Science.gov

Sample records for maturity alpha amylase

  1. [The polymorphism of alpha-amylase].

    PubMed

    Baltova, S; Popov, K; Kynchev, V

    1990-01-01

    Individual phenotypes, phenotypic and genetic frequencies of alpha-amylase enzyme were determined by means of population genetic study. The results of this study revealed absence of genetic linkage between alpha-amylase phenotypes, haptoglobins and serum factor G1m(1) of gammaglobulin system (Gm).

  2. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  3. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  4. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  5. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  6. Bakers' asthma caused by alpha amylase.

    PubMed

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  7. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  8. Additive-dominance genetic model analyses for late-maturity alpha-amylase activity in a bread wheat factorial crossing population.

    PubMed

    Rasul, Golam; Glover, Karl D; Krishnan, Padmanaban G; Wu, Jixiang; Berzonsky, William A; Ibrahim, Amir M H

    2015-12-01

    Elevated level of late maturity α-amylase activity (LMAA) can result in low falling number scores, reduced grain quality, and downgrade of wheat (Triticum aestivum L.) class. A mating population was developed by crossing parents with different levels of LMAA. The F2 and F3 hybrids and their parents were evaluated for LMAA, and data were analyzed using the R software package 'qgtools' integrated with an additive-dominance genetic model and a mixed linear model approach. Simulated results showed high testing powers for additive and additive × environment variances, and comparatively low powers for dominance and dominance × environment variances. All variance components and their proportions to the phenotypic variance for the parents and hybrids were significant except for the dominance × environment variance. The estimated narrow-sense heritability and broad-sense heritability for LMAA were 14 and 54%, respectively. High significant negative additive effects for parents suggest that spring wheat cultivars 'Lancer' and 'Chester' can serve as good general combiners, and that 'Kinsman' and 'Seri-82' had negative specific combining ability in some hybrids despite of their own significant positive additive effects, suggesting they can be used as parents to reduce LMAA levels. Seri-82 showed very good general combining ability effect when used as a male parent, indicating the importance of reciprocal effects. High significant negative dominance effects and high-parent heterosis for hybrids demonstrated that the specific hybrid combinations; Chester × Kinsman, 'Lerma52' × Lancer, Lerma52 × 'LoSprout' and 'Janz' × Seri-82 could be generated to produce cultivars with significantly reduced LMAA level.

  9. On the mechanism of alpha-amylase.

    PubMed

    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique

    2003-10-01

    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  10. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  11. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  12. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  13. Characterization of alpha-amylase inhibitor from Palo Fierro seeds.

    PubMed

    Guzman-Partida, A M; Jatomea-Fino, O; Robles-Burgueño, M R; Ortega-Nieblas, M; Vazquez-Moreno, L

    2007-09-01

    Alpha amylase inhibitor from Palo Fierro seeds (alphaAI-PF) was purified using affinity chromatography on a fetuin-fractogel column followed by anionic exchange chromatography. AlphaAI-PF has a molecular mass of 77kDa with two subunits (15.8 and 17.4 kDa), it is nonglycosylated and has pI of 4.7. AlphaAI-PF inhibited porcine pancreatic alpha-amylase (PPA) (1,4-alpha-D-glucan glucanohydrolase; EC 3.2.1.1), but was almost devoid of inhibitory activity on alpha-amylase extracts from Zabrotes subfasciatus (ZSA). Analysis of alphaAI-PF peptides showed a high homology to alphaAI-1 from Phaseolus vulgaris that also inhibits PPA.

  14. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza

    2016-01-01

    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  15. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    2000-07-01

    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

  16. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.

    PubMed

    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R

    2002-10-23

    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry.

  17. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  18. Alpha-amylase supplementation of broiler diets based on corn.

    PubMed

    Gracia, M I; Araníbar, M J; Lázaro, R; Medel, P; Mateos, G G

    2003-03-01

    A 42-d trial was conducted to study the influence of exogenous alpha-amylase on digestive and performance traits in broilers fed a corn-soybean meal diet. There were two treatments (control and alpha-amylase supplemented diet) and six replicates (14 Cobb male chicks caged together) per treatment. At 7 d of age, alpha-amylase supplementation improved daily gain by 9.4% (P < or = 0.05) and feed conversion by 4.2% (P < or = 0.01). At the end of the trial, birds fed the alpha-amylase-supplemented diet ate more and grew faster (P < or = 0.05) and hadbetter feed conversion (P < or = 0.10) than broilers fed the control diet. Also, alpha-amylase supplementation improved apparent fecal digestibility of organic matter and starch (P < or = 0.01) and AMEn of the diet (P < or = 0.001). However, no effects were detected for CP or fat digestibility. Nutrient digestibility and AMEn of the diet increased with age (P < or = 0.001); however, no interactions of alpha-amylase x age were observed for any trait. Coefficients of apparent ileal and fecal digestibility of starch at 28 d of age were similar, which indicated that most of the undigested starch was not fermented in the hindgut of the chick. alpha-Amylase supplementation reduced relative pancreas weight (P < or = 0.001) but did not affect the weight of the remaining organs. Age consistently reduced intestinal viscosity and relative weights of all the organs (P < or = 0.001). The data indicated that alpha-amylase supplementation of a corn-soybean meal diet improved digestibility of nutrients and performance of broilers.

  19. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  20. Some studies of alpha-amylase production using Aspergillus oryzae.

    PubMed

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S

    2008-11-15

    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164.

  1. [Alpha-amylase polymorphism. 1. A comparative study of alpha-amylase Hp and Gm].

    PubMed

    Baltova, S; Popov, K; Kŭnchev, V

    1989-01-01

    Individual phenotypes, phenotypical and genetic frequencies of the alpha-amylase enzyme have been established by means of populational genetic researches. The most common phenotype is AmylA Amyl2A (85.15%) followed by AmylA Amyl2A 2B (6.27%), AmylAIB Amyl2A (5.37%), Amyl IA Amyl2A 2B (2.15%), AmylA Amyl2B (0.53%), AmylC Amyl2B (0.35%), AmylC Amyl2A 2B (0.18%). The difference between the observed and theoretically expected phenotypes of Amy, Hp and M Gm(1) is insignificant. The examined contingent from the Bulgarian population is found to be in genetic balance. Statistical analysis of the reuö results does not prove a genetic link between Amy, Hp and Gm (1).

  2. Cloning and expression of a chicken alpha-amylase gene.

    PubMed

    Benkel, B F; Nguyen, T; Ahluwalia, N; Benkel, K I; Hickey, D A

    1997-06-19

    We have isolated and sequenced a genomic clone for a pancreatic alpha-amylase gene (amy) of the chicken (Gallus gallus). The gene is interrupted by nine introns, spans over 4 kb, and encodes a protein (AMY) of 512 aa that is 83% identical to the human pancreatic alpha-amylase enzyme. Southern blot analysis of chicken DNA revealed two distinct pancreatic amy loci. In addition, we have generated a cDNA from chicken pancreatic RNA corresponding to the coding sequence of the genomic clone. The cDNA was inserted into a yeast expression vector, and the resulting construct used to transform Saccharomyces cerevisiae cells. Transformed yeast cells synthesized and secreted active AMY enzyme, and the gel migration pattern of the alpha-amylase produced by the yeast cells was identical to that of the native chicken enzyme.

  3. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  4. Magnetic alginate microparticles for purification of alpha-amylases.

    PubMed

    Safaríková, M; Roy, I; Gupta, M N; Safarík, I

    2003-11-06

    Spherical magnetic alginate microparticles (25-60 microm in diameter) were prepared using the microemulsion system, with water-saturated 1-pentanol as the organic phase. The limited solubility of 1-pentanol in water enabled simple removal of the organic solvent from the prepared beads with water solution. The prepared alginate microparticles were used as magnetic affinity adsorbents for specific purification of alpha-amylases. Enzyme activity was eluted by 1.0 M maltose. alpha-Amylases from Bacillus amyloliquefaciens and porcine pancreatic acetone powder were purified 9- and 12-fold with 88 and 96% activity recovery, respectively.

  5. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].

    PubMed

    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K

    1982-11-01

    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  6. Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein

    SciTech Connect

    Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. )

    1993-04-01

    Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

  7. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  8. Optimization of alpha-amylase application in raw sugar manufacture

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentration sin raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  9. Sugar modulation of alpha-amylase genes under anoxia.

    PubMed

    Loreti, Elena; Yamaguchi, Junji; Alpi, Amedeo; Perata, Pierdomenico

    2003-01-01

    Tolerance to low oxygen availability is likely to be due to the interaction of several factors. Sugar availability is one of the elements required to support anaerobic metabolism. In cereal grains the availability of soluble sugars is limited, while starch is stored in large amounts. Degradation of starch under anoxia is therefore needed to avoid sugar starvation leading to rapid cell death. The striking difference in the ability to produce alpha-amylase when comparing the anoxia-tolerant rice (Oryza sativa L.) grains with grains of other cereals is not easily explained. Rice is able to respond to gibberellins under anoxia, but the response is too slow to explain the rapid production of alpha-amylase enzyme. In the present work we demonstrated that alpha-amylase production during the first 2 d after imbibition is mostly due to the activity of the Ramy3D gene, encoding for the G and H isoforms of alpha-amylase. The induction of Ramy3D transcription is likely to result from a low sugar content in the grains incubated under anoxia. The ability of rice embryos to sense sugars under anoxia is reported.

  10. Synthesis and secretion of wheat alpha-amylase in Saccharomyces cerevisiae.

    PubMed

    Rothstein, S J; Lahners, K N; Lazarus, C M; Baulcombe, D C; Gatenby, A A

    1987-01-01

    A wheat alpha-amylase cDNA clone has been fused to the phosphoglycerate kinase initiator methionine to enable synthesis in the yeast Saccharomyces cerevisiae of an alpha-amylase enzyme that is identical in size to the wild-type alpha-amylase. The alpha-amylase is synthesized with an N-terminal plant signal peptide which is recognized in the yeast host, leading to efficient processing and secretion into the medium. The secretion of alpha-amylase into the medium is quite efficient in rich medium, but barely detectable in a minimal medium.

  11. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    PubMed

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  12. New substrate specificity of modified porcine pancreatic alpha-amylase.

    PubMed

    Ishikawa, K; Hirata, H

    1989-08-01

    Conversion of the substrate specificity of porcine pancreatic alpha-amylase (PPA) was studied using chemical modification of His residues. Diethyl pyrocarbonate modified His residues in PPA and the activity of the modified PPA for the hydrolysis of the alpha-D-(1,4)glucoside bond in starch or oligosaccharides decreased to less than 1% of that of the native enzyme. However, the activity for the hydrolysis of the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides was increased by chemical modification. When the modified PPA was incubated with a proteinaceous alpha-amylase inhibitor (Mr 60,000) purified from white kidney bean (Phaseolus vulgaris), it bound to the inhibitor. As a result, the remaining less than 1% hydrolytic activity of the modified PPA for starch disappeared completely but that for p-nitrophenyl oligosaccharides remained unaltered. The hydrolytic activity of the native PPA for the alpha-D-(1,4)glucoside bond in oligosaccharides was stronger than that between p-nitrophenyl and oligosaccharides in p-nitrophenyl oligosaccharides. Therefore, when p-nitrophenyl oligosaccharides (three to five glucose residues) were used as substrates for the native PPA, the alpha-D-(1,4)glucoside bonds in the oligosaccharides were hydrolyzed. However, the modified PPA-inhibitor complex hydrolyzed only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides. The above results reveal that, by chemical modification with diethyl pyrocarbonate and biochemical modification with an amylase inhibitor, amylase can be converted to a new exo-type enzyme which hydrolyzes only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides.

  13. Immunochemical relationship between alpha-amylases of rat liver, serum, pancreas and parotid gland.

    PubMed Central

    Messer, M; Dean, R T

    1975-01-01

    1. Rabbit antisera to purified rat parotid alpha-amylase were prepared. 2. The relationships between rat parotid-gland, pancreatic, serum and liver amylase were investigated by using the antisera in immunodiffusion, immunoelectrophoresis and immunoinhibition experiments. 3. Serum and liver amylase were identical, and very similar to parotid-gland amylase; pancreatic amylase was, however, quite distinct, and showed only some of the determinants present on parotid-gland amylase. 4. The data strengthen the suggestion that the liver is the main source of serum amylase. Images PLATE 1 PLATE 2 PLATE 3 PMID:55120

  14. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds.

    PubMed

    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B

    2008-09-01

    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature.

  15. The alpha-amylase from the yellow meal worm: complete primary structure, crystallization and preliminary X-ray analysis.

    PubMed

    Strobl, S; Gomis-Rüth, F X; Maskos, K; Frank, G; Huber, R; Glockshuber, R

    1997-06-02

    The alpha-amylase from Tenebrio molitor larvae (TMA) was purified from a crude larval extract. After removal of the N-terminal pyroglutamate residue and identification of the following 17 residues by Edman sequencing, the cDNA of mature TMA was cloned from larval mRNA. The encoded enzyme consists of 471 amino acid residues and has 57-79% sequence identity to other insect alpha-amylases and also shows high homology to the mammalian enzymes. TMA was crystallized in form of well-ordered orthorhombic crystals of space group P2(1)2(1)2(1) diffracting beyond 1.6 A resolution with unit cell dimensions of a = 51.24 A, b = 93.46 A, c = 96.95 A. TMA may serve as model system for the future analysis of interactions between insect alpha-amylase and proteinaceous plant inhibitors on the molecular level.

  16. A circularly permuted alpha-amylase-type alpha/beta-barrel structure in glucan-synthesizing glucosyltransferases.

    PubMed

    MacGregor, E A; Jespersen, H M; Svensson, B

    1996-01-15

    A motif of amino acid residues, located at the active site and specific beta-strands in alpha-amylases, is recognized in alpha-1,3- and alpha-1,6-glucan-synthesizing glucosyltransferases, leading to the conclusion that these enzymes contain an alpha/beta-barrel closely related to the (beta/alpha)8-fold of the alpha-amylase superfamily. The secondary structure elements of the transferase barrel, however, are circularly permuted to start with an alpha-helix equivalent to helix 3 in the alpha-amylases. Thus, the transferase counterpart of the long third beta-->alpha connection--constituting a domain in the alpha-amylases--is divided to precede and succeed the barrel. This architectural arrangement may be coupled to sucrose scission and glucosyl transfer. The involvement in the mechanism in glucosyltransferases of active site residues recurring in amylolytic enzymes is discussed.

  17. [The contribution of different alpha-amylase isoenzymes of the commodity grain spring wheat in the formation of falling number values].

    PubMed

    Mamytova, N S; Kuzovlev, V A; Khakimzhanov, A A; Fursov, O V

    2014-01-01

    The participation of various isoenzymes of alpha-amylase in the formation of falling number values of the commodity grain of wheat grown in the Republic of Kazakhstan was investigated. It was found that active isoenzymes alpha-AMY1 and alpha-AMY2 of the embryonic shield were present in the grain with an index over 200. A significant decrease in the falling number depended mainly on the synthesis of alpha-AMY1 and alpha-AMY2 isoenzymes in the aleurone layer. In the grain, isoenzymes with high isoelectric points (p1 > or = 7.3) were found; these isoenzymes belong to alpha-amylase or late maturing or alpha-amylase of practically mature grains. It was discovered that the exogenous hormone (gibberellic acid) induced synthesis of alpha-amylase isoenzymes of scutellum, whole caryopses, and aleurone. It was shown that the impact of exogenous gibberellic acid on the activity and structure of alpha-amylase is reduced in grain with a low falling number.

  18. Crystal and molecular structure of barley alpha-amylase.

    PubMed

    Kadziola, A; Abe, J; Svensson, B; Haser, R

    1994-05-27

    The three-dimensional structure of barley malt alpha-amylase (isoform AMY2-2) was determined by multiple isomorphous replacement using three heavy-atom derivatives and solvent flattening. The model was refined using a combination of simulated annealing and conventional restrained least-squares crystallographic refinement to an R-factor of 0.153 based on 18,303 independent reflections with F(o) > sigma(F(o)) between 10 and 2.8 A resolution, with root-mean-square deviations of 0.016 A and 3.3 degrees from ideal bond lengths and bond angles, respectively. The final model consists of 403 amino acid residues, three calcium ions and 153 water molecules. The polypeptide chain folds into three domains: a central domain forming a (beta alpha)8-barrel of 286 residues, with a protruding irregular structured loop domain of 64 residues (domain B) connecting strand beta 3 and helix alpha 3 of the barrel, and a C-terminal domain of 53 residues forming a five stranded anti-parallel beta-sheet. Unlike the previously known alpha-amylase structures, AMY2-2 contains three Ca2+ binding sites co-ordinated by seven or eight oxygen atoms from carboxylate groups, main-chain carbonyl atoms and water molecules, all calcium ions being bound to domain B and therefore essential for the structural integrity of that domain. Two of the Ca2+ sites are located only 7.0 A apart with one Asp residue serving as ligand for both. One Ca2+ site located at about 20 A from the other two was found to be exchangeable with Eu3+. By homology with other alpha-amylases, some important active site residues are identified as Asp179, Glu204 and Asp289, and are situated at the C-terminal end of the central beta-barrel. A starch granule binding site, previously identified as Trp276 and Trp277, is situated on alpha-helix 6 in the central (beta alpha)8-barrel, at the surface of the enzyme. This binding site region is associated with a considerable disruption of the (beta alpha)8-barrel 8-fold symmetry.

  19. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.

    PubMed

    Svensson, B

    1994-05-01

    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  20. The predominantly nonhydrolytic action of alpha amylases on alpha-maltosyl fluoride.

    PubMed

    Okada, G; Genghof, D S; Hehre, E J

    1979-06-01

    Crystalline alpha amylases from a number of sources utilized alpha-maltosyl fluoride as a glycosyl donor and acceptor at high rates (approximately 10 to approximately 1550 mumol/min/mg of protein, for 30 mM substrate). All enzymes catalyzed conversion of this compound into maltooligosaccharides in preference to causing its hydrolysis. Maltotetraosyl flouride and maltooligosaccharides of d.p. 3 to 6+ accounted for 75--93% (by weight) of early reaction-products. At a late stage, the yield of maltooligosaccharides was 2--5 times that of maltose, with chains as long as 12 D-glucosyl residues formed by one amylase (from Asp. oryzae), which utilized alpha-maltosyl fluoride as a donor and as an acceptor at extremely high rates. These results indicate that alpha amylases have a substantial capacity for binding two molecules of this small substrate in a distinctive way, with the C--F glycosylic bond of one and the free C-4 hydroxyl group of the other located in the region of the enzyme's catalytic groups, therby favoring glycosylation of the suitably positioned acceptor over solvent water. Hydrolysis is assumed to prevail when only a single substrate molecule or segment binds to alpha amylase with a (1 linked to 4)-alpha-D-glucosidic linkage of glycosylic C--F bond positioned at the catalytic center. The present demonstration that glycosyl-transfer reactions can be dominantly expressed by alpha amylases, given an appropriate substrate, illustrates the inadequacy of the usual characterization of these enzymes as hydrolases that produce overwhelming hydrolysis of all substrates.

  1. alpha-Amylase: an ideal representative of thermostable enzymes.

    PubMed

    Prakash, Om; Jaiswal, Nivedita

    2010-04-01

    The conditions prevailing in the industrial applications in which enzymes are used are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand to improve the stability of enzymes and to meet the requirements set by specific applications. In this respect, thermostable enzymes have been proposed to be industrially relevant. In this review, alpha-amylase, a well-established representative of thermostable enzymes, providing an attractive model for the investigation of the structural basis of thermostability of proteins, has been discussed.

  2. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.

    PubMed

    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S

    2010-04-01

    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing.

  3. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  4. Interactions of alpha-amylase and calcium chelator during neutral detergent fiber analysis.

    PubMed

    Brougher, Daniel S; Oleas, Telmo B; Kohn, Richard A

    2005-07-13

    Amylase and calcium chelators, such as disodium ethylene diaminotetraacetate (EDTA), are used in analysis of neutral detergent fiber (NDF) to dissolve starch and pectin, respectively. However, these reagents may interfere with each other's activity. Six combinations of alpha-amylase and EDTA were examined for determining NDF values of beet pulp (Beta vulgaris), ground corn (Zea mays L.), timothy hay (Phleum pratense), and soybean meal (Glycine max L). For treatment A, 2.5 mL of alpha-amylase was added 5 min after boiling. Other treatments differed as follows: (B) 4.5 mL of alpha-amylase, (C) 4.5 mL of alpha-amylase added 30 min after boiling, (D) delayed addition of EDTA to 30 min after boiling, (E) no EDTA, and (F) no alpha-amylase. Inclusion of EDTA interfered with amylase activity in corn grain samples, and addition of amylase to beet pulp and soybean meal samples reduced the effectiveness of EDTA and increased ash in the NDF residue. Amylase should not be used for samples that do not contain starch. Calculating NDF on an ash-free basis minimized the negative effects of amylase on EDTA activity.

  5. Genetic analyses using GGE model and a mixed linear model approach, and stability analyses using AMMI bi-plot for late-maturity alpha-amylase activity in bread wheat genotypes.

    PubMed

    Rasul, Golam; Glover, Karl D; Krishnan, Padmanaban G; Wu, Jixiang; Berzonsky, William A; Fofana, Bourlaye

    2017-06-01

    Low falling number and discounting grain when it is downgraded in class are the consequences of excessive late-maturity α-amylase activity (LMAA) in bread wheat (Triticum aestivum L.). Grain expressing high LMAA produces poorer quality bread products. To effectively breed for low LMAA, it is necessary to understand what genes control it and how they are expressed, particularly when genotypes are grown in different environments. In this study, an International Collection (IC) of 18 spring wheat genotypes and another set of 15 spring wheat cultivars adapted to South Dakota (SD), USA were assessed to characterize the genetic component of LMAA over 5 and 13 environments, respectively. The data were analysed using a GGE model with a mixed linear model approach and stability analysis was presented using an AMMI bi-plot on R software. All estimated variance components and their proportions to the total phenotypic variance were highly significant for both sets of genotypes, which were validated by the AMMI model analysis. Broad-sense heritability for LMAA was higher in SD adapted cultivars (53%) compared to that in IC (49%). Significant genetic effects and stability analyses showed some genotypes, e.g. 'Lancer', 'Chester' and 'LoSprout' from IC, and 'Alsen', 'Traverse' and 'Forefront' from SD cultivars could be used as parents to develop new cultivars expressing low levels of LMAA. Stability analysis using an AMMI bi-plot revealed that 'Chester', 'Lancer' and 'Advance' were the most stable across environments, while in contrast, 'Kinsman', 'Lerma52' and 'Traverse' exhibited the lowest stability for LMAA across environments.

  6. Parallel beta/alpha-barrels of alpha-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase versus the barrel of beta-amylase: evolutionary distance is a reflection of unrelated sequences.

    PubMed

    Janecek, S

    1994-10-17

    The structures of functionally related beta/alpha-barrel starch hydrolases, alpha-amylase, beta-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, are discussed, their mutual sequence similarities being emphasized. Since these enzymes (except for beta-amylase) along with the predicted set of more than ten beta/alpha-barrels from the alpha-amylase enzyme superfamily fulfil the criteria characteristic of the products of divergent evolution, their unrooted distance tree is presented.

  7. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  8. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  9. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    PubMed Central

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also contain a 5.4-kb HindIII fragment of DNA. Cloning experiments with the four plasmids yielded alpha-amylase-producing E. coli that contained the same 9.7-kb chimeric plasmid. Restriction endonuclease analysis and further recombinant DNA experiments identified a 26-kb plasmid that contains the gene for alpha-amylase. A spontaneous mutant of B. stearothermophilus unable to produce alpha-amylase was missing the 26-kb plasmid but contained a 20-kb plasmid. A 6-kb deletion within the region of the 5.4-kb HindIII fragment yielded the 20-kb plasmid unable to code for alpha-amylase. A nick-translated probe for the alpha-amylase coding region did not hybridize to either plasmid or total cellular DNA from this mutant strain of B. stearothermophilus. These results demonstrate the gene for alpha-amylase is located exclusively on a 26-kb plasmid in B. stearothermophilus with no genetic counterpart present on the chromosome. Images PMID:6193526

  10. Alpha-amylase activity from the halophilic archaeon Haloferax mediterranei.

    PubMed

    Pérez-Pomares, F; Bautista, V; Ferrer, J; Pire, C; Marhuenda-Egea, F C; Bonete, M J

    2003-08-01

    The halophilic archaeon Haloferax mediterranei is able to grow in a minimal medium containing ammonium acetate as a carbon and nitrogen source. When this medium is enriched with starch, alpha-amylase activity is excreted to the medium in low concentration. Here we report methods to concentrate and purify the enzyme. The relative molecular mass of the enzyme, determined by gel filtration, is 50 +/- 4 kDa, and on SDS-PAGE analysis a single band appeared at 58 kDa. These results indicated that the halophilic alpha-amylase is a monomeric enzyme. The enzyme showed a salt requirement for both stability and activity, being stable from 2 to 4 M NaCl, with maximal activity at 3 M NaCl. The enzyme displayed maximal activity at pHs from 7 to 8, and its optimal temperature was in a range from 50 degrees C to 60 degrees C. The results also implicated several prototropic groups in the catalytic reaction.

  11. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    PubMed Central

    Wan, Cynthia; Couture-Lalande, Marie-Ève; Narain, Tasha A.; Lebel, Sophie; Bielajew, Catherine

    2016-01-01

    The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39) = 17.95, p < 0.001 and F (1, 37) = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes. PMID:27023572

  12. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  13. Structure activity relationships of flavonoids as potent alpha-amylase inhibitors.

    PubMed

    Yuan, Erdong; Liu, Benguo; Wei, Qingyi; Yang, Jiguo; Chen, Lei; Li, Qiong

    2014-08-01

    The effects of three flavonoids (quercetin, luteolin, diosmetin) on alpha-amylase were examined by enzymatic kinetics and fluorescence spectroscopy. The three test flavonoids were non-competitive inhibitors of the enzyme. Addition of flavonoids led to fluorescence quenching of alpha-amylase. The quenching was initiated from the formation of a complex between the flavonoids and the enzyme, corresponding to a static quenching process. An alpha-amylase molecule provides a binding site for the test flavonoid. The main binding force was hydrophobic. The decreasing order of inhibition of alpha-amylase by flavonoids and the binding force was luteolin, diosmetin, and quercetin. It is demonstrated that hydroxylation in ring C and methylation of the hydroxyl group in ring B of flavonoids may weaken the binding affinities to alpha-amylase.

  14. Induction of digestive alpha-amylases in larvae of Zabrotes subfasciatus (Coleoptera: Bruchidae) in response to ingestion of common bean alpha-amylase inhibitor 1.

    PubMed

    Silva, C P.; Terra, W R.; de Sá, M F.G.; Samuels, R I.; Isejima, E M.; Bifano, T D.; Almeida, J S.

    2001-11-01

    Zabrotes subfasciatus larvae possess three alpha-amylase isoforms determined by in gel assays following SDS-PAGE. Two minor isoforms present lower electrophoretic mobility than the major form. When developed inside Vigna unguiculata (cowpea) seeds, fourth instar larvae have minor quantities of the slow-migrating isoforms, but when reared on seeds of Phaseolus vulgaris (common bean), the two slow-migrating forms are expressed in higher amounts, whilst the quantity of the major constitutive form is independent of the host bean. Larvae at the beginning of the fourth instar were fed on flour or cotyledons of cowpea and common bean and it was observed that the larvae fed on the common bean expressed the two slow-migrating forms in higher amounts when compared to the control larvae fed on cowpea. In order to investigate the possible correlation between the induction of alpha-amylases and the ingestion of the common bean alpha-amylase inhibitor 1 (alphaAI-1), this inhibitor was incorporated into artificial diet. It was observed that larvae fed on diet containing chronic doses of alphaAI-1 during their development, produced the two slow-migrating forms in higher amounts than control larvae, however, fourth-instar larvae fed on the same diet presented less amylase activity than control larvae. The data suggested that alphaAI-1 is involved in amylase induction and that it has inhibitory activity against the constitutive amylase, when starch granules are used as substrate.

  15. Crystal structure determination and inhibition studies of a novel xylanase and alpha-amylase inhibitor protein (XAIP) from Scadoxus multiflorus.

    PubMed

    Kumar, Sanjit; Singh, Nagendra; Sinha, Mau; Dube, Divya; Singh, S Baskar; Bhushan, Asha; Kaur, Punit; Srinivasan, Alagiri; Sharma, Sujata; Singh, Tej P

    2010-07-01

    A novel plant protein isolated from the underground bulbs of Scadoxus multiflorus, xylanase and alpha-amylase inhibitor protein (XAIP), inhibits two structurally and functionally unrelated enzymes: xylanase and alpha-amylase. The mature protein contains 272 amino acid residues which show sequence identities of 48% to the plant chitinase hevamine and 36% to xylanase inhibitor protein-I, a double-headed inhibitor of GH10 and GH11 xylanases. However, unlike hevamine, it is enzymatically inactive and, unlike xylanase inhibitor protein-I, it inhibits two functionally different classes of enzyme. The crystal structure of XAIP has been determined at 2.0 A resolution and refined to R(cryst) and R(free) factors of 15.2% and 18.6%, respectively. The polypeptide chain of XAIP adopts a modified triosephosphate isomerase barrel fold with eight beta-strands in the inner circle and nine alpha-helices forming the outer ring. The structure contains three cis peptide bonds: Gly33-Phe34, Tyr159-Pro160 and Trp253-Asp254. Although hevamine has a long accessible carbohydrate-binding channel, in XAIP this channel is almost completely filled with the side-chains of residues Phe13, Pro77, Lys78 and Trp253. Solution studies indicate that XAIP inhibits GH11 family xylanases and GH13 family alpha-amylases through two independent binding sites located on opposite surfaces of the protein. Comparison of the structure of XAIP with that of xylanase inhibitor protein-I, and docking studies, suggest that loops alpha3-beta4 and alpha4-beta5 may be involved in the binding of GH11 xylanase, and that helix alpha7 and loop beta6-alpha6 are suitable for the interaction with alpha-amylase.

  16. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    PubMed Central

    Kuhn, H; Fietzek, P P; Lampen, J O

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis. PMID:6172418

  17. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  18. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  19. Liver alpha-amylase gene expression as an early obesity biomarker.

    PubMed

    Mojbafan, Marzieh; Afsartala, Zohreh; Amoli, Mahsa M; Mahmoudi, Mahdi; Yaghmaei, Parichehreh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2017-04-01

    Obesity is a major health problem worldwide, for which preventive and therapeutic means are still needed. Alpha-amylase is a digestive enzyme whose inhibition has been targeted as a potential anti-obesity strategy. However, alpha-amylase gene expression has not been particularly attended to, and in contrast with pancreatic and salivary amylases, fewer studies have focused on liver alpha-amylase. The present study aimed at investigating the expression of alpha-amylase gene in obese and normal mice at RNA and protein level as well as acarbose effect on this gene expression in hepatocyte cell culture. Control and case groups were fed by normal mouse pellet and high-fat diet respectively, during 8 weeks. After this period, serum biochemical parameters including glucose, cholesterol, triglycerides, AST, ALT and alpha-amylase were assayed. Liver alpha-amylase gene was analyzed by real time PCR, and liver enzyme was assayed with Bernfeld and ELISA methods Hepatocyte cell culture derived from both group were also treated by acarbose and alpha-amylase activity and gene expression was analyzed by above mentioned methods. All biochemical factors showed an increase in obese mice, but the increase in ALT and AST were not statistically significant. Alpha-amylase levels were also increased in obese mice, both at RNA and protein level, while a decrease was seen in obese mice derived hepatocytes after acarbose treatment. Elevated liver alpha-amylase levels may be indicative of initial stages of obesity and the use of acarbose could be considered as a treatment of obesity which could be potentially effective at multiple levels. Copyright © 2016. Published by Elsevier Urban & Partner Sp. z o.o.

  20. Inhibition of alpha-glucosidase and amylase by bartogenic acid isolated from Barringtonia racemosa Roxb. seeds.

    PubMed

    Gowri, P Mangala; Tiwari, Ashok K; Ali, A Zehra; Rao, J Madhusudana

    2007-08-01

    Barringtonia racemosa presents a wide range of therapeutic applications. In the course of identifying bioactives from Indian medicinal plants it was observed that the hexane, ethanol and methanol extracts of B. racemosa seeds displayed potent yeast and intestinal alpha-glucosidase inhibitory activities. The methanol extract was found to be superior among them. However, none of the extracts exhibited pancreatic alpha-amylase inhibitory activity, rather the ethanol and methanol extracts accelerated the alpha-amylase enzyme activity. Interestingly, however, bartogenic acid isolated from the methanol extract inhibited alpha-amylase also. This is the first report identifying alpha-glucosidase inhibitory activity in B. racemosa seed extracts and assigning to bartogenic acid an alpha-glucosidase and amylase inhibitory property. The presence of bartogenic acid in B. racemosa seeds as a major compound is also reported for the first time in this communication. (c) 2007 John Wiley & Sons, Ltd.

  1. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    PubMed

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  2. Effects of infrared radiation, solar cooking and microwave cooking on alpha-amylase inhibitor in sorghum (Sorghum bicolor L.).

    PubMed

    Mulimani, V H; Supriya, D

    1994-10-01

    Three domestic cooking methods were studied in alpha-amylase inhibitory activity in sorghum grains. In all the treatments, overnight soaked seeds lost amylase inhibitory activity much faster. All the three treatments reduced the inhibitory activity. Use of solar cooker for reducing amylase inhibitory activity works out very economically and efficiently. Microwave cooking eliminates amylase inhibitory activity within 5 minutes.

  3. Ca-binding to Bacillus licheniformis alpha-amylase (BLA).

    PubMed

    Nazmi, Ali Reza; Reinisch, Timm; Hinz, Hans-Jürgen

    2006-09-01

    Ca-induced renaturation of Bacillus licheniformis alpha-amylase in the presence of urea has been employed to determine the binding constants of the ion. The native enzyme is folded at 3M urea while the Ca-depleted protein is largely unfolded at this denaturant concentration. Refolding of the protein has been monitored by circular dichroism and the titration curves have been analyzed assuming a model of three independent binding sites. The stoichiometry has been taken from X-ray studies. The refolded protein exhibits a secondary structure that is similar but not identical to that of the native protein. The binding constants have been used to construct a phase diagram that illustrates the contribution of Ca-binding to the resistance against urea unfolding.

  4. Optimization of alpha-amylase immobilization in calcium alginate beads.

    PubMed

    Ertan, Figen; Yagar, Hulya; Balkan, Bilal

    2007-01-01

    alpha-Amylase enzyme was produced by Aspergillus sclerotiorum under SSF conditions, and immobilized in calcium alginate beads. Effects of immobilization conditions, such as alginate concentration, CaCl(2) concentration, amount of loading enzyme, bead size, and amount of beads, on enzymatic activity were investigated. Optimum alginate and CaCl(2) concentration were found to be 3% (w/v). Using a loading enzyme concentration of 140 U mL(-1), and bead (diameter 3 mm) amount of 0.5 g, maximum enzyme activity was observed. Beads prepared at optimum immobilization conditions were suitable for up to 7 repeated uses, losing only 35% of their initial activity. Among the various starches tested, the highest enzyme activity (96.2%) was determined in soluble potato starch hydrolysis for 120 min at 40 degrees C.

  5. A quantitative assessment of the importance of barley seed alpha-amylase, beta-amylase, debranching enzyme, and alpha-glucosidase in starch degradation.

    PubMed

    Sun, Z T; Henson, C A

    1991-02-01

    Extracts of germinated barley (Hordeum vulgare L.) seeds of 41 different genotypes were analyzed for their activities of alpha-amylase, beta-amylase, alpha-glucosidase, and debranching enzyme and for their abilities to hydrolyze boiled soluble starch, nonboiled soluble starch, and starch granules extracted from barley seeds with water. Linear correlation analysis, used to quantitate the interactions between the seven parameters, revealed that boiled soluble starch was not a good substrate for predicting activities of enzymes functioning in in vivo starch hydrolysis as the extracts' abilities to hydrolyze boiled soluble starch was not correlated with their abilities to hydrolyze native starch granules. Activities of alpha-amylase and alpha-glucosidase were positively and significantly correlated with the seed extracts' abilities to hydrolyze all three starches. beta-Amylase was only significantly correlated with hydrolysis of boiled soluble starch. No significant correlations existed between debranching enzyme activity and hydrolysis of any of the three starches. Interactions between the four enzymes as they functioned together to hydrolyze the three types of starch were evaluated by path coefficient analysis. alpha-Amylase contributed to hydrolyses of all three starches primarily by its direct effect (noninteractive component). This direct contribution increased as the substrate progressed from the completely artificial boiled soluble starch, to the most physiologically significant substrate, native starch granules. alpha-Glucosidase contributed to the hydrolysis of boiled soluble starch primarily by its direct effect (noninteractive) yet contributed to starch granule hydrolysis primarily via its interaction with alpha-amylase (indirect effect). The contribution of beta-amylase to hydrolysis of boiled soluble starch was direct and it did not contribute significantly to hydrolysis of native starch granules.

  6. Experimental approach to optimize the use of alpha-Amylases in breadmaking.

    PubMed

    Rosell, C M; Haros, M; Escrivá, C; Benedito De Barber, C

    2001-06-01

    alpha-Amylases from different origins (wheat, malted barley, fungi, and bacteria) are used extensively to improve breadmaking. However, the enzyme activities, in addition to the differences associated with their origins, are strongly affected by the process conditions and the presence of other compounds in the medium. The activity of different alpha-amylases was tested under different conditions (pH and temperature), and in the presence of some bread ingredients (salt and sugar), some breadmaking additives (ascorbic acid and sodium propionate), and some metabolites (organic acids and saccharides) generated during the fermentation step, to envisage the behavior of these alpha-amylases during the breadmaking process. The alpha-amylase activities were affected to a different extent by the addition of these compounds depending on the enzyme origin. In general, the alpha-amylases from cereals (wheat and malted barley) were less sensitive to the presence of some ingredients, additives, and metabolites. These results show the great variation of the alpha-amylase activity with the process conditions and the importance of its knowledge in the selection of the appropriate alpha-amylase for a specific breadmaking process.

  7. [Comparison between alpha-amylase from B. amyloliquefaciens and B. licheniformis].

    PubMed

    Maassen, A

    1991-01-01

    Two sequence-homologous alpha-amylases from B. amyloliquefaciens and B. licheniformis were studied with respect to their stability against heat denaturation and were compared with respect to common structure-stabilizing principles. The investigated alpha-amylases were isolated from culture broth of B. amyloliquefaciens and B. licheniformis. The molecular parameters (molecular weight and isoelectric point) are similar. The thermostability was determined by changes of the protein structure (changes of the fluorescence emission spectra). At pH 5.0 the thermostable alpha-amylase from B. licheniformis showed a rate of denaturation which was achieved by the thermolabile alpha-amylase from B. amyloliquefaciens at a temperature 15 degrees lower. The alpha-amylase from B. licheniformis exhibits a marked stability also at the alkaline pH-range in contrast to the alpha-amylase from B. amyloliquefaciens. From measurements in the presence of EDTA and Ca2+ follows that both enzymes are stabilized by binding of calcium ions. An analysis of preferred amino acid exchanges between the two sequence-homologous alpha-amylases showed correspondences and differences to the well-known diagram of ARGOS. Possibly an increased thermic stability can already be achieved by special amino acid exchanges without significant changes in the protein structure.

  8. Hormonal Regulation of alpha-Amylase Gene Transcription in Wild Oat (Avena fatua L.) Aleurone Protoplasts.

    PubMed

    Zwar, J A; Hooley, R

    1986-02-01

    The time of appearance and relative amounts of alpha-amylase mRNA in wild oat (Avena fatua L.) aleurone protoplasts incubated with 1 micromolar gibberellin A(4) (GA(4)) were closely correlated with the amounts of alpha-amylase enzyme secreted by the protoplasts. In the absence of GA(4), or when protoplasts were incubated with 25 micromolar abscisic acid (ABA) together with 1 micromolar GA(4) no alpha-amylase mRNA was detected and only very low levels of alpha-amylase were secreted. Nuclei were isolated in high yields (65-71%) from aleurone protoplasts and in an in vitro transcription system displayed characteristics of a faithful DNA-dependent RNA synthesizing system. The time course of incorporation of [(3)H]-UTP suggested that the RNA synthesized was mainly ;run off' transcription and therefore that the transcripts produced in vitro were those being synthesized in the protoplasts at the times when the nuclei were isolated. By hybridizing in vitro synthesized [(32)P]RNA to barley alpha-amylase cDNA and control filters we have estimated that 90 +/- 10 ppm of the transcripts synthesized by nuclei isolated from GA(4) treated protoplasts can be attributed to alpha-amylase sequences and that statistically insignificant amounts of these transcripts are obtained from control and GA(4) plus ABA treatments. The results suggest that GA(4) and ABA influence the transcription of alpha-amylase genes in aleurone protoplasts of wild oat.

  9. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    DTIC Science & Technology

    2011-04-01

    Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...stress-related conditions. The findings suggest that measuring salivary α- amylase levels may help to determine a Soldier’s resilience or risk of

  10. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  11. Alpha-amylase production is induced by sulfuric acid in rice aleurone cells.

    PubMed

    Mitsunaga, Shin-ichiro; Kobayashi, Midori; Fukui, Satoe; Fukuoka, Kayoko; Kawakami, Osamu; Yamaguchi, Junji; Ohshima, Masahiro; Mitsui, Toshiaki

    2007-12-01

    The hydrolytic enzyme alpha-amylase (EC 3.2.1.1) is produced mainly in aleurone cells of germinating cereals, and the phytohormone gibberellin (GA) is essential for its induction. However, in rice (Oryza sativa L.), sulfuric acid (H(2)SO(4)) induces alpha-amylase production in aleurone tissue even in the absence of GA. Here, the pre-treatment of rice aleurone cells with H(2)SO(4) and incubation in water induced alpha-amylase activity, as if the cells had been incubated in GA solution.

  12. Capillary electrophoresis as a screening tool for alpha amylase inhibitors in plant extracts

    PubMed Central

    Hamdan, Imad I.; Afifi, Fatima U.

    2010-01-01

    Capillary electrophoresis (CE) method was developed for screening plant extract for potential alpha amylase (AA) inhibitory activity. The method was validated against a well established UV method. Overall, the proposed method was shown able to detect plants with significant alpha amylase inhibitory activity but not those with rather clinically insignificant activities. Fifty plant species were screened using both the proposed CE method and the UV method and seven plant species were found to possess significant AA inhibitory activities. Two plant species were proved to have alpha amylase inhibitory activity for the first time. PMID:24115900

  13. [Study of the effect of Pb2+ on alpha-amylase activity by spectroscopy].

    PubMed

    Hong, Fa-shui

    2003-06-01

    The activity of alpha-amylase from porcine pancreas was enhanced under the treatment by Pb2+ at low concentration (0.5-4 mumol.L-1), but was inhibited by Pb2+ at high concentration (above 4 mumol.L-1). Pb2+ at high concentration could competitively displace Ca2+ from alpha-amylase. The EXAFS demonstrated that Pb2+ was bound to the active site of alpha-amylase, the coordination atom was oxygen, the coordination number was 2, and the Pb-O bond length was 0.234 nm. Circular dichroism spectra showed that the secondary structure of trypsin was greatly changed by Pb2+ at high concentration, as alpha-helix, beta-turn and random coil contents decreased, while beta-sheet, aromatic and disulfide bond contents increased. It was suggested that Pb2+ was bound to result in an alpha-amylase conformational change, and the enzyme activity decreased.

  14. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  15. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  16. Alpha-amylase kinetic test in bodily single and mixed stains.

    PubMed

    Barni, Filippo; Berti, Andrea; Rapone, Cesare; Lago, Giampietro

    2006-11-01

    Recently, in Italy, a murder and a putative sexual violence was accomplished on a child. A bodily fluids mixture on the child's underwear between the victim (female) and the suspect (male) was ascertained by short tandem repeat (STR) DNA typing and, due to the absence of seminal fluid, saliva from the suspect and urine from the child was hypothesized. In order to investigate the possibility of specifically and rapidly detecting saliva stains both alone and mixed with other bodily fluids, we used a quantitative spectrophotometric technique, named Amylase test, for the detection of alpha-amylases. We determined alpha-amylase activity and reaction kinetic curves in several samples collected from the child's underwear. In order to confirm our intuition, we first tested saliva, perspiration, and urine, singularly and in mixtures; second, several forensic stains including saliva, perspiration, urine stains, saliva/perspiration, and saliva/urine mixture stains were tested. Evaluating alpha-amylase activity values and time-course curves' behavior of alpha-amylase reactions we were able to recognize successfully, in all cases, the presence of saliva and to distinguish it specifically from other bodily fluids containing alpha-amylase. A further confirmation of our result was provided by STR DNA typing on several areas of the underwear: a clear correlation between alpha-amylases activity and male DNA was detected on all the samples evaluated.

  17. Digestive alpha-amylases from Tecia solanivora larvae (Lepidoptera: Gelechiidae): response to pH, temperature and plant amylase inhibitors.

    PubMed

    Valencia-Jiménez, A; Arboleda, J W; López Avila, A; Grossi-de-Sá, M F

    2008-12-01

    The biochemical properties of the digestive alpha-amylase from Tecia solanivora larvae, an important and invasive insect pest of potato (Solanum tuberosum), were studied. This insect has three major digestive alpha-amylases with isoelectric points 5.30, 5.70 and 5.98, respectively, which were separated using native and isoelectric focusing gels. The alpha-amylase activity has an optimum pH between 7.0 and 10.0 with a peak at pH 9.0. The enzymes are stable when heated to 50 degrees C and were inhibited by proteinaceous inhibitors from Phaseolus coccineus (70% inhibition) and P. vulgaris cv. Radical (87% inhibition) at pH 6.0. The inhibitors present in an amaranth hybrid inhibited 80% of the activity at pH 9.0. The results show that the alpha-amylase inhibitor from amaranth seeds may be a better candidate to make genetically-modified potatoes resistant to this insect than inhibitors from common bean seeds.

  18. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  19. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].

    PubMed

    Avdiiuk, K V; Varbanets', L D

    2013-01-01

    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  20. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.

    PubMed

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  1. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  2. Adolescents' increasing stress response to social evaluation: pubertal effects on cortisol and alpha-amylase during public speaking.

    PubMed

    van den Bos, Esther; de Rooij, Mark; Miers, Anne C; Bokhorst, Caroline L; Westenberg, P Michiel

    2014-01-01

    Stress responses to social evaluation are thought to increase during adolescence, which may be due to pubertal maturation. However, empirical evidence is scarce. This study is the first to investigate the relation between pubertal development and biological responses to a social-evaluative stressor longitudinally. Participants performed the Leiden Public Speaking Task twice, with a 2-year interval (N = 217; age at Time 1: 8-17 years). The results support an increase in sensitivity to social evaluation during adolescence. The overall cortisol and alpha-amylase responses increased-both between and within participants-and were more strongly related to self-reported pubertal development than to age. The cortisol response shifted from speech delivery toward anticipation. The alpha-amylase response increased in both phases.

  3. Transport of alpha-amylase across the basolateral membrane of the pancreatic acinar cell.

    PubMed Central

    Isenman, L D; Rothman, S S

    1977-01-01

    The flux of alpha-amylase (1,4-alpha-D-glucan glucanohydrolase; EC 3.2.1.1) across the basolateral membrane of the acinar cell was measured in the cell-to-bath direction using the whole rabbit pancreas in organ culture. This in vitro preparation is polarized so that apical and basolateral secretions can be collected separately. The unstimulated amylase flux from cell to bath was substantial at the initial rate (approximately three times the concurrent apical flux). With time, bath amylase approached a steady-state concentration, suggesting an equilbrating process. During the same time interval, ductal amylase secretion remained constant. At the steady state, the amylase concentration in the bath was at least an order of magnitude less than its ductal concentration. Hourly replacement of bathing medium reproduced the initial rate of amylase release into the bath for five consecutive hours. Pancreozymin (cholecystokinin), a peptide hormone, did not alter the steady-state bath amylase content, although it greatly augmented ductal amylase secretion. In contrast, a cholinergic agonist greatly increased both the flux from the cell to bath and the ductal secretion of amylase. Taken together, these results indicate a natural bidirectional permeability of the basolateral membrane to digestive enzyme and support evidence previously obtained suggesting that such a permeability might exist. PMID:302947

  4. Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch

    SciTech Connect

    Fujii, M.; Kawamura, Y.

    1985-03-01

    Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

  5. A functional raw starch-binding domain of barley alpha-amylase expressed in Escherichia coli.

    PubMed

    Tibbot, B K; Wong, D W; Robertson, G H

    2000-11-01

    The mature form of barley seed low-pI alpha-amylase (BAA1) possesses a raw starch-binding site in addition to the catalytic site. A truncated cDNA encoding the C-terminal region (aa 281-414) and containing the proposed raw starch-binding domain (SBD) but lacking Trp278/Trp279, a previously proposed starch granule-binding site, was synthesized via PCR and expressed in Escherichia coli as an N-terminal His-Tag fusion protein. SBD was produced in the form of insoluble inclusion bodies that were extracted with urea and successfully refolded into a soluble form via dialysis. To determine binding, SBD was purified by affinity chromatography with cycloheptaamylose as ligand cross-linked to Sepharose. This work demonstrates that a SBD is located in the C-terminal region and retains sufficient function in the absence of the N-terminal, catalytic, and Trp278/279 regions.

  6. Skin-prick tests for hypersensitivity to alpha-amylase preparations.

    PubMed

    Moneo, I; Alday, E; Sanchez-Agudo, L; Curiel, G; Lucena, R; Calatrava, J M

    1995-06-01

    Twenty-five asthmatic subjects with suspected alpha-amylase hypersensitivity were studied by skin-prick tests, a capture ELISA, immunoblotting and bronchial provocation tests. At the same time, different amylases were analysed by SDS-PAGE and immunoblotting using a polyclonal rabbit antiserum. Eight patients showed a positive bronchial response to amylase. Seven of them had positive skin-prick tests, with this method being the most sensitive approach for diagnosis. However, in four cases, skin tests were also positive although the patients had a negative provocation test, thus demonstrating that skin tests are not specific. ELISA and blotting showed similar results in terms of sensitivity and specificity. The enzymes used by the workers included several antigens besides alpha-amylase. The rabbit antiserum to alpha-amylase detected a protein in a wheat flour extract. In one case, the IgE antibodies were specific only for a contaminant of lower molecular weight than amylase. These facts suggest that proteins from the culture medium could be responsible for some cases of amylase hypersensitivity, making the diagnosis difficult. The presence of amylase in another enzymatic extract, a protease produced by Aspergillus oryzae, was proved by means of skin tests and immunoblotting, thus demonstrating the allergenic properties of this enzymatic preparation.

  7. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    PubMed

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants. © 2015 International Union of Biochemistry and Molecular Biology.

  8. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  9. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    PubMed

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  10. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  11. Control of alpha-Amylase Development in Cotyledons during and following Germination of Mung Bean Seeds.

    PubMed

    Morohashi, Y; Katoh, H; Kaneko, Y; Matsushima, H

    1989-09-01

    Developmental patterns of alpha-amylase in Vigna radiata cotyledons during and following germination were quite different depending on the differences in the treatments of cotyledons during the imbibitional stage. When axis-detached cotyledons were imbibed in water with seed-coats attached, alpha-amylase activity did not increase and remained low. On the other hand, when the cotyledons were imbibed in water after seed-coat removal, the enzyme activity increased markedly. If the axis was attached to the cotyledons, alpha-amylase showed a marked development even under the former imbibition conditions. These changes in the enzyme activity were in parallel with those in the enzyme content, and the content, in turn, was dependent upon the availability of mRNA for alpha-amylase. We propose that the regulation of the development of alpha-amylase in cotyledons may involve some factor(s) inhibitory to accumulation of alpha-amylase mRNA, which is present in dry cotyledons and can be removed from cotyledons by leakage or by the presence of the axis.

  12. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.

    PubMed

    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul

    2009-10-31

    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  13. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.

    PubMed

    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho

    2002-09-01

    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  14. alpha-Amylase is not required for breakdown of transitory starch in Arabidopsis leaves.

    PubMed

    Yu, Tien-Shin; Zeeman, Samuel C; Thorneycroft, David; Fulton, Daniel C; Dunstan, Hannah; Lue, Wei-Ling; Hegemann, Björn; Tung, Shu-Yun; Umemoto, Takayuki; Chapple, Andrew; Tsai, Der-Long; Wang, Shue-Mei; Smith, Alison M; Chen, Jychian; Smith, Steven M

    2005-03-18

    The Arabidopsis thaliana genome encodes three alpha-amylase-like proteins (AtAMY1, AtAMY2, and AtAMY3). Only AtAMY3 has a predicted N-terminal transit peptide for plastidial localization. AtAMY3 is an unusually large alpha-amylase (93.5 kDa) with the C-terminal half showing similarity to other known alpha-amylases. When expressed in Escherichia coli, both the whole AtAMY3 protein and the C-terminal half alone show alpha-amylase activity. We show that AtAMY3 is localized in chloroplasts. The starch-excess mutant of Arabidopsis sex4, previously shown to have reduced plastidial alpha-amylase activity, is deficient in AtAMY3 protein. Unexpectedly, T-DNA knock-out mutants of AtAMY3 have the same diurnal pattern of transitory starch metabolism as the wild type. These results show that AtAMY3 is not required for transitory starch breakdown and that the starch-excess phenotype of the sex4 mutant is not caused simply by deficiency of AtAMY3 protein. Knock-out mutants in the predicted non-plastidial alpha-amylases AtAMY1 and AtAMY2 were also isolated, and these displayed normal starch breakdown in the dark as expected for extraplastidial amylases. Furthermore, all three AtAMY double knock-out mutant combinations and the triple knock-out degraded their leaf starch normally. We conclude that alpha-amylase is not necessary for transitory starch breakdown in Arabidopsis leaves.

  15. Characterization of alpha-Amylase from Shoots and Cotyledons of Pea (Pisum sativum L.) Seedlings.

    PubMed

    Beers, E P; Duke, S H

    1990-04-01

    The most abundant alpha-amylase (EC 3.2.1.1) in shoots and cotyledons from pea (Pisum sativum L.) seedlings was purified 6700-and 850-fold, respectively, utilizing affinity (amylose and cycloheptaamylose) and gel filtration chromatography and ultrafiltration. This alpha-amylase contributed at least 79 and 15% of the total amylolytic activity in seedling cotyledons and shoots, respectively. The enzyme was identified as an alpha-amylase by polarimetry, substrate specificity, and end product analyses. The purified alpha-amylases from shoots and cotyledons appear identical. Both are 43.5 kilodalton monomers with pls of 4.5, broad pH activity optima from 5.5 to 6.5, and nearly identical substrate specificities. They produce identical one-dimensional peptide fingerprints following partial proteolysis in the presence of SDS. Calcium is required for activity and thermal stability of this amylase. The enzyme cannot attack maltodextrins with degrees of polymerization below that of maltotetraose, and hydrolysis of intact starch granules was detected only after prolonged incubation. It best utilizes soluble starch as substrate. Glucose and maltose are the major end products of the enzyme with amylose as substrate. This alpha-amylase appears to be secreted, in that it is at least partially localized in the apoplast of shoots. The native enzyme exhibits a high degree of resistance to degradation by proteinase K, trypsin/chymostrypsin, thermolysin, and Staphylococcus aureus V8 protease. It does not appear to be a high-mannose-type glycoprotein. Common cell wall constituents (e.g. beta-glucan) are not substrates of the enzyme. A very low amount of this alpha-amylase appears to be associated with chloroplasts; however, it is unclear whether this activity is contamination or alpha-amylase which is integrally associated with the chloroplast.

  16. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  17. Increasing levels of saliva alpha amylase in electrohypersensitive (EHS) patients.

    PubMed

    Andrianome, Soafara; Hugueville, Laurent; de Seze, René; Selmaoui, Brahim

    2017-08-01

    To assess the level of various salivary and urinary markers of patients with electromagnetic hypersensitivity (EHS) and to compare them with those of a healthy control group. We analyzed samples from 30 EHS individuals and a matched control group of 25 individuals (non-EHS) aged between 22 and 66. We quantified cortisol both in saliva and urine, alpha amylase (sAA), immunoglobulin A and C Reactive Protein levels in saliva and neopterin in urine (uNeopterin). sAA was found to be significantly higher (p < 0.005) in the EHS group. uNeopterin and sAA analysis showed a significant difference based on the duration of EHS. Higher levels of sAA in EHS participants may suggest that the sympathetic adrenal medullar system is activated. However, most of the analyzed markers of the immune system, sympathetic activity and circadian rhythm did not vary significantly in the EHS group. There is a trend to the higher levels of some variables in subgroups according to the EHS duration.

  18. Salivary cortisol, salivary alpha amylase, and the dental anxiety scale.

    PubMed

    Sadi, Hana; Finkelman, Matthew; Rosenberg, Morton

    2013-01-01

    The aim of this study was to investigate the correlation between dental anxiety, salivary cortisol, and salivary alpha amylase (sAA) levels. Furthermore, the aim was to look into individual differences such as age, race, gender, any existing pain, or traumatic dental experience and their effect on dental anxiety. This study followed a cross-sectional design and included a convenience sample of 46. Every patient was asked to complete the Dental Anxiety Scale (DAS) and a basic demographic/dental history questionnaire. A saliva sample, utilizing the method of passive drooling, was then collected in 2-mL cryovials. Samples were analyzed for salivary cortisol and sAA levels by Salimetrics. Significant associations were observed between DAS scores and presence of pain and history of traumatic dental experience. However, no significant correlations were observed between DAS, cortisol, and sAA levels. Our study reconfirms that dental anxiety is associated with presence of pain and a history of traumatic dental experience. On the other hand, our study was the first to our knowledge to test the correlation between the DAS and sAA; nevertheless, our results failed to show any significant correlation between dental anxiety, cortisol, and sAA levels.

  19. Interparental Aggression and Parent-Adolescent Salivary Alpha Amylase Symmetry

    PubMed Central

    Gordis, Elana B.; Margolin, Gayla; Spies, Lauren; Susman, Elizabeth J.; Granger, Douglas A.

    2010-01-01

    The present study examined salivary alpha-amylase (sAA), a putative marker of adrenergic activity, in family members engaging in family conflict discussions. We examined symmetry among family members' sAA levels at baseline and in response to a conflict discussion. The relation between a history of interparental aggression on parent-adolescent sAA symmetry also was examined. Participants were 62 families with a mother, father, and biological child age 13-18 (n = 29 girls). After engaging in a relaxation procedure, families participated in a 15-minute triadic family conflict discussion. Participants provided saliva samples at post-relaxation/pre-discussion, immediately post-discussion, and at 10 and 20 min post-discussion. Participants also reported on interparental physical aggression during the previous year. Across the sample we found evidence of symmetry between mothers' and adolescents' sAA levels at baseline and around the discussion. Interparental aggression was associated with lower sAA levels among fathers. Interparental aggression also affected patterns of parent-child sAA response symmetry such that families reporting interparental aggression exhibited greater father-adolescent sAA symmetry than did those with no reports of interparental aggression. Among families with no interparental aggression history, we found consistent mother-adolescent symmetry. These differences suggest different patterns of parent-adolescent physiological attunement among families with interparental aggression. PMID:20096715

  20. Bread eating induced oral angioedema due to alpha-amylase allergy.

    PubMed

    Moreno-Ancillo, A; Domínguez-Noche, C; Gil-Adrados, A C; Cosmes, P M

    2004-01-01

    Inhalation of dust from different enzymes can be the cause of occupational asthma in exposed workers. Enzymes from different sources are being increasingly used in food. Few cases of food allergy to alpha-amylase induced by eating bread have been reported. Those cases were reported in bakery-related patients and in a pharmaceutical-industry worker. A 25-year-old farmer suffered sneezing, rhinorrhea, oropharyngeal itching, hoarseness, cough, and non-wheezy dyspnea after eating white bread. Skin prick tests (SPT) with common aeroallergens and food allergens revealed only sensitization to Olea europaea pollen. SPT response was positive to Aspergillus oryzae alpha-amylase. Specific IgE against alpha-amylase was positive. A double-blind placebo-controlled challenge with 5 mg of uncooked -amylase induced sneezing, cough, oral angioedema within 10 minutes. The provocation test with 50 g of white bread gave similar findings. This case indicates that alpha-amylase contained in bread may provoke IgE-mediated food allergy. It is worth noting that in this case, the only source of alpha-amylases sensitization was bread.

  1. Evaluation of alpha-glucosidase, alpha-amylase and protein glycation inhibitory activities of edible plants.

    PubMed

    Adisakwattana, Sirichai; Jiphimai, Pariwat; Prutanopajai, Pornsawan; Chanathong, Benjanut; Sapwarobol, Suwimol; Ariyapitipan, Tipayanate

    2010-05-01

    The present study was to investigate in vitro alpha-glucosidase, pancreatic alpha-amylase and protein glycation inhibitory activities of nine edible plants. The results indicated that total phenolics, flavonoids, and condensed tannins of nine edible plants showed marked variations, ranging from 12.2 to 80.1 mg gallic acid equivalent/g extract, 2.34 to 13.65 mg quercetin equivalent/g extract, and 97.2 to 460.1 mg catechin equivalent/g extract, respectively. Our findings showed that grape seed, Cat's whiskers and Sweetleaf extract were the most effective pancreatic alpha-amylase, intestinal maltase, and sucrase inhibitor with IC(50) values of 0.29 +/- 0.01 mg/ml, 0.97 +/- 0.10 mg/ml and 0.86 +/- 0.01 mg/ml, respectively. All extracts (1 mg/ml) markedly inhibited the glycation of bovine serum albumin in fructose-mediated non-enzyme glycation by 50-30% at week 1. It was found that Pennywort maintained the high percentage inhibition among those of the extracts during the 4 weeks of experiment. These edible plants may be used for controlling blood glucose level and prevention of the development of type 2 diabetes.

  2. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  3. Purification and characterization of the extracellular. alpha. -amylase from Clostridium acetobutylicum ATCC 824

    SciTech Connect

    Paquet, V.; Croux, C.; Goma, G.; Soucaille, P. )

    1991-01-01

    The extracellular {alpha}-amylase (1,4-{alpha}-D-glucanglucanohydrolase; EC 3.2.1.1) from Clostridium acetobutylicum ATCC 824 was purified to homogeneity by anion-exchange chromatography (Mono Q) and gel filtration (Superose 12). The enzyme had an isoelectric point of 4.7 and a molecular weight of 84,000, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It was a monomeric protein, the 19-amino-acid N terminus of which displayed 42% homology with the Bacillus subtilis saccharifying {alpha}-amylase. The amino acid composition of the enzyme showed a high number of acidic and hydrophobic residues and only one cysteine residue per mole. The activity of the {alpha}-amylase was not stimulated by calcium ions (or other metal ions) or inhibited by EDTA, although the enzyme contained seven calcium atoms per molecule. {alpha}-Amylase activity on soluble starch was optimal at pH 5.6 and 45{degree}C. The {alpha}-amylase was stable at an acidic pH but very sensitive to thermal inactivation. It hydrolyzed soluble starch, with a K{sub m} of 3.6 g {center dot} liter{sup {minus}1} and a K{sub cat} of 122 mol of reducing sugars {center dot} s{sup {minus}1} {center dot} mol{sup {minus}1}. The {alpha}-amylase showed greater activity with high-molecular-weight substrates than with low-molecular-weight maltooligosaccharides, hydrolyzed glycogen and pullulan slowly, but did not hydrolyze dextran or cyclodextrins. The major end products of maltohexaose degradation were glucose, maltose, and maltotriose; maltotetraose and maltopentaose were formed as intermediate products. Twenty seven percent of the glucoamylase activity generally detected in the culture supernatant of C. acetobutylicum can be attributed to the {alpha}-amylase.

  4. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    PubMed Central

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  5. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System.

    PubMed

    Nater, Urs M; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals.

  6. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes.

    PubMed

    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir Ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra

    2014-01-01

    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bacillus subtilis (70°C) and Bacillus KSM K38 (55°C) and Eukaryotes i.e. Aspergillus oryzae (60°C) were selected from NCBI. Primary structure composition analysis and Conserved sequence analysis were conducted through Bio Edit tools. Results from BioEdit shown only three conserved regions of base pairs and least similarity in MSA of the above mentioned alpha amylases. In Mega 5.1 Phylogeny of thermo stable alpha amylases of Kingdom Archea, Prokaryotes and Eukaryote was handled by Neighbor-Joining (NJ) algorithm. Mega 5.1 phylogenetic results suggested that alpha amylases of thermo stable organisms i.e. Pyrococcus furiosus (100-105°C), Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C) and Bacillus amyloliquefaciens (72°C) are more distantly related as compared to less thermo stable organisms. By keeping in mind the characteristics of most thermo stable alpha amylases novel and improved features can be introduced in less thermo stable alpha amylases so that they become more thermo tolerant and productive for industry.

  7. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

    PubMed

    Rasiah, Indira A; Rehm, Bernd H A

    2009-04-01

    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  8. Correlation between salivary alpha-amylase and stress-related anxiety.

    PubMed

    Rashkova, Maya R; Ribagin, Lora S; Toneva, Nina G

    2012-01-01

    Salivary alpha-amylase is a useful biomarker that can be used in assessing human psychobiological and social behavioural processes. Studying it opens up possibilities for the creation of novel concepts concerning the interaction of biological and social processes and their impact on health and behaviour. The levels of salivary alpha-amylase and situation anxiety self-assessment using Spielberger test were measured twice in 30 individuals aged 21.37 +/- 0.96 yrs (18 females and 12 males): once during stressful situation (prior to examination) and, again a month later, in stress-free environment (during a training session). Salivary alpha-amylase was measured using kinetic reaction kit Salimetrics LLC--USA. The mean level of salivary alpha-amylase measured during the first measurement 156.0 +/- 93.33 U/ml. During the second measurement in the absence of intense stress, the levels were two times lower - 74.03 +/- 58.06 U/ml and the differences were statistically significant (P < 0.001). We found a statistically significant correlation between the levels of salivary alpha-amylase in both measurements (P < 0.01). The correlation coefficient was r = 0.472 (P < 0.01). The adapted version of the State-Trait Anxiety Inventory score (STAI) created by Spielberger is appropriate for assessment of stress-related anxiety in young individuals. Salivary alpha-amylase may be used as a biomarker for objective evaluation of the psychosomatic state of individuals in a stressful environment. The combination of psychological test and objective indicator such as salivary alpha-amylase is an excellent tool for objective evaluation of individual's state in stressful environment. Similar tests may be used in assessment of patients' behaviours at dental treatment that may be considered a stressor in most patients.

  9. Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution.

    PubMed

    Strobl, S; Maskos, K; Betz, M; Wiegand, G; Huber, R; Gomis-Rüth, F X; Glockshuber, R

    1998-05-08

    The three-dimensional structure of the alpha-amylase from Tenebrio molitor larvae (TMA) has been determined by molecular replacement techniques using diffraction data of a crystal of space group P212121 (a=51.24 A; b=93.46 A; c=96.95 A). The structure has been refined to a crystallographic R-factor of 17.7% for 58,219 independent reflections in the 7.0 to 1.64 A resolution range, with root-mean-square deviations of 0.008 A for bond lengths and 1.482 degrees for bond angles. The final model comprises all 471 residues of TMA, 261 water molecules, one calcium cation and one chloride anion. The electron density confirms that the N-terminal glutamine residue has undergone a post-transitional modification resulting in a stable 5-oxo-proline residue. The X-ray structure of TMA provides the first three-dimensional model of an insect alpha-amylase. The monomeric enzyme exhibits an elongated shape approximately 75 Ax46 Ax40 A and consists of three distinct domains, in line with models for alpha-amylases from microbial, plant and mammalian origin. However, the structure of TMA reflects in the substrate and inhibitor binding region a remarkable difference from mammalian alpha-amylases: the lack of a highly flexible, glycine-rich loop, which has been proposed to be involved in a "trap-release" mechanism of substrate hydrolysis by mammalian alpha-amylases. The structural differences between alpha-amylases of various origins might explain the specificity of inhibitors directed exclusively against insect alpha-amylases.

  10. Inhibitory effect of Azadirachta indica A. juss leaf extract on the activities of alpha-amylase and alpha-glucosidase.

    PubMed

    Kazeem, M I; Dansu, T V; Adeola, S A

    2013-11-01

    In recent decades, there has been a drastic increase in the incidence and prevalence of diabetic mellitus. The aim of this study was to evaluate the in vitro inhibitory effect of Azadirachita indica leaf extract on the activity of alpha-amylase and alpha-glucosidase as a means of alleviating hyperglycemia and managing diabetes mellitus. Aqueous extract of Azadirachita indica exhibited most potent alpha-amylase inhibitory activity with IC50 value of 9.15 mg mL(-1) and acetone extract exhibited most potent alpha-glucosidase inhibitory activity with IC50 value of 5.00 mg mL(-1). Kinetic studies revealed both acetone and aqueous extract to exhibit mixed non-competitive inhibition for alpha-amylase and alpha-glucosidase. It can be concluded that the antidiabetic potential of Azadirachta indica may be due to its ability to inhibit both alpha-amylase and alpha-glucosidase. The presence of phytochemicals such as flavonoids, tannins and saponins in this plant may be responsible for its inhibitory activity on the two enzymes studied.

  11. Studies on the formation of alpha-amylase by Thermomonospora vulgaris.

    PubMed

    Allam, A M; Hussein, A M; Ragab, A M

    1977-01-01

    Conditions affecting the formation of alpha-amylase by static cultures of the thermophilic actinomycete Thermomonospora vulgaris were studied. The organism failed to grow under submerged culture conditions or when the culture medium was devoid of CaCO3-alpha-Amylase was produced during the logarithmic phase of growth and maximum yield was obtained after 3 to 9 days of incubation. Growth and amylase formation took place only in a range from 45 degrees to 55 degrees C; optimum temperature was 55 degrees C. Of the tested carbon sources only starch induced enzyme formation. Maximum enzyme yield was obtained when starch concentration of the medium was 2% and when ammonium citrate served as a nitrogen source. Crushed clay pots could substitute for CaCO3 of the medium, but growth and amylase yield were less.

  12. Selective inhibition of histidine-modified pancreatic alpha-amylase by proteinaceous inhibitor from Phaseolus vulgaris.

    PubMed

    Nakatani, H

    1988-06-01

    Chemical modification of two histidine residues of porcine pancreatic alpha-amylase (EC 3.2.1.1) by diethyl pyrocarbonate in the presence of a high concentration of maltotriose caused a decrease of amylase activity and an increase of maltosidase activity (hydrolysis of p-nitrophenyl-alpha-maltoside). By binding a proteinaceous inhibitor from Phaseolus vulgaris (white kidney bean) with the modified enzyme, the amylase activity was further decreased but the maltosidase activity was retained to about 100% that of the native enzyme. Both amylase and maltosidase activities of the native enzyme were almost completely inhibited by the proteinaceous inhibitor. The increase of maltosidase activity by histidine modification was due to an increase of kcat, whereas the Km value was not changed; but binding of the proteinous inhibitor affected mainly the Km value of the modified enzyme.

  13. A novel alpha-amylase from the cyanobacterium Nostoc sp. PCC 7119.

    PubMed

    Reyes-Sosa, Francisco M; Molina-Heredia, Fernando P; De la Rosa, Miguel A

    2010-03-01

    Little information is yet available on the alpha-amylases of cyanobacteria. Here, the presence of an alpha-amylase in the cyanobacterium Nostoc sp. PCC 7119 is first demonstrated. A gene (amy1) encoding a cytoplasmic alpha-amylase (Amy1) protein has been identified, cloned, and overexpressed in Escherichia coli cells. The recombinant protein is a 56.7-kDa monomer, which has been purified to electrophoretic homogeneity by affinity chromatography. The substrate specificity and end product analyses confirm that it is a calcium-dependent alpha-amylase enzyme, which exhibits its maximum activity at 31 degrees C and at pH between 6.5 and 7.5. The Amy1 protein breaks down mainly starch, is also able to cleave glycogen and dextrin, and exhibits no activity against xylan or pullulan. So the enzyme cannot efficiently attack the maltodextrins with degrees of polymerization below that of maltooctaose. Maltotriose, maltose, and maltotetraose are the major products of the enzymatic reaction with starch as substrate. The enzyme shows a very high turnover number against soluble potato starch (3,420 +/- 270 s(-1)), as compared with other alpha-amylases reported in the literature. The high catalytic efficiency and relatively low optimum temperature of the Nostoc Amy1 protein make this previously unexplored group of cyanobacterial enzymes of great interest for further physiological studies and industrial applications.

  14. Alpha-amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits alpha-amylases from the coffee berry borer pest.

    PubMed

    Barbosa, Aulus E A D; Albuquerque, Erika V S; Silva, Maria C M; Souza, Djair S L; Oliveira-Neto, Osmundo B; Valencia, Arnubio; Rocha, Thales L; Grossi-de-Sa, Maria F

    2010-06-17

    Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an alpha-amylase inhibitor gene (alpha-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. We transformed C. arabica with the alpha-amylase inhibitor-1 gene (alpha-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the alpha-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against alpha-AI1 inhibitor showed a maximum alpha-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the alpha-AI1 protein against H. hampei alpha-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  15. X-ray crystallographic analyses of pig pancreatic alpha-amylase with limit dextrin, oligosaccharide, and alpha-cyclodextrin.

    PubMed

    Larson, Steven B; Day, John S; McPherson, Alexander

    2010-04-13

    Further refinement of the model using maximum likelihood procedures and reevaluation of the native electron density map has shown that crystals of pig pancreatic alpha-amylase, whose structure we reported more than 15 years ago, in fact contain a substantial amount of carbohydrate. The carbohydrate fragments are the products of glycogen digestion carried out as an essential step of the protein's purification procedure. In particular, the substrate-binding cleft contains a limit dextrin of six glucose residues, one of which contains both alpha-(1,4) and alpha-(1,6) linkages to contiguous residues. The disaccharide in the original model, shared between two amylase molecules in the crystal lattice, but also occupying a portion of the substrate-binding cleft, is now seen to be a tetrasaccharide. There are, in addition, several other probable monosaccharide binding sites. Furthermore, we have further reviewed our X-ray diffraction analysis of alpha-amylase complexed with alpha-cyclodextrin. alpha-Amylase binds three cyclodextrin molecules. Glucose residues of two of the rings superimpose upon the limit dextrin and the tetrasaccharide. The limit dextrin superimposes in large part upon linear oligosaccharide inhibitors visualized by other investigators. By comprehensive integration of these complexes we have constructed a model for the binding of polysaccharides having the helical character known to be present in natural substrates such as starch and glycogen.

  16. Action of Bacillus subtilis alpha-amylase on native wheat starch.

    PubMed

    Colonna, P; Buléon, A; Lemarié, F

    1988-06-05

    Native starch granules from wheat have been subjected to enzymatic depolymerization with an alpha-amylase from Bacillus subtilis. Crystallites made from short-chain amylose and residues from mild acid hydrolysis have been also tested. Electron microscopy, particle size analysis, DSC, and x-ray diffractometry reveal that enzymatic degradation occurs granule by granule. Gel permeation chromatography shows off the macromolecular nature of the remaining material. In contrast, acid erodes simultaneously all the granules, leading to a splitting into small particles. Crystalline fractions are completely degraded by alpha-amylase. These results support evidence for an active disentanglement of chains, carried out by the different subsites of alpha-amylase molecules. A simple mathematical treatment is proposed to explain the results of the kinetics.

  17. An isoquinoline alkaloid, berberine, can inhibit fungal alpha amylase: enzyme kinetic and molecular modeling studies.

    PubMed

    Tintu, Ignatius; Dileep, Kalarickal V; Augustine, Anu; Sadasivan, Chittalakkottu

    2012-10-01

    Aspergillus flavus is a commonly found fungal pathogen, which produces aflatoxins, highly toxic and hepatocarcinogenic natural compounds. Inhibition of fungal alpha amylase activity has been found to limit the ability of the fungus to produce aflatoxins. Berberine, an isoquinoline alkaloid commonly found in many medicinal plants, was identified to inhibit the growth of A. flavus. The amount of berberine required to inhibit the fungal mycelial growth was determined. The compound was also found to inhibit the alpha amylase from the A. flavus. The binding affinity of the compound toward alpha amylase and the enzyme inhibitory activity have been determined by enzyme kinetic studies and Isothermal Titration Calorimetric analysis. Molecular modeling and docking studies were carried out to understand the enzyme-ligand interactions. © 2012 John Wiley & Sons A/S.

  18. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  19. Retention of enzymatic activity of alpha-amylase in the reductive synthesis of gold nanoparticles.

    PubMed

    Rangnekar, Abhijit; Sarma, Tridib Kumar; Singh, Atul Kumar; Deka, Jashmini; Ramesh, Aiyagari; Chattopadhyay, Arun

    2007-05-08

    In this paper, we report the generation of Au nanoparticles (NPs), using a pure enzyme for the reduction of AuCl4(-), with the retention of enzymatic activity in the complex. As a model system, alpha-amylase was used to readily synthesize and stabilize Au NPs in aqueous solution. Although several other enzymes were also pursued for the synthesis, it was interesting to observe that only alpha-amylase and EcoRI could produce Au NPs. Following NP synthesis, the activity of the enzyme was retained in the Au NP-alpha-amylase complex. The presence of Au NPs and alpha-amylase in the complex was established by UV-visible and FT-IR spectroscopy, X-ray diffraction (XRD) and transmission electron microscopic (TEM) measurements. Our observations suggest that the presence of free and exposed S-H groups is essential in the reduction of AuCl4(-) to Au NPs. Structural analysis of the enzymes showed that both alpha-amylase and EcoRI enzymes have free and exposed S-H groups in their native form and thus are suitable for the generation of NPs, whereas the other ones used here do not have such groups. Fortuitously, the enzymatic functional group of alpha-amylase is positioned opposite to that of the free and exposed S-H group, which makes it ideal for the production of Au NPs; binding of the enzyme to Au NPs via Au-S bond and also retention of the biological activity of the enzyme.

  20. Structural characterization of an alpha-amylase inhibitor from a wild common bean (Phaseolus vulgaris): insight into the common structural features of leguminous alpha-amylase inhibitors.

    PubMed

    Nakaguchi, T; Arakawa, T; Philo, J S; Wen, J; Ishimoto, M; Yamaguchi, H

    1997-02-01

    The primary structures of two subunits of an alpha-amylase inhibitor (alpha AI-2) from a wild common bean (Phaseolus vulgaris) were revealed by a comparison of the amino acid sequence previously deduced from the nucleotide sequence with the amino- and carboxyl-terminal amino acid sequences determined by conventional methods. The polypeptide molecular weight of alpha AI-2 obtained by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that alpha AI-2 has the subunit stoichiometry of an alpha 2 beta 2 complex. These structural features were closely similar to those recently elucidated for a white kidney bean (P. vulgaris) alpha-amylase inhibitor, which is quite different in the inhibitory specificity from alpha AI-2. The post-translational processing of the precursor glycoproteins to form the tetrameric structure appeared to require an Arg residue close to the processing site. Further, the proper associations of the subunits into the tetrameric structures seemed to be strictly controlled by a few amino acids on the subunit interfaces.

  1. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the alpha-amylase family.

    PubMed

    Park, K H; Kim, T J; Cheong, T K; Kim, J W; Oh, B H; Svensson, B

    2000-05-23

    Cyclomaltodextrinase (CDase, EC 3.2.1.54), maltogenic amylase (EC 3. 2.1.133), and neopullulanase (EC 3.2.1.135) are reported to be capable of hydrolyzing all or two of the following three types of substrates: cyclomaltodextrins (CDs); pullulan; and starch. These enzymes hydrolyze CDs and starch to maltose and pullulan to panose by cleavage of alpha-1,4 glycosidic bonds whereas alpha-amylases essentially lack activity on CDs and pullulan. They also catalyze transglycosylation of oligosaccharides to the C3-, C4- or C6-hydroxyl groups of various acceptor sugar molecules. The present review surveys the biochemical, enzymatic, and structural properties of three types of such enzymes as defined based on the substrate specificity toward the CDs: type I, cyclomaltodextrinase and maltogenic amylase that hydrolyze CDs much faster than pullulan and starch; type II, Thermoactinomyces vulgaris amylase II (TVA II) that hydrolyzes CDs much less efficiently than pullulan; and type III, neopullulanase that hydrolyzes pullulan efficiently, but remains to be reported to hydrolyze CDs. These three types of enzymes exhibit 40-60% amino acid sequence identity. They occur in the cytoplasm of bacteria and have molecular masses from 62 to 90 kDa which are slightly larger than those of most alpha-amylases. Multiple amino acid sequence alignment and crystal structures of maltogenic amylase and TVA II reveal the presence of an N-terminal extension of approximately 130 residues not found in alpha-amylases. This unique N-terminal domain as seen in the crystal structures apparently contributes to the active site structure leading to the distinct substrate specificity through a dimer formation. In aqueous solution, most of these enzymes show a monomer-dimer equilibrium. The present review discusses the multiple specificity in the light of the oligomerization and the molecular structures arriving at a clarified enzyme classification. Finally, a physiological role of the enzymes is proposed.

  2. Artificial chaperone-assisted refolding of chemically denatured alpha-amylase.

    PubMed

    Yazdanparast, Razieh; Khodagholi, Fariba; Khodarahmi, Reza

    2005-06-01

    It is now well established that alpha-cyclodextrin (alpha-CD) is a valuable folding agent in refolding processes of several denatured enzyme solutions. The refolding of Gu-HCl denatured alpha-amylase in the dilution-additive mode revealed that alpha-CD enhanced the refolding yield by 20-30% depending upon alpha-CD concentration. However, the refolding efficiency of the Gu-HCl denatured alpha-amylase through the artificial chaperone-assisted method indicated that alpha-CD enhanced the activity recovery of denatured alpha-amylase by almost 50% and also increased the reactivation rate constant relative to the unassisted control sample. The higher refolding efficiency should be due to different mechanism played by alpha-CD in this technique. In addition, our data indicated that higher refolding yields are obtained when the residual Gu-HCl concentration is low in the refolding environment and when the capture agent is removed not in a stepwise manner from the protein-detergent complexes in the stripping step of the whole process. Collectively, the results of this investigation expand the range of procedural variations used to refold different denatured proteins through artificial chaperone-assisted method.

  3. Effects of alpha-amylase on in vitro growth of Legionella pneumophila.

    PubMed Central

    Bortner, C A; Miller, R D; Arnold, R R

    1983-01-01

    Sterile parotid saliva inhibited growth of Legionella pneumophila on solid media, and the salivary component involved in this inhibition has been shown to be amylase. Disk diffusion and well plate assays were used to study possible mechanisms for this effect. The amylolytic activity of saliva copurified with inhibitory activity, and both activities were sensitive to proteinase K digestion and heat treatment. In addition, purified alpha-amylase from several sources (bacteria, fungi, porcine pancreas, and human saliva) exhibited similar activity. Incorporation of charcoal or bovine serum albumin into media blocked inhibition by amylase. Replacement of Bacto-Agar with Noble agar (both from Difco Laboratories) prevented growth inhibition in the absence of starch. However, when corn starch was present with Noble agar, amylase-induced growth inhibition occurred. Purification of starch by washing with methanol eliminated some toxic component. The toxic component from starch could be recovered from the methanol wash and inhibited growth of L. pneumophila in the absence of amylase activity. The results suggest that toxic substances exist in media components which may be unmasked during salivary amylase digestion of starch. This effect may explain, in part, the difficulty in recovery of the organism from clinical specimens containing amylase. PMID:6190756

  4. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    USDA-ARS?s Scientific Manuscript database

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  5. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed Central

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-01-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch. PMID:942374

  6. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-03-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch.

  7. A thermoactive alpha-amylase from a Bacillus sp. isolated from CSMCRI salt farm.

    PubMed

    Pancha, Imran; Jain, Deepti; Shrivastav, Anupama; Mishra, Sanjiv K; Shethia, Bhumi; Mishra, Sandhya; V P, Mohandas; Jha, Bhavanath

    2010-08-01

    Amylases are the most important hydrolytic enzymes for starch-based industries. It is desirable that alpha-amylases should be active at high temperature of gelatinization (100-110 degrees C) and liquefaction (80-90 degrees C) to economize processes. Therefore, thermostable and thermoactive enzyme from natural bacterial strain would have wide industrial importance. In the present study a highly thermoactive and thermostable amylase producing Bacillus sp. was isolated from experimental salt farm of Central Salt and Marine Chemicals Research Institute, yielding 452Uml(-1) amylase in medium containing (%) NaCl 0.5, peptone 0.5, beef extract 0.3, starch 1.0 at 37 degrees C, pH 7.0 after 48h of incubation. Maximum activity of amylase was observed at pH 8.0 and 110 degrees C temperature. The crude enzyme was highly active between pH 6.0 and 11.0 and observed to be active and thermostable after 30min of incubation at 60 degrees C. These properties indicated that the isolated alpha-amylase enzyme is suitable for starch liquefaction and other food processing. Copyright 2010 Elsevier B.V. All rights reserved.

  8. Structure-based discovery of a new affinity ligand to pancreatic alpha-amylase.

    PubMed

    Westerfors, Maria; Tedebark, Ulf; Andersson, Hans O; Ohrman, Sara; Choudhury, Devapriya; Ersoy, Oguz; Shinohara, Yasuro; Axén, Andreas; Carredano, Enrique; Baumann, Herbert

    2003-01-01

    A ligand useful for affinity capture of porcine pancreatic alpha-amylase was found by virtual screening of the commercially available compound data base MDL Available Chemicals Directory. Hits from the virtual screening were investigated for binding by nuclear magnetic resonance (NMR) and surface plasmon resonance. Selected compounds were tested for inhibition of the enzyme using a NMR-based assay. One of the binders found was covalently coupled to a chromatographic resin and a column, packed with this resin, could retain alpha-amylase, which subsequently was eluted by introduction of the known inhibitor acarbose to the elution buffer. Copyright 2003 John Wiley & Sons, Ltd.

  9. Exposure to inhalable dust, wheat flour and alpha-amylase allergens in industrial and traditional bakeries.

    PubMed

    Bulat, Petar; Myny, Katrien; Braeckman, Lutgart; van Sprundel, Marc; Kusters, Edouard; Doekes, Gert; Pössel, Kerstin; Droste, Jos; Vanhoorne, Michel

    2004-01-01

    This study was designed to characterize exposure to inhalable dust, wheat flour and alpha-amylase allergens in industrial and traditional bakeries. The study included 70 bakeries from the northern part of Belgium. Based on the degree of automation and a clear division of individual job tasks, four bakeries were identified as industrial and the remaining 66 were identified as traditional ones. Personal, as well as stationary, samples of inhalable dust were collected during full shift periods, usually 5-7 h. The portable pumps aspirated 2 l/min through Teflon personal dust samplers (Millipore, pore size 1.0 microm) mounted in PAS-6 sampling heads. In the collected samples the inhalable dust, wheat flour and alpha-amylase allergens were determined. Wheat flour allergens were measured using enzyme-linked immunosorbent assay inhibition and an antiwheat IgG4 serum pool. The alpha-amylase allergens were measured using a sandwich enzyme immunoassay with affinity-purified polyclonal rabbit IgG antibodies. In total, 440 samples (300 personal and 140 stationary) were processed. The highest inhalable dust exposure was observed in traditional bakeries among bread [geometric mean (GM) 2.10 mg/m3] and bread and pastry workers (GM 1.80 mg/m3). In industrial bakeries the highest dust exposure was measured in bread-producing workers (GM 1.06 mg/m3). Similar relations were observed for wheat flour and alpha-amylase allergens. Bread baking workers in traditional bakeries had the highest exposure to both allergens (wheat flour GM 22.33 microg/m(3), alpha-amylase GM 0.61 ng/m3). The exposure to wheat flour and alpha-amylase allergens in industrial bakeries was higher in bread baking workers (wheat flour GM 6.15 microg/m3, alpha-amylase GM 0.47 ng/m3) than in bread packing workers (wheat flour GM 2.79 microg/m3, alpha-amylase GM 0.15 ng/m3). The data presented suggest that, on average, exposure in the Belgium bakeries studied-industrial as well as traditional-is lower than or similar to

  10. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  11. Production, purification and characterization of an extracellular alpha-amylase enzyme isolated from Aspergillus flavus.

    PubMed

    Abou-Zeid, A M

    1997-01-01

    Filamentous fungi isolated from cereals were screened for their ability to produce alpha-amylase (1,4-alpha-glucan glucanohydrolase, EC 3.2.1.1). A selected strain identified as Aspergillus flavus showed high enzymatic activity. A single extracellular alpha-amylase was purified to homogeneity by a starch adsorption method. The molecular weight (M(r)) of the A. flavus alpha-amylase was approximately 75,000 +/- 3,000 by polyacrylamide gel electrophoresis (PAGE) and that of the subunit was approximately 75,000 +/- 3000 SDS-PAGE. The optimal activity of the purified enzyme was achieved at pH 7.0 and 30 degrees C. K+ ions increased the alpha-amylase activity, but Mg2+ did not greatly affect enzyme activity. Mn2+, Zn2+, Cu2+ and Fe3+ ions strongly inhibited the enzyme activity. The products of hydrolysis of native starch by the A. flavus enzyme were mainly glucose as well as unidentified oligosaccharides.

  12. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  13. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  14. Protective mechanism of the Mexican bean weevil against high levels of alpha-amylase inhibitor in the common bean.

    PubMed

    Ishimoto, M; Chrispeels, M J

    1996-06-01

    Alpha-amylase inhibitor (alpha AI) protects seeds of the common bean (Phaseolus vulgaris) against predation by certain species of bruchids such as the cowpea weevil (Callosobruchus maculatus) and the azuki bean weevil (Callosobruchus chinensis), but not against predation by the bean weevil (Acanthoscelides obtectus) or the Mexican bean weevil (Zabrotes subfasciatus), insects that are common in the Americas. We characterized the interaction of alpha AI-1 present in seeds of the common bean, of a different isoform, alpha AI-2, present in seeds of wild common bean accessions, and of two homologs, alpha AI-Pa present in seeds of the tepary bean (Phaseolus acutifolius) and alpha AI-Pc in seeds of the scarlet runner bean (Phaseolus coccineus), with the midgut extracts of several bruchids. The extract of the Z. subfasciatus larvae rapidly digests and inactivates alpha AI-1 and alpha AI-Pc, but not alpha AI-2 or alpha AI-Pa. The digestion is caused by a serine protease. A single proteolytic cleavage in the beta subunit of alpha AI-1 occurs at the active site of the protein. When degradation is prevented, alpha AI-1 and alpha AI-Pc do not inhibit the alpha-amylase of Z. subfasciatus, although they are effective against the alpha-amylase of C. chinensis. Alpha AI-2 and alpha AI-Pa, on the other hand, do inhibit the alpha-amylase of Z. subfasciatus, suggesting that they are good candidates for genetic engineering to achieve resistance to Z. subfasciatus.

  15. Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine

    SciTech Connect

    Zhang, Q.; Tsukagoshi, N.; Miyashiro, S.; Udaka, S.

    1983-07-01

    The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth. Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. (Refs. 10).

  16. The noncatalytic triad of alpha-amylases: a novel structural motif involved in conformational stability.

    PubMed

    Marx, Jean-Claude; Poncin, Johan; Simorre, Jean-Pierre; Ramteke, Pramod W; Feller, Georges

    2008-02-01

    Chloride-activated alpha-amylases contain a noncatalytic triad, independent of the glycosidic active site, perfectly mimicking the catalytic triad of serine-proteases and of other active serine hydrolytic enzymes. Mutagenesis of Glu, His, and Ser residues in various alpha-amylases shows that this pattern is a structural determinant of the enzyme conformation that cannot be altered without losing the intrinsic stability of the protein. (1)H-(15)N NMR spectra of a bacterial alpha-amylase reveal proton signals that are identical with the NMR signature of catalytic triads and especially a deshielded proton involving a protonated histidine and displaying properties similar to that of a low barrier hydrogen bond. It is proposed that the H-bond between His and Glu of the noncatalytic triad is an unusually strong interaction, responsible for the observed NMR signal and for the weak stability of the triad mutants. Furthermore, a stringent template-based search of the Protein Data Bank demonstrated that this motif is not restricted to alpha-amylases, but is also found in 80 structures from 33 different proteins, amongst which SH2 domain-containing proteins are the best representatives.

  17. Optimization of Alpha-Amylase Application in U.S. Factories

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  18. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  19. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  20. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    PubMed

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing.

  1. Structure of Bacillus amyloliquefaciens alpha-amylase at high resolution: implications for thermal stability.

    PubMed

    Alikhajeh, Jahan; Khajeh, Khosro; Ranjbar, Bijan; Naderi-Manesh, Hossein; Lin, Yi Hung; Liu, Enhung; Guan, Hong Hsiang; Hsieh, Yin Cheng; Chuankhayan, Phimonphan; Huang, Yen Chieh; Jeyaraman, Jeyakanthan; Liu, Ming Yih; Chen, Chun Jung

    2010-02-01

    The crystal structure of Bacillus amyloliquefaciens alpha-amylase (BAA) at 1.4 A resolution revealed ambiguities in the thermal adaptation of homologous proteins in this family. The final model of BAA is composed of two molecules in a back-to-back orientation, which is likely to be a consequence of crystal packing. Despite a high degree of identity, comparison of the structure of BAA with those of other liquefying-type alpha-amylases indicated moderate discrepancies at the secondary-structural level. Moreover, a domain-displacement survey using anisotropic B-factor and domain-motion analyses implied a significant contribution of domain B to the total flexibility of BAA, while visual inspection of the structure superimposed with that of B. licheniformis alpha-amylase (BLA) indicated higher flexibility of the latter in the central domain A. Therefore, it is suggested that domain B may play an important role in liquefying alpha-amylases, as its rigidity offers a substantial improvement in thermostability in BLA compared with BAA.

  2. [Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars].

    PubMed

    Netsvetaev, V P; Badaeva, E D

    2014-07-01

    The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in Tris-glycine (pH 8.3) system in wheat cultivars with different genome composition. We show that durum wheat (Triticum durum, 2n=4x=28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in common wheat zymograms (Triticum aestivum, 2n=6x=42, BBAADD). A similar pattern is observed in a synthetic allohexaploid carrying the BBAA genomes of wheat and the HchHch genome of barley (Hordeum chilense). Our method of electrophoresis fails to reveal additional variants of alpha-amylase encoded by the barley genome, although C-banding analysis confirms the genomic structure BBAAHChHCh of this allopolyploid. The electrophoretic spectrum of the spring common wheat cultivar Dobrynya with the wheat-Agropyron translocation 7DL-7AiL contains all of the alpha-amylase isoenzymes typical for common wheat (2n=6x=42, BBAADD) except for the zymotype encoded by the long arm of chromosome 7D. This observation confirms the results of cytogenetic analysis that identified a 7DL-7AiL translocation in this cultivar. No additional alpha-amylase isoenzymes encoded by Agropyron chromosome have been observed. Our data indicate that analysis of wheat-alien hybrids or introgressive forms should be carried out using a complex of different methods.

  3. Beta-thiomaltosides as active site probes for alpha-amylase.

    PubMed

    Stankiewicz, P J; Cascio, D; McPherson, A

    1983-12-01

    A series of substituted 1-thio-beta-D-maltopyranosides was synthesized and confirmed by elemental analysis, optical rotation, NMR, and liquid chromatography. These compounds were shown by several biochemical techniques to bind to the active site of alpha-amylase. Steady-state kinetic studies showed the compounds to be competitive inhibitors, with affinities lying within the range of the natural ligands, maltose and maltotriose. Affinity chromatography employing p-aminophenyl-1-thio-beta-D-maltopyranoside linked to Sepharose provides a relatively simple procedure for alpha-amylase purification. The binding of p-bromphenyl-1-thio-beta-D-maltoside was observed in crystals of alpha-amylase using X-ray crystallography, and through the use of difference Fourier analysis its interaction at 5.0-A resolution with the active site of the enzyme has been visualized. The inhibitor binds in a long, deep cleft that divides the two major domains of the enzyme. These studies are believed to provide a first step toward the rational design of ligands for the physiological regulation of starch breakdown and utilization through modulation of alpha-amylase activity.

  4. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    ERIC Educational Resources Information Center

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2010-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  5. Validation of an assay for quantification of alpha-amylase in saliva of sheep.

    PubMed

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-07-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep.

  6. Validation of an assay for quantification of alpha-amylase in saliva of sheep

    PubMed Central

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-01-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  7. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    ERIC Educational Resources Information Center

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2010-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  8. Crystal structures of human pancreatic alpha-amylase in complex with carbohydrate and proteinaceous inhibitors.

    PubMed Central

    Nahoum, V; Roux, G; Anton, V; Rougé, P; Puigserver, A; Bischoff, H; Henrissat, B; Payan, F

    2000-01-01

    Crystal structures of human pancreatic alpha-amylase (HPA) in complex with naturally occurring inhibitors have been solved. The tetrasaccharide acarbose and a pseudo-pentasaccharide of the trestatin family produced identical continuous electron densities corresponding to a pentasaccharide species, spanning the -3 to +2 subsites of the enzyme, presumably resulting from transglycosylation. Binding of the acarviosine core linked to a glucose residue at subsites -1 to +2 appears to be a critical part of the interaction process between alpha-amylases and trestatin-derived inhibitors. Two crystal forms, obtained at different values of pH, for the complex of HPA with the protein inhibitor from Phaseolus vulgaris (alpha-amylase inhibitor) have been solved. The flexible loop typical of the mammalian alpha-amylases was shown to exist in two different conformations, suggesting that loop closure is pH-sensitive. Structural information is provided for the important inhibitor residue, Arg-74, which has not been observed previously in structural analyses. PMID:10657258

  9. ALPHA-AMYLASE ACTIVITY IN VARIOUS CONCENTRATIONS OF THE IONIC LIQUID, 1-BUTYL-3-METHYLIMIDAZOLIUM CHLORIDE

    USDA-ARS?s Scientific Manuscript database

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  10. Isolation of a cDNA Clone for alpha-Amylase in Mung Bean Cotyledons : Analysis of alpha-Amylase mRNA Levels in Cotyledons during and following Germination of Mung Bean Seeds.

    PubMed

    Koizuka, N; Tanaka, Y; Morohashi, Y

    1990-11-01

    A cDNA was isolated that codes for alpha-amylase in mung bean (Vigna radiata) cotyledons, and the nucleotide sequence was determined. The deduced amino acid sequence (421 amino acid residues) is about 65% homologous with those of barley alpha-amylases. By comparing the deduced sequence with the sequence of the purified alpha-amylase, it was inferred that 23 N-terminal amino acids of a nascent polypeptide represent a signal peptide. Northern blot analysis showed that the levels of alpha-amylase mRNA are in parallel with the activities of alpha-amylase synthesis in cotyledons. Under the conditions where the solute leakage from cotyledons is accelerated during imbibition, a rapid increase in the amount of the alpha-amylase mRNA occurs. We postulate that a factor(s) which regulates in an inhibitory manner the alpha-amylase expression at the transcriptional level may be present in dry cotyledons and be removed by leakage.

  11. Affinity labeling of soybean beta-amylase with 2',3'-epoxypropyl alpha-D-glucopyranoside.

    PubMed

    Isoda, Y; Nitta, Y

    1986-06-01

    The synthesized 2',3'-epoxypropyl alpha-D-glucopyranoside (alpha-EPG) inactivated soybean beta-amylase completely. The incorporation of alpha-EPG into the enzyme at 92% inactivation was 1.1 mol per mol of enzyme, as determined by using 14C-labeled alpha-EPG. The inactivation obeyed saturation kinetics of a two-step mechanism. The dissociation constant of alpha-EPG-enzyme complex and the rate constant of the irreversible inactivation step were estimated to be 119 mM and 1.14 X 10(-3)s-1, respectively. alpha-Cyclodextrin, a competitive inhibitor of this enzyme, protected the enzyme against the inactivation by alpha-EPG in a competitive manner. This suggests that alpha-EPG binds to the active site of the enzyme. The above results indicate that alpha-EPG acts on soybean beta-amylase as an affinity labeling reagent. It was also shown that an essential SH group near the active site, but not the catalytic one, scarcely participated in the inactivation by alpha-EPG.

  12. Aerobic Fitness Level Affects Cardiovascular and Salivary Alpha Amylase Responses to Acute Psychosocial Stress.

    PubMed

    Wyss, Thomas; Boesch, Maria; Roos, Lilian; Tschopp, Céline; Frei, Klaus M; Annen, Hubert; La Marca, Roberto

    2016-12-01

    Good physical fitness seems to help the individual to buffer the potential harmful impact of psychosocial stress on somatic and mental health. The aim of the present study is to investigate the role of physical fitness levels on the autonomic nervous system (ANS; i.e. heart rate and salivary alpha amylase) responses to acute psychosocial stress, while controlling for established factors influencing individual stress reactions. The Trier Social Stress Test for Groups (TSST-G) was executed with 302 male recruits during their first week of Swiss Army basic training. Heart rate was measured continuously, and salivary alpha amylase was measured twice, before and after the stress intervention. In the same week, all volunteers participated in a physical fitness test and they responded to questionnaires on lifestyle factors and personal traits. A multiple linear regression analysis was conducted to determine ANS responses to acute psychosocial stress from physical fitness test performances, controlling for personal traits, behavioural factors, and socioeconomic data. Multiple linear regression revealed three variables predicting 15 % of the variance in heart rate response (area under the individual heart rate response curve during TSST-G) and four variables predicting 12 % of the variance in salivary alpha amylase response (salivary alpha amylase level immediately after the TSST-G) to acute psychosocial stress. A strong performance at the progressive endurance run (high maximal oxygen consumption) was a significant predictor of ANS response in both models: low area under the heart rate response curve during TSST-G as well as low salivary alpha amylase level after TSST-G. Further, high muscle power, non-smoking, high extraversion, and low agreeableness were predictors of a favourable ANS response in either one of the two dependent variables. Good physical fitness, especially good aerobic endurance capacity, is an important protective factor against health

  13. Thermodynamic stability of a cold-active alpha-amylase from the Antarctic bacterium Alteromonas haloplanctis.

    PubMed

    Feller, G; d'Amico, D; Gerday, C

    1999-04-06

    The thermal stability of the cold-active alpha-amylase (AHA) secreted by the Antarctic bacterium Alteromonas haloplanctis has been investigated by intrinsic fluorescence, circular dichroism, and differential scanning calorimetry. It was found that this heat-labile enzyme is the largest known multidomain protein exhibiting a reversible two-state unfolding, as demonstrated by the recovery of DeltaHcal values after consecutive calorimetric transitions, a DeltaHcal/DeltaHeff ratio close to unity, and the independence of unfolding thermodynamic parameters of scan rates. By contrast, the mesophilic alpha-amylases investigated here (from porcine pancreas, human salivary glands, yellow meal beetle, Bacillus amyloliquefaciens, and Bacillus licheniformis) unfold irreversibly according to a non-two-state mechanism. Unlike mesophilic alpha-amylases, the melting point of AHA is independent of calcium and chloride binding while the allosteric and structural functions of these ions are conserved. The thermostability of AHA at optimal conditions is characterized by a Tm of 43.7 degrees C, a DeltaHcal of 238 kcal mol-1, and a DeltaCp of 8.47 kcal mol-1 K-1. These values were used to calculate the Gibbs free energy of unfolding over a wide range of temperatures. This stability curve shows that (a) the specific DeltaGmax of AHA [22 cal (mol of residue)-1] is 4 times lower than that of mesophilic alpha-amylases, (b) group hydration plays a crucial role in the enzyme flexibility at low temperatures, (c) the temperature of cold unfolding closely corresponds to the lower limit of bacterial growth, and (d) the recombinant heat-labile enzyme can be expressed in mesophilic hosts at moderate temperatures. It is also argued that the cold-active alpha-amylase has evolved toward the lowest possible conformational stability of its native state.

  14. Development of an amylolytic Lactobacillus plantarum silage strain expressing the Lactobacillus amylovorus alpha-amylase gene.

    PubMed Central

    Fitzsimons, A; Hols, P; Jore, J; Leer, R J; O'Connell, M; Delcour, J

    1994-01-01

    An amylolytic Lactobacillus plantarum silage strain with the starch-degrading ability displayed by Lactobacillus amylovorus was developed. An active fragment of the gene coding for alpha-amylase production in L. amylovorus was cloned and integrated into the chromosome of the competitive inoculant strain L. plantarum Lp80 at the cbh locus. The alpha-amylase gene fragment was also introduced into L. plantarum Lp80 on an autoreplicative plasmid. Both constructions were also performed in the laboratory strain L. plantarum NCIB8826. All four recombinant strains secreted levels of amylase ranging from 23 to 69 U/liter, compared with 47 U/liter for L. amylovorus. Secretion levels were higher in L. plantarum NCIB8826 than in L. plantarum Lp80 derivatives and were higher in recombinant strains containing autoreplicative plasmids than in the corresponding integrants. The L. plantarum Lp80 derivative containing the L. amylovorus alpha-amylase gene fragment integrated into the host chromosome secreted alpha-amylase to a level comparable to that of L. amylovorus and was stable over 50 generations of growth under nonselective conditions. It grew to a higher cell density than either the parent strain or L. amylovorus in MRS medium containing a mixture of starch and glucose as the fermentable carbohydrate source. This recombinant alpha-amylolytic L. plantarum strain would therefore seem to have considerable potential as a silage inoculant for crops such as alfalfa, in which water-soluble carbohydrate levels are frequently low but starch is present as an alternative carbohydrate source. Images PMID:7986030

  15. Complete sequence, subunit structure, and complexes with pancreatic alpha-amylase of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Kasahara, K; Hayashi, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    1996-07-01

    The complete amino acid sequence of a white kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor (PHA-I), which is composed of two kinds of glycopolypeptide subunits, alpha and beta, was established by conventional methods. The polypeptide molecular weight of PHA-I determined by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that PHA-I has the subunit stoichiometry of (alpha beta)2 complex. Inhibition test of PHA-I with increasing amounts of porcine pancreatic alpha-amylase (PPA) suggested that an inactive 2:1 complex is formed between PPA and PHA-I. In fact, two complexes differing from each other in the molar ratio of PPA to PHA-I were separated by gel filtration, and molecular weight estimation by the light-scattering technique confirmed that they are complexes of PHA-I with one or two PPA molecules. The binding of PPA to PHA-I appeared to follow simple binomial statistics, suggesting that two binding sites on PHA-I are independent and of high affinity for PPA.

  16. Concurrent attenuated reactivity of alpha-amylase and cortisol is related to disruptive behavior in male adolescents.

    PubMed

    de Vries-Bouw, Marjan; Jansen, Lucres; Vermeiren, Robert; Doreleijers, Theo; van de Ven, Peter; Popma, Arne

    2012-06-01

    Attenuated reactivity of salivary alpha-amylase has been proposed as a specific sympathetic marker of disruptive behavior in juveniles and may have additional value to studying other autonomic parameters and hypothalamic-pituitary-adrenal axis activity. Investigating the interrelationships between neurobiological parameters in relation to juvenile disruptive behavior may enhance insight into the complex mechanisms at play. We investigated salivary alpha-amylase, cortisol, heart rate (HR), and heart rate variability (HRV) in response to a standardized public speaking task, and examined interactions between these parameters in relation to disruptive behavior. Participants were 48 delinquent male adolescents (mean age 18.4 years, SD 0.9), with and without a disruptive behavior disorder (resp. DP+, DP-) and 16 matched normal controls (NC). A structured psychiatric interview as well as the Youth Self Report and Child Behavior Checklist were administered to assess disruptive behavior. Alpha-amylase and cortisol reactivity, but not HR or HRV, showed significant inverse associations with dimensional measures of disruptive behavior. Moreover, both cortisol and alpha-amylase reactivity were significantly lower in the DP+ group as compared to the NC group. The mentioned relationships remained present when nicotine use was entered as a covariate. Combining alpha-amylase and cortisol in one model explained a larger part of the variance of disruptive behavior than either single parameter. There were no interactions between alpha-amylase and cortisol or HRV in relation to disruptive behavior. Attenuated alpha-amylase responsivity to stress is a correlate of disruptive behavior in late-adolescent males. Although nicotine use explains a considerable part of the variance of disruptive behavior, both alpha-amylase and cortisol are related to disruptive behavior, over and above the effect of nicotine use. Combining alpha-amylase and cortisol improved insight into neurobiological

  17. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    PubMed

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  18. Preparation, characterization and biocatalytic activity of a nanoconjugate of alpha amylase and silver nanoparticles.

    PubMed

    Mishra, Abhijeet; Ahmad, Razi; Singh, Veena; Gupta, Munishwar Nath; Sardar, Meryam

    2013-07-01

    The primary challenge in developing nanoparticle based enzymatic devices is to be able to chemically immobilize an enzyme, which will retain its activity or improve its function while being attached to the nanoparticle. This would be of even greater significance if the whole process could be performed under benign conditions without having to resort to functionalization of key molecules at various steps. In the present study the conjugates of amylase and silver nanoparticles were synthesized using neem leaf extract as the reducing and stabilizing agent. The silver nanoparticles were characterized using Surface Plasmon Resonance Spectra, Dynamic Light Spectroscopy (DLS), Fourier Transform Infrared Spectroscopy (FTIR), Circular Dichroism (CD) and Surface Tunneling Microscopy (STM). The silver nanoparticles retained 85% amylase activity. The nanobiocatalyst was further characterized in terms of kinetic parameters and thermal stability. It was thermally more stable as compared to the free alpha amylase enzyme.

  19. Icodextrin metabolism and alpha-amylase activity in nonuremic rats undergoing chronic peritoneal dialysis.

    PubMed

    García-López, Elvia; Pawlaczyk, Krzysztof; Anderstam, Björn; Qureshi, A Rashid; Kuzlan-Pawlaczyk, Malgorzata; Heimbürger, Olof; Werynski, Andrzej; Lindholm, Bengt

    2007-01-01

    To study the metabolism of icodextrin and alpha-amylase activity following daily exposure to dialysis solutions containing either glucose or icodextrin as osmotic agent in rats. Male Wistar rats with implanted peritoneal catheters were infused twice daily for 3 weeks with 20 mL 7.5% icodextrin-based peritoneal dialysis fluid (IPDF; ICO group, n = 12) or 3.86% glucose-based peritoneal dialysis fluid (GLU group, n = 11). A 4-hour dwell study using 30 mL IPDF was performed on day 10 (D1) and day 21 (D2) in both the ICO and the GLU groups. Radiolabeled serum albumin (RISA) was used as a macromolecular volume marker. Dialysate samples were collected at 3, 15, 30, 60, 90, 120, and 240 minutes. Blood samples were drawn before the start and at the end of the dwell. During all dwell studies, the dialysate concentrations of total icodextrin decreased due to decrease in high molecular weight (MW) fractions, whereas there was a marked increase in icodextrin low MW metabolites. alpha-Amylase activity increased in dialysate and decreased in plasma. About 60% of the total icodextrin was absorbed from the peritoneal cavity during the 4-hour dwells. Low MW icodextrin metabolites were present in the dialysate already at 3 minutes, and maltose (G2), maltotriose (G3), maltotetraose (G4), and maltopentaose (G5) increased progressively, reaching maximum concentrations at 60 minutes. Maltohexaose (G6) and maltoheptaose (G7) were also detected already at 3 minutes but did not change significantly during the dwells. During the two 4-hour dwell studies (D1 and D2), the concentrations of total icodextrin and icodextrin metabolites and alpha-amylase activity in dialysate did not differ between the ICO and GLU groups, during either D1 or D2. No icodextrin metabolites were detected in plasma at the end of the dwells. alpha-Amylase activity in the dialysate increased six- to eightfold whereas plasma alpha-amylase activity decreased by 21% - 26% during the two 4-hour dwells in both the ICO and

  20. [Alpha-amylase as an occupational allergen in baking industry employees].

    PubMed

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Structure and sequence based analysis of alpha-amylase evolution.

    PubMed

    Singh, Swati; Guruprasad, Lalitha

    2014-01-01

    α-Amylases hydrolyze α- 1,4-glycosidic bonds during assimilation of biological macromolecules. The amino acid sequences of these enzymes in thousands of diverse organisms are known and the 3D structures of several proteins have been solved. The 3D structure analysis of these universal enzymes from diverse organisms has been studied by the generation of phylogenetic trees and structure based sequence analysis to generate a metric for the degree of conservation that is responsible for individual speciation. Greater similarities are observed between reference NCBI tree and structure based phylogenetic tree compared to sequence based phylogenetic tree indicating that structures truly represent the functional aspects of proteins than from the sequence information alone. We report differences in the profile specific conserved and insertion/deletion regions, factors responsible for the Ca(2+) and Cl(-) ion binding and the disulfide connectivity pattern that discriminate the enzymes over evolution.

  2. In vitro alpha-glucosidase and alpha-amylase enzyme inhibitory effects of Andrographis paniculata extract and andrographolide.

    PubMed

    Subramanian, Rammohan; Asmawi, M Zaini; Sadikun, Amirin

    2008-01-01

    There has been an enormous interest in the development of alternative medicines for type 2 diabetes, specifically screening for phytochemicals with the ability to delay or prevent glucose absorption. The goal of the present study was to provide in vitro evidence for potential inhibition of alpha-glucosidase and alpha-amylase enzymes, followed by a confirmatory in vivo study on rats to generate a stronger biochemical rationale for further studies on the ethanolic extract of Andrographis paniculata and andrographolide. The extract showed appreciable alpha-glucosidase inhibitory effect in a concentration-dependent manner (IC(50)=17.2+/-0.15 mg/ml) and a weak alpha-amylase inhibitory activity (IC(50)=50.9+/-0.17 mg/ml). Andrographolide demonstrated a similar (IC(50)=11.0+/-0.28 mg/ml) alpha-glucosidase and alpha-amylase inhibitory activity (IC(50)=11.3+/-0.29 mg/ml). The positive in vitro enzyme inhibition tests paved way for confirmatory in vivo studies. The in vivo studies demonstrated that A. paniculata extract significantly (P<0.05) reduced peak blood glucose and area under curve in diabetic rats when challenged with oral administration of starch and sucrose. Further, andrographolide also caused a significant (P<0.05) reduction in peak blood glucose and area under the curve in diabetic rats. Hence alpha-glucosidase inhibition may possibly be one of the mechanisms for the A. paniculata extract to exert antidiabetic activity and indicates that AP extract can be considered as a potential candidate for the management of type 2 diabetes mellitus.

  3. Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

    PubMed

    Attia, M S; Al-Radadi, Najlaa S

    2016-12-15

    A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Dual feeding strategy for the production of alpha-amylase by Bacillus caldolyticus using complex media.

    PubMed

    Schwab, Karima; Bader, Johannes; Brokamp, Christian; Popović, Milan K; Bajpai, Rakesh; Berovic, Marin

    2009-10-01

    In this study, the objective was to investigate an exponential feeding strategy for fed-batch production of thermostable alpha-amylase (E.C. 3.2.1.1.) from the Bacillus caldolyticus (DSM405). The parameters for establishing compositions of feed media and feeding rate were obtained by statistical analysis of batch and continuous shake flask experiments. These parameters were casitone to starch ratio of 2.67g(casitone)g(starch)(-1), maintenance coefficient 0.174g(casitone)g(DW)(-1)h(-1), cell yield 0.62g(DW)g(casitone)(-1) and mu(opt)=0.2h(-1). The exponentially fed fermentation resulted in yield of 120Uml(-1) alpha-amylase that was thermostable up to 105 degrees C. Results of the exponentially fed fermentation have been discussed in the light of a feed-back controlled fed-batch fermentation reported earlier by the authors. A comparison of the temperature and pH effects on amylase produced by B. caldolyticus and on several other commercially available amylases has also been presented.

  5. Molecular structure of a barley alpha-amylase-inhibitor complex: implications for starch binding and catalysis.

    PubMed

    Kadziola, A; Søgaard, M; Svensson, B; Haser, R

    1998-04-24

    alpha-Amylases are widely occurring, multidomain proteins with a catalytic (beta/alpha)8-barrel. In barley alpha-amylase, insight into the catalytic mechanism is gained from the X-ray crystal structure of its molecular complex with acarbose, a pseudotetrasaccharide that acts like a transition-state analogue and which is shown to bind at two specific regions of the enzyme. The structure of the complex has been refined to an R-factor of 15.1% for all observations with Fo>sigma(Fo) between 10 and 2.8 A resolution. A difference Fourier map produced after refinement of the native structure against the data of the acarbose complex clearly revealed density corresponding to two oligosaccharide-binding sites. One of these is defined as the surface-located starch granule-binding site characteristic of cereal alpha-amylases. It involves stacking of two acarbose rings on Trp276 and Trp277. The other binding region is the active site covering subsites -1, +1 and +2. Here, Glu204 is positioned to act in general acid/base catalysis protonating the glucosidic oxygen atom assisted by Asp289. A water molecule that bridges Glu204 and Asp289 is found at the entrance cavity containing a total of five water molecules. This water molecule is proposed to reprotonate Glu204 and supply the hydroxyl ion for nucleophilic attack on the glucosyl C1 atom. Asp 179 acts as the nucleophile that can bind covalently to the substrate intermediate after bond cleavage. The present complex structure together with the conservation of active-site residues among alpha-amylases and related enzymes, are consistent with a common catalytic mechanism for this class of retaining carbohydrases.

  6. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  7. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    USDA-ARS?s Scientific Manuscript database

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  8. Diurnal profiles of salivary cortisol and alpha-amylase change across the adult lifespan: evidence from repeated daily life assessments.

    PubMed

    Nater, Urs M; Hoppmann, Christiane A; Scott, Stacey B

    2013-12-01

    Salivary cortisol and alpha-amylase are known to have distinctive diurnal profiles. However, little is known about systematic changes in these biomarkers across the adult lifespan. In a study of 185 participants (aged 20-81 years), time-stamped salivary cortisol and alpha-amylase were collected 7 times/day over 10 days. Samples were taken upon waking, 30 min later, and then approximately every 3 h until 9 pm. Multilevel models showed that older age was associated with increased daily cortisol secretion as indicated by greater area under the curve, attenuated wake-evening slopes, and more pronounced cortisol awakening responses. Further, older age was related to greater daily alpha-amylase output and attenuated wake-evening slopes. No age differences were observed regarding the alpha-amylase awakening response. Our findings may contribute to a better understanding of age-related differences in functioning of stress-related systems. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Production and characterization of a thermostable alpha-amylase from Nocardiopsis sp. endophyte of yam bean.

    PubMed

    Stamford, T L; Stamford, N P; Coelho, L C; Araújo, J M

    2001-01-01

    Thermostable amylolytic enzymes have been currently investigated to improve industrial processes of starch degradation. Studies on production of alpha-amylase by Nocardiopsis sp., an endophytic actinomycete isolated from yam bean (Pachyrhizus erosus L. Urban), showed that higher enzyme levels were obtained at the end of the logarithmic growth phase after incubation for 72 h at pH 8.6. Maximum activity of alpha-amylase was obtained at pH 5.0 and 70 degrees C. The isolated enzyme exhibited thermostable properties as indicated by retention of 100% of residual activity at 70 degrees C, and 50% of residual activity at 90 degrees C for 10 min. Extracellular enzyme from Nocardiopsis sp. was purified by fractional precipitation with ammonium sulphate. After 60% saturation produced 1130 U mg-1 protein and yield was 28% with purification 2.7-fold. The enzyme produced by Nocardiopsis sp. has potential for industrial applications.

  10. Simple structured model for alpha-amylase synthesis by Bacillus amyloliquefaciens.

    PubMed

    Ponzo, J H; Weigand, W A

    1991-11-01

    A predictive, simple, structured model describing the synthesis of alpha-amylase by Bacillus amyloliquefaciens was formulated. Three key intracellular processes were identified (i.e, translation, and excretion) along with two key intracellular components (i.e., mRNA and the intracellular form of the alpha-amylase enzyme). Nearly all the model parameters were estimated by means of performing independent experiments, primarily fed-batch experiments. The model was shown to predict transient system behavior in batch and in fed-batch operation with some limitation and minor model parameter revisions. Since a principal objective was to demonstrate that independent experimental parameter determination can be used to construct the predictive model, further fine-tuning of the parameters may be necessary before application for optimization and control purposes.

  11. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  12. alpha-Amylase inhibitory activity of some Malaysian plants used to treat diabetes; with particular reference to Phyllanthus amarus.

    PubMed

    Ali, Hasenah; Houghton, P J; Soumyanath, Amala

    2006-10-11

    Extracts of six selected Malaysian plants with a reputation of usefulness in treating diabetes were examined for alpha-amylase inhibition using an in vitro model. Inhibitory activity studied by two different protocols (with and without pre-incubation) showed that Phyllanthus amarus hexane extract had alpha-amylase inhibitory properties. Hexane and dichloromethane extracts of Anacardium occidentale, Lagerstroemia speciosa, Averrhoa bilimbiPithecellobium jiringa and Parkia speciosa were not active when tested without pre-incubation. Extraction and fractionation of Phyllanthus amarus hexane extract led to the isolation of dotriacontanyl docosanoate, triacontanol and a mixture of oleanolic acid and ursolic acid. Dotriacontanyl docosanoate and the mixture of oleanolic acid and ursolic acid are reported from this plant species for the first time. All compounds were tested in the alpha-amylase inhibition assay and the results revealed that the oleanolic acid and ursolic acid (2:1) mixture was a potent alpha-amylase inhibitor with IC(50)=2.01 microg/ml (4.41 microM) and that it contributes significantly to the alpha-amylase inhibition activity of the extract. Three pure pentacyclic triterpenoids, oleanolic acid, ursolic acid and lupeol were shown to inhibit alpha-amylase.

  13. Three alpha-amylases from malted finger millet (Ragi, Eleusine coracana, Indaf-15)--purification and partial characterization.

    PubMed

    Nirmala, M; Muralikrishna, G

    2003-01-01

    Three alpha-amylases (E.C. 3.2.1.1) were purified to apparent homogeneity from 72 h finger millet malt by three step purification via fractional acetone precipitation, DEAE-Sephacel ion exchange and Sephacryl S-200 gel permeation chromatographies with a recovery of 6.5, 2.9, 9.6% and fold purification of 26, 17 and 31, respectively. alpha-Nature of these amylases was identified by their ability to rapidly reduce the viscosity of starch solution and also in liberating oligosaccharides of higher D.P. and were accordingly designated as amylases alpha-1((b)), alpha-2 and alpha-3, respectively. These amylases, having a molecular weight of 45+/-2 kDa were found to be monomeric. The pH and temperature optima of these alpha-amylases were found to be in the range of 5.0-5.5 and 45-50 degrees C, respectively. K(m) values of these amylases for various cereal starches varied between 0.59 and 1.43%. Carbodiimide (50 mM) and metal ions such as Al(3+), Fe(2+), and Hg(2+) (5 mM) have completely inhibited these enzymes at 45 degrees C. Amino acid analysis of these enzymes indicated high amounts of glycine which is an unusual feature of these enzymes.

  14. Alpha-amylase from mung beans (Vigna radiata)--correlation of biochemical properties and tertiary structure by homology modelling.

    PubMed

    Tripathi, Pallavi; Lo Leggio, Leila; Mansfeld, Johanna; Ulbrich-Hofmann, Renate; Kayastha, Arvind M

    2007-06-01

    Alpha-amylase from germinated mung beans (Vigna radiata) has been purified 600-fold to electrophoretic homogeneity and a final specific activity of 437 U/mg. SDS-PAGE of the final preparation revealed a single protein band of 46 kDa. The optimum pH was 5.6. The energy of activation was determined to be 7.03 kcal/mol in the temperature range 15-55 degrees C. Km for starch was 1.6 mg/mL in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 70 degrees C showed first-order kinetics with rate constant (k) equal to 0.005 min(-1). Mung bean alpha-amylase showed high specificity for its primary substrate starch. Addition of EDTA (10 mM) caused irreversible loss of activity. Mung bean alpha-amylase is inhibited in a non-competitive manner by heavy metal ions, for example, mercury with a Ki of 110 microM. Homology modelling studies with mung bean alpha-amylase using barley alpha-amylases Amy 1 and Amy 2 as templates showed a very similar structure as expected from the high sequence identity. The model showed that alpha-amylase from mung beans has no sugar-binding site, instead it has a methionine. Furthermore, instead of two tryptophans, it has Val(277) and Lys(278), which are the conserved residues, important for proper folding and conformational stability.

  15. Characteristics of alpha-Amylase during Germination of Two High-Sugar Sweet Corn Cultivars of Zea mays L.

    PubMed

    Sanwo, M M; Demason, D A

    1992-07-01

    The role of the scutellum and the aleurone in alpha-amylase production in the high-sugar sweet corn cultivars Illini X-tra Sweet (shrunken-2, sh2) and Illinois 677a (sugary, sugary enhancer; su se) was compared to that in the starchy (Su) hybrid Funks G4646 with the use of alpha-amylase enzyme assays, isoelectric focusing, electron microscopy, and laser scanning confocal microscopy. The scutellum of Illinois 677a had low levels of alpha-amylase activity compared to that of Funks G4646 through 10 days after imbibition, and the aleurone of Illini X-tra Sweet had negligible activity. On the isoelectric focusing gels, the Illinois 677a scutellum had fewer alpha-amylase isozymes at 7 days compared to the Funks G4646 scutellum. The Illini X-tra Sweet aleurone had no alpha-amylase isozymes. Funks G4646 scutellar epithelial and aleurone cells contained abundant rough endoplasmic reticulum, polysomes, and dictyosomes at 5 and 7 days, respectively. The scutellar epithelial cells of Illinois 677a contained fewer of these structures by 5 days, and the Illini X-tra Sweet aleurone contained mostly lipid bodies through 7 days. Few cytoplasmic membranes and little RNA were detected with laser scanning confocal microscopy in the Illini X-tra Sweet aleurone compared to Funks G4646 at 7 days. These data suggest that the scutellum of Illinois 677a and the aleurone of Illini X-tra Sweet have impaired abilities to produce alpha-amylase.

  16. Encapsulation of alpha-amylase into starch-based biomaterials: an enzymatic approach to tailor their degradation rate.

    PubMed

    Azevedo, Helena S; Reis, Rui L

    2009-10-01

    This paper reports the effect of alpha-amylase encapsulation on the degradation rate of a starch-based biomaterial. The encapsulation method consisted in mixing a thermostable alpha-amylase with a blend of corn starch and polycaprolactone (SPCL), which were processed by compression moulding to produce circular disks. The presence of water was avoided to keep the water activity low and consequently to minimize the enzyme activity during the encapsulation process. No degradation of the starch matrix occurred during processing and storage (the encapsulated enzyme remained inactive due to the absence of water), since no significant amount of reducing sugars was detected in solution. After the encapsulation process, the released enzyme activity from the SPCL disks after 28days was found to be 40% comparatively to the free enzyme (unprocessed). Degradation studies on SPCL disks, with alpha-amylase encapsulated or free in solution, showed no significant differences on the degradation behaviour between both conditions. This indicates that alpha-amylase enzyme was successfully encapsulated with almost full retention of its enzymatic activity and the encapsulation of alpha-amylase clearly accelerates the degradation rate of the SPCL disks, when compared with the enzyme-free disks. The results obtained in this work show that degradation kinetics of the starch polymer can be controlled by the amount of encapsulated alpha-amylase into the matrix.

  17. Evolutionary studies on an alpha-amylase gene segment in bats and other mammals.

    PubMed

    Redondo, Rodrigo A F; Santos, Fabrício R

    2006-01-01

    Comparative studies of salivary glands showed that they maybe related to the adaptive radiation of bats, especially in the family Phylostomidae. In this study we have been searching for a likely relationship between different feeding habits found in bats and possible adaptive changes in a coding segment of the alpha-amylase enzyme. We have also tested some hypothesis about the phylogenetic relationship of bats and other mammals. A 663 bp segment of the alpha-amylase gene, corresponding to the exon 4 and part of the intron c, was sequenced in nine bat species. The exon 4 was also sequenced in further ten mammalian species. The phylogenetic trees generated with different methods produced the same results. When the intron c and the exon 4 were independently analyzed, they showed distinct topologies involving the bat species Sturnira lilium, different from the traditional bat phylogeny. Phylogenetic analysis of bats, primates and rodents supports the Euarchontoglires-Laurasiatheria hypothesis about the relationship among these groups. Selection tests showed that the alpha-amylase exon 4 is under strong purifying selection, probably caused by functional constraints. The conflicting bat phylogenies could not be explained by evolutionary convergence due to adaptive forces, and the different topologies may be likely due to the retention of plesiomorphic characters or the independent acquisition by evolutionary parallelism.

  18. Mutation of Alternaria tenuissima FCBP-252 for hyper-active alpha-amylase.

    PubMed

    Shafique, Sobiya; Bajwa, Rukhsana; Shafique, Shazia

    2009-07-01

    Production of extracellular alpha-amylase enzyme by a filamentous fungus, Alternaria tenuissima was studied in solid-state fermentation (SSF) as well as submerged fermentation (SmF). The potential strain was successfully mutated by UV and ethyl methanesulfonate (EMS). High-level of alpha-amylase activity was obtained by the mutant At-Ch-5.6 (76.75 Units mL(-1)) after chemical treatment followed by UV mutant At-UV-2.8 (63.12 Units mL(-1)) which was significantly higher than parental A. tenuissima FCBP-252 (32 Units mL(-1)). These mutants with high levels of activity were genetically characterized using RAPD-PCR. Expression pattern of mutants exhibited that the mutants were isogenic variants of parent strain and out-performance of the mutants could be attributed to change in genetic make up. This work represented the first report of strain improvement in Alternaria for hyper activity of alpha-amylase enzyme and suggested that this fungus could be used to extract purified enzyme.

  19. Production and properties of alpha-amylase from Penicillium chrysogenum and its application in starch hydrolysis.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2005-01-01

    Fungi were screened for their ability to produce alpha-amylase by a plate culture method. Penicillium chrysogenum showed high enzymatic activity. Alpha-amylase production by P. chrysogenum cultivated in liquid media containing maltose (2%) reached its maximum at 6-8 days, at 30 degrees C, with a level of 155 U ml(-1). Some general properties of the enzyme were investigated. The optimum reaction pH and temperature were 5.0 and 30-40 degrees C, respectively. The enzyme was stable at a pH range from 5.0-6.0 and at 30 degrees C for 20 min and the enzyme's 92.1% activity's was retained at 40 degrees C for 20 min without substrate. Hydrolysis products of the enzyme were maltose, unidefined oligosaccharides, and a trace amount of glucose. Alpha-amylase of P. chrysogenum hydrolysed starches from different sources. The best hydrolysis was determined (98.69%) in soluble starch for 15 minute at 30 degrees C.

  20. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112].

    PubMed

    Mariani, D D; Lorda, G; Balatti, A P

    2000-01-01

    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  1. [Activity of alpha-amylase and concentration of protein in saliva of pregnant women].

    PubMed

    Ciejak, Magdalena; Olszewska, Maria; Jakubowska, Katarzyna; Zebiełowicz, Dariusz; Safranow, Krzysztof; Chlubek, Dariusz

    2007-01-01

    One of the hypothetical reasons of the increased incidence of caries in women during the pregnancy may be the increased activity of alpha-amylase, which can be found in their saliva. The enzyme takes part in the process of decomposition of simple sugars, which make basic substrate for caries-causing bacteria. The aim of the paper was the evaluation of the influence of pregnancy and gestational age on the activity of alpha-amylase and the concentration of protein in women's saliva. The examined group consisted of 64 pregnant women at age 17-39, between 21st and 40th week of pregnancy. The control group consisted of 44 healthy women at age 20-35, who were not pregnant. In saliva, which was taken before morning meal, without stimulation, protein concentration was determined by Bradford method and the activity of amylase was determined by kinetic method. The activity of amylase correlated strongly and positively with protein concentration in saliva of both the pregnant (RS = +0.65; p < 0.00001) and the control group (RS = +0.74; p < 0.00001) women. There were no significant differences between examined parameters in the examined and the control group. It has been observed in the examined group, that there is the significant negative correlation between protein concentration in saliva and the week of pregnancy (RS = -0.35; p <0.01). It has been observed, in conducted researches, that there is no relation between the activity of amylase and the pregnancy and gestational age, which proves against the essential role of this enzyme in the increased caries incidence of pregnant women. However, the observed changes of total protein concentration in saliva during pregnancy, suggest that the exact cognition of proteins in pregnant women's saliva may reveal new mechanisms, which lead to an increase of caries risk.

  2. Study of serum lipase, alpha-amylase and pancreatic amylose in gall-stone diseases.

    PubMed

    Bera, Swati; Bhattacharyya, Swati; Ghose, Bikash C; Bera, Tapas; Mukhopadhyay, Surajit K; Saha, Mita

    2011-09-01

    Silent gall-stone causes significant morbidity and mortality and its incidence in India as well as in whole world is on the rise. It has positive correlation with development of carcinoma gall bladder. So far no predictive study has been done to show its correlation with biochemical markers. The present study has been aimed to establish whether simple enzymatic markers can predict association with cholelithiasis. Study group has been selected from the patients attending general surgery OPD of a tertiary healthcare centre with complaints of vague abdominal pain, flatulence and dyspepsia. A total of 61 cases (male = 18, female = 43) were studied and data matched with age and sex matched control. The biochemical markers studied are serum alkaline phosphatase, serum lipase, serum alpha-amylase and serum pancreatic amylase. Patients with obstructive cholelithiasis, duct stones, pancreatic insufficiency and malignancy are excluded from the study. The results were analysed by Student's t-test. Alkaline phosphatase in all the above mentioned cases was not significantly different from the control group (40 female, 21 male healthy individuals). A significant association was found out with serum alpha-amylase (p < 0.05) and a highly significant association was found out with pancreatic amylase (p < 0.001). Results of serum lipase however were inconclusive (p = 0.1). Pancreatic amylase can be estimated at a reasonable cost and costwise may prove to be a marker of gall-stone diseases which are in many cases silent preventing further complications and chances of Malignancy especially where alkaline phosphatase isinconclusive.

  3. Development and validation of a monoclonal based immunoassay for the measurement of fungal alpha-amylase: focus on peak exposures.

    PubMed

    Elms, J; Denniss, S; Smith, M; Evans, P G; Wiley, K; Griffin, P; Curran, A D

    2001-03-01

    The inhalation of flour dust has been implicated in the induction of sensitisation and elicitation of respiratory symptoms, such as asthma in bakers. In addition to the cereal allergens present in wheat flour, enzymes in flour improvers, in particular fungal alpha-amylase, are now known to be a significant cause of respiratory allergy in the baking industry.A monoclonal antibody based enzyme-linked immunoassay (ELISA) was developed using two monoclonal antibodies that recognised two distinct epitopes of the fungal alpha-amylase enzyme. The ELISA had an inter-assay variation of 12.0% at 1360 pg/ml and 12.8% at 564 pg/ml and intra-assay variation of 4.9% at 1340 pg/ml and 6.1% at 504 pg/ml. The assay had a sensitivity of 200 pg/ml. Competitive inhibition assays confirmed that the monoclonal antibodies had no cross reactivity with other enzymes used in the baking industry and could distinguish added fungal alpha-amylase from cereal amylase. We assessed the levels of exposure to dust, total protein and fungal alpha-amylase in four UK bakeries ranging in size and technical capabilities. Within the bakeries we surveyed, workers were exposed to variable levels of inhalable dust (0.8-39.8 mg/m3), total protein (0-5.7 mg/m3) and fungal alpha-amylase (0-29.8 ng/m3). Consecutive 15 min personal samples taken over a 1 h period demonstrated that the ELISA could measure fungal alpha-amylase exposure in such a 15 min period. Short term peak exposures to fungal alpha-amylase could be identified which may contribute to the sensitisation in individuals who appear to have low exposure levels if measured over a full shift period.

  4. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86

    PubMed Central

    2011-01-01

    Background Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. Results The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Conclusions Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both

  5. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86.

    PubMed

    Altenbach, Susan B; Vensel, William H; Dupont, Frances M

    2011-07-20

    Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both plant defense mechanisms and

  6. Interaction of europium and curium with alpha-amylase.

    PubMed

    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert

    2016-06-07

    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  7. Purification by expanded bed adsorption and characterization of an alpha-amylases FORILASE NTL from A. niger.

    PubMed

    Toledo, A L; Severo, J B; Souza, R R; Campos, E S; Santana, J C C; Tambourgi, E B

    2007-02-01

    In this work the purification and biochemistry characterization of alpha-amylases from Aspergillus niger (FORILASE NTL) were studied. The effects of expansion degree of resin bed on enzyme purification by expanded bed adsorption (EBA) have also been studied. Residence time distributions (RTD) studies were done to achieve the optimal conditions of the amylases recovery on ion-exchange resin, and glucose solution was used as a new tracer. Results showed that height equivalent of the theoretical plates (HETP), axial dispersion and the Prandt number increased with bed height, bed voidage and linear velocity. The adsorption capacity of alpha-amylases, on the resin, increased with bed height and the best condition was at four-expansion degree. alpha-Amylase characterization showed that this enzyme has high affinity with soluble starch, good hydrolysis potential and molecular weight of 116 kDa.

  8. Solution structure of the main alpha-amylase inhibitor from amaranth seeds.

    PubMed

    Martins, J C; Enassar, M; Willem, R; Wieruzeski, J M; Lippens, G; Wodak, S J

    2001-04-01

    The most abundant alpha-amylase inhibitor (AAI) present in the seeds of Amaranthus hypochondriacus, a variety of the Mexican crop plant amaranth, is the smallest polypeptide (32 residues) known to inhibit alpha-amylase activity of insect larvae while leaving that of mammals unaffected. In solution, 1H NMR reveals that AAI isolated from amaranth seeds adopts a major trans (70%) and minor cis (30%) conformation, resulting from slow cis-trans isomerization of the Val15-Pro16 peptide bond. Both solution structures have been determined using 2D 1H-NMR spectroscopy and XPLOR followed by restrained energy refinement in the consistent-valence force field. For the major isomer, a total of 563 distance restraints, including 55 medium-range and 173 long-range ones, were available from the NOESY spectra. This rather large number of constraints from a protein of such a small size results from a compact fold, imposed through three disulfide bridges arranged in a cysteine-knot motif. The structure of the minor cis isomer has also been determined using a smaller constraint set. It reveals a different backbone conformation in the Pro10-Pro20 segment, while preserving the overall global fold. The energy-refined ensemble of the major isomer, consisting of 20 low-energy conformers with an average backbone rmsd of 0.29 +/- 0.19 A and no violations larger than 0.4 A, represents a considerable improvement in precision over a previously reported and independently performed calculation on AAI obtained through solid-phase synthesis, which was determined with only half the number of medium-range and long-range restraints reported here, and featured the trans isomer only. The resulting differences in ensemble precision have been quantified locally and globally, indicating that, for regions of the backbone and a good fraction of the side chains, the conformation is better defined in the new solution structure. Structural comparison of the solution structure with the X-ray structure of the

  9. Chewing bread: impact on alpha-amylase secretion and oral digestion.

    PubMed

    Joubert, Marianne; Septier, Chantal; Brignot, Hélène; Salles, Christian; Panouillé, Maud; Feron, Gilles; Tournier, Carole

    2017-02-22

    During chewing, saliva helps in preparing the food bolus by agglomerating the formed particles, and it initiates enzymatic food breakdown. However, limited information is actually available on the adaptation of saliva composition during the oral processing of complex foods, especially for foods that are sensitive to salivary enzymes. We addressed this question in the context of starch-based products and salivary alpha-amylase. The objectives were two-fold: (1) to determine if salivary alpha-amylase secretion can be modulated by the bread type and (2) to evaluate the contribution of the oral phase in bread enzymatic breakdown. Mouthfuls of three different wheat breads (industrial, artisan and whole-meal breads) were chewed by twelve subjects. Saliva samples were collected at rest and at different times corresponding to 33, 66 and 100% of the individual's chewing sequence. Alpha-amylase activity and total protein content were determined for all saliva samples that were collected. Additionally, the salivary maltose concentration was measured as a marker of bread enzymatic digestion. Boluses were collected at the swallowing time to evaluate the saliva uptake. Chewing industrial bread induced higher saliva uptake than the other breads despite a similar chewing duration. The evolution of salivary amylase activity tended to depend on the type of bread and was highly influenced by a large degree of inter- and intra-subject variability. The protein and maltose concentration steadily increased during chewing as a result of bread breakdown. The salivary protein concentration was mainly affected by the release of the water-soluble proteins of the bread. The salivary maltose concentration was found to be significantly lower for the whole-meal bread. When considering the weight of the mouthful, enzymatic breakdown was found to be most efficient for the breads ranking from industrial > artisan > whole-meal.

  10. Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.

    PubMed Central

    McWethy, S J; Hartman, P A

    1977-01-01

    A medium was developed to obtain maximum yields of extracellular amylase from Bacteroides amylophilus 70. Crude enzyme preparation, obtained by ammonium sulfate precipitation of cell-free broth, contained six amylolytic isoenzymes that were detected by isoelectric focusing and polyacrylamide gel electrophoresis. One of these amylases was purified by diethylaminoethyl-Sephadex A-50 ion-exchange chromatography and Sephadex G-200 gel filtration techniques. Some properties of the purified extracellular alpha-amylase were: optimum pH, 6.3; optimum temperature, 43 degrees C: PH stability range, 5.8 to 7.5; isoelectric point, pH 4.6; molecular weight, 92,000 (by sodium dodecyl sulfatedisc gel electrophoresis); and sugars causing inhibition, cyclomaltoheptaose, cyclomaltohexaose, and alpha-d-phenylglucoside. In addition, Ca2+ and Co2+ were strong activators,and Hg2+ was a strong inhibitior; all other cations were slightly stimulatory. Dialysis against 0.01 M ethylenediaminetetraacetic acid caused a 58% loss of activity that was restored to 92% of the original by the addition of 0.04 M Ca2+. The enzyme affected a blue-value-reducing-value curve characteristic of alpha-type amylases. The relative rates of hydrolysis of amylose, soluble starch, amylopectin, and dextrin were 100, 97, 92, and 60%, respectively; Michaelis constants for these substrates were 18.2, 18.7, 18.2, and 16.7 mumol of d-glucosidic bond/liter, respectively. The enzyme degraded maize (corn) starch granules to some extent and had relatively little activity on potato starch granules. Images PMID:14926

  11. Comparison of alpha-amylase activity in larval stages of flour beetles, Tribolium confusum (Coleoptera: Tenebionidae).

    PubMed

    Bandani, A R; Balvasi, A

    2006-01-01

    Flour beetles attack stored grain products such as flour, cereals, meal, dried pet food, dried flowers and even dried museum specimens and other foods in the house. Stored-product insects cause tremendous losses by lowering weight, germination rate, nutritional value and grain grade. These beetles are of the most important pests of stored products in the home and grocery stores. The adult female may live for as long as two years, depositing 300 to 400 eggs. The life cycle requires one to four months when temperatures are favorable. Several methods could be used to control this insect including synthetic insecticides, biological control, physical control and transgenic plant carrying gene of interest. Chemical controls are discouraged due to pesticide residue in the commodities and resistance in insects. The study of insect digestive enzymes seems to make sense in the realization that the gut is the major interface between the insect and its environment. Hence, an understanding of digestive enzyme function is essential when developing methods of insect control such as the use of enzyme inhibitors and transgenic plants to control insect pests. Therefore, the aim of the current study was to get a good understanding from enzyme composition of different larval stages of the insect and finally characterize amylase which is the key enzyme in digestive system of this insect. For alpha-amylase study whole larvae were homogenized in 0.02 M phosphate buffer at pH 7.2. The homogenates were separately transferred to a 1.5 ml of centrifuge tubes and centrifuged at 15000xg for 20 min at 4degrees C. The supernatants were used as enzyme source in assays. alpha-Amylase activity was assayed by the dinitrosalicylic acid (DNS) procedure using 1% soluble starch (Merck) as substrate. The results show that enzyme activity (OD) in the first, second, third and fourth larval stages were 0.5, 1.15, 1.35 and 1.362, respectively. There are significant differences in amylase activity in

  12. Interaction of wheat monomeric and dimeric protein inhibitors with alpha-amylase from yellow mealworm (Tenebrio molitor L. larva).

    PubMed

    Buonocore, V; Gramenzi, F; Pace, W; Petrucci, T; Poerio, E; Silano, V

    1980-06-01

    The highly purified alpha-amylase from Tenebrio molitor L. larva (yellow mealworm) reversibly combines with two closely related homogeneous glycoprotein inhibitors, one dimeric (termed 'inhibitor 0.19') and one monomeric (termed 'inhibitor 0.28'), from wheat flour. As established by means of difference spectroscopy and kinetic studies, molar combining ratios for the amylase--inhibitor-0.19 and amylase-inhibitor-0.28 complexes were 1:1 and 1:2 respectively. Two amylase--inhibitor-0.19 complexes with slightly different retention volumes on Bio-Gel P-300 and only one amylase--inhibitor-0.28 complex were observed. Dissociation constants of the amylase--inhibitor-0.19 and amylase--inhibitor-0.28 complexes were 0.85 nM and 0.13 nM respectively. A strong tendency of both complexes to precipitate under an ultracentrifugal field was observed; the minimum molecular weight calculated for the two complexes under such conditions was approx. 95 000. The two complexes showed difference spectra indicating involvement of structurally related or identical tryptophyl side chains in the binding of inhibitors 0.28 and 0.19 to the amylase. A model summarizing the main features of the inhibition of the insect amylase by the two wheat protein inhibitors is proposed.

  13. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    USDA-ARS?s Scientific Manuscript database

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  14. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    USDA-ARS?s Scientific Manuscript database

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  15. Properties and applications of starch-converting enzymes of the alpha-amylase family.

    PubMed

    van der Maarel, Marc J E C; van der Veen, Bart; Uitdehaag, Joost C M; Leemhuis, Hans; Dijkhuizen, L

    2002-03-28

    Starch is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. A large-scale starch processing industry has emerged in the last century. In the past decades, we have seen a shift from the acid hydrolysis of starch to the use of starch-converting enzymes in the production of maltodextrin, modified starches, or glucose and fructose syrups. Currently, these enzymes comprise about 30% of the world's enzyme production. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-staling agents in baking. A number of these starch-converting enzymes belong to a single family: the alpha-amylase family or family13 glycosyl hydrolases. This group of enzymes share a number of common characteristics such as a (beta/alpha)(8) barrel structure, the hydrolysis or formation of glycosidic bonds in the alpha conformation, and a number of conserved amino acid residues in the active site. As many as 21 different reaction and product specificities are found in this family. Currently, 25 three-dimensional (3D) structures of a few members of the alpha-amylase family have been determined using protein crystallization and X-ray crystallography. These data in combination with site-directed mutagenesis studies have helped to better understand the interactions between the substrate or product molecule and the different amino acids found in and around the active site. This review illustrates the reaction and product diversity found within the alpha-amylase family, the mechanistic principles deduced from structure-function relationship structures, and the use of the enzymes of this family in industrial applications.

  16. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase.

    PubMed

    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana; Leos-Rivas, Catalina

    2016-01-01

    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity.

  17. Miconia sp. Increases mRNA Levels of PPAR Gamma and Inhibits Alpha Amylase and Alpha Glucosidase

    PubMed Central

    Ortíz-Martinez, David Mizael; Rivas-Morales, Catalina; de la Garza-Ramos, Myriam Angelica; Verde-Star, Maria Julia; Nuñez-Gonzalez, Maria Adriana

    2016-01-01

    Diabetes mellitus is a public health problem worldwide. For this reason, ethanolic extract of Miconia sp. from Oaxaca, Mexico, was selected in search of an alternative against this disease. The effect of Miconia sp. on mRNA expression of PPARγ on cell line 3T3-L1, its effect on alpha amylase and alpha glucosidase, lipid accumulation during adipogenesis, and cell viability on VERO cells were evaluated. The mRNA levels of PPARγ increased on 1.393 ± 0.008 folds, lipid accumulation was increased by 29.55% with Miconia sp. extract and 34.57% with rosiglitazone, and α-amylase and α-glycosidase were inhibited with IC50 values from 28.23 ± 2.15 μg/mL and 1.95 ± 0.15 μg/mL, respectively; the IC50 on antiproliferative activity on VERO cells was 314.54 ± 45.40 μg/mL. In case of α-amylase and α-glycosidase assays, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of enzymatic activity. On the other hand, on antiproliferative activity, IC50 (inhibitory concentration 50) refers to necessary extract amounts to inhibit 50% of cell proliferation. It was concluded that the compounds present in Miconia sp. ethanolic extract increase mRNA expression of PPARγ, inhibit α-amylase and α-glucosidase, and increase lipid accumulation. It constitutes an alternative as adjuvant in diabetes mellitus treatment; therefore, we recommend continuing identifying the compounds responsible for its promising in vivo antidiabetic activity. PMID:27478477

  18. Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10.

    PubMed

    Ezeji, Thaddeus C; Bahl, Hubert

    2006-08-20

    The alpha-amylase (1, 4-alpha-d-glucanohydrolase; EC 3.2.1.1) and alpha-glucosidase (alpha-d-glucoside glucohydrolase; EC 3.2.1.20) secreted by Geobacillus thermodenitrificans HRO10 were purified to homogeneity (13.6-fold; 11.5% yield and 25.4-fold; 32.0% yield, respectively) through a series of steps. The molecular weight of alpha-amylase was 58kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The alpha-amylase activity on potato starch was optimal at pH 5.5 and 80 degrees Celsius. In the presence of Ca(2+), the alpha-amylase had residual activity of more than 92% after 1h of incubation at 70 degrees Celsius. The alpha-amylase did not lose any activity in the presence of phytate (a selective alpha-amylase inhibitor) at concentrations as high as 10mM, rather it retained 90% maximal activity after 1h of incubation at 70 degrees Celsius. EGTA and EDTA were strong inhibitory substances of the enzyme. The alpha-amylase hydrolyzed soluble starch at 80 degrees Celsius, with a K(m) of 3.05mgml(-1) and a V(max) of 7.35Uml(-1). The molecular weight of alpha-glucosidase was approximately 45kDa, as determined by SDS-PAGE. The enzyme activity was optimal at pH 6.5-7.5 and 55 degrees Celsius. Phytate did not inhibit G. thermodenitrificans HRO10 alpha-glucosidase activity, whereas pCMB was a potent inhibitor of the enzyme. The alpha-glucosidase exhibited Michaelis-Menten kinetics with maltose at 55 degrees Celsius (K(m): 17mM; V(max): 23micromolmin(-1)mg(-1)). Thin-layer chromatography studies with G. thermodenitrificans HRO10 alpha-amylase and alpha-glucosidase showed an excellent synergistic action and did not reveal any transglycosylation catalyzed reaction by the alpha-glucosidase.

  19. Alpha amylase enzyme inhibitory and anti-inflammatory effect of Lawsonia inermis.

    PubMed

    Imam, Hasan; Mahbub, Nasir Uddin; Khan, Md Forhad; Hana, Humayera Kabir; Sarker, Md Moklesur Rahman

    2013-12-01

    Previously it was reported elsewhere that Lawsonia inermis have anti-inflammatory and analgesic effect in experimental animals. The in vitro porcine alpha amylase inhibitory effect was investigated of this plant methanolic extracts and consequently hypoglycemic effect by quantitatively determining the maltose from the maltose standard curve while the anti-inflammatory effect by acetic acid induced writhing test in mice. Acarbose (10 microg mL(-1)) and Diclofenac sodium (20 mg kg(-1)) were used as reference hypoglycemic and anti-inflammatory drugs, respectively, for this study. The methanolic leaves extract of the plant significantly inhibited (60.97% compared to untreated) enzymatic activity of the amylase at 10 microg mL(-1) dose (p < 0.05) also reduced the chemically induced nociceptive pain stimuli significantly at all doses (p < 0.01). Carbohydrates, glycosides, flavonoids, saponins and tannins were found to have in phytochemical screening of the extract which are thought to bring these effects. For the conclusive purpose, it is suggesting from the result that the pharmacological properties of this Lawsonia inermis can elicit hypoglycemic effect by inhibiting alpha-amylase enzyme and can reduce neurogenic pain stimulus. It gives the notion that how this group of patient would be therapeutically benefitted by decreasing both these effects by the same agent which is easy available.

  20. Refined molecular structure of pig pancreatic alpha-amylase at 2.1 A resolution.

    PubMed

    Larson, S B; Greenwood, A; Cascio, D; Day, J; McPherson, A

    1994-02-04

    The structure of pig pancreatic alpha-amylase has been determined by X-ray diffraction analysis using multiple isomorphous replacement in a crystal of space group P2(1)2(1)2(1) (a = 70.6 A, b = 114.8 A, c = 118.8 A) containing nearly 75% solvent. The structure was refined by simulated annealing and Powell minimization, as monitored by 2Fo-Fc difference Fourier syntheses, to a conventional R of 0.168 at 2.1 A resolution. The final model consists of all 496 amino acid residues, a chloride and a calcium ion, 145 water molecules and an endogenous disaccharide molecule that contiguously links protein molecules related by the 2(1) crystallographic operator along x. The protein is composed of a large domain (amino acid residues 1 to 403) featuring a central alpha ta-barrel of eight parallel strands and connecting helices with a prominent excursion between strand beta 3 and helix alpha 3 (amino acid residues 100 to 168). The final 93 amino acid residues at the carboxyl terminus form a second small domain consisting of a compact Greek key beta-barrel. The domains are tightly associated through hydrophobic interfaces. The beta 3/alpha 3 excursion and portions of the central alpha/beta-barrel provide four protein ligands to the tightly bound Ca ion; three water molecules complete the coordination. The Cl- ion is bound within one end of the alpha/beta-barrel by two arginine residues in a manner suggesting a plausible mechanism for its allosteric activation of the enzyme. A crystalline complex of the pancreatic alpha-amylase with alpha-cyclodextrin, a cyclic substrate analog of six glucose residues, reveals, in difference Fourier maps, three unique binding sites. One of the alpha-cyclodextrin sites is near the center of the long polysaccharide binding cleft that traverses one end of the alpha/beta-barrel, another is at the extreme of this cleft. By symmetry this can also be considered as two half sites located at the extremes of the active site cleft. This latter alpha

  1. Digestive alpha-amylases of the flour moth Ephestia kuehniella--adaptation to alkaline environment and plant inhibitors.

    PubMed

    Pytelková, Jana; Hubert, Jan; Lepsík, Martin; Sobotník, Jan; Sindelka, Radek; Krízková, Iva; Horn, Martin; Mares, Michael

    2009-07-01

    The digestive tract of lepidopteran insects is extremely alkaline. In the present work, molecular adaptation of amylolytic enzymes to this environment was investigated in the flour moth Ephestia kuehniella, an important stored-product pest. Three digestive alpha-amylases [Ephestia kuehniella alpha-amylase isoenzymes 1-3 (EkAmy1-3)] with an alkaline pH optimum were purified from larvae and biochemically characterized. These isoenzymes differ significantly in their sensitivity to alpha-amylase inhibitors of plant origin that are directed against herbivores as antifeedants. Such functional variability renders the amylolytic system less vulnerable to suppression by plant defensive molecules. Moreover, we found that expression of alpha-amylases is upregulated in larvae feeding on a diet enriched with an alpha-amylase inhibitor. The alpha-amylases are secreted into the larval midgut by an exocytotic mechanism, as revealed by immunogold microscopy. The cDNA sequence of EkAmy3 was determined, and a homology model of EkAmy3 was built in order to analyze the structural features responsible for adaptation to alkaline pH. First, the overall fold was found to be stabilized by remodeling of ion pairs. Second, molecular simulations supported by activity measurements showed that EkAmy3 does not bind a Cl(-), owing to an Arg-to-Gln mutation in a conserved binding site. The Cl(-)-binding residues are in contact with the catalytic residues, and this change might help to fine-tune the catalytic pK(a) values to an alkaline pH optimum. We conclude that lepidopteran alpha-amylases are evolutionarily adapted in terms of structure and expression dynamics for effective functioning in the digestive system.

  2. Transformation of Bacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B. subtilis var. amylosacchariticus.

    PubMed

    Yoneda, Y; Yamane, K; Yamaguchi, K; Nagata, Y; Maruo, B

    1974-12-01

    Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC 3.2.1.1.) in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.

  3. Biological and chemical evaluation of chick pea seed proteins as affected by germination, extraction and alpha-amylase treatment.

    PubMed

    Mansour, E H

    1996-06-01

    The effects of germination, extraction (double extraction with 70% ethanol and water at isoelectric point) and alpha-amylase treatments of chick pea seed flours on crude protein, total carbohydrate, protein efficiency ratio (PER), biological value (BV), true digestibility (TD), net protein utilization (NPU), essential amino acid composition, in-vitro protein digestibility (IVPD) and actual amino acid indices (essential amino acid index or amino acid score) were evaluated. Crude protein content was increased (8-149%), while total carbohydrate was decreased (11-62%) by germination, extraction and alpha-amylase treatments. Alpha-amylase treatment was more efficient in reducing total carbohydrate and increasing the protein content than that of extraction treatment. The protein quality of chick pea flours as measured by PER, BV, TD, NPU, IVPD and corrected amino acid indices (actual amino acid indices x IVPD) was significantly improved by these treatments. The protein quality of germinated-alpha-amylase treatment was comparable with casein, while germinated-alpha-amylase treaded seeds appeared nutritionally superior to casein. The results indicate that the germinated-alpha-amylase and germinated-alpha-amylase-extracted treatments could be used successfully as a source of concentrated high quality protein for baby food production. The corrected amino acid indices gave better prediction of PER, BV, TD and NPU (r = 93 to 97) than actual amino acid indices (r = 45 to 71). PER was highly correlated with corrected amino acid score (r = 0.93). The PER could be predicted from the following simple regression equation: PER = -1.827 + 0.0561 x corrected amino acid score.

  4. Electron microscopic investigation of the diffusion of Bacillus licheniformis alpha-amylase into corn starch granules.

    PubMed

    Helbert, W; Schülein, M; Henrissat, B

    1996-10-01

    A method for the direct electron microscopic observation of amylases in interaction with starch granules is presented. The technique involves immuno-gold labeling of the enzymes and cross-sectioning of hydrated starch granules. This approach allows the analysis of the internal degradation of starch with a concomitant visualization of enzymes at the sites of hydrolysis. The visualization of enzymes at the surface, inside the channel and inside the core of the degraded granules shows that the alpha-amylase molecules first proceed from the surface toward the center (centripetal hydrolysis). Then the core is completely degraded from within by erosion of its periphery (centrifugal hydrolysis). In the first case (centripetal hydrolysis), the enzymes act by progressing along the polysaccharide chains. By contrast, the centrifugal hydrolysis leads to even erosion, indicative of a more diffusive motion of the enzymes.

  5. Immobilization of alpha-amylase from Bacillus circulans GRS 313 on coconut fiber.

    PubMed

    Dey, Gargi; Nagpal, Varima; Banerjee, Rintu

    2002-01-01

    A simple and inexpensive method for immobilizing alpha-amylase from Bacillus circulans GRS 313 on coconut fiber was developed. The immobilization conditions for highest efficiency were optimized with respect to immobilization pH of 5.5, 30 degrees C, contact time of 4 h, and enzyme to support a ratio of 1:1 containing 0.12 mg/mL of protein. The catalytic properties of the immobilized enzyme were compared with that of the free enzyme. The activity of amylase adsorbed on coconut fiber was 38.7 U/g of fiber at its optimum pH of 5.7 and 48 degrees C, compared with the maximum activity of 40.2 U/mL of free enzyme at the optimum pH of 4.9 and 48 degrees C. The reutilization capacity of the immobilized enzyme was up to three cycles.

  6. Effects of metals on {alpha}-amylase activity in the digestive gland of the green mussel, Perna viridis L.

    SciTech Connect

    Yan, T.; Teo, L.H.; Sin, Y.M.

    1996-04-01

    A number of digestive enzymes in the green mussel, Perna viridis L., have been reported, and {alpha}-amylase is believed to have a higher activity than the others. Small plankton, on which the green mussel feeds, may supply plenty of starch and glycogen. They may be an important source of nutrients for the green mussel and the ability of the latter to make good use of them depends mainly on the activities of amylase. The effect of heavy metals on amylase activity is also important as the ability of the mussel`s digestive gland to accumulate these metals is well known. High concentrations of heavy metals, especially lead, have been observed in the water around Singapore. The in vitro inhibition of some metals on the activities of digestive enzymes from the green mussel has been observed, but kinetic properties of the inhibition and the in vivo inhibition of the heavy metals on digestive enzymes are little understood. In the present study, in vitro inhibition of four metals (Pb, Cd, Zn and Hg) on the activity of {alpha}-amylase from the digestive gland of the green mussel will be compared. Their effects on the K{sub M} and V{sub max} values of {alpha}-amylase will also be compared. Finally, lead is either added to the food or water, to see how it affects the activity of {alpha}-amylase and how this effect acts in combination with starvation. 12 refs., 3 figs., 3 tabs.

  7. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  8. [Effect of triterpenoid glycosides on alpha- and beta-amylase activity and total protein content in wheat seedlings].

    PubMed

    Davidiants, E S

    2011-01-01

    Influence of the aleanolic acid glycosides from Silphium perfoliatum L. (silphioside B, C, E and G) and their progenins on the amylase activity and total protein content in wheat seedlings was studied. Treatment of the Triticum aestivum L. seeds with 1-10 microM water solutions of mono- and diglycosides (mono- and bisdesmosines) elevated the alpha-amylase and total amylase activities in seedlings. Silphioside E containing three glucose moieties in its molecule did not change alpha-amylase activity, but it did if bis-triglycoside acetylated carbohydrate (as in silphioside C). Effects of 5-10 microM solutions of the active glycosides was comparable with that of exogenous gibberellin A3 and 6-benzylaminopurine.

  9. Domain B protruding at the third beta strand of the alpha/beta barrel in barley alpha-amylase confers distinct isozyme-specific properties.

    PubMed

    Rodenburg, K W; Juge, N; Guo, X J; Søgaard, M; Chaix, J C; Svensson, B

    1994-04-01

    alpha-Amylases belong to the alpha/beta-barrel protein family in which the active site is created by residues located at the C-terminus of the beta strands and in the helix-connecting loops extending from these ends. In the alpha-amylase family, a small separate domain B protrudes at the C-terminus of the third beta strand of the (beta/alpha)8-barrel framework. The 80% identical barley alpha-amylase isozymes 1 and 2 (AMY1 and AMY2, respectively) differ in substrate affinity and turnover rate, CaCl2 stimulation of activity, sensitivity to the endogenous 21-kDa alpha-amylase/subtilisin inhibitor, and stability at low pH. To identify regions that confer these isozyme-specific variations, AMY1-AMY2 hybrid cDNAs were generated by in vivo homologous recombination in yeast. The hybrids AMY1-(1-90)-AMY2-(90-403) and AMY1-(1-161)-AMY2-(161-403) characterized in this study contain the 90-residue and 161-residue N-terminal sequences, respectively, of AMY1 and complementary C-terminal regions of AMY2. AMY1-(1-90)-AMY2-(90-403) comprises the 60-amino-acid domain B of AMY2 and resembles this isozyme in sensitivity to alpha-amylase/subtilisin inhibitor and its low affinity for the substrates p-nitrophenyl alpha-D-maltoheptaoside, amylose and the inhibitor acarbose. Only AMY1-(1-161)-AMY2-(161-403) and AMY1, which both share domain B, are stable at low pH. However, AMY2 and both hybrid AMY species, but not AMY1, show maximum enzyme activity on insoluble blue starch at approximately 10 mM CaCl2. Domain B thus determines several functional and stability properties that distinguish the barley alpha-amylase isozymes.

  10. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    NASA Technical Reports Server (NTRS)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter

    2003-01-01

    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  11. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.

    PubMed

    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K

    1986-04-01

    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  12. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    NASA Technical Reports Server (NTRS)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter

    2003-01-01

    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  13. Heavy metal resistance of some thermophiles: potential use of alpha-amylase from Anoxybacillus amylolyticus as a microbial enzymatic bioassay.

    PubMed

    Poli, Annarita; Salerno, Anna; Laezza, Giusi; di Donato, Paola; Dumontet, Stefano; Nicolaus, Barbara

    2009-03-01

    Six thermophilic extremophiles, Anoxybacillus amylolyticus, Geobacillus thermoleovorans, Geobacillus thermoleovorans subspecies stromboliensis, Geobacillus toebii subspecies decanicus, Bacillus thermantarcticus and Thermus oshimai, isolated from different environmental sites, were studied for their heavy metal resistance. The effects of heavy metals on microorganism growth were studied here in a pilot fermenter tank spiked with various trace metals, (Ni(2+), Zn(2+), Co(2+), Hg(2+), Mn(2+), Cr(6+), Cu(2+), Fe(3+) and Cd(2+)) at concentrations spanning from 0.01 to 20 mM. Trace metal toxicity varied depending on the species and metal considered. Among the tested microorganisms, attention was focused on alpha-amylase producing-A. amylolyticus, an acidothermophilic bacterium recently isolated from geothermal soil samples from Mount Rittmann in Antarctica. The effect of heavy metals on the biosynthesis and activity of alpha-amylase of A. amylolyticus was investigated. When bacteria were grown in the presence of heavy metals, a decrease in alpha-amylase activity, correlated with a decrease in alpha-amylase production, was observed, suggesting an effect on the biosynthesis of the enzyme. A decrease in enzyme activity was also noted when the assay was performed in the presence of heavy metals. Thus, alpha-amylase could represent a potential sensitive bioassay for detecting trace heavy metals.

  14. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  15. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  16. Determinants of wheat antigen and fungal alpha-amylase exposure in bakeries.

    PubMed

    Burstyn, I; Teschke, K; Bartlett, K; Kennedy, S M

    1998-05-01

    The study's objectives were to measure flour antigen exposure in bakeries and define the determinants of exposure. Ninety-six bakery workers, employed in seven different bakeries, participated in the study. Two side-by-side full-shift inhalable dust samples were obtained from each study participant on a single occasion. The flour antigen exposure was measured as wheat antigen and fungal alpha-amylase content of the water-soluble fraction of inhalable dust, assayed via enzyme-linked immunosorbent assays. During the entire sampling period bakers were observed and information on 14 different tasks was recorded at 15-minute intervals. Other production characteristics were also recorded for each sampling day and used in statistical modeling to identify significant predictors of exposure. The mean alpha-amylase antigen exposure was 22.0 ng/m3 (ranging from below the limit of detection of 0.1 ng/m3 to 307.1 ng/m3) and the mean wheat antigen exposure was 109 micrograms/m3 (ranging from below the limit of detection of 1 microgram/m3 to 1018 micrograms/m3). Regression models that explained 74% of variability in wheat antigen and alpha-amylase antigen exposures were constructed. The models indicated that tasks such as weighing, pouring, and operating dough-brakers increased flour antigen exposure, while packing and decorating resulted in lower exposures. Croissant, puff-pastry, and bread/bun production lines were associated with increased exposure, while cake production and substitution of dusting with the use of divider oil were associated with decreased exposure. Exposure levels can be reduced by the automation of forming tasks, alteration of tasks requiring pouring of flour, and changes to the types of products manufactured.

  17. Alpha-amylase inhibitory activity and phytochemical study of Zhumeria majdae Rech. f. and Wendelbo

    PubMed Central

    Mirshafie, Behnaz; Mokhber-Dezfouli, Najmeh; Manayi, Azadeh; Saeidnia, Soodabeh; Ajani, Yousef; Gohari, Ahmad Reza

    2015-01-01

    Background: Zhumeria majdae (Lamiaceae) is an endemic species growing in the South parts of Iran especially Hormozgan province. The plant is so-called Mohrekhosh locally and widely used for medicinal purposes including stomachache and dysmenorrhea. Objective: In order to separation and identification of the main flavonoid glycosides of the plant (aerial parts including leaves, stems, flowers, and fruits were used) and evaluation of its alpha-amylase inhibitory (AAI) activity, methanolic extract was prepared and fractionated to botanolic portion. Materials and Methods: Isolation of the main compounds of the butanol extract of the plant have been performed using different column chromatography methods such as high-performance liquid chromatography (C18 column) and Sephadex LH-20 as well. The isolated compounds were identified by Hydrogen-1 nuclear magnetic resonance and Carbon-13 nuclear magnetic resonance spectra and comparison with those reported in previous literature. Moreover, inhibitory activity of the butanolic extract of the plant against alpha-amylase enzyme was examined in different concentrations (15–30 mg/mL), where acarbose used as a positive control. Results: Three flavonoid glycosides: Linarin (1), hispidulin-7-O-(4-O-acetyl-rutinoside) (2), hispidulin-7-O-rutinoside (3) were successfully identified in the extract. The activity of alpha amylase enzyme was dose-dependently suppressed by the butanol extract. The extract exhibited the highest inhibition at 30 mg/mL toward enzyme (77.9 ± 2.1%), while acarbose inhibited the enzyme at 20 mg/mL by 73.9 ± 1.9%. The inhibitory concentrations of 50% for the extract and acarbose were calculated at 24.5 ± 2.1 and 6.6 ± 3.1 mg/mL, respectively. Conclusion: Z. majdae contains glycosylated flavones and could be a good candidate for anti-diabetic evaluations in animal and clinical trials due to possessing AAI activity. PMID:26692743

  18. Alpha-amylase inhibitory activity and phytochemical study of Zhumeria majdae Rech. f. and Wendelbo.

    PubMed

    Mirshafie, Behnaz; Mokhber-Dezfouli, Najmeh; Manayi, Azadeh; Saeidnia, Soodabeh; Ajani, Yousef; Gohari, Ahmad Reza

    2014-01-01

    Zhumeria majdae (Lamiaceae) is an endemic species growing in the South parts of Iran especially Hormozgan province. The plant is so-called Mohrekhosh locally and widely used for medicinal purposes including stomachache and dysmenorrhea. In order to separation and identification of the main flavonoid glycosides of the plant (aerial parts including leaves, stems, flowers, and fruits were used) and evaluation of its alpha-amylase inhibitory (AAI) activity, methanolic extract was prepared and fractionated to botanolic portion. Isolation of the main compounds of the butanol extract of the plant have been performed using different column chromatography methods such as high-performance liquid chromatography (C18 column) and Sephadex LH-20 as well. The isolated compounds were identified by Hydrogen-1 nuclear magnetic resonance and Carbon-13 nuclear magnetic resonance spectra and comparison with those reported in previous literature. Moreover, inhibitory activity of the butanolic extract of the plant against alpha-amylase enzyme was examined in different concentrations (15-30 mg/mL), where acarbose used as a positive control. Three flavonoid glycosides: Linarin (1), hispidulin-7-O-(4-O-acetyl-rutinoside) (2), hispidulin-7-O-rutinoside (3) were successfully identified in the extract. The activity of alpha amylase enzyme was dose-dependently suppressed by the butanol extract. The extract exhibited the highest inhibition at 30 mg/mL toward enzyme (77.9 ± 2.1%), while acarbose inhibited the enzyme at 20 mg/mL by 73.9 ± 1.9%. The inhibitory concentrations of 50% for the extract and acarbose were calculated at 24.5 ± 2.1 and 6.6 ± 3.1 mg/mL, respectively. Z. majdae contains glycosylated flavones and could be a good candidate for anti-diabetic evaluations in animal and clinical trials due to possessing AAI activity.

  19. Purification and characterization of alpha-amylase from safflower (Carthamus tinctorius L.) germinating seeds.

    PubMed

    Ben Elarbi, Mosbah; Khemiri, Halima; Jridi, Taoufik; Ben Hamida, Jeannette

    2009-05-01

    alpha-Amylase (alpha-1-4 D-glucan glucanohydrolase EC 3.2.1.1) crude extract was obtained from safflower (Carthamus tinctorius L.) cotyledons excised from 5-day-old dark grown seedlings. The enzyme was purified by precipitating the crude extract with ammonium sulphate at 20-60% saturation, and then by subjecting this fraction to affinity chromatography on a beta-cyclodextrin-Sepharose 6B column. The active fraction was dialysed and concentrated. An overall purification of about 131 folds with an activity yield of 81.25% was achieved. The molecular mass of purified enzyme determined by SDS-PAGE was 35 kD. When the purified alpha-amylase was subjected to gel electrophoresis followed by negative staining, only one band of active protein was detected. Its maximal activity was in the pH 6.0 and at a temperature of 55 degrees C. This enzyme was activated by Ca(2+) and inhibited by Fe(2+).

  20. Alpha-amylase Inhibition and Antioxidant Activity of Marine Green Algae and its Possible Role in Diabetes Management.

    PubMed

    Unnikrishnan, P S; Suthindhiran, K; Jayasri, M A

    2015-10-01

    In the continuing search for safe and efficient antidiabetic drug, marine algae become important source which provide several compounds of immense therapeutic potential. Alpha-amylase, alpha-glucosidase inhibitors, and antioxidant compounds are known to manage diabetes and have received much attention recently. In the present study, four green algae (Chaetomorpha aerea, Enteromorpha intestinalis, Chlorodesmis, and Cladophora rupestris) were chosen to evaluate alpha-amylase, alpha-glucosidase inhibitory, and antioxidant activity in vitro. The phytochemical constituents of all the extracts were qualitatively determined. Antidiabetic activity was evaluated by inhibitory potential of extracts against alpha-amylase and alpha-glucosidase by spectrophotometric assays. Antioxidant activity was determined by 2,2-diphenyl-1-picrylhydrazyl, hydrogen peroxide (H2O2), and nitric oxide scavenging assay. Gas chromatography-mass spectrometry (GC-MS) analysis was carried out to determine the major compound responsible for its antidiabetic action. Among the various extracts screened, chloroform extract of C. aerea (IC50 - 408.9 μg/ml) and methanol extract of Chlorodesmis (IC50 - 147.6 μg/ml) showed effective inhibition against alpha-amylase. The extracts were also evaluated for alpha-glucosidase inhibition, and no observed activity was found. Methanol extract of C. rupestris showed notable free radical scavenging activity (IC50 - 666.3 μg/ml), followed by H2O2 (34%) and nitric oxide (49%). Further, chemical profiling by GC-MS revealed the presence of major bioactive compounds. Phenol, 2,4-bis (1,1-dimethylethyl) and z, z-6,28-heptatriactontadien-2-one were predominantly found in the methanol extract of C. rupestris and chloroform extract of C. aerea. Our results demonstrate that the selected algae exhibit notable alpha-amylase inhibition and antioxidant activity. Therefore, characterization of active compounds and its in vivo assays will be noteworthy. Four green algae were

  1. [Effect of dental alloys on salivary alkaline and acid phosphatase, alpha amylase K+, Na+, and Cl-].

    PubMed

    Todorov, I; Saprjanova, M

    1977-04-01

    Comparative studied were performed in healthy subjects without metals in their oral cavities and in individuals having different metal alloys (gold, steel, amalgam) in their mouths and presenting with various complaints such as xerostomia, burning mucosa, etc. It was found that the contents of alkaline and acid phosphatases, alpha-amylase, K+, Na+ and Cl- in saliva increased significantly with the increase in total corrosion potential when non-precious metal alloys, especially different types of alloys, were present. Parallel to this, the frequency and the intensity of the complaints increased.

  2. Increased production of thermostable alpha-amylase enzyme by Bacillus sp. TCRDC-25A with maltodextrins.

    PubMed

    Bajpai, P; Bajpai, P K

    1991-11-01

    Maltodextrins and hydrolysates of rice and corn flour of varying dextrose equivalents (DE) have been used as a carbon source for alpha-amylase enzyme production by Bacillus sp. TCRDC-25A. The rate and total enzyme production was higher in maltodextrin media than in cornstarch. The enzyme production increased with increase in DE up to 45%. The maximum enzyme production of 2390, 2450, and 2510 DUN/mL was obtained in cornstarch maltodextrins, and hydrolysates of corn and rice flours, respectively, in a bench-scale reactor in 40 h.

  3. Crystal structure of thermostable alpha-amylase from Bacillus licheniformis refined at 1.7 A resolution.

    PubMed

    Hwang, K Y; Song, H K; Chang, C; Lee, J; Lee, S Y; Kim, K K; Choe, S; Sweet, R M; Suh, S W

    1997-04-30

    alpha-Amylases (alpha-1,4-glucan-4-glucanohydrolase, E.C.3.2.1.1) catalyze the cleavage of alpha-1, 4-glucosidic linkages of starch components, glycogen, and various oligosaccharides. Thermostable alpha-amylases from Bacillus species are of great industrial importance in the production of corn syrup or dextrose. Thermostable alpha-amylase from Bacillus licheniformis, a monomeric enzyme with molecular mass of 55,200 Da (483 amino acid residues), shows a remarkable heat stability. This enzyme provides an attractive model for investigating the structural basis for thermostability of proteins. The three-dimensional structure of thermostable alpha-amylase from Bacillus licheniformis has been determined by the multiple isomorphous replacement method of X-ray crystallography. The structure has been refined to a crystallographic R-factor of 19.9% for 58,601 independent reflections with F0 > 2 sigma F0 between 8.0 and 1.7 A resolution, with root mean square deviations of 0.013 A from ideal bond lengths and 1.72 degrees from ideal bond angles. The final model consists of 469 amino acid residues and 294 water molecules. Missing from the model are the N- and C-termini and the segment between Trp182 and Asn192. Like other alpha-amylases, the polypeptide chain folds into three distinct domains. The first domain (domain A), consisting of 291 residues (from residue 3 to 103 and 207 to 396), forms a (beta/alpha)8-barrel structure. The second domain (domain B), consisting of residues 104 to 206, is inserted between the third beta-strand and the third alpha-helix of domain A. The third C-terminal domain (domain C), consisting of residues 397 to 482, folds into an eight-stranded antiparallel beta-barrel. Neither calcium ion nor chloride ion is located near the active site. This study reveals the architecture of the thermostable alpha-amylase from Bacillus licheniformis. By homology with other alpha-amylases, important active site residues can be identified as Asp231, Glu261, and Asp

  4. Transgenic cowpea (Vigna unguiculata) seeds expressing a bean alpha-amylase inhibitor 1 confer resistance to storage pests, bruchid beetles.

    PubMed

    Solleti, Siva Kumar; Bakshi, Souvika; Purkayastha, Jubilee; Panda, Sanjib Kumar; Sahoo, Lingaraj

    2008-12-01

    Cowpea is one of the important grain legumes. Storage pests, Callosobruchus maculatus and C. chinensis cause severe damage to the cowpea seeds during storage. We employ a highly efficient Agrobacterium-mediated cowpea transformation method for introduction of the bean (Phaseolus vulgaris) alpha-amylase inhibitor-1 (alphaAI-1) gene into a commercially important Indian cowpea cultivar, Pusa Komal and generated fertile transgenic plants. The use of constitutive expression of additional vir genes in resident pSB1 vector in Agrobacterium strain LBA4404, thiol compounds during cocultivation and a geneticin based selection system resulted in twofold increase in stable transformation frequency. Expression of alphaAI-1 gene under bean phytohemagglutinin promoter results in accumulation of alphaAI-1 in transgenic seeds. The transgenic protein was active as an inhibitor of porcine alpha-amylase in vitro. Transgenic cowpeas expressing alphaAI-1 strongly inhibited the development of C. maculatus and C. chinensis in insect bioassays.

  5. The production of a new fungal alpha-amylase degraded the raw starch by means of solid-state fermentation.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2010-01-01

    In this study, it was intended to produce a new fungal amylase by solid-state fermentation and purification and also to determine some of its biochemical properties. It was found that Penicillium brevicompactum had the best enzyme activity according to screening methods with amylase degrading raw starch, and P. brevicompactum was selected as the amylase source. Wheat bran, rice husks, and sunflower oil meal were tested to determine the best solid substrate. Wheat bran was determined as the best of these. The fermentation conditions were optimized for the production of amylase. The optimum fermentation conditions were found to be an initial moisture level for the solid substrate of 55%, moistening agent of 0.1 M sodium phosphate buffer (pH 5.0), incubation period of 7 d, inoculum concentration of 2.5 mL, and incubation temperature at 30 degrees C. Penicillium brevicompactum alpha-amylase was purified 45.98 times by the starch affinity method. The K(m) and V(max) values of alpha-amylase for soluble starch were 5.71 mg/mL and 666.6 U/mL, respectively. This amylase showed maximum activity at between 30 and 50 degrees C and at pH 5.0. Initial enzyme activity was kept at 100% after incubation at 30 degrees C for 45 min. Enzyme was stable in the pH range of 4.0-5.0. This enzyme was activated by Mn(2+), Cu(2+), and Na(+) ions, and was inhibited by Mg(2+), K(+), Fe(3+), and ethylenediamine tetraacetic acid (EDTA). The molecular mass of P. brevicompactum alpha-amylase was found to be 32.5 kD by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis.

  6. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  7. The effect of calcium binding on the unfolding barrier: A kinetic study on homologous alpha-amylases.

    PubMed

    Kumari, Arpana; Rosenkranz, Tobias; Kayastha, Arvind M; Fitter, Jörg

    2010-09-01

    Extreme thermostabilities of proteins can be achieved by binding co-factors to the protein structures. For various alpha-amylases protein stabilization upon calcium binding is a well-known phenomenon. In the present study the mechanism of stabilization of three homologous alpha-amylases was investigated by measuring the unfolding kinetics with CD spectroscopy. For this purpose thermal unfolding kinetics of calcium saturated and calcium depleted enzymes were analyzed by means of Eyring-plots. The free energy change between the native and the transition state which characterized the unfolding barrier height was found to be proportional to the number of calcium ions bound to the protein structures. For the most thermostable alpha-amylases calcium binding caused a significant increase in the enthalpy change, which was partly compensated by increased entropy changes.

  8. Induction and regulation of alpha-amylase synthesis in a cellulolytic thermophilic fungus Myceliophthora thermophila D14 (ATCC 48104).

    PubMed

    Sadhukhan, R; Roy, S K; Raha, S K; Manna, S; Chakrabarty, S L

    1992-06-01

    The alpha-amylase enzyme synthesis was higher when M. thermophila D-14 (ATCC 48104) was grown in culture medium incorporated with starch or other carbohydrates containing maltose units. Maximum enzyme production was attained with 1% starch followed by a gradual decrease with increasing concentration. Marked decrease in alpha-amylase synthesis occurred with the addition of glucose to the culture medium and this decreasing activity was proportional to the concentration of glucose. The enzyme synthesis was resumed as soon as the glucose concentration fell below a critical level. The addition of cAMP did not eliminate the repressive activity of glucose. The findings suggest that extracellular alpha-amylase synthesis in M. thermophila D-14 was inducible and subject to catabolite repression.

  9. Immunocytochemical Identification and Localization of Active and Inactive alpha-Amylase and Pullulanase in Cells of Clostridium thermosulfurogenes EM1.

    PubMed

    Specka, U; Spreinat, A; Antranikian, G; Mayer, F

    1991-04-01

    Clostridium thermosulfurogenes EM1 formed blebs, i.e., protrusions still in contact with the cytoplasmic membrane, that originated from the cytoplasmic membrane during growth in batch culture and continuous culture. They could be observed squeezed between the cell wall and cytoplasmic membrane in cells with seemingly intact wall layers (surface layer and peptidoglycan layer) as well as in cells with wall layers in different states of degradation caused by phosphate limitation or high dilution rates. Blebs were found to turn into membrane vesicles by constriction in cases when the cell wall was heavily degraded. Bleb and vesicle formation was also observed in the absence of substrates that induce alpha-amylase and pullulanase synthesis. No correlations existed between bleb formation and the presence of active enzyme. Similar blebs could also be observed in a number of other gram-positive bacteria not producing these enzymes, but they were not observed in gram-negative bacteria. For immunoelectron-microscopic localization of alpha-amylase and pullulanase in C. thermosulfurogenes EM1, two different antisera were applied. One was raised against the enzymes isolated from the culture fluid; the other was produced against a peptide synthesized, as a defined epitope, in analogy to the N-terminal amino acid sequence (21 amino acids) of the native extracellular alpha-amylase. By using these antisera, alpha-amylase and pullulanase were localized at the cell periphery in samples taken from continuous culture or batch culture. In samples prepared for electron microscopy by freeze substitution followed by ultrathin sectioning, blebs could be seen, and the immunolabel pinpointing alpha-amylase enzyme particles was seen not only randomly distributed in the cell periphery, but also lining the surface of the cytoplasmic membrane and the blebs. Cells exhibiting high or virtually no enzyme activity were labeled similarly with both antisera. This finding strongly suggests that alpha-amylase

  10. Multiple time courses of salivary alpha-amylase and dimensions of affect in adolescence.

    PubMed

    Doane, Leah D; Van Lenten, Scott A

    2014-11-01

    Previous research has illustrated associations among daily experiences, emotions and stress-responding physiological systems. Recently, investigators have examined salivary alpha-amylase (sAA), a surrogate marker of the autonomic nervous system, and its associations with affect. The current study examined associations among affective valence, arousal and sAA across three different time courses at the momentary, daily and inter-individual level to understand varying influences of adolescents' daily emotional experiences on sAA reactivity and diurnal sAA activity. Adolescents (N=82) provided salivary samples and diary reports of affect and experiences five times a day for three consecutive days. They also completed self-report questionnaires on trait affect. Findings from multilevel growth curves demonstrated that adolescents in our sample displayed typical sAA diurnal rhythms with levels dropping 30 min after waking and then increasing across the day to a peak in the late afternoon. Within person momentary experiences of high arousal positive affect were associated with momentary sAA reactivity. Prior day experiences of high arousal negative affect were associated with a greater amylase awakening response (i.e., greater decrease) and flatter slopes the next day. Trait positive affect was also associated with flatter sAA slopes. Our findings suggest that both affective arousal and valence should be accounted for when examining differences in sAA reactivity and diurnal patterns. Further, our results indicated that emotion-physiology transactions among adolescents occur over varying time scales for salivary alpha-amylase as well as cortisol. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.

    PubMed

    Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy

    2009-08-01

    An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

  12. A comparison of ghrelin, glucose, alpha-amylase and protein levels in saliva from diabetics.

    PubMed

    Aydin, Suleyman

    2007-01-31

    During the past decade, many salivary parameters have been used to characterize disease states. Ghrelin (GAH) is recently-discovered peptide hormone secreted mainly from the stomach but also produced in a number of other tissues including salivary glands. The aim of this work was to examine the relationship between active (aGAH) and inactive (dGAH) ghrelin in the saliva and other salivary parameters in type II diabetic patients and healthy controls. Salivary parameters were assessed in a single measurement of unstimulated whole saliva from 20 obese and 20 non-obese type II diabetes patients, and in 22 healthy controls. Total protein and alpha-amylase were determined by colorimetric methods, and glucose by the glucose-oxidase method. Saliva aGAH and dGAH levels were measured using a commercial radioimmunoassay (RIA) kit. Salivary concentrations of aGAH and dGAH ghrelin were more markedly decreased in obese diabetic subjects than in the two other groups. Glucose and alpha-amylase levels were higher in diabetic subjects than in controls. Furthermore, there were correlations between GAH levels and BMI, and between GAH and blood pressure. However, there was no marked variability in saliva flow rates among the groups. These results indicate that measurement of salivary GAH and its relationship to other salivary parameters might help to provide insight into the role of ghrelin in diabetes.

  13. Alpha amylase assisted synthesis of TiO₂ nanoparticles: structural characterization and application as antibacterial agents.

    PubMed

    Ahmad, Razi; Mohsin, Mohd; Ahmad, Tokeer; Sardar, Meryam

    2015-01-01

    The enzyme alpha amylase was used as the sole reducing and capping agent for the synthesis of TiO2 nanoparticles. The biosynthesized nanoparticles were characterized by X-ray diffraction (XRD) and transmission electron microscopic (TEM) methods. The XRD data confirms the monophasic crystalline nature of the nanoparticles formed. TEM data shows that the morphology of nanoparticles depends upon the enzyme concentration used at the time of synthesis. The presence of alpha amylase on TiO2 nanoparticles was confirmed by FTIR. The nanoparticles were investigated for their antibacterial effect on Staphylococcus aureus and Escherichia coli. The minimum inhibitory concentration value of the TiO2 nanoparticles was found to be 62.50 μg/ml for both the bacterial strains. The inhibition was further confirmed using disc diffusion assay. It is evident from the zone of inhibition that TiO2 nanoparticles possess potent bactericidal activity. Further, growth curve study shows effect of inhibitory concentration of TiO2 nanoparticles against S. aureus and E. coli. Confocal microscopy and TEM investigation confirm that nanoparticles were disrupting the bacterial cell wall.

  14. Cortisol, salivary alpha-amylase and children's perceptions of their social networks.

    PubMed

    Ponzi, Davide; Muehlenbein, Michael P; Geary, David C; Flinn, Mark V

    2016-01-01

    In recent years there has been a growing interest in the use of social network analysis in biobehavioral research. Despite the well-established importance of social relationships in influencing human behavior and health, little is known about how children's perception of their immediate social relationships correlates with biological parameters of stress. In this study we explore the association between two measures of children's personal social networks, perceived network size and perceived network density, with two biomarkers of stress, cortisol and salivary alpha-amylase. Forty children (mean age = 8.30, min age = 5, and max age = 12) were interviewed to collect information about their friendships and three samples of saliva were collected. Our results show that children characterized by a lower pre-interview cortisol concentration and a lower salivary alpha-amylase reactivity to the interview reported the highest density of friendships. We discuss this result in light of the multisystem approach to the study of children's behavioral outcomes, emphasizing that future work of this kind is needed in order to understand the cognitive and biological mechanisms underlying children's and adolescents' social perceptual biases.

  15. Psychosocial stress-induced activation of salivary alpha-amylase: an indicator of sympathetic activity?

    PubMed

    Rohleder, Nicolas; Nater, Urs M; Wolf, Jutta M; Ehlert, Ulrike; Kirschbaum, Clemens

    2004-12-01

    Assessment of sympathoadrenal medullary system (SAM) activity is only possible to date via measurement of catecholamines in blood plasma or via electrophysiological methods. Both ways of measurement are restricted to endocrinological or psychophysiological laboratories, as both require either immediate freezing of blood samples or complex recording devices. Efforts have therefore been undertaken to find a method comparable to salivary cortisol measurements, in which noninvasive samples can be taken at any place and stored at room temperature for sufficient time before later analysis in the laboratory. Salivary alpha-amylase (sAA) is a candidate that may prove useful in this context. We show here that sAA activity is increased by acute psychosocial stress (Trier Social Stress Test) and that increases in sAA correlate with increases in norepinephrine. We further report that sAA exhibits a stable circadian pattern that mirrors that of salivary cortisol. In conclusion, the current data show that salivary alpha-amylase may serve as an easy-to-use index for SAM activity. However, some questions remain to be answered; for example, what impact does salivary flow rate exert on stress-induced sAA activity?

  16. The effects of autonomy support on salivary alpha-amylase: The role of individual differences.

    PubMed

    Sieber, Vanda; Schüler, Julia; Wegner, Mirko

    2016-12-01

    The empirical evidence for the relationship between autonomy-supportive environments and physiological stress is inconsistent. Whereas some studies report a decrease in stress in autonomy-supportive environments, other studies show a negative effect of autonomy on physiological stress. As previous research has not considered individual differences within this relationship, the present research aims to close this empirical gap by proposing that an implicit autonomy disposition, which is defined as a dispositional preference for self-determination, serves as a moderator. In an experiment, we tested whether the autonomy disposition moderates the effect of different teaching styles (controlling, autonomy-supportive, and neutral) on the acute physiological stress response (salivary alpha-amylase) in adolescents (N=69). The study revealed that participants with a high implicit autonomy disposition displayed lower salivary alpha-amylase responses when exposed to autonomy-supportive vignettes compared to when they were exposed to controlling or neutral teaching styles. The opposite pattern was found in students with a low implicit autonomy disposition. The results illustrate that experimentally induced variations in autonomy support lead to different physiological stress responses, depending on individual differences in the implicit autonomy disposition.

  17. The Effects of Red and Blue Lights on Circadian Variations in Cortisol, Alpha Amylase, and Melatonin

    PubMed Central

    Figueiro, Mariana G.; Rea, Mark S.

    2010-01-01

    The primary purpose of the present study was to expand our understanding of the impact of light exposures on the endocrine and autonomic systems as measured by acute cortisol, alpha amylase, and melatonin responses. We utilized exposures from narrowband long-wavelength (red) and from narrow-band short-wavelength (blue) lights to more precisely understand the role of the suprachiasmatic nuclei (SCN) in these responses. In a within-subjects experimental design, twelve subjects periodically received one-hour corneal exposures of 40 lux from the blue or from the red lights while continuously awake for 27 hours. Results showed-that, as expected, only the blue light reduced nocturnal melatonin. In contrast, both blue and red lights affected cortisol levels and, although less clear, alpha amylase levels as well. The present data bring into question whether the nonvisual pathway mediating nocturnal melatonin suppression is the same as that mediating other responses to light exhibited by the endocrine and the autonomic nervous systems. PMID:20652045

  18. The effects of red and blue lights on circadian variations in cortisol, alpha amylase, and melatonin.

    PubMed

    Figueiro, Mariana G; Rea, Mark S

    2010-01-01

    The primary purpose of the present study was to expand our understanding of the impact of light exposures on the endocrine and autonomic systems as measured by acute cortisol, alpha amylase, and melatonin responses. We utilized exposures from narrowband long-wavelength (red) and from narrow-band short-wavelength (blue) lights to more precisely understand the role of the suprachiasmatic nuclei (SCN) in these responses. In a within-subjects experimental design, twelve subjects periodically received one-hour corneal exposures of 40 lux from the blue or from the red lights while continuously awake for 27 hours. Results showed-that, as expected, only the blue light reduced nocturnal melatonin. In contrast, both blue and red lights affected cortisol levels and, although less clear, alpha amylase levels as well. The present data bring into question whether the nonvisual pathway mediating nocturnal melatonin suppression is the same as that mediating other responses to light exhibited by the endocrine and the autonomic nervous systems.

  19. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family.

    PubMed

    Skov, L K; Mirza, O; Henriksen, A; De Montalk, G P; Remaud-Simeon, M; Sarçabal, P; Willemot, R M; Monsan, P; Gajhede, M

    2001-07-06

    Amylosucrase (E.C. 2.4.1.4) is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N-terminal domain that is not similar to any known fold, a (beta/alpha)(8)-barrel A-domain, B- and B'-domains displaying alpha/beta-structure, and a C-terminal eight-stranded beta-sheet domain. In contrast to other Family 13 hydrolases that have the active site in the bottom of a large cleft, the active site of amylosucrase is at the bottom of a pocket at the molecular surface. A substrate binding site resembling the amylase 2 subsite is not found in amylosucrase. The site is blocked by a salt bridge between residues in the second and eight loops of the (beta/alpha)(8)-barrel. The result is an exo-acting enzyme. Loop 7 in the amylosucrase barrel is prolonged compared with the loop structure found in other hydrolases, and this insertion (forming domain B') is suggested to be important for the polymer synthase activity of the enzyme. The topology of the B'-domain creates an active site entrance with several ravines in the molecular surface that could be used specifically by the substrates/products (sucrose, glucan polymer, and fructose) that have to get in and out of the active site pocket.

  20. Isolation and characterization of the subunits of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Yamaguchi, H

    1991-11-01

    An alpha-amylase inhibitor (PHA-I) of the white kidney bean (Phaseolus vulgaris) was found to be composed of two kinds of subunits and they were isolated on a size-exclusion column by HPLC under denaturing conditions. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide map between these subunit polypeptides. The alpha-subunit contained 28% by weight of carbohydrate, mainly made up of high mannose-type oligosacharides, whereas the sugar moiety of the beta-subunit amounted to 7% by weight and seemed to be predominantly composed of xylomannose-type oligosaccharides. By SDS-PAGE following deglycosylation, the molecular weights of the polypeptides of alpha- and beta-subunits were shown to be 7,800 and 14,000, respectively. These values were consistent with molecular sizes obtained for alpha- and beta-subunits by gel permeation HPLC in 6 M guanidine hydrochloride. The molecular weight of the native PHA-I, 28,800, obtained by gel permeation HPLC under non-denaturing conditions, suggested a heterodimeric structure for PHA-I.

  1. Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

    PubMed

    Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

    2015-10-01

    Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact. Copyright © 2015 John Wiley & Sons, Ltd.

  2. Automated docking of alpha-(1-->4)- and alpha-(1-->6)-linked glucosyl trisaccharides and maltopentaose into the soybean beta-amylase active site.

    PubMed

    Rockey, W M; Laederach, A; Reilly, P J

    2000-08-01

    The Lamarckian genetic algorithm of AutoDock 3.0 was used to dock alpha-maltotriose, methyl alpha-panoside, methyl alpha-isopanoside, methyl alpha-isomaltotrioside, methyl alpha-(6(1)-alpha-glucopyranosyl)-maltoside, and alpha-maltopentaose into the closed and, except for alpha-maltopentaose, into the open conformation of the soybean beta-amylase active site. In the closed conformation, the hinged flap at the mouth of the active site closes over the substrate. The nonreducing end of alpha-maltotriose docks preferentially to subsites -2 or +1, the latter yielding nonproductive binding. Some ligands dock into less optimal conformations with the nonreducing end at subsite -1. The reducing-end glucosyl residue of nonproductively-bound alpha-maltotriose is close to residue Gln194, which likely contributes to binding to subsite +3. In the open conformation, the substrate hydrogen-bonds with several residues of the open flap. When the flap closes, the substrate productively docks if the nonreducing end is near subsites -2 or -1. Trisaccharides with alpha-(1-->6) bonds do not successfully dock except for methyl alpha-isopanoside, whose first and second glucosyl rings dock exceptionally well into subsites -2 and -1. The alpha-(1-->6) bond between the second and third glucosyl units causes the latter to be improperly positioned into subsite +1; the fact that isopanose is not a substrate of beta-amylase indicates that binding to this subsite is critical for hydrolysis.

  3. Action pattern of human pancreatic and salivary alpha-amylase on 1,4-alpha-D-nitrophenylmaltooligosaccharides. 1,4-alpha-D-nitrophenylmaltooligosaccharides as substrates of alpha-amylse, I.

    PubMed

    Wallenfels, K; Laule, G; Meltzer, B

    1982-08-01

    High performance liquid chromatography (HPLC) was used to monitor the purity of the substrates and to establish the patterns of hydrolysis of ortho- and para-nitrophenylmaltooligosaccharides (2-7 glucose residues) catalysed by human pancreatic and salivary alpha-amylase. Separation of the reaction products from the remaining substrate was performed on a TSK-G-2000 PW or a RP18 column. By measuring the quantitative distribution of products, and assuming a 5-subsite model for the active site of alpha-amylase, differential activities for the hydrolysis of the different glycosidic bonds in the 2 series of substrates were deduced. A highly sensitive coupled continuous assay system is based on the formation of phenyloligosaccharides with 1-4 glucose residues by the action of the amylase under test, coupled to hydrolysis of these products by yeast alpha-glucosidase. The most suitable test substrates were shown to be para-nitrophenyl-alpha-D-maltotetraoside and -pentaoside. Direct production of nitrophenol from ortho-nitrophenyl-alpha-D-maltotrioside is recommended for the measurement of the alpha-amylase activity of pancreatic and salivary gland secretions and extracts.

  4. Bean alpha-amylase inhibitors in transgenic peas inhibit development of pea weevil larvae.

    PubMed

    de Sousa-Majer, Maria José; Hardie, Darryl C; Turner, Neil C; Higgins, Thomas J V

    2007-08-01

    This glasshouse study used an improved larval measurement procedure to evaluate the impact of transgenic pea, Pisum sativum L., seeds expressing a-amylase inhibitor (AI)-1 or -2 proteins on pea weevil, Bruchus pisorum L. Seeds of transgenic 'Laura' and 'Greenfeast' peas expressing alpha-(AI)-1 reduced pea weevil survival by 93-98%. Larval mortality occurred at an early instar. Conversely, in nontransgenic cultivars, approximately 98-99% of the pea weevils emerged as adults. By measuring the head capsule size, we determined that larvae died at the first to early third instar in alpha-(AI)-1 transgenic peas, indicating that this inhibitor is highly effective in controlling this insect. By contrast, transgenic Laura and 'Dundale' expressing alpha-(AI)-2 did not affect pea weevil survival, but they did delay larval development. After 77 d of development, the head capsule size indicated that the larvae were still at the third instar stage in transgenic alpha-(AI)-2 peas, whereas adult bruchids had developed in the nontransgenic peas.

  5. Structural investigation and homology modeling studies of native and truncated forms of alpha-amylases from Sclerotinia sclerotiorum.

    PubMed

    Ben Abdelmalek, Imen; Urdaci, Maria Camino; Ben Ali, Mamdouh; Denayrolles, Muriel; Chaignepain, Stephane; Limam, Ferid; Bejar, Samir; Marzouki, Mohamed Nejib

    2009-11-01

    The filamentous ascomycete Sclerotinia sclerotiorum is well known for its ability to produce a large variety of hydrolytic enzymes for the degradation of plant polysaccharide material. Two alpha-amylases designated as ScAmy54 and ScAmy43 were biochemically characterized and predicted to play an important role in starch degradation. Those enzymes produce specific oligosaccharides, essentially maltotriose, that have a considerable commercial interest. The primary structures of the two enzymes were analyzed by N-terminal sequencing, MALDI-TOF mass spectrometry, and cDNA cloning, and implied that the two proteins have the same N-terminal catalytic domain and ScAmy43 was produced from ScAmy54 by truncation of 96 amino acids at the carboxyl-terminal region. The result of genomic analysis suggested that the two enzymes originated from the same alpha-amylase gene and that truncation of ScAmy54 to ScAmy43 occurred probably during the S. sclerotiorum cultivation. The structural gene of ScAmy54 consisted of 9 exons and 8 introns, containing a single 1,500-bp open reading frame encoding 499 amino acids including a signal peptide of 21 amino acids. ScAmy54 exhibited high amino acid identity to other liquefying fungal alpha-amylases, essentially in the four conserved regions and in the putative catalytic triad. A 3D structure model of ScAmy54 and ScAmy43 was built using the 3D structure of 2guy from A. niger as template. ScAmy54 with three domains A, B, and C, including the well-known (beta/alpha)8-barrel motif in domain A, has a typical structure of the alpha-amylase family. ScAmy43 composed only of domains A and B constitutes a smallest fungal alpha-amylase with only a catalytic domain.

  6. Purification and characterization of alpha-amylase from Bacillus licheniformis CUMC305

    SciTech Connect

    Krishnan, T.; Chandra, A.K.

    1983-08-01

    Alpha-amylase produced by Bacillus licheniformis CUMC305 was purified 212-fold with a 42% yield through a series of four steps. The purified enzyme was homogeneous as shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and discontinuous gel electrophoresis. The purified enzyme showed maximal activity at 90 degrees C and pH 9.0, and 91% of this activity remained at 100 degrees C. In the presence of substrate (soluble starch), the alpha-amylase enzyme was fully stable after a 4-hour incubation at 100 degrees C. The enzyme showed 100% stability in the pH range 7 to 9; 95% stability at pH 10; and 84, 74, 68, and 50% stability at pH values of 6, 5, 4, and 3, respectively, after 18 hours of treatment. The activation energy for this enzyme was calculated as 5.1 x 10 to the power of 5 J/mol. The molecular weight was estimated to be 28,000 by sodium dodecyl sulfate-gel electrophoresis. The relative rates of hydrolysis of soluble starch, amylose, amylopectin, and glycogen were 1.27, 1.8, 1.94, and 2.28 mg/ml, respectively. Vmax values for hydrolysis of these substrates were calculated as 0.738, 1.08, 0.8, and 0.5 mg of maltose/ml per min, respectively. Of the cations, Na+, Ca(2+), and Mg(2+), showed stimulatory effect, wheras Hg(2+), Cu(2+), Ni(2+), Zn(2+), Ag+, Fe(2+), Co(2+), Cd(2+), Al(3+), and Mn(2+) were inhibitory. Of the anions, azide, F-, SO/sub 3/(2-), SO/sub 4/(3-), S/sub 2/O/sub 3/(2-), MoO/sub 4/(2-), and Wo/sub 4/(2-) showed an excitant effect. p-Chloromercuribenzoic acid and sodium iodoacetate were inhibitory, whereas cysteine, reduced glutathione, thiourea, beta-mercaptoethanol, and sodium glycerophosphate afforded protection to enzyme activity. Alpha-amylase was fairly resistant to EDTA treatment at 30 degrees C, but heating at 90 degrees C in presence of EDTA resulted in the complete loss of enzyme activity. (Refs. 32).

  7. Purification and Characterization of alpha-Amylase from Bacillus licheniformis CUMC305.

    PubMed

    Krishnan, T; Chandra, A K

    1983-08-01

    alpha-Amylase produced by Bacillus licheniformis CUMC305 was purified 212-fold with a 42% yield through a series of four steps. The purified enzyme was homogeneous as shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and discontinuous gel electrophoresis. The purified enzyme showed maximal activity at 90 degrees C and pH 9.0, and 91% of this activity remained at 100 degrees C. The enzyme retained 91, 79, and 71% maximal activity after 3 h of treatment at 60 degrees C, 3 h at 70 degrees C, and 90 min at 80 degrees C, respectively, in the absence of substrate. On the contrary, in the presence of substrate (soluble starch), the alpha-amylase enzyme was fully stable after a 4-h incubation at 100 degrees C. The enzyme showed 100% stability in the pH range 7 to 9; 95% stability at pH 10; and 84, 74, 68, and 50% stability at pH values of 6, 5, 4, and 3, respectively, after 18 h of treatment. The activation energy for this enzyme was calculated as 5.1 x 10 J/mol. The molecular weight was estimated to be 28,000 by sodium dodecyl sulfate-gel electrophoresis. The relative rates of hydrolysis of soluble starch, amylose, amylopectin, and glycogen were 1.27, 1.8, 1.94, and 2.28 mg/ml, respectively. V(max) values for hydrolysis of these substrates were calculated as 0.738, 1.08, 0.8, and 0.5 mg of maltose/ml per min, respectively. Of the cations, Na, Ca, and Mg, showed stimulatory effect, whereas Hg, Cu, Ni, Zn, Ag, Fe, Co, Cd, Al, and Mn were inhibitory. Of the anions, azide, F, SO(3), SO(4), S(2)O(3), MoO(4), and Wo(4) showed an excitant effect. p-Chloromercuribenzoic acid and sodium iodoacetate were inhibitory, whereas cysteine, reduced glutathione, thiourea, beta-mercaptoethanol, and sodium glycerophosphate afforded protection to enzyme activity. alpha-Amylase was fairly resistant to EDTA treatment at 30 degrees C, but heating at 90 degrees C in presence of EDTA resulted in the complete loss of enzyme activity, which could be recovered partially by the

  8. Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children

    ERIC Educational Resources Information Center

    Kidd, Sharon A.; Corbett, Blythe A.; Granger, Douglas A.; Boyce, W. Thomas; Anders, Thomas F.; Tager, Ira B.

    2012-01-01

    We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in preschool-aged children with autism (AUT) and typically developing children (TYP). Fifty-two subjects (26 AUT and 26 TYP) were enrolled. Salivary samples were obtained at waking, midday, and bedtime on two consecutive days at three phases…

  9. Permissive role of the acidification caused by wheat aleurone layers upon. alpha. -amylase induction by GA sub 3

    SciTech Connect

    Rodriguez-Campos, E.; Bernal-Lugo, I.; Hamabata, A. )

    1989-04-01

    Wheat aleurone has the capacity of acidifying the incubation medium in 1 to 2 pH units. The {alpha}-amylase induction by GA{sub 3} in isolated wheat aleurone layers is strongly dependent on acidic pH of the medium (pH < 5). To examine possible mechanisms {sup 35}-Met incorporation into proteins and {alpha}-amylase, in the presence of GA{sub 3} and Ca{sup 2+} at pH, 4, 5 and 6 was studied. Although {sup 35}-Met uptake decreased markedly ({approx} 90%) at pH 4 in thepresence of GA{sub 3}, incorporation into total protein did not change significantly from other conditions. Auto-radiography of SDS-PAGE showed that most of the amino acid was in the {alpha}-amylase band, meaning that the effect of acidic pH is specific for GA{sub 3} actions on aleurone tissue. On the other hand, an increase of protonated GA{sub 3} diffusion could be ruled out. Also, there was not {alpha}-amylase inactivation at pH 6. These findings point out to the important physiological role of the acidification caused by the aleurone.

  10. Alpha-Amylase Inhibition and Antioxidative Capacity of Some Antidiabetic Plants Used by the Traditional Healers in Southeastern Nigeria

    PubMed Central

    Oyedemi, Blessing O.; Ijeh, Ifeoma I.; Ohanyerem, Princemartins E.; Aiyegoro, Olayinka A.

    2017-01-01

    Oxidative stress plays a significant role in the pathogenesis of metabolic syndrome including diabetes mellitus (DM). The inhibition of alpha-amylase is an important therapeutic target in the regulation of postprandial increase of blood glucose in diabetic patients. The present study investigated the alpha-amylase inhibitory and antioxidant potential of selected herbal drugs used in the treatment of DM by the traditional healers in Isiala Mbano and Ikwuano regions of southeastern Nigeria. Antioxidant activity was evaluated in terms of free radical scavenging, reducing power, and total phenolic (TPC) and flavonoid content (TFC) in consonance with the TLC profiling. The results showed that methanol crude extracts from Anacardium occidentale (AO) and Ceiba pentandra (CP) recorded higher TPC and TFC, potent free radical scavenging, and efficient reducing power (RP) as compared with other plant samples. All the plant extracts exhibited a relative alpha-amylase inhibition apart from Strophanthus hispidus (SH) extract with a negative effect. We discovered a mild to weak correlation between alpha-amylase inhibition or antioxidative capacity and the total phenol or flavonoid content. At least in part, the results obtained in this work support the traditional use of certain plant species in the treatment of patients with DM. PMID:28367491

  11. Relationship Between Meditation Depth and Waking Salivary Alpha-Amylase Secretion Among Long-Term MBSR Instructors.

    PubMed

    Haslam, Alyson; Wirth, Michael D; Robb, Sara Wagner

    2016-09-28

    The purpose of this study was to characterize sympathetic activity by using waking salivary alpha-amylase (sAA) concentrations in a group of long-term meditation instructors and to examine the association between meditation (depth, dose and duration) and the waking alpha-amylase response. Salivary alpha-amylase samples were collected (immediately upon waking and at 15-min, 30-min and 45-min intervals after waking) from mindfulness-based stress reduction instructors to determine both the area under the curve and the awakening slope (difference in alpha-amylase concentrations between waking and 30-min post-waking). It was determined through general linear models that neither years of meditation nor meditation dose were associated with the awakening sAA slope, but higher scores for meditation depth (greater depth) was associated with a more negative (or steeper) awakening slope [Quartile (Q)1: -7 versus Q4: -21 U/mL; p = 0.06], in fully adjusted models. Older age (p = 0.04) and a later time of waking (p < 0.01) also were associated with less negative awakening slope values. Smoking was associated with lower area under the curve values (smokers: 1716 U/mL versus nonsmokers: 2107 U/mL; p = 0.05) in fully adjusted models. The results suggest a 'healthy' sAA waking slope among individuals who meditate more deeply. Copyright © 2016 John Wiley & Sons, Ltd.

  12. Identification of essential amino acid residues of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Takahashi, T; Hiramoto, S; Wato, S; Nishimoto, T; Wada, Y; Nagai, K; Yamaguchi, H

    1999-11-01

    Kidney bean (Phaseolus vulgaris) alpha-amylase inhibitors, which are bivalent inhibitors with the subunit stoichiometry of (alphabeta)(2) complex, have been inferred to contain unique arginine, tryptophan, and tyrosine residues essential for the inhibitory activity. To test the validity of this inference, an attempt was made to identify the essential amino acid residues of a white kidney bean (P. vulgaris) alpha-amylase inhibitor (PHA-I) by using the chemical modification technique combined with amino acid sequencing and mass spectrometry. Exhaustive modification of the arginine residues by phenylglyoxal did not lead to a marked loss of activity, suggesting that no arginine residue is directly associated with the inhibitory activity. N-Bromosuccinimide treatment of PHA-I in the presence or absence of a substrate alpha-amylase revealed the involvement of two tryptophan residues in alpha-amylase inhibition, and they were identified as Trp188 of the beta-subunit by amino acid sequencing and mass spectrometry of lysylendopeptidase peptides. Further, two tyrosine residues were preferentially modified either by N-acetylimidazole or by tetranitromethane, resulting in a concomitant loss of most of the PHA-I activity. Amino acid sequencing of the lysylendopeptidase peptides from a tetranitromethane-modified PHA-I identified Tyr186 of the beta-subunit as an essential residue.

  13. Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children

    ERIC Educational Resources Information Center

    Kidd, Sharon A.; Corbett, Blythe A.; Granger, Douglas A.; Boyce, W. Thomas; Anders, Thomas F.; Tager, Ira B.

    2012-01-01

    We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in preschool-aged children with autism (AUT) and typically developing children (TYP). Fifty-two subjects (26 AUT and 26 TYP) were enrolled. Salivary samples were obtained at waking, midday, and bedtime on two consecutive days at three phases…

  14. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat Butte 86

    USDA-ARS?s Scientific Manuscript database

    The complement of genes encoding alpha-amylase/protease inhibitors expressed in Triticum aestivum cv. Butte 86 was characterized by transcript and proteomic analysis. Coding sequences for 18 distinct proteins were identified among a collection of expressed sequence tags (ESTs) from Butte 86 developi...

  15. Maltose effects on barley malt diastatic power enzyme activity and thermostability at high isothermal mashing temperature: II. Alpha-amylase

    USDA-ARS?s Scientific Manuscript database

    Maltose, the primary product of starch degradation during mashing, has the potential as a compatible solute to affect the activity of and increase the thermostability of barley malt alpha-amylase activity at high temperatures used in mashing and temperatures above those normally used in mashing. To ...

  16. The green tea polyphenol (-)-epigallocatechin gallate precipitates salivary proteins including alpha-amylase: biochemical implications for oral health.

    PubMed

    Hara, Kumiko; Ohara, Masaru; Hayashi, Ikue; Hino, Takamune; Nishimura, Rumi; Iwasaki, Yoriko; Ogawa, Tetsuji; Ohyama, Yoshihiko; Sugiyama, Masaru; Amano, Hideaki

    2012-04-01

    Green tea is a popular drink throughout the world, and it contains various components, including the green tea polyphenol (-)-epigallocatechin gallate (EGCG). Tea interacts with saliva upon entering the mouth, so the interaction between saliva and EGCG interested us, especially with respect to EGCG-protein binding. SDS-PAGE revealed that several salivary proteins were precipitated after adding EGCG to saliva. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) peptide mass fingerprinting indicated that the major proteins precipitated by EGCG were alpha-amylase, S100, and cystatins. Surface plasmon resonance revealed that EGCG bound to alpha-amylase at dissociation constant (K(d)) = 2.74 × 10(-6) M, suggesting that EGCG interacts with salivary proteins with a relatively strong affinity. In addition, EGCG inhibited the activity of alpha-amylase by non-competitive inhibition, indicating that EGCG is effective at inhibiting the formation of fermentable carbohydrates involved in caries formation. Interestingly, alpha-amylase reduced the antimicrobial activity of EGCG against the periodontal bacterium Aggregatibacter actinomycetemcomitans. Therefore, we considered that EGCG-salivary protein interactions might have both protective and detrimental effects with respect to oral health.

  17. Effects of alpha-amylases from different sources on the firming of concentrated wheat starch gels: relationship to bread staling.

    PubMed

    Palacios, Hernan R; Schwarz, Paul B; D'Appolonia, Bert L

    2004-09-22

    The firming and carbohydrate fractions of concentrated starch gels supplemented with four alpha-amylases from different sources were evaluated. Correlations were found between the firmness data and results for the carbohydrate fractions extracted from the gels. The thermostable (TBA) and intermediate temperature stability (ISBA) bacterial alpha-amylases were most effective in decreasing the rate of firming. The cereal alpha-amylase at the high level (CAH) was also effective. The CAH produced the largest quantity of dextrins at storage time zero and the thermostable bacterial alpha-amylase at the high level (TBAH) after storage for 5 days. None of the maltooligosaccharides appeared to be responsible for the decreased rate of firming of the gels. The results indicated that the TBA and ISBA most effectively inhibited firming because they degraded the external branches and the intercluster regions of amylopectin during storage. Consideration of previously reported differential scanning calorimetry and X-ray crystallography results leads to the conclusion that the antifirming action of the TBA and ISBA is due to their ability to degrade the amylopectin and amorphous regions of the gels during storage, which inhibits the formation of double helices and decreases the strength of the starch gel matrix. Gels supplemented with the TBA and ISBA were most crystalline but firmed to a lesser extent. These results are similar to those previously reported by other researchers for bread and strongly suggest that starch retrogradation plays a primary role in bread staling.

  18. Neohesperidin dihydrochalcone: presentation of a small molecule activator of mammalian alpha-amylase as an allosteric effector.

    PubMed

    Kashani-Amin, Elaheh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2013-03-18

    Flavonoids and their precursor trans-chalcone have been reported as inhibitors of mammalian alpha-amylase. With regard to this background, neohesperidin dihydrochalcone (NHDC) effect was investigated toward porcine pancreatic alpha-amylase (PPA), and found to be an activator of the enzyme. The maximal activation (up to threefold) was found to occur at 4.8mM of NHDC, which could be considered to have a high activation profile, with regard to the alpha and beta parameters (alpha<1

  19. Engineering of a Bacillus alpha-amylase with improved thermostability and calcium independency.

    PubMed

    Ghollasi, Marzieh; Khajeh, Khosro; Naderi-Manesh, Hossein; Ghasemi, Atiyeh

    2010-09-01

    Successful industrial use of amylases requires that they are sufficiently stable and active at application conditions, e.g., at high temperature in starch-liquefaction process. In the present study, site-directed mutagenesis was used to enhance the thermal stability and calcium independency of a mesophilic alpha-amylase from Bacillus megaterium WHO. Mutations (A53S and H58I) were designed at the calcium-binding site based on the sequence alignment. Kinetic and thermostability parameters of the mutants were analyzed and compared with that of the wild type. In the presence of calcium, the affinity of the enzymes (wild type and mutants) toward starch was increased. In comparison to the wild type, calcium ion had more effect on the catalytic efficiency, k (cat)/K (m), and half-life (at 60 degrees C) of A53S mutant. In A53S, the dependence of half-life on calcium concentration showed that the enhanced calcium binding is likely to be responsible for the increased stability. In contrast, calcium-independent mutant (H58I) possessed high thermostability. In addition, thermodynamic parameters of amylolytic reaction exhibited an increase in the activation energy and the entropy of the system. Kinetics of irreversible thermal inactivation suggests that the activation energy increased by 1.4-fold in the most stable variant.

  20. Alpha-amylase inhibitors selected from a combinatorial library of a cellulose binding domain scaffold.

    PubMed

    Lehtiö, J; Teeri, T T; Nygren, P A

    2000-11-15

    A disulfide bridge-constrained cellulose binding domain (CBD(WT)) derived from the cellobiohydrolase Cel7A from Trichoderma reesei has been investigated for use in scaffold engineering to obtain novel binding proteins. The gene encoding the wild-type 36 aa CBD(WT) domain was first inserted into a phagemid vector and shown to be functionally displayed on M13 filamentous phage as a protein III fusion protein with retained cellulose binding activity. A combinatorial library comprising 46 million variants of the CBD domain was constructed through randomization of 11 positions located at the domain surface and distributed over three separate beta-sheets of the domain. Using the enzyme porcine alpha-amylase (PPA) as target in biopannings, two CBD variants showing selective binding to the enzyme were characterized. Reduction and iodoacetamide blocking of cysteine residues in selected CBD variants resulted in a loss of binding activity, indicating a conformation dependent binding. Interestingly, further studies showed that the selected CBD variants were capable of competing with the binding of the amylase inhibitor acarbose to the enzyme. In addition, the enzyme activity could be partially inhibited by addition of soluble protein, suggesting that the selected CBD variants bind to the active site of the enzyme.

  1. The structure of human pancreatic alpha-amylase at 1.8 A resolution and comparisons with related enzymes.

    PubMed

    Brayer, G D; Luo, Y; Withers, S G

    1995-09-01

    The structure of human pancreatic alpha-amylase has been determined to 1.8 A resolution using X-ray diffraction techniques. This enzyme is found to be composed of three structural domains. The largest is Domain A (residues 1-99, 169-404), which forms a central eight-stranded parallel beta-barrel, to one end of which are located the active site residues Asp 197, Glu 233, and Asp 300. Also found in this vicinity is a bound chloride ion that forms ligand interactions to Arg 195, Asn 298, and Arg 337. Domain B is the smallest (residues 100-168) and serves to form a calcium binding site against the wall of the beta-barrel of Domain A. Protein groups making ligand interactions to this calcium include Asn 100, Arg 158, Asp 167, and His 201. Domain C (residues 405-496) is made up of anti-parallel beta-structure and is only loosely associated with Domains A and B. It is notable that the N-terminal glutamine residue of human pancreatic alpha-amylase undergoes a posttranslational modification to form a stable pyrrolidone derivative that may provide protection against other digestive enzymes. Structure-based comparisons of human pancreatic alpha-amylase with functionally related enzymes serve to emphasize three points. Firstly, despite this approach facilitating primary sequence alignments with respect to the numerous insertions and deletions present, overall there is only approximately 15% sequence homology between the mammalian and fungal alpha-amylases. Secondly, in contrast, these same studies indicate that significant structural homology is present and of the order of approximately 70%. Thirdly, the positioning of Domain C can vary considerably between alpha-amylases. In terms of the more closely related porcine enzyme, there are four regions of polypeptide chain (residues 237-250, 304-310, 346-354, and 458-461) with significantly different conformations from those in human pancreatic alpha-amylase. At least two of these could play a role in observed differential

  2. Comparing Dental Stress in New Child Patients and Returning Patients Using Salivary Cortisol, Immunoglobulin-A and Alpha- Amylase.

    PubMed

    Alaki, Sumer M; Safi, Ayman; Ouda, Soliman; Nadhreen, Alaa

    2017-09-22

    this study was aimed at comparing dental stress in children having their first dental visit to those returning for dental treatment using salivary biomarkers of stress including salivary cortisol (s-cortisol), Immunoglobulin-A (s-IgA) and alpha-amylase (s-α-amylase). Additionally, the study was aimed at monitoring the change in stress in new patients as they progressed from the waiting to the clinical areas. salivary samples were collected from 40 children who had not been to a dentist before and similar samples were collected from 40 children who were returning for completion of dental treatment. Salivary cortisol, s-IgA and s-α-amylase concentrations were obtained by Enzyme-linked Immunosorbent Assay (ELISA). salivary cortisol levels were higher for new patients at the waiting area compared to that at the dental chair (p=0.05). Salivary alpha-amylase significantly increased in new patients while being seated in the dental chair. Returning patients had higher s-α-amylase (p=0.001) and s-IgA (p=0.016) compared to new patients. Returning patients had the lowest level of s-cortisol when providers were faculty pediatric dentists than with students and interns (p=0.035). children coming in for their first dental visit may experience dental stress at the waiting area before being seated for dental examination. Returning children may experience higher levels of stress compared to new child patients possibly due to previous dental exposure.

  3. Characterization of. alpha. -amylase-inhibitor, a lectin-like protein in the seeds of Phaseolus vulgaris

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1990-03-01

    The common bean, Phaseolus vulgaris, contains a glycoprotein that inhibits the activity of mammalian and insect {alpha}-amylases but not of plant {alpha}-amylases. It is therefore classified as an antifeedant or seed defense protein. In P. vulgaris cv Greensleeves, {alpha}-amylase inhibitor ({alpha}Al) is present in embryonic axes and cotyledons, but not in other organs of the plant. The protein is synthesized during the same time period that phaseolin and phytohemagglutinin are made and also accumulates in the protein storage vacuoles (protein bodies). All the glycoforms have complex glycans that are resistant to removal by endoglycosidase H, indicating transport of the protein through the Golgi apparatus. The two different polypeptides correspond to the N-terminal and C-terminal halves of a lectin-like protein encoded by an already identified gene or a gene closely related to it. The primary translation product of {alpha}Al is a polypeptide of M{sub r} 28,000. Immunologically cross-reacting glycopolypeptides of M{sub r} 30,000 to 35,000 are present in the endoplasmic reticulum, while the smaller polypeptides (M{sub r} 15,000-19,000) accumulate in protein storage vacuoles (protein bodies). Together these data indicate that {alpha}Al is a typical bean lectin-type protein that is synthesized on the rough endoplasmic reticulum, modified in the Golgi, and transported to the protein storage vacuoles.

  4. Purification and characterization of extracellular alpha-amylase and glucoamylase from the yeast Candida antarctica CBS 6678.

    PubMed

    De Mot, R; Verachtert, H

    1987-05-04

    An alpha-amylase and a glucoamylase were purified to homogeneity from the culture fluid of beta-cyclodextrin-grown Candida antarctica CBS 6678 by protamine sulfate treatment, ammonium sulfate precipitation, gel filtration (Sephadex G-75 sf, Ultrogel AcA 54), DEAE-Sephacel chromatography, hydroxyapatite chromatography and affinity chromatography on acarbose--AH-Sepharose 4B. Both enzymes were monomeric glycoproteins with fairly different amino acid compositions. Their apparent relative molecular mass, sedimentation coefficient (Szero20,w), isoelectric point, absorption coefficient (280 nm), pH and temperature optima were estimated as 48,500, 4.7 S, 10.1, 1.74 cm2 mg-1, 4.2 and 57 degrees C, respectively, for glucoamylase and as 50,000, 4.9 S, 10.3, 1.53 cm2 mg-1, 4.2 and 62 degrees C, respectively, for alpha-amylase. Kinetic analyses indicated that both enzymes preferentially hydrolyzed high-molecular-mass substrates, including some raw starches. alpha-Amylase was active on cyclodextrins, whereas debranching activity was demonstrated for glucoamylase. Trestatins were potent inhibitors of both alpha-amylase (Ki less than 1 microM) and glucoamylase (Ki less than 0.1 microM), being more effective than Bay e 4609 (Ki less than 10 microM). Glucoamylase was selectivity and strongly inhibited by acarbose (Ki less than 0.1 microM). Activity of the latter enzyme was also affected by 1-deoxynojirimycin (Ki less than 1 mM), maltitol and amino alcohols (Ki less than 10 mM). Unlike alpha-amylase, glucoamylase adsorbed strongly onto raw starch, the adsorption site being non-identical with the active site.

  5. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  6. Salivary alpha-amylase changes promoted by sustained exposure to affective pictures.

    PubMed

    Sánchez-Navarro, Juan P; Maldonado, Enrique F; Martínez-Selva, José M; Enguix, Alfredo; Ortiz, Carmen

    2012-12-01

    We studied the changes in salivary alpha-amylase (sAA) and other psychophysiological indices (heart rate, skin conductance, and corrugator supercilii activity) elicited by sustained exposure to affective pictures. Thirty-nine subjects viewed five blocks of pictures depicting mutilations, human attack, neutral scenes, sport/adventure, and erotica. Each block comprised 12 pictures of the same content. Saliva samples were collected before and after each block of pictures. The results showed that mutilation pictures promoted the greatest increase in sAA activity and output, as well as greater corrugator supercilii activity than pleasant pictures. Skin conductance response did not differ among high arousal picture contents. Changes in sAA varied with the affective valence but not with the arousal ratings of the pictures. Our results point to sAA as an index directly related to the unpleasantness elicited by sustained exposure to affective stimuli. Copyright © 2012 Society for Psychophysiological Research.

  7. Self-compassionate young adults show lower salivary alpha-amylase responses to repeated psychosocial stress

    PubMed Central

    Breines, Juliana G.; McInnis, Christine M.; Kuras, Yuliya I.; Thoma, Myriam V.; Gianferante, Danielle; Hanlin, Luke; Chen, Xuejie; Rohleder, Nicolas

    2015-01-01

    In this study we tested the hypothesis that participants higher in dispositional self-compassion would show lower stress-induced reactivity of salivary alpha-amylase (sAA), a marker of sympathetic nervous system activation. Thirty-three healthy participants (18–34 years old) were exposed to a standardized laboratory stressor on two consecutive days. Self-compassion, self-esteem, and demographic factors were assessed by questionnaire and sAA was assessed at baseline and at 1, 10, 30, and 60 minutes following each stressor. Self-compassion was a significant negative predictor of sAA responses on both days. This relationship remained significant when controlling for self-esteem, subjective distress, age, gender, ethnicity, and Body Mass Index (BMI). These results suggest that self-compassion may serve as a protective factor against stress-induced physiological changes that have implications for health. PMID:26005394

  8. Multi-site substrate binding and interplay in barley alpha-amylase 1.

    PubMed

    Nielsen, Morten Munch; Seo, Eun-Seong; Bozonnet, Sophie; Aghajari, Nushin; Robert, Xavier; Haser, Richard; Svensson, Birte

    2008-07-23

    Certain starch hydrolases possess secondary carbohydrate binding sites outside of the active site, suggesting that multi-site substrate interactions are functionally significant. In barley alpha-amylase both Tyr380, situated on a remote non-catalytic domain, and Tyr105 in subsite -6 of the active site cleft are principal carbohydrate binding residues. The dual active site/secondary site mutants Y105A/Y380A and Y105A/Y380M show that each of Tyr380 and Tyr105 is important, albeit not essential for binding, degradation, and multiple attack on polysaccharides, while Tyr105 predominates in oligosaccharide hydrolysis. Additional delicate structure/function relationships of the secondary site are uncovered using Y380A/H395A, Y380A, and H395A AMY1 mutants.

  9. Cell-associated alpha-amylases of butyrate-producing Firmicute bacteria from the human colon.

    PubMed

    Ramsay, Alan G; Scott, Karen P; Martin, Jenny C; Rincon, Marco T; Flint, Harry J

    2006-11-01

    Selected butyrate-producing bacteria from the human colon that are related to Roseburia spp. and Butyrivibrio fibrisolvens showed a good ability to utilize a variety of starches for growth when compared with the Gram-negative amylolytic anaerobe Bacteroides thetaiotaomicron. A major cell-associated amylase of high molecular mass (140-210 kDa) was detected in each strain by SDS-PAGE zymogram analysis, and genes corresponding to these enzymes were analysed for two representative strains. Amy13B from But. fibrisolvens 16/4 is a multi-domain enzyme of 144.6 kDa that includes a family 13 glycoside hydrolase domain, and duplicated family 26 carbohydrate-binding modules. Amy13A (182.4 kDa), from Roseburia inulinivorans A2-194, also includes a family 13 domain, which is preceded by two repeat units of approximately 116 aa rich in aromatic residues, an isoamylase N-terminal domain, a pullulanase-associated domain, and an additional unidentified domain. Both Amy13A and Amy13B have N-terminal signal peptides and C-terminal cell-wall sorting signals, including a modified LPXTG motif similar to that involved in interactions with the cell surface in other Gram-positive bacteria, a hydrophobic transmembrane segment, and a basic C terminus. The overexpressed family 13 domains showed an absolute requirement for Mg2+ or Ca2+ for activity, and functioned as 1,4-alpha-glucanohydrolases (alpha-amylases; EC 3.2.1.1). These major starch-degrading enzymes thus appear to be anchored to the cell wall in this important group of human gut bacteria.

  10. Structural analysis of a chimeric bacterial alpha-amylase. High-resolution analysis of native and ligand complexes.

    PubMed

    Brzozowski, A M; Lawson, D M; Turkenburg, J P; Bisgaard-Frantzen, H; Svendsen, A; Borchert, T V; Dauter, Z; Wilson, K S; Davies, G J

    2000-08-08

    Several chimeric alpha-amylases genes were constructed by an in vivo recombination technique from the Bacillus amyloliquefaciens and Bacillus licheniformis genes. One of the fusion amylases (hereafter BA2), consisting of residues 1-300 from B. amyloliquefaciens and 301-483 from B. licheniformis, has been extensively studied by X-ray crystallography at resolutions between 2.2 and 1.7 A. The 3-dimensional structure of the native enzyme was solved by multiple isomorphous replacement, and refined at a resolution of 1.7 A. It consists of 483 amino acids, organized similarly to the known B. lichiniformis alpha-amylase structure [Machius et al. (1995) J. Mol. Biol. 246, 545-559], but features 4 bound calcium ions. Two of these form part of a linear cluster of three ions, the central ion being attributed to sodium. This cluster lies at the junction of the A and B domains with one calcium of the cluster structurally equivalent to the major Ca(2+) binding site of fungal alpha-amylases. The third calcium ion is found at the interface of the A and C domains. BA2 contains a fourth calcium site, not observed in the B. licheniformis alpha-amylase structure. It is found on the C domain where it bridges the two beta-sheets. Three acid residues (Glu261, Asp328, and Asp231) form an active site similar to that seen in other amylases. In the presence of TRIS buffer, a single molecule of TRIS occupies the -1 subsite of the enzyme where it is coordinated by the three active-center carboxylates. Kinetic data reveal that BA2 displays properties intermediate to those of its parents. Data for crystals soaked in maltooligosaccharides reveal the presence of a maltotriose binding site on the N-terminal face of the (beta/alpha)(8) barrel of the molecule, not previously described for any alpha-amylase structure, the biological function of which is unclear. Data for a complex soaked with the tetrasaccharide inhibitor acarbose, at 1.9 A, reveal a decasaccharide moiety, spanning the -7 to +3

  11. Plant cell calcium-rich environment enhances thermostability of recombinantly produced alpha-amylase from the hyperthermophilic bacterium Thermotoga maritime.

    PubMed

    Santa-Maria, Monica C; Chou, Chung-Jung; Yencho, G Craig; Haigler, Candace H; Thompson, William F; Kelly, Robert M; Sosinski, Bryon

    2009-12-01

    In the industrial processing of starch for sugar syrup and ethanol production, a liquefaction step is involved where starch is initially solubilized at high temperature and partially hydrolyzed with a thermostable and thermoactive alpha-amylase. Most amylases require calcium as a cofactor for their activity and stability, therefore calcium, along with the thermostable enzyme, are typically added to the starch mixture during enzymatic liquefaction, thereby increasing process costs. An attractive alternative would be to produce the enzyme directly in the tissue to be treated. In a proof of concept study, tobacco cell cultures were used as model system to test in planta production of a hyperthermophilic alpha-amylase from Thermotoga maritima. While comparable biochemical properties to recombinant production in Escherichia coli were observed, thermostability of the plant-produced alpha-amylase benefited significantly from high intrinsic calcium levels in the tobacco cells. The plant-made enzyme retained 85% of its initial activity after 3 h incubation at 100 degrees C, whereas the E. coli-produced enzyme was completely inactivated after 30 min under the same conditions. The addition of Ca(2+) or plant cell extracts from tobacco and sweetpotato to the E. coli-produced enzyme resulted in a similar stabilization, demonstrating the importance of a calcium-rich environment for thermostability, as well as the advantage of producing this enzyme directly in plant cells where calcium is readily available.

  12. Rubusuaviins A-F, monomeric and oligomeric ellagitannins from Chinese sweet tea and their alpha-amylase inhibitory activity.

    PubMed

    Li, Haizhou; Tanaka, Takashi; Zhang, Ying-Jun; Yang, Chong-Ren; Kouno, Isao

    2007-09-01

    Six new ellagitannins herein, rubusuaviins A-F, were isolated from the aqueous acetone extract of Chinese sweet tea (Tien-cha, dried leaves of Rubus suavissimus S. LEE) together with seven known tannins. Rubusuaviin A was characterized as 1-O-galloyl-2,3-O-(S)-HHDP-4,6-O-(S)-sanguisorboyl-beta-D-glucopyranose. Rubusuaviins B, C, and E are dimeric, trimeric, and tetrameric ellagitannins, respectively, in which the sanguisorboyl groups were connected ellagitannin units. Rubusuaviins D and F were desgalloyl derivatives of rubusuaviins C and E, respectively. The inhibition of alpha-amylase activity by rubusuaviins and related ellagitannins was compared. Ellagitannins with beta-galloyl groups at the glucose C-1 positions showed stronger inhibition compared with the alpha-galloyl and desgalloyl compounds. The molecular weight of these compounds was not important for the inhibition of alpha-amylase activity.

  13. Putative implication of alpha-amylase loop 7 in the mechanism of substrate binding and reaction products release.

    PubMed

    André, G; Tran, V

    2004-10-05

    Alpha-amylases are widespread endo-enzymes involved in the hydrolysis of internal alpha-(1,4) glycosidic linkages of starch polymers. Molecular modeling of amylose-amylase interactions is a step toward enzymatic mechanism understanding and rational design of new enzymes. From the crystallographic complex of barley alpha-amylase AMY2-acarbose, the static aspects of amylose-amylase docking have been characterized with a model of maltododecaose (DP12) (G. André, A. Buléon, R. Haser, and V. Tran, Biopolymers 1999, Vol. 50, pp. 751-762; G. André and V. Tran, Special Publication no. 246 1999, The Royal Society of Chemistry, H. J. Gilbert, G. J. Davies, B. Henrissat, and B. Svensson, Eds., Cambridge, pp. 165-174). These studies, consistent with the experimental subsite mapping (K. Bak-Jensen, G. André, V. Tran, and B. Svensson, Journal of Biological Chemistry, to be published), propose a propagation scheme for an amylose chain in the active cleft of AMY2. The topographical overview of alpha-amylases identified loop 7 as a conserved segment flanking the active site. Since some crystallographic experiments suspected its high flexibility, its putative motion was explored through a robotic scheme, an alternate route to dynamics simulations that consume CPU time. The present article describes the characteristics of the flexibility of loop 7: location and motion in AMY2. A back-and-forth motion with a large amplitude of more than 0.6 nm was evaluated. This movement could be triggered by two hinge residues. It results in the loop flipping over the active site to enhance the docking of the native helical substrate through specific interactions, it positions the catalytic residues, it distorts the substrate towards its transition state geometry, and finally monitors the release of the products after hydrolysis. The residues involved in the process are now rational mutation points in the hands of molecular biologists.

  14. Genetic, Hormonal, and Physiological Analysis of Late Maturity α-Amylase in Wheat1[W][OA

    PubMed Central

    Barrero, Jose M.; Mrva, Kolumbina; Talbot, Mark J.; White, Rosemary G.; Taylor, Jennifer; Gubler, Frank; Mares, Daryl J.

    2013-01-01

    Late maturity α-amylase (LMA) is a genetic defect that is commonly found in bread wheat (Triticum aestivum) cultivars and can result in commercially unacceptably high levels of α-amylase in harvest-ripe grain in the absence of rain or preharvest sprouting. This defect represents a serious problem for wheat farmers, and apart from the circumstantial evidence that gibberellins are somehow involved in the expression of LMA, the mechanisms or genes underlying LMA are unknown. In this work, we use a doubled haploid population segregating for constitutive LMA to physiologically analyze the appearance of LMA during grain development and to profile the transcriptomic and hormonal changes associated with this phenomenon. Our results show that LMA is a consequence of a very narrow and transitory peak of expression of genes encoding high-isoelectric point α-amylase during grain development and that the LMA phenotype seems to be a partial or incomplete gibberellin response emerging from a strongly altered hormonal environment. PMID:23321420

  15. Structures of Thermoactinomyces vulgaris R-47 alpha-amylase II complexed with substrate analogues.

    PubMed

    Yokota, T; Tonozuka, T; Shimura, Y; Ichikawa, K; Kamitori, S; Sakano, Y

    2001-03-01

    The structures of Thermoactinomyces vulgaris R-47 alpha-amylase II mutant (d325nTVA II) complexed with substrate analogues, methyl beta-cyclodextrin (m beta-CD) and maltohexaose (G6), were solved by X-ray diffraction at 3.2 A and 3.3 A resolution, respectively. In d325nTVA II-m beta-CD complex, the orientation and binding-position of beta-CD in TVA II were identical to those in cyclodextin glucanotransferase (CGTase). The active site residues were essentialy conserved, while there are no residues corresponding to Tyr89, Phe183, and His233 of CGTase in TVA II. In d325nTVA II-G6 complex, the electron density maps of two glucosyl units at the non-reducing end were disordered and invisible. The four glucosyl units of G6 were bound to TVA II as in CGTase, while the others were not stacked and were probably flexible. The residues of TVA II corresponding to Tyr89, Lys232, and His233 of CGTase were completely lacking. These results suggest that the lack of the residues related to alpha-glucan and CD-stacking causes the functional distinctions between CGTase and TVA II.

  16. Relationship of sequence and structure to specificity in the alpha-amylase family of enzymes.

    PubMed

    MacGregor, E A; Janecek, S; Svensson, B

    2001-03-09

    The hydrolases and transferases that constitute the alpha-amylase family are multidomain proteins, but each has a catalytic domain in the form of a (beta/alpha)(8)-barrel, with the active site being at the C-terminal end of the barrel beta-strands. Although the enzymes are believed to share the same catalytic acids and a common mechanism of action, they have been assigned to three separate families - 13, 70 and 77 - in the classification scheme for glycoside hydrolases and transferases that is based on amino acid sequence similarities. Each enzyme has one glutamic acid and two aspartic acid residues necessary for activity, while most enzymes of the family also contain two histidine residues critical for transition state stabilisation. These five residues occur in four short sequences conserved throughout the family, and within such sequences some key amino acid residues are related to enzyme specificity. A table is given showing motifs distinctive for each specificity as extracted from 316 sequences, which should aid in identifying the enzyme from primary structure information. Where appropriate, existing problems with identification of some enzymes of the family are pointed out. For enzymes of known three-dimensional structure, action is discussed in terms of molecular architecture. The sequence-specificity and structure-specificity relationships described may provide useful pointers for rational protein engineering.

  17. Purification and characterization of alpha-amylase from Bacillus amyloliquefaciens NCIM 2829.

    PubMed

    De, Mithu; Das, Kali P; Chakrabartty, P K

    2005-10-01

    Alpha-Amylase (EC 3.2.1.1) was purified to homogeneity (specific activity 58,000 micromole min(-1) mg protein(-1)) from the culture filtrate of Bacillus amyloliquefaciens NCIM 2829. Its molecular mass was found to be 67.5 kDa. The activity of the enzyme increased by almost 50% in the presence of Co+2 ion. Hg2+ and Cu2+ acted as strong inhibitors of the enzyme. The tryptophan moities of the enzyme were fairly protected from the aqueous environment. However, the globular interior of the protein was somewhat loosely packed. The protein had nearly an equal amount of alpha-helical and beta-sheet structure in dilute solution. In concentrated solution, its secondary structure had a higher proportion of beta-sheet at the expense of some random coil structure. The protein showed a molten globule state at a low concentration of chaotropic agent. The denaturation profile of the protein showed no cooperativity. Co2+ enhanced the structural stability of the enzyme.

  18. Correlation of Salivary Alpha Amylase Level and Adenotonsillar Hypertrophy with Sleep Disordered Breathing in Pediatric Subjects

    PubMed Central

    Park, Chan-Soon; Guilleminault, Christian; Park, Hong-Jin; Cho, Jin-Hee; Lee, Heung-Ku; Son, Hye-Lim; Hwang, Se-Hwan

    2014-01-01

    Study Objectives: Obstructive sleep apnea syndrome (OSAS) and sleep disordered breathing (SDB) can affect the sympathetic adrenomedullary system (SAM). As a biomarker of SAM activity, salivary α-amylase (sAA) in pediatric subjects was evaluated whether it has any correlation with polysomnographic (PSG) parameters related to SDB. Methods: Sixty-seven children who attended our clinic during 1 year were enrolled prospectively and underwent clinical examinations and in-lab polysomnography. The sAA was measured at 2 points—at night before PSG and in the early morning after PSG Results: Subjects were divided into control (n = 26, apneahypopnea index [AHI] < 1) and OSAS (n = 41, AHI ≥ 1) groups. The OSAS group was subdivided according to AHI (mild-moderate, 1 ≤ AHI < 10; severe, AHI ≥ 10). The sAA subtraction and ratio (p = 0.014 and p < 0.001, respectively) were significantly higher in severe OSAS than in the mild-moderate and control groups. Although oxygen desaturation index (ODI) and AHI were significantly associated with sAA, sAA in the OSAS group was not related to lowest oxygen saturation or adenotonsillar hypertrophy. Conclusion: sAA was well related to polysomnographic (PSG) parameters related to SDB, such as AHI and ODI. Therefore, screening test for sAA in children suspected to have SBD may help to identify OSAS patients from control. Citation: Park CS, Guilleminault C, Park HJ, Cho JH, Lee HK, Son HL, Hwang SH. Correlation of salivary alpha amylase level and adenotonsillar hypertrophy with sleep disordered breathing in pediatric subjects. J Clin Sleep Med 2014;10(5):559-566. PMID:24812542

  19. THESIS-ABSTRACT Supplementation levels of exogenous alpha-amylase in broilers diets.

    PubMed

    Oliveira, H B; Silva, M I A; Mesquita, F R

    2017-08-17

    This study aimed to evaluate the supplementation levels of an exogenous alpha-amylase in broilers diets and compare two indicators in determining the diets energy. The experiment was divided into two parallel evaluations, being one of performance and the other of metabolism. In performance assay, 1,700 one-day-old Cobb-500 male chicks were used. The animals were distributed in 50 experimental plots and evaluated five treatments with ten replicates in a completely randomized design (CRD). The treatments were: a positive control (PC), a negative control (NC) and three alpha-amylase supplementation levels 200, 400 and 600 g/t, and the NC was formulated with 50 and 90 kcal of energy reduction in relation to the PC to the phases from 1 to 21 days and from 22 to 42 days, respectively. In the metabolism assay were used 240 animals, 150 birds for stage from 14 to 21 days and 90 birds to stage from 35 to 42 days of age and the treatments were the same as the performance assay, with six replicates per treatment in CRD. All diets of metabolism test contained the digestibility indicators Lipe(®) (eucalyptus purified lignin) and chromic oxide (Cr2O3), in concentrations of 0.05 and 1.0%, respectively. In the period from 1 to 21 days old, no significant differences were observed in weight gain (WG) (P > 0.05), however, feed intake (FI) was found higher by using 200 ppm of enzyme (P < 0.05) and better feed conversion (FC) with the PC (P < 0.05). From 22 to 42 days, no significant differences were observed on the WG (P > 0.05), but were observed lower FI and better FC to PC treatment (P < 0.05). In the period from 1 to 42 days of age, significant differences were also not observed on the WG (P > 0.05), but there was lower FI and better FC for the PC treatment (P < 0.05). The AMEn (apparent metabolizable energy corrected for nitrogen balance), determined using the total collection, reaffirmed the values ​​calculated for the PC and NC with intermediate data obtained from the

  20. Effects of a dietary Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle.

    PubMed

    Tricarico, J M; Abney, M D; Galyean, M L; Rivera, J D; Hanson, K C; McLeod, K R; Harmon, D L

    2007-03-01

    Three experiments were conducted to examine the effects of an Aspergillus oryzae extract containing alpha-amylase activity on performance and carcass characteristics of finishing beef cattle. In Exp. 1, 120 crossbred steers were used in a randomized complete block design to evaluate the effects of roughage source (alfalfa hay vs. cottonseed hulls) and supplemental alpha-amylase at 950 dextrinizing units (DU)/kg of DM. Significant roughage source x alpha-amylase interactions (P < 0.05) were observed for performance. In steers fed cottonseed hulls, supplemental alpha-amylase increased ADG through d 28 and 112 and tended (P < 0.15) to increase ADG in all other periods. The increases in ADG were related to increased DMI and efficiency of gain during the initial 28-d period but were primarily related to increased DMI as the feeding period progressed. Supplemental alpha-amylase increased (P = 0.02) the LM area across both roughage sources. In Exp. 2, 96 crossbred heifers were used in a randomized complete block design with a 2 x 3 factorial arrangement of treatments to evaluate the effects of corn processing (dry cracked vs. high moisture) and supplemental alpha-amylase concentration (0, 580, or 1,160 DU/kg of DM). Alpha-amylase supplementation increased DMI (P = 0.05) and ADG (P = 0.03) during the initial 28 d on feed and carcass-adjusted ADG (P = 0.04) across corn processing methods. Longissimus muscle area was greatest (quadratic effect, P = 0.04), and yield grade was least (quadratic effect, P = 0.02) in heifers fed 580 DU of alpha-amylase/kg of DM across corn processing methods. In Exp. 3, 56 crossbred steers were used in a randomized complete block design to evaluate the effects of supplemental alpha-amylase (930 DU/kg of DM) on performance when DMI was restricted to yield a programmed ADG. Alpha-amylase supplementation did not affect performance when DMI was restricted. We conclude that dietary alpha-amylase supplementation of finishing beef diets may result in

  1. Hyper-production of alpha-amylase from agro-residual medium with high-glucose in SSF using catabolite derepressed Bacillus subtilis KCC103.

    PubMed

    Rajagopalan, Gobinath; Krishnan, Chandraraj

    2010-08-01

    In Bacillus subtilis KCC103, alpha-amylase is hyper-produced and alpha-amylase synthesis is not subject to catabolite repression. The alpha-amylase was produced from KCC103 by solid-state fermentation (SSF) using agro-residues and oil cakes as growth substrates. The KCC103 was also tested for its resistance to repression by hyper level (>10% w/w) of glucose and xylose on alpha-amylase production in SSF. Among growth media containing various combinations of agro-residues, the medium with wheat bran and sunflower oil cake supported highest enzyme production (20700 IU (g dry wt)(-1)). The alpha-amylase production was enhanced (4.2 folds) by optimizing the growth substrate and the process parameters: the optimal conditions were wheat bran:sun flower oil cake ratio-1:1 (w/w), substrate particle size-500 mum, substrate to flask volume-1:100 (w/v), initial substrate moisture content-90% (v/w), inoculum size-35%, initial medium pH-7.0, growth temperature-37 degrees C and cultivation time-48 h. alpha-Amylase production was further enhanced up to 1.7 folds when SSF was carried out using optimized medium supplemented with sugars or yeast extract (1% w/v) under optimized conditions. Supplementation of biomass sugars, glucose or xylose at 20% (w/w), did not repress the synthesis of alpha-amylase showing the hyper-tolerance of KCC103 to repression by simple sugars on alpha-amylase production in SSF. Copyright 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  2. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional alpha-amylase/subtilisin inhibitor from Oryza sativa.

    PubMed

    Lin, Yi Hung; Peng, Wen Yan; Huang, Yen Chieh; Guan, Hong Hsiang; Hsieh, Ying Cheng; Liu, Ming Yih; Chang, Tschining; Chen, Chun Jung

    2006-08-01

    Rice bifunctional alpha-amylase/subtilisin inhibitor (RASI) can inhibit both alpha-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 angstroms resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P2(1)2(1)2, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 angstroms. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%.

  3. Structures of sugar chains of the subunits of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Yamaguchi, H; Funaoka, H; Iwamoto, H

    1992-03-01

    The structures of asparagine-linked oligosaccharides in the subunits of an alpha-amylase inhibitor from the white kidney bean (Phaseolus vulgaris) were determined. Glycopeptides obtained from each subunit were treated with hydrazine, then N-acetylated. The oligosaccharides thus liberated were labeled with 2-aminopyridine at their reducing ends and purified by gel-permeation, reverse-phase, and size-fractionation HPLC. The structures of seven oligosaccharides from the alpha-subunit and eight oligosaccharides from the beta-subunit were determined by a combination of composition and molecular size analyses, exo- and endoglycosidase digestions, partial acetolysis, and 1H-NMR spectroscopy. The major glycan chains in the alpha-subunit were Man alpha 1-6(Man alpha 1-3)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)-Man beta 1-4GlcNAc beta 1-4GlcNAc and (Man alpha 1-2)Man alpha 1-6(Man alpha 1-2Man alpha 1-3)Man alpha 1-6 (Man alpha 1-2Man alpha 1-2Man alpha 1-3)Man beta 1-4GlcNAc beta 1-4GlcNAc, while a glycan chain Man alpha 1-6(Man alpha 1-3)(Xyl beta 1-2)Man beta 1-4GlcNAc beta 1-4GlcNAc comprised more than 70% of the sugar moiety of the beta-subunit.

  4. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).

    PubMed

    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima

    2006-09-01

    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  5. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  6. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts.

    PubMed

    Rahimzadeh, Mahsa; Jahanshahi, Samaneh; Moein, Soheila; Moein, Mahmood Reza

    2014-06-01

    One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and 0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets.

  7. Hyperthermostable, Ca(2+)-independent, and high maltose-forming alpha-amylase production by an extreme thermophile Geobacillus thermoleovorans: whole cell immobilization.

    PubMed

    Rao, J L Uma Maheswar; Satyanarayana, T

    2009-11-01

    The synthesis of extracellular alpha-amylase in Geobacillus thermoleovorans was constitutive. The enzyme was secreted in metabolizable carbon sources as well as non-metabolizable synthetic analogues of glucose, but the titers were higher in the former than that in the latter. G. thermoleovorans is a fast-growing facultatively anaerobic bacterium that grows under both aerobic and anaerobic conditions and produces an extracellular amylolytic enzyme alpha-amylase with the by-product of lactic acid. G. thermoleovorans is a rich source of various novel thermostable biocatalysts for different industrial applications. alpha-Amylase synthesis was subject to catabolite repression in the presence of high concentrations of glucose. The addition of cAMP to the medium containing glucose did not result in the repression of alpha-amylase synthesis. The addition of maltose (1%) to the starch arginine medium resulted in a twofold enhancement in enzyme titers. Polyurethane foam (PUF)-immobilized cells secreted alpha-amylase, which was higher than that with the free cells. PUF appeared to be a better matrix for immobilization of the thermophilic bacterium than the other commonly used matrices. The repeated use of PUF-immobilized cells was possible over 15 cycles with a sustained alpha-amylase secretion. The use of this enzyme in starch saccharification eliminates the addition of Ca(2+) in starch liquefaction and its subsequent removal by ion exchangers from the product streams.

  8. Sociodemographic Risk, Parenting, and Effortful Control: Relations to Salivary Alpha-amylase and Cortisol in Early Childhood

    PubMed Central

    Taylor, Zoe E.; Spinrad, Tracy L.; VanSchyndel, Sarah K.; Eisenberg, Nancy; Huynh, Jacqueline; Sulik, Michael J.; Granger, Douglas A.

    2012-01-01

    Early sociodemographic risk, parenting, and temperament were examined as predictors of the activity of children’s (N = 148; 81 boys, 67 girls) hypothalamic-pituitary-adrenal axis and autonomic nervous system. Demographic risk was assessed at 18 months (T1), intrusive-overcontrolling parenting and effortful control were assessed at 30 months (T2), and salivary cortisol and alpha-amylase were collected at 72 (T3) months of age. Demographic risk at T1 predicted lower levels of children’s effortful control and higher levels of mothers’ intrusive-overcontrolling parenting at T2. Intrusive-overcontrolling parenting at T2 predicted higher levels of children’s cortisol and alpha-amylase at T3, but effortful control did not uniquely predict children’s cortisol or alpha-amylase. Findings support the open nature of stress responsive physiological systems to influence by features of the early caregiving environment and underscore the utility of including measures of these systems in prevention trials designed to influence child outcomes by modifying parenting behavior. PMID:22949301

  9. Detection and measurement of alpha-amylase in canine saliva and changes after an experimentally induced sympathetic activation.

    PubMed

    Contreras-Aguilar, María Dolores; Tecles, Fernando; Martínez-Subiela, Silvia; Escribano, Damián; Bernal, Luis Jesús; Cerón, José Joaquín

    2017-08-22

    Salivary alpha-amylase (sAA) is considered a biomarker of sympathetic activation in humans, but there is controversy regarding the existence of sAA in dogs. The hypothesis of this study was that sAA exists in dogs and it could change in situations of sympathetic stimulation. Therefore, the aims of this study were: 1) to demonstrate the presence of alpha-amylase in saliva of dogs by Western-Blot, 2) to validate an spectrophotometric method for the measurement of sAA activity and 3) to evaluate the possible changes in sAA activity after the induction of an ejaculation in dogs which is known to produce a sympathetic activation. Western-Blot demonstrated a band in dog saliva specimens between 60 kDa and 50 kDa, similar to purified sAA. The spectrophotometric assay validated showed an adequate inter- and intra-assay precision, and a high correlation coefficient (r = 0.999) in the linearity under dilution study. sAA median activity significantly increased just after ejaculation compared with just before the ejaculation (2.06-fold, P = 0.005). This study demonstrated the existence of alpha-amylase in saliva of dogs and that this enzyme can be measured by a spectrophotometric assay. In addition, results showed that sAA increase after a sympathetic activation and could be potentially used as non-invasive biomarker of sympathetic activity in this species.

  10. Sociodemographic risk, parenting, and effortful control: relations to salivary alpha-amylase and cortisol in early childhood.

    PubMed

    Taylor, Zoe E; Spinrad, Tracy L; VanSchyndel, Sarah K; Eisenberg, Nancy; Huynh, Jacqueline; Sulik, Michael J; Granger, Douglas A

    2013-12-01

    Early sociodemographic risk, parenting, and temperament were examined as predictors of the activity of children's (N = 148; 81 boys, 67 girls) hypothalamic-pituitary-adrenal axis and autonomic nervous system. Demographic risk was assessed at 18 months (T1), intrusive/overcontrolling parenting and effortful control were assessed at 30 months (T2), and salivary cortisol and alpha-amylase were collected at 72 (T3) months of age. Demographic risk at T1 predicted lower levels of children's effortful control and higher levels of mothers' intrusive/overcontrolling parenting at T2. Intrusive/overcontrolling parenting at T2 predicted higher levels of children's cortisol and alpha-amylase at T3, but effortful control did not uniquely predict children's cortisol or alpha-amylase levels. Findings support the open nature of stress responsive physiological systems to influence by features of the early caregiving environment and underscore the utility of including measures of these systems in prevention trials designed to influence child outcomes by modifying parenting behavior. © 2012 Wiley Periodicals, Inc.

  11. Fed-batch optimization of alpha-amylase and protease-producing Bacillus subtilis using Markov chain methods.

    PubMed

    Skolpap, Wanwisa; Scharer, J M; Douglas, P L; Moo-Young, M

    2004-06-20

    A stoichiometry-based model for the fed-batch culture of the recombinant bacterium Bacillus subtilis ATCC 6051a, producing extracellular alpha-amylase as a desirable product and proteases as undesirable products, was developed and verified. The model was then used for optimizing the feeding schedule in fed-batch culture. To handle higher-order model equations (14 state variables), an optimization methodology for the dual-enzyme system is proposed by integrating Pontryagin's optimum principle with fermentation measurements. Markov chain Monte Carlo (MCMC) procedures were appropriate for model parameter and decision variable estimation by using a priori parameter distributions reflecting the experimental results. Using a simplified Metropolis-Hastings algorithm, the specific productivity of alpha-amylase was maximized and the optimum path was confirmed by experimentation. The optimization process predicted a further 14% improvement of alpha-amylase productivity that could not be realized because of the onset of sporulation. Among the decision variables, the switching time from batch to fed-batch operation (t(s)) was the most sensitive decision variable.

  12. Continuous automated assay of alpha-amylase release from superfused rat salivary gland.

    PubMed

    Templeton, D

    1980-11-01

    A method of continuous automated amylase assay is described. This relies on the absorption of iodine by starch to produce a blue color that can be quantified colorimetrically. Digestion of the starch by amylase released from parotid tissue slices reduces the intensity of the color formed, allowing quantification of the amylase released. The assay in sensitive to 0.05 U/amylase/ml and linear up to 13 U/ml. Typical tissue responses to acetyl-beta-methylcholine and isoprenaline are presented.

  13. Crystal structure of calcium-depleted Bacillus licheniformis alpha-amylase at 2.2 A resolution.

    PubMed

    Machius, M; Wiegand, G; Huber, R

    1995-03-03

    The three-dimensional structure of the calcium-free form of Bacillus licheniformis alpha-amylase (BLA) has been determined by multiple isomorphous replacement in a crystal of space group P4(3)2(1)2 (a = b = 119.6 A, c = 85.4 A). The structure was refined using restrained crystallographic refinement to an R-factor of 0.177 for 28,147 independent reflections with intensities FObs > 0 at 2.2 A resolution, with root mean square deviations of 0.008 A and 1.4 degrees from ideal bond lengths and bond angles, respectively. The final model contains 469 residue, 237 water molecules, and one chloride ion. The segment between Trp182 and Asn192 could not be located in the electron density, nor could the N and C termini. Cleavage of the calcium-free form of BLA was observed after Glu189, due to a Glu-C endopeptidase present in trace amounts in the preparation. BLA did not crystallize without this cleavage under the conditions applied. BLA exhibits the characteristic overall topological fold observed for other alpha-amylases and related amylolytic enzymes: a central domain A containing an alpha/beta-barrel with a large protrusion between beta-strand 3 and alpha-helix 3 (domain B) and a C-terminal greek key motif (domain C). Unlike in the other enzymes, domain B possesses a beta-sheet made up of six loosely connected, twisted beta-strands forming a kind of a barrel with a large hole in the interior. Topological comparisons to TAKA-amylase, pig pancreatic alpha-amylase and cyclodextrin glycosyltransferase reveal a very high structural equivalence for large portions of the proteins and an exceptionally pronounced structural similarity for calcium binding, chloride binding and the active site. None of the theories proposed to explain the enhanced thermostability of BLA showed a satisfactory correlation with the three-dimensional structure. Instead, sequence comparisons to the less thermostable bacterial alpha-amylase from Bacillus amyloliquefaciens (BAA) indicate that some ionic

  14. Job categories and their effect on exposure to fungal alpha-amylase and inhalable dust in the U.K. baking industry.

    PubMed

    Elms, Joanne; Beckett, Paul; Griffin, Peter; Evans, Paul; Sams, Craig; Roff, Martin; Curran, Andrew D

    2003-01-01

    Enzymes in flour improver, in particular fungal alpha-amylase, are known to be a significant cause of respiratory allergy in the baking industry. This study measured total inhalable dust and fungal alpha-amylase exposures in U.K. bakeries, mills, and a flour improver production and packing facility and determined whether assignment of job description could identify individuals with the highest exposures to fungal alpha-amylase and inhalable dust. A total of 117 personal samples were taken for workers in 19 bakeries, 2 mills, and a flour improver production and packing facility and were analyzed using a monoclonal based immunoassay. Occupational hygiene surveys were undertaken for each site to assign job description and identify individuals who worked directly with flour improvers. Analysis of exposure data identified that mixers and weighers from large bakeries had the highest exposures to both inhalable dust and fungal alpha-amylase among the different categories of bakery workers (p<.01). Currently, the maximum exposure limit for flour dust in the United Kingdom is 10 mg/m(3) (8-hour time-weighted average reference period). In this study 25% of the total dust results for bakers exceeded 10 mg/m(3), and interestingly, 63% of the individuals with exposure levels exceeding 10 mg/m(3) were weighers and mixers. Individuals who worked directly with flour improvers were exposed to higher levels of both inhalable dust and fungal alpha-amylase (p<.01) than those who were not directly handling these products. Before sensitive immunoassays were utilized for the detection of specific inhalable allergens, gravimetric analysis was often used as a surrogate. There was a weak relationship between inhalable dust and fungal alpha-amylase exposures; however, inhalable dust levels could not be used to predict amylase exposures, which highlights the importance of measuring both inhalable dust and fungal alpha-amylase exposures.

  15. LaaA, a novel high-active alkalophilic alpha-amylase from deep-sea bacterium Luteimonas abyssi XH031(T).

    PubMed

    Song, Qinghao; Wang, Yan; Yin, Chong; Zhang, Xiao-Hua

    2016-08-01

    Alpha-amylase is a kind of broadly used industrial enzymes, most of which have been exploited from terrestrial organism. Comparatively, alpha-amylase from marine environment was largely undeveloped. In this study, a novel alkalophilic alpha-amylase with high activity, Luteimonas abyssi alpha-amylase (LaaA), was cloned from deep-sea bacterium L. abyssi XH031(T) and expressed in Escherichia coli BL21. The gene has a length of 1428bp and encodes 475 amino acids with a 35-residue signal peptide. The specific activity of LaaA reached 8881U/mg at the optimum pH 9.0, which is obvious higher than other reported alpha-amylase. This enzyme can remain active at pH levels ranging from 6.0 to 11.0 and temperatures below 45°C, retaining high activity even at low temperatures (almost 38% residual activity at 10°C). In addition, 1mM Na(+), K(+), and Mn(2+) enhanced the activity of LaaA. To investigate the function of potential active sites, R227G, D229K, E256Q/H, H327V and D328V mutants were generated, and the results suggested that Arg227, Asp229, Glu256 and Asp328 were total conserved and essential for the activity of alpha-amylase LaaA. This study shows that the alpha-amylase LaaA is an alkali-tolerant and high-active amylase with strong potential for use in detergent industry. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Directed evolution of a maltogenic alpha-amylase from Bacillus sp. TS-25.

    PubMed

    Jones, Aubrey; Lamsa, Michael; Frandsen, Torben P; Spendler, Tina; Harris, Paul; Sloma, Alan; Xu, Feng; Nielsen, Jack Bech; Cherry, Joel R

    2008-04-30

    Directed evolution coupled with a high-throughput robotic screen was employed to broaden the industrial use of the maltogenic alpha-amylase Novamyl from Bacillus sp. TS-25. Wild-type Novamyl is currently used in the baking industry as an anti-staling agent in breads baked at neutral or near neutral pH. However, the enzyme is rapidly inactivated during the baking process of bread made with low pH recipes and Novamyl thus has very limited beneficial effect for this particular application. In an effort to improve the performance of Novamyl for low pH bread applications such as sourdough and rye, two error-prone PCR libraries were generated, expressed in Bacillus subtilis and screened for variants with improved thermal stability and activity under low pH conditions. Variants exhibiting improved performance were iteratively recombined using DNA shuffling to create two generations of libraries. Relative to wild-type Novamyl, a number of the resulting variants exhibited more than 10 degrees C increase in thermal stability at pH 4.5, one of which demonstrated substantial anti-staling properties in low pH breads.

  17. Salivary nitric oxide and alpha-amylase as indexes of training intensity and load.

    PubMed

    Diaz, M M; Bocanegra, O L; Teixeira, R R; Soares, S S; Espindola, F S

    2013-01-01

    This study examined the variation in salivary nitric oxide (NO), alpha-amylase (sAA) and serum markers of muscle injury during 21 weeks of training in elite swimmers. Samples of saliva and blood were collected once a month during 5 months from 11 male professional athletes during their regular training season. The variation in each marker throughout the 21 weeks was compared with the dynamics of training volume, intensity and load. Unstimulated whole saliva was assessed for NO and sAA whereas venous blood was assessed for lactate dehydrogenase, creatine kinase, and γ-glutamyltransferase. Nitric oxide and sAA showed a proportional response to the intensity of training. However, whereas the concentration of NO increased across the 21 weeks, the activity of sAA decreased. Similar variations in the concentration of NO and the markers of muscle injury were also observed. The higher concentration of NO might be attributed to changes in haemodynamics and muscle regenerative processes. On the other hand, autonomic regulation towards parasympathetic predominance might have been responsible for the decrease in sAA activity. These findings provide appealing evidence for the utilization of salivary constituents in sports medicine to monitor training programmes.

  18. Diacylglycerol pyrophosphate inhibits the alpha-amylase secretion stimulated by gibberellic acid in barley aleurone.

    PubMed

    Racagni, Graciela; Villasuso, Ana L; Pasquaré, Susana J; Giusto, Norma M; Machado, Estela

    2008-11-01

    ABA plays an important regulatory role in seed germination because it inhibits the response to GA in aleurone, a secretory tissue surrounding the endosperm. Phosphatidic acid (PA) is a well-known intermediary in ABA signaling, but the role of diacylglycerol pyrophosphate (DGPP) in germination processes is not clearly established. In this study, we show that PA produced by phospholipase D (E.C. 3.1.4.4) during the antagonist effect of ABA in GA signaling is rapidly phosphorylated by phosphatidate kinase (PAK) to DGPP. This is a crucial fact for aleurone function because exogenously added dioleoyl-DGPP inhibits secretion of alpha-amylase (E.C. 3.2.1.1). Aleurone treatment with ABA and 1-butanol results in normal secretory activity, and this effect is reversed by addition of dioleoyl-DGPP. We also found that ABA decreased the activity of an Mg2+-independent, N-ethylmaleimide-insensitive form of phosphatidate phosphohydrolase (PAP2) (E.C. 3.1.3.4), leading to reduction of PA dephosphorylation and increased PAK activity. Sequence analysis using Arabidopsis thaliana lipid phosphate phosphatase (LPP) sequences as queries identified two putative molecular homologues, termed HvLPP1 and HvLPP2, encoding putative Lpps with the presence of well-conserved structural Lpp domains. Our results are consistent with a role of DGPP as a regulator of ABA antagonist effect in GA signaling and provide evidence about regulation of PA level by a PAP2 during ABA response in aleurone.

  19. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortiol and Alpha-Amylase

    PubMed Central

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2011-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = .33) completed a measure of peer victimization, teachers rated children’s aggression, and children’s saliva was collected prior to, and following, participation in a laboratory-based peer-oriented social challenge task. Children rated their level of frustration at the end of the task. Results revealed that victimization interacted with cortisol and sAA measured in anticipation of the task to predict aggression; the victimization × cortisol contribution to aggression was partly mediated by children’s self-reported frustration level. Victimization also was associated with heightened frustration in girls with high task-related sAA reactivity. Task-related sAA reactivity was associated with heightened aggression, but only for girls. These findings suggest that associations between peer victimization and aggression are moderated by variation in the activity of the major components of the psychobiology of stress; results are discussed in relation to theoretical models of individual differences in biological sensitivity to context. PMID:20405198

  20. Caffeine and stress alter salivary alpha-amylase activity in young men.

    PubMed

    Klein, Laura C; Bennett, Jeanette M; Whetzel, Courtney A; Granger, Douglas A; Ritter, Frank E

    2010-07-01

    We examined the effects of caffeine and a psychological stressor on salivary alpha-amylase (sAA) in healthy young males (age 18-30 years) who consumed caffeine on a daily basis. Using a between-subjects, double-blind, placebo-controlled design, 45 participants received either 200 or 400 mg of caffeine (Vivarin) or placebo, rested for 20 min, and then performed 20 min of mental arithmetic. Saliva samples (assayed for sAA and caffeine), blood pressure, and heart rate were taken before (baseline) and 15 min after the math stressor (stress). Baseline sAA activity did not differ among the treatment groups; however, there was a statistically significant time by caffeine group interaction. Changes in sAA activity across the session were dependent on the amount of caffeine consumed. Following the challenge period, sAA activity among the placebo group was the lowest and sAA activity among the 400 mg treatment group was the highest. Separate repeated-measures ANOVAs conducted for each drug treatment group revealed that sAA activity increased in response to stress and caffeine (i.e., 200 and 400 mg groups) but not to stress alone (i.e., placebo group). Findings provide evidence for acute sAA changes in response to caffeine and stress in habitual caffeine users. (c) 2010 John Wiley & Sons, Ltd.

  1. Inhibition of human salivary alpha-amylase by glucopyranosylidene-spiro-thiohydantoin.

    PubMed

    Gyémánt, Gyöngyi; Kandra, Lili; Nagy, Veronika; Somsák, László

    2003-12-12

    This study is the first report on the effectiveness and specificity of glucopyranosylidene-spiro-thiohydantoin (G-TH) inhibitor on the 2-chloro-4-nitrophenyl-4-O-beta-D-galactopyranosyl-maltoside (GalG(2)CNP) hydrolysis catalysed by human salivary alpha-amylase (HSA). The inhibition of hydrolysis is a mixed-noncompetitive type. In any case, only one molecule of inhibitor binds to HSA. Since our substrate and inhibitor are small molecules the long enough active site facilitates accommodating both of them simultaneously. However, the product formation can be excluded from enzyme-substrate-inhibitor complex (ESI) since Dixon plots are linear. Kinetic constants calculated from secondary plots and nonlinear regression are almost entirely equal, confirming the fidelity of the suggested model. Kinetic constants (K(1i)=7.3mM, L(1i)=2.84 mM) show that G-TH is not such a potent inhibitor of HSA as acarbose and indicate higher stability for ESI than for enzyme-inhibitor complex.

  2. Effect of temperature on subsite map of Bacillus licheniformis alpha-amylase.

    PubMed

    Kandra, Lili; Remenyik, Judit; Gyémánt, Gyöngyi; Lipták, A

    2006-09-01

    To elucidate how temperature effects subsite mapping of a thermostable alpha-amylase from Bacillus licheniformis (BLA), a comparative study was performed by using 2-chloro-4-nitrophenyl (CNP) beta-maltooligosides with degree of polymerisation (DP) 4-10 as model substrates. Action patterns, cleavage frequencies and subsite binding energies were determined at 50 degrees C, 80 degrees C and 100 degrees C. Subsite map at 80 degrees C indicates more favourable bindings compared to the hydrolysis at 50 degrees C. Hydrolysis at 100 degrees C resulted in a clear shift in the product pattern and suggests significant differences in the active site architecture. Two preferred cleavage modes were seen for all substrates in which subsite (+2) and (+3) were dominant, but CNP-G1 was never formed. In the preferred binding mode of shorter oligomers, CNP-G2 serves as the leaving group (79%, 50%, 59% and 62% from CNP-G4, CNP-G5, CNP-G6 and CNP-G7, respectively), while CNP-G3 is the dominant hydrolysis product from CNP-G8, CNP-G9, and CNP-Gl0 (62%, 68% and 64%, respectively). The high binding energy value (-17.5 kJ/mol) found at subsite (+2) is consistent with the significant formation of CNP-G2. Subsite mapping at 80 degrees C and 100 degrees C confirms that there are no further binding sites despite the presence of longer products.

  3. Conversion of the maltogenic alpha-amylase Novamyl into a CGTase.

    PubMed

    Beier, L; Svendsen, A; Andersen, C; Frandsen, T P; Borchert, T V; Cherry, J R

    2000-07-01

    Novamyl is a thermostable five-domain maltogenic alpha-amylase that shows sequence and structural homology with the cyclodextrin glycosyltransferases (CGTases). Comparing X-ray crystal structures of Novamyl and CGTases, two major differences in the active site cleft were observed: Novamyl contains a loop insertion consisting of five residues (residues 191-195) and the location of an aromatic residue known to be essential to obtain an efficient cyclization reaction. To convert Novamyl into a cyclodextrin (CD)-producing enzyme, the loop was deleted and two substitutions, F188L and T189Y, were introduced. Unlike the parent Novamyl, the obtained variant is able to produce beta-CD and showed an overall conversion of starch to CD of 9%, compared with CGTases which are able to convert up to 40%. The lower conversion compared with the CGTase is probably due to additional differences in the active site cleft and in the starch-binding E domain. A variant with only the five-residue loop deleted was not able to form beta-CD.

  4. Salivary Alpha Amylase, Dental Anxiety, and Extraction Pain: A Pilot Study.

    PubMed

    Lee, Kevin C; Bassiur, Jennifer P

    2017-01-01

    The primary intention of this study was to determine whether salivary alpha-amylase (sAA) factors or the Dental Anxiety Scale (DAS) was a better predictor of dental extraction pain. This study followed a cross-sectional design and included a convenience sample (n = 23) recruited from an outpatient oral surgery clinic. While waiting for their scheduled appointments, consenting patients completed both basic demographic/medical history questionnaires and Corah's DAS as well as submitted sublingual saliva samples. After their extractions, patients marked visual analog scales (VAS) to indicate the intensity of their intraoperative discomfort. Results of this study confirm that there is a relationship between a patient's dental anxiety and intraoperative extraction pain (r[21] = .47, P = .02). This study did not find that preoperative sAA factors (concentration and output rate) were related to either VAS extraction pain or DAS score. A strong positive relationship was observed between the concentration of sAA and the rate of sAA output (r[21] = .81, P < .001). Based on the results of our study, we conclude that dental anxiety has a moderate but significant correlation with intraoperative dental pain. Factors of sAA do not appear to be predictive of this experience. Therefore, simply assessing an anxious patient may be the best indication of that patient's extraction pain.

  5. Harsh discipline and behavior problems: the moderating effects of cortisol and alpha-amylase.

    PubMed

    Chen, Frances R; Raine, Adrian; Rudo-Hutt, Anna S; Glenn, Andrea L; Soyfer, Liana; Granger, Douglas A

    2015-01-01

    Numerous studies link harsh discipline to adjustment problems in youth, yet not all individuals exposed to harsh discipline develop behavior problems. Contemporary theory suggests that this relationship could be moderated by individual differences in environmentally sensitive biological systems. This study investigated whether the interaction between hypothalamic-pituitary-adrenal (HPA) activity and autonomic nervous system (ANS) arousal moderated the link between harsh discipline and behavior problems. Three saliva samples were collected on a single day from 425 inner city youth (50% male, age 11-12 years, 80% African American) and were later assayed for cortisol (HPA) and alpha-amylase (ANS). Problem behavior was assessed by self- and parent-report using the Child Behavior Checklist. Youth also reported the level of harsh discipline that they experienced. Harsh discipline was positively associated with externalizing and internalizing problems only when there were asymmetrical profiles of HPA activity and ANS arousal. This pattern was evident for boys but not girls. Findings are discussed in relation to prevailing theories suggesting that biological susceptibility translates adversity into risk for behavior problems.

  6. Salivary Alpha-amylase and Cortisol in Toddlers: Differential Relations to Affective Behavior

    PubMed Central

    Fortunato, Christine K.; Dribin, Amy E.; Granger, Douglas A.; Buss, Kristin A.

    2008-01-01

    This study applies a non-invasive and multi-system measurement approach (using salivary analytes) to examine associations between the psychobiology of the stress response and affective behavior in toddlers. Eighty-seven two-year-olds (48 females) participated in laboratory tasks designed to elicit emotions and behavior ranging from pleasure/approach to fear/withdrawal. Saliva samples were collected pre-task and immediately post-task, and assayed for markers of sympathetic nervous system (alpha-amylase or sAA) and hypothalamic-pituitary-adrenal axis (cortisol) activity. Individual differences in sAA were positively associated with approach behavior and positive affect; whereas, cortisol was positively associated with negative affect and withdrawal behavior. The findings suggest that individual differences in sAA may covary specifically with positive affect and approach behaviors or the predominant emotional state across a series of tasks. The results are discussed with respect to advancing biosocial models of the concomitants and correlates of young children’s affective behaviors. PMID:18688807

  7. Salivary Alpha-Amylase Activity and Salivary Flow Rate in Young Adults

    PubMed Central

    Arhakis, Aristidis; Karagiannis, Vasilis; Kalfas, Sotirios

    2013-01-01

    The secretion of salivary alpha-amylase (sAA) is more associated with psychoneuroendocrinological response to stress than with the flow rate and age. The aim of this cross sectional study is to build an explanatory model based on patterns of relationship between age 20-39 in resting and stimulated saliva under no stressful condition in healthy volunteers. Both resting and stimulated saliva were collected from 40 subjects. The sAA values were log-transformed, the normality assumption was verified with the Shapiro-Wilk test and the reliability of the measurements was estimated by the Pearsons’ r correlation coefficient. The estimated model was based on the theory of the Linear Mixed Models. Significant mean changes were observed in flow rate and sAA activity between resting and stimulated saliva. The final model consists of two components, the first revealed a positive correlation between age and sAA while the second one revealed a negative correlation between the interaction of age × flow rate in its condition (resting or stimulated saliva), with sAA. Both flow rate and age influence sAA activity. PMID:23524385

  8. Subsite mapping of enzymes. Application of the depolymerase computer model to two alpha-amylases.

    PubMed Central

    Allen, J D; Thoma, J A

    1976-01-01

    In the preceding paper (Allen and Thoma, 1976) we developed a depolymerase computer model, which uses a minimization routine to establish a subsite map for a depolymerase. In the present paper we show how the model is applied to experimental data for two alpha-amylases. Michaelis parameters and bond-cleavage frequencies for substrates of chain lengths up to twelve glucosyl units have been reported for Bacillus amyloliquefaciens, and a subsite map has been proposed for this enzyme [Thoma et al. (1971) J. Biol. Chem. 246, 5621-5635]. By applying the computer model to the experimental data, we have arrived at a ten-subsite map. We find that a significant improvement in this map is achieved by allowing the hydrolytic rate coefficient to vary as a function of the number of occupied subsites comprising the enzyme-binding region. The bond-cleavage frequencies, the enzyme is found to have eight subsites. A partial subsite map is arrived at, but the entire binding region cannot be mapped because Michaelis parameters are complicated by transglycosylation reactions. The hydrolytic rate coefficients for this enzyme are not constant. PMID:999630

  9. Autonomic markers associated with generalized social phobia symptoms: heart rate variability and salivary alpha-amylase.

    PubMed

    García-Rubio, María J; Espín, Laura; Hidalgo, Vanesa; Salvador, Alicia; Gómez-Amor, Jesús

    2017-01-01

    The study of autonomic nervous system changes associated with generalized social phobia (GSP) disorder has increased in recent years, showing contradictory results. The present study aimed to evaluate how young people with GSP reacted before, during, and after exposure to the Trier Stress Social Test (TSST), focusing on their autonomic changes (heart rate variability (HRV) and salivary alpha-amylase (sAA)) compared to a control group (non-GSP). Some psychological variables were also considered. Sex was specifically studied as a possible modulator of autonomic fluctuations and psychological state. Eighty young people were randomly distributed into two counterbalanced situations: stress condition (N = 18 and 21 for GSP and non-GSP, respectively) and control condition (N = 21 and 20 for GSP and non-GSP, respectively), where cardiovascular variables were continuously recorded. Psychological questionnaires about mood and perceived stress were filled out, and five saliva samples were collected to analyze sAA. GSP participants showed higher values on low- and high-frequency ratios (HR domains), compared to non-GSP people, during exposure to the TSST, but no differences were observed after the stressor. Furthermore, the two groups did not differ in sAA. Importantly, positive affect in GSP participants was modulated by sex. The present study suggests that the balance between high- and low-frequency domains of HRV is a key cardiovascular marker reflecting the stress response of GSP people, as well the importance of sex in positive affect when facing a stressful situation.

  10. Molecular evolution and diversity of dimeric alpha-amylase inhibitor gene in Kengyilia species (Triticeae: Poaceae).

    PubMed

    Zeng, Jian; Fan, Xing; Sha, Li-Na; Kang, Hou-Yang; Wang, Yi; Zhang, Hai-Qin; Zhou, Yong-Hong

    2013-10-25

    Kengyilia Yen et J. L. Yang is a group of allohexaploid species with StYP genomic constitutions in the wheat tribe. To investigate the evolution and diversity of dimeric alpha-amylase inhibitor genes in the Kengyilia, forty-five homoeologous DAAI gene sequences were isolated from sampled Kengyilia species and analyzed together with those of its close relatives. These results suggested that (1) Kengyilia species from Central Asia and the Qinghai-Tibetan Plateau had different origins from those of the geographically differentiated P genome; (2) the St and P genomes of Kengyilia were donated by Pseudoroegneria and Agropyron, respectively, and the Y genome had an independent origin and showed an affinity with the St genome; (3) purifying selection dominated the DAAI gene members and the St-DAAI gene was evolving at faster rate than the P- and Y-DAAI genes in Kengyilia; and (4) natural selection was the main factor on the codon usage pattern of the DAAI gene in Kengyilia.

  11. Calcium-binding parameter of Bacillus amyloliquefaciens alpha-amylase determined by inactivation kinetics.

    PubMed Central

    Tanaka, Atsushi; Hoshino, Eiichi

    2002-01-01

    The irreversible thermal inactivation and the thermodynamics of calcium ion binding of Bacillus amyloliquefaciens alpha-amylase in the absence of substrates were studied. The enzyme inactivation on heating was apparently followed by first-order kinetics. The enzyme was stabilized with an increased concentration of calcium ion and thus the inactivation was highly dependent on the state of calcium binding. The activation parameter for the inactivation suggests an unfolding of the enzyme protein upon heating. Values of both the activation enthalpy and entropy were increased with a higher calcium ion concentration. An inactivation kinetic model is based on the assumption of a two-stage unfolding transition in which the bivalent ion dissociation occurs in the first step followed by the secondary structural unfolding. This simple kinetic model provides both a qualitative and quantitative interpretation of calcium ion binding to the enzyme and its effect on the inactivation properties. The specific approximations of the kinetic model were strictly followed in the analysis to calculate the apparent inactivation rate at each calcium ion concentration in terms of the calcium-binding parameters. The enthalpy and entropy changes for the calcium ion binding were calculated to be -149 kJ/mol and -360 J.mol(-1).K(-1) respectively and these values suggest a strong enthalpic affinity for the bivalent ion binding to the enzyme protein. The thermodynamical interpretation attempts to provide clear relations between the terms of an apparent inactivation rate and the calcium binding. PMID:12049626

  12. Salivary Alpha-Amylase Enzyme, Psychological Disorders, and Life Quality in Patients with Recurrent Aphthous Stomatitis

    PubMed Central

    Cardoso, Juliana Andrade; dos Santos Junior, André Avelino; Nunes, Maria Lucia Tiellet; de Figueiredo, Maria Antonia Zancanaro; Cherubini, Karen

    2017-01-01

    Objective. The aim of this study was to evaluate stress, anxiety, and salivary alpha-amylase (SAA) activity in patients with recurrent aphthous stomatitis (RAS). The impact of this disease on the life quality was also evaluated. Design. Twenty-two patients with RAS and controls, matched by sex and age, were selected. Stress and anxiety were assessed using Lipp's Inventory of Stress Symptoms and Beck Anxiety Inventory. Life quality was assessed through the World Health Organization Quality of Life-bref (WHOQOL-BREF) and the Oral Health Impact Profile-14 (OHIP-14). Saliva samples were collected in the morning and afternoon and the SAA activity was analyzed by enzymatic kinetic method. Results. No significant difference was observed between the groups regarding the SAA activity (p = 0.306). Patients with RAS had higher scores of anxiety (p = 0.016). The scores of WHOQOL-BREF were significantly lower in patients with RAS. The values obtained through OHIP-14 were significantly higher in these patients (p = 0.002). Conclusion. RAS negatively affects the life quality. Patients with the disease have higher levels of anxiety, suggesting its association with the etiopathogenesis of RAS. PMID:28408928

  13. Salivary Alpha-Amylase Enzyme, Psychological Disorders, and Life Quality in Patients with Recurrent Aphthous Stomatitis.

    PubMed

    Cardoso, Juliana Andrade; Dos Santos Junior, André Avelino; Nunes, Maria Lucia Tiellet; de Figueiredo, Maria Antonia Zancanaro; Cherubini, Karen; Salum, Fernanda Gonçalves

    2017-01-01

    Objective. The aim of this study was to evaluate stress, anxiety, and salivary alpha-amylase (SAA) activity in patients with recurrent aphthous stomatitis (RAS). The impact of this disease on the life quality was also evaluated. Design. Twenty-two patients with RAS and controls, matched by sex and age, were selected. Stress and anxiety were assessed using Lipp's Inventory of Stress Symptoms and Beck Anxiety Inventory. Life quality was assessed through the World Health Organization Quality of Life-bref (WHOQOL-BREF) and the Oral Health Impact Profile-14 (OHIP-14). Saliva samples were collected in the morning and afternoon and the SAA activity was analyzed by enzymatic kinetic method. Results. No significant difference was observed between the groups regarding the SAA activity (p = 0.306). Patients with RAS had higher scores of anxiety (p = 0.016). The scores of WHOQOL-BREF were significantly lower in patients with RAS. The values obtained through OHIP-14 were significantly higher in these patients (p = 0.002). Conclusion. RAS negatively affects the life quality. Patients with the disease have higher levels of anxiety, suggesting its association with the etiopathogenesis of RAS.

  14. Children's cortisol and salivary alpha-amylase interact to predict attention bias to threatening stimuli.

    PubMed

    Ursache, Alexandra; Blair, Clancy

    2015-01-01

    Physiological responses to threat occur through both the autonomic nervous system (ANS) and the hypothalamic pituitary adrenal (HPA) axis. Activity in these systems can be measured through salivary alpha-amylase (sAA) and salivary cortisol, respectively. Theoretical work and empirical studies have suggested the importance of examining the coordination of these systems in relation to cognitive functioning and behavior problems. Less is known, however, about whether these systems interactively predict more automatic aspects of attention processing such as attention toward emotionally salient threatening stimuli. We used a dot probe task to assess attention bias toward threatening stimuli in 347 kindergarten children. Cortisol and sAA were assayed from saliva samples collected prior to children's participation in assessments on a subsequent day. Using regression analyses, we examined relations of sAA and cortisol to attention bias. Results indicate that cortisol and sAA interact in predicting attention bias. Higher levels of cortisol predicted greater bias toward threat for children who had high levels of sAA, but predicted greater bias away from threat for children who had low levels of sAA. These results suggest that greater symmetry in HPA and ANS functioning is associated with greater reliance on automatic attention processes in the face of threat.

  15. Alpha-amylase inhibitory activity and sterol composition of the marine algae, Sargassum glaucescens.

    PubMed

    Payghami, Nasrin; Jamili, Shahla; Rustaiyan, Abdolhossein; Saeidnia, Soodabeh; Nikan, Marjan; Gohari, Ahmad Reza

    2014-01-01

    Sargassum species (phaeophyceae) are economically important brown algae in southern parts of Iran. Sargassum is mainly harvested as a row material in alginate production industries and is a source of plant foods or plant bio-stimulants even a component of animal foods. In this study, Sargassum glaucescens, collected from the seashore of Chabahar, was employed for phytochemical and biological evaluations. For that purpose, the dried algae was extracted by methanol and subjected to different chromatographic separation methods. Six sterols, fucosterol (1), 24(S)-hydroxy-24-vinylcholesterol (2), 24(R)-hydroxy-24-vinylcholesterol (3), stigmasterol (4), β-sitosterol (5) and cholesterol (6) were identified by spectroscopic methods including (1)H-NMR, (13)C-NMR and mass spectroscopy. In vitro alpha-amylase inhibitory test was performed on the methanolic extract and the results revealed a potent inhibition (IC50 = 8.9 ± 2.4 mg/mL) of the enzyme compared to acarbose as a positive control. Various biological activities and distribution of sterols in Sargassum genus have been critically reviewed here. The results concluded that these algae are a good candidate for further anti-diabetic investigations in animals and human.

  16. Alpha-amylase inhibitory activity and sterol composition of the marine algae, Sargassum glaucescens

    PubMed Central

    Payghami, Nasrin; Jamili, Shahla; Rustaiyan, Abdolhossein; Saeidnia, Soodabeh; Nikan, Marjan; Gohari, Ahmad Reza

    2015-01-01

    Background: Sargassum species (phaeophyceae) are economically important brown algae in southern parts of Iran. Sargassum is mainly harvested as a row material in alginate production industries and is a source of plant foods or plant bio-stimulants even a component of animal foods. Objective: In this study, Sargassum glaucescens, collected from the seashore of Chabahar, was employed for phytochemical and biological evaluations. Materials and Methods: For that purpose, the dried algae was extracted by methanol and subjected to different chromatographic separation methods. Results: Six sterols, fucosterol (1), 24(S)-hydroxy-24-vinylcholesterol (2), 24(R)-hydroxy-24-vinylcholesterol (3), stigmasterol (4), β-sitosterol (5) and cholesterol (6) were identified by spectroscopic methods including 1H-NMR, 13C-NMR and mass spectroscopy. In vitro alpha-amylase inhibitory test was performed on the methanolic extract and the results revealed a potent inhibition (IC50 = 8.9 ± 2.4 mg/mL) of the enzyme compared to acarbose as a positive control. Conclusion: Various biological activities and distribution of sterols in Sargassum genus have been critically reviewed here. The results concluded that these algae are a good candidate for further anti-diabetic investigations in animals and human. PMID:26692744

  17. Analysis of the extreme diversity of salivary alpha-amylase isoforms generated by physiological proteolysis using liquid chromatography-tandem mass spectrometry.

    PubMed

    Bailey, Ulla-Maja; Punyadeera, Chamindie; Cooper-White, Justin J; Schulz, Benjamin L

    2012-12-12

    Saliva is a crucial biofluid for oral health and is also of increasing importance as a non-invasive source of disease biomarkers. Salivary alpha-amylase is an abundant protein in saliva, and changes in amylase expression have been previously associated with a variety of diseases and conditions. Salivary alpha-amylase is subject to a high diversity of post-translational modifications, including physiological proteolysis in the oral cavity. Here we developed methodology for rapid sample preparation and non-targeted LC-ESI-MS/MS analysis of saliva from healthy subjects and observed an extreme diversity of alpha-amylase proteolytic isoforms. Our results emphasize the importance of consideration of post-translational events such as proteolysis in proteomic studies, biomarker discovery and validation, particularly in saliva. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Amylases in Pea Tissues with Reduced Chloroplast Density and/or Function.

    PubMed

    Saeed, M; Duke, S H

    1990-12-01

    Pea (Pisum sativum L.) tissues with reduced chloroplast density (e.g. petals and stems) or function (i.e. senescent leaves and leaves darkened for prolonged periods) were surveyed to determine whether tissues with genetically or environmentally reduced chloroplast density and/or function also have significantly different amylolytic enzyme activities and/or isoform patterns than leaf tissues with totally competent chloroplasts. Native PAGE followed by electrophoretically blotting through a starch or beta-limit dextrin containing gel and KI/I(2) staining revealed that the primary amylases in leaves, stems, petals, and roots were the primarily vacuolar beta-amylase (EC 3.2.1.2) and the primarily apoplastic alpha-amylase (EC 3.2.1.1). Among tissues of light grown pea plants, petals contained the highest levels of total amylolytic (primarily beta-amylase) activity and considerably higher ratios of beta- to alpha-amylase. In aerial tissues there was an inverse relationship between chlorophyll and starch concentration, and beta-amylase activity. In sections of petals and stems there was a pronounced inverse relationship between chlorophyll concentration and the activity of alpha-amylase. Senescing leaves of pea, as determined by age, and protein and chlorophyll content, contained 3.8-fold (fresh weight basis) and 32-fold (protein basis) higher alpha-amylase activity than fully mature leaves. Leaves maintained in darkness for 12 days displayed a 14-fold (fresh weight basis) increase in alpha-amylase activity over those grown under continuous light. In senescence and prolonged darkness studies, the alpha-amylase that was greatly increased in activity was the primarily apoplastic alpha-amylase. These studies indicate that there is a pronounced inverse relationship between chloroplast function and levels of apoplastic alpha-amylase activity and in some cases an inverse relationship between chloroplast density and/or function and vacuolar beta-amylase activity.

  19. Evaluation of the alpha-amylase activity as an indicator of pasteurization efficiency and microbiological quality of liquid whole eggs.

    PubMed

    Silva, Guilherme Resende da; Menezes, Liliane Denize Miranda; Lanza, Isabela Pereira; Oliveira, Daniela Duarte de; Silva, Carla Aparecida; Klein, Roger Wilker Tavares; Assis, Débora Cristina Sampaio de; Cançado, Silvana de Vasconcelos

    2017-09-01

    In order to evaluate the efficiency of the pasteurization process in liquid whole eggs, an UV/visible spectrophotometric method was developed and validated for the assessment of alpha-amylase activity. Samples were collected from 30 lots of raw eggs (n = 30) and divided into three groups: one was reserved for analysis of the raw eggs, the second group was pasteurized at 61.1°C for 3.5 minutes (n = 30), and the third group was pasteurized at 64.4°C for 2.5 minutes (n = 30). In addition to assessing alpha-amylase activity, the microbiological quality of the samples was also evaluated by counting total and thermotolerant coliforms, mesophilic aerobic microorganisms, Staphylococcus spp., and Salmonella spp. The validated spectrophotometric method demonstrated linearity, with a coefficient of determination (R2) greater than 0.99, limits of detection (LOD) and quantification (LOQ) of 0.48 mg kg-1 and 1.16 mg kg-1, respectively, and acceptable precision and accuracy with relative standard deviation (RSD) values of less than 10% and recovery rates between 98.81% and 105.40%. The results for alpha-amylase activity in the raw egg samples showed high enzyme activity due to near-complete hydrolysis of the starch, while in the eggs pasteurized at 61.1°C, partial inactivation of the enzyme was observed. In the samples of whole eggs pasteurized at 64.4°C, starch hydrolysis did not occur due to enzyme inactivation. The results of the microbiological analyses showed a decrease (P < 0.0001) in the counts for all the studied microorganisms and in the frequency of Salmonella spp. in the pasteurized egg samples according to the two binomials under investigation, compared to the raw egg samples, which showed high rates of contamination (P < 0.0001). After pasteurization, only one sample (3.33%) was positive for Salmonella spp., indicating failure in the pasteurization process, which was confirmed by the alpha-amylase test. It was concluded that the validated methodology for

  20. Structure of waxy maize starch hydrolyzed by maltogenic alpha-amylase in relation to its retrogradation

    USDA-ARS?s Scientific Manuscript database

    Maltogenic a-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different...

  1. Alpha-amylase from germinating soybean (Glycine max) seeds--purification, characterization and sequential similarity of conserved and catalytic amino acid residues.

    PubMed

    Kumari, Arpana; Singh, Vinay Kumar; Fitter, Jörg; Polen, Tino; Kayastha, Arvind M

    2010-10-01

    Starch hydrolyzing amylase from germinated soybeans seeds (Glycine max) has been purified 400-fold to electrophoretic homogeneity with a final specific activity of 384 units/mg. SDS-PAGE of the final preparation revealed a single protein band of 100 kDa, whereas molecular mass was determined to be 84 kDa by MALDI-TOF and gel filtration on Superdex-200 (FPLC). The enzyme exhibited maximum activity at pH 5.5 and a pI value of 4.85. The energy of activation was determined to be 6.09 kcal/mol in the temperature range 25-85 degrees C. Apparent Michaelis constant (K(m)((app))) for starch was 0.71 mg/mL and turnover number (k(cat)) was 280 s(-1) in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 85 degrees C showed first-order kinetics with rate constant (k) equal to 0.0063 min(-1). Soybean alpha-amylase showed high specificity for its primary substrate starch. High similarity of soybean alpha-amylase with known amylases suggests that this alpha-amylase belongs to glycosyl hydrolase family 13. Cereal alpha-amylases have gained importance due to their compatibility for biotechnological applications. Wide availability and easy purification protocol make soybean as an attractive alternative for plant alpha-amylase. Soybean can be used as commercially viable source of alpha-amylase for various industrial applications. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Studies on the subsite structure of amylases. II. Difference-spectrophotometric studies on the interaction of maltotriose with liquefying alpha-amylase from Bacillus subtilis.

    PubMed

    Ohnishi, M; Kegai, H; Hiromi, K

    1975-08-01

    The difference spectra of liquefying alpha-amylase (EC 3.2.1.1) from B. subtilis upon the addition of a slowly reacting substrate, maltotriose, were measured to investigate specific binding of the substrate to the enzyme. The spectra produced by maltotriose were attributed to one tryptophan and one tyrosine residues on the basis of analysis of their shape and magnitude. From the dependence of the difference absorption upon the concentration of maltotriose, the dissociation constant of the maltotriose-enzyme complex was determined to be 170(+/- 20) mM, which is in good agreement with the Michaelis constant, Km obtained from the steady-state kinetics. The difference spectrum characteristic of a tryptophan residue was significantly decreased by the chemical modification of a trytophan residue with N-bromosuccinimide.

  3. Production and characterization of alpha-amylase from mango kernel by Fusarium solani NAIMCC-F-02956 using submerged fermentation.

    PubMed

    Kumar, Devendra; Yadav, Kaushlesh K; Muthukumar, M; Garg, Neelima

    2013-11-01

    Microbial production of enzymes using low valued agro industrial wastes is gaining importance globally. Mango is one of the major fruit processed into a variety of products. During processing 40-50% of solid waste is generated in form of peel and stones. After decortications of mango stone, kernel is obtained which is a rich source of starch (upto 60%). It was utilized as a substrate for alpha-amylase production using Fusarium soloni. Maximum alpha-amylase production (0.889 U g(-1)) was recorded using a substrate concentration of 5% (w/v), pH-4 and temperature 30 degrees C on 9th day of incubation. Supplementation of production medium with micronutrients viz., Ca2+, Fe2+ or Mg2+ improved the enzyme production while, Zn2+, B3+ or Mn2+ ions exhibited inhibitory effect. The extracellular protein was precipitated by ammonium sulphate up to 70% saturation, dialyzed and purified (27.84 fold) by gel-exclusion (Sephadex G-75) chromatography. Protein profiling on 12% SDS-PAGE revealed three bands corresponding to 26, 27 and 30 kDa molecular sizes. The optimum amylase activity was achieved at pH 5.0 at 40 degrees C. The Michaelis constant (KM), Vmax and activation energy (-Ea) were found to be 3.7 mg ml(-1), 0.24 U mg(-1) and 42.39 kJ mole(-1), respectively.

  4. Using multiconformation continuum electrostatics to compare chloride binding motifs in alpha-amylase, human serum albumin, and Omp32.

    PubMed

    Song, Yifan; Gunner, M R

    2009-04-10

    Ions are a ubiquitous component of the cellular environment, transferring into cells through membrane-embedded proteins. Ions bind to proteins to regulate their charge and function. Here, using multiconformation continuum electrostatics (MCCE), we show that the changes of chloride binding to alpha-amylase, human serum albumin (HSA) and Omp32 with pH, and of alpha-amylase with mutation agree well with experimental data. The three proteins represent three different types of binding. In alpha-amylase, chloride is bound in a specific buried site. Chloride binding is strongly coupled to the protonation state of a nearby lysine. MCCE calculates an 11-fold change in chloride affinity between the wild-type alpha-amylase and the K300R mutant, in good agreement with the measured 10-fold change.Without considering the coupled protonation reaction, the calculated affinity change would be more than 10(6)-fold. In HSA, chlorides are distributed on the protein surface. Although HSA has a negative net charge, it binds more anions than cations. There are no highly occupied binding sites in HSA. Rather, there are many partially occupied sites near clusters of basic residues. The relative affinity of bound ions of different charges is shown to depend on the distribution of charged residues on the surface rather than the overall net charge of the protein. The calculated strong pH dependence of the number of chlorides bound and the anion selectivity agree with those of previous experiments. In Omp32, chlorides are stabilized in an anion-selective transmembrane channel in a pH-independent manner. The positive electrostatic potential in Omp32 results in about two chlorides and no cations bound in the transmembrane region of this anion-selective channel. The studies here show that with the ability to sample multiple binding sites and coupled protein protonation states, MCCE provides a powerful tool to analyze and predict ion binding. The calculations overestimate the affinity of surface

  5. Salicylic acid inhibits gibberellin-induced alpha-amylase expression and seed germination via a pathway involving an abscisic-acid-inducible WRKY gene.

    PubMed

    Xie, Zhen; Zhang, Zhong-Lin; Hanzlik, Shane; Cook, Everett; Shen, Qingxi J

    2007-06-01

    It is well known that abscisic acid (ABA) antagonizes gibberellin (GA)-promoted seed germination. Recent circumstantial evidence suggests that salicylic acid (SA) also inhibits seed germination in maize and Arabidopsis. Our study shows that SA blocks barley seed germination in a dosage dependent manner. As an initial effort to addressing the mechanism controlling the crosstalk of SA, GA and ABA signaling in barley, we studied the regulation of alpha-amylases by SA and a WRKY gene whose expression is modulated by these hormones. Assays of alpha-amylase activity reveal that GA-induced alpha-amylase production in aleurone cells is inhibited by bioactive SA, but not its analogs, 3-hydroxybenzoic acid and 4-hydroxybenzoic acid. This inhibitory effect is unlikely due to repressing alpha-amylase secretion or inhibiting alpha-amylase enzyme activities. Northern blot analyses indicate that SA suppresses GA-induced expression of a barley low pI alpha-amylase gene (Amy32b). Because our previous data indicate that ABA-inducible and GA-suppressible WRKY genes inhibit the expression of alpha-amylase genes in rice, we studied the steady state mRNA levels of a barley WRKY gene, HvWRKY38. The expression of HvWRKY38 in barley aleurone cells is down-regulated by GA, but up-regulated by SA and ABA. However, the regulation of HvWRKY38 by SA appears to be different from that of ABA in term of the kinetics and levels of induction. Over-expression of HvWRKY38 in aleurone cells by particle bombardment blocks GA induction of the Amy32b promoter reporter construct (Amy32b-GUS). Therefore, HvWRKY38 might serve as a converging node of SA and ABA signal pathways involved in suppressing GA-induced seed germination.

  6. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum.

    PubMed

    Kim, Kyung-Tae; Rioux, Laurie-Eve; Turgeon, Sylvie L

    2014-02-01

    Fucoidan is a water-soluble, negatively charged, biologically active polysaccharide found in great abundance in brown marine algae. However, the inhibition of α-amylase and α-glucosidase by fucoidan derived from two algal species (Ascophyllum nodosum and Fucus vesiculosus) harvested at different periods (accounting for seasonal and yearly variations) has never been investigated. It was found that fucoidans inhibited α-glucosidase differently, depending on the algal species from which it was extracted and the algae's season of harvest. Fucoidan extracted from A. nodosum was a more potent inhibitor of α-glucosidase, with an IC50 ranging from 0.013 to 0.047 mg/mL, than the inhibition by fucoidan extracted from F. vesiculosus (IC50=0.049 mg/mL). In contrast, fucoidan extracted from F. vesiculosus did not inhibit α-amylase activity, while fucoidan from A. nodosum decreased α-amylase activity by 7-100% at 5 mg/mL depending upon the algae harvest period. An IC50 of 0.12-4.64 mg/mL for fucoidan from A. nodosum was found for the α-amylase inhibition. The ability of fucoidan to inhibit α-amylase and α-glucosidase thus varies according to the algae species and harvest period. A. nodosum is more suitable than F. vesiculosus as a source of fucoidan to inhibit α-amylase and α-glucosidase activities. Their potential benefits towards Type 2 diabetes management should be further investigated.

  7. Host-mediated induction of alpha-amylases by larvae of the Mexican bean weevil Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae) is irreversible and observed from the initiation of the feeding period.

    PubMed

    Bifano, Thaís D; Samuels, Richard I; Alexandre, Daniel; Silva, Carlos P

    2010-08-01

    Larvae of Zabrotes subfasciatus secrete alpha-amylases that are insensitive to the alpha-amylase inhibitor found in seeds of Phaseolus vulgaris. By analyzing amylase activities during larval development on P. vulgaris, we detected activity of the constitutive amylase and the two inducible amylase isoforms at all stages. When larvae were transferred from the non alpha-amylase inhibitor containing seeds of Vigna unguiculata to P. vulgaris, the inducible alpha-amylases were expressed at the same level as in control larvae fed on P. vulgaris. Interestingly, when larvae were transferred from seeds of P. vulgaris to those of V. unguiculata, inducible alpha-amylases continued to be expressed at a level similar to that found in control larvae fed P. vulgaris continuously. When 10-day-old larvae were removed from seeds of V. unguiculata and transferred into capsules containing flour of P. vulgaris cotyledons, and thus maintained until completing 17 days (age when the larvae stopped feeding), we could detect higher activity of the inducible alpha-amylases. However, when larvae of the same age were transferred from P. vulgaris into capsules containing flour of V. unguiculata, the inducible alpha-amylases remained up-regulated. These results suggest that the larvae of Z. subfasciatus have the ability to induce insensitive amylases early in their development. A short period of feeding on P. vulgaris cotyledon flour was sufficient to irreversibly induce the inducible alpha-amylase isoforms. Incubations of brush border membrane vesicles with the alpha-amylase inhibitor 1 from P. vulgaris suggest that the inhibitor is recognized by putative receptors found in the midgut microvillar membranes.

  8. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.

    PubMed

    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M

    2014-10-01

    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  9. Cortisol and Alpha-amylase changes during an Ultra-Running Event.

    PubMed

    Deneen, Whitney P; Jones, Alexis B

    2017-01-01

    Elevated stress hormone concentrations can positively affect an athlete's overall performance during a competition, and in many cases, are necessary to be able to perform exercise. During extreme exercise, the body's ability to utilize energy efficiently can affect an athlete's performance. Elevated hormonal concentrations can have many benefits in regards to an athlete's overall performance during a competition. The purpose of this study was to examine the effects of long distance running, such as seen during an ultra-running event (distances beyond 26.2 miles), on the activity of the hypothalamic-pituitary-adrenocortical (HPA) axis production of cortisol (CORT) as compared to autonomic nervous system production of salivary alpha-amylase (AA). Despite the well-known effects of exercise on CORT and AA response, it is unclear what effect running beyond the marathon distance has on these levels. This study investigates what effect long duration cardio exercise, such as running up to 100K (kilometers) distance, has on the neuroendocrine system, by means of saliva samples provided by participants signed up for an ultra-marathon event. The findings of this study show that the autonomic nervous system may present a response signal during physical stress that is independent of the HPA axis response. At distances beyond the marathon length, the production of CORT and AA was found to be suppressed for athletes, which could help them in their continued performance. Furthermore, this study recognizes a difference in the overall male and female response to stress in regards to CORT and AA production.

  10. Correlation between salivary alpha-amylase, anxiety, and game records in the archery competition

    PubMed Central

    Lim, In Soo

    2016-01-01

    [Purpose] This study was aimed to investigate the relationship between psychological and physiological changes and performance in archery, which is strongly influenced by psychological factors including concentration, tension, anxiety, and stress. [Methods] A total of 19 athletes from women’s colleges who participated in the 30 m individual competition at the 34th President’s Cup National Archery Competition in July 2016 were included in this study. The anxiety levels of the participants were assessed on a 10-point Likert scale, with 1 corresponding to “not at all” and 10 to “extremely anxious.” Saliva samples were collected as follows: 10 min before the game (pre-10), 1 min before the game (pre-1), and 10 min after the game (post-10). Repeated measures general linear model ANOVA was performed to compare the mean values of salivary alpha amylase (sAA) concentrations and anxiety levels. The correlations between sAA, anxiety, and game records were analyzed using the Pearson’s correlation method. [Results] The sAA concentrations increased significantly in pre-1 and post-10, but not in pre-10 samples. Moreover, anxiety levels increased in both pre-1 and post-10 samples, but not in pre-10 samples. Anxiety and sAA were positively correlated (p < 0.01), while sAA and game records, or anxiety and game record were negatively correlated (p < 0.01). [Conclusion] During the archery competition, the level of cognitive anxiety increased, sAA concentrations increased, and performance decreased. The study findings suggest that during archery competitions, anxiety hinders performance, and this effect may be related to the increase in sAA levels. PMID:28150473

  11. Correlation between salivary alpha-amylase, anxiety, and game records in the archery competition.

    PubMed

    Lim, In Soo

    2016-12-31

    This study was aimed to investigate the relationship between psychological and physiological changes and performance in archery, which is strongly influenced by psychological factors including concentration, tension, anxiety, and stress. A total of 19 athletes from women's colleges who participated in the 30 m individual competition at the 34th President's Cup National Archery Competition in July 2016 were included in this study. The anxiety levels of the participants were assessed on a 10-point Likert scale, with 1 corresponding to "not at all" and 10 to "extremely anxious." Saliva samples were collected as follows: 10 min before the game (pre-10), 1 min before the game (pre-1), and 10 min after the game (post-10). Repeated measures general linear model ANOVA was performed to compare the mean values of salivary alpha amylase (sAA) concentrations and anxiety levels. The correlations between sAA, anxiety, and game records were analyzed using the Pearson's correlation method. The sAA concentrations increased significantly in pre-1 and post-10, but not in pre-10 samples. Moreover, anxiety levels increased in both pre-1 and post-10 samples, but not in pre-10 samples. Anxiety and sAA were positively correlated (p < 0.01), while sAA and game records, or anxiety and game record were negatively correlated (p < 0.01). During the archery competition, the level of cognitive anxiety increased, sAA concentrations increased, and performance decreased. The study findings suggest that during archery competitions, anxiety hinders performance, and this effect may be related to the increase in sAA levels.

  12. Alpha-amylase reactivity in relation to psychopathic traits in adults.

    PubMed

    Glenn, Andrea L; Remmel, Rheanna J; Raine, Adrian; Schug, Robert A; Gao, Yu; Granger, Douglas A

    2015-04-01

    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n=158) of adult males (M age=36.81, range=22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, 'fight or flight', component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis.

  13. Elevated Salivary Alpha Amylase in Adolescent Sexual Abuse Survivors with Posttraumatic Stress Disorder Symptoms

    PubMed Central

    Strawn, Jeffrey R.; Out, Dorothee; Granger, Douglas A.; Putnam, Frank W.

    2015-01-01

    Abstract Objective: Little is known regarding neuroendocrine responses in adolescent girls with posttraumatic stress disorder (PTSD) who have experienced sexual abuse. Therefore, we collected saliva samples three times daily for 3 days to assess concentrations of salivary alpha amylase (sAA) – a surrogate marker for autonomic nervous system (ANS) activity and, in particular, sympathetic activity – in sexually abused adolescent girls. Methods: Twenty-four girls (mean age: 15±1.4 years) who had experienced recent sexual abuse (i.e., sexual abuse occurred 1–6 months prior to study enrollment) and 12 healthy comparison subjects (mean age: 14.8±1.3 years) completed a structured interview and assessments to ascertain symptoms of posttraumatic stress, then collected saliva at home upon awakening, 30 minutes after waking, and at 5 p.m. on three consecutive school days. Results: For sexually abused girls, total PTSD symptoms were associated with higher overall morning levels of sAA (r[20]=0.51, p=0.02), a finding driven by intrusive symptoms (r[20]=0.43, p<0.05) and hyperarousal symptoms (r[20]=0.58, p=0.01). There were no significant differences in diurnal sAA secretion between the sexually abused girls and healthy comparison adolescents. Conclusions: Overall morning concentrations of sAA in sexually abused girls are associated with overall PTSD severity as well as symptoms of hyperarousal and intrusive symptoms, possibly reflecting symptom-linked increases in ANS tone. These data raise the possibility that alterations in ANS activity are related to the pathophysiology of sexual abuse-related PTSD in adolescent girls, and may inform therapeutic interventions (e.g., antiadrenergic medications). PMID:25803321

  14. Salivary alpha amylase and salivary cortisol response to fluid consumption in exercising athletes

    PubMed Central

    Horvath, PJ; Kazial, KA

    2015-01-01

    The objective of the study was to examine salivary biomarker response to fluid consumption in exercising athletes. Exercise induces stress on the body and salivary alpha amylase (sAA) and salivary cortisol are useful biomarkers for activity in the sympathoadrenal medullary system and the hypothalamic pituitary adrenal axis which are involved in the stress response. Fifteen college students were given 150 ml and 500 ml of water on different days and blinded to fluid condition. The exercise protocol was identical for both fluid conditions using absolute exercise intensities ranging from moderate to high. Saliva was collected prior to exercise, post moderate and post high intensities and analyzed by Salimetrics assays. Exercise was significant for sAA with values different between pre-exercise (85 ± 10 U · ml−1) and high intensity (284 ± 30 U · ml−1) as well as between moderate intensity (204 ± 32 U · ml−1) and high intensity. There was no difference in sAA values between fluid conditions at either intensity. Exercise intensity and fluid condition were each significant for cortisol. Cortisol values were different between pre-exercise (0.30 ± 0.03 ug · dL−1) and high intensity (0.45 ± 0.05 ug · dL−1) as well as between moderate intensity (0.33 ± 0.04 ug · dL−1) and high intensity. Moderate exercise intensity cortisol was lower in the 500 ml condition (0.33 ± 0.03 ug · dL−1) compared with the 150 ml condition (0.38 ± 0.03 ug · dL−1). This altered physiological response due to fluid consumption could influence sport performance and should be considered. In addition, future sport and exercise studies should control for fluid consumption. PMID:26681828

  15. Alpha-Amylase Reactivity in Relation to Psychopathic Traits in Adults

    PubMed Central

    Glenn, Andrea L.; Remmel, Rheanna J.; Raine, Adrian; Schug, Robert A.; Gao, Yu; Granger, Douglas A.

    2015-01-01

    Recent investigations of the psychobiology of stress in antisocial youth have benefited from a multi-system measurement model. The inclusion of salivary alpha-amylase (sAA), a surrogate marker of autonomic/sympathetic nervous system (ANS) activity, in addition to salivary cortisol, a biomarker of the hypothalamic-pituitary-adrenal (HPA) axis functioning, has helped define a more complete picture of individual differences and potential dysfunction in the stress response system of these individuals. To the authors' knowledge, no studies have examined sAA in relation to antisocial behavior in adults or in relation to psychopathic traits specifically. In the present study, we examined sAA, in addition to salivary cortisol, in a relatively large sample (n = 158) of adult males (M age = 36.81, range = 22-67 years; 44% African-American, 34% Caucasian, 16% Hispanic) recruited from temporary employment agencies with varying levels of psychopathic traits. Males scoring highest in psychopathy were found to have attenuated sAA reactivity to social stress compared to those scoring lower in psychopathy. No differential relationships with the different factors of psychopathy were observed. In contrast to studies of antisocial youth, there were no interactions between sAA and cortisol levels in relation to psychopathy, but there was a significant interaction between pre-stressor levels of sAA and cortisol. Findings reveal potential regulatory deficits in the fast-acting, ‘fight or flight’, component of the stress response in adult males with psychopathic traits, as well as abnormalities in how this system may interact with the HPA axis. PMID:25662339

  16. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  17. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts

    PubMed Central

    Rahimzadeh, Mahsa; Jahanshahi, Samaneh; Moein, Soheila; Moein, Mahmood Reza

    2014-01-01

    Objective(s): One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Results: Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and 0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Conclusion: Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets. PMID:25140210

  18. Alpha-amylase serum levels in professional soccer players are not related with physical fitness.

    PubMed

    Sanchis-Gomar, Fabian; Alis, Rafael; Rampinini, Ermanno; Bosio, Andrea; Romagnoli, Marco; Lombardi, Giovanni; Lippi, Giuseppe

    2017-03-01

    Recent evidence has showed that serum or salivary values of α-amylase predict endurance running performance. In this study we investigate whether serum α-amylase concentration may be associated with training status during a competitive season and after a detraining period in professional soccer players. The study population consisted in 15 male professional soccer players from an Italian major league team (age [mean±SD] 27±5 years, weight 76.9±4.1 kg, height 1.82±0.05 m). Serum α-amylase levels were measured 3 times during the last part of a competitive season (January, March and May) and just before preseason training (July). Metabolic and cardiovascular fitness of soccer players was improved during the last part of the season. The levels of α-amylase did not change significantly throughout the study period (χ2=7.331, P=0.062), nor they were found to be associated with variation of physical fitness and training status. The α-amylase fluctuations throughout a competitive season and after vacation time were meaningless in professional soccer players. No significant associations with physical fitness variations could be observed. These results suggest that α-amylase concentration may be a useful parameter for identifying individual inclination to endurance exercise, but not for predicting actual training status.

  19. Optimized conditions for determining activity concentration of alpha-amylase in serum, with 1,4-alpha-D-4-nitrophenylmaltoheptaoside as substrate.

    PubMed

    Rauscher, E; Neumann, U; Schaich, E; von Bülow, S; Wahlefeld, A W

    1985-01-01

    We describe a method for measuring the catalytic activity of alpha-amylase (EC 3.2.1.1) in serum and urine, by use of a defined substrate: 1,4-alpha, D-4-nitrophenyl maltoheptaoside. We use a phosphate buffer of pH 7.10, containing chloride as activator and alpha-glucosidase (EC 3.2.1.20) as the auxiliary enzyme. After a lag phase of 4 min at 25 degrees C or 30 degrees C, or 3 min at 37 degrees C, the increase of absorption of 4-nitrophenol is measured at 410 nm or 405 nm. The pH value of the assay mixture is a compromise between optimum pH for the alpha-amylase reaction, shortest possible lag phase, and an acceptable absorptivity of 4-nitrophenol. Because the dissociation of 4-nitrophenol depends strongly on pH and temperature, we determined its absorptivity with various combinations of these variables in the assay. Heparin-treated plasma can be used, but not EDTA, fluoride, or citrate. Lipemia, hemoglobin less than or equal to mumol/L, bilirubin less than or equal to 170 mumol/L, glucose less than or equal to 100 mmol/L, and ascorbic acid less than or equal to 1 mmol/L of sample do not interfere in the assay.

  20. The Multiple Forms of alpha-Amylase Enzyme of the Araucaria Species of South America: A. araucana (Mol.) Koch and A. angustifolia (Bert.) O. Kutz : A Comparative Study.

    PubMed

    Salas, E; Cardemil, L

    1986-08-01

    alpha-Amylase is one of the major enzymes present in the seeds of both Araucaria species of South America and it initiates starch hydrolysis during germination and early seedling growth. The pattern of the multiple forms of alpha-amylase of the two Araucaria species was investigated by electrophoresis and isoelectrofocusing of the native enzyme in polyacrylamide gels. The enzyme forms were compared in the embryo and megagametophyte of quiescent seeds and of seeds imbibed for 18, 48, and 90 hours. Specific alpha-amylase enzyme forms appear and disappear during these imbibition periods showing both similarities and differences between tissues and species. Before imbibition, there are five alpha-amylase forms identical in both tissues, but different between species. After 18 hours of imbibition, there are two enzyme forms in both tissues of Araucaria araucana seeds, only one form in the embryo of Araucaria angustifolia but two forms in the megagametophyte of this specie. After 48 hours of seed imbibition, most of the enzyme forms present in quiescent seeds reappear. At 90 hours of imbibition different enzyme forms are detected in the embryo with respect to the gametophyte. The changes in form patterns of alpha-amylase are discussed according to a possible regulation of gene expression by endogenous gibberellins.

  1. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )

    1990-02-01

    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  2. Immunohistochemical and immunoelectron microscopic analyses of alpha-amylase isozymes in human intrahepatic biliary epithelium and hepatocytes.

    PubMed

    Terada, T; Kono, N; Nakanuma, Y

    1992-11-01

    The expression and localization of the pancreatic and salivary isozymes of alpha-amylase in the intrahepatic biliary epithelium and hepatocytes were examined by the immunohistochemical method with polyclonal and monoclonal antibodies in 45 normal autopsied human livers. Immunoelectron microscopic studies with the protein A-gold method were performed with the monoclonal antibodies (MAb) on seven of the livers. The intrahepatic biliary system was divided into large ducts, septal ducts, interlobular ducts, bile ductules, and peribiliary glands. Immunohistochemically, pancreatic isozyme was observed in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, and peribiliary glands in almost all livers. Interlobular ducts expressed pancreatic isozyme in only four (9%) livers. Bile ductules and hepatocytes were negative for pancreatic isozyme in all cases. Expression of salivary isozyme was observed in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, interlobular ducts, bile ductules, and peribiliary glands in almost all livers, although the expression in interlobular ducts and bile ductules was weak. Hepatocytes were weakly positive for salivary isozyme. Immunoelectron microscopy revealed that both pancreatic and salivary isozymes were located in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, and peribiliary glands, and that hepatocytes had no pancreatic isozyme but contained salivary isozyme. These data suggest that pancreatic and salivary isozymes of alpha-amylase are produced by the intrahepatic biliary epithelium and secreted into intrahepatic biliary lumens, and that they may play an important role in the physiology of the intrahepatic biliary tree and hepatic bile. It is also suggested that hepatocytes produce a small amount of salivary alpha-amylase that may be secreted into the biliary tree.

  3. Enzymatic activity and immunoreactivity of Aca s 4, an alpha-amylase allergen from the storage mite Acarus siro

    PubMed Central

    2012-01-01

    Background Enzymatic allergens of storage mites that contaminate stored food products are poorly characterized. We describe biochemical and immunological properties of the native alpha-amylase allergen Aca s 4 from Acarus siro, a medically important storage mite. Results A. siro produced a high level of alpha-amylase activity attributed to Aca s 4. This enzyme was purified and identified by protein sequencing and LC-MS/MS analysis. Aca s 4 showed a distinct inhibition pattern and an unusual alpha-amylolytic activity with low sensitivity to activation by chloride ions. Homology modeling of Aca s 4 revealed a structural change in the chloride-binding site that may account for this activation pattern. Aca s 4 was recognized by IgE from house dust mite-sensitive patients, and potential epitopes for cross-reactivity with house dust mite group 4 allergens were found. Conclusions We present the first protein-level characterization of a group 4 allergen from storage mites. Due to its high production and IgE reactivity, Aca s 4 is potentially relevant to allergic hypersensitivity. PMID:22292590

  4. The psychosocial stress-induced increase in salivary alpha-amylase is independent of saliva flow rate.

    PubMed

    Rohleder, Nicolas; Wolf, Jutta M; Maldonado, Enrique F; Kirschbaum, Clemens

    2006-11-01

    The stress response of salivary alpha-amylase (sAA) has been suggested as an index for sympathetic nervous system activation. However, concurrent inhibition of the parasympathetic nervous system is discussed as a confounder due to suppression of saliva flow rate. Here we set out to test the influence of stress-induced changes in flow rate on sAA secretion. Twenty-six subjects underwent the Trier Social Stress Test and a control condition. Saliva was sampled by passive drooling or salivettes. Saliva flow rate, sAA levels and output, salivary cortisol, and heart rate variability were measured. Flow rate increased only when sampled by passive drooling. Stress-induced increases in amylase levels were correlated with increases of amylase output but not with flow rate. Results indicate that flow rate is not a confounder of stress-induced sAA activation and suggest that valid measurements of sAA can be obtained by salivettes without the need for assessment of flow rate.

  5. Salivary Alpha-Amylase and Cortisol Among Pentecostals on a Worship and Nonworship Day

    PubMed Central

    LYNN, CHRISTOPHER DANA; PARIS, JASON; FRYE, CHERYL ANNE; SCHELL, LAWRENCE M.

    2013-01-01

    Objectives This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. Methods As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York’s mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. Results There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Conclusions Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. Am. J. Hum. Biol. 22:819–822, 2010. PMID:20878966

  6. Salivary alpha-amylase and cortisol among pentecostals on a worship and nonworship day.

    PubMed

    Lynn, Christopher Dana; Paris, Jason; Frye, Cheryl Anne; Schell, Lawrence M

    2010-01-01

    This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York's mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. © 2010 Wiley-Liss, Inc.

  7. Comparison of the wild-type alpha-amylase and its variant enzymes in Bacillus amyloliquefaciens in activity and thermal stability, and insights into engineering the thermal stability of bacillus alpha-amylase.

    PubMed

    Lee, Seunjae; Mouri, Yoshiki; Minoda, Masashi; Oneda, Hiroshi; Inouye, Kuniyo

    2006-06-01

    The starch hydrolysis activity and thermal stability of Bacillus amyloliquefaciens alpha-amylase (wild-type enzyme or WT) and its variant enzymes, designated as M77, M111, and 21B, were compared. All have an optimal pH at around 6, as well as almost the same reaction rates and Km and kcat values. The optimal temperature in the absence of Ca2+ ions is 60 degrees C for WT and M77 and 40 degrees C for M111 and 21B. Those of M111 and 21B rose to 50-60 degrees C upon the addition of 5 mM CaCl2, while those of WT and M77 did not change. The dissociation constants Kd for Ca2+ to WT and M77 are much lower than those of M111 and 21B. Asp233 in WT is replaced by Asn in M111 and 21B, while it is retained in M77, suggesting that Asp233 is involved in the thermal stability of the enzyme through Ca2+ ion binding. These findings provide insight into engineering the thermal stability of B. amyloliquefaciens alpha-amylase, which would be useful for its applications in the baking industry and in glucose manufacturing.

  8. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft.

    PubMed

    Kandra, Lili; Hachem, Maher Abou; Gyémánt, Gyöngyi; Kramhøft, Birte; Svensson, Birte

    2006-09-18

    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites as binding barriers. Barley alpha-amylase 1 mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in alpha-amylases.

  9. Synthesis and processing of Escherichia coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase in E. coli: the role of signal peptidase I.

    PubMed

    van Dijl, J M; Smith, H; Bron, S; Venema, G

    1988-09-01

    A mutant of Escherichia coli, in which signal peptidase I synthesis can be regulated, was constructed. The mutant was used to study the effects of signal peptidase I limitation on the synthesis and efficiency of processing of two proteins: the periplasmic E. coli TEM-beta-lactamase and Bacillus licheniformis alpha-amylase, which also accumulates in the periplasm of E. coli. Signal peptidase I limitation resulted in reduced rates of processing of pre-beta-lactamase and in strong inhibition of synthesis of alpha-amylase. The data suggest that beta-lactamase is processed post-translationally and that an intimate relationship exists between the synthesis and processing of alpha-amylase.

  10. Diurnal patterns and associations among salivary cortisol, DHEA and alpha-amylase in older adults.

    PubMed

    Wilcox, Rand R; Granger, Douglas A; Szanton, Sarah; Clark, Florence

    2014-04-22

    Cortisol and dehydroepiandrosterone (DHEA) are considered to be valuable markers of the hypothalamus-pituitary-adrenal (HPA) axis, while salivary alpha-amylase (sAA) reflects the autonomic nervous system. Past studies have found certain diurnal patterns among these biomarkers, with some studies reporting results that differ from others. Also, some past studies have found an association among these three biomarkers while other studies have not. This study investigates these patterns and associations in older adults by taking advantage of modern statistical methods for dealing with non-normality, outliers and curvature. Basic characteristics of the data are reported as well, which are relevant to understanding the nature of any patterns and associations. Boxplots were used to check on the skewness and presence of outliers, including the impact of using simple transformations for dealing with non-normality. Diurnal patterns were investigated using recent advances aimed at comparing medians. When studying associations, the initial step was to check for curvature using a non-parametric regression estimator. Based on the resulting fit, a robust regression estimator was used that is designed to deal with skewed distributions and outliers. Boxplots indicated highly skewed distributions with outliers. Simple transformations (such as taking logs) did not deal with this issue in an effective manner. Consequently, diurnal patterns were investigated using medians and found to be consistent with some previous studies but not others. A positive association between awakening cortisol levels and DHEA was found when DHEA is relatively low; otherwise no association was found. The nature of the association between cortisol and DHEA was found to change during the course of the day. Upon awakening, cortisol was found to have no association with sAA when DHEA levels are relatively low, but otherwise there is a negative association. DHEA was found to have a positive association with s

  11. Decreased salivary alpha-amylase levels are associated with performance deficits during sleep loss.

    PubMed

    Pajcin, Maja; Banks, Siobhan; White, Jason M; Dorrian, Jill; Paech, Gemma M; Grant, Crystal; Johnson, Kayla; Tooley, Katie; Fidock, Justin; Kamimori, Gary H; Della Vedova, Chris B

    2017-04-01

    During sleep deprivation, neurobehavioral functions requiring sustained levels of attention and alertness are significantly impaired. Discrepancies between subjective measures of sleepiness and objective performance during sustained operations have led to interest in physiological monitoring of operator performance. Alertness, vigilance, and arousal are modulated by the wake-promoting actions of the central noradrenergic system. Salivary alpha-amylase (sAA) has been proposed as a sensitive peripheral measure of noradrenergic activity, but limited research has investigated the relationship between sAA and performance. In a laboratory-controlled environment, we investigated the relationship between sAA levels, subjective sleepiness, and performance during two days (50h) of total sleep deprivation. Beginning at 09:00, twelve healthy participants (5 females) aged 22.5±2.5years (mean±SD) provided saliva samples, recorded ratings of subjective sleepiness, completed a brief 3-min psychomotor vigilance task (PVT-B) and performed a 40-min simulated driving task, at regular 3h intervals during wakefulness. Ratings of subjective sleepiness exhibited a constant linear increase (p<0.001) during sleep deprivation. In contrast, sAA levels showed a marked diurnal profile, with levels increasing during the day (p<0.001) and steadily declining in the evening and early-morning (p<0.001). PVT-B (mean reaction time and mean slowest 10% reaction time) and simulated driving performance (speed deviation and lane deviation) also exhibited diurnal profiles across the two days of sleep deprivation. Performance peaked in the afternoon (p<0.001) and then steadily worsened as wakefulness continued into the evening and early-morning (p<0.001). Further analysis revealed that higher sAA levels in the hour preceding each performance assessment were associated with better PVT-B and driving performance (p<0.001). These findings suggest that sAA measures may be suitable indicators of performance

  12. Salivary cortisol and alpha-amylase reactivity to taekwondo competition in children.

    PubMed

    Capranica, Laura; Lupo, Corrado; Cortis, Cristina; Chiodo, Salvatore; Cibelli, Giuseppe; Tessitore, Antonio

    2012-02-01

    The aim of this study was to evaluate the effects of an official taekwondo competition (three 1-min rounds with a 1-min recovery in-between) on heart rate (HR), salivary alpha-amylase (sAA), and salivary-free cortisol (sC) in children. Parental consent was obtained for 12 young (10.4 ± 0.2 years) male taekwondo athletes. Saliva sample were collected 15 min before and 1 min after an official taekwondo competition, and at 30, 60, and 90 min of the recovery period. To evaluate the exercise intensity during the competition, HR was measured and expressed as a percentage of individuals HR(peak). Athletes spent 78% of the time working at HR > 90% HR(max), with significant increases from round 1 to round 2 and 3. Peak sAA observed at the end of the match (169.6 ± 47.0 U/mL) was different (P = 0.0001) from the other samplings (pre-competition 55.0 ± 14.0 U/mL, 30-min recovery 80.4 ± 17.7 U/mL, 60-min recovery 50.5 ± 7.6 U/ml; 90-min recovery 53.2 ± 9.6 U/mL). Peak sC values observed at 30-min recovery (17.9 ± 3.5 nmol/L) were different (P < 0.0001) from pre-competition (5.6 ± 0.9 nmol/L), post-competition (9.0 ± 2.0 nmol/L), 60-min recovery (10.3 ± 2.6 nmol/L) and 90-min recovery (4.2 ± 0.8 nmol/L) values. These findings confirm that taekwondo competitions pose a high stress on young athletes. The different sAA and sC reactions in response to the physical stressor mirror the faster reactivity of the sympathetic-adrenomedullary system relatively to the hypothalamic-pituitary-adrenocortical system, respectively. This experimental paradigm might represent a useful model for further research on the effects of various stressors (i.e., training and competition) in taekwondo athletes.

  13. Salivary alpha-amylase, salivary cortisol, and anxiety during a youth taekwondo championship

    PubMed Central

    Capranica, Laura; Condello, Giancarlo; Tornello, Francesco; Iona, Teresa; Chiodo, Salvatore; Valenzano, Anna; De Rosas, Mario; Messina, Giovanni; Tessitore, Antonio; Cibelli, Giuseppe

    2017-01-01

    Abstract The aim of this study was to assess the stress-related responses and the coach's capability to match perceived efforts of youth athletes during a taekwondo championship. Using a cross-sectional study design, salivary cortisol (sC) and alpha-amylase (sAA) were measured in 6 males and 3 females young (11.0 ± 0.9 years) athletes at awakening, 5 minutes before, and 1 minute and 30 minutes after official combats. State anxiety was recorded 60 minutes before the first competition, whereas coach's and athletes’ ratings of perceived exertion (RPE) were obtained at the end of the combats. Time-matched (awakening and pre-competition) salivary samples and trait anxiety were collected 7-day postcompetition during a resting day. No effect for match outcome emerged. No difference emerged between athletes and coach RPEs. Higher (P = .03) state anxiety (41.6 ± 10.9 points) was shown than trait anxiety (34.8 ± 7.1 points). Time-matched sAA were similar. Peak sAA observed at the end of the combat (114.2 ± 108.1 U/mL) was higher (P < .01) than the other samples (range: 20.6–48.1 U/mL), whereas sC increased (P < .05) from awakening (8.0 ± 1.5 nmol/L), with peak levels observed at 30 minutes into the recovery phase (19.3 ± 4.3 nmol/L). Furthermore, pre-competition sC (16.5 ± 4.5 nmol/L) values were higher (P < .01) with respect to time-matched samples during the resting day (4.6 ± 1.0 nmol/L). The 3 athletes engaged in consecutive matches showed a tendency toward increasing sAA and sC. Taekwondo combats pose a high stress on young athletes, eliciting a fast reactivity of the sympathetic-adreno-medullary system relative to the hypothalamic-pituitary-adrenocortical system. Understanding the athlete's efforts during combats, coaches are recommended to apply effective recovery strategies between matches. PMID:28700470

  14. Salivary alpha-amylase, salivary cortisol, and anxiety during a youth taekwondo championship: An observational study.

    PubMed

    Capranica, Laura; Condello, Giancarlo; Tornello, Francesco; Iona, Teresa; Chiodo, Salvatore; Valenzano, Anna; De Rosas, Mario; Messina, Giovanni; Tessitore, Antonio; Cibelli, Giuseppe

    2017-07-01

    The aim of this study was to assess the stress-related responses and the coach's capability to match perceived efforts of youth athletes during a taekwondo championship.Using a cross-sectional study design, salivary cortisol (sC) and alpha-amylase (sAA) were measured in 6 males and 3 females young (11.0 ± 0.9 years) athletes at awakening, 5 minutes before, and 1 minute and 30 minutes after official combats. State anxiety was recorded 60 minutes before the first competition, whereas coach's and athletes' ratings of perceived exertion (RPE) were obtained at the end of the combats. Time-matched (awakening and pre-competition) salivary samples and trait anxiety were collected 7-day postcompetition during a resting day.No effect for match outcome emerged. No difference emerged between athletes and coach RPEs. Higher (P = .03) state anxiety (41.6 ± 10.9 points) was shown than trait anxiety (34.8 ± 7.1 points). Time-matched sAA were similar. Peak sAA observed at the end of the combat (114.2 ± 108.1 U/mL) was higher (P < .01) than the other samples (range: 20.6-48.1 U/mL), whereas sC increased (P < .05) from awakening (8.0 ± 1.5 nmol/L), with peak levels observed at 30 minutes into the recovery phase (19.3 ± 4.3 nmol/L). Furthermore, pre-competition sC (16.5 ± 4.5 nmol/L) values were higher (P < .01) with respect to time-matched samples during the resting day (4.6 ± 1.0 nmol/L). The 3 athletes engaged in consecutive matches showed a tendency toward increasing sAA and sC.Taekwondo combats pose a high stress on young athletes, eliciting a fast reactivity of the sympathetic-adreno-medullary system relative to the hypothalamic-pituitary-adrenocortical system. Understanding the athlete's efforts during combats, coaches are recommended to apply effective recovery strategies between matches.

  15. Crystal structure of a catalytic-site mutant alpha-amylase from Bacillus subtilis complexed with maltopentaose.

    PubMed

    Fujimoto, Z; Takase, K; Doui, N; Momma, M; Matsumoto, T; Mizuno, H

    1998-03-27

    The X-ray crystal structure of a catalytic-site mutant EQ208 [Glu208-->Gln] of alpha-amylase from Bacillus subtilis cocrystallized with maltopentaose (G5) and acarbose has been determined by multiple isomorphous replacement at 2.5 A resolution. Restrained crystallographic refinement has resulted in an R-factor of 19.8% in the 7.0 to 2.5 A resolution range. EQ208 consists of three domains containing a (beta/alpha)8-barrel as observed in other alpha-amylases. Clear connected density corresponding to a pentasaccharide was observed, which was considered as the G5 molecule based on the high affinity of EQ208 for G5 that could replace pre-bound acarbose or a possible transglycosylation product of acarbose. The conformation around the third alpha-(1,4)-glucosidic bond makes a sharp turn, allowing the substrate to fit into the L-shaped cleft. Aromatic residues build the walls of the substrate binding cleft and leucine residues form the inner curvature of the cleft. The amide nitrogen of Gln208 forms a hydrogen bond with the glucosidic oxygen in the scissile bond between Glc3 and Glc4 (Glc1 is the non-reducing end glucose residue of the substrate). This hydrogen-bonding manner may correspond to that of the protonated state of Glu208 in the initial kinetic complex between wild-type enzyme and substrate. The amide oxygen of Gln208 is anchored by two hydrogen bonds with Ala177 and a water molecule, assisting to make the amide proton point precisely to the place of the catalytic attack. The carboxyl oxygen atoms of the other catalytic-site residues Asp176 and Asp269 form hydrogen bonds with the oxygen atoms of Glc3. The carboxyl group of Asp176 has non-bonded contacts to the anomeric carbon atom and to the endocyclic oxygen atom of Glc3. These results suggest that Glu208 acts as a general acid and Asp176 as a general base. Glc3 forms seven hydrogen bonds with the surrounding protein groups and a stacking interaction with Tyr62, which is consistent with the fact that Glc3 has

  16. Study of phenolic content and urease and alpha-amylase inhibitory activities of methanolic extract of Rumex acetosella roots and its sub-fractions in different solvents.

    PubMed

    Ahmed, Dildar; Mughal, Qaria Mumtaz; Younas, Saba; Ikram, Muhammad

    2013-05-01

    The present study aimed to establish relationship between urease and alpha-amylase inhibitory activities on the one hand and on the other between anti-enzymatic activities and total phenolic contents of the methanolic extract of roots of Rumex acetosella and its fractions in various solvents. The methanolic extract and its fractions in chloroform, ethyl acetate, n-butanol and water showed remarkable inhibitory activities against both urease and alpha-amylase, there was a close correspondence between urease and alpha-amylase inhibitory activities of the plant samples. The n-butanol fraction which had the highest total phenolic content (252.19 ± 2.32 µg of Gallic Acid Equivalents/mg of dry mass of the sample) showed prominent activity against both urease and alpha-amylase indicating a possible role of phenolics in inhibiting the activities of these enzymes. The samples displayed enzyme inhibitory activities in a dose dependent manner and their effectiveness was comparable with that of the standards, thiourea (for urease) and acarbose (for alpha-amylase). The samples were manifold more effective against urease than alpha-amylase; 2.8 mg/mL of MeOH extract produced about 81% inhibition in alpha-amylase activity, while only 10 µg/mL of the extract was required to create the same inhibition in urease activity. The IC50 values of methanolic, chloroform, ethyl acetate, n-butanolic, aqueous and standard solutions were 1.29, 1.31, 1.90, 1.38, 0.85 and 1.20 (mg/mL) respectively against alpha-amylase and 0.99, 3.89, 1.76, 0.91, 0.85 and 0.97 (μg/mL) respectively against urease. The total phenolic content in MeOH, hexane, chloroform, ethyl acetate, n-butanol and water fractions was 108.88 ± 2.65, 43.70 ± 1.90, 34.44 ± 2.30, 230.71 ± 1.78, 252.19 ± 2.32 and 94.07 ± 2.25 respectively.

  17. Investigation on the effects of three X-->histidine replacements on thermostability of alpha-amylase from Bacillus amyloliquefaciens.

    PubMed

    Haghani, Karimeh; Khajeh, Khosro; Naderi-Manesh, Hossein; Ranjbar, Bijan

    2012-05-01

    Bacillus licheniformis alpha-amylase (BLA), a thermophilic counterpart of Bacillus amyloliquefaciens alpha-amylase (BAA), is an appropriate model for the design of stabilizing mutations in BAA. BLA has 10 more histidines than BAA. Considering this prominent difference, in the present study, three out of these positions (I34, Q67, and P407; located in the thermostability determinant 1 region and Ca-III binding site of BAA) were replaced with histidine in BAA, using the site-directed mutagenesis technique. The results showed that the thermostability of P407H and Q67H mutants had increased, but no significant changes were observed in their kinetic parameters compared to that of the wild type. I34H replacement resulted in complete loss of enzyme activity. Moreover, fluorescence and circular dichroism data indicated a more rigid structure for the P407H variant compared with that of the wild-type BAA. However, the flexibility of Q67H and I34H mutants increased in comparison with that of wild-type enzyme.

  18. Collecting saliva and measuring salivary cortisol and alpha-amylase in frail community residing older adults via family caregivers.

    PubMed

    Hodgson, Nancy A; Granger, Douglas A

    2013-12-18

    Salivary measures have emerged in bio-behavioral research that are easy-to-collect, minimally invasive, and relatively inexpensive biologic markers of stress. This article we present the steps for collection and analysis of two salivary assays in research with frail, community residing older adults-salivary cortisol and salivary alpha amylase. The field of salivary bioscience is rapidly advancing and the purpose of this presentation is to provide an update on the developments for investigators interested in integrating these measures into research on aging. Strategies are presented for instructing family caregivers in collecting saliva in the home, and for conducting laboratory analyses of salivary analytes that have demonstrated feasibility, high compliance, and yield quality specimens. The protocol for sample collection includes: (1) consistent use of collection materials; (2) standardized methods that promote adherence and minimize subject burden; and (3) procedures for controlling certain confounding agents. We also provide strategies for laboratory analyses include: (1) saliva handling and processing; (2) salivary cortisol and salivary alpha amylase assay procedures; and (3) analytic considerations.

  19. Characterization of BGTG-1, a tergal gland-secreted alpha-amylase, from the German cockroach, Blattella germanica (L.).

    PubMed

    Saltzmann, K D; Saltzmann, K A; Neal, J J; Scharf, M E; Bennett, G W

    2006-08-01

    The protein fraction of the German cockroach, Blattella germanica (L.), tergal gland secretion was examined. SDS-PAGE separation of proteins present in B. germanica tergal gland secretion revealed a tergal gland-secreted protein, BGTG-1, at approximately 63 kDa. BGTG-1 first appeared in tergal gland secretion at 2 days postimaginal moult and the amount of protein observed increased through day 5. A 2051 bp cDNA sequence, bgtg-1, was obtained by RACE polymerase chain reaction and contains a 1494 bp ORF encoding a predicted protein of 498 amino acids. In a Northern hybridization experiment using total RNA from B. germanica tergal gland tissue, a (32)P-labelled bgtg-1 probe hybridized to an RNA approximately 2000 bp and confirmed the 2051 bp cDNA size obtained by RACE PCR. Using the BLASTx sequence similarity search tool, the top match to the bgtg-1 ORF was found to be an alpha-amylase from Drosophila kikkawai (e-value = 1 x 10(-178)). Alignment of the bgtg-1 deduced protein sequence with alpha-amylases from fruit fly, Drosophila melanogaster, honey bee, Apis mellifera (L.) and yellow mealworm, Tenebrio molitor (L.), revealed conserved residues throughout the ORF and sequence identities ranging from 58.4 to 58.2%. Using a gel-based assay, degradation of starch by native BGTG-1 was demonstrated in vitro and we propose that BGTG-1 may be involved in processing phagostimulatory sugars present in B. germanica tergal gland secretion.

  20. Improvement in lactic acid production from starch using alpha-amylase-secreting Lactococcus lactis cells adapted to maltose or starch.

    PubMed

    Okano, Kenji; Kimura, Sakurako; Narita, Junya; Fukuda, Hideki; Kondo, Akihiko

    2007-07-01

    To achieve direct and efficient lactic acid production from starch, a genetically modified Lactococcus lactis IL 1403 secreting alpha-amylase, which was obtained from Streptococcus bovis 148, was constructed. Using this strain, the fermentation of soluble starch was achieved, although its rate was far from efficient (0.09 g l(-1) h(-1) lactate). High-performance liquid chromatography revealed that maltose accumulated during fermentation, and this was thought to lead to inefficient fermentation. To accelerate maltose consumption, starch fermentation was examined using L. lactis cells adapted to maltose instead of glucose. This led to a decrease in the amount of maltose accumulation in the culture, and, as a result, a more rapid fermentation was accomplished (1.31 g l(-1) h(-1) lactate). Maximum volumetric lactate productivity was further increased (1.57 g l(-1) h(-1) lactate) using cells adapted to starch, and a high yield of lactate (0.89 g of lactate per gram of consumed sugar) of high optical purity (99.2% of L: -lactate) was achieved. In this study, we propose a new approach to lactate production by alpha-amylase-secreting L. lactis that allows efficient fermentation from starch using cells adapted to maltose or starch before fermentation.

  1. New action pattern of a maltose-forming alpha-amylase from Streptomyces sp. and its possible application in bakery.

    PubMed

    Ammar, Youssef Ben; Matsubara, Takayoshi; Ito, Kazuo; Iizuka, Masaru; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Minamiura, Noshi

    2002-11-30

    An a-Amylase (EC 3.2.1.1) was purified that catalyses the production of a high level of maltose from starch without the attendant production of glucose. The enzyme was produced extracellularly by thermophilic Streptomyces sp. that was isolated from Thailand's soil. Purification was achieved by alcohol precipitation, DEAE-Cellulose, and Gel filtration chromatographies. The purified enzyme exhibited maximum activity at pH 6-7 and 60 degrees C. It had a relative molecular mass of 45 kDa, as determined by SDS-PAGE. The hydrolysis products from starch had alpha-anomeric forms, as determined by 1H-NMR. This maltose-forming alpha-Amylase completely hydrolyzed the soluble starch to produce a high level of maltose, representing up to 90%. It hydrolyzed maltotetrose and maltotriose to primarily produce maltose (82% and 62% respectively) without the attendant production of glucose. The high maltose level as a final end-product from starch and maltooligosaccharides, and the unique action pattern of this enzyme, indicate an unusual maltose-forming system. After the addition of the enzyme in the bread-baking process, the bread's volume increased and kept its softness longer than when the bread had no enzyme.

  2. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    SciTech Connect

    Koropatkin, Nicole M.; Smith, Thomas J.

    2010-09-21

    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  3. SusG: a unique cell-membrane-associated alpha-amylase from a prominent human gut symbiont targets complex starch molecules.

    PubMed

    Koropatkin, Nicole M; Smith, Thomas J

    2010-02-10

    SusG is an alpha-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  4. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    USDA-ARS?s Scientific Manuscript database

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  5. Homology modeling and molecular dynamics study on Schwanniomyces occidentalis alpha-amylase.

    PubMed

    Sefidbakht, Yahya; Ranaei Siadat, Omid; Taheri, Fatemeh

    2017-02-01

    With consumers growing increasingly aware of environmental issues, industries find enzymes as a reasonable alternative over physical conditions and chemical catalysts. Amylases are important hydrolase enzymes, which have been widely used in variety of industrial process such as pharmaceutical, food, and fermentation industries. Among amylases α-Amylase is in maximum demand due to its wide range of applications. The homology modeling study on Schwanniomyces occidentalis amylase (AMY1, UniProt identifier number: P19269) was performed by Modeller using Aspergillus oryzae (6TAA) as the template. The resulting structure was analyzed for validity and subjected to 14 ns of molecular dynamics (MD) simulation trough GROMACS. The validity of obtained model may represent that utilized OPLS force field is suitable for calcium-containing enzymes. DSSP secondary structure and contact map analysis represent the conservation of domain A TIM barrel feature together with calcium ion coordination sphere. Investigating the covariance matrix followed by principle component analyses for the first five eigenvectors of both trajectories indicate a little more flexibility for AMY1 structure. The electrostatic calculation for the final structures shows similar isoelectric point and superimposed buffering zone in the 5-8 pH range.

  6. Hypoglycemic activity of Pyrus biossieriana Buhse leaf extract and arbutin: Inhibitory effects on alpha amylase and alpha glucosidase

    PubMed Central

    Yousefi, Fatemeh; Mahjoub, Soleiman; Pouramir, Mahdi; Khadir, Fatemeh

    2013-01-01

    Background: The mechanism of hypoglycemic and hypolipidemic activities of Pyrus biossieriana Buhse leaf extract (PbBLE) and its phytochemical component arbutin, have not been well determined. The present study was performed to understand the hypoglycemic activity mechanisms of pbBLE and arbutin more clearly. Methods: In vitro enzymatic carbohydrate digestion with PbBLE and arbutin was assessed using α-amylase and α-glucosidase powders. The enzyme solutions were premixed with PbBLE and arbutin at different concentrations (0.1, 1, 10 and 100 mg/ml). Substrate solutions and colorimetric reagents were added to the reaction. The release of glucose was determined by spectrophotometric method. Acarbose was used as the positive control. Results: The extract (10, 100 mg/ ml) completely inhibit α- amylase and α- glucosidase activities. The extract produced higher reduction of α-amylase and α-glucosidase activity than arbutin. Inhibition at various concentrations (0.1, 1, 10, 100 mg/ml) were significantly different (p<0.05). Conclusion: Our results exhibited that both the extract and arbutin were able to suppress the enzymes strongly. PMID:24294470

  7. Hypoglycemic activity of Pyrus biossieriana Buhse leaf extract and arbutin: Inhibitory effects on alpha amylase and alpha glucosidase.

    PubMed

    Yousefi, Fatemeh; Mahjoub, Soleiman; Pouramir, Mahdi; Khadir, Fatemeh

    2013-01-01

    The mechanism of hypoglycemic and hypolipidemic activities of Pyrus biossieriana Buhse leaf extract (PbBLE) and its phytochemical component arbutin, have not been well determined. The present study was performed to understand the hypoglycemic activity mechanisms of pbBLE and arbutin more clearly. In vitro enzymatic carbohydrate digestion with PbBLE and arbutin was assessed using α-amylase and α-glucosidase powders. The enzyme solutions were premixed with PbBLE and arbutin at different concentrations (0.1, 1, 10 and 100 mg/ml). Substrate solutions and colorimetric reagents were added to the reaction. The release of glucose was determined by spectrophotometric method. Acarbose was used as the positive control. The extract (10, 100 mg/ ml) completely inhibit α- amylase and α- glucosidase activities. The extract produced higher reduction of α-amylase and α-glucosidase activity than arbutin. Inhibition at various concentrations (0.1, 1, 10, 100 mg/ml) were significantly different (p<0.05). Our results exhibited that both the extract and arbutin were able to suppress the enzymes strongly.

  8. Temperature adaptations in psychrophilic, mesophilic and thermophilic chloride-dependent alpha-amylases.

    PubMed

    Cipolla, Alexandre; Delbrassine, François; Da Lage, Jean-Luc; Feller, Georges

    2012-09-01

    The functional and structural adaptations to temperature have been addressed in homologous chloride-dependent α-amylases from a psychrophilic Antarctic bacterium, the ectothermic fruit fly, the homeothermic pig and from a thermophilic actinomycete. This series covers nearly all temperatures encountered by living organisms. We report a striking continuum in the functional properties of these enzymes coupled to their structural stability and related to the thermal regime of the source organism. In particular, thermal stability recorded by intrinsic fluorescence, circular dichroism and differential scanning calorimetry appears to be a compromise between the requirement for a stable native state and the proper structural dynamics to sustain the function at the environmental/physiological temperatures. The thermodependence of activity, the kinetic parameters, the activations parameters and fluorescence quenching support these activity-stability relationships in the investigated α-amylases.

  9. Salivary Alpha Amylase and Cortisol Levels in Children with Global Developmental Delay and Their Relation with the Expectation of Dental Care and Behavior during the Intervention

    ERIC Educational Resources Information Center

    dos Santos, Marcio Jose Possari; Bernabe, Daniel Galera; Nakamune, Ana Claudia de Melo Stevanato; Perri, Silvia Helena Venturoli; de Aguiar, Sandra Maria Herondina Coelho Avila; de Oliveira, Sandra Helena Penha

    2012-01-01

    The purpose of this study was to analyze the alpha-amylase (sAA) and cortisol levels in children with Global developmental delay (GDD) before and after dental treatment and its association with the children's behavior during treatment. The morning salivary cortisol levels and activity of sAA of 33 children with GDD were evaluated before and after…

  10. Effects of sorghum (Sorghum bicolor (L.) Moench) tannins on alpha-amylase activity and in vitro digestibility of starch in raw and processed flours

    USDA-ARS?s Scientific Manuscript database

    The effect of condensed tannins (CT) on in vitro starch digestibility in cooked, wholegrain sorghum flours and on corn starch was investigated. CT extracts were also tested for their inhibitory effect on alpha-amylases. Rapidly digestible starch, slowly digestible starch, and resistant starch were n...

  11. Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

    ERIC Educational Resources Information Center

    Marini, Isabella

    2005-01-01

    Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

  12. Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

    ERIC Educational Resources Information Center

    Marini, Isabella

    2005-01-01

    Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

  13. Salivary Alpha Amylase and Cortisol Levels in Children with Global Developmental Delay and Their Relation with the Expectation of Dental Care and Behavior during the Intervention

    ERIC Educational Resources Information Center

    dos Santos, Marcio Jose Possari; Bernabe, Daniel Galera; Nakamune, Ana Claudia de Melo Stevanato; Perri, Silvia Helena Venturoli; de Aguiar, Sandra Maria Herondina Coelho Avila; de Oliveira, Sandra Helena Penha

    2012-01-01

    The purpose of this study was to analyze the alpha-amylase (sAA) and cortisol levels in children with Global developmental delay (GDD) before and after dental treatment and its association with the children's behavior during treatment. The morning salivary cortisol levels and activity of sAA of 33 children with GDD were evaluated before and after…

  14. General Subject 2. Report to ICUMSA on the determination of carry-over alpha-amylase activity in white and refined sugars by a spectrophotometric method

    USDA-ARS?s Scientific Manuscript database

    A report is given on a new industrial method for the determination of carry-over alpha-amylase activity in raw and refined sugars, as well as a recommendation. In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) s...

  15. In vitro alpha-amylase inhibition and in vivo antioxidant potential of Amaranthus spinosus in alloxan-induced oxidative stress in diabetic rats

    PubMed Central

    Ashok Kumar, B.S.; Lakshman, K.; Nandeesh, R.; Arun Kumar, P.A.; Manoj, B.; Kumar, Vinod; Sheshadri Shekar, D.

    2010-01-01

    Amaranthus spinosus Linn. (Amaranthaceae), commonly known as “Mulluharivesoppu” in Kannada, is used in the Indian traditional system of medicine for the treatment of diabetes. The present study deals with the scientific evaluation of alpha amylase and the antioxidant potential of methanol extract of A. spinosus (MEAS). The aim of this study was to investigate in vitro alpha-amylase enzyme inhibition by CNPG3 (2-chloro-4-nitrophenol α-d-maltotrioside) and in vivo antioxidant potential of malondialdehyde (MDA), glutathione (GSH), catalase (CAT) and total thiols (TT) in alloxan-induced diabetic rats of a methanolic extract of A. spinosus. Blood sugar was also determined in MEAS-treated alloxan-induced diabetic rats. MEAS showed significant inhibition of alpha-amylase activity and IC50 46.02 μg/ml. Oral administration of MEAS (200 and 400 mg/kg) for 15 days showed significant reduction in the elevated blood glucose, MDA and restores GSH, CAT and TT levels as compared with a diabetic control. The present study provides evidence that the methanolic extract of A. spinosus has potent alpha amylase, anti-diabetic and antioxidant activities. PMID:23961097

  16. In vitro alpha-amylase inhibition and in vivo antioxidant potential of Amaranthus spinosus in alloxan-induced oxidative stress in diabetic rats.

    PubMed

    Ashok Kumar, B S; Lakshman, K; Nandeesh, R; Arun Kumar, P A; Manoj, B; Kumar, Vinod; Sheshadri Shekar, D

    2011-01-01

    Amaranthus spinosus Linn. (Amaranthaceae), commonly known as "Mulluharivesoppu" in Kannada, is used in the Indian traditional system of medicine for the treatment of diabetes. The present study deals with the scientific evaluation of alpha amylase and the antioxidant potential of methanol extract of A. spinosus (MEAS). The aim of this study was to investigate in vitro alpha-amylase enzyme inhibition by CNPG3 (2-chloro-4-nitrophenol α-d-maltotrioside) and in vivo antioxidant potential of malondialdehyde (MDA), glutathione (GSH), catalase (CAT) and total thiols (TT) in alloxan-induced diabetic rats of a methanolic extract of A. spinosus. Blood sugar was also determined in MEAS-treated alloxan-induced diabetic rats. MEAS showed significant inhibition of alpha-amylase activity and IC50 46.02 μg/ml. Oral administration of MEAS (200 and 400 mg/kg) for 15 days showed significant reduction in the elevated blood glucose, MDA and restores GSH, CAT and TT levels as compared with a diabetic control. The present study provides evidence that the methanolic extract of A. spinosus has potent alpha amylase, anti-diabetic and antioxidant activities.

  17. Digestion of legume starch granules by larvae of Zabrotes subfasciatus (Coleoptera: bruchidae) and the induction of alpha-amylases in response to different diets.

    PubMed

    Silva, C P; Terra, W R; Xavier-Filho, J; Grossi de Sá, M F; Isejima, E M; DaMatta, R A; Miguens, F C; Bifano, T D

    2001-01-01

    Zabrotes subfasciatus larvae possess three alpha-amylase isoforms as determined by in gel assays following SDS-PAGE. The two minor isoforms present lower electrophoretic mobility than the major form, and seem to occur as a heterodimer. When developed inside Vigna unguiculata (cowpea) seeds, fourth instar larvae have minor quantities of the slow-migrating forms, but when reared on seeds of Phaseolus vulgaris (common bean) or Phaseolus lunatus, the two slow-migrating forms are expressed in higher amounts, while activity of the major form was independent of the host seed. Larvae developing inside cowpea seeds at the beginning of the fourth instar were fed on flour from cotyledons of cowpea or common bean. Larvae fed on the common bean flour started to express the dimer in higher amounts when compared with the control larvae fed on cowpea flour. In an attempt to correlate differences between starch granules and the induction of alpha-amylases, a detailed study on the digestive process of the granules was conducted. Incorporation of purified starch granules into artificial diets did not induce the two minor alpha-amylases. The in vitro hydrolysis rates of purified granules and the pattern of dextrins liberated by the different alpha-amylases were similar for the two legume species. The starch granules enter the midgut extensively damaged, which may facilitate the access to the more susceptible parts of the granules to enzymatic attack.

  18. In vitro and in vivo inhibition of alpha-amylases of stored-product mite Acarus siro.

    PubMed

    Hubert, Jan; Dolecková-Maresová, Lucie; Hýblová, Jana; Kudlíková, Iva; Stejskal, Václav; Mares, Michael

    2005-01-01

    The stored-product mites are the most abundant and frequent group of pests living on the stored food products in Europe. They endanger public health since they produce allergens and transmit mycotoxin-producing fungi. Novel acaricidal compounds with inhibitory effects on the digestive enzymes of arthropods are a safe alternative to the traditional neurotoxic pesticides used for control of the stored-product pests. In this work, we explored the properties of acarbose, the low molecular weight inhibitor of alpha-amylases (AI), as a novel acaricide candidate for protection of the stored products from infestation by Acarus siro (Acari: Acaridae). In vitro analysis revealed that AI blocked efficiently the enzymatic activity of digestive amylases of A. siro, and decreased the physiological capacity of mite's gut in utilizing a starch component of grain flour. In vivo experiments showed that AI suppressed the population growth of A. siro. The mites were kept for three weeks on experimental diet enriched by AI in concentration range of 0.005 to 0.25%. Population growth of A. siro was negatively correlated with the content of AI in the treated diet with a half-population dose of 0.125%. The suppressive effect of AIs on stored-product mites is discussed in the context of their potential application in GMO crops.

  19. Bioactive compounds from Carissa opaca roots and xanthine oxidase and alpha-amylase inhibitory activities of their methanolic extract and its fractions in different solvents.

    PubMed

    Saeed, Ramsha; Ahmed, Dildar

    2014-01-01

    Carissa opaca is known for its many ethnomedicinal uses. There was a need to study its bioactivities and identify its phytochemicals. The objective was to isolate and identify phytochemicals from roots of C. opaca and to evaluate xanthine oxidase (XO) and alpha-amylase inhibitory activities of their methanolic extract and its fractions. Methanolic extract of finely divided powder of roots of C. opaca was obtained by cold maceration, followed by its fractionation to obtain hexane, chloroform, ethyl acetate, n-butanolic, and aqueous fractions. Phytochemicals screening was done by standard protocols. XO and alpha-amylase inhibitory activities of the methanolic extract and its fractions were studied. The most active ethyl acetate fraction was subjected to the column and thin layer chromatography to isolate its compounds, which were identified by gas chromatography-mass spectrometry and high-performance liquid chromatography comparison. Methanolic extract displayed significant activity against both the enzymes with IC50 of 156.0 mg/mL and 5.6 mg/mL for XO and alpha-amylase, respectively. Ethyl acetate fraction showed highest activity against both the enzymes with IC50 of 129 mg/mL and 4.9 mg/mL for XO and alpha-amylase, respectively. Chloroform fraction had IC50 of 154.2 mg/mL and 5.5 mg/mL for XO and alpha-amylase, respectively. Aqueous fraction exhibited significant efficacy against alpha-amylase (IC50 5.0 mg/mL). Hexane fraction showed good activity against alpha-amylase in a dose-dependent manner but exhibited opposite trend against XO. The compounds isolated from ethyl acetate fraction included limonene, vanillin, lupeol, rutin, quercetin, b-sitosterol, Vitamin E, 2-hydroxyacetophenone, naphthalenone, 2,3,3-trimethyl-2-(3-methylbuta-1,3-dienyl)-6-methylenecyclohexanone, and 2-benzenedicarboxylic acid, mono(2-ethylhexyl) ester. Moderately polar phytochemicals of C. opaca roots possess exploitable inhibitory activity against both the enzymes.

  20. Bioactive compounds from Carissa opaca roots and xanthine oxidase and alpha-amylase inhibitory activities of their methanolic extract and its fractions in different solvents

    PubMed Central

    Saeed, Ramsha; Ahmed, Dildar

    2015-01-01

    Background: Carissa opaca is known for its many ethnomedicinal uses. There was a need to study its bioactivities and identify its phytochemicals. Objective: The objective was to isolate and identify phytochemicals from roots of C. opaca and to evaluate xanthine oxidase (XO) and alpha-amylase inhibitory activities of their methanolic extract and its fractions. Materials and Methods: Methanolic extract of finely divided powder of roots of C. opaca was obtained by cold maceration, followed by its fractionation to obtain hexane, chloroform, ethyl acetate, n-butanolic, and aqueous fractions. Phytochemicals screening was done by standard protocols. XO and alpha-amylase inhibitory activities of the methanolic extract and its fractions were studied. The most active ethyl acetate fraction was subjected to the column and thin layer chromatography to isolate its compounds, which were identified by gas chromatography-mass spectrometry and high-performance liquid chromatography comparison. Results: Methanolic extract displayed significant activity against both the enzymes with IC50 of 156.0 mg/mL and 5.6 mg/mL for XO and alpha-amylase, respectively. Ethyl acetate fraction showed highest activity against both the enzymes with IC50 of 129 mg/mL and 4.9 mg/mL for XO and alpha-amylase, respectively. Chloroform fraction had IC50 of 154.2 mg/mL and 5.5 mg/mL for XO and alpha-amylase, respectively. Aqueous fraction exhibited significant efficacy against alpha-amylase (IC50 5.0 mg/mL). Hexane fraction showed good activity against alpha-amylase in a dose-dependent manner but exhibited opposite trend against XO. The compounds isolated from ethyl acetate fraction included limonene, vanillin, lupeol, rutin, quercetin, b-sitosterol, Vitamin E, 2-hydroxyacetophenone, naphthalenone, 2,3,3-trimethyl-2-(3-methylbuta-1,3-dienyl)-6-methylenecyclohexanone, and 2-benzenedicarboxylic acid, mono(2-ethylhexyl) ester. Conclusions: Moderately polar phytochemicals of C. opaca roots possess exploitable

  1. Differential splicing of pre-messenger RNA produces multiple forms of mature caprine alpha(s1)-casein.

    PubMed

    Ferranti, P; Addeo, F; Malorni, A; Chianese, L; Leroux, C; Martin, P

    1997-10-01

    The identity of multiple forms of caprine alpha(s1)-casein in variants A, B, and C has been determined by structural characterisation using mass spectrometry, automated Edman degradation and peptide mapping. Mature goat alpha(s1)-casein exists as a mixture of at least four molecular species which differ in peptide chain length. The main component corresponds to the 199-residues form already described. The other three, in lesser amounts, were shorter forms of alpha(s1)-casein and differed for the deleted peptides 141-148, as shown previously for ovine alpha(s1)-casein, peptide 110-117, or Gln78. Analysis of alpha(s1)-casein mRNA from milk somatic cells demonstrated that these forms originated from skipping events at the level of exon 13 (codifying for peptide 110-117) and 16 (codifying for peptide 141-148) and from the presence of a cryptic splice site within exon 11 (whose first CAG triplet encodes Gln78) during primary transcript processing. The finding of these splicing abnormalities in the three common variants A, B, and C suggests that this is a general feature of alpha(s1)-casein in goat. A further source of heterogeneity of caprine alpha(s1)-casein was identified in the discrete phosphorylation of seryl residues. Eight serine residues (at positions 44, 46, 64 to 68 and 75) are fully phosphorylated (except in variant A because of the replacement Glu77-->Gln which prevents phosphorylation of Ser75). Conversely, Ser115 and Ser41 are phosphorylated only to about 50% and 20%, respectively. Ser12, although located in a consensus triplet, is never phosphorylated, similarly to the ovine alpha(s1)-casein variants. These results confirm that there are stabilised mechanisms of simultaneous synthesis of alpha(s1)-casein at different length and of post-translational modification in both caprine and ovine species.

  2. Effect of alpha-tocopherol and ascorbic acid on bovine oocyte in vitro maturation.

    PubMed

    Dalvit, G; Llanes, S P; Descalzo, A; Insani, M; Beconi, M; Cetica, P

    2005-04-01

    In vitro culture results in higher oxygen concentrations than in vivo environments, leading to an increased level of reactive oxygen species (ROS) that cause lipid peroxidation of cellular membranes. Alpha-tocopherol (active form of vitamin E) is an antioxidant that protects mammalian cells against lipid peroxidation, which is regenerated by ascorbic acid. The aim of this study was to determine the effect of the addition of alpha-tocopherol and/or ascorbic acid to the maturation medium on bovine oocyte in vitro maturation (IVM) and subsequently on in vitro fertilization (IVF) and embryo development. Cumulus-oocyte complexes (COCs) were matured in Medium 199 (control), and with the addition of alpha-tocopherol and/or ascorbic acid. The concentration of alpha-tocopherol in COCs was determined by high-performance liquid chromatography (HPLC). IVF and in vitro culture (IVC) were carried out in modified synthetic oviductal fluid (mSOF). The quantity of alpha-tocopherol naturally present in COCs diminished by half during IVM (p < 0.05), although in the presence of ascorbic acid it remained constant. A greater amount of alpha-tocopherol was detected in COCs matured in medium supplemented with this antioxidant (p < 0.05), but the addition of alpha-tocopherol plus ascorbic acid maintained higher levels of alpha-tocopherol (p < 0.05). Significant differences were not observed in the percentages of nuclear maturation and fertilization among different treatments. The presence of alpha-tocopherol or ascorbic acid in the maturation medium failed to modify the percentage of blastocysts obtained, unlike the addition of both antioxidants when a significant decrease was observed (p < 0.05). Absorbic acid maintained the antioxidant capacity of the alpha-tocopherol incorporated to COC membranes during IVM. The active form of vitamin E during maturation impaired the acquisition of oocyte developmental competence.

  3. One-step enzymatic hydrolysis of starch using a recombinant strain of Saccharomyces cerevisiae producing alpha-amylase, glucoamylase and pullulanase.

    PubMed

    Janse, B J; Pretorius, I S

    1995-03-01

    A recombinant strain of Saccharomyces cerevisiae was constructed that contained the genes encoding a bacterial alpha-amylase (AMY1), a yeast glucoamylase (STA2) and a bacterial pullulanase (pulA). The Bacillus amyloliquefaciens alpha-amylase and S. cerevisiae var. diastaticus glucoamylase genes were expressed in S. cerevisiae using their native promoters and the encoded enzymes secreted under direction of their native leader sequences. In contrast, the Klebsiella pneumoniae pullulanase gene was placed under the control of the yeast alcohol dehydrogenase gene promoter (ADC1P) and secreted using the yeast mating pheromone alpha-factor secretion signal (MF alpha 1S). Transcription termination of the pullulanase gene was effected by the yeast tryptophan synthase gene terminator (TRP5T), whereas termination of the glucoamylase and alpha-amylase genes was directed by their native terminators. Pullulanase (PUL1) produced by recombinant yeasts containing ADC1P MF alpha 1S pulA TRP5T (designated PUL1) was further characterized and compared to its bacterial counterpart (PulA). The different genes were introduced into S. cerevisiae in different combinations and the various amylolytic Saccharomyces transformants compared to Schwanniomyces occidentalis. Introduction of PUL1 into a S. cerevisiae strain containing both STA2 and AMY1, resulted in 99% assimilation of starch.

  4. Longitudinal and Immediate Effect of Kundalini Yoga on Salivary Levels of Cortisol and Activity of Alpha-Amylase and Its Effect on Perceived Stress.

    PubMed

    García-Sesnich, Jocelyn N; Flores, Mauricio Garrido; Ríos, Marcela Hernández; Aravena, Jorge Gamonal

    2017-01-01

    Stress is defined as an alteration of an organism's balance in response to a demand perceived from the environment. Diverse methods exist to evaluate physiological response. A noninvasive method is salivary measurement of cortisol and alpha-amylase. A growing body of evidence suggests that the regular practice of Yoga would be an effective treatment for stress. To determine the Kundalini Yoga (KY) effect, immediate and after 3 months of regular practice, on the perception of psychological stress and the salivary levels of cortisol and alpha-amylase activity. To determine the psychological perceived stress, levels of cortisol and alpha-amylase activity in saliva, and compare between the participants to KY classes performed for 3 months and a group that does not practice any type of yoga. The total sample consisted of 26 people between 18 and 45-year-old; 13 taking part in KY classes given at the Faculty of Dentistry, University of Chile and 13 controls. Salivary samples were collected, enzyme-linked immunosorbent assay was performed to quantify cortisol and kinetic reaction test was made to determine alpha-amylase activity. Perceived Stress Scale was applied at the beginning and at the end of the intervention. Statistical analysis was applied using Stata v11.1 software. Shapiro-Wilk test was used to determine data distribution. The paired analysis was fulfilled by t-test or Wilcoxon signed-rank test. T-test or Mann-Whitney's test was applied to compare longitudinal data. A statistical significance was considered when P < 0.05. KY practice had an immediate effect on salivary cortisol. The activity of alpha-amylase did not show significant changes. A significant decrease of perceived stress in the study group was found. KY practice shows an immediate effect on salivary cortisol levels and on perceived stress after 3 months of practice.

  5. Cortisol and alpha-amylase as stress response indicators during pre-hospital emergency medicine training with repetitive high-fidelity simulation and scenarios with standardized patients.

    PubMed

    Valentin, Bernd; Grottke, Oliver; Skorning, Max; Bergrath, Sebastian; Fischermann, Harold; Rörtgen, Daniel; Mennig, Marie-Therese; Fitzner, Christina; Müller, Michael P; Kirschbaum, Clemens; Rossaint, Rolf; Beckers, Stefan K

    2015-04-08

    In emergency medicine, the benefits of high-fidelity simulation (SIM) are widely accepted and standardized patients (SP) are known to mimic real patients accurately. However, only limited data are available concerning physicians' stress markers within these training environments. The aim of this pilot study was to investigate repetitive stress among healthcare professionals in simulated pre-hospital emergency scenarios using either SIM or SPs. Teams with one emergency medical services (EMS) physician and two paramedics completed three SIM scenarios and two SP scenarios consecutively. To evaluate stress, salivary cortisol and alpha-amylase were measured in saliva samples taken before, during and after the scenarios. A total of 14 EMS physicians (29% female; mean age: 36.8 ± 5.0 years; mean duration of EMS-experience: 9.1 ± 5.8 years) and 27 paramedics (11% female; age: 30.9 ± 6.9 years; EMS experience: 8.1 ± 6.0 years) completed the study. Alpha-amylase and cortisol levels did not differ significantly between the two professions. Cortisol values showed a gradual and statistically significant reduction over time but little change was observed in response to each scenario. In contrast, alpha-amylase activity increased significantly in response to every SIM and SP scenario, but there was no clear trend towards an overall increase or decrease over time. Increases in salivary alpha-amylase activity suggest that both SIM and SP training produce stress among emergency healthcare professionals. Corresponding increases in salivary cortisol levels were not observed. Among physicians in the emergency setting, it appears that alpha-amylase provides a more sensitive measure of stress levels than cortisol.

  6. Self-compassion training modulates alpha-amylase, heart rate variability, and subjective responses to social evaluative threat in women.

    PubMed

    Arch, Joanna J; Brown, Kirk Warren; Dean, Derek J; Landy, Lauren N; Brown, Kimberley D; Laudenslager, Mark L

    2014-04-01

    A growing body of research has revealed that social evaluative stressors trigger biological and psychological responses that in chronic forms have been linked to aging and disease. Recent research suggests that self-compassion may protect the self from typical defensive responses to evaluation. We investigated whether brief training in self-compassion moderated biopsychological responses to the Trier Social Stress Test (TSST) in women. Compared to attention (placebo) and no-training control conditions, brief self-compassion training diminished sympathetic (salivary alpha-amylase), cardiac parasympathetic, and subjective anxiety responses, though not HPA-axis (salivary cortisol) responses to the TSST. Self-compassion training also led to greater self-compassion under threat relative to the control groups. In that social stress pervades modern life, self-compassion represents a promising approach to diminishing its potentially negative psychological and biological effects. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Purification and characterization of novel raw-starch-digesting and cold-adapted alpha-amylases from Eisenia foetida.

    PubMed

    Ueda, Mitsuhiro; Asano, Tomohiko; Nakazawa, Masami; Miyatake, Kazutaka; Inouye, Kuniyo

    2008-05-01

    Novel raw-starch-digesting and cold-adapted alpha-amylases (Amy I and Amy II) from the earthworm Eisenia foetida were purified to electrophoretically homogeneous states. The molecular weights of both purified enzymes were estimated to be 60,000 by SDS-PAGE. The enzymes were most active at pH 5.5 and 50 degrees C and stable at pH 7.0-9.0 and 50-60 degrees C. Both Amy I and II exhibited activities at 10 degrees C. The enzymes were inhibited by metal ions Cu(2+), Fe(2+), and Hg(2+), and hydrolyzed raw starch into glucose, maltose and maltotriose as end products.

  8. Effect of gelatinization and hydrolysis conditions on the selectivity of starch hydrolysis with alpha-amylase from Bacillus licheniformis.

    PubMed

    Baks, Tim; Bruins, Marieke E; Matser, Ariette M; Janssen, Anja E M; Boom, Remko M

    2008-01-23

    Enzymatic hydrolysis of starch can be used to obtain various valuable hydrolyzates with different compositions. The effects of starch pretreatment, enzyme addition point, and hydrolysis conditions on the hydrolyzate composition and reaction rate during wheat starch hydrolysis with alpha-amylase from Bacillus licheniformis were compared. Suspensions of native starch or starch gelatinized at different conditions either with or without enzyme were hydrolyzed. During hydrolysis, the oligosaccharide concentration, the dextrose equivalent, and the enzyme activity were determined. We found that the hydrolyzate composition was affected by the type of starch pretreatment and the enzyme addition point but that it was just minimally affected by the pressure applied during hydrolysis, as long as gelatinization was complete. The differences between hydrolysis of thermally gelatinized, high-pressure gelatinized, and native starch were explained by considering the granule structure and the specific surface area of the granules. These results show that the hydrolyzate composition can be influenced by choosing different process sequences and conditions.

  9. Alpha-amylase production by Streptomyces erumpens MTCC 7317 in solid state fermentation using response surface methodology (RSM).

    PubMed

    Kar, Shaktimay; Ray, Ramesh C; Mohapatra, Uma B

    2008-01-01

    Production of alpha-amylase under solid state fermentation by Streptomyces erumpens MTCC 7317 has been investigated using different agro-industrial residues, i.e. cassava bagasse, sugarcane bagasse and wheat bran; wheat bran was found to be the best substrate. Among different nitrogen source supplemented to wheat bran, beef extract or peptone (1%) showed maximum enzyme production. Response surface methodology was used to evaluate the effect of main process parameters as incubation period (48 h), moisture holding capacity (70%), pH (7.0) and temperature (50 degrees C) on enzyme production by applying a full factorial central composite design. The maximum hydrolysis of soluble starch (90%) and cassava starch (75%) was obtained with the application of 4 ml (approximately 12096 U) of S. erumpens crude enzyme after 5 h of incubation.

  10. Self-compassion training modulates alpha-amylase, heart rate variability, and subjective responses to social evaluative threat in women

    PubMed Central

    Arch, Joanna J.; Brown, Kirk Warren; Dean, Derek J.; Landy, Lauren N.; Brown, Kimberley; Laudenslager, Mark L.

    2014-01-01

    A growing body of research has revealed that social evaluative stressors trigger biological and psychological responses that in chronic forms have been linked to aging and disease. Recent research suggests that self-compassion may protect the self from typical defensive responses to evaluation. We investigated whether brief training in self-compassion moderated biopsychological responses to the Trier Social Stress Test (TSST) in women. Compared to attention (placebo) and no-training control conditions, brief self-compassion training diminished sympathetic (salivary alpha-amylase), cardiac parasympathetic, and subjective anxiety responses, though not HPA-axis (salivary cortisol) responses to the TSST. Self-compassion training also led to greater self-compassion under threat relative to the control groups. In that social stress pervades modern life, self-compassion represents a promising approach to diminishing its potentially negative psychological and biological effects. PMID:24636501

  11. Alpha-amylase starch binding domains: cooperative effects of binding to starch granules of multiple tandemly arranged domains.

    PubMed

    Guillén, D; Santiago, M; Linares, L; Pérez, R; Morlon, J; Ruiz, B; Sánchez, S; Rodríguez-Sanoja, R

    2007-06-01

    The Lactobacillus amylovorus alpha-amylase starch binding domain (SBD) is a functional domain responsible for binding to insoluble starch. Structurally, this domain is dissimilar from other reported SBDs because it is composed of five identical tandem modules of 91 amino acids each. To understand adsorption phenomena specific to this SBD, the importance of their modular arrangement in relationship to binding ability was investigated. Peptides corresponding to one, two, three, four, or five modules were expressed as His-tagged proteins. Protein binding assays showed an increased capacity of adsorption as a function of the number of modules, suggesting that each unit of the SBD may act in an additive or synergic way to optimize binding to raw starch.

  12. Major water-soluble polyphenols, proanthocyanidins, in leaves of persimmon (Diospyros kaki) and their alpha-amylase inhibitory activity.

    PubMed

    Kawakami, Kayoko; Aketa, Saiko; Nakanami, Mitsuhiro; Iizuka, Shinzo; Hirayama, Masao

    2010-01-01

    The amounts and compositions of polyphenol in persimmon leaves and persimmon leaf tea were investigated. The predominant polyphenols in fresh leaves were water-soluble, and the contents reached a maximum (2.40% w/w) in June, and then gradually decreased. Separation of them followed by thiolytic degradation revealed that the major components were unique proanthocyanidin oligomers consisting of four heterogeneous extension units, including epigallocatechin-3-O-gallate. Persimmon leaf tea also contained similar proanthocyanidins with similar compositional units. Oral administration of starch with polyphenol concentrate of persimmon leaf tea resulted in a significant and dose-dependent decrease in the blood glucose level in Wistar rats. This effect is considered to be due to inhibition of pancreas alpha-amylase. These results indicate that persimmon leaf tea containing peculiar proanthocyanidins has a significant role in suppressing blood glucose elevation after starch intake, and that the best harvest time is June.

  13. Evening salivary cortisol and alpha-amylase at 14months and neurodevelopment at 4years: Sex differences.

    PubMed

    Andiarena, Ainara; Balluerka, Nekane; Murcia, Mario; Ibarluzea, Jesús; Glover, Vivette; Vegas, Oscar

    2017-08-01

    Stress system activity in early life can have long-term effects on neurodevelopment. The main aim of this study was to assess the association of child evening salivary cortisol and alpha-amylase basal levels at 14months of age with longer-term neuropsychological development at 4years in a low-risk population-based birth cohort derived from the INMA (Environment and Childhood) project in Spain. We included 186 parent-children pairs with information on both stress system activity and neurodevelopment. Both stress markers at 14months of age showed an association with neuropsychological development at 4years. Salivary cortisol showed a sex-specific pattern of association. In girls, cortisol levels at 14months were negatively associated with cognitive development [long-term declarative memory (β=-17.8, p=0.028; 95% CI=-33.2 to -2.5); executive function (β=-9.8, p=0.08; 95% CI=-21 to 1)] and gross motor development (β=-13; p=0.022; 95% CI=-24 to -2), whereas in boys cortisol levels were negatively associated with socioemotional development [autistic-like behaviours: Incidence Rate Ratio (IRR)=1.6, p=0.039; 95% CI=1.01 to 2.41]. Salivary alpha-amylase was positively associated with socioemotional development in boys only [social competence (β=2.11, p=0.013; 95% CI=0.47 to 3.72), autistic-like behaviours (IRR=0.93, p=0.042; 95% CI=0.87 to 0.99) and hyperactivity symptoms (IRR=0.81, p=0.021; 95% CI=0.69 to 0.97)]. These results suggest that stress system activity in early life is associated with longer-term neurodevelopment and that sex is an important factor in this relationship. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Effects of early life adversity on cortisol/salivary alpha-amylase symmetry in free-ranging juvenile rhesus macaques.

    PubMed

    Petrullo, Lauren A; Mandalaywala, Tara M; Parker, Karen J; Maestripieri, Dario; Higham, James P

    2016-11-01

    Early life adversity (ELA) affects physiological and behavioral development. One key component is the relationship between the developing Hypothalamic-Pituitary-Adrenal (HPA) axis and the Sympathetic Nervous System (SNS). Recent studies suggest a relationship between early life adversity and asymmetry in cortisol (a measure of HPA activation) and salivary alpha-amylase (sAA: a correlate of SNS activation) responses to stress among human children, but to our knowledge there have been no comparable studies in nonhumans. Here, we investigate the responses of these two analytes in "low stress" and "high stress" situations in free-ranging juvenile rhesus macaques (Macaca mulatta) on Cayo Santiago, Puerto Rico. Behavioral data on maternal maltreatment were collected during the first 3months of life to determine individual rates of ELA, and saliva samples were collected from subjects noninvasively during juvenility. Irrespective of ELA, salivary alpha-amylase levels were lower in low stress situations and higher in high stress situations. For cortisol however, high ELA subjects exhibited higher low stress concentrations and blunted acute responses during high stress situations compared to moderate and low ELA subjects. Cortisol and sAA values were positively correlated among low ELA subjects, suggesting symmetry, but were uncorrelated or negatively correlated among moderate and high ELA subjects, suggesting asymmetry in these individuals. These findings indicate dysregulation of the stress response among juveniles maltreated during infancy: specifically, attenuated cortisol reactivity coupled with typical sAA reactivity characterize the stress response profiles of juveniles exposed to higher rates of ELA during the first 3months of life. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. The starch-bound alpha-amylase/trypsin-inhibitors in Avena.

    PubMed

    Gazza, Laura; Gazzelloni, Gloria; Taddei, Federica; Latini, Arianna; Muccilli, Vera; Alfieri, Michela; Conti, Salvatore; Redaelli, Rita; Pogna, Norberto E

    2016-12-01

    Oat kernels exhibit an extra-soft texture, a trait recently demonstrated to be largely modulated by starch-bound tryptophan-rich 2S proteins, the vromindolines. In this study, fractionation by two-dimensional electrophoresis of starch-bound proteins in 25 oat (Avena sativa) cultivars and 11 diploid or tetraploid Avena species revealed novel 2S proteins called Avena α-amylase/trypsin-inhibitors (AATI) because of their sequence similarity with wheat α-amylase/trypsin inhibitors. Thirty-seven AATI polypeptides, about 14 kDa in size, were split into three families named AATI-1, AATI-2, and AATI-3 with different primary structures and isoelectric points. AATI-1 and AATI-2 proteins showed 55.5-60.0 % sequence similarity with wheat α-amylase inhibitors CM1, CM2, and CM16, which have been found to cause innate immunity responses in celiac disease and non-celiac gluten sensitivity. Diploid A-genome and tetraploid AC-genome oat species possess three and five genes encoding for the AATI proteins, respectively, whereas hexaploid A. sativa exhibits 12 genes dispersed over the A-, C-, and D-genomes. Some AATI proteins expressed in hexaploid oats were assigned to the A-genome based on similarity to their counterparts in diploid species, contributing to further clarify the genetic origin of hexaploid oats. Moreover, AATI may interact with starch-bound vromindolines in determining the extra-soft texture of oat kernels and, due to their balanced amino acid compositions, may contribute to the biological value of oat proteins in a positive manner.

  16. Significant differences in the activities of alpha-amylases in the absence and presence of polyethylene glycol assayed on eight starches solubilized by two methods.

    PubMed

    Mukerjea, Rupendra; Slocum, Giles; Mukerjea, Romila; Robyt, John F

    2006-09-04

    Starch is a reserve chemical source of the energy of the sun found in plants as a water-insoluble granule that differs in their chemical and physical properties, depending on the source. The granules can be solubilized by heating in water or by treatment with various reagents, such as 1M NaOH. alpha-Amylases are widely distributed enzymes that initiate the hydrolysis of starch into low molecular weight maltodextrins. We recently found that the activities of a single alpha-amylase on two different starches were significantly different. We then determined the activities of Bacillus amyloliquefaciens and porcine pancreas alpha-amylases, using eight different starches, solubilized by two methods: autoclaving at 121 degrees C and 1M NaOH at 20 degrees C. There were significant differences in the activities of both of the amylases on all eight of the starches. Previously, it had been found that polyethylene glycol (PEG) stabilized and activated the activities of both enzymes, using a soluble amylose as the substrate. Addition of PEG to the enzymes greatly increased the activities on the eight starches, but the activities still differed significantly. The different activities with the starches were hypothesized as differences in the amounts of secondary and tertiary structures that are partially retained when the different starches are solubilized; the activities on addition of PEG is hypothesized as the formation of highly active species from a series of less active forms.

  17. Improved activity and modulated action pattern obtained by random mutagenesis at the fourth beta-alpha loop involved in substrate binding to the catalytic (beta/alpha)8-barrel domain of barley alpha-amylase 1.

    PubMed

    Matsui, I; Svensson, B

    1997-09-05

    The functionality of the sequence Arg183-Gly184-Tyr185 of the substrate binding fourth beta-alpha loop in the (beta/alpha)8-barrel of barley alpha-amylase isozyme 1 (AMY1) was studied by random mutagenesis. A motif of polar Gly184 hydrophobic residues was present in active mutants, selected by starch plate screening of yeast transformants. Gly184 was important, probably due to the carbonyl group binding to Ca2+ and the spatial proximity of Phe181. Mutation of both flanking residues as in Ser183-Gly184-Met185 (SGM-) and TGL-AMY1 decreased the Ca2+ affinity. SGM-AMY1 has 2-fold increased activity for amylose but reduced activity on maltooligosaccharides, whereas KGY-AMY1 has up to 3-fold elevated activity toward the oligosaccharides. TGL-AMY1 has modest activity on all substrates. Shifted action pattern on maltooligosaccharides for NGY-, SGM-, and TGL-AMY1 support that Arg183 in wild type is located at subsites +1 and +2, accommodating two sugar rings toward the reducing end from the site of cleavage. In the crystal structure of barley alpha-amylase 2 (AMY2), Lys182 (equivalent to AMY1 Arg183) is hydrogen-bonded with sugar OH-3 in subsite +2. Higher Ki app for acarbose inhibition of KGY-AMY1 and parent AMY1 compared with the other mutants suggests favorable substrate interactions for Arg/Lys183. KGY-AMY1 was not inhibited by the AMY2-specific proteinaceous barley alpha-amylase/subtilisin inhibitor, although Lys182 of AMY2 is salt-linked to the inhibitor.

  18. Effects of radiation and alpha-tocopherol on saliva flow rate, amylase activity, total protein and electrolyte levels in oral cavity cancer.

    PubMed

    Chitra, S; Shyamala Devi, C S

    2008-01-01

    The objective of the present study was to evaluate early and late effects of radiation and a-tocopherol on the secretion rate of saliva and on selected saliva salivary parameters in oral cavity cancer patients. Eighty-nine histologically confirmed oral cavity cancer patients (OCC) were enrolled in the study. Resting whole saliva was collected before, during and at the end of the radiation therapy (RT) and simultaneous supplementation with alpha - tocopherol to the radiation treated patients (RT + AT). Salivary flow rate, pH, amylase activity, total protein, sodium and potassium were analyzed. Increased pH, potassium and decreased flow rate, amylase activity, protein content and sodium were observed in 6 weeks of radiation treated patients when compared to OCC patients. A significant improvement of those parameters was observed on alpha - tocopherol supplementation in RT + AT patients. Supplementation with alpha - tocopherol improves the salivary flow rate thereby, maintains salivary parameters.

  19. Effects of alpha-amylase reaction mechanisms on analysis of resistant-starch contents.

    PubMed

    Moore, Samuel A; Ai, Yongfeng; Chang, Fengdan; Jane, Jay-lin

    2015-01-22

    This study aimed to understand differences in the resistant starch (RS) contents of native and modified starches obtained using two standard methods of RS content analysis: AOAC Method 991.43 and 2002.02. The largest differences were observed in native potato starch, cross-linked wheat distarch phosphate, and high-amylose corn starch stearic-acid complex (RS5) between using AOAC Method 991.43 with Bacillus licheniformis α-amylase (BL) and AOAC Method 2002.02 with porcine pancreatic α-amylase (PPA). To determine possible reasons for these differences, we hydrolyzed raw-starch granules with BL and PPA with equal activity at pH 6.9 and 37°C for up to 84 h and observed the starch granules displayed distinct morphological differences after the hydrolysis. Starches hydrolyzed by BL showed erosion on the surface of the granules; those hydrolyzed by PPA showed pitting on granule surfaces. These results suggested that enzyme reaction mechanisms, including the sizes of the binding sites and the reaction patterns of the two enzymes, contributed to the differences in the RS contents obtained using different methods of RS analysis.

  20. AmyA, an alpha-amylase with beta-cyclodextrin-forming activity, and AmyB from the thermoalkaliphilic organism Anaerobranca gottschalkii: two alpha-amylases adapted to their different cellular localizations.

    PubMed

    Ballschmiter, Meike; Armbrecht, Martin; Ivanova, Krasimira; Antranikian, Garabed; Liebl, Wolfgang

    2005-07-01

    Two alpha-amylase genes from the thermophilic alkaliphile Anaerobranca gottschalkii were cloned, and the corresponding enzymes, AmyA and AmyB, were investigated after purification of the recombinant proteins. Based on their amino acid sequences, AmyA is proposed to be a lipoprotein with extracellular localization and thus is exposed to the alkaline milieu, while AmyB apparently represents a cytoplasmic enzyme. The amino acid sequences of both enzymes bear high similarity to those of GHF13 proteins. The different cellular localizations of AmyA and AmyB are reflected in their physicochemical properties. The alkaline pH optimum (pH 8), as well as the broad pH range, of AmyA activity (more than 50% activity between pH 6 and pH 9.5) mirrors the conditions that are encountered by an extracellular enzyme exposed to the medium of A. gottschalkii, which grows between pH 6 and pH 10.5. AmyB, on the other hand, has a narrow pH range with a slightly acidic pH optimum at 6 to 6.5, which is presumably close to the pH in the cytoplasm. Also, the intracellular AmyB is less tolerant of high temperatures than the extracellular AmyA. While AmyA has a half-life of 48 h at 70 degrees C, AmyB has a half-life of only about 10 min at that temperature, perhaps due to the lack of stabilizing constituents of the cytoplasm. AmyA and AmyB were very similar with respect to their substrate specificity profiles, clearly preferring amylose over amylopectin, pullulan, and glycogen. Both enzymes also hydrolyzed alpha-, beta-, and gamma-cyclodextrin. Very interestingly, AmyA, but not AmyB, displayed high transglycosylation activity on maltooligosaccharides and also had significant beta-cyclodextrin glycosyltransferase (CGTase) activity. CGTase activity has not been reported for typical alpha-amylases before. The mechanism of cyclodextrin formation by AmyA is unknown.

  1. [Study on immobilized cells for producing alpha-amylase by using polyving alcohol as the carrier(II): The effect of fermentating conditions on the ability producing alpha-amylase of the cells immobilized with polyving alcohol as the corrier and continuous fermentation of the immobilized cells in CSTR].

    PubMed

    Liu, Z; Wang, J; Li, Z

    1998-03-01

    The effects of fermentating conditions on the ability of immobilized cells with PVA as carrier for producing alpha-amylase were studied. The continuous fermentation with the immobilized cells were tested in continuous flow stirred tank reactor (CSTR). The results showed that the adaptability of the immobilized Bacillus substilis to pH increased after immobilization. In CSTR, the immobilized cells can be fermentated continuously for 360 hrs and the activity of alpha-amylase can be kept on the level of about 170 u/ml.

  2. Heterologous expression of Thermobifida fusca thermostable alpha-amylase in Yarrowia lipolytica and its application in boiling stable resistant sago starch preparation.

    PubMed

    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying

    2010-09-01

    A gene encoding the thermostable alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced, and cloned into Yarrowia lipolytica P01g host strain using the vector pYLSC1 allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 730 U/l in the Hinton flask culture broth. It is higher than that observed in P. pastoris expression system and E. coli expression system. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis and this agrees with the predicted size based on the nucleotide sequence. About 70% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 72-h treatment, the DP(w) of raw sago starch obviously decreased from 830,945 to 237,092. The boiling stable resistant starch content of the sago starch increased from 8.3 to 18.1%. The starch recovery rate was 71%.

  3. Expression of Thermobifida fusca thermostable raw starch digesting alpha-amylase in Pichia pastoris and its application in raw sago starch hydrolysis.

    PubMed

    Yang, Chao-Hsun; Huang, Yu-Chun; Chen, Cheng-Yu; Wen, Chia-Ying

    2010-04-01

    A gene encoding the thermostable raw starch digesting alpha-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced and cloned into Pichia pastoris X-33 host strain using the vector pGAPZalphaA, allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular amylase production, as high as 510 U/l in the Hinton flask culture broth. The purified amylase showed a single band at about 65 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo-beta-N-acetylglycosaminidase H, and this agrees with the predicted size based on the nucleotide sequence. About 75% of the original activity remained after heat treatment at 60 degrees C for 3 h. The optimal pH and temperature of the purified amylase were 7.0 and 60 degrees C, respectively. The purified amylase exhibited a high level of activity with raw sago starch. After 48-h treatment, the DPw of raw sago starch obviously decreased from 830,945 to 378,732. The surface of starch granules was rough, and some granules displayed deep cavities.

  4. Association of Tenebrio molitor L. alpha-amylase with two protein inhibitors--one monomeric, one dimeric--from wheat flour. Differential scanning calorimetric comparison of heat stabilities.

    PubMed

    Silano, V; Zahnley, J C

    1978-03-28

    Thermal stabilization resulting from protein . protein association between two protein inhibitors (coded as 0.19, a dimer, and 0.28, a monomer) from wheat flour and the alpha-amylase from Tenebrio molitor L. (yellow mealworm) larvae was investigated by differential scanning calorimetry (heating rate 10 degrees C/min). Thermograms (plots of heat flow vs. temperature) for the two inhibitors showed broad endothermic peaks with the same extrema (denaturation temperatures) at 93 degrees C, and equal, small enthalpies of denaturation (2 cal/g). The amylase produced a sharp endotherm at 70.5 degrees C, but a larger enthalpy change on denaturation (6 cal/g). The amylase . inhibitor complexes differed in thermal stability, but both showed significant stabilization relative to free enzyme. The complex formed with monomeric inhibitor 0.28 showed a higher denaturation temperature (85.0 degrees C) than that formed with dimeric inhibitor 0.19 (80.5 degrees C). This order of stabilization agrees with the relative affinities of the inhibitors for the amylase. These thermograms are consistent with previous results which indicated that 1 mol of amylase binds 1 mol of inhibitor 0.19.

  5. A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.

    PubMed

    Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T

    1999-02-01

    Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.

  6. Structure of starch binding domains of halophilic alpha-amylase at low pH.

    PubMed

    Yamaguchi, Rui; Ishibashi, Matsujiro; Tokunaga, Hiroko; Arakawa, Tsutomu; Tokunaga, Masao

    2013-07-01

    The solubility and structural properties of halophilic proteins are ascribed to their abundant acidic residues, resulting in large net negative charges at neutral pH. This study examined the effects of low pH, i.e., reduction of net negative charges on the structural properties of starch binding domain (SBD) of halophilic Kocuria varians α-amylase. Titration to pH 2.1 caused loss of 233 nm peak characteristic of aromatic interactions present in the native SBD at neutral pH and resulted in the spectrum with a 216 nm valley characteristic of β-sheet. The low pH β-sheet structure was stable against heat treatment. The addition of NaCl and trifluoroethanol resulted in decrease and increase of the 216 nm signal, without altering the spectral shape. These structural properties were significantly different from those of the native protein.

  7. Porcine pancreatic alpha-amylase hydrolysis of native starch granules as a function of granule surface area.

    PubMed

    Kong, Byoung-Wook; Kim, Jung-In; Kim, Myo-Jeong; Kim, Jae Cherl

    2003-01-01

    Porcine pancreatic alpha-amylase activity on native starch granules is more accurately described as a function of surface area of the granules rather than of substrate concentration. The apparent K(m) of alpha-amylolysis of native starch from potato, maize, and rice expressed as a function of substrate concentration was largest for potato with a single value of V(max). However, the ratio of the slope of a Lineweaver-Burk plot to that of rice for enzymatic hydrolysis of native potato and maize starch were 7.78 and 2.58, respectively, which were very close to the ratio of surface area per mass of the two starch granules to that of rice. Therefore, the reciprocal of initial velocity was a linear function of the reciprocal of surface area for each starch granule. Surface area was calculated assuming the starch granules were spherical. The values obtained by this calculation were in good agreement with the value obtained by the photomicrographic method. By comparing enzymatic digestion of native maize granules to that of rice granules, it was concluded that the presence of pores in maize granules appeared to significantly affect overall rate of digestion after sufficient reaction time, but not at the very initial stage of hydrolysis.

  8. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  9. Continuous extraction of alpha- and beta-amylases from Zea mays malt in a PEG4000/CaCl2 ATPS.

    PubMed

    Biazus, J P M; Santana, J C C; Souza, R R; Jordão, E; Tambourgi, E B

    2007-10-15

    In the present work, alpha- and beta-amylase enzymes from Zea mays malt were recovered by continuous extraction in a PEG/CaCl2 aqueous two-phase system (ATPS). The influences of the flux rate (RQ), free area of vane (A(free)) and vane rotation (RV) on enzyme recovery were studied by optimization using response surface methodology (RSM). The protein content and enzyme activity were measured from time to time in the extract and refined fluxes. RSM curves showed a squared dependence of recovery index with the RQ, A(free) and RV. The best system for recovering the maize malt enzymes was with low vane rotation and flux rate and high free area of vane. Alpha- and beta-amylases were purified 130-fold in the salt-rich phase.

  10. Enzymatic degradation products from a marine polysaccharide YCP with different immunological activity and binding affinity to macrophages, hydrolyzed by alpha-amylases from different origins.

    PubMed

    Ren, Min; Yan, Wei; Yao, Wenbing; Jin, Lei; Gao, Xiangdong

    2010-04-01

    YCP is a marine polysaccharide with anti-tumor and immune-modulating effects. This study evaluated the effect of enzymatic degradation of YCP by alpha-amylases from different origins on its immunological activity and binding ability to the macrophages. YCP was hydrolyzed by alpha-amylases isolated from Aspergillus oryzae, Bacillus licheniformis, Barley malt, and Porcine pancreas respectively, then four fragments with unique molecular weight (termed: YCP-Ao, YCP-Bl, YCP-Bm, and YCP-Pp, respectively) were obtained. The four fragments showed different immunological activity and the ability to bind to macrophages. Among them, YCP-Ao possessed almost equivalent immunological activity compared to the original YCP, while such properties were not retained in YCP-Bl. Our further study showed that YCP-Ao prevented YCP from binding to macrophages. In conclusion, YCP-Ao and YCP might have similar active regions.

  11. Calcium binding in. alpha. -amylases: An X-ray diffraction study at 2. 1- angstrom resolution of two enzymes from Aspergillus

    SciTech Connect

    Boel, E.; Jensen, V.J.; Petersen, S.B.; Thim, L. Woldike, H.F. ); Brady, L.; Brzozowski, AM.; Derewenda, Z.; Dodson, G.G.; Swift, H. )

    1990-07-03

    X-ray diffraction analysis (at 2.1-{angstrom} resolution) of an acid alpha-amylase from Aspergillus niger allowed a detailed description of the stereochemistry of the calcium-binding sites. The primary site (which is essential in maintaining proper folding around the active site) contains a tightly bound Ca{sup 2+} with an unusually high number of eight ligands. A secondary binding site was identified at the bottom of the substrate binding cleft; it involves the residues presumed to play a catalytic role (Asp206 and Glu230). This explains the inhibitory effect of calcium observed at higher concentrations. Neutral Aspergillus oryzae (TAKA) {alpha}-amylase was also refined in a new crystal at 2.1-{angstrom} resolution. The structure of this homologous (over 80%) enzyme and addition kinetic studies support all the structural conclusions regarding both calcium-binding sites.

  12. Purification and characterization of the beta-trefoil fold protein barley alpha-amylase/subtilisin inhibitor overexpressed in Escherichia coli.

    PubMed

    Bønsager, Birgit C; Praetorius-Ibba, Mette; Nielsen, Peter K; Svensson, Birte

    2003-08-01

    Barley alpha-amylase/subtilisin inhibitor (BASI) is a beta-trefoil fold protein related to soybean trypsin inhibitor (Kunitz) and inhibits barley alpha-amylase isozyme 2 (AMY2), which is de novo synthesized in the seed during germination. Recombinant BASI was produced in Escherichia coli in an untagged form (untagged rBASI), in two His(6)-tag forms (His(6)-rBASI and His(6)-Xa-rBASI), and in an intein-CBD-tagged form (rBASI (intein)). The yields per liter culture after purification were (i) 25 mgl(-1) His(6)-rBASI; (ii) 6 mgl(-1) rBASI purified after cleavage of His(6)-Xa-rBASI by Factor Xa; (iii) 3 mgl(-1) untagged rBASI; and (iv) 0.2 mgl(-1) rBASI after a chitin-column and autohydrolysis of the rBASI-intein-CBD. In Pichia pastoris, rBASI was secreted at 0.1 mgl(-1). The recombinant BASI forms and natural seed BASI (sBASI) all had an identical isoelectric point of 7.2 and a mass of 19,879 Da, as determined by mass spectrometry. The fold of rBASI from the different preparations was confirmed by circular dichroism spectroscopy and rBASI (intein), His(6)-rBASI, and sBASI inhibited AMY2 catalyzed starch hydrolysis with K(i) of 0.10, 0.06, and 0.09 nM, respectively. Surface plasmon resonance analysis of the formation of AMY2/rBASI (intein) gave k(on)=1.3x10(5)M(-1)s(-1), k(off)=1.4x10(-4)s(-1), and K(D)=1.1 nM, and of the savinase-His(6)-rBASI complex k(on)=21.0x10(4)M(-1)s(-1), k(off)=53.0x10(-4)s(-1), and K(D)=25.0 nM, in agreement with sBASI values. K(i) was 77 and 65 nM for inhibition of savinase activity by His(6)-rBASI and sBASI, respectively.

  13. Improvement of cloned [alpha]-amylase gene expression in fed-batch culture of recombinant Saccharomyces cerevisiae by regulating both glucose and ethanol concentrations using a fuzzy controller

    SciTech Connect

    Shiba, Sumihisa; Nishida, Yoshio; Park, Y.S.; Iijima, Shinji; Kobayashi, Takeshi . Dept. of Biotechnology)

    1994-11-05

    The effect of ethanol concentration on cloned gene expression in recombinant Saccharomyces cerevisiae strain 20B-12 containing one of two plasmids, pNA3 and pNA7, was investigated in batch cultures. Plasmids pNA3 and pNA7 contain the [alpha]-amylase gene under the control of the SUC2 or PGK promoter, respectively. When the ethanol concentration was controlled at 2 to 5 g/L, the gene expressions were two times higher than those at 20 g/L ethanol. To increase the gene expression by maintaining both the ethanol and glucose concentrations at low levels, a fuzzy controller was developed. The concentrations of glucose and ethanol were controlled simultaneously at 0.15 and 2 g/L, respectively, in the production phase using the fuzzy controller in fed-batch culture. The synthesis of [alpha]-amylase was induced by the low glucose concentration and maintained at a high level of activity by regulating the ethanol concentration at 2 g/L. The secretory [alpha]-amylase activities of cells harboring plasmids pNA3 and pNA7 in fed-batch culture were 175 and 392 U/mL, and their maximal specific activities 7.7 and 12.4 U/mg dry cells, respectively. These values are two to three times higher in activity and three to four times higher in specific activity than those obtained when glucose only was controlled.

  14. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.

    PubMed

    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji

    2007-10-01

    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  15. Correlation between bacterial haemoglobin gene (vgb) and aeration: their effect on the growth and alpha-amylase activity in transformed Enterobacter aerogenes.

    PubMed

    Khleifat, K; Abboud, M M

    2003-01-01

    To evaluate the effects of bacterial haemoglobin on bacterial growth and alpha-amylase formation under different aeration conditions. Enterobacter aerogenes was transformed with the gene encoding Vitreoscilla (bacterial) haemoglobin, vgb. The growth kinetics and ability to synthesize alpha-amylase enzyme were investigated in this transformed Enterobacter strain as well as in two other Enterobacter control strains that do not harbour the vgb gene. Such comparison was made under variable aeration conditions, using the agitation rate as a measure of aeration. The expression of bacterial haemoglobin-supported cell growth determined as O.D.600 and cell viability in addition to the alpha-amylase production. These positive effects of bacterial haemoglobin were observed under both low and high aerations, but at different extents. In addition to improving cell growth under low aeration, the bacterial haemoglobin is able to promote bacterial cell tolerance during exposure to high oxygen tension. The expression of bacterial haemoglobin is advantageous in reducing the burden of certain toxic conditions such as high oxygen levels. It may have the same impact on some environmental toxic substances. This, haemoglobin biotechnology can be extended to induce enzymes of pollutants degradation or production of some useful industrial substances.

  16. Crystal structure of Thermoactinomyces vulgaris R-47 alpha-amylase II (TVAII) hydrolyzing cyclodextrins and pullulan at 2.6 A resolution.

    PubMed

    Kamitori, S; Kondo, S; Okuyama, K; Yokota, T; Shimura, Y; Tonozuka, T; Sakano, Y

    1999-04-16

    The crystal structure of Thermoactinomyces vulgaris R-47 alpha-Amylase II (TVAII) has been determined by multiple isomorphous replacement at 2.6 A resolution. TVAII was crystallized in an orthorhombic system with the space group P212121 and the cell dimensions a=118.5 A, b=119.5 A, c=114.5 A. There are two molecules in an asymmetric unit, related by the non-crystallographic 2-fold symmetry. Diffraction data were collected at 113 K and the cell dimensions reduced to a=114.6 A, b=117.9 A, c=114.2 A, and the model was refined against 7.0-2.6 A resolution data giving an R-factor of 0.204 (Rfree=0.272). The final model consists of 1170 amino acid residues (two molecules) and 478 water molecules with good chemical geometry. TVAII has three domains, A, B, and C, like other alpha-amylases. Domain A with a (beta/alpha)8 barrel structure and domain C with a beta-sandwich structure are very similar to those found in other alpha-amylases. Additionally, TVAII has an extra domain N composed of 121 amino acid residues at the N-terminal site, which has a beta-barrel-like structure consisting of seven antiparallel beta-strands. Domain N is one of the driving forces in the formation of the dimer structure of TVAII, but its role in the enzyme activity is still not clear. TVAII does not have the Ca2+ binding site that connects domains A and B in other alpha-amylases, rather the NZ atom of Lys299 of TVAII serves as the connector between these domains. TVAII can hydrolyze cyclodextrins and pullulan as well as starch. Based on a structural comparison with the complex between a mutant cyclodextrin glucanotransferase and a beta-cyclodextrin derivative, Phe286 located at domain B is considered the residue most likely to recognize the hydrophobic cavity of cyclodextrins. The active-site cleft of TVAII is wider and shallower than that of other alpha-amylases, and seems to be suitable for the binding of pullulan which is expected not to adopt the helical structure of amylose.

  17. Quantifying the impact of exogenous abscisic acid and gibberellins on pre-maturity α-amylase formation in developing wheat grains

    PubMed Central

    Kondhare, Kirtikumar R.; Hedden, Peter; Kettlewell, Peter S.; Farrell, Aidan D.; Monaghan, James M.

    2014-01-01

    To study the role of abscisic acid (ABA) and gibberellins (GA) in pre-maturity α-amylase (PMA) formation in developing wheat grain, two glasshouse experiments were conducted under controlled conditions in the highly PMA-susceptible genotype Rialto. The first, determined the relative efficacy of applying hormone solutions by injection into the peduncle compared to direct application to the intact grain. The second, examined the effects of each hormone, applied by either method, at mid-grain development on PMA in mature grains. In the first experiment, tritiated ABA (3H-ABA) and gibberellic acid (3H-GA3) were diluted with unlabelled ABA (100 µM) and GA3 (50 µM), respectively, and applied at mid-grain development using both methods. Spikes were harvested after 24, 48 and 72 h from application, and hormone taken up by grains was determined. After 72 h, the uptake per grain in terms of hormones applied was approximately 13% for ABA and 8% for GA3 when applied onto the grains, and approximately 17% for ABA and 5% for GA3 when applied by injection. In the second experiment, applied ABA reduced, whereas applied GA3 increased α-amylase activity. This confirmed that exogenously applied ABA and GA were absorbed in sufficient amounts to alter grain metabolism and impact on PMA. PMID:24942128

  18. Seasonal variations in optimized applications of intermediate stable alpha-amylase in raw sugar manufacture

    USDA-ARS?s Scientific Manuscript database

    In recent years, starch being delivered to and processed in U.S. factories has risen markedly because of the increased production of green (unburnt) and combine-harvested (billeted) sugarcane and the introduction of new sugarcane varieties with higher starch content. To prevent carry-over alpha-amy...

  19. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  20. Effects of Cardiorespiratory Fitness and Obesity on Salivary Secretory IgA and Alpha-Amylase in South African Children

    PubMed Central

    Starzak, Dorota E.; Konkol, Kristen F.; McKune, Andrew J.

    2016-01-01

    This study examined whether cardiorespiratory fitness (CRF) and body composition are associated with salivary secretory immunoglobulin A (SIgA), a mucosal immunity marker, and salivary alpha-amylase (sAA), a marker of stress-related sympathetic nervous system (SNS) activity, in South African children. Morning (7:30–8:00 a.m.) saliva samples were collected from 132 children (10.05 ± 1.68 years old, 74 females, 58 males). Body composition, resting blood pressure, and predicted maximal aerobic capacity (VO2max) were determined, and SIgA and sAA were quantified. Obese children had significantly higher sAA compared with overweight and normal weight children (p < 0.01). SIgA secretion rate was significantly lower in obese and overweight vs. normal weight children (p < 0.01). Multiple-linear regression analysis revealed that body mass index (BMI) (p < 0.05) and diastolic blood pressure (DBP) (p < 0.05) were independent predictors of sAA with CRF acting as a mitigator. Age and BMI predicted SIgA secretion rate (p < 0.05) with BMI (p < 0.001) found to be an independent predictor of SIgA secretion rate. Obesity, based on BMI, was associated with elevated SNS activity and lowered mucosal immunity. CRF-mitigated sympathetic activation was not associated with mucosal immunity. PMID:27483329

  1. Salivary cortisol and alpha-amylase: Is there consistency between psychosocial stress test and burdensome work shifts?

    PubMed

    Karhula, Kati; Härmä, Mikko; Sallinen, Mikael; Lindholm, Harri; Hirvonen, Ari; Elovainio, Marko; Kivimäki, Mika; Vahtera, Jussi; Puttonen, Sampsa

    2017-07-10

    This study examined the consistency of salivary cortisol and alpha-amylase (sAA) total daily secretion between laboratory and field circumstances. The 95 participants were shift working female health care professionals with high (n = 53) or low (n = 42) psychosocial stress (job strain) measured by the Job Content Questionnaire (JCQ). The Trier Social Stress Test including a 5-minute free speech and a mental arithmetic task was conducted with four, and field measurements with three daily saliva samples of cortisol and sAA during circadian rhythm and inter-shift recovery controlled morning shift, night shift, and a day off. The associations of salivary cortisol and sAA area under the curve with respect to ground (AUCg) and area under the curve with respect to increase (AUCi) between laboratory and field were tested using OLS (Ordinary Least Squares) regression. The sAA AUCg output in the laboratory was correlated with output during all field measurement days and similarly among high and low job strain groups (p<0.001). SAA AUCi and salivary cortisol AUCg and AUCi were not correlated between laboratory and field measurement, neither in the whole sample nor among low or high job strain group. In conclusion, a laboratory measure of sAA AUCg output is promising in predicting stress-related output during burdensome work shifts and leisure time, whereas sAA AUCi or salivary cortisol seem not to have this potential.

  2. Evening salivary alpha-amylase, major depressive disorder, and antidepressant use in the Netherlands Study of Depression and Anxiety (NESDA).

    PubMed

    Veen, Gerthe; Giltay, Erik J; Licht, Carmilla M M; Vreeburg, Sophie A; Cobbaert, Christa M; Penninx, Brenda W J H; Zitman, Frans G

    2013-06-30

    Salivary alpha-amylase (sAA) may be a suitable index for sympathetic activity and dysregulation of the autonomic nervous system. The relationship between antidepressants and depression with sAA levels was studied, since antidepressants were previously shown to have a profound impact on heart rate variability as an ANS indicator. Data are from 1692 participants of the Netherlands Study of Depression and Anxiety (NESDA) who were recruited from the community, general practice, and specialized mental health care. Differences in evening sAA levels were examined between patient groups (i.e., 752 current major depressive disorder [MDD], 611 remitted MDD, and 329 healthy controls) and between 46 tricyclic antidepressant (TCA) users, 307 selective serotonin reuptake inhibitor (SSRI) users, 97 users of another antidepressant, and 1242 non-users. Each participant sampled twice at 22.00h and 23.00h. In multivariable analysis, there was a trend over the three groups with increasing sAA levels from controls to remitted MDD to current MDD that approached significance. Furthermore, in comparison to non-users of antidepressants, TCA rather than SSRI users showed higher sAA levels, that persisted after multivariable adjustment. The present study shows that higher evening sAA levels in depressed patients, indicative of an increased sympathetic activity, may be induced by TCAs.

  3. Role of disulfide bridges in the activity and stability of a cold-active alpha-amylase.

    PubMed

    Siddiqui, Khawar Sohail; Poljak, Anne; Guilhaus, Michael; Feller, Georges; D'Amico, Salvino; Gerday, Charles; Cavicchioli, Ricardo

    2005-09-01

    The cold-adapted alpha-amylase from Pseudoalteromonas haloplanktis unfolds reversibly and cooperatively according to a two-state mechanism at 30 degrees C and unfolds reversibly and sequentially with two transitions at temperatures below 12 degrees C. To examine the role of the four disulfide bridges in activity and conformational stability of the enzyme, the eight cysteine residues were reduced with beta-mercaptoethanol or chemically modified using iodoacetamide or iodoacetic acid. Matrix-assisted laser desorption-time of flight mass spectrometry analysis confirmed that all of the cysteines were modified. The iodoacetamide-modified enzyme reversibly folded/unfolded and retained approximately one-third of its activity. Removal of all disulfide bonds resulted in stabilization of the least stable region of the enzyme (including the active site), with a concomitant decrease in activity (increase in activation enthalpy). Disulfide bond removal had a greater impact on enzyme activity than on stability (particularly the active-site region). The functional role of the disulfide bridges appears to be to prevent the active site from developing ionic interactions. Overall, the study demonstrated that none of the four disulfide bonds are important in stabilizing the native structure of enzyme, and instead, they appear to promote a localized destabilization to preserve activity.

  4. A dispersion model for predicting the extent of starch liquefaction by Bacillus licheniformis alpha-amylase during reactive extrusion.

    PubMed

    Komolprasert, V; Ofoli, R Y

    1991-03-25

    A Baker-Perkins corotating twin screw extruder was used as a bioreactor to hydrolyze pregelantinized corn starch by themophilic Bacillus licheniformis alpha-amylase. The extruder was modeled as a tube, and characterized as a closed system. This characterization is not in the thermodynamic sense; rather, it relates to the profile of a tracer fluid upon entry to and exit from the reaction zone. The reaction kinetics were modeled by a modified first-order equation, which allowed the dispersion equation to be solved analytically with the Danckwerts boundary condition. Data from several extrusion runs were super-imposed to obtain a profile to evaluate the model. The dispersion number, determined from the first and second moments of the RTD curve, was primarily a function of the length of the reaction zone. There was good agreement between predictions and experimental data, especially at low dispersion numbers. In general, the axial dispersion model appears to be suitable for analysis of enzymatic reactions of up to 30% conversion. At a fixed flow rate and constant temperature, the extent of starch conversion depends significantly on moisture content, residence time and enzyme dosage, but not on screw speed.

  5. A fluid response: Alpha-amylase reactions to acute laboratory stress are related to sample timing and saliva flow rate.

    PubMed

    Nagy, Tamás; van Lien, René; Willemsen, Gonneke; Proctor, Gordon; Efting, Marieke; Fülöp, Márta; Bárdos, György; Veerman, Enno C I; Bosch, Jos A

    2015-07-01

    Salivary alpha-amylase (sAA) is used as a sympathetic (SNS) stress marker, though its release is likely co-determined by SNS and parasympathetic (PNS) activation. The SNS and PNS show asynchronous changes during acute stressors, and sAA responses may thus vary with sample timing. Thirty-four participants underwent an eight-minute memory task (MT) and cold pressor task (CPT). Cardiovascular SNS (pre-ejection period, blood pressure) and PNS (heart rate variability) activity were monitored continuously. Unstimulated saliva was collected repeatedly during and after each laboratory stressor, and sAA concentration (U/ml) and secretion (U/minute) determined. Both stressors increased anxiety. The MT caused an immediate and continued cardiac SNS activation, but sAA concentration increased at task cessation only (+54%); i.e., when there was SNS-PNS co-activation. During the MT sAA secretion even decreased (-35%) in conjunction with flow rate and vagal tone. The CPT robustly increased blood pressure but not sAA. In summary, sAA fluctuations did not parallel changes in cardiac SNS activity or anxiety. sAA responses seem contingent on sample timing and flow rate, likely involving both SNS and PNS influences. Verification using other stressors and contexts seems warranted. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Aging diurnal rhythms and chronic stress: Distinct alteration of diurnal rhythmicity of salivary alpha-amylase and cortisol.

    PubMed

    Strahler, Jana; Berndt, Christiane; Kirschbaum, Clemens; Rohleder, Nicolas

    2010-05-01

    The present study assessed diurnal profiles of salivary alpha-amylase (sAA), proposed as a marker of autonomic activity, and salivary cortisol in competitive ballroom dancers as well as age- and sex-matched controls to investigate age-related changes of basal activity and potential chronic psychosocial stress-related alterations. According to the Allostatic Load (AL) hypothesis of a cumulative wear and tear of the body we expected to see physiological accumulation of the effects of stress and age especially pronounced in older dancers. Dancers and controls collected five saliva samples throughout the day. Daily overall output of sAA was elevated in older adults while there was no effect of age on mean cortisol levels. Alterations of diurnal rhythms were only seen in younger male dancers showing a flattened diurnal profile of sAA and younger dancers and female older dancers showing a blunted diurnal rhythmicity of cortisol. Furthermore, we found a negative correlation between summary indices of basal sAA and the amount of physical activity. In conclusion, higher overall output of sAA in older adults is in line with the phenomenon of a sympathetic "drive" with increasing age. Furthermore, a lower output of sAA in people who are more physical active is in line with the hypothesis of an exercise-induced decrease of sympathetic activity. Overall, our study does not support the AL hypothesis, but rather highlights the importance of regular physical activity and social environment in promoting health.

  7. Effect of combined cognitive-behavioural therapy and endurance training on cortisol and salivary alpha-amylase in panic disorder.

    PubMed

    Plag, Jens; Gaudlitz, Katharina; Schumacher, Sarah; Dimeo, Fernando; Bobbert, Thomas; Kirschbaum, Clemens; Ströhle, Andreas

    2014-11-01

    Current data point to an alteration of both the hypothalamo-pituitary-adrenal (HPA)-system and the peripheral transmission of catecholamines in anxiety disorders. There is also some evidence for the effect of several components of cognitive-behavioural interventions such as coping and control and for an effect of exercise training on the neuroendocrine stress response in healthy subjects as well as patients suffering from distinct (mental) disorders. This double-blind, controlled study investigated the effect of cognitive-behavioural therapy (CBT) in combination with either high-level endurance training or low-level exercise on salivary cortisol (sC) and on levels of salivary alpha-amylase (sAA) in patients suffering from panic disorder (PD) with and without agoraphobia. In comparison to the low-level exercise condition, there were significantly lower sC-levels in the experimental group performing high-level endurance training at a 7-month follow-up. In contrast, there were no group differences in sAA levels during the study period. In this trial, we found evidence for a decelerated effect of endurance-training on HPA-system's functioning in PD. Further studies addressing the alteration of sAA levels in this population might investigate physical exercise different in intensity and duration. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Covalent immobilization of alpha-amylase onto pHEMA microspheres: preparation and application to fixed bed reactor.

    PubMed

    Arica, M Y; Hasirci, V; Alaeddinoğlu, N G

    1995-07-01

    Microspheres of poly(2-hydroxyethyl methacrylate) with and without cross-linker were prepared by suspension polymerization. As the amount of cross-linker increased, the equilibrium water content, enzyme loading, immobilization efficiency and recovered activity were all adversely affected. Enzyme alpha-amylase was immobilized onto the microspheres after activation with epichlorohydrin. The Km value for the immobilized enzyme (0.90% w/v) was much greater than that of the free enzyme (0.53% w/v). It was found that the inactivation constant (ki) increased from 2.23 x 10(-8) min-1 at 20 degrees C to 1.45 x 10(-4) min-1 at 60 degrees C. Since the enzyme activity increased as the temperature increased, the temperature profile yielded a peak at 50 degrees C. For free enzyme this is at 45 degrees C. The residence time was proportional to the percentage hydrolysis until a residence time of 12 min was reached. Beyond this the activity increase could not match the increase in residence time. The pH profile yielded a broadening upon immobilization in addition to a small shift to higher pH (from 5.5 to 6.0). The continuous run at 30 degrees C, 1.0% w/v starch concentration and flow rate of 40 cm3 h-1 led to only 20% loss in activity after a 120 h operation.

  9. Condition stabilization for Aspergillus niger FCBP-198 and its hyperactive mutants to yield high titres of alpha-amylase.

    PubMed

    Shafique, Sobiya; Bajwa, Rukhsana; Shafique, Shazia

    2010-01-01

    A number of substrates were tested for the cultivation of microorganisms to produce a host of enzymes. The effect of different substrates (wheat and rice straw, sugar cane waste, wood waste), incubation temperatures (20-40 degrees C), initial pH levels (3.5-9.0), incubation periods (0-72 hours) and nitrogen sources (ammonium sulfate, urea, peptone, yeast extract, sodium nitrate) on growth and alpha-amylase activity was studied for the native and mutant strains. Maximum enzyme activity was observed at 1.5% wheat straw for Aspergillus niger FCBP-198 and An-Ch-4.7 and at 2% wheat straw for An-UV-5.6, with sodium nitrate as a principle nitrogen source. The optimum temperature for maximum enzyme activity was 30 degrees C for the parental strain, while An-UV-5.6 and An-Ch-4.7 thrived well at 32.5 degrees C. The best conditions of pH and incubation duration were 4.5 and 48 hours, respectively, for all the strains. Mass production under preoptimized growth conditions demonstrated the suitability of wheat straw for swift mycelial colonization and viability.

  10. Evaluation of column flotation in the downstream processing of fermentation products: recovery of a genetically engineered alpha-amylase.

    PubMed

    Miranda, E A; Berglund, K A

    1993-01-01

    Flotation is a simple, inexpensive, and versatile unit operation with a largely unexplored potential in biotechnology. There is a general lack of research concerning biotechnological applications in this area, especially in the recovery of fermentation products. Moreover, the few reports in the literature do not consider the modern concept of column flotation as practiced in the mineral industry. We report herein the application of column flotation for the recovery of a Bacillus stearothermophilus alpha-amylase expressed in Escherichia coli by the use of a food-grade polymer, (hydroxypropyl)methylcellulose (HPMC), and ammonium sulfate. First, the enzyme was removed from the liquid phase by partition to a salted-out HPMC phase. The enzyme-containing polymer flocs were then floated from the liquid. Recovery of active enzyme was as high as 90%, with throughput as high as 94 m3/(h.m2). The floatability of the enzyme from a periplasmic extract was higher than extracellular enzyme in the broth due to the presence of depressors of molecular weight lower than 10,000 in the broth.

  11. Sex differences in emotional memory consolidation: the effect of stress-induced salivary alpha-amylase and cortisol.

    PubMed

    Felmingham, Kim L; Tran, Thu Phuong; Fong, Wing Chee; Bryant, Richard A

    2012-03-01

    This study examined sex differences in the emotional memory consolidation, and the impact of stress-induced cortisol and salivary alpha amylase responses on emotional memory recall. Following baseline salivary measures, 39 healthy women and 41 men viewed 20 neutral and 20 negative arousing images, and then underwent either a cold pressor stress test or control condition, followed by further salivary measures. Participants returned two days later for a free recall test. The stress condition induced greater cortisol response, and negative images were better recalled than neutral. Whereas women displayed greater recall of negative images under stress than men, they recalled fewer negative images in the control condition. Stress-induced cortisol predicted recall of negative images in women, and neutral images in men. This suggests there is an enhanced consolidation of negative images under stress in women that may be a potential mechanism for the greater female prevalence for developing anxiety disorders. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.

    PubMed

    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M

    2000-09-01

    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III.

  13. New type of starch-binding domain: the direct repeat motif in the C-terminal region of Bacillus sp. no. 195 alpha-amylase contributes to starch binding and raw starch degrading.

    PubMed Central

    Sumitani, J; Tottori, T; Kawaguchi, T; Arai, M

    2000-01-01

    The alpha-amylase from Bacillus sp. no. 195 (BAA) consists of two domains: one is the catalytic domain similar to alpha-amylases from animals and Streptomyces in the N-terminal region; the other is the functionally unknown domain composed of an approx. 90-residue direct repeat in the C-terminal region. The gene coding for BAA was expressed in Streptomyces lividans TK24. Three active forms of the gene products were found. The pH and thermal profiles of BAAs, and their catalytic activities for p-nitrophenyl maltopentaoside and soluble starch, showed almost the same behaviours. The largest, 69 kDa, form (BAA-alpha) was of the same molecular mass as that of the mature protein estimated from the nucleotide sequence, and had raw-starch-binding and -degrading abilities. The second largest, 60 kDa, form (BAA-beta), whose molecular mass was the same as that of the natural enzyme from Bacillus sp. no. 195, was generated by proteolytic processing between the two repeat sequences in the C-terminal region, and had lower activities for raw starch binding and degrading than those of BAA-alpha. The smallest, 50 kDa, form (BAA-gamma) contained only the N-terminal catalytic domain as a result of removal of the C-terminal repeat sequence, which led to loss of binding and degradation of insoluble starches. Thus the starch adsorption capacity and raw-starch-degrading activity of BAAs depends on the existence of the repeat sequence in the C-terminal region. BAA-alpha was specifically adsorbed on starch or dextran (alpha-1,4 or alpha-1,6 glucan), and specifically desorbed with maltose or beta-cyclodextrin. These observations indicated that the repeat sequence of the enzyme was functional in the starch-binding domain (SBD). We propose the designation of the homologues to the SBD of glucoamylase from Aspergillus niger as family I SBDs, the homologues to that of glucoamylase from Rhizopus oryzae as family II, and the homologues of this repeat sequence of BAA as family III. PMID:10947962

  14. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  15. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  16. Effect of domestic cooking on the starch digestibility, predicted glycemic indices, polyphenol contents and alpha amylase inhibitory properties of beans (Phaseolis vulgaris) and breadfruit (Treculia africana).

    PubMed

    Chinedum, E; Sanni, S; Theressa, N; Ebere, A

    2017-08-09

    The effect of processing on starch digestibility, predicted glycemic indices (pGI), polyphenol contents and alpha amylase inhibitory properties of beans (Phaseolis vulgaris) and breadfruit (Treculia africana) was studied. Total starch ranged from 4.3 to 68.3g/100g, digestible starch ranged from 4.3 to 59.2 to 65.7g/100g for the raw and processed legumes; Resistance starch was not detected in most of the legumes except in fried breadfruit and the starches in both the raw and processed breadfruit were more rapidly digested than those from raw and cooked beans. Raw and processed breadfruit had higher hydrolysis curves than raw and processed beans with the amylolysis level in raw breadfruit close to that of white bread. Raw beans had a low glycemic index (GI); boiled beans and breadfruit had intermediate glycemic indices respectively while raw and fried breadfruit had high glycemic indices. Aqueous extracts of the food samples had weak α-amylase inhibition compared to acarbose. The raw and processed legumes contained considerable amounts of dietary phenols and flavonoids. The significant correlation (r=0.626) between α-amylase inhibitory actions of the legumes versus their total phenolic contents suggests the contribution of the phenolic compounds in these legumes to their α-amylase inhibitory properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Use of alpha-amylase and amyloglucosidase combinations to minimize the bread quality problems caused by high levels of damaged starch.

    PubMed

    Barrera, Gabriela N; Tadini, Carmen C; León, Alberto E; Ribotta, Pablo D

    2016-10-01

    The objective of this work was to investigate the contribution of α-amylase and amyloglucosidase to dough fermentation process and bread quality, as an alternative to reduce the negative effects caused by high damaged starch in flour. The dough properties during the proofing process were modified by higher damaged starch content. Higher damaged starch in flour resulted into breads with darker crusts and firmer crumbs. The enzymes reduced the negative influence of damaged starch, producing a positive effect on the maximum carbon dioxide pressure reached during fermentation and the carbon dioxide volume retained by dough. Incorporation of alpha-amylase reduced dimension ratio and crumb firmness attributes; however, progressive additions of this additive produced lower bread volume and red intensity, and higher crumb firmness. The amyloglucosidase additions produced higher bread volume and red intensity of the crust, and lower brightness crust and gas cell diameter. Incorporation of amyloglucosidase was beneficial in the presence of a suitable quantity of damaged starch. The results confirmed that the α-amylase and amyloglucosidase additions significantly improved bread quality. Incorporation of α-amylase and amyloglucosidase led to higher bread loaves and lower crumb firmness throughout the storage period, promoting a longer life of the finished product.

  18. Fermentation by Lactobacillus fermentum Ogi E1 of different combinations of carbohydrates occurring naturally in cereals: consequences on growth energetics and alpha-amylase production.

    PubMed

    Calderon, M; Loiseau, G; Guyot, J P

    2003-01-25

    Glucose, fructose, sucrose and starch are naturally present in cereals. Fermentation of different combinations of these carbohydrates by Lactobacillus fermentum Ogi E1, a sourdough heterofermentative lactobacillus, was investigated to determine effects on fermentation kinetics, growth energetics and alpha-amylase production. Irrespective of the substrate combination, the strain was able to simultaneously produce alpha-amylase and consume starch, glucose, fructose and sucrose. In mixtures of starch with either sucrose or fructose or with both fructose and glucose, yields of alpha-amylase from biomass (Y(amy/x)) were similar to those observed for starch. However, for starch and glucose or starch, glucose, fructose and sucrose mixtures, both Y(amy/x) and the specific rate of alpha-amylase production decreased markedly. In fructose- or sucrose-containing mixtures, mannitol was formed stoichiometrically indicating that fructose served as electron acceptor, and acetate was produced at constant yield from biomass (Y(ac/x)) (1 g acetate g biomass(-1)). Acetate production was expected to confer to the strain a competitive advantage during natural fermentation by improving biomass formation and growth through an increase in the ATP gain. Y(ATP) varied depending on the carbohydrate mixture, indicating different effects of substrate mixtures on the efficiency in ATP coupling to biomass formation. Compared to starch fermentation, the highest value of Y(ATP) (29 g biomass mol ATP(-1)) was estimated for the starch/fructose mixture but no increase in mu(max) was observed. The lowest value (16 g biomass mol ATP(-1)) was obtained for the starch, glucose and fructose mixture, whereas for the mixture of all carbohydrates, Y(ATP) was similar to that obtained with starch alone (20 g biomass mol ATP(-1)) and it was intermediary for the starch and sucrose mixture (17 g biomass mol ATP(-1)). It is concluded that competitiveness of the strain cannot be based on expected energy gain in mixed

  19. Structure-activity relationship of benzoxazinones and related compounds with respect to the growth inhibition and alpha-amylase activity in cress seedlings.

    PubMed

    Kato-Noguchi, Hisashi; Macías, Francisco A; Molinillo, José M G

    2010-10-15

    Benzoxazinones and their degradation compounds inhibited root growth and alpha-amylase activity in cress seedlings. The inhibitory activity of these compounds was divided into three groups: the high active group; 2,4-dihydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2,4-dihydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 4-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, the moderate active group; 7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, (2H)-1,4-benzoxazin-3(4H)-one, 6-methoxy-benzoxazolin-2(3H)-one, benzoxazolin-2(3H)-one and 2-amino-phenoxazine-3-one, and the low active group; 2-hydroxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-hydroxy-7-methoxy-(2H)-1,4-benzoxazin-3(4H)-one, 2-amino-7-hydroxyphenoxazine-3-one and 2-amino-7-methoxyphenoxazine-3-one. The structure-activity of these compounds suggests that compounds that have benzoxazinone skeletons are the most active structure, and a hydroxyl group at position C-2 on the benzoxazinone skeleton may not affect inhibitory activity, whereas a hydroxyl group at position N-4 on the skeleton is essential for inhibitory activity. However, the concentration-response curves of these compounds and the I(50) values (the concentrations required for 50% inhibition) for root growth and alpha-amylase indicated that root growth was positively correlated with the alpha-amylase activity in the seedlings. alpha-Amylase is required not only for seed germination, but also subsequent seedling growth until photosynthesis is sufficient to support seedling growth. Therefore, these results suggest that the compounds studied here may inhibit the root growth of cress seedlings by inhibiting alpha-amylase activity.

  20. Association of alpha-amylase and the R1 protein with starch granules precedes the initiation of net starch degradation in turions of Spirodela polyrhiza.

    PubMed

    Reimann, Rezarta; Ritte, Gerhard; Steup, Martin; Appenroth, Klaus-J

    2002-01-01

    In turions of Spirodela polyrhiza (L.) Schleiden, net degradation of storage starch is controlled by a special low fluence response of phytochrome requiring illumination for several days. This light effect has been used to study protein-starch interactions that occur prior to and during net degradation of starch. Following various pretreatments on S. polyrhiza turions, native starch granules were isolated and two fractions of starch-related proteins were distinguished: proteins enclosed within the starch particles (starch-internalized proteins) and those attached to the surface (starch-associated proteins). The pattern of starch-associated proteins as resolved by SDS-PAGE was more complex than that of starch-internalized proteins and varied depending upon the pretreatment of the turions. Two starch associated proteins were identified immunochemically as alpha-amylase (EC 3.2.1.1) and the R1 protein (Lorberth et al. (1998) Nature Biotechnology 16: 473-477). Dark-pretreatment of non-dormant turions does not induce starch net degradation. Under these conditions, alpha-amylase and R1 were bound to the surface of the starch granules. Continuous illumination with red light induces a rapid degradation of starch. Within the first 24 h of illumination the level of starch-associated alpha-amylase transiently increased and subsequently decreased rapidly. Similarly, the amount of the starch-associated R1 also decreased during illumination. The dissociation of both alpha-amylase and R1 from the starch granules preceded the decrease in starch content. However, binding of the two proteins to starch granules remained unchanged when the turions did not perform net starch degradation (as observed during continuous darkness, orthophosphate deficiency, or dormancy of the turions). Thus, during net starch degradation, so far unidentified changes are postulated to occur at the surface of the starch particles that are relevant for protein binding. This conclusion was supported by in

  1. Purification, characterization, and partial primary sequence of a major-maltotriose-producing alpha-amylase, ScAmy43, from Sclerotinia sclerotiorum.

    PubMed

    Ben Abdelmalek-Khedher, Imen; Urdaci, Maria Camino; Limam, Ferid; Schmitter, Jean Marie; Marzouki, M Nejib; Bressollier, Philippe

    2008-09-01

    A novel alpha-amylase (alpha-1,4-alpha-D-glucan glucanohydrolase, E.C. 3.2.1.1), ScAmy43, was found in the culture medium of the phytopathogenic fungus Sclerotinia sclerotiorum grown on oats flour. Purified to homogeneity, ScAmy43 appeared as a 43 kDa monomeric enzyme, as estimated by SDS-PAGE and Superdex 75 gel filtration. The MALDI peptide mass fingerprint of ScAmy43 tryptic digest as well as internal sequence analyses indicate that the enzyme has an original primary structure when compared with other fungal alpha- amylases. However, the sequence of the 12 N-terminal residues is homologous with those of Aspergillus awamori and Aspergillus kawachii amylases, suggesting that the new enzyme belongs to the same GH13 glycosyl hydrolase family. Assayed with soluble starch as substrate, this enzyme displayed optimal activity at pH 4 and 55oC with an apparent Km value of 1.66 mg/ml and Vmax of 0.1 micromol glucose x min-1 x ml-1. ScAmy43 activity was strongly inhibited by Cu2+, Mn2+, and Ba2+, moderately by Fe2+, and was only weakly affected by Ca2+ addition. However, since EDTA and EGTA did not inhibit ScAmy43 activity, this enzyme is probably not a metalloprotein. DTT and beta-mercaptoethanol strongly increased the enzyme activity. Starting with soluble starch as substrate, the end products were mainly maltotriose, suggesting for this enzyme an endo action.

  2. Efficacy of supplementation of alpha-amylase-producing bacterial culture on the performance, nutrient use, and gut morphology of broiler chickens fed a corn-based diet.

    PubMed

    Onderci, M; Sahin, N; Sahin, K; Cikim, G; Aydín, A; Ozercan, I; Aydín, S

    2006-03-01

    A trial was conducted to evaluate the efficacy of an Escherichia coli strain producing alpha-amylase of Bacillus stearothermophilus on growth performance, nutrient use, and the morphology of the small intestine of broilers fed a corn-based diet. One hundred thirty-five 1-d-old chicks (Cobb 500) were randomly divided into 3 groups and treated as follows: (i) basal diet (control); (ii) basal diet and water supplemented with an E. coli strain that produced amylase, and (iii) basal diet and water supplemented with an E. coli strain that produced amylase plus bacterial hemoglobin. At 21 d of age, supplementation of E. coli improved daily gain (P < 0.05) and feed conversion (P < 0.01). At the end of the trial, birds supplemented with water containing bacteria consumed more and grew faster (P < 0.05) and had better feed conversion (P < 0.10) than broilers given no bacteria. Also, the presence of bacteria improved apparent digestibility of organic matter (P < 0.01). However, no effects were detected for CP or fat digestibility. Supplementation with E. coli reduced relative pancreas weight (P = 0.06) but did not affect the weight of the liver (P > 0.05) and length of duedonum, jejunum, ileum, and cecum (P > 0.05). Length of the villi and crypts were significantly increased with bacterial supplementation. Presence of the bacterial hemoglobin gene did not cause a significant difference in changes observed. The data indicated that supplementation of an E. coli strain capable of producing alpha-amylase improved digestibility of nutrients and performance of broilers fed a corn-based diet.

  3. The impact of attentional training on the salivary cortisol and alpha amylase response to psychosocial stress: importance of attentional control.

    PubMed

    Pilgrim, Kamala; Ellenbogen, Mark A; Paquin, Karine

    2014-06-01

    This study examined the effects of three consecutive days of attentional training on the salivary alpha amylase (sAA), cortisol, and mood response to the Trier Social Stress Test (TSST). The training was designed to elicit faster disengagement of attention away from threatening facial expressions and faster shifts of attention toward positive ones. Fifty-six healthy participants between the ages of 18 and 30 participated in a double-blind, within-subject experiment. Participants were randomly assigned to one of three attentional training conditions - supraliminal training: pictures shown with full conscious awareness, masked training: stimuli presented with limited conscious awareness, or control training: both supraliminal and masked pictures shown but no shifting of attention required. Following training, participants underwent the TSST. Self-reported mood and saliva samples were collected for the determination of emotional reactivity, cortisol, and sAA in response to stress post-training. Unexpectedly, participants in both attentional training groups exhibited a higher salivary cortisol response to the TSST relative to participants who underwent the control training, F (4, 86)=4.07, p=.005, ηp(2)=.16. Supraliminal training was also associated with enhanced sAA reactivity, F (2, 44)=13.90, p=.000, ηp(2)=.38, and a more hostile mood response (p=.021), to the TSST. Interestingly, the effect of attention training on the cortisol response to stress was more robust in those with high attentional control than those with low attentional control (β=-0.134; t=-2.24, p=.03). This is among the first experimental manipulations to demonstrate that attentional training can elicit a paradoxical increase in three different markers of stress reactivity. These findings suggest that attentional training, in certain individuals, can have iatrogenic effects. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Differences in Salivary Alpha-Amylase and Cortisol Responsiveness following Exposure to Electrical Stimulation versus the Trier Social Stress Tests

    PubMed Central

    Maruyama, Yoshihiro; Kawano, Aimi; Okamoto, Shizuko; Ando, Tomoko; Ishitobi, Yoshinobu; Tanaka, Yoshihiro; Inoue, Ayako; Imanaga, Junko; Kanehisa, Masayuki; Higuma, Haruka; Ninomiya, Taiga; Tsuru, Jusen; Hanada, Hiroaki; Akiyoshi, Jotaro

    2012-01-01

    Background Cortisol is an essential hormone in the regulation of the stress response along the HPA axis, and salivary cortisol has been used as a measure of free circulating cortisol levels. Recently, salivary alpha-amylase (sAA) has also emerged as a novel biomarker for psychosocial stress responsiveness within the sympathetic adrenomedullary (SAM) system. Principal Findings We measured sAA and salivary cortisol in healthy volunteers after exposure to the Trier Social Stress Test (TSST) and electric stimulation stress. One hundred forty-nine healthy volunteers participated in this study. All subjects were exposed to both the TSST and electric stimulation stress on separate days. We measured sAA and salivary cortisol levels three times immediately before, immediately after, and 20 min after the stress challenge. The State (STAI-S) and Trait (STAI-T) versions of the Spielberger Anxiety Inventory test and the Profile of Mood State (POMS) tests were administered to participants before the electrical stimulation and TSST protocols. We also measured HF, LF and LF/HF Heart Rate Variability ratio immediately after electrical stimulation and TSST exposure. Following TSST exposure or electrical stimulation, sAA levels displayed a rapid increase and recovery, returning to baseline levels 20 min after the stress challenge. Salivary cortisol responses showed a delayed increase, which remained significantly elevated from baseline levels 20 min after the stress challenge. Analyses revealed no differences between men and women with regard to their sAA response to the challenges (TSST or electric stimulations), while we found significantly higher salivary cortisol responses to the TSST in females. We also found that younger subjects tended to display higher sAA activity. Salivary cortisol levels were significantly correlated with the strength of the applied electrical stimulation. Conclusions These preliminary results suggest that the HPA axis (but not the SAM system) may show

  5. Immediate Effects of Traditional Thai Massage on Psychological Stress as Indicated by Salivary Alpha-Amylase Levels in Healthy Persons.

    PubMed

    Sripongngam, Thanarat; Eungpinichpong, Wichai; Sirivongs, Dhavee; Kanpittaya, Jaturat; Tangvoraphonkchai, Kamonwan; Chanaboon, Sutin

    2015-10-05

    BACKGROUND Stress can cause psychological and physiological changes. Many studies revealed that massage can decrease stress. However, traditional Thai massage has not been well researched in this regard. The purpose of this study was to investigate the immediate effects of traditional Thai massage (TTM) on salivary alpha-amylase levels (sAA), heart rate variability (HRV), autonomic nervous system (ANS) function, and plasma renin activity (PRA). MATERIAL AND METHODS Twenty-nine healthy participants were randomly allocated into either a traditional Thai massage (TTM) group or Control (C) group, after which they were switched to the other group with a 2-week wash-out period. Each of them was given a 10-minute mental arithmetic test to induce psychological stress before a 1-hour session of TTM or rest. RESULTS Within-groups comparison revealed that sAA was significantly decreased (p<0.05) in the TTM group but not in the C group. HRV and ANS function were significantly increased (p<0.05) and PRA was significantly decreased (p<0.05) in both groups. However, low frequency per high frequency ratio (LF/HF ratio) and ANS balance status were not changed. Only sAA was found to be significantly different between groups (p<0.05). CONCLUSIONS We conclude that both TTM and rest can reduce psychological stress, as indicated by decreased sAA levels, increased parasympathetic activity, decreased sympathetic activity, and decreased PRA. However, TTM may have a modest effect on stress reduction as indicated by a reduced sAA.

  6. The rice alpha-amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids.

    PubMed

    Kitajima, Aya; Asatsuma, Satoru; Okada, Hisao; Hamada, Yuki; Kaneko, Kentaro; Nanjo, Yohei; Kawagoe, Yasushi; Toyooka, Kiminori; Matsuoka, Ken; Takeuchi, Masaki; Nakano, Akihiko; Mitsui, Toshiaki

    2009-09-01

    The well-characterized secretory glycoprotein, rice (Oryza sativa) alpha-amylase isoform I-1 (AmyI-1), was localized within the plastids and proved to be involved in the degradation of starch granules in the organelles of rice cells. In addition, a large portion of transiently expressed AmyI-1 fused to green fluorescent protein (AmyI-1-GFP) colocalized with a simultaneously expressed fluorescent plastid marker in onion (Allium cepa) epidermal cells. The plastid targeting of AmyI-1 was inhibited by both dominant-negative and constitutively active mutants of Arabidopsis thaliana ARF1 and Arabidopsis SAR1, which arrest endoplasmic reticulum-to-Golgi traffic. In cells expressing fluorescent trans-Golgi and plastid markers, these fluorescent markers frequently colocalized when coexpressed with AmyI-1. Three-dimensional time-lapse imaging and electron microscopy of high-pressure frozen/freeze-substituted cells demonstrated that contact of the Golgi-derived membrane vesicles with cargo and subsequent absorption into plastids occur within the cells. The transient expression of a series of C-terminal-truncated AmyI-1-GFP fusion proteins in the onion cell system showed that the region from Trp-301 to Gln-369 is necessary for plastid targeting of AmyI-1. Furthermore, the results obtained by site-directed mutations of Trp-302 and Gly-354, located on the surface and on opposite sides of the AmyI-1 protein, suggest that multiple surface regions are necessary for plastid targeting. Thus, Golgi-to-plastid traffic appears to be involved in the transport of glycoproteins to plastids and plastid targeting seems to be accomplished in a sorting signal-dependent manner.

  7. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    PubMed Central

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  8. Salivary alpha-amylase during pregnancy: diurnal course and associations with obstetric history, maternal demographics, and mood.

    PubMed

    Giesbrecht, Gerald F; Granger, Douglas A; Campbell, Tavis; Kaplan, Bonnie

    2013-03-01

    Diurnal patterns of salivary alpha amylase (sAA) in pregnant women have not previously been described. The current study employed ecological momentary assessment to examine the association between the diurnal sAA, obstetric history, maternal demographics, and mood during pregnancy. Saliva was self-collected by 83 pregnant women (89% White, age 25.3-43.0 years; mean gestational age 21.9 weeks, range 6-37 weeks; gravida 1-6) at home over three days. Results indicated that current pregnancy (gestational age and fetal sex) and maternal demographics were not related to diurnal sAA. In contrast, a history of previous miscarriage (Parameter = -.17; SE = .05; p < .05) was associated with an atypical diurnal pattern. Even after accounting for obstetric history, trait anxiety (Parameter = .16; SE = .04; p < .001) was associated with increased sAA over the day while chronic levels of fatigue (Parameter = -.06; SE = .03; p < .05) were associated with decreased sAA. In a separate model, we also tested the time varying covariation of sAA and mood. The effects of momentary mood were in contrast to those for trait mood. Both momentary depression (Parameter = .22; SE = .09; p < .01) and vigour/positive mood (Parameter = .12; SE = .04; p < .001) were associated with momentary increases in sAA while momentary anxiety and fatigue were not related to sAA. The findings suggest that basal sAA during pregnancy is sensitive to emotional arousal. Evaluating diurnal patterns of sAA holds promise for advancing understanding of how emotional arousal during pregnancy may affect fetal development.

  9. Influence of the way of reporting alpha-Amylase values in saliva in different naturalistic situations: A pilot study.

    PubMed

    Contreras-Aguilar, María Dolores; Escribano, Damián; Martínez-Subiela, Silvia; Martínez-Miró, Silvia; Rubio, Mónica; Tvarijonaviciute, Asta; Tecles, Fernando; Cerón, Jose J

    2017-01-01

    The objective of this pilot study was to compare the different ways of measuring salivary alpha-amylase (sAA, enzymatic vs. concentration) and to evaluate the influence that the different ways of reporting the results can have in sAA interpretation. For this purpose, sAA was measured by direct quantification and also by an enzymatic assay in three different naturalistic situations, a physical stressor (situation 1) and two mental stressors of different intensity (situations 2 and 3). The results were expressed in three different ways (without correction, multiplied by flow rate and divided by protein concentration). sAA concentration and activity increased just after situations 1 and 3. When values were multiplied by the flow rate, significant changes after situation 1 were detected only for sAA activity but not for sAA concentration, being these changes of lower significance and magnitude that those observed for sAA activity without any correction. In addition, a significant increase in sAA activity was found at T+15 in situation 2. In situation 3 the significant decrease in sAA at T+15 disappeared. When values were divided by protein concentration, there were no significant changes in situations 1 or 3, but a decrease in situation 2 at T+0 and an increase at T+15. sAA activity and concentration showed a significant correlation in all situations. This pilot study points out that the way of expressing sAA can influence the results obtained in different stress models and also their interpretation. Therefore, how sAA is reported and the factors involved in the different ways of expressing sAA, should be taken into consideration for an objective interpretation of sAA values.

  10. Enzymatic laundry for old clothes: immobilized alpha-amylase from Bacillus sp. for the biocleaning of an ancient Coptic tunic.

    PubMed

    Ferrari, Martina; Mazzoli, Roberto; Morales, Simona; Fedi, Mariaelena; Liccioli, Lucia; Piccirillo, Anna; Cavaleri, Tiziana; Oliva, Cinzia; Gallo, Paolo; Borla, Matilde; Cardinali, Michela; Pessione, Enrica

    2017-07-31

    The classification and conservation of ancient artworks (belonging to collections) is of important cultural, historical, and economic concern. However, ancient textiles often display structural damage that renders them fragile and unsuitable for exhibition. One of the most common types of damage is linked to erroneous restoration treatments, among which the application of glues to consolidate cuts. Harsh strategies, such as mechanical or chemical treatments, are not suitable since they can cause further impairment of the fabric, whereas mild approaches, like wet cleaning, are often ineffective, as also demonstrated by the present study. Here, we have explored the possibility of using gellan-immobilized enzymes of bacterial origin (Bacillus alpha-amylase) to obtain a satisfactory starch removal from a damaged archaeological tunic-shroud from the Turin Egyptian Museum (Italy), without altering the original yarns or textile fibers. This method, already applied to clean casein-damaged wall paintings, as well as cotton, silk, and linen fabrics, has proved to be optimal for the treatment of a wool burial shroud and to be able to definitively solve fragile textile restoration problems. Moreover, efforts have been made to obtain insights into the artwork: a multidisciplinary approach has allowed to obtain a correct chronological attribution (radiocarbon dating) and fabric fiber characterization (SEM-EDX) as well as shed light on the colored parts and dark stains (FORS+IRFC and XRF). Finally, the evaluation of the type of glue, by Fourier transform infrared spectroscopy, has suggested the best enzyme for glue removal. These results have demonstrated that a mild bio-based approach is a successful tool for the treatment of archaeological textiles in critical conditions.

  11. Differences in salivary alpha-amylase and cortisol responsiveness following exposure to electrical stimulation versus the Trier Social Stress Tests.

    PubMed

    Maruyama, Yoshihiro; Kawano, Aimi; Okamoto, Shizuko; Ando, Tomoko; Ishitobi, Yoshinobu; Tanaka, Yoshihiro; Inoue, Ayako; Imanaga, Junko; Kanehisa, Masayuki; Higuma, Haruka; Ninomiya, Taiga; Tsuru, Jusen; Hanada, Hiroaki; Akiyoshi, Jotaro

    2012-01-01

    Cortisol is an essential hormone in the regulation of the stress response along the HPA axis, and salivary cortisol has been used as a measure of free circulating cortisol levels. Recently, salivary alpha-amylase (sAA) has also emerged as a novel biomarker for psychosocial stress responsiveness within the sympathetic adrenomedullary (SAM) system. We measured sAA and salivary cortisol in healthy volunteers after exposure to the Trier Social Stress Test (TSST) and electric stimulation stress. One hundred forty-nine healthy volunteers participated in this study. All subjects were exposed to both the TSST and electric stimulation stress on separate days. We measured sAA and salivary cortisol levels three times immediately before, immediately after, and 20 min after the stress challenge. The State (STAI-S) and Trait (STAI-T) versions of the Spielberger Anxiety Inventory test and the Profile of Mood State (POMS) tests were administered to participants before the electrical stimulation and TSST protocols. We also measured HF, LF and LF/HF Heart Rate Variability ratio immediately after electrical stimulation and TSST exposure. Following TSST exposure or electrical stimulation, sAA levels displayed a rapid increase and recovery, returning to baseline levels 20 min after the stress challenge. Salivary cortisol responses showed a delayed increase, which remained significantly elevated from baseline levels 20 min after the stress challenge. Analyses revealed no differences between men and women with regard to their sAA response to the challenges (TSST or electric stimulations), while we found significantly higher salivary cortisol responses to the TSST in females. We also found that younger subjects tended to display higher sAA activity. Salivary cortisol levels were significantly correlated with the strength of the applied electrical stimulation. These preliminary results suggest that the HPA axis (but not the SAM system) may show differential response patterns to distinct

  12. Increased alpha-amylase response to an acute psychosocial stress challenge in healthy adults with childhood adversity.

    PubMed

    Kuras, Yuliya I; McInnis, Christine M; Thoma, Myriam V; Chen, Xuejie; Hanlin, Luke; Gianferante, Danielle; Rohleder, Nicolas

    2017-01-01

    Childhood adversity is highly prevalent and linked to lasting psychological and physiological consequences. A potential mechanism for negative health outcomes is altered stress reactivity. While previous research has addressed associations of childhood adversity with stress system reactivity, sympathetic nervous system (SNS) stress reactivity is understudied. We therefore set out here to examining salivary alpha-amylase (sAA) reactivity in relation with childhood adversity. Forty-one healthy adult subjects (n = 24 male; n = 17 female) aged 18-34 years underwent the Trier Social Stress Test (TSST) and completed the Childhood Trauma Questionnaire (CTQ). Saliva for measurement of sAA was collected at three time points; before the TSST, immediately after, and 10 min post-TSST. We found that those with childhood trauma had a higher overall sAA response to the TSST, as seen in a repeated measures ANOVA (CTQ by time interaction: F(1.8,71.5) = 6.46, p = .01) and an independent samples t-test indicating higher sAA baseline to peak response (t = 3.22, p = .003). There was also a positive correlation between sAA reactivity and the CTQ subscales of childhood physical abuse (r = .46, p = .005) and emotional abuse (r = .37, p = .024). Healthy adults with low-to-moderate childhood adversity had a heightened sAA response immediately following the stressor. Higher SNS reactivity could be a link to negative health outcomes in adults with early adversity. Future research should address whether altered sAA reactivity is predictive of negative health outcomes in those with childhood adversity.

  13. Isolation and characterization of the subunits of a heat-labile alpha-amylase inhibitor from Phaseolus vulgaris white kidney bean.

    PubMed

    Yamaguchi, H

    1993-02-01

    The heat-labile one of the two alpha-amylase inhibitors of the white kidney bean (Phaseolus vulgaris) was found to be composed of three kinds of subunits, and they were isolated and characterized. The alpha-subunit was free from tryptophan and cysteine and the beta-subunit contained no methionine or cysteine. There was no marked resemblance in tryptic peptide maps between the alpha- and beta-subunit polypeptides. The alpha-subunit contained 30% by weight of carbohydrate, mainly made up of high mannose-oligosaccharides, and the sugar moiety of the beta-subunit amounted 7% and appeared to be predominantly composed of xylomannose-type oligosaccharides. The largest subunit, gamma, was very similar in molecular features to a postulated alpha beta-dimer and its N-terminal sequence coincided with that of the alpha-subunit. The molecular weights of the polypeptides of alpha, beta-, and gamma-subunits were shown to be 7,800, 14,000, and 22,000, respectively, by SDS-PAGE. It seemed likely that the alpha- and beta-subunits are common to both of the inhibitors and that the heat-lability of this inhibitor arises from the gamma-subunit.

  14. Polymer masked-unmasked protein therapy. 1. Bioresponsive dextrin-trypsin and -melanocyte stimulating hormone conjugates designed for alpha-amylase activation.

    PubMed

    Duncan, Ruth; Gilbert, Helena R P; Carbajo, Rodrigo J; Vicent, María J

    2008-04-01

    Polymer-protein conjugation, particularly PEGylation, is well-established as a means of increasing circulation time, reducing antigenicity, and improving the stability of protein therapeutics. However, PEG has limitations including lack of polymer biodegradability, and conjugation can diminish or modify protein activity. The aim of this study was to explore a novel approach for polymer-protein modification called polymer-masking-unmasking-protein therapy (PUMPT), the hypothesis being that conjugation of a biodegradable polymer to a protein would protect it and mask activity in transit, while enabling controlled reinstatement of activity at the target site by triggered degradation of the polymeric component. To test this hypothesis, dextrin (alpha-1,4 polyglucose, a natural polymer degraded by alpha-amylase) was conjugated to trypsin as a model enzyme or to melanocyte stimulating hormone (MSH) as a model receptor-binding ligand. The effect of dextrin molecular weight (7700, and 47200 g/mol) and degree of succinoylation (9-32 mol %) on its ability to mask/unmask trypsin activity was assessed using N-benzoyl-L-arginine-p-nitroanilide (L-BAPNA). Dextrin conjugation reduced enzyme activity by 34-69% depending on the molecular weight and degree of succinoylation of dextrin. However, incubation with alpha-amylase led to reinstatement of activity to a maximum of 92-115%. The highest molecular dextrin (26 mol % succinoylation) gave optimum trypsin masking-unmasking. This intermediate was used to synthesize a dextrin-MSH conjugate (dextrin Mw = 47200 g/mol; MSH content 37 wt %), and its biological activity (+/-alpha-amylase) was assessed by measuring melanin production by murine melanoma (B16F10) cells. Conjugation reduced melanin production to 11%, but addition of alpha-amylase was able to restore activity to 33% of the control value. These were the first studies to confirm the potential of PUMPT for further application to clinically important protein therapeutics. The

  15. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.

    PubMed

    Buisson, G; Duée, E; Haser, R; Payan, F

    1987-12-20

    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 A resolution. Role of calcium in structure and activity.

    PubMed Central

    Buisson, G; Duée, E; Haser, R; Payan, F

    1987-01-01

    The crystal structure of porcine pancreatic alpha-amylase (PPA) has been solved at 2.9 A resolution by X-ray crystallographic methods. The enzyme contains three domains. The larger, in the N-terminal part, consists of 330 amino acid residues. This central domain has the typical parallel-stranded alpha-beta barrel structure (alpha beta)8, already found in a number of other enzymes like triose phosphate isomerase and pyruvate kinase. The C-terminal domain forms a distinct globular unit where the chain folds into an eight-stranded antiparallel beta-barrel. The third domain lies between a beta-strand and a alpha-helix of the central domain, in a position similar to those found for domain B in triose phosphate isomerase and pyruvate kinase. It is essentially composed of antiparallel beta-sheets. The active site is located in a cleft within the N-terminal central domain, at the carboxy-end of the beta-strands of the (alpha beta)8 barrel. Binding of various substrate analogues to the enzyme suggests that the amino acid residues involved in the catalytic reaction are a pair of aspartic acids. A number of other residues surround the substrate and seem to participate in its binding via hydrogen bonds and hydrophobic interactions. The 'essential' calcium ion has been located near the active site region and between two domains, each of them providing two calcium ligands. On the basis of sequence comparisons this calcium binding site is suggested to be a common structural feature of all alpha-amylases. It represents a new type of calcium-protein interaction pattern.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 5. Fig. 7. PMID:3502087

  17. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): A review of clinical studies on weight loss and glycemic control

    PubMed Central

    2011-01-01

    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity. PMID:21414227

  18. A proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris): a review of clinical studies on weight loss and glycemic control.

    PubMed

    Barrett, Marilyn L; Udani, Jay K

    2011-03-17

    Obesity, and resultant health hazards which include diabetes, cardiovascular disease and metabolic syndrome, are worldwide medical problems. Control of diet and exercise are cornerstones of the management of excess weight. Foods with a low glycemic index may reduce the risk of diabetes and heart disease as well as their complications. As an alternative to a low glycemic index diet, there is a growing body of research into products that slow the absorption of carbohydrates through the inhibition of enzymes responsible for their digestion. These products include alpha-amylase and glucosidase inhibitors. The common white bean (Phaseolus vulgaris) produces an alpha-amylase inhibitor, which has been characterized and tested in numerous clinical studies. A specific and proprietary product named Phase 2® Carb Controller (Pharmachem Laboratories, Kearny, NJ) has demonstrated the ability to cause weight loss with doses of 500 to 3000 mg per day, in either a single dose or in divided doses. Clinical studies also show that Phase 2 has the ability to reduce the post-prandial spike in blood glucose levels. Experiments conducted incorporating Phase 2 into food and beverage products have found that it can be integrated into various products without losing activity or altering the appearance, texture or taste of the food. There have been no serious side effects reported following consumption of Phase 2. Gastro-intestinal side effects are rare and diminish upon extended use of the product. In summary, Phase 2 has the potential to induce weight loss and reduce spikes in blood sugar caused by carbohydrates through its alpha-amylase inhibiting activity.

  19. Double-sided staining with a gold probe and silver enhancement to detect alpha-amylase and sugar moieties in the mouse salivary glands.

    PubMed

    Menghi, G; Marchetti, L; Bondi, A M; Accili, D; Sabbieti, M G; Materazzi, G

    1999-07-01

    In the present study we report the development of an ultrastructural electron microscopic double-sided staining technique that, using gold probes of 10 nm and enhancement of the gold signal by silver amplification, allows the demonstration of two antigenic sites on the same section. The labeling was carried out in the following manner: one face of uncoated floating grids was incubated with an antibody directed to alpha-amylase, followed by a secondary gold-labeled antibody, amplification of gold particles, drying and carbon coating; subsequently, the reverse face of the same grid, was processed for lectin cytochemistry, with and without sialidase digestion, and it was incubated with HRP-conjugated lectins, anti-HRP antibody and protein-A gold. Also the reverse sequence of steps and amplification of gold signal after the first or second labeling were experimented. The resultant small and large particles revealed different distributional patterns of antigenic sites on the opposite faces of the same tissue section. The transparency of the resin-embedded ultrathin sections in the electron beam allowed the simultaneous visualization of the gold probes of different sizes present on the two faces. The analysis of immunolabeling revealed that the alpha-amylase is chiefly secreted by the parotid and submandibular glands. The application of this double-sided staining technique also indicated that, when present in glycosylated form, the alpha-amylase enzyme does not contain sialic acid in the submandibular and sublingual glands; conversely, its location on the electron-dense areas of target granules in the parotid acinar cells seems to suggest that a sialylated isoenzymatic form can occur within these granule regions where sialic, acid linked to beta-galactose, was found to be located.

  20. The effect of single and repeated bouts of prolonged cycling and circadian variation on saliva flow rate, immunoglobulin A and alpha-amylase responses.

    PubMed

    Li, Tzai-Li; Gleeson, Michael

    2004-01-01

    The purpose of this study was to establish the effect of exercise at different times of day on saliva flow rate, immunoglobulin A (sIgA) concentration and secretion rate, and alpha-amylase activity, and to establish how these parameters change following a second exercise bout performed on the same day. In a counterbalanced design, eight male volunteers participated in three experimental trials separated by at least 4 days. On the trial with afternoon exercise only, the participants cycled for 2 h at 60% VO2max starting at 14:00 h. On the other two trials, participants performed either two bouts of exercise at 60% VO2max for 2 h (the first started at 09:00 h and the second started at 14:00 h) or a separate resting trial. Unstimulated saliva samples were obtained 10 min before exercise, after 58 - 60 min and during the last 2 min of exercise, and at 1 h and 2 h after exercise. Venous blood samples were taken 5 min before exercise and immediately after exercise for both bouts. Participants remained fasted between 23:00 h on the day before the trials and 18:00 h on the day of the trial. Circadian variations were found in sIgA concentration, which decreased with time from its highest value in the early morning to its lowest value in the evening, and salivary alpha-amylase secretion rate, which increased from its lowest value in the morning to its highest value in the late afternoon. Cycling at 60% VO2max for 2 h significantly decreased saliva flow rate, increased sIgA concentration and alpha-amylase activity, but did not influence sIgA secretion rate. Performing prolonged cycling at different times of day did not differentially affect the salivary and plasma hormonal responses in the short term. Performance of a second prolonged exercise bout elicited a greater plasma stress hormone response but did not appear to compromise oral immunity acutely. These findings also suggest that, in terms of saliva secretion, sIgA and alpha-amylase responses, a 3 h rest is enough to

  1. New insights into the effectiveness of alpha-amylase enzyme presentation on the Bacillus subtilis spore surface by adsorption and covalent immobilization.

    PubMed

    Gashtasbi, Fatemeh; Ahmadian, Gholamreza; Noghabi, Kambiz Akbari

    2014-10-01

    Most of the studies in the field of enzyme immobilization have sought to develop a simple, efficient and cost-effective immobilization system. In this study, probiotic Bacillus spores were used as a matrix for enzyme immobilization, because of their inherent resistance to extreme temperatures, UV irradiation, solvents and drying. Above all, their preparation is cost-effective. The alpha-amylase enzyme was immobilized on the spore surface by the covalent and adsorption methods. For the covalent method, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N hydroxysulfosuccinimide (NHS) were used. The maximum concentration of the alpha-amylase immobilized by the two methods onto the spore surface was 360 μg/1.2×10(11) spore. However, maximum activity was achieved at an enzyme concentration of approximately 60 μg/.4×10(10), corresponding to an estimated activity of 8×10(3) IU mg(-1)/1.2×10(11) spore for covalent immobilization and 8.53×10(3) for the adsorption method. After washing the enzyme with 1M NaCl and 0.5% Triton X-100, the enzyme immobilization yield was estimated to be 77% and 20.07% for the covalent and adsorption methods, respectively. The alpha-amylase immobilized by both methods, displayed improved activity in the basic pH range. The optimum pH for the free enzyme was 5 while it shifted to 8 for the immobilized enzyme. The optimum temperatures for the free and immobilized enzymes were 60 °C and 80 °C, respectively. The covalently-immobilized alpha-amylase retained 65% of its initial activity, even after 10 times of recycling. The Km and Vmax values were determined by the GraphPad Prism software, which showed that the Vmax value decreased moderately after immobilization. This is the first study which reports the covalent immobilization of an enzyme on the spore surface. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Examining multiple sleep behaviors and diurnal salivary cortisol and alpha-amylase: Within- and between-person associations.

    PubMed

    Van Lenten, Scott A; Doane, Leah D

    2016-06-01

    Sleep has been linked to the daily patterns of stress-responsive physiological systems, specifically the hypothalamic-pituitary-adrenal (HPA) axis and autonomic nervous system (ANS). However, extant research examining sleep and diurnal patterns of cortisol, the primary end product of the HPA axis, has primarily focused on sleep duration with limited attention on other facets of sleep. For example, it is not clear how specific aspects of sleep (e.g., sleep quality, sleep duration variability) are related to specific components of diurnal cortisol rhythms. Salivary alpha-amylase (sAA) has been recognized as a surrogate marker of ANS activity, but limited research has explored relations between sleep and sAA diurnal rhythms. The current study utilized an ecological momentary assessment protocol to examine within- and between-person relations between several facets of sleep behavior using multiple methods (e.g., subjective report, actigraphy) and salivary cortisol and sAA. Older adolescents (N=76) provided saliva samples and diary entries five times per day over the course of three days. Sleep was assessed via questionnaire, through daily diaries, and monitored objectively using actigraphy over a four day period. Between-person results revealed that shorter average objective sleep duration and greater sleep duration variability were related to lower levels of waking cortisol and flatter diurnal slopes across the day. Within-person results revealed that on nights when individuals slept for shorter durations than usual they also had lower levels of waking cortisol the next day. Sleep was not related to the cortisol awakening response (CAR) or diurnal patterns of sAA, in either between-person or within-person analyses. However, typical sleep behaviors measured via questionnaire were related to waking levels of sAA. Overall, this study provides a greater understanding of how multiple components of sleep, measured in naturalistic environments, are related to cortisol and s

  3. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  4. Change in location and processing of inhibin alpha-subunit precursors during sexual maturation of the Djungarian hamster testis.

    PubMed

    Tuohimaa, P; Bläuer, M; Bergmann, M; Aumüller, G

    1993-02-01

    Immunohistochemical location and immunoblot of inhibin alpha-subunit peptides were analyzed in the testis of the Djungarian hamster from days 0-31 of postnatal development using a specific antibody. An intense immunoreaction was observed in the centrally located T1 prespermatogonia at day 0. The staining intensity decreased gradually in the spermatogonia when they make contact with the basal lamina at days 8-10. At days 13 and 15 there is no staining. Thereafter the immunoreactivity in Sertoli cells as well as in A spermatogonia gradually increased, being highest in sexually mature animals. The intensity of alpha-subunit staining in the seminiferous tubules was stage specific, being strongest at stages III and IV. Immunoblot analysis of testis homogenates with the anti-INH alpha 1-32 antibody showed several bands: 88K, 80K, and 43K in immature hamster testis (0-, 2-, 6-, 8-, or 10-day-old). In the adult hamster (31-day-old) 88K, 80K, 28K, and 20K bands were seen, but no 43K band. Dimeric inhibin was not detected. The 43-44K band most likely corresponds to the pro-alpha N alpha C, the 28K band to intermediate forms between alpha N alpha C and alpha C (alpha I alpha C), and the 20K band to mature alpha-subunit (alpha C). The shift from the immature pattern to mature occurs at about 20 days of age. Freezing of the samples was deleterious to alpha C, since it could be detected only in freshly homogenized samples. The results suggest that prespermatogonia produce predominantly monomeric alpha-subunit precursor pro-alpha N alpha C, whereas the mature Sertoli cells as well as A spermatogonia contain mainly monomeric alpha I alpha C. The alpha-inhibin precursors may act as auto-/paracrine regulators of spermatogenesis. Our results suggest that different alpha-subunit precursors, pro-alpha N alpha C and alpha I alpha C, might be involved in the differentiation and maintenance of spermatogenesis, respectively. The posttranslational processing of alpha-subunit precursors

  5. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  6. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  7. In silico analysis of the thermodynamic stability changes of psychrophilic and mesophilic alpha-amylases upon exhaustive single-site mutations.

    PubMed

    Gilis, Dimitri

    2006-01-01

    Identifying sequence modifications that distinguish psychrophilic from mesophilic proteins is important for designing enzymes with different thermodynamic stabilities and to understand the underlying mechanisms. The PoPMuSiC algorithm is used to introduce, in silico, all the single-site mutations in four mesophilic and one psychrophilic chloride-dependent alpha-amylases and to evaluate the changes in thermodynamic stability. The analysis of the distribution of the sequence positions that could be stabilized upon mutation shows a clear difference between the three domains of psychrophilic and mesophilic alpha-amylases. Most of the mutations stabilizing the psychrophilic enzyme are found in domains B and C, contrary to the mesophilic proteins where they are preferentially situated in the catalytic domain A. Moreover, the calculations show that the environment of some residues responsible for the activity of the psychrophilic protein has evolved to reinforce favorable interactions with these residues. In the second part, these results are exploited to propose rationally designed mutations that are predicted to confer to the psychrophilic enzyme mesophilic-like thermodynamic properties. Interestingly, most of the mutations found in domain C strengthen the interactions with domain A, in agreement with suggestions made on the basis of structural analyses. Although this study focuses on single-site mutations, the thermodynamic effects of the recommended mutations should be additive if the mutated residues are not close in space.

  8. Insecticidal effects of extracts of seven plant species on larval development, alpha-amylase activity and offspring production of Tribolium castaneum (Herbst) (Insecta: Coleoptera: Tenebrionidae).

    PubMed

    Jbilou, R; Amri, H; Bouayad, N; Ghailani, N; Ennabili, A; Sayah, F

    2008-03-01

    Bioinsecticidal effects of methanol extracts from seven plant species on Tribolium castaneum were investigated. Centaurium erythraea, Peganum harmala, Ajuga iva, Aristolochia baetica, Pteridium aquilinum and Raphanus raphanistrum extracts inhibit growth of larvae. C. erythraea was the most toxic with 63% mortality 10 days after treatment, followed by P. harmala with 58%. C. erythraea and P. aquilinum reduce the emergence rate respectively of 66% and 19%. The duration of larval period was shortened by Launaea arborescens, P. aquilinum and A. iva extracts, whereas R. raphanistrum and P. harmala extracts extend the larval period when compared to the control. Extracts of C. erythraea, P. harmala, A. iva and A. baetica inhibited F1 progeny production. Larvae possess three alpha-amylase isoforms as determined by SDS-PAGE. Larvae fed on treated diet had lower alpha-amylase activity than larvae feed on untreated diet. C. erythraea and P. harmala are the most potent extracts. These plant extracts could be useful to reduce seed damage caused by this pest species.

  9. Asymmetry in children's salivary cortisol and alpha-amylase in the context of marital conflict: links to children's emotional security and adjustment.

    PubMed

    Koss, Kalsea J; George, Melissa R W; Cummings, E Mark; Davies, Patrick T; El-Sheikh, Mona; Cicchetti, Dante

    2014-05-01

    Recent research supports the promise of examining interactive models of physiological processes on children's adjustment. The present study investigates interactions between children's autonomic nervous system activity and adrenocortical functioning in the context of marital discord; specifically, testing models of concurrent responses proposed by Bauer et al. ([2002] Developmental and Behavioral Pediatrics 23:102-113) in the prediction of children's behavioral responses to conflict and adjustment. Asymmetry and symmetry in children's salivary alpha-amylase and cortisol were examined in 195 children (M age = 8 years) in response to viewing conflict vignettes. Results were partially consistent with an interactive model in the context of high marital discord; asymmetry among higher alpha-amylase and lower cortisol related to higher emotional insecurity and concurrent and subsequent maladjustment. In contrast, patterns of symmetrical responses were related to greater maladjustment for children exposed to lower levels of marital discord, supporting an additive model. Findings support the importance of a multisystem approach to investigating the adaptiveness of children's physiological stress responses, while also highlighting the value of considering physiological responses in the context of family risk.

  10. Oligo-1,6-glucosidase and neopullulanase enzyme subfamilies from the alpha-amylase family defined by the fifth conserved sequence region.

    PubMed

    Oslancová, A; Janecek, S

    2002-11-01

    The alpha-amylase enzyme family is the largest family of glycoside hydrolases. It contains almost 30 different enzyme specificities covering hydrolases, transferases and isomerases. Some of the enzyme specificities from the family are closely related, others less so. This study, based on the analysis of 79 amino acid sequences, postulates two subfamilies in the framework of the aamylase family: the oligo-1,6-glucosidase subfamily and the neopullulanase subfamily. The specific sequence in the fifth conserved sequence region of the family served as the basis for defining the subfamilies: QpDln for the oligo-1,6-glucosidase subfamily and MPKln for the neopullulanase subfamily. This conserved sequence region is proposed to be the selection marker that enables one to distinguish between the two subfamilies. The 'intermediary' sequence MPDLN can be characteristic of the so-called intermediary group with a mixed enzyme specificity of alpha-amylase, cyclomaltodextrinase and neopullulanase. The evolutionary trees clearly supported the proposed definition of the two subfamilies.

  11. Safety evaluation of an alpha-amylase enzyme preparation derived from the archaeal order Thermococcales as expressed in Pseudomonas fluorescens biovar I.

    PubMed

    Landry, Timothy D; Chew, Lawrence; Davis, John W; Frawley, Nile; Foley, Holly H; Stelman, Steven J; Thomas, Johnson; Wolt, Jeffrey; Hanselman, David S

    2003-02-01

    BD5088 alpha-amylase derived from archaeal sources has characteristics of pH and temperature tolerance that are well suited to hydrolysis of starch in food processing applications. The production microorganism recipient strain, Pseudomonas fluorescens biovar I, strain MB101, was avirulent after oral administration to mice and does not represent an infectious threat to humans. Repeated dose gavage studies with BD5088 enzyme preparation, up to 13 weeks in duration, showed no systemic toxicity due to the oral route with an NOAEL of 890 mg/kg/day as Total Organic Solids. Some irritation occurred in the respiratory tract, which was considered to be a consequence of reflux and aspiration of test material that contained lipopolysaccharide from the Pseudomonas production strain. A 2-week dietary study (0 and 310 mg/kg/day) confirmed that there were no respiratory tract effects related to oral ingestion. There was no genotoxic activity based on Ames, mouse lymphoma, mouse micronucleus, and rat lymphocyte chromosomal aberration tests. There was no evidence of allergenic potential based on a comparison of the primary sequence of BD5088 with sequences in an allergen database. The enzyme was labile to pepsin digestion. Based on these data, BD5088 alpha-amylase preparation may be considered safe for use in food production such as corn wet milling. Copyright 2003 Elsevier Science (USA)

  12. Improving production of hyperthermostable and high maltose-forming alpha-amylase by an extreme thermophile Geobacillus thermoleovorans using response surface methodology and its applications.

    PubMed

    Uma Maheswar Rao, J L; Satyanarayana, T

    2007-01-01

    By cultivating Geobacillus thermoleovorans in shake flasks containing cane molasses medium at 70 degrees C, the fermentation variables were optimized by 'one variable at a time' approach followed by response surface methodology (RSM). The statistical model was obtained by central composite design (CCD) using three variables (cane-molasses, urea and inoculum density). An overall 1.6- and 2.1-fold increase in enzyme production was achieved in the optimized medium in shake flasks and fermenter, respectively. The alpha-amylase titre increased significantly in cane-molasses medium (60 U ml(-1)) as compared to that in the synthetic medium (26 U ml(-1)). Thus the cost of enzyme produced in cane molasses medium (0.823 euros per million U) was much lower than that produced in the synthetic starch-yeast extract-tryptone medium (18.52 euros per million U). The shelf life of bread was improved by supplementing dough with alpha-amylase, and thus, the enzyme was found to be useful in preventing the staling of bread. Reducing sugars liberated from 20% and 30% raw pearl millet starch were fermented to ethanol; ethanol production levels attained were 35.40 and 28.0 g l(-1), respectively.

  13. Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Both (Porcine and bacterial) starch degrading enzymes highly valued by the biotechnology industry. (Porcine) A major target for protein engineering and the study of diabetes, obesity and dental care. (Bacterial) Major industrial and biotechnology interest used in brewing, baking, and food processing. World's number one industrial protein.

  14. Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Both (Porcine and bacterial) starch degrading enzymes highly valued by the biotechnology industry. (Porcine) A major target for protein engineering and the study of diabetes, obesity and dental care. (Bacterial) Major industrial and biotechnology interest used in brewing, baking, and food processing. World's number one industrial protein.

  15. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents

    PubMed Central

    Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki′ 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia. PMID:26469405

  16. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents.

    PubMed

    Ponnusamy, Sudha; Haldar, Saikat; Mulani, Fayaj; Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki' 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia.

  17. Rat parotid gland amylase: evidence for alterations in an exocrine protein with increased age.

    PubMed

    Baum, B J; Levine, R L; Kuyatt, B L; Sogin, D B

    1982-05-01

    The content of alpha-amylase, the major exocrine secretory protein from rat parotid glands, was studied in young adult and aged rat tissue. alpha-Amylase protein was determined with an enzyme-linked immunosorbent assay. This employed antisera, produced against alpha-amylase purified from young adult rats, but which recognized and precipitated alpha-amylase enzyme activity equally well from both age groups. The parotid gland content of alpha-amylase was reduced about 50% in aged rats. Furthermore, the percentage of total gland protein which was alpha-amylase was decreased about 40% in aged animals. The data suggest that a somewhat specific alteration in alpha-amylase production (synthesis and/or degradation) occurs in parotid glands from aged rats. In addition, alpha-amylase functional activity was followed. The specific enzyme activity (U amylase activity per mg immunoreactive amylase) was about 35% higher in extracts from aged rat parotid glands compared to that of young adult glands.

  18. The 'pair of sugar tongs' site on the non-catalytic domain C of barley alpha-amylase participates in substrate binding and activity.

    PubMed

    Bozonnet, Sophie; Jensen, Morten T; Nielsen, Morten M; Aghajari, Nushin; Jensen, Malene H; Kramhøft, Birte; Willemoës, Martin; Tranier, Samuel; Haser, Richard; Svensson, Birte

    2007-10-01

    Some starch-degrading enzymes accommodate carbohydrates at sites situated at a certain distance from the active site. In the crystal structure of barley alpha-amylase 1, oligosaccharide is thus bound to the 'sugar tongs' site. This site on the non-catalytic domain C in the C-terminal part of the molecule contains a key residue, Tyr380, which has numerous contacts with the oligosaccharide. The mutant enzymes Y380A and Y380M failed to bind to beta-cyclodextrin-Sepharose, a starch-mimic resin used for alpha-amylase affinity purification. The K(d) for beta-cyclodextrin binding to Y380A and Y380M was 1.4 mm compared to 0.20-0.25 mm for the wild-type, S378P and S378T enzymes. The substitution in the S378P enzyme mimics Pro376 in the barley alpha-amylase 2 isozyme, which in spite of its conserved Tyr378 did not bind oligosaccharide at the 'sugar tongs' in the structure. Crystal structures of both wild-type and S378P enzymes, but not the Y380A enzyme, showed binding of the pseudotetrasaccharide acarbose at the 'sugar tongs' site. The 'sugar tongs' site also contributed importantly to the adsorption to starch granules, as Kd = 0.47 mg.mL(-1) for the wild-type enzyme increased to 5.9 mg.mL(-1) for Y380A, which moreover catalyzed the release of soluble oligosaccharides from starch granules with only 10% of the wild-type activity. beta-cyclodextrin both inhibited binding to and suppressed activity on starch granules for wild-type and S378P enzymes, but did not affect these properties of Y380A, reflecting the functional role of Tyr380. In addition, the Y380A enzyme hydrolyzed amylose with reduced multiple attack, emphasizing that the 'sugar tongs' participates in multivalent binding of polysaccharide substrates.

  19. In vitro alpha-amylase inhibition and in vivo antioxidant potential of Momordica dioica seeds in streptozotocin-induced oxidative stress in diabetic rats.

    PubMed

    Rao, P Sailaja; Mohan, G Krishna

    2017-09-01

    Momordica dioica Roxb. Commonly known as "Kakora" in Telugu, is used in the Indian traditional system of medicine for the treatment of diabetes. The aim of this study was to investigate the antidiabetic activity of methanolic extract of M. dioica seeds (MEMD) in streptozotocin (STZ) induced diabetic rats. The in vitro α-amylase inhibitory activity of the MEMD was done by spectrophotometric method. Diabetes was induced by STZ (45 mg/kg; i.p), MEMD (100 & 200 mg/kg; b.wt) and standard drug metformin (50 mg/kg; b.wt) were administered to the diabetic rats. Blood glucose was estimated on the 11th day and the level of MDA, SOD and CAT was estimated in the liver tissue homogenate after the 15 days of experimental period. MEMD showed significant inhibition of alpha amylase activity and the IC50 was found to be 48 μg/ml. Oral administration of MEMD significantly reduced blood glucose level (P < 0.05), diminished the MDA level and refurbished depleted antioxidant enzymes and Insulin level to normalcy. These findings revealed that M. dioica seeds possess antihyperglycemic, antioxidant and anti lipid peroxidative activity and thus mitigate STZ-induced oxidative damage.

  20. New approach for separating Bacillus subtilis metalloprotease and alpha-amylase by affinity chromatography and for purifying neutral protease by hydrophobic chromatography.

    PubMed

    Lauer, I; Bonnewitz, B; Meunier, A; Beverini, M

    2000-01-14

    Proteases are commonly used in the biscuit and cracker industry as processing aids. They cause moderate hydrolysis of gluten proteins and improve dough rheology to better control product texture and crunchiness. Commercial bacterial proteases are derived from Bacillus fermentation broth. As filtration and ultrafiltration are carried out as the only recovery steps, these preparations contain also alpha-amylase and beta-glucanase as the main side activities. The aim of this study is to purify and characterize the Bacillus subtilis metalloprotease from a commercial preparation, in order to study separately the impact of the protease activity with regards to its functionality on biscuit properties. Purification was achieved by means of affinity chromatography on Cibacron Blue and HIC as a polishing step. Affinity appeared to be the most appropriate matrix for large scale purification while ion exchange chromatography was inefficient in terms of recovery yields. The crude product was first loaded on a Hi Trap Blue column (34 microm, Pharmacia Biotech); elution was carried out with a gradient of NaCl in the presence of 1 mM ZnCl2. This step was only efficient in the presence of Zn cations, because this salt promoted both protease stabilization resulting in high recovery yields and also complexation of amylase units into dimers resulting in amylase retention on the column and a better separation of the 3 activities. Beta-glucanase was mostly non retained on the column and a part was coeluted with the protease. This protease fraction was then loaded on a Resource Phe column (15 microm, Pharmacia Biotech) in a