzyme (G4-2), whose structure was determined, is a product of spontaneous limited proteolysis in culture broth. It has 429 amino acid residues and a molecular mass of 47,200, and crystallizes in ammonium sulfate solution at pH 7.5. The structure was elucidated by the multiple isomorphous replacement method and refined at 2.0 A resolution, resulting in a final R-factor of 0.178 for significant reflections with a root-mean-square deviation from ideality in bond distances of 0.013 A. The polypeptide chain of this molecule folds into three domains; the first with a (beta/alpha)8 barrel structure, the second with an excursed part from the first one, and the third with five-stranded antiparallel beta-sheets. The active cleft is formed on the C-terminal side of the beta-sheets in the (beta/alpha)8 barrel as in the known endo-type alpha-amylases. A histidine side-chain nitrogen ND1 is coordinated to one of the bound calcium ion. The recognition site of the non-reducing end of the amylose that determines exo-wise degradation is presumed to be at one end of this cleft where there is a disordered loop consisting of the 66th to 72nd residues, and a loop carrying an aspartic acid (Asp160). These structural features may be responsible for the binding of the non-reducing end of the substrate amylose.

  18. α-Amylase inhibitory triterpene from Abrus precatorius leaves.

    PubMed

    Yonemoto, Ryuta; Shimada, Miyuki; Gunawan-Puteri, Maria D P T; Kato, Eisuke; Kawabata, Jun

    2014-08-20

    In the screening experiments for porcine pancreatic α-amylase inhibitors in 18 plants obtained from Indonesia, a potent inhibitory activity was detected in the extract of leaves of Abrus precatorius. The enzyme assay-guided fractionation of the extract led to the isolation of a triterpene ketone, lupenone (1), as a potent α-amylase inhibitor, together with 24-methylenecycloartenone (2) and luteolin (3). The mode of inhibition of compound 1 against porcine pancreatic α-amylase was a mixed inhibition. This is the first report that describes the potent α-amylase inhibitory activity of the low-polar triterpene ketone similar to compound 1. A comparison of the activities of the isolate and related compounds indicated the importance of C-3 ketone and the lupane skeleton in the α-amylase inhibitory activity.

  19. Purification and Characterization of a Highly Efficient Calcium-Independent α-Amylase from Talaromyces pinophilus 1-95

    PubMed Central

    Xian, Liang; Wang, Fei; Luo, Xiang; Feng, Yu-Liang; Feng, Jia-Xun

    2015-01-01

    Alpha-amylase is a very important enzyme in the starch conversion process. Most of the α-amylases are calcium-dependent and exhibit poor performance in the simultaneous saccharification and fermentation process of industrial bioethanol production that uses starch as feedstock. In this study, an extracellular amylolytic enzyme was purified from the culture broth of newly isolated Talaromyces pinophilus strain 1-95. The purified amylolytic enzyme, with an apparent molecular weight of 58 kDa on SDS-PAGE, hydrolyzed maltopentaose, maltohexaose, and maltoheptaose into mainly maltose and maltotriose and minor amount of glucose, confirming the endo-acting mode of the enzyme, and hence, was named Talaromyces pinophilus α-amylase (TpAA). TpAA was most active at pH 4.0–5.0 (with the temperature held at 37°C) and 55°C (at pH 5.0), and stable within the pH range of 5.0–9.5 (at 4°C) and below 45°C (at pH 5.0). Interestingly, the Ca2+ did not improve its enzymatic activity, optimal temperature, or thermostability of the enzyme, indicating that the TpAA was Ca2+-independent. TpAA displayed higher enzyme activity toward malto-oligosaccharides and dextrin than other previously reported α-amylases. This highly active Ca2+-independent α-amylase may have potential applications in starch-to-ethanol conversion process. PMID:25811759

  20. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    PubMed

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  1. Activity and storage of commercial amylases in the 2013 Louisiana grinding season

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A current problem in the application of amylases at sugarcane factories is the existence of a wide variation in the activities and activity per unit cost of commercial amylases. The efficiency of amylase action to break down starch in the factory is related to the activity of the amylase used. Until...

  2. Bacillus thuringiensis HCB6 Amylase Immobilization by Chitosan Beads

    NASA Astrophysics Data System (ADS)

    Zusfahair; Ningsih, D. R.; Kartika, D.; Fatoni, A.; Zuliana, A. L.

    2017-02-01

    The purpose of this study was to optimize the amylase immobilization using a chitosan bead and to characterize immobilized amylase of Bacillus thuringiensis Bacteria HCB6. This study was started of amylase production, continued by immobilization optimization including ratio of chitosan:enzymes, enzyme-matrix contact time, substrate concentration, pH effect, incubation temperature effect, reaction time, and stability of immobilized enzyme. Amylase activity assay was dinitro salicylic (DNS) method. The results showed the optimum chitosan:enzyme ratio was 2.5: 1 (v/v), immobilization contact time of 18 hours and immobilization efficiency of 87.93%. Furthermore, immobilized amylase of B. thuringiensis HCB6 showed optimum substrate concentration of 1.5%, optimum pH of 6, optimum incubation temperature of 37 ° C, and the reaction time of 30 minutes. The Michaelis-Menten constant KM value for free and immobilized amylase were 5.30% and 1.33% respectively. Immobilized amylase can be used up to five times with the remaining activity of 43.3%.

  3. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris*

    PubMed Central

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P.

    2015-01-01

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1–As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. PMID:26546678

  4. Characterisation of three starch degrading enzymes: thermostable β-amylase, maltotetraogenic and maltogenic α-amylases.

    PubMed

    Derde, L J; Gomand, S V; Courtin, C M; Delcour, J A

    2012-11-15

    Maltogenic α-amylase from Bacillus stearothermophilus (BStA) is widely used as bread crumb anti-firming enzyme. A maltotetraose-forming α-amylase from Pseudomonas saccharophila (PSA) was recently proposed as alternative, hence the need to compare both exo-acting enzymes with some endo-action component. A purely exo-acting thermostable β-amylase from Clostridium thermosulfurogenes (CTB) was included for reference purposes. Under the experimental conditions used, temperature optima of the enzymes are rather similar (60-65 °C), but temperature stability decreased in the order BStA, PSA and CTB. The action of the enzymes on different substrates and their impact on the rheological behaviour of maize starch suspensions demonstrated that, while CTB acts exclusively through an exo-action mechanism, BStA displayed limited endo-action which became more pronounced at higher temperatures. PSA has more substantial endo-action than BStA, which is rather temperature independent. This is important for their impact in processes such as breadmaking, where temperature is gradually increased.

  5. AmyM, a Novel Maltohexaose-Forming α-Amylase from Corallococcus sp. Strain EGB

    PubMed Central

    Li, Zhoukun; Wu, Jiale; Zhang, Biying; Wang, Fei; Ye, Xianfeng; Huang, Yan; Huang, Qiang

    2015-01-01

    A novel α-amylase, AmyM, was purified from the culture supernatant of Corallococcus sp. strain EGB. AmyM is a maltohexaose-forming exoamylase with an apparent molecular mass of 43 kDa. Based on the results of matrix-assisted laser desorption ionization–time of flight mass spectrometry and peptide mass fingerprinting of AmyM and by comparison to the genome sequence of Corallococcus coralloides DSM 2259, the AmyM gene was identified and cloned into Escherichia coli. amyM encodes a secretory amylase with a predicted signal peptide of 23 amino acid residues, which showed no significant identity with known and functionally verified amylases. amyM was expressed in E. coli BL21(DE3) cells with a hexahistidine tag. The signal peptide efficiently induced the secretion of mature AmyM in E. coli. Recombinant AmyM (rAmyM) was purified by Ni-nitrilotriacetic acid (NTA) affinity chromatography, with a specific activity of up to 14,000 U/mg. rAmyM was optimally active at 50°C in Tris-HCl buffer (50 mM; pH 7.0) and stable at temperatures of <50°C. rAmyM was stable over a wide range of pH values (from pH 5.0 to 10.0) and highly tolerant to high concentrations of salts, detergents, and various organic solvents. Its activity toward starch was independent of calcium ions. The Km and Vmax of recombinant AmyM for soluble starch were 6.61 mg ml−1 and 44,301.5 μmol min−1 mg−1, respectively. End product analysis showed that maltohexaose accounted for 59.4% of the maltooligosaccharides produced. These characteristics indicate that AmyM has great potential in industrial applications. PMID:25576603

  6. Inhibition of Sunn pest, Eurygaster integriceps, α-amylases by α-amylase inhibitors (T-αAI) from Triticale.

    PubMed

    Mehrabadi, Mohammad; Bandani, Ali R; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the K(m) remained constant (0.58%) but the maximum velocity (V(max)) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T(50)) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase.

  7. Inhibition of Sunn Pest, Eurygaster integriceps, α-Amylases by α-Amylase Inhibitors (T-αAI) from Triticale

    PubMed Central

    Mehrabadi, Mohammad; Bandani, Ali R.; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the Km remained constant (0.58%) but the maximum velocity (Vmax) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T50) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase. PMID:21062146

  8. Reasons for reduced activities of 17 alpha-hydroxylase and C17-C20 lyase in spite of increased contents of cytochrome P-450 in mature rat testis fetally irradiated with 60Co.

    PubMed

    Inano, H; Ishii-Ohba, H; Suzuki, K; Ikeda, K

    1990-05-01

    Pregnant rats received whole body irradiation with 2.6 Gy gamma-ray from a 60Co source at Day 20 of gestation. When pups were 4 months old, activities of electron transport system and steroid monooxygenase in tests were assayed. The content of total cytochrome P-450 in the irradiated testes had increased to 170% of that in non-irradiated rats, but NADPH-cytochrome P-450 reductase activity had reduced to 36% of the control. Also, amounts of cytochrome b5 in testicular microsomal fraction were decreased markedly after irradiation, but no significant change of NADH-cytochrome b5 reductase activity was observed in the treated pups. Because both 17 alpha-hydroxylase and C17-C20 lyase activities tended to be decreased by fetal irradiation, testosterone production from progesterone and 17 alpha-hydroxyprogesterone was reduced to about 30% of the control. From these results, it has been suggested that the testicular cytochrome P-450 is radioresistant but steroid monooxygenase activities are reduced after the fetal irradiation. We propose that the discrepancy arises from the marked decrement of NADPH-cytochrome P-450 reductase activity.

  9. Mature Teachers Matter

    ERIC Educational Resources Information Center

    Berl, Patricia Scallan

    2005-01-01

    In this article, the author discusses the consequences of losing mature teachers due to voluntary separation or retirement and the mindset of a mature teacher that is different from younger teachers in a number of ways. Mature teachers are colleagues over 45 years of age possessing significant experience in the field. Future trends in teacher…

  10. Cyclomaltodextrinase, neopullulanase, and maltogenic amylase are nearly indistinguishable from each other.

    PubMed

    Lee, Hee-Seob; Kim, Min-Sung; Cho, Hyun-Soo; Kim, Jung-In; Kim, Tae-Jip; Choi, Ji-Hye; Park, Cheonseok; Lee, Heung-Soo; Oh, Byung-Ha; Park, Kwan-Hwa

    2002-06-14

    Over 20 enzymes denoted as cyclomaltodextrinase, maltogenic amylase, or neopullulanase that share 40-86% sequence identity with each other are found in public data bases. These enzymes are distinguished from typical alpha-amylases by containing a novel N-terminal domain and exhibiting preferential substrate specificities for cyclomaltodextrins (CDs) over starch. In this research field, a great deal of confusion exists regarding the features distinguishing the three groups of enzymes from one another. Although a different enzyme code has been assigned to each of the three different enzyme names, even a single differentiating enzymatic property has not been documented in the literature. On the other hand, an outstanding question related to this issue concerns the structural basis for the preference of these enzymes for CDs. To clarify the confusion and to address this question, we have determined the structures of two enzymes, one from alkalophilic Bacillus sp. I-5 and named cyclomaltodextrinase and the other from a Thermus species and named maltogenic amylase. The structure of the Bacillus enzyme reveals a dodecameric assembly composed of six copies of the dimer, which is the structural and functional unit of the Thermus enzyme and an enzyme named neopullulanase. The structure of the Thermus enzyme in complex with beta-CD led to the conclusion that Trp47, a well conserved N-terminal domain residue, contributes greatly to the preference for beta-CD. The common dimer formation through the novel N-terminal domain, which contributes to the preference for CDs by lining the active-site cavity, convincingly indicates that the three groups of enzymes are not different enough to preserve the different names and enzyme codes.

  11. [Amylases of the fungus Aspergillus flavipes associated with Fucus evanescens].

    PubMed

    Frolova, G M; Sil'chenko, A S; Pivkin, M V; Mikhaĭlov, V V

    2002-01-01

    A promising producer of extracellular amylases, Aspergillus flavipes, was selected from 245 strains of marine fungi. Depending on the conditions of growth, this strain produced diverse amylolytic complexes. When grown on medium containing peptone and yeast extract (pH 7.0), A. flavipes synthesized three forms of amylase, differing in pH optimum (5.5, 6.0, and 7.5). A single form of the enzyme was synthesized either in the absence of peptone from the medium or at the initial pH value of the medium, equal to 8.6. The activity of the isolated amylase forms decreased in the presence of proteolytic enzymes. New, highly stable forms of amylase (with pH optima of 5.5 and 7.5 and maximum activity at 60-80 degrees C) were synthesized in the presence of diisopropyl fluorophosphate, an inhibitor of proteases.

  12. Synthesis and processing in Escherichia coli of human leucocyte interferon fused with the signal sequence of Bacillus amyloliquefaciens a-amylase

    SciTech Connect

    Sorokin, A.V.; Avakov, A.S.; Bogush, V.G.; Kostrov, S.V.; Gaiga, G.Z.; Iomantas, Yu.V.; Abalakina, E.G.; Stepanov, A.I.; Strongin, A.Ya.; Kozlov, Yu.I.; Debabov, V.G.

    1985-11-01

    Earlier, the authors reported cloning of the alpha-amylase gene of B. amyloliquefaciens in B. subtilis and E. coli. Currently, the authors report results on the expression of the hybrid gene consisting of the DNA fragment coding for the leader part of B. amyloliquefaciens alpha-amylase and the structural part of the human interferon alpha-2 in E. coli cells. This gene contains an additional methionine codon at the 5'-terminal, which codes for the interferon structure (without its own signal peptide). The interferon gene was inserted into plasmid /sub p/TG 278 at the cleavage site of EcoRI. The structure of the plasmid thus obtained the signal peptide of amylase, five amino acids (Val-Gly-Glu-Phe-Met), and the structural part of the interferon. The E. coli C600 cells carrying plasmid pTGA6 were used to study interferon secretions. The interferon activity was determined radioimmunologically with the use of monoclonal anti-bodies NK2.

  13. [Peritoneal mesothelioma with elevated amylase in the ascitic fluid].

    PubMed

    Carrión, A; Jover, R; Carnicer, F; García, M F; Aranda, F I; Martínez, J F; Griñó

    1995-03-01

    The case of a 42-year-old woman with no previous disease admitted for abdominal pain and ascites is presented. Analysis of the ascitic fluid demonstrated high concentrations of amylase with normal lipase. The diagnosis of peritoneal mesothelioma was obtained by laparotomy. This association has not been previously described. The authors suggest that this diagnostic possibility should be considered in patients without pancreatic disease and high amylase levels in ascitic fluid.

  14. Inhibition of Porcine Pancreatic Amylase Activity by Sulfamethoxazole: Structural and Functional Aspect.

    PubMed

    Maity, Sujan; Mukherjee, Koel; Banerjee, Amrita; Mukherjee, Suman; Dasgupta, Dipak; Gupta, Suvroma

    2016-06-01

    Combating Type-2 diabetes mellitus is a pivotal challenge in front of the present world. Several lines of therapy are in practice for resisting this deadly disease which often culminates with cardiovascular complexities, neuropathy and retinopathy. Among various therapies, administration of alpha glucosidase inhibitors is common and widely practiced. Sulfonylurea category of anti diabetic drug often suffers from cross reactivity with sulfamethoxazole (SMX), a common drug in use to treat a handful of microbial infections. However the specific cellular target generating postprandial hypoglycemia on SMX administration is till date unraveled. The present work has been initiated to elucidate the effects of a group of sulfonamide drugs inclusive of SMX for their amylase inhibitory role. SMX inhibits porcine pancreatic amylase (PPA) in a noncompetitive mode with an average IC50 value 0.94 mM respectively. Interaction of SMX with PPA is manifested with gradual quenching of tryptophan fluorescence with concomitant shift in lambda max value (λmax). Binding is governed by entropy driven factor (24.8 cal mol(-1) K(-1)) with unfavorable contribution from enthalpy change. SMX interferes with the activity of acarbose in a synergistic mode to reduce the effective dose of acarbose as evident from the in vitro PPA inhibition study. In summary, loss of PPA activity in presence of SMX is indicative of structural changes of PPA which is further augmented in the presence of acarbose as explained in the schematic model and docking study.

  15. Bean amylase inhibitor and other carbohydrate absorption blockers: effects on diabesity and general health.

    PubMed

    Preuss, Harry G

    2009-06-01

    Many believe that excessive intake of refined carbohydrates (CHO) plays a major role in the development of obesity/overweight, type 2 diabetes mellitus and insulin resistance, a collection of events commonly referred to as "diabesity," and have sought natural means to overcome these linked perturbations. As a first approach, planned diets with low portions of refined CHO have become popular. However, these diets do not satisfy everyone; and many are concerned over replacing CHO with more fats. As a second option, addition of soluble fiber to the diet can slow absorption of refined CHO, i.e., lower the glycemic index of foods and overcome or at least ameliorate many of the adverse reactions resulting from increased refined CHO ingestion. Unfortunately, the general public does not favor diets high in fiber content, and various fibers can lead to gastrointestinal problems such as gas and diarrhea. A third choice to favorably influence CHO absorption is to use natural dietary supplements that block or slow CHO absorption in the gastrointestinal tract via inhibiting enzymes necessary for CHO absorption -amylase and alpha-glucosidases. Although a number of natural supplements with anti-amylase activity have been recognized, the most studied and favored one is white kidney bean extract. Animal and human studies clearly show that this agent works in vivo and has clinical utility. This paper reviews many aspects of diabesity and the use of "carb blockers" to prevent and ameliorate the situation. In many respects, carb blockers mimic the beneficial effects of fibers.

  16. Electrophoretic amylase fractionation as an aid in diagnosis of pancreatic disease.

    PubMed

    Legaz, M E; Kenny, M A

    1976-01-01

    Six alpha-amylase (EC 3.2.1.1) isoenzymes have been resolved electrophoretically on cellulose acetate membranes in a discontinuous buffer system. The fastest migrating isoenzymes are of salivary origin (S1, S2, S3), the slower ones of pancreatic origin (P1, P2, P3). We determined the amylase isoenzyme distribution in the sera of 240 subjects. A specific pancreatic isoenzyme (P3) was observed in all clinically diagnosed cases of acute or chronic pancreatitis as well as in 15 of 40 renal-transplant patients. Moreover, P3 isoenzyme activity declined during apparent recovery from pancreatitis. The P2 isoenzyme appeared in 95% of all specimens, P1 in only 2%. The pancreatic isoenzymes were preferentially excreted in the urine of both renal-transplant patients and normal individuals. The major salivary isoenzyme, S1, was observed in 95% of all serum and urine samples; however, the S2 and S3 appeared less consistently. Our method is simple and rapid, and quite applicable for use in clinical evaluation of patients with pancreatitis or with certain nonpancreatic dysfunctions.

  17. Extracellular Transglucosylase and α-Amylase of Streptococcus equinus1

    PubMed Central

    Boyer, Ernest W.; Hartman, Paul A.

    1971-01-01

    Culture filtrates of Streptococcus equinus 1091 contained α-amylase and transglucosylase. The effects of calcium carbonate, age of inoculum, concentration of maltose, and duration of the fermentation on α-amylase and transglucosylase production were determined. The extracellular α-amylase was purified 48-fold and was free of transglucosylase activity. The α-amylase (amylose substrate) required Cl− for maximum activity; ethylenediaminetetraacetic acid (EDTA) partially inhibited activity, but CaCl2 prevented EDTA inhibition. The temperature optimum was 38 C at pH 7.0, and the pH optimum was 7.0 at 37 C in the presence of CaCl2. Predominant final products of amylose hydrolysis, in order of decreasing prevalence, were maltose, maltotriose, maltotetraose, and glucose. The α-amylase showed no evidence of multiple attack. The extracellular transglucosylase was purified 27-fold, but a small amount of α-amylase remained. Transglucosylase activity (amylose substrate) was not increased in the presence of CaCl2. The temperature optimum was 37 C at pH 6.5, and the pH optimum was 6.0 at 37 C. Carbohydrates that served as acceptors for the transglucosylase to degrade amylose were, in order of decreasing acceptor efficiency: d-glucose, d-mannose, l-sorbose, maltose, sucrose, and trehalose. The extracellular transglucosylase of S. equinus 1091 synthesized higher maltodextrins in the medium when the cells were grown in the presence of maltose. Images PMID:4995651

  18. [Purification and characterization of thermostable amylases from two bacterial species].

    PubMed

    Dong, Yongcun; Liu, Yang; Chen, Yuanyuan; Niu, Dandan; Zhang, Liang; Shi, Guiyang; Wang, Zhengxiang

    2008-02-01

    Two thermophilic bacterial isolates, strain 173 and strain 174, with raw starch-digesting activities were selected from thermophilic bacteria growing in hot spring of Tengchong County, Yunnan Province, China. By amplification, sequencing and alignment analysis of 16S ribosomal DNAs, they were identified as members of genus Geobacillus. In shaker flask culture Geobacillus sp. 173 produced 14.5 U/mL amylase and for Geobacillus sp. 174 with 12.9 U/mL. Both amylases were purified by starch absorption-desorption and chromatograph. The amylases from strain 173 and strain 174 purified to about 50 and 29 folds were respectively achieved with an overall yield of 34% and 41%. The maximum gelatinized-starch-digesting activity of the purified amylases were at 70 degrees C and pH 5.0 - 5.5. The high raw-starch-digesting activity of these enzymes were observed at 50 degrees C - 60 degrees C (from strain 173) and 40 degrees C - 60 degrees C (from strain 174). Both enzymes were not sensitive to ions including mental ions (Na+, K+, Mg2+, Ca2+, Mn2+, Zn2+) and others (EDTA, Citrate), but were slightly inhibited by ions such as Co2+, Cu2+ for amylase from strain 173 and Cu2+ for amylase from strain 174. Both enzyme had specificity of starch substrates.

  19. Contribution of mucosal maltase-glucoamylase activities to mouse small intestinal starch alpha-glucogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Digestion of starch requires activities provided by 6 interactive small intestinal enzymes. Two of these are luminal endo-glucosidases named alpha-amylases. Four are exo-glucosidases bound to the luminal surface of enterocytes. These mucosal activities were identified as 4 different maltases. Two ma...

  20. Adsorption of amylase enzyme on ultrafiltration membranes.

    PubMed

    Beier, Søren Prip; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios M; Hansen, Ernst B; Jonsson, Gunnar

    2007-08-28

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of amylase-F has been measured on two different ultrafiltration membranes, both with a cutoff value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-modified PVDF membrane). The adsorption follows the Langmuir adsorption theory. Thus, the static adsorption consists of monolayer coverage and is expressed both as a permeability drop and an adsorption resistance. From the adsorption isotherms, the maximum static permeability drops and the maximum static adsorption resistances are determined. The maximum static permeability drop for the hydrophobic PES membrane is 75%, and the maximum static adsorption resistance is 0.014 m2.h.bar/L. The maximum static permeability drop for the hydrophilic surface-modified PVDF membrane (ETNA10PP) is 23%, and the maximum static adsorption resistance is 0.0046 m2.h.bar/L. The difference in maximum static adsorption, by a factor of around 3, affects the performance during the filtration of a 5 g/L amylase-F solution at 2 bar. The two membranes behave very similarly during filtration with almost equal fluxes and retentions even though the initial water permeability of the PES membrane is around 3 times larger than the initial water permeability of the ETNA10PP membrane. This is mainly attributed to the larger maximum static adsorption of the PES membrane. The permeability drop during filtration exceeds the maximum static permeability drop, indicating that the buildup layer on the membranes during filtration exceeds monolayer coverage, which is also seen by the increase in fouling resistance during filtration. The accumulated layer on the membrane surface can be described as a continually increasing cake-layer thickness, which is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects cannot be neglected. Therefore, stagnant film theory and the osmotic

  1. Mechanism of maltal hydration catalyzed by. beta. -amylase: Role of protein structure in controlling the steric outcome of reactions catalyzed by a glycosylase

    SciTech Connect

    Kitahata, Sumio ); Chiba, S. ); Brewer, C.F.; Hehre, E.J. )

    1991-07-09

    Crystalline (monomeric) soybean and (tetrameric) sweet potato {beta}-amylase were shown to catalyze the cis hydration of maltal ({alpha}-D-glucopyranosyl-2-deoxy-D-arabino-hex-1-enitol) to form {beta}-2-deoxymaltose. As reported earlier with the sweet potato enzyme, maltal hydration in D{sub 2}O by soybean {beta}-amylase was found to exhibit an unusually large solvent deuterium kinetic isotope effect (V{sub H}/V{sub D}=6.5), a reaction rate linearly dependent on the mole fraction of deuterium, and 2-deoxy-(2(a)-{sup 2}H)maltose as product. These results indicate (for each {beta}-amylase) that protonation is the rate-limiting step in a reaction involving a nearly symmetric one-proton transition state and that maltal is specifically protonated from above the double bond. That maltal undergoes cis hydration provides evidence in support of a general-acid-catalyzed, carbonium ion mediated reaction. Of fundamental significance is that {beta}-amylase protonates maltal from a direction opposite that assumed for protonating strach, yet creates products of the same anomeric configuration from both. Such stereochemical dichotomy argues for the overriding role of protein structures is dictating the steric outcome of reactions catalyzed by a glycosylase, by limiting the approach and orientation of water or other acceptors to the reaction center.

  2. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    PubMed

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species.

  3. Alpha Blockers

    MedlinePlus

    ... conditions such as high blood pressure and benign prostatic hyperplasia. Find out more about this class of medication. ... these conditions: High blood pressure Enlarged prostate (benign prostatic hyperplasia) Though alpha blockers are commonly used to treat ...

  4. Alpha fetoprotein

    MedlinePlus

    ... Alpha fetoprotein - series References Cunningham FG, Leveno KJ, Bloom SL, et al. Prenatal diagnosis and fetal therapy. In: Cunningham FG, Leveno KJ, Bloom SL, et al, eds. Williams Obstetrics . 23rd ed. ...

  5. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  6. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    PubMed

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.