Science.gov

Sample records for measles vaccination laboratory

  1. Measles and Measles Vaccination: A Review.

    PubMed

    Bester, Johan Christiaan

    2016-12-01

    Measles is a highly communicable viral infection with serious complications. There have been continued outbreaks of measles in countries in which measles is considered to be eliminated, such as the United States and the Netherlands, and measles remains endemic in some countries. Health care professionals play an important role in diagnosing and managing acute cases of measles, preventing spread during outbreaks, and vaccination uptake. To provide an overview of measles and vaccination for health care professionals. MEDLINE and PubMed were searched from January 1, 1980, to April 30, 2016, in addition to the data repositories of the Centers for Disease Control and Prevention and World Health Organization. Seven systematic reviews, 15 reviews, 15 observational studies, 1 qualitative study, 5 epidemiologic reports, and 2 books were included, in addition to World Health Organization and Centers for Disease Control and Prevention data, position papers, and statements. Transmission of measles is dependent on person-to-person spread through respiratory droplets or direct contact. Diagnosis is based on recognizing the clinical picture and can be confirmed with results of laboratory testing, such as serologic tests or polymerase chain reaction. Measles infection leads to immune suppression for weeks to months. Complications of measles are of high frequency and severity. There is no specific antiviral treatment for measles; treatment with vitamin A is recommended for younger children to decrease mortality from measles. Vaccination against measles is effective, cost-effective, and safe. There is no link between the measles vaccination and autism. Measles can be eliminated from a population; this outcome requires coverage with 2 doses of vaccine at rates of 93% to 95% of the population. Countries with high rates of measles vaccination experience outbreaks by virtue of imported cases causing transmission through susceptible groups of individuals who are not immune to the measles

  2. Measles 50 Years After Use of Measles Vaccine.

    PubMed

    Goodson, James L; Seward, Jane F

    2015-12-01

    In response to severe measles, the first measles vaccine was licensed in the United States in 1963. Widespread use of measles vaccines for more than 50 years has significantly reduced global measles morbidity and mortality. However, measles virus continues to circulate, causing infection, illness, and an estimated 400 deaths worldwide each day. Measles is preventable by vaccine, and humans are the only reservoir. Clinicians should promote and provide on-time vaccination for all patients and keep measles in their differential diagnosis of febrile rash illness for rapid case detection, confirmation of measles infection, isolation, treatment, and appropriate public health response.

  3. Clinical safety issues of measles, mumps and rubella vaccines.

    PubMed

    Afzal, M A; Minor, P D; Schild, G C

    2000-01-01

    The clinical safety of measles and measles-mumps-rubella vaccines has been questioned in recent reports that propose a possible link between measles virus or measles vaccines and the occurrence of juvenile Crohn disease and autism. This article reviews the outcomes of several laboratory investigations which were carried out independently to identify the presence or absence of measles virus in the intestinal tissues derived from cases of inflammatory bowel disease. One research group reported the presence of measles virus particles and genomic RNA in inflammatory bowel disease tissues, but this could not be confirmed by other groups, despite use of techniques that are highly specific and sensitive for the detection of measles virus nucleic acid in clinical specimens down to the molecular level. Based on the published data reviewed here, it can be concluded that there is no direct association between measles virus or measles vaccines and the development of Crohn disease, a conclusion which is supported by most epidemiological findings.

  4. Measles vaccination before the measles-mumps-rubella vaccine.

    PubMed

    Hendriks, Jan; Blume, Stuart

    2013-08-01

    At the beginning of the 1960s, it was clear that a vaccine against measles would soon be available. Although measles was (and remains) a killer disease in the developing world, in the United States and Western Europe this was no longer so. Many parents and many medical practitioners considered measles an inevitable stage of a child's development. Debating the desirability of measles immunization, public health experts reasoned differently. In the United States, introduction of the vaccine fit well with Kennedy's and Johnson's administrations' political commitments. European policymakers proceeded cautiously, concerned about the acceptability of existing vaccination programs. In Sweden and the Netherlands, recent experience in controlling polio led researchers to prefer an inactivated virus vaccine. Although in the early 1970s attempts to develop a sufficiently potent inactivated vaccine were abandoned, we have argued that the debates and initiatives of the time during the vaccine's early history merit reflection in today's era of standardization and global markets.

  5. Measles.

    PubMed

    Rota, Paul A; Moss, William J; Takeda, Makoto; de Swart, Rik L; Thompson, Kimberly M; Goodson, James L

    2016-07-14

    Measles is an infectious disease in humans caused by the measles virus (MeV). Before the introduction of an effective measles vaccine, virtually everyone experienced measles during childhood. Symptoms of measles include fever and maculopapular skin rash accompanied by cough, coryza and/or conjunctivitis. MeV causes immunosuppression, and severe sequelae of measles include pneumonia, gastroenteritis, blindness, measles inclusion body encephalitis and subacute sclerosing panencephalitis. Case confirmation depends on clinical presentation and results of laboratory tests, including the detection of anti-MeV IgM antibodies and/or viral RNA. All current measles vaccines contain a live attenuated strain of MeV, and great progress has been made to increase global vaccination coverage to drive down the incidence of measles. However, endemic transmission continues in many parts of the world. Measles remains a considerable cause of childhood mortality worldwide, with estimates that >100,000 fatal cases occur each year. Case fatality ratio estimates vary from <0.01% in industrialized countries to >5% in developing countries. All six WHO regions have set goals to eliminate endemic transmission of MeV by achieving and maintaining high levels of vaccination coverage accompanied by a sensitive surveillance system. Because of the availability of a highly effective and relatively inexpensive vaccine, the monotypic nature of the virus and the lack of an animal reservoir, measles is considered a candidate for eradication.

  6. Measles, mumps, rubella (MMR) vaccine.

    PubMed

    Dubey, A P; Banerjee, S

    2003-07-01

    MMR is a live attenuated vaccine. Indian children show almost 90% seroconversion against measles and rubella and 90% against mumps. Several adverse effects have been reported. Epidemiological studies do not support a causative link between MMR and autism, IBD or GBS. There is an association between the Urabe strain of mumps vaccine and viral meningitis. Vaccine associated thrombocytopenia has been reported. Severe hypersensitivity reactions occur, mainly due to the gelatin component. Outbreaks of measles occur in areas of high measles vaccine coverage, when susceptible individuals accumulate. A second dose is given mainly to vaccinate those who missed the first dose or had primary vaccine failure, rather than to boost waning antibody levels. The possibility or eradication of mumps with a second dose of mumps vaccine is being considered.

  7. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Measles Vaccine. 113.313 Section 113.313 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture...

  8. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Measles Vaccine. 113.313 Section 113.313 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture...

  9. Perspective on Global Measles Epidemiology and Control and the Role of Novel Vaccination Strategies

    PubMed Central

    Coughlin, Melissa M.; Beck, Andrew S.; Bankamp, Bettina; Rota, Paul A.

    2017-01-01

    Measles is a highly contagious, vaccine preventable disease. Measles results in a systemic illness which causes profound immunosuppression often leading to severe complications. In 2010, the World Health Assembly declared that measles can and should be eradicated. Measles has been eliminated in the Region of the Americas, and the remaining five regions of the World Health Organization (WHO) have adopted measles elimination goals. Significant progress has been made through increased global coverage of first and second doses of measles-containing vaccine, leading to a decrease in global incidence of measles, and through improved case based surveillance supported by the WHO Global Measles and Rubella Laboratory Network. Improved vaccine delivery methods will likely play an important role in achieving measles elimination goals as these delivery methods circumvent many of the logistic issues associated with subcutaneous injection. This review highlights the status of global measles epidemiology, novel measles vaccination strategies, and describes the pathway toward measles elimination. PMID:28106841

  10. Perspective on Global Measles Epidemiology and Control and the Role of Novel Vaccination Strategies.

    PubMed

    Coughlin, Melissa M; Beck, Andrew S; Bankamp, Bettina; Rota, Paul A

    2017-01-19

    Measles is a highly contagious, vaccine preventable disease. Measles results in a systemic illness which causes profound immunosuppression often leading to severe complications. In 2010, the World Health Assembly declared that measles can and should be eradicated. Measles has been eliminated in the Region of the Americas, and the remaining five regions of the World Health Organization (WHO) have adopted measles elimination goals. Significant progress has been made through increased global coverage of first and second doses of measles-containing vaccine, leading to a decrease in global incidence of measles, and through improved case based surveillance supported by the WHO Global Measles and Rubella Laboratory Network. Improved vaccine delivery methods will likely play an important role in achieving measles elimination goals as these delivery methods circumvent many of the logistic issues associated with subcutaneous injection. This review highlights the status of global measles epidemiology, novel measles vaccination strategies, and describes the pathway toward measles elimination.

  11. Measles vaccination and inflammatory bowel disease: controversy laid to rest?

    PubMed

    Davis, R L; Bohlke, K

    2001-01-01

    The increasing incidence of Crohn's disease has lead to speculation about changes in exposures to environmental or infectious agents. Considerable attention has focused on the role of measles infection and/or vaccination in the pathogenesis of Crohn's disease and ulcerative colitis. Current evidence regarding the association between measles vaccination and inflammatory bowel disease (IBD) comprises analytic epidemiological studies, a case-series report and ecological studies. The first of these, a 1995 cohort study, found an association between measles vaccination and Crohn's disease and ulcerative colitis, but was widely questioned on methodological grounds. This was followed by a 1997 case-control study showing no association between measles vaccination and IBD. In 1998, public concern was rekindled by a report of 12 children with nonspecific colitis, ileal-lymphoid-nodular hyperplasia, and developmental disorders largely attributed to measles-mumps-rubella vaccine, but the nature of the report limited its scientific conclusions. Two additional studies, one case-control and one cohort, then followed and neither found an association with measles vaccination. Of the several ecological studies of measles vaccine coverage or measles schedule changes, none found an association with rates of IBD. The role of measles infection in IBD has been examined more extensively with studies of in utero measles exposure, measles infection early in life, and laboratory based investigations. An initial report of high rates of Crohn's disease among pregnancies affected by measles infection was followed by negative studies. Numerous case-control and ecological studies of children with measles infections early in life have also had discordant findings. Of three recent cohort studies, two showed no relationship between infection with early measles exposure and risk for IBD, while one found an approximate 3-fold elevation in risk. Laboratory investigations into persistent measles

  12. Measles Vaccination Before the Measles-Mumps-Rubella Vaccine

    PubMed Central

    Hendriks, Jan

    2013-01-01

    At the beginning of the 1960s, it was clear that a vaccine against measles would soon be available. Although measles was (and remains) a killer disease in the developing world, in the United States and Western Europe this was no longer so. Many parents and many medical practitioners considered measles an inevitable stage of a child’s development. Debating the desirability of measles immunization, public health experts reasoned differently. In the United States, introduction of the vaccine fit well with Kennedy’s and Johnson’s administrations’ political commitments. European policymakers proceeded cautiously, concerned about the acceptability of existing vaccination programs. In Sweden and the Netherlands, recent experience in controlling polio led researchers to prefer an inactivated virus vaccine. Although in the early 1970s attempts to develop a sufficiently potent inactivated vaccine were abandoned, we have argued that the debates and initiatives of the time during the vaccine’s early history merit reflection in today’s era of standardization and global markets. PMID:23763422

  13. Measles

    MedlinePlus

    ... measles protection is part of the measles-mumps-rubella vaccine (MMR) or measles-mumps-rubella-varicella vaccine (MMRV) given when they're 12 ... to Ease My Child's Fear of Shots? Encephalitis Rubella (German Measles) Your Child's Immunizations: Measles, Mumps & Rubella ...

  14. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Live Virus Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture fluids. Only Master Seed Virus which has been established as pure, safe, and immunogenic shall be used...

  15. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Live Virus Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture fluids. Only Master Seed Virus which has been established as pure, safe, and immunogenic shall be used...

  16. Clinical safety issues of measles, mumps and rubella vaccines.

    PubMed Central

    Afzal, M. A.; Minor, P. D.; Schild, G. C.

    2000-01-01

    The clinical safety of measles and measles-mumps-rubella vaccines has been questioned in recent reports that propose a possible link between measles virus or measles vaccines and the occurrence of juvenile Crohn disease and autism. This article reviews the outcomes of several laboratory investigations which were carried out independently to identify the presence or absence of measles virus in the intestinal tissues derived from cases of inflammatory bowel disease. One research group reported the presence of measles virus particles and genomic RNA in inflammatory bowel disease tissues, but this could not be confirmed by other groups, despite use of techniques that are highly specific and sensitive for the detection of measles virus nucleic acid in clinical specimens down to the molecular level. Based on the published data reviewed here, it can be concluded that there is no direct association between measles virus or measles vaccines and the development of Crohn disease, a conclusion which is supported by most epidemiological findings. PMID:10743285

  17. Arthritis after mumps and measles vaccination.

    PubMed Central

    Nussinovitch, M; Harel, L; Varsano, I

    1995-01-01

    Measles, mumps, and rubella vaccine carries a risk of joint symptoms particularly in children under 5 years. A boy who presented with an inflamed knee after measles and mumps vaccination is reported; synovial fluid aspirated from the joint contained 4.3 x 10(9)/l leucocytes. It is thought that the mumps component is the aetiological cause of acute monoarthritis. PMID:7763072

  18. NLM Grantee's "HealthMap" Helps Uncover Measles Vaccination Gap

    MedlinePlus

    ... of NLM NLM Grantee's "HealthMap" Helps Uncover Measles Vaccination Gap Inadequate vaccine coverage is likely a driving ... stop this and future measles outbreaks is through vaccination." The research indicates that vaccine coverage among the ...

  19. Laboratory confirmation of rubella infection in suspected measles cases.

    PubMed

    Vaidya, Sunil R; Raut, Chandrashekhar G; Jadhav, Santoshkumar M

    2016-10-01

    As a part of measles outbreak based surveillance undertaken by the World Health Organization India, suspected measles cases were referred for the laboratory diagnosis at National Institute of Virology (NIV) Pune and NIV Unit Bengaluru. Altogether, 4,592 serum samples were referred during 2010-2015 from the States of Karnataka (n = 1,173), Kerala (n = 559), and Maharashtra (n = 2,860). Initially, serum samples were tested in measles IgM antibody EIA and samples with measles negative and equivocal results (n = 1,954) were subjected to rubella IgM antibody detection. Overall, 62.9% (2,889/4,592) samples were laboratory confirmed measles, 27.7% (542/1,954) were laboratory confirmed rubella and remaining 25.2% (1,161/4,592) were negative for measles and rubella. The measles vaccination status was available for 1,206 cases. Among the vaccinated individuals, 50.7% (612/1,206) were laboratory confirmed measles. The contribution of laboratory confirmed measles was 493 (40.8%) from Maharashtra, 90 (7.5%) from Karnataka, and 29 (2.4%) from Kerala. Since, 1/3rd of suspected measles cases were laboratory confirmed rubella, an urgent attention needed to build rubella surveillance in India. Additional efforts are required to rule out other exanthematous disease including Dengue and Chikungunya in measles and rubella negatives. J. Med. Virol. 88:1685-1689, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. [Optimal age for vaccination against measles].

    PubMed

    José, M V; Kumate, J

    1989-01-01

    A review of the general aspects of the transmission dynamics of measles is presented. Similarities and differences in the patterns of transmission of measles in developed and developing countries are pointed out. Epidemiological, demographic and nutritional variables relevant to the design of an immunization program are briefly discussed. Since there is no cohort in developing countries in which most individuals are susceptible, it is concluded that there is no single optimum age at which to vaccinate against measles. Finally, a simple method based upon case notification records, for calculating the force and average age of infection as well as the optimum age for vaccination against measles is illustrated.

  1. Factors Influencing University Nursing Students' Measles Vaccination Rate During a Community Measles Outbreak.

    PubMed

    Kim, Ji Soo; Choi, Jeong Sil

    2016-03-01

    The purpose of this study was to survey the current state of measles vaccination in university nursing students during a measles outbreak and to identify factors influencing nursing students' vaccination rate. In 2014, this study used a self-administered questionnaire to survey 380 university nursing students. Factors influencing measles vaccination were identified through logistic regression analysis using variables between the vaccinated and nonvaccinated groups. Measles vaccination rate was 52.1%. The vaccination rate was significantly higher in juniors, seniors, and those who had heard about measles. In relation to health beliefs, the measles vaccination rate was higher when perceived benefits were high and perceived barriers were low. A systematic measles vaccination program targeting nursing students upon their entry to university is needed. In order to increase the measles vaccination rate, application of effective promotion campaigns and education programs is necessary. Copyright © 2016. Published by Elsevier B.V.

  2. Measles and measles vaccination in an African village*

    PubMed Central

    Morley, David C.; Woodland, Margaret; Krugman, Saul; Friedman, Harriet; Grab, Bernard

    1964-01-01

    Over the last five years, a number of reports have appeared drawing attention to the serious results of measles in young West African children. This is borne out by observations over a three-year period on children in the village of Imesi, which showed measles to be a severe and often fatal disease. The original live attenuated measles vaccine developed by Enders has been shown to give good protection and, in combination with immune serum, has been widely used in the USA. However, the need to combine it with immune serum severely limits its usefulness, owing to the small quantities of serum available and the high cost. In the present study, the reaction produced by the original vaccine with immune serum was compared with the reaction produced by a further attenuated vaccine without serum. The latter gave significantly fewer and less severe reactions, but produced a satisfactory serological response. This new vaccine should facilitate large-scale immunization of children in areas such as West Africa where protection against measles is urgently required. PMID:14196817

  3. Measles, immune suppression and vaccination: direct and indirect nonspecific vaccine benefits.

    PubMed

    Mina, Michael J

    2017-06-01

    The measles virus is among the most transmissible viruses known to infect humans. Prior to measles vaccination programs, measles infected over 95% of all children and was responsible for over 4 million deaths each year. Measles vaccination programs have been among the greatest public health achievements reducing, eliminating endemic measles in the whole of the Americas and across much of the globe. Where measles vaccines are introduced, unexpectedly large reductions in all-cause childhood mortality have been observed. These gains appear to derive in part from direct heterologous benefits of measles vaccines that enhance innate and adaptive immune responses. Additionally, by preventing measles infections, vaccination prevents measles-associated short- and long-term immunomodulating effects. Before vaccination, these invisible hallmarks of measles infections increased vulnerability to non-measles infections in nearly all children for weeks, months, or years following acute infections. By depleting measles incidence, vaccination has had important indirect benefits to reduce non-measles mortality. Delineating the relative importance of these two modes of survival benefits following measles vaccine introduction is of critical public health importance. While both support continued unwavering global commitments to measles vaccination programs until measles eradication is complete, direct heterologous benefits of measles vaccination further support continued commitment to measles vaccination programs indefinitely. We discuss what is known about direct and indirect nonspecific measles vaccine benefits, and their implications for continued measles vaccination programs. © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  4. [Costs and benefits of measles vaccination].

    PubMed

    Ambrosch, F; Wiedermann, G; Harasek, G

    1978-02-23

    Former calculations of the medical benefit of measles immunization, concerning frequency of measles complications, effectiveness and risk of vaccination, showed that measles vaccination is a very useful measure. As the decision to introduce vaccination on a broad scale depends on financial deliberations, too, a cost-benefit analysis for Austria has been performed and the cost-benefit ratio as well as the cost-benefit difference calculated. The costs of measles vaccination which is performed mainly by private pediatricians at the present time, include costs of vaccine, physician and additional antipyretic and is 257.90 AS. The average costs of therapy per child consist of home treatment (287.20 AS), hospital treatment (162.50 AS) and care of residual cerebral damage (88.50 AS). Together with the costs of one week vacation which is warranted in Austria for the nursing of a sick child once a year, this makes a total sum of 1081.--AS. From these data the cost-benefit ratio was calculated by 2.95, the cost-benefit difference by 715.--AS per child. 5 years after the start of general measles vaccination of 1 year old children the accumulated costs of vaccination are equalled by the profit gained by prevention of the disease. The annual cost-benefit difference is positive after 3 years. 10 years after introduction of general vaccination the accumulated cost-benefit difference in Austria would be approximately 167 Mill. AS.

  5. Measles

    MedlinePlus

    ... stop it in its tracks. Doctors call this "herd immunity." Measles isn't very common, but it is ... t get the vaccine get some protection through herd immunity. During a measles outbreak, some people who haven' ...

  6. Measles

    MedlinePlus

    ... it in its tracks. Doctors call this "herd immunity." Measles isn't very common, but it is ... get the vaccine get some protection through herd immunity. During a measles outbreak, some people who haven' ...

  7. Measles

    MedlinePlus

    ... Fear of Shots? Encephalitis Rubella (German Measles) Your Child's Immunizations: Measles, Mumps & Rubella Vaccine (MMR) Immunization Schedule Frequently Asked Questions About Immunizations Your Child's Immunizations Contact Us Print Resources Send to a Friend ...

  8. Measles vaccination using a microneedle patch.

    PubMed

    Edens, Chris; Collins, Marcus L; Ayers, Jessica; Rota, Paul A; Prausnitz, Mark R

    2013-07-25

    Measles vaccination programs would benefit from delivery methods that decrease cost, simplify logistics, and increase safety. Conventional subcutaneous injection is limited by the need for skilled healthcare professionals to reconstitute and administer injections, and by the need for safe needle handling and disposal to reduce the risk of disease transmission through needle re-use and needlestick injury. Microneedles are micron-scale, solid needles coated with a dry formulation of vaccine that dissolves in the skin within minutes after patch application. By avoiding the use of hypodermic needles, vaccination using a microneedle patch could be carried out by minimally trained personnel with reduced risk of blood-borne disease transmission. The goal of this study was to evaluate measles vaccination using a microneedle patch to address some of the limitations of subcutaneous injection. Viability of vaccine virus dried onto a microneedle patch was stabilized by incorporation of the sugar, trehalose, and loss of viral titer was less than 1 log10(TCID50) after storage for at least 30 days at room temperature. Microneedle patches were then used to immunize cotton rats with the Edmonston-Zagreb measles vaccine strain. Vaccination using microneedles at doses equaling the standard human dose or one-fifth the human dose generated neutralizing antibody levels equivalent to those of a subcutaneous immunization at the same dose. These results show that measles vaccine can be stabilized on microneedles and that vaccine efficiently reconstitutes in vivo to generate a neutralizing antibody response equivalent to that generated by subcutaneous injection.

  9. Measles vaccination using a microneedle patch☆

    PubMed Central

    Edens, Chris; Collins, Marcus L.; Ayers, Jessica; Rota, Paul A.; Prausnitz, Mark R.

    2013-01-01

    Measles vaccination programs would benefit from delivery methods that decrease cost, simplify logistics, and increase safety. Conventional subcutaneous injection is limited by the need for skilled healthcare professionals to reconstitute and administer injections, and by the need for safe needle handling and disposal to reduce the risk of disease transmission through needle re-use and needlestick injury. Microneedles are micron-scale, solid needles coated with a dry formulation of vaccine that dissolves in the skin within minutes after patch application. By avoiding the use of hypodermic needles, vaccination using a microneedle patch could be carried out by minimally trained personnel with reduced risk of blood-borne disease transmission. The goal of this study was to evaluate measles vaccination using a microneedle patch to address some of the limitations of subcutaneous injection. Viability of vaccine virus dried onto a microneedle patch was stabilized by incorporation of the sugar, trehalose, and loss of viral titer was less than 1 log10(TCID50) after storage for at least 30 days at room temperature. Microneedle patches were then used to immunize cotton rats with the Edmonston-Zagreb measles vaccine strain. Vaccination using microneedles at doses equaling the standard human dose or one-fifth the human dose generated neutralizing antibody levels equivalent to those of a subcutaneous immunization at the same dose. These results show that measles vaccine can be stabilized on microneedles and that vaccine efficiently reconstitutes in vivo to generate a neutralizing antibody response equivalent to that generated by subcutaneous injection. PMID:23044406

  10. Measles epidemic from 1951 to 2012 and vaccine effectiveness in Guangzhou, Southern China

    PubMed Central

    Yang, Zhicong; Xu, Jianxiong; Wang, Ming; Di, Biao; Tan, Huifeng; He, Qing; Cai, Yanshan; Liang, Jianhua; Hu, Wensui; Dong, Zhiqiang; Yang, Yunqing; Fu, Chuanxi

    2014-01-01

    Background Since the National Expanded Program on Immunization was implemented in China, considerable progress has been made in reducing the incidence of measles. However, the incidence of measles increased again in 2004. Few post-marketing studies on measles vaccine effectiveness were reported in China. In this study, we aimed to describe the measles epidemic and to evaluate the effectiveness of the measles vaccine in Guangzhou, southern China. Methods Based on the surveillance data for measles, we investigated the epidemiology during different periods between 1951 and 2012. We analyzed the clinical characteristics of laboratory-confirmed cases of measles between 2009 and 2012 and conducted a case-control study using test-negative cases as controls. We determined the protective effect of measles vaccine. Results The highest annual incidence in Guangzhou was 2187.15/100 000 in 1964, and the lowest was 0.32/100 000 in 2011. The average incidence of measles from 1951 to 2012 was 306.27/100 000. There was a significant tendency of decline in recent years. From 2009 to 2012, there are 700 laboratory-confirmed cases reported with an average onset age of 2.5 (median) years. The non-vaccinated target population (age <8 months and ≥15 years) accounted for 56.7% of the cases. The transient (non-resident) population accounted for 51.3% of the cases. Fewer cases were observed in the population targeted for measles vaccine (aged 8 months to 14 years). The effectiveness of a single dose of the measles vaccine was 89.1% (95% confidence interval (CI), 44.5–97.9), and the effectiveness of ≥2 doses of the measles vaccine was 97.8% (95% CI, 88.3–99.6) in children aged 8 months to 14 years old. Conclusions There is a significant overall decline in the incidence of measles (including clinical and laboratory confirmed cases) in the measles vaccine targeted population in Guangzhou. Two doses of measles vaccine are more effective than one dose in preventing measles in China

  11. The impact of declining vaccination coverage on measles control: a case study of Abia state Nigeria.

    PubMed

    Umeh, Chukwuemeka Anthony; Ahaneku, Hycienth Peterson

    2013-01-01

    Efforts at immunizing children against measles was intensified in Nigeria with nation-wide measles vaccination campaigns in 2005-2006, 2008 and 2011 targeting children between 9 and 59 months. However, there were measles outbreaks in 2010 and 2011 in Abia state Nigeria. This study seeks to find out if there is any association between measles immunization coverage and measles outbreak. This is a descriptive analysis of the 2007 to 2011 Abia state measles case-based surveillance data supplied to Abia state World Health Organization office and Abia State Ministry of Health by the disease surveillance and notification officers. As the proportion of cases with febrile rash who were immunized decreased from 81% in 2007 to 42% in 2011, the laboratory confirmed cases of measles increased from two in 2007 to 53 in 2011.Of the laboratory confirmed cases of measles, five (7%) occurred in children < 9 months, 48 (64%) occurred in children 9-59 months and 22 (29%) occurred in children < 59 months old. Seventy five percent of all laboratory confirmed cases of measles occurred in rural areas. Efforts should be made to increase measles immunization in children between 9 and 59 months as most cases of measles occurred in this age group as immunization coverage dropped. In addition, further studies should be carried out to determine the cause of the disproportional incidence of measles in rural areas in Abia state bearing in mind that measles immunization coverage in urban and rural areas was not markedly different.

  12. Measles.

    PubMed

    Moss, William J

    2017-06-30

    Measles is a highly contagious disease that results from infection with measles virus and is still responsible for more than 100 000 deaths every year, down from more than 2 million deaths annually before the introduction and widespread use of measles vaccine. Measles virus is transmitted by the respiratory route and illness begins with fever, cough, coryza, and conjunctivitis followed by a characteristic rash. Complications of measles affect most organ systems, with pneumonia accounting for most measles-associated morbidity and mortality. The management of patients with measles includes provision of vitamin A. Measles is best prevented through vaccination, and the major reductions in measles incidence and mortality have renewed interest in regional elimination and global eradication. However, urgent efforts are needed to increase stagnating global coverage with two doses of measles vaccine through advocacy, education, and the strengthening of routine immunisation systems. Use of combined measles-rubella vaccines provides an opportunity to eliminate rubella and congenital rubella syndrome. Ongoing research efforts, including the development of point-of-care diagnostics and microneedle patches, will facilitate progress towards measles elimination and eradication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Measles vaccination and prevention in big cities in China.

    PubMed

    Meina, Li; Xiaodong, Liu; Lulu, Zhang

    2015-01-01

    Despite the tremendous progress in controlling measles in China, there was measles outbreak in Beijing which was a result of cluster of unvaccinated people or people failure to vaccinate. In order to accelerate measles control efforts and achieve and high levels of measles immunity, it is helpful to implement more targeted management strategy.

  14. Measles in the United Kingdom 1990-2008 and the effectiveness of measles vaccines.

    PubMed

    Jick, Hershel; Hagberg, Katrina Wilcox

    2010-06-23

    We identified all children in the UK General Practice Research Database diagnosed with measles from 1990 to 2008 and calculated annual incidence according to age and geographic region by dividing the number of cases per year by the number of children who were active in the population. We evaluated the effectiveness of the measles vaccines by comparing the vaccination histories of children who were diagnosed with measles (cases) to children who were not (controls). The annual incidence of measles fell after the introduction of the MMR vaccine in late 1988. However, a modest outbreak of measles occurred in 1994, leading to large nationwide programs to immunize children. Since 1996, the incidence of measles has fallen by more than 80%. Prior measles vaccination is highly effective and has substantially reduced the risk of measles.

  15. The perilous path to a better measles vaccine.

    PubMed

    Minor, P D

    1992-10-01

    Despite a global child immunization coverage of higher than 80%, 29 million children per year are infected with measles, of whom more than 1 million die as a result. The measles vaccines currently in use worldwide are live attenuated viruses which infect recipients without causing disease and which, when used properly, prevent disease due to natural measles viruses. However, the natural immunity to measles which a child acquires from his or her mother at birth can prevent infection by these vaccines. Children in developed countries are therefore given measles vaccine at age 12 months or later, by which time they have lost their maternally acquired immunity. In developing countries, however, where measles transmission can be intense and the risk of infection is generally higher than in developed countries, the World Health Organization (WHO) recommends measles vaccination at age 9 months. A measles vaccine which could be administered at age 2-6 months would prevent measles in very young children and enable measles vaccination to fit readily into existing Expanded Program on Immunization schedules for that age group. Possible approaches to achieving measles immunization at a very young age include the use of high-titre live virus vaccines or nonliving or inactivated vaccine strains. For a number of reasons, however, WHO now recommends that high-titre measles vaccines be dropped from routine immunization programs.

  16. Expansion of syndromic vaccine preventable disease surveillance to include bacterial meningitis and Japanese encephalitis: Evaluation of adapting polio and measles laboratory networks in Bangladesh, China and India, 2007–2008

    PubMed Central

    Cavallaro, Kathleen F.; Sandhu, Hardeep S.; Hyde, Terri B.; Johnson, Barbara W.; Fischer, Marc; Mayer, Leonard W.; Clark, Thomas A.; Pallansch, Mark A.; Yin, Zundong; Zuo, Shuyan; Hadler, Stephen C.; Diorditsa, Serguey; Hasan, A.S.M. Mainul; Bose, Anindya S.; Dietz, Vance

    2016-01-01

    Background Surveillance for acute flaccid paralysis with laboratory confirmation has been a key strategy in the global polio eradication initiative, and the laboratory platform established for polio testing has been expanded in many countries to include surveillance for cases of febrile rash illness to identify measles and rubella cases. Vaccine-preventable disease surveillance is essential to detect outbreaks, define disease burden, guide vaccination strategies and assess immunization impact. Vaccines now exist to prevent Japanese encephalitis (JE) and some etiologies of bacterial meningitis. Methods We evaluated the feasibility of expanding polio–measles surveillance and laboratory networks to detect bacterial meningitis and JE, using surveillance for acute meningitis-encephalitis syndrome in Bangladesh and China and acute encephalitis syndrome in India. We developed nine syndromic surveillance performance indicators based on international surveillance guidelines and calculated scores using supervisory visit reports, annual reports, and case-based surveillance data. Results Scores, variable by country and targeted disease, were highest for the presence of national guidelines, sustainability, training, availability of JE laboratory resources, and effectiveness of using polio–measles networks for JE surveillance. Scores for effectiveness of building on polio–measles networks for bacterial meningitis surveillance and specimen referral were the lowest, because of differences in specimens and techniques. Conclusions Polio–measles surveillance and laboratory networks provided useful infrastructure for establishing syndromic surveillance and building capacity for JE diagnosis, but were less applicable for bacterial meningitis. Laboratory-supported surveillance for vaccine-preventable bacterial diseases will require substantial technical and financial support to enhance local diagnostic capacity. PMID:25597940

  17. Expansion of syndromic vaccine preventable disease surveillance to include bacterial meningitis and Japanese encephalitis: evaluation of adapting polio and measles laboratory networks in Bangladesh, China and India, 2007-2008.

    PubMed

    Cavallaro, Kathleen F; Sandhu, Hardeep S; Hyde, Terri B; Johnson, Barbara W; Fischer, Marc; Mayer, Leonard W; Clark, Thomas A; Pallansch, Mark A; Yin, Zundong; Zuo, Shuyan; Hadler, Stephen C; Diorditsa, Serguey; Hasan, A S M Mainul; Bose, Anindya S; Dietz, Vance

    2015-02-25

    Surveillance for acute flaccid paralysis with laboratory confirmation has been a key strategy in the global polio eradication initiative, and the laboratory platform established for polio testing has been expanded in many countries to include surveillance for cases of febrile rash illness to identify measles and rubella cases. Vaccine-preventable disease surveillance is essential to detect outbreaks, define disease burden, guide vaccination strategies and assess immunization impact. Vaccines now exist to prevent Japanese encephalitis (JE) and some etiologies of bacterial meningitis. We evaluated the feasibility of expanding polio-measles surveillance and laboratory networks to detect bacterial meningitis and JE, using surveillance for acute meningitis-encephalitis syndrome in Bangladesh and China and acute encephalitis syndrome in India. We developed nine syndromic surveillance performance indicators based on international surveillance guidelines and calculated scores using supervisory visit reports, annual reports, and case-based surveillance data. Scores, variable by country and targeted disease, were highest for the presence of national guidelines, sustainability, training, availability of JE laboratory resources, and effectiveness of using polio-measles networks for JE surveillance. Scores for effectiveness of building on polio-measles networks for bacterial meningitis surveillance and specimen referral were the lowest, because of differences in specimens and techniques. Polio-measles surveillance and laboratory networks provided useful infrastructure for establishing syndromic surveillance and building capacity for JE diagnosis, but were less applicable for bacterial meningitis. Laboratory-supported surveillance for vaccine-preventable bacterial diseases will require substantial technical and financial support to enhance local diagnostic capacity. Published by Elsevier Ltd.

  18. [Measles, mumps, and rubella vaccine. Resurgence of measles in Europe].

    PubMed

    Garcés-Sánchez, María; Renales-Toboso, María; Bóveda-García, María; Díez-Domingo, Javier

    2015-12-01

    Measles is a rash illness of moderate severity and high risk of serious complications, with recovery in several weeks. It is a viral disease caused by one of the most infectious and contagious pathogens that exists, whose only known reservoir is human. In 1998, the European Region of the WHO set a target of eliminating measles by 2010. This goal has not been achieved. Furthermore, it has been observed the resurgence of the disease in some parts of Europe. We review the disease and its vaccines as well as the epidemiological and social factors that have so far prevented the total control of the disease. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. Genetic characterization of measles vaccine strains.

    PubMed

    Bankamp, Bettina; Takeda, Makoto; Zhang, Yan; Xu, Wenbo; Rota, Paul A

    2011-07-01

    The complete genomic sequences of 9 measles vaccine strains were compared with the sequence of the Edmonston wild-type virus. AIK-C, Moraten, Rubeovax, Schwarz, and Zagreb are vaccine strains of the Edmonston lineage, whereas CAM-70, Changchun-47, Leningrad-4 and Shanghai-191 were derived from 4 different wild-type isolates. Nucleotide substitutions were found in the noncoding regions of the genomes as well as in all coding regions, leading to deduced amino acid substitutions in all 8 viral proteins. Although the precise mechanisms involved in the attenuation of individual measles vaccines remain to be elucidated, in vitro assays of viral protein functions and recombinant viruses with defined genetic modifications have been used to characterize the differences between vaccine and wild-type strains. Although almost every protein contributes to an attenuated phenotype, substitutions affecting host cell tropism, virus assembly, and the ability to inhibit cellular antiviral defense mechanisms play an especially important role in attenuation.

  20. Epidemiology of laboratory confirmed measles virus cases in the southern nations of Ethiopia, 2007-2014.

    PubMed

    Getahun, Mekonen; Beyene, Berhane; Ademe, Ayesheshem; Teshome, Birke; Tefera, Mesfin; Afework, Aklog; HaileMariam, Yoseph; Assefa, Esete; Hailegiorgis, Yonas; Asha, Anjelo

    2017-01-19

    In Ethiopia, measles case-based surveillance was introduced in 2004 as one strategy for measles control by laboratory confirmation of suspected cases. In this article, epidemiological distribution of laboratory-confirmed measles cases were reported from the Southern Nation Nationalities and Peoples Region (SNNPR) of Ethiopia between 2007 and 2014, as the region is one of the highly measles affected areas in Ethiopia. A serum sample was collected from all measles suspected cases, and patient information was captured by case reporting format (CRF). Samples were transported to the National Measles Laboratory for Measles IgM testing by ELISA technique. Data entry and analysis were done using Epi-Info 3.5.4 software. A total of 4810 samples were tested for measles IgM using ELISA technique and 1507 (31.3%) were found positive during 2007-2014 in SNNPR of Ethiopia. Patients with age 1-4 years were the most affected regardless of sex. The incidence of measles confirmed cases increased from 15 in 2007 to 180 in 2013 per million population. The highest percentage of laboratory-confirmed cases were found in 2014. Measles was found distributed throughout the regional state. Measles was found a public health important disease in SNNPR of Ethiopia, mostly affecting children 1-4 years. The incidence of measles cases is increasing from time to time. Additional research to determine the genotype of circulating measles virus, knowledge, attitude and practice of professionals and the population for measles vaccination and infection in the region is important. A wide age group measles vaccination campaign is highly recommended.

  1. Measles Virus Infection Among Vaccinated and Unvaccinated Children in Nigeria

    PubMed Central

    Adeniji, Johnson A.; Olusola, Babatunde A.; Motayo, Babatunde O.; Akintunde, Grace B.

    2015-01-01

    Abstract This study investigated measles infection in vaccinated and unvaccinated children presenting with fever and maculopapular rash during measles outbreaks in the southern and western states of Nigeria. Measles, an acute viral illness caused by a virus in the family Paramyxoviridae, is a vaccine-preventable disease. Measles outbreak is common in Nigeria, despite the national immunization program. Children presenting with symptoms of measles infection in general hospitals and health centers in the states of southern and western Nigeria were recruited for this study. Vaccination history, clinical details, and 5 mL of blood were obtained from the children. Their sera samples were screened for specific immunoglobulin M antibodies to measles virus. Of 234 children tested (124 [53.2%] female), 133 (56.8%) had previously been vaccinated against measles virus, while 93 (39.7%) had not been vaccinated. Vaccination information for eight children could not be retrieved. One hundred and forty-three (62.4%) had measles IgM antibodies. Of these, 79 (55.3%) had been vaccinated for measles, while 65 (44.7%) had not. Despite the ongoing vaccination program in Nigeria, a high number of children are still being infected with measles, despite their vaccination status. Therefore, there is need to identify the reason for the low level of vaccine protection. PMID:26102341

  2. Progress towards Rapid Detection of Measles Vaccine Strains: a Tool To Inform Public Health Interventions.

    PubMed

    Hacker, Jill K

    2017-03-01

    Rapid differentiation of vaccine from wild-type strains in suspect measles cases is a valuable epidemiological tool that informs the public health response to this highly infectious disease. Few public health laboratories sequence measles virus-positive specimens to determine genotype, and the vaccine-specific real-time reverse transcriptase PCR (rRT-PCR) assay described by F. Roy et al. (J. Clin. Microbiol. 55:735-743, 2017, https://doi.org/10.1128/JCM.01879-16) offers a rapid, easily adoptable method to identify measles vaccine strains in suspect cases. Copyright © 2017 American Society for Microbiology.

  3. Progress towards Rapid Detection of Measles Vaccine Strains: a Tool To Inform Public Health Interventions

    PubMed Central

    2016-01-01

    ABSTRACT Rapid differentiation of vaccine from wild-type strains in suspect measles cases is a valuable epidemiological tool that informs the public health response to this highly infectious disease. Few public health laboratories sequence measles virus-positive specimens to determine genotype, and the vaccine-specific real-time reverse transcriptase PCR (rRT-PCR) assay described by F. Roy et al. (J. Clin. Microbiol. 55:735–743, 2017, https://doi.org/10.1128/JCM.01879-16) offers a rapid, easily adoptable method to identify measles vaccine strains in suspect cases. PMID:28003421

  4. Variability in Humoral Immunity to Measles Vaccine: New Developments

    PubMed Central

    Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Whitaker, Jennifer A.; Poland, Gregory A.

    2015-01-01

    Despite the existence of an effective measles vaccine, resurgence in measles cases in the United States and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms, provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination. PMID:26602762

  5. [Safety and tolerability of monovalent measles and combined measles, mumps, rubella, and varicella vaccines].

    PubMed

    Mentzer, D; Meyer, H; Keller-Stanislawski, B

    2013-09-01

    Although effective monovalent and combined measles vaccines have been available for several decades in Germany, measles outbreaks continue to occur leading to severe cases of measles and even death. Possible reasons for the low acceptance of the measles vaccination are concerns about adverse events and serious complications following vaccination. In this report, we have summarized and assessed all adverse events reported in Germany from 2001 to 2012 after vaccination with monovalent- and combined measles-containing vaccines. A total of 1,696 suspected adverse reaction reports describing 5,297 adverse events were sent to the Paul Ehrlich Institute (PEI) between 1 January 2001 and 31 December 2012. The calculated mean reporting rate was 5.7 reports per 100,000 vaccine doses released by the PEI. Analysis of the reports indicates that measles-containing vaccines are well tolerated with a constantly low rate of adverse events reported. Compared to the high rate of serious complications following wild-type measles infection, the benefit of measles-containing vaccines clearly outweighs the anticipated risks of adverse events.

  6. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  7. Measles

    MedlinePlus

    ... protects against measles, mumps, and rubella, can cause autism. Parents and caregivers should know that: Large studies ... no connection between this or any vaccine and autism. Reviews by all major health organizations in the ...

  8. The laboratory confirmation of suspected measles cases in settings of low measles transmission: conclusions from the experience in the Americas.

    PubMed Central

    Dietz, Vance; Rota, Jennifer; Izurieta, Héctor; Carrasco, Peter; Bellini, William

    2004-01-01

    The Americas have set a goal of interrupting indigenous transmission of measles using a strategy developed by the Pan American Health Organization (PAHO). This strategy includes recommendations for vaccination activities to achieve and sustain high immunity in the population and is complemented by sensitive epidemiological surveillance systems developed to monitor illnesses characterized by febrile rash, and to provide effective virological and serological surveillance. A key component in ensuring the success of the programme has been a laboratory network comprising 22 national laboratories including reference centres. Commercially available indirect enzyme immunoassay kits (EIA) for immunoglobulin M (IgM)-class antibodies are currently being used throughout the region. However, because there are few or no true measles cases in the region, the positive predictive value of these diagnostic tests has decreased. False-positive results of IgM tests can also occur as a result of testing suspected measles cases with exanthemata caused by Parvovirus B19, rubella and Human herpesvirus 6, among others. In addition, as countries maintain high levels of vaccination activity and increased surveillance of rash and fever, the notification of febrile rash illness in recently vaccinated people can be anticipated. Thus, managers in the measles elimination programme must be prepared to address the interpretation of a positive result of a laboratory test for measles IgM when clinical and epidemiological data may indicate that the case is not measles. The interpretation of an IgM-positive test under different circumstances and the definition of a vaccine-related rash illness in a setting of greatly reduced, or absent, transmission of measles is discussed. PMID:15640921

  9. Laboratory confirmation of measles in elimination settings: experience from the Republic of the Marshall Islands, 2003

    PubMed Central

    Nandy, Robin; Hickman, Carole J; Langidrik, Justina R; Strebel, Peter M; Papania, Mark J; Seward, Jane F; Bellini, William J

    2009-01-01

    Abstract Objective To highlight the complications involved in interpreting laboratory tests of measles immunoglobulin M (IgM) for confirmation of infection during a measles outbreak in a highly vaccinated population after conducting a mass immunization campaign as a control measure. Methods This case study was undertaken in the Republic of the Marshall Islands during a measles outbreak in 2003, when response immunization was conducted. A measles case was defined as fever and rash and one or more of cough, coryza or conjunctivitis. Between 13 July and 7 November 2003, serum samples were obtained from suspected measles cases for serologic testing and nasopharyngeal swabs were taken for viral isolation by reverse transcriptase polymerase chain reaction (RT–PCR). Findings Specimens were collected from 201 suspected measles cases (19% of total): of the ones that satisfied the clinical case definition, 45% were IgM positive (IgM+) and, of these, 24% had received measles vaccination within the previous 45 days (up to 45 days after vaccination an IgM+ result could be due to either vaccination or wild-type measles infection). The proportion of IgM+ results varied with clinical presentation, the timing of specimen collection and vaccination status. Positive results on RT–PCR occurred in specimens from eight IgM-negative and four IgM+ individuals who had recently been vaccinated. Conclusion During measles outbreaks, limiting IgM testing to individuals who meet the clinical case definition and have not been recently vaccinated allows for measles to be confirmed while conserving resources. PMID:19274360

  10. Measles vaccination response during Kosi floods, Bihar, India 2008.

    PubMed

    Varkey, Sherin; Krishna, Gopal; Pradhan, Narottam; Gupta, Satish Kumar; Caravotta, Jorge; Hombergh, Henri Vanden; Hoekstra, Edward; Askari, Sufia; Kansal, O P

    2009-11-01

    The Kosi floods of Bihar in 2008 led to initial rapid displacement followed by rehabilitation of the affected population. Strategically planned phase-wise activity of supplementary as well as primary measles vaccination combined with a variety of other interventions proved to be successful in preventing outbreaks and deaths due to measles. While 70% supplementary measles vaccination coverage was achieved in relief camps, the coverage of primary measles doses in the latter phases was dependant on accessibility of villages and previous vaccination status of eligible beneficiaries. The integrated diseases surveillance system, which became operational during the floods, also complemented the vaccination efforts by providing daily figures of cases with fever and rash. The overall response was not only successful in terms of preventing measles mortality, but also provided vital lessons that may be useful for planning future vaccination responses in emergency settings.

  11. A short clinical review of vaccination against measles

    PubMed Central

    Barlow, Gavin; Metcalfe, Neil H

    2014-01-01

    Major epidemics of measles are again in the news across the UK because of our failure to maintain population herd immunity. This situation has occurred primarily because of a loss of public confidence in the measles, mumps and rubella (MMR) vaccine, which was never restored following the Wakefield debacle, and a lack of awareness of the potential morbidity and mortality associated with measles. This article provides healthcare professionals with a succinct overview of important clinical aspects of measles and also describes the history of measles vaccination in the UK. Restoration of herd immunity will require higher public acceptance of the MMR vaccine in the context of recognition that measles remains an important infection. While achievement of this appears to be challenging, recent UK-based research suggests that it can be ascertained. PMID:25057386

  12. Measles seroprevalence, outbreaks, and vaccine coverage in Rwanda.

    PubMed

    Seruyange, Eric; Gahutu, Jean-Bosco; Mambo Muvunyi, Claude; Uwimana, Zena G; Gatera, Maurice; Twagirumugabe, Theogene; Katare, Swaibu; Karenzi, Ben; Bergström, Tomas

    2016-01-01

    Measles outbreaks are reported after insufficient vaccine coverage, especially in countries recovering from natural disaster or conflict. We compared seroprevalence to measles in blood donors in Rwanda and Sweden and explored distribution of active cases of measles and vaccine coverage in Rwanda. 516 Rwandan and 215 Swedish blood donors were assayed for measles-specific immunoglobulin G (IgG) by enzyme-linked immunosorbent assay (ELISA). Data on vaccine coverage and acute cases in Rwanda from 1980 to 2014 were collected, and IgM on serum samples and polymerase chain reaction (PCR) on nasopharyngeal (NPH) swabs from suspected measles cases during 2010-2011 were analysed. The seroprevalence of measles IgG was significantly higher in Swedish blood donors (92.6%; 95% CI: 89.1-96.1%) compared to Rwandan subjects (71.5%; 95% CI: 67.6-75.4%) and more pronounced <35 years of age. The OD values were significantly lower in the Rwandan blood donors as compared to Swedish subjects (p < 0.00001). However, effective measles vaccine coverage was concomitant with decrease in measles cases in Rwanda, with the exception of an outbreak in 1995 following the 1994 genocide. 76/544 serum samples were IgM positive and 21/31 NPH swabs were PCR positive for measles, determined by sequencing to be of genotype B3. Measles seroprevalence was lower in Rwandan blood donors compared to Swedish subjects. Despite this, the number of reported measles cases in Rwanda rapidly decreased during the study period, concomitant with increased vaccine coverage. Taken together, the circulation of measles was limited in Rwanda and vaccine coverage was favourable, but seroprevalence and IgG levels were low especially in younger age groups.

  13. Will Synergizing Vaccination with Therapeutics Boost Measles Virus Eradication?

    PubMed Central

    Plemper, Richard K; Hammond, Anthea L

    2014-01-01

    Introduction Measles virus is a major human pathogen responsible for approximately 150,000 measles deaths annually. The disease is vaccine preventable and eradication of the virus is considered feasible in principle. However, a herd immunity exceeding 95% is required to prevent sporadic viral outbreaks in a population. Declining disease prevalence combined with public anxieties about vaccination safety has increased vaccine refusal especially in the European region, which has resulted in measles resurgence in some areas. Areas covered Here, we discuss whether synergizing effective measles therapeutics with vaccination could contribute to solving an endgame conundrum of measles elimination by accelerating the eradication effort. Based on an anticipated use for protection of high-risk contacts of confirmed measles cases through post-exposure prophylaxis, we identify key elements of the desirable drug profile, review current disease management strategies and the state of experimental inhibitor candidates, evaluate the risk associated with viral escape from inhibition, and consider the potential of measles therapeutics for the management of persistent viral infection of the CNS. Assuming a post-measles world with waning measles immunity, we contemplate the possible impact of therapeutics on controlling the threat imposed by closely related zoonotic pathogens of the same genus as measles virus. Expert opinion Efficacious therapeutics given for post-exposure prophylaxis of high-risk social contacts of confirmed index cases may aid measles eradication by closing herd immunity gaps due to vaccine refusal or failure in populations with overall good vaccination coverage. The envisioned primarily prophylactic application of measles therapeutics to a predominantly pediatric and/or adolescent patient population dictates the drug profile; the article must be safe and efficacious, orally available, shelf-stable at ambient temperature, and amenable to cost-effective manufacture

  14. [The running status of Chinese Measles Laboratory Network in 2008].

    PubMed

    Zhang, Yan; Xu, Song-Tao; Jiang, Xiao-Hong

    2009-04-01

    To evaluate the running status of Measles laboratory network of China (Hong Kong, Macao and Taiwan were excluded) in 2008. To analyze the database of Measles laboratory network surveillance of the year 2008, and the database of serologic and virologic surveillance of National laboratory for Measles in Chinese Centers for Disease Control and Prevention(CCDC), then the indicators of the running of Measles laboratory network of China were analyzed. 1, serologic surveillance: 107,160 Measles sera samples were collected between Feburary and September of 2008, and the collection rate was 77.93%; 53 778 samples were qualified and positive for IgM, the positive percentage was 50.2%. 2, Virologic surveillance: 287 Measles viral isolates were isolated by 18 provincial Measles laboratories in 2008, all were certified as H1a genotype, H1a genotype was still the predominant genotype circulating in China; 29 Rubella viral isolates were isolated by 4 provincial Measles laboratories in 2008, all belonged to 1E genotype. 3, Laboratory quality control: National laboratory for Measles passed the proficiency test and on-site review in 2008; all provincial Measles laboratories passed the sera samples recheck and proficiency test hold by National laboratory for Measles in 2008; Tianjin, Shanxi, Shandong, Zhejiang, Jilin, Hubei, provincial Measles laboratory passed the on-site review by WHO. The running status of Chinese Measles laboratory network was good in 2008, and good laboratory quality control system was also set up, methods such as specimens collection, serologic detection, cell culture and viral isolation, etc, were standardized, and applied to Chinese Measles laboratory network, and it provided important scientific basis for eradication Measles in the year of 2012.

  15. [Measles].

    PubMed

    Stock, Ingo

    2009-04-01

    Measles are a systemic infectious disease caused by a single stranded ribonucleic acid virus (measles virus) from the paramyxovirus family. Typically, the disease is characterized by a two-phase course. After an average incubation period of 8 to 11 days, initial symptoms such as fever, cough, coryza and conjunctivitis appear. Two thirds of the patients shows a white-marked enanthema on the buccal mucosa (Koplik's spots). After disappearance of these symptoms, a second increase of temperature and the typical measles exanthema, a brownish-red maculopapular rash, appear. Infection with measles virus induces transient immunodeficiency that favours the formation of several complications. Some of them, e. g. encephalitic diseases, are severe and associated with a high mortality. Measles are world-wide distributed and belong to the ten most frequent infectious diseases in some less developed countries. The disease is associated with a high mortality in some African and South-East Asian countries, in particular in children aged less than 12 months. Of particular note, measles are the most important cause of blindness in children in population with borderline vitamin A status. In Germany, the number of reported measles cases has been declined dramatically since the introduction of a vaccine more than four decades ago. However, regional outbreaks or small epidemics still occur. Because there is no specific antiviral treatment, therapy of measles is symptomatic and depends on the manifestation of the disease. The most important prevention strategy is immunization with a life-attenuated vaccine that can be applied as monovaccination or in combination with mumps and rubella virus (MMR vaccination) or mumps, rubella and varicella virus (MMRV vaccination).

  16. Accuracy of parent-reported measles-containing vaccination status of children with measles.

    PubMed

    Liu, G; Liao, Z; Xu, X; Liang, Y; Xiong, Y; Ni, J

    2017-03-01

    The validity of parent-reported measles-containing vaccination history in children with measles has not been assessed. This study evaluated the accuracy of parental recall of measles-containing vaccination histories in Shenzhen, China. A retrospective study was performed to compare the data from the electronic records with parental recall. The electronic records were regarded as accurate data about the children's measles-containing vaccination status. We collected data from the National Notifiable Diseases Surveillance System and the Immunization Program Information Management System in Shenzhen city, China. Between 2009 and 2014, there were 163 children with measles who had electronic vaccination records; the vaccination status of these cases was reported by the parents in the field epidemiological investigation. We validated parental recall with electronic records. The agreement between parental recall and electronic records was 78.7%. The kappa value was 0.57. The parent-reported measles-containing vaccination rate was higher than the electronic record (48.5% vs 41.7%, χ(2) = 53.64, P < 0.001). The true positive rate for parental recall was 82.4%, and the true negative rate was 75.8%. The positive predictive value was 70.9%, and the negative predictive value was 76.6%. In children with measles, parental recall slightly overestimated the measles vaccination rate, and the vaccination status recalled by parents was in moderate agreement with the electronic record. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  17. Measles vaccination of macaques by dry powder inhalation.

    PubMed

    de Swart, Rik L; LiCalsi, Cynthia; Quirk, Alan V; van Amerongen, Geert; Nodelman, Vladislav; Alcock, Robert; Yüksel, Selma; Ward, Gary H; Hardy, John G; Vos, Helma; Witham, Clyde L; Grainger, Christopher I; Kuiken, Thijs; Greenspan, Bernard J; Gard, Trevor G; Osterhaus, Albert D M E

    2007-01-26

    Measles vaccination via the aerosol route has proven effective under field conditions, using vaccine reconstituted prior to nebulization. Inhalation of a dry powder aerosol vaccine would have additional benefits, including easier logistics of administration, reduced cold chain dependence and the potential of single dose administration. We have evaluated two candidate dry powder measles vaccine formulations in macaques. Specific immune responses were demonstrated, but levels of immunity were lower than in animals vaccinated by injection or by nebulized aerosol. These studies provide proof of principle that dry powder inhalation is a possible route for measles vaccination, but suggest that either the vaccine formulation or the method of delivery need to be improved for a better immune response.

  18. Effectiveness of Early Measles, Mumps, and Rubella Vaccination Among 6-14-Month-Old Infants During an Epidemic in the Netherlands: An Observational Cohort Study.

    PubMed

    Woudenberg, Tom; van der Maas, Nicoline A T; Knol, Mirjam J; de Melker, Hester; van Binnendijk, Rob S; Hahné, Susan J M

    2017-04-15

    Routinely, the first measles, mumps, and rubella (MMR) vaccine dose is given at 14 months of age in the Netherlands. However, during a measles epidemic in 2013-2014, MMR vaccination was also offered to 6-14-month-olds in municipalities with <90% MMR vaccination coverage. We studied the effectiveness of the early MMR vaccination schedule. Parents of all infants targeted for early MMR vaccination were asked to participate. When parent(s) suspected measles, their infant's saliva was tested for measles-specific antibodies. The vaccine effectiveness (VE) against laboratory-confirmed and self-reported measles was estimated using Cox regression, with VE calculated as 1 minus the hazard ratio. Three vaccinated and 10 unvaccinated laboratory-confirmed cases occurred over observation times of 106631 and 23769 days, respectively. The unadjusted VE against laboratory-confirmed measles was 94% (95% confidence interval [CI], 79%-98%). After adjustment for religion and sibling's vaccination status, the VE decreased to 71% (-72%-95%). For self-reported measles, the unadjusted and adjusted VE was 67% (40%-82%) and 43% (-12%-71%), respectively. Infants vaccinated between 6 and 14 months of age had a lower risk of measles than unvaccinated infants. However, part of the effect was caused by herd immunity, since vaccinated infants were more likely to be surrounded by other vaccinated individuals.

  19. Global Measles and Rubella Laboratory Network Support for Elimination Goals, 2010-2015.

    PubMed

    Mulders, Mick N; Rota, Paul A; Icenogle, Joseph P; Brown, Kevin E; Takeda, Makoto; Rey, Gloria J; Ben Mamou, Myriam C; Dosseh, Annick R G A; Byabamazima, Charles R; Ahmed, Hinda J; Pattamadilok, Sirima; Zhang, Yan; Gacic-Dobo, Marta; Strebel, Peter M; Goodson, James L

    2016-05-06

    In 2012, the World Health Assembly endorsed the Global Vaccine Action Plan (GVAP)* with the objective to eliminate measles and rubella in five World Health Organization (WHO) regions by 2020. In September 2013, countries in all six WHO regions had established measles elimination goals, and additional goals for elimination of rubella and congenital rubella syndrome were established in three regions (1). Capacity for surveillance, including laboratory confirmation, is fundamental to monitoring and verifying elimination. The 2012-2020 Global Measles and Rubella Strategic Plan of the Measles and Rubella Initiative(†) calls for effective case-based surveillance with laboratory testing for case confirmation (2). In 2000, the WHO Global Measles and Rubella Laboratory Network (GMRLN) was established to provide high quality laboratory support for surveillance (3). The GMRLN is the largest globally coordinated laboratory network, with 703 laboratories supporting surveillance in 191 countries. During 2010-2015, 742,187 serum specimens were tested, and 27,832 viral sequences were reported globally. Expansion of the capacity of the GMRLN will support measles and rubella elimination efforts as well as surveillance for other vaccine-preventable diseases (VPDs), including rotavirus, and for emerging pathogens of public health concern.

  20. Epidemiology of laboratory confirmed measles virus cases in Amhara Regional State of Ethiopia, 2004-2014.

    PubMed

    Getahun, Mekonen; Beyene, Berhane; Ademe, Ayesheshem; Teshome, Birke; Tefera, Mesfin; Asha, Anjelo; Afework, Aklog; HaileMariyam, Yoseph; Assefa, Esete; Gallagher, Kathleen

    2016-03-22

    Measles is a highly contagious viral infection causing large outbreaks all over the world. Despite the availability of safe and cost effective vaccine, measles remained endemic with persistent periodic outbreaks in the Horn of Africa. The aim of this study is to characterize laboratory confirmed measles cases in Amhara Regional State, which was one of the highly affected regions in Ethiopia. A suspected measles case was defined as any person presenting with fever, maculopapular rash and one or more of the three symptoms cough, coryza or conjunctivitis or a patient in whom a clinician suspects measles. A blood sample was collected for any measles suspected patient with a case based investigation form and specimen transported to the National Measles Laboratory in good condition where it was to be tested for Measles IgM antibody by ELISA technique. Data was entered and analyzed using Epi-Info 3.5.4 software. A total of 6579 samples were tested for measles IgM among 7296 samples collected in Amhara Regional State over 11 years (2004-2014). Of the tested samples, 2412 (36.7%) were found positive, while 3965 and 202 samples were found to be negative and equivocal (compatible) respectively. Patients with age ≥ 10 years were the most affected. The highest number of laboratory confirmed measles cases were detected in 2014 and cases were occurred in all of the 11 zones of the state. A seasonal peak was noted in the hot-dry season of the year. Measles remains to be a public health problem in Amhara Regional State of Ethiopia, mostly affecting people ≥ 10 years of age. Measles virus was detected in all zones of the state, reaching its peak in the hot-dry season. To reduce the incidence of measles, it is highly recommended to improve routine immunization, and conduct a wide age group campaign. Additional research to evaluate the knowledge, attitudes and practices of the general population and health care professionals about measles infection and vaccination is important

  1. [Study of measles history, vaccination, antibody status, and vaccination effectiveress for school teachers].

    PubMed

    Ichinohe, Sadato; Ogawa, Tomoko

    2011-05-01

    To determine an efficient measles vaccination program for school teachers, we studied knowledge about measles history, immunization, and immunity status among 269 school teachers in Ichihara City in 2009. We found that (1) many are uncertain about disease and immunization history, with neither history related to the immunity status of neutralizing antibody titer (NT), (2) particle agglutination (PA) and enzyme immunoassay (EIA) testing have replaced NT in commercial laboratories, but persons having antibodies fewer than 8-fold of the NT titer as a sensitivity desigration for measles, and 11 false-positive immunity results are indicated in PA testing (cutoff: 256-fold) and 140 false-positive sensitivity results in EIA testing (cutoff: 16.0 EIA), and (3) sensitivity cases are 7.1% in the naturally infected generation born before 1977 and 23.7% in the vaccinated generation born after 1978. Given "herd" immunity, we concluded that all vaccinated-generation persons should be administered additional vaccination regardless of sensitivity due to history, immunization, and PA or EIA antibody testing.

  2. Measles in Morocco: epidemiological profile and impact of vaccination strategy.

    PubMed

    Cheikh, Amine; Ziani, Mouncif; Cheikh, Zakia; Barakat, Amina; El Menzhi, Omar; Braikat, Mohammed; Benomar, Ali; Cherrah, Yahya; El Hassani, Amine

    2015-02-01

    Measles continues to persist as one of the leading causes of infant mortality due to preventable diseases through vaccination. This study aims to highlight measles in Morocco, and to present the vaccination strategy implemented to control and eliminate the disease in this country. Throughout this study, and based on data from the Directorate of Epidemiology and Control of Diseases and those of the Directorate of Population, we present an overview on the epidemiological trends of measles from 1997 to 2012, while evoking the plans established by the Ministry of Health (MoH) for the control and elimination of this disease. The number of measles cases has decreased in Morocco between 1997 and 2012 (2574-720 reported cases per year) as a result of four important steps: first, increasing the routine vaccination coverage (73-94%); second, the introduction of the second dose of the combined vaccine against measles and rubella in schools (children aged 6 years) since 2003; third, the first catch-up campaign of vaccination in Morocco in 2008, for which coverage was highly satisfactory (96% and 100% for age groups 5-59 months and 5-14 years, respectively); and fourth, the organization of a mass vaccination campaign in 2013 that targeted children from aged 9 months to 19 years. The vaccination plan and the surveillance system executed in Morocco within the framework of the regional project implemented by the World Health Organization (WHO) to eliminate measles has given remarkable results regarding the reduction of measles cases and mortality due to this disease. According to the data from MoH and WHO, the number of reported and confirmed measles cases decreased drastically during 2014. However, these efforts are still unsatisfactory compared to the prospective of eliminating the disease by 2015.

  3. Adding interventions to mass measles vaccinations in India

    PubMed Central

    Verguet, Stéphane; Morris, Shaun K; Sharma, Jitendar K; Ram, Usha; Gauvreau, Cindy; Jones, Edward; Jha, Prabhat; Jit, Mark

    2016-01-01

    Abstract Objective To quantify the impact on mortality of offering a hypothetical set of technically feasible, high-impact interventions for maternal and child survival during India’s 2010–2013 measles supplementary immunization activity. Methods We developed Lives Saved Tool models for 12 Indian states participating in the supplementary immunization, based on state- and sex-specific data on mortality from India’s Million Deaths Study and on health services coverage from Indian household surveys. Potential add-on interventions were identified through a literature review and expert consultations. We quantified the number of lives saved for a campaign offering measles vaccine alone versus a campaign offering measles vaccine with six add-on interventions (nutritional screening and complementary feeding for children, vitamin A and zinc supplementation for children, multiple micronutrient and calcium supplementation in pregnancy, and free distribution of insecticide-treated bednets). Findings The measles vaccination campaign saved an estimated 19 016 lives of children younger than 5 years. A hypothetical campaign including measles vaccine with add-on interventions was projected to save around 73 900 lives (range: 70 200–79 300), preventing 73 700 child deaths (range: 70 000–79 000) and 300 maternal deaths (range: 200–400). The most effective interventions in the whole package were insecticide-treated bednets, measles vaccine and preventive zinc supplementation. Girls accounted for 66% of expected lives saved (12 712/19 346) for the measles vaccine campaign, and 62% of lives saved (45 721/74 367) for the hypothetical campaign including add-on interventions. Conclusion In India, a measles vaccination campaign including feasible, high-impact interventions could substantially increase the number of lives saved and mitigate gender-related inequities in child mortality. PMID:27843161

  4. Recombinant measles AIK-C vaccine strain expressing heterologous virus antigens.

    PubMed

    Nakayama, Tetsuo; Sawada, Akihito; Yamaji, Yoshiaki; Ito, Takashi

    2016-01-04

    Further attenuated measles vaccines were developed more than 50 years ago and have been used throughout the world. Recombinant measles vaccine candidates have been developed and express several heterologous virus protective antigens. Immunogenicity and protective actions were confirmed using experimental animals: transgenic mice, cotton rats, and primates. The recent development of measles vaccine-based vectored vaccine candidates has been reviewed and some information on recombinant measles vaccines expressing respiratory syncytial virus proteins has been shown and discussed.

  5. Laboratory diagnosis of measles infection and monitoring of measles immunization: memorandum from a WHO meeting.

    PubMed Central

    1994-01-01

    Measles infection continues to be a major global health problem, and in many countries the disease is frequently diagnosed on clinical grounds alone, although it is easily confused with other conditions. In order to discuss approaches to improving this situation, a WHO Consultation on Laboratory Diagnosis of Measles Infection and Monitoring of Measles Immunization was held in Glasgow on 7-8 August 1993. The discussions and recommendations made by the participants are summarized in this Memorandum. PMID:8205639

  6. A game dynamic model for vaccine skeptics and vaccine believers: measles as an example.

    PubMed

    Shim, Eunha; Grefenstette, John J; Albert, Steven M; Cakouros, Brigid E; Burke, Donald S

    2012-02-21

    Widespread avoidance of Measles-Mumps-Rubella vaccination (MMR), with a consequent increase in the incidence of major measles outbreaks, demonstrates that the effectiveness of vaccination programs can be thwarted by the public misperceptions of vaccine risk. By coupling game theory and epidemic models, we examine vaccination choice among populations stratified into two behavioral groups: vaccine skeptics and vaccine believers. The two behavioral groups are assumed to be heterogeneous with respect to their perceptions of vaccine and infection risks. We demonstrate that the pursuit of self-interest among vaccine skeptics often leads to vaccination levels that are suboptimal for a population, even if complete coverage is achieved among vaccine believers. The demand for measles vaccine across populations driven by individual self-interest was found to be more sensitive to the proportion of vaccine skeptics than to the extent to which vaccine skeptics misperceive the risk of vaccine. Furthermore, as the number of vaccine skeptics increases, the probability of infection among vaccine skeptics increases initially, but it decreases once the vaccine skeptics begin receiving the vaccination, if both behavioral groups are vaccinated according to individual self-interest. Our results show that the discrepancy between the coverages of measles vaccine that are driven by self-interest and those driven by population interest becomes larger when the cost of vaccination increases. This research illustrates the importance of public education on vaccine safety and infection risk in order to maintain vaccination levels that are sufficient to maintain herd immunity.

  7. The strategy for prevention of measles and rubella prevalence with measles-rubella (MR) vaccine in Japan.

    PubMed

    Ihara, Toshiaki

    2009-05-21

    To eliminate the indigenous measles and rubella virus by 2012 in Japan, the strategy fro prevention of measles and rubella prevalence with measles-rubella (MR) vaccine was proposed. Since the vast majority of 1-year old infants are susceptible to measles and rubella, the first MR vaccine, the first MR vaccine should be administered at 1-year old to sustain the herd immunity. Since significant elevation of measles and rubella antibody titers were eliminated in a half of children after the second dose, the second dose of of MR vaccine within 1 year before elementary school entry is the effective maneuver. Moreover, supplement MR vaccination to the teenage group and 20-29 years' group might be necessary, because the mean measles antibody titers in this group were significantly lower compared with those in the older individuals' groups.

  8. Measles vaccination in the presence or absence of maternal measles antibody: impact on child survival.

    PubMed

    Aaby, Peter; Martins, Cesário L; Garly, May-Lill; Andersen, Andreas; Fisker, Ane B; Claesson, Mogens H; Ravn, Henrik; Rodrigues, Amabelia; Whittle, Hilton C; Benn, Christine S

    2014-08-15

    Measles vaccine (MV) has a greater effect on child survival when administered in early infancy, when maternal antibody may still be present. To test whether MV has a greater effect on overall survival if given in the presence of maternal measles antibody, we reanalyzed data from 2 previously published randomized trials of a 2-dose schedule with MV given at 4-6 months and at 9 months of age. In both trials antibody levels had been measured before early measles vaccination. In trial I (1993-1995), the mortality rate was 0.0 per 1000 person-years among children vaccinated with MV in the presence of maternal antibody and 32.3 per 1000 person-years without maternal antibody (mortality rate ratio [MRR], 0.0; 95% confidence interval [CI], 0-.52). In trial II (2003-2007), the mortality rate was 4.2 per 1000 person-years among children vaccinated in presence of maternal measles antibody and 14.5 per 1000 person-years without measles antibody (MRR, 0.29; 95% CI, .09-.91). Possible confounding factors did not explain the difference. In a combined analysis, children who had measles antibody detected when they received their first dose of MV at 4-6 months of age had lower mortality than children with no maternal antibody, the MRR being 0.22 (95% CI, .07-.64) between 4-6 months and 5 years. Child mortality in low-income countries may be reduced by vaccinating against measles in the presence of maternal antibody, using a 2-dose schedule with the first dose at 4-6 months (earlier than currently recommended) and a booster dose at 9-12 months of age. NCT00168558. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  9. Measles Vaccination in the Presence or Absence of Maternal Measles Antibody: Impact on Child Survival

    PubMed Central

    Aaby, Peter; Martins, Cesário L.; Garly, May-Lill; Andersen, Andreas; Fisker, Ane B.; Claesson, Mogens H.; Ravn, Henrik; Rodrigues, Amabelia; Whittle, Hilton C.; Benn, Christine S.

    2014-01-01

    Background. Measles vaccine (MV) has a greater effect on child survival when administered in early infancy, when maternal antibody may still be present. Methods. To test whether MV has a greater effect on overall survival if given in the presence of maternal measles antibody, we reanalyzed data from 2 previously published randomized trials of a 2-dose schedule with MV given at 4–6 months and at 9 months of age. In both trials antibody levels had been measured before early measles vaccination. Results. In trial I (1993–1995), the mortality rate was 0.0 per 1000 person-years among children vaccinated with MV in the presence of maternal antibody and 32.3 per 1000 person-years without maternal antibody (mortality rate ratio [MRR], 0.0; 95% confidence interval [CI], 0–.52). In trial II (2003–2007), the mortality rate was 4.2 per 1000 person-years among children vaccinated in presence of maternal measles antibody and 14.5 per 1000 person-years without measles antibody (MRR, 0.29; 95% CI, .09–.91). Possible confounding factors did not explain the difference. In a combined analysis, children who had measles antibody detected when they received their first dose of MV at 4–6 months of age had lower mortality than children with no maternal antibody, the MRR being 0.22 (95% CI, .07–.64) between 4–6 months and 5 years. Conclusions. Child mortality in low-income countries may be reduced by vaccinating against measles in the presence of maternal antibody, using a 2-dose schedule with the first dose at 4–6 months (earlier than currently recommended) and a booster dose at 9–12 months of age. Clinical Trials Registration. NCT00168558. PMID:24829213

  10. Current progress in pulmonary delivery of measles vaccine.

    PubMed

    Griffin, Diane E

    2014-06-01

    Due to the high infectivity of measles virus, achieving sufficient population immunity to interrupt transmission requires two doses of live attenuated measles virus vaccine. Subcutaneous delivery of vaccine by injection requires trained personnel, maintenance of a cold chain and safe disposal of used needles and syringes. Pulmonary vaccine delivery offers the opportunity for cost-savings and improved coverage, but requires re-licensure. Two aerosol vaccine formulations, nebulized liquid and dry powder, and multiple delivery devices have been evaluated in humans and macaques. Nebulized liquid vaccine is effective for a second dose of vaccine in older children, but less effective for primary vaccination of infants. Dry powder vaccine provides solid protection in macaques and boosts responses in immune adults, but has not yet been tested in infants.

  11. Aerosolized measles and measles-rubella vaccines induce better measles antibody booster responses than injected vaccines: randomized trials in Mexican schoolchildren.

    PubMed Central

    Bennett, John V.; Fernandez de Castro, Jorge; Valdespino-Gomez, Jose Luis; Garcia-Garcia, Ma de Lourdes; Islas-Romero, Rocio; Echaniz-Aviles, Gabriela; Jimenez-Corona, Aida; Sepulveda-Amor, Jaime

    2002-01-01

    OBJECTIVE: To compare antibody responses and side-effects of aerosolized and injected measles vaccines after revaccination of children enrolling in elementary schools. METHODS: Vaccines for measles (Edmonston-Zagreb) or measles-rubella (Edmonston-Zagreb with RA27/3) were given by aerosol or injection to four groups of children. An additional group received Schwarz measles vaccine by injection. These five groups received vaccines in usual standard titre doses. A sixth group received only 1000 plaque-forming units of Edmonston-Zagreb vaccine by aerosol. The groups were randomized by school. Concentrations of neutralizing antibodies were determined in blood specimens taken at baseline and four months after vaccination from randomized subgroups (n = 28-31) of children in each group. FINDINGS: After baseline antibody titres were controlled for, the frequencies of fourfold or greater increases in neutralizing antibodies did not differ significantly between the three groups that received vaccine by aerosol (range 52%-64%), but they were significantly higher than those for the three groups that received injected vaccine (range 4%-23%). Mean increases in titres and post-vaccination geometric mean titres paralleled these findings. Fewer side-effects were noted after aerosol than injection administration of vaccine. CONCLUSION: Immunogenicity of measles vaccine when administered by aerosol is superior to that when the vaccine is given by injection. This advantage persists with aerosolized doses less than or equal to one-fifth of usual injected doses. The efficacy and cost-effectiveness of measles vaccination by aerosol should be further evaluated in mass campaigns. PMID:12471401

  12. Measles Virus IgG Avidity Assay for Use in Classification of Measles Vaccine Failure in Measles Elimination Settings

    PubMed Central

    Garcia, Philip; Bellini, William J.

    2012-01-01

    In regions where endemic measles virus has been eliminated, diagnostic assays are needed to assist in correctly classifying measles cases irrespective of vaccination status. A measles IgG avidity assay was configured using a commercially available measles-specific IgG enzyme immunoassay by modifying the protocol to include three 5-min washes with diethylamine (60 mM; pH 10.25) following serum incubation; serum was serially diluted, and the results were expressed as the end titer avidity index. Receiver operating characteristic analysis was used for evaluation and validation and to establish low (≤30%) and high (≥70%) end titer avidity thresholds. Analysis of 319 serum specimens expected to contain either high- or low-avidity antibodies according to clinical and epidemiological data indicated that the assay is highly accurate, with an area under the curve of 0.998 (95% confidence interval [CI], 0.978 to 1.000), sensitivity of 91.9% (95% CI, 83.2% to 97.0%), and specificity of 98.4% (95% CI, 91.6% to 100%). The assay is rapid (<2 h) and precise (standard deviation [SD], 4% to 7%). In 18 samples from an elimination setting outbreak, the assay identified 2 acute measles cases with low-avidity results; both were IgM-positive samples. Additionally, 11 patients (15 samples) with modified measles who were found to have high-avidity IgG results were classified as secondary vaccine failures; one sample with an intermediate-avidity result was not interpretable. In elimination settings, measles IgG avidity assays can complement existing diagnostic tools in confirming unvaccinated acute cases and, in conjunction with adequate clinical and epidemiologic investigation, aid in the classification of vaccine failure cases. PMID:22971778

  13. Measles, mumps and rubella--safety of the combined vaccine.

    PubMed

    Bedford, Helen

    Despite the fact that scientific evidence shows no support for a link between the combined measles, mumps and rubella vaccine (MMR) and autism or bowel problems, many parents remain worried. This article discusses the reasons for the introduction of MMR and outlines the debate about its safety and the problems associated with using single vaccines.

  14. John F. Enders and measles virus vaccine--a reminiscence.

    PubMed

    Katz, S L

    2009-01-01

    Following their initial isolation in cell culture of the virus in 1954, a succession of investigators under the mentorship of John E Enders conducted the research, development, and initial clinical studies responsible for the licensure in 1963 of a successful live attenuated measles virus vaccine. Propagation of the virus successively in human kidney cells, human amnion cells, embryonated hens' eggs, and finally chick embryo cell cultures had selected virus that when inoculated into susceptible monkeys proved immunogenic without viremia or overt disease, in contrast to the early kidney cell-passaged material, which in similar monkeys produced viremia with illness mimicking human measles. Careful clinical studies in children by the Enders group and then by collaborating investigators in many sites established its safety, immunogenicity, and efficacy. This Edmonston strain measles virus became the progenitor of vaccines prepared, studied, and utilized throughout the United States and many other countries. With appreciation of measles morbidity and mortality, most marked among infants and children in the resource-limited lands, the vaccine was incorporated into the World Health Organization's (WHO) Expanded Programme of Immunization (EPI) in 1974 along with BCG, OPV, and DTP. Successful efforts to further reduce measles' burden were launched in 2001 and are continuing as the Measles Initiative (Partnership) under the leadership of the American Red Cross, International Red Cross, and Red Crescent societies, Centers for Disease Control (CDC), United Nations Children's Fund (UNICEF), WHO, and the United Nations Foundation.

  15. Vaccine-preventable diseases in pediatric patients: a review of measles, mumps, rubella, and varicella [digest].

    PubMed

    Levine, Deborah A; Pade, Kathryn H

    2016-12-22

    Vaccine-preventable diseases such as measles, mumps, rubella, and varicella continue to plague children and adults worldwide. Although public health programs have helped decrease the prevalence and sequelae of these diseases, outbreaks still occur. To limit the spread of these diseases, emergency clinicians must be able to readily identify the characteristic presentations of the rashes associated with measles, rubella, and varicella, as well as the common presenting features associated with mumps. Diagnostic laboratory studies are not usually necessary, as a complete history and physical examination usually lead to an accurate diagnosis. Treatment for these vaccine-preventable diseases usually consists of supportive care, but, in some cases, severe complications and death may occur. This issue provides a review of the clinical features, differential diagnoses, potential complications, and treatment options for measles, mumps, rubella, and varicella. [Points & Pearls is a digest of Pediatric Emergency Medicine Practice].

  16. Vaccine-Preventable Diseases In Pediatric Patients: A Review Of Measles, Mumps, Rubella, And Varicella.

    PubMed

    Levine, Deborah A

    2016-12-01

    Vaccine-preventable diseases such as measles, mumps, rubella, and varicella continue to plague children and adults worldwide. Although public health programs have helped decrease the prevalence and sequelae of these diseases, outbreaks still occur. To limit the spread of these diseases, emergency clinicians must be able to readily identify the characteristic presentations of the rashes associated with measles, rubella, and varicella, as well as the common presenting features associated with mumps. Diagnostic laboratory studies are not usually necessary, as a complete history and physical examination usually lead to an accurate diagnosis. Treatment for these vaccine-preventable diseases usually consists of supportive care, but, in some cases, severe complications and death may occur. This issue provides a review of the clinical features, differential diagnoses, potential complications, and treatment options for measles, mumps, rubella, and varicella.

  17. A randomized, controlled trial of an aerosolized vaccine against measles.

    PubMed

    Low, Nicola; Bavdekar, Ashish; Jeyaseelan, Lakshmanan; Hirve, Siddhivinayak; Ramanathan, Kavitha; Andrews, Nicholas J; Shaikh, Naseem; Jadi, Ramesh S; Rajagopal, Arunachalam; Brown, Kevin E; Brown, David; Fink, James B; John, Oommen; Scott, Pippa; Riveros-Balta, A Ximena; Greco, Michel; Dhere, Rajeev; Kulkarni, Prasad S; Henao Restrepo, Ana Maria

    2015-04-16

    Aerosolized vaccine can be used as a needle-free method of immunization against measles, a disease that remains a major cause of illness and death. Data on the immunogenicity of aerosolized vaccine against measles in children are inconsistent. We conducted an open-label noninferiority trial involving children 9.0 to 11.9 months of age in India who were eligible to receive a first dose of measles vaccine. Children were randomly assigned to receive a single dose of vaccine by means of either aerosol inhalation or a subcutaneous injection. The primary end points were seropositivity for antibodies against measles and adverse events 91 days after vaccination. The noninferiority margin was 5 percentage points. A total of 1001 children were assigned to receive aerosolized vaccine, and 1003 children were assigned to receive subcutaneous vaccine; 1956 of all the children (97.6%) were followed to day 91, but outcome data were missing for 331 children because of thawed specimens. In the per-protocol population, data on 1560 of 2004 children (77.8%) could be evaluated. At day 91, a total of 662 of 775 children (85.4%; 95% confidence interval [CI], 82.5 to 88.0) in the aerosol group, as compared with 743 of 785 children (94.6%; 95% CI, 92.7 to 96.1) in the subcutaneous group, were seropositive, a difference of -9.2 percentage points (95% CI, -12.2 to -6.3). Findings were similar in the full-analysis set (673 of 788 children in the aerosol group [85.4%] and 754 of 796 children in the subcutaneous group [94.7%] were seropositive at day 91, a difference of -9.3 percentage points [95% CI, -12.3 to -6.4]) and after multiple imputation of missing results. No serious adverse events were attributable to measles vaccination. Adverse-event profiles were similar in the two groups. Aerosolized vaccine against measles was immunogenic, but, at the prespecified margin, the aerosolized vaccine was inferior to the subcutaneous vaccine with respect to the rate of seropositivity. (Funded by the

  18. Measles incidence rate and a phylogenetic study of contemporary genotype H1 measles strains in China: is an improved measles vaccine needed?

    PubMed

    Shi, Jingwei; Zheng, Jingtong; Huang, Honglan; Hu, Yu; Bian, Jiang; Xu, Deqi; Li, Fan

    2011-12-01

    The incidence of measles in China has increased over the last decade. To evaluate the genetic variation of measles strains, 16 measles wild-type virus strains were isolated from 14 vaccinated cases and 2 nonvaccinated cases in Jilin Province during 2005-2006, and their nucleoprotein (N) and hemagglutinin (H) genes were amplified by RT-PCR. The amplified products were sequenced and compared with the Edmonston virus and the existing vaccine strains (Changchun-47 and Shanghai-191). The results showed that the variation rate between the vaccine and wild-type strains was 9.8-12.0% in the N gene and 5.9-6.9% in the H gene, respectively. In addition, cross-neutralization assays revealed that although sera obtained from infants following primary vaccination effectively neutralized vaccine strains, the capacity in neutralizing H1 wild-type measles virus isolates was decreased fourfold. Antigenic ratios testing revealed that the antigenic relatedness between wild-type measles viruses and existing vaccine strains was notably low. These data suggest that the increased incidence of measles in Jilin Province may be attributed to the antigenic drift between wild-type and vaccine strains. Our findings strengthen the recommendation of supplemental immunization with existing vaccines and also strongly suggest a need for developing new vaccines to better control measles virus outbreaks.

  19. Immunogenic measles antigens expressed in plants: role as an edible vaccine for adults.

    PubMed

    Muller, Claude P; Marquet-Blouin, Estelle; Fack, Fred; Damien, Benjamin; Steinmetz, Andŕe; Bouche, Fabienne B

    2003-01-30

    Vaccine-induced immunity against measles is less robust than natural immunity. Waning of immunity in vaccines may eventually require a revaccination of adults. Measles antigens expressed in plants have been shown to be antigenic and immunogenic both after invasive and oral vaccination. Strategies for the vaccination of adults, the potential of an oral measles vaccine produced in edible plants and the design of suitable antigens are discussed.

  20. HIV-1 infection in Zambian children impairs the development and avidity maturation of measles virus-specific immunoglobulin G after vaccination and infection.

    PubMed

    Nair, Nitya; Moss, William J; Scott, Susana; Mugala, Nanthalile; Ndhlovu, Zaza M; Lilo, Kareem; Ryon, Judith J; Monze, Mwaka; Quinn, Thomas C; Cousens, Simon; Cutts, Felicity; Griffin, Diane E

    2009-10-01

    Endemic transmission of measles continues in many countries that have a high human immunodeficiency virus (HIV) burden. The effects that HIV infection has on immune responses to measles and to measles vaccine can impact measles elimination efforts. Assays to measure antibody include the enzyme immunoassay (EIA), which measures immunoglobulin G (IgG) to all measles virus (MV) proteins, and the plaque reduction neutralization (PRN) assay, which measures antibody to the hemagglutinin and correlates with protection. Antibody avidity may affect neutralizing capacity. HIV-infected and HIV-uninfected Zambian children were studied after measles vaccination (n=44) or MV infection (n=57). Laboratory or wild-type MV strains were used to infect Vero or Vero/signaling lymphocyte-activation molecule (SLAM) cells in PRN assays. IgG to MV was measured by EIA, and avidity was determined by ammonium thiocyanate dissociation. HIV infection impaired EIA IgG responses after vaccination and measles but not PRN responses measured using laboratory-adapted MV. Avidity was lower among HIV-infected children 3 months after vaccination and 1 and 3 months after measles. Neutralization of wild-type MV infection of Vero/SLAM cells correlated with IgG avidity. Lower antibody quality and quantity in HIV-infected children after measles vaccination raise challenges for assuring the long-term protection of these children. Antibody quality in children receiving antiretroviral therapy requires assessment.

  1. [Measles epidemic in a school population. Effectiveness of the vaccine].

    PubMed

    Cosín Borobio, R

    1993-12-01

    To describe the distribution of the illness according to the school students' measles vaccination status and to assess its effectiveness. Analytical study of a retrospective cohort. Two schools within the Base Health Area of San Leonardo de Yagüe, Soria. 410 school students between 3 and 14. 314 were included in the study sample. The overall vaccination rate was 81.8% and was higher among lower age groups. The overall incidence rate was 18.5%; 9.7% in those vaccinated and 57.9% in those not vaccinated. The incidence rates increased with age, 5.5% for the 3-6 and 24.5% for the 11-14 age groups. Vaccine effectiveness was measured by Relative Risk (5.9) and Attributable Fraction (83.2%), with a statistically significant association between non-vaccination and the occurrence of measles. As measles vaccination is highly effective, it would be worthwhile to increase vaccine coverage to 93.5-96%, so that group immunity within a community can be attained and so transmission of the disease be avoided.

  2. A further study on measles vaccination in Nigerian children*

    PubMed Central

    Hendrickse, R. G.; Montefiore, D.; Sherman, P. M.; Sofoluwe, G. O.

    1965-01-01

    Measles is a serious disease in Nigeria, causing severe morbidity and appreciable mortality; it occurs almost exclusively in the pre-school child with a peak incidence in the second year of life. A safe measles vaccine would be of inestimable value both in that country and in other areas where the disease constitutes a grave menace. Studies using vaccines of the Enders Edmonston B type have shown that while these are efficient immunizing agents, severe reactions are too frequent to permit of their wide general use. In the quest for safer vaccines, and in accordance with the recommendations of a WHO Scientific Group, a field trial was undertaken in Western Nigeria in May 1964 to make direct comparisons of the antigenicity and reaction rates of three further-attenuated measles vaccines (Schwarz, Beckenham 20 and Beckenham 20/2) and Enders Edmonston B vaccine plus gamma-globulin. A control group was also included. Analysis of the clinical responses demonstrated that reactions were similar, and of minimal severity, in all vaccine groups. Neutralizing antibody responses showed that all the vaccines used were effective immunizing agents. From the point of view of ease of administration and expense, however, further-attenuated vaccines seem preferable to Enders Edmonston B administered with gamma-globulin. PMID:5294305

  3. Measles Outbreak in Macedonia: Epidemiological, Clinical and Laboratory Findings and Identification of Susceptible Cohorts

    PubMed Central

    Kondova, Irena T.; Milenkovic, Zvonko; Marinkovic, Sanja P.; Bosevska, Golubinka; Kuzmanovska, Gordana; Kondov, Goran; Alabakovska, Sonja; Muller, Claude P.; Hübschen, Judith M.

    2013-01-01

    Objectives Despite a 92-99% national vaccination coverage since 2000, the former Yugoslav Republic of Macedonia experienced a large measles outbreak between 2010 and 2011. Here we investigate the characteristics of patients hospitalized during this outbreak at the Clinic of Infectious Diseases in Skopje. Methods Epidemiological, clinical and laboratory data of 284 measles patients, including 251 from Skopje (43.80% of the 573 reported cases) and 33 from elsewhere in Macedonia were collected. Results The most affected age groups were children up to 4 years of age and adolescents/adults of 15 years and older. Most patients were unvaccinated (n=263, 92.61%) and many had non-Macedonian nationalities (n=156, 54.93%) or belonged to the Roma ethnicity (n=73, 25.70%). Bronchopneumonia and diarrhea were the most common complications. Eighty-two out of 86 tested patients (95.35%) had measles-specific IgM antibodies. The outbreak was caused by the measles variant D4-Hamburg. Conclusions The epidemic identified pockets of susceptibles in Skopje and indicated that additional vaccination opportunities in particular for people with non-Macedonian nationality and traveler communities are warranted to ensure efficient measles control in Macedonia. The high attack rate among children of less than 1 year suggests that vaccination before 12 months of age should be considered in high risk settings. PMID:24040337

  4. Effectiveness and timing of vaccination during school measles outbreak.

    PubMed

    Bonačić Marinović, Axel Antonio; Swaan, Corien; Wichmann, Ole; van Steenbergen, Jim; Kretzschmar, Mirjam

    2012-09-01

    Despite high vaccination coverage in most European countries, large community outbreaks of measles do occur, normally clustered around schools and resulting from suboptimal vaccination coverage. To determine whether or when it is worth implementing outbreak-response vaccination campaigns in schools, we used stochastic outbreak models to reproduce a public school outbreak in Germany, where no vaccination campaign was implemented. We assumed 2 scenarios covering the baseline vaccination ratio range (91.3%-94.3%) estimated for that school and computed outbreaks assuming various vaccination delays. In one scenario, reacting (i.e., implementing outbreak-response vaccination campaigns) within 12-24 days avoided large outbreaks and reacting within 50 days reduced outbreak size. In the other scenario, reacting within 6-14 days avoided large outbreaks and reacting within 40 days reduced the outbreak size. These are realistic time frames for implementing school outbreak response vaccination campaigns. High baseline vaccination ratios extended the time needed for effective response.

  5. Seroconversion of children following natural measles infection and vaccination.

    PubMed

    Odoemele, C F; Ukwandu, N C D; Adu, F D; Nmorsi, O P G; Anyanwu, L C; Odike, M A C; Omotade, O O

    2008-09-01

    To evaluate the relationship between measles virus (MV) antibodies (abs) in sera and breast milk of nursing mothers, their contributions in seroconversion of children (0-9 months) post vaccination, prevalence of prevaccination measles abs in sera of children brought for measles vaccination and seroconversion rate in vaccinees from nursing and lactating mothers. Also to determine the potency of vaccines available in Nigeria in relation to seroconversion. One hundred and twenty pre- and post-vaccination sera and breast milk samples were collected from each nursing mother while corresponding number of finger prick pre- and post-vaccination sera samples were collected from children on filter papers. These were tested for mv abs using serological techniques. Eighty (20.0%) mothers had measles haemagglutination inhibition (HI) abs in sera and 88 (27.2%) had mv HI abs in breast milk. Eight (2.0%) children who had prevaccination mv abs in sera came from mv ab negative mothers. Forty-four (37.0%) came back for post vaccination sera, sero-converted while 76 (63.3%) gave low sero-conversion rate of 37.0%. Results showed that mv abs in sera or breast milk of mothers did not interfere with mv vaccination in children. The low sero-conversion rate obtained was due to low vaccine potency with titres ranging between (log10-10 - log10-2.5)TCID/per dose, besides non-specific antiviral substances exhibited virus neutralizing activity. Poor sero-conversion due to loss of passive immunity arose from undernourishment while low ab titres came with natural infection. This suggested mv vaccination did not immunize following natural mv infection or any other previous immune status.

  6. Measles Outbreak Associated with Vaccine Failure in Adults--Federated States of Micronesia, February-August 2014.

    PubMed

    Breakwell, Lucy; Moturi, Edna; Helgenberger, Louisa; Gopalani, Sameer V; Hales, Craig; Lam, Eugene; Sharapov, Umid; Larzelere, Maribeth; Johnson, Eliaser; Masao, Carolee; Setik, Eleanor; Barrow, Lisa; Dolan, Samantha; Chen, Tai-Ho; Patel, Minal; Rota, Paul; Hickman, Carole; Bellini, William; Seward, Jane; Wallace, Greg; Papania, Mark

    2015-10-02

    On May 15, 2014, CDC was notified of two laboratory-confirmed measles cases in the Federated States of Micronesia (FSM), after 20 years with no reported measles. FSM was assisted by the World Health Organization (WHO), the United Nations Children’s Fund (UNICEF), and CDC in investigating suspected cases, identify contacts, conduct analyses to guide outbreak vaccination response, and review vaccine cold chain practices. During February–August, three of FSM’s four states reported measles cases: Kosrae (139 cases), Pohnpei (251), and Chuuk (3). Two thirds of cases occurred among adults aged ≥20 years; of these, 49% had received ≥2 doses of measles-containing vaccine (MCV). Apart from infants aged <12 months who were too young for routine vaccination, measles incidence was lower among children than adults. A review of current cold chain practices in Kosrae revealed minor weaknesses; however, an absence of historical cold chain maintenance records precluded an evaluation of earlier problems. Each state implemented vaccination campaigns targeting children as young as age 6 months through adults up to age 57 years. The preponderance of cases in this outbreak associated with vaccine failure in adults highlights the need for both thorough case investigation and epidemiologic analysis to guide outbreak response vaccination. Routine childhood vaccination coverage achieved in recent years limited the transmission of measles among children. Even in areas where transmission has not occurred for years, maintaining high 2-dose MCV coverage through routine and supplemental immunization is needed to prevent outbreaks resulting from increased measles susceptibility in the population.

  7. Field evaluation of measles vaccine efficacy in Mozambique.

    PubMed

    Cutts, F T; Smith, P G; Colombo, S; Mann, G; Ascherio, A; Soares, A C

    1990-02-01

    Monitoring measles vaccine efficacy is an important form of quality control in immunization programs. Retrospective cohort studies of vaccine efficacy were conducted in Mozambique with the aim of adopting this method for regular use. The authors studied 1,215 and 790 children aged 12-35 months in the cities of Nampula and Beira, respectively. In Nampula (1985), vaccine efficacy was estimated to be 40%, and in Beira (1986), it was estimated to be 59%. To investigate the possibility of falsely low results due to poor specificity of maternal reporting of measles cases, a seroepidemiologic study of 600 children aged 12-47 months was conducted in Nampula in 1986. The specificity and sensitivity of a maternal history of measles in an unvaccinated child were estimated as 83% and 56%, respectively. These results were used to obtain an adjusted vaccine efficacy estimate of 66%, almost double the estimate of 37% obtained using data on history of vaccination and illness alone. The large bias introduced into the vaccine efficacy estimation by low specificity of disease diagnosis is a serious limitation to the use of retrospective cohort methods to assess efficacy.

  8. Reactogenicity and immunogenicity of measles-rubella combined vaccine in school-entry-aged subjects with naturally acquired measles immunity.

    PubMed

    Kumagai, Takuji; Ihara, Toshiaki; Nakayama, Tetsuo; Nagata, Nobuo; Kamiya, Hitoshi

    2015-08-01

    The reintroduction of measles-rubella combined (MR) vaccination to Japan raised concerns about adverse events as well as immunogenicity related to booster immunization in subjects with naturally acquired immunity to measles or rubella. The time course of reactogenicity and antibody responses in recipients with pre-existing immunity to measles through natural infection was observed. Eighteen children aged 80-104 months received MR booster vaccination; 16 of them had had previous rubella vaccination. There were virtually no clinical reactions related to booster vaccination, and a highly significant antibody response to rubella antigen, whereas the antibody rise to measles was statistically significant but poor. Vaccination of individuals already immune is not harmful. Booster immunization to rubella for Japanese children is vitally important. © 2015 Japan Pediatric Society.

  9. [Vaccination offers good protection against measles, mumps and rubella. To refuse vaccination would seriously threaten our good immunity status].

    PubMed

    Linde, A; Johansen, K

    2001-08-29

    Since vaccination against measles, rubella and mumps (MMR) was introduced in Sweden in 1982 for children at 1.5 and 12 years of age these diseases have almost completely disappeared. Severe side effects have been rare. Threats against the continued protection from these diseases include a lessening inclination on the part of parents to vaccinate their children, a weakening of the vaccine-induced immunological response with time, and possibly also genetic changes in strains of circulating wild type virus. By law physicians are bound to report diagnosed cases as well as new or severe side effects. Continuous laboratory analysis of antibodies and circulating viruses is also necessary.

  10. [35-year measles, mumps, rubella vaccination assessment in France].

    PubMed

    Reinert, P; Soubeyrand, B; Gauchoux, R

    2003-11-01

    The setting-up and the follow-up of a vaccination programme require important human and economical investments. Our study objective consists of the clinical benefit evaluation given by measles, mumps and rubella (MMR) vaccination since monovalent and combined vaccines availability (35 years for measles, 30 years for rubella and 20 years for mumps). Vaccination impact has been evaluated from the modelisation for each disease under the shape of a decision tree relying on epidemiological data and on efficacy data of the vaccines. We have compared the results in terms of complications, sequaela, deaths in the vaccinated population (vaccination period) with the results that we would obtain if this same population had not been vaccinated (non vaccination period). The general model was applied to each of the three diseases excluding congenital rubella syndrome. They have been modelised according to the occurrence, or not, of a complication leading to an evolution towards either recovery or sequaela or death. The estimation of the number of avoided congenital rubella syndromes has been made from the number of protected women by vaccination and incidence figures of congenital rubella syndromes reported in the population considered before and after vaccination. In France over the period of time considered, almost 2 million meningitis, 60 000 encephalitis, 170 subacute sclerosis panencephalitis and more than 5600 neurological sequaela including more than 600 deafness cases have been avoided as a result of the MMR vaccination programme. Moreover, 590 000 pneumonia, more than one million of acute otitis media and 300 000 orchitis, 3000 rubella infection cases occurring during pregnancy have also been avoided. Overall, more than 12 000 deaths that have been avoided as a result of the MMR vaccination. In France, MMR vaccination programme leads to a huge benefit in terms of public health, which emphasises the true value of vaccination in the daily medical practice.

  11. Measles susceptibility in young Thai men suggests need for young adult measles vaccination: a cross sectional study.

    PubMed

    Gonwong, Siriphan; Chuenchitra, Thippawan; Khantapura, Patchariya; Islam, Dilara; Mason, Carl J

    2016-04-11

    Measles remains a major public health concern in Thailand despite the introduction of vaccination since 1984. Similar to other countries, Thailand has experienced numerous measles outbreaks including adult communities such as university student dormitories, prisons, refugee camps, and military recruit camps. These outbreaks raise questions on the seroprotective antibody level in Thai adults. To better understand measles susceptibility in young Thai adults, a retrospective measles seroprevalence study on repository serum specimens obtained with informed consent from young Thai men entering the Royal Thai Army (RTA) during 2007-2008 was conducted. A total of 7760 stratified randomized samples were chosen by residence province. Measles IgG titer was measured using a commercial IgG quantitative ELISA kit following the manufacturer's instructions. An antibody level ≥ 250 International Units per Liter (IU/L) was interpreted as seropositive. The overall measles seroprevalence was 78.5 % (95 % Confidence Interval: 77.6-79.4 %) with geometric mean titer of 738 IU/L (95 % Confidence Interval: 716-760 IU/L). The measles seroprevalence by province ranged from 59.6 % to 93.1 %. A trend of decreasing seroprevalence in the younger cohorts despite increasing immunization coverage was found. Lower seroprevalence than vaccination coverage was observed in the youngest age group. To achieve long term measles control and elimination, an integrated two doses vaccination strategy has been implemented in children in Thailand. This nationwide measles seroprevalence study in young adult RTA recruits found a measles seroprevalence lower than WHO's recommendation for measles outbreak prevention and elimination. These results raise concerns for measles control in Thailand. Supplementary immunization in young adults is essential especially in high-risk and densely populated communities to establish herd immunity for outbreak prevention and elimination.

  12. Measles-mumps-rubella vaccine and the development of autism.

    PubMed

    Miller, Elizabeth

    2003-07-01

    The measles-mumps-rubella (MMR) vaccine has been postulated to cause a form of autism characterized by regression and bowel symptoms, and onset occurring shortly after vaccination. It is also claimed that, as a result, there has been a dramatic increase in autism prevalence. These hypotheses have now been tested in a number of epidemiologic studies that are reviewed in this article. None has found any evidence of the existence of a phenotypically distinct form of autism in children who received the MMR vaccine or of a clustering of onset symptoms in children who are autistic after receiving the MMR vaccine. There is no proof that the overall risk of autism is higher in children who were vaccinated with MMR or of an increase in autism prevalence associated with the use of the MMR vaccine. No epidemiologic evidence suggests an association between MMR vaccination and autism. Moreover, epidemiologic evidence against such an association is compelling.

  13. Costs and benefits of measles vaccination in Finland.

    PubMed

    Ekblom, M; Elo, O; Laurinkari, J; Niemelä, P

    1978-01-01

    Measles vaccination is fairly beneficial. During the third year after launching of the vaccination programme, cumulative benefits accuring from vaccination outweigh the cumulative costs of vaccination. This conclusion is based on a study of the vaccination programme in Finland. According to the vaccination programme, all 1-year-old infants in Finland are vaccinated. The duration of the period under survey has been set at 25 years, the measuring unit is the Finnish mark and the price level is that of the year 1975. When comparing costs and benefits, these are converted to present day monetary values. Vaccination costs per vaccinated infant amount to 32 marks, and in total during the period 1975--1999 they will amount to about 34 million marks according to an interest rate of 9% and to about 41 million marks according to an interest rate of 6% in current monetary value. Benefits gained by vaccination, compared with costs, are manifold. The benefits of one vaccination have been estimated at 230 marks. In total, benefits during the period 1975--99 constitute ca 117 million marks at an interest rate of 9%, and ca 159 million marks at an interest rate of 6% in current monetary value, without any deduction for vaccination costs. The net gain of vaccination--with a deduction of vaccination costs--is ca 84 million marks at an interest rate of 9%, and ca 118 million marks at an interest rate of 6% in current monetary value.

  14. A Global Perspective of Vaccination of Healthcare Personnel against Measles: Systematic Review

    PubMed Central

    Fiebelkorn, Amy Parker; Seward, Jane F.; Orenstein, Walter

    2015-01-01

    Measles transmission has been well documented in healthcare facilities. Healthcare personnel who are unvaccinated and who lack other evidence of measles immunity put themselves and their patients at risk for measles. We conducted a systematic literature review of measles vaccination policies and their implementation in healthcare personnel, measles seroprevalence among healthcare personnel, measles transmission and disease burden in healthcare settings, and impact/costs incurred by healthcare facilities for healthcare-associated measles transmission. Five database searches yielded 135 relevant articles; 47 additional articles were found through cross-referencing. The risk of acquiring measles is estimated to be 2 to 19 times higher for susceptible healthcare personnel than for the general population. Fifty-three articles published worldwide during 1989–2013 reported measles transmission from patients to healthcare personnel; many of the healthcare personnel were unvaccinated or had unknown vaccination status. Eighteen articles published worldwide during 1982–2013 described examples of transmission from healthcare personnel to patients or to other healthcare personnel. Half of European countries have no measles vaccine policies for healthcare personnel. There is no global policy recommendation for the vaccination of healthcare personnel against measles. Even in countries such as the United States or Finland that have national policies, the recommendations are not uniformly implemented in healthcare facilities. Measles serosusceptibility in healthcare personnel varied widely across studies (median 6.5%, range 0%-46%) but was consistently higher among younger healthcare personnel. Deficiencies in documentation of two doses of measles vaccination or other evidence of immunity among healthcare personnel presents challenges in responding to measles exposures in healthcare settings. Evaluating and containing exposures and outbreaks in healthcare settings can be

  15. Is there enough vaccine to eradicate measles? An integrated analysis of measles-containing vaccine supply and demand.

    PubMed

    Smith, Graegar; Michelson, Joshua; Singh, Rohit; Dabbagh, Alya; Hoekstra, Edward; van den Ent, Maya; Mallya, Apoorva

    2011-07-01

    Responding to regional advancements in combating measles, the World Health Organization in May 2008 called for an assessment of the feasibility of measles eradication, including whether sufficient vaccine supply exists. Interviews with international health officials and vaccine-makers provided data for a detailed model of worldwide demand and supply for measles-containing vaccine (MCV). The study projected global MCV demand through 2025 with and without a global eradication goal. The study found that 5.2 billion MCV doses must be administered during 2010-2025 to maintain current measles programs, and 5.9 billion doses would likely be needed with a 2020 eradication goal; in the most intensive scenario, demand could increase to 7.5 billion doses. These volumes are within existing and planned MCV-manufacturing capacity, although there are risks. In some markets, capacity is concentrated: Supply-chain disruptions could reduce supply or increase prices. Mitigation strategies could include stockpiling, long-term contracts, and further coordination with manufacturers. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.

  16. Antibody response and clinical reactions in children given measles vaccine with immunoglobulin.

    PubMed Central

    Lingam, S; Miller, C L; Clarke, M; Pateman, J

    1986-01-01

    Antibody responses and clinical reactions to three measles vaccines (Attenuvax, Mevilin, and Rimevax) injected into the opposite arm to immunoglobulin were assessed in 45 children with brain disorders making them susceptible to fits if given measles vaccine alone. In this small study no unacceptable reactions occurred and in only three cases was the antibody response minimal or absent. More children in this special category should be considered for vaccination against measles in this way. PMID:3083994

  17. Mumps, measles and rubella vaccination in children with PFAPA syndrome.

    PubMed

    Kraszewska-G Omba, Barbara; Matkowska-Kocjan, Agnieszka; Mi Kiewicz, Katarzyna; Szyma Ska-Toczek, Zofia; Wójcik, Marta; Bany, Dorota; Szenborn, Leszek

    2016-11-21

    There is no published data regarding immunologic response to vaccinations in children with PFAPA syndrome (periodic fever, aphthous stomatitis, pharyngitis and cervical adenitis). The aim of this study was to evaluate mumps, measles and rubella immunity in children with PFAPA. 31 children with PFAPA syndrome and 22 healthy children (control group - CG) were recruited to the study. All children were previously vaccinated with one dose of MMR vaccine according to the Polish obligatory vaccination schedule. The patients from both groups were evaluated for anti-measles, anti-mumps and anti-rubella IgG antibodies concentrations (ELISA tests; the reference values for protective antibody levels were 150IU/L, 16RU/L and 11IU/ml respectively). The percentage of patients with protective antibodies levels was as follows: measles - 93.55% of PFAPA and 95.45% of CG patients (p=0.77); mumps - 74.19% of PFAPA and 95.45% of CG patients (p=0.02); rubella - 80.65% of PFAPA and 90.9% of CG patients (p=0.30).

  18. Measles Outbreak in a Vaccinated School Population: Epidemiology, Chains of Transmission and the Role of Vaccine Failures.

    ERIC Educational Resources Information Center

    Nkowane, Benjamin M.; And Others

    1987-01-01

    An outbreak of measles occurred in a high school with a documented vaccination level of 98 percent. When measles is introduced in a highly vaccinated population, vaccine failures may play some role in transmission but such transmission is not usually sustained. (Author/LHW)

  19. Measles Outbreak in a Vaccinated School Population: Epidemiology, Chains of Transmission and the Role of Vaccine Failures.

    ERIC Educational Resources Information Center

    Nkowane, Benjamin M.; And Others

    1987-01-01

    An outbreak of measles occurred in a high school with a documented vaccination level of 98 percent. When measles is introduced in a highly vaccinated population, vaccine failures may play some role in transmission but such transmission is not usually sustained. (Author/LHW)

  20. [Vaccination coverage against measles and sero-epidemiology of measles-specific IgG antibodies in German children and adolescents].

    PubMed

    Poethko-Müller, C; Mankertz, A

    2013-09-01

    Measles is a vaccine-preventable disease that could be eliminated by global vaccination strategies with two-dose measles vaccination. The World Health Organization (WHO) European Region aims at achieving measles elimination by 2015. Target control is mainly based on verification of 95 % vaccination coverage. In Germany, target verification cannot be based on data from centrally collected registers on vaccination and seroprevalence of measles-specific antibodies. This paper provides an overview of measles vaccination coverage and the timeliness of measles vaccination in birth cohorts 1989-2008. In addition, factors associated with vaccination gaps are described. Primary data on vaccination coverage (annual school entrance health examination) and on vaccination coverage and immune status (population-based German Health Interview and Examination Survey for Children and Adolescents - KiGGS) and secondary data (insurance refund claim data) are described and discussed. The measles immunization coverage (two doses) obtained in the 2010 school entrance examinations was 91.5 %. The range was 87.6-95.3 % between Federal States. Regional differences were even more pronounced between districts. The timeliness of the two-dose measles immunization increased from 41 % (birth cohorts 2001/2002) to 66 % (birth cohorts 2006/2008). Despite progress in recent years, measles vaccination coverage is still inadequate in adolescents, young adults, and young children. The German Standing Committee on Vaccination (STIKO) recommends a combined MMR vaccination of adults who were born after 1970 and who were not fully vaccinated against measles during childhood. Successful implementation of this recommendation is crucial just as it is important to step up efforts to improve the timeliness of measles vaccination in young children. Regional vaccination gaps and susceptible clusters defined by age or sociodemographic parameters are of particular importance to the epidemiology of measles

  1. Safety of measles-containing vaccines in post-marketing surveillance in Anhui, China.

    PubMed

    Meng, Fan-Ya; Sun, Yong; Shen, Yong-Gang; Pan, Hai-Feng; Tang, Ji-Hai; Wang, Bin-Bing; Wu, Chang-Hao; Ye, Dong-Qing

    2017-01-01

    The safety of measles vaccination is of great interest and importance to public health practice and the general society. We have analyzed the adverse events following immunization (AEFIs) of currently used measles-containing vaccines (including live attenuated measles vaccine, live attenuated measles and rubella combined vaccine, live attenuated measles and mumps combined vaccine, live attenuated Measles, Mumps and Rubella Combined Vaccine) in Anhui Province, China. From 2009 to 2014, 9.9 million doses of measles-containing vaccines were administrated and 1893 AEFIs were found (191.4 per million doses), of which, 33 serious AEFIs (3.3 per million vaccine doses) were reported. 59.4% (1124 cases) were male cases, and 85.1% (1611 cases) occurred in persons aged < 1 year. 93.3% (1766 cases) occurred at the first dose of vaccination and 95.9% (1815 cases) were found within 3 days after vaccination. This study presents up-to-date data and suggests that the measles-containing vaccines used in Anhui Province of China are safe.

  2. Safety of measles-containing vaccines in post-marketing surveillance in Anhui, China

    PubMed Central

    Meng, Fan-Ya; Sun, Yong; Shen, Yong-Gang; Pan, Hai-Feng; Tang, Ji-Hai; Wang, Bin-Bing; Wu, Chang-Hao; Ye, Dong-Qing

    2017-01-01

    The safety of measles vaccination is of great interest and importance to public health practice and the general society. We have analyzed the adverse events following immunization (AEFIs) of currently used measles-containing vaccines (including live attenuated measles vaccine, live attenuated measles and rubella combined vaccine, live attenuated measles and mumps combined vaccine, live attenuated Measles, Mumps and Rubella Combined Vaccine) in Anhui Province, China. From 2009 to 2014, 9.9 million doses of measles-containing vaccines were administrated and 1893 AEFIs were found (191.4 per million doses), of which, 33 serious AEFIs (3.3 per million vaccine doses) were reported. 59.4% (1124 cases) were male cases, and 85.1% (1611 cases) occurred in persons aged < 1 year. 93.3% (1766 cases) occurred at the first dose of vaccination and 95.9% (1815 cases) were found within 3 days after vaccination. This study presents up-to-date data and suggests that the measles-containing vaccines used in Anhui Province of China are safe. PMID:28192490

  3. Surveillance and vaccination coverage of measles and rubella in Northern Italy.

    PubMed

    Amendola, Antonella; Bubba, Laura; Piralla, Antonio; Binda, Sandro; Zanetti, Alessandro; Pariani, Elena; Ranghiero, Alberto; Premoli, Marta; Pellegrinelli, Laura; Coppola, Liliana; Gramegna, Maria; Baldanti, Fausto; Zanetti, Alessandro

    2015-01-01

    Measles and rubella are infectious diseases and humans are the only reservoir of these infections. Effective vaccines are available with the potential for measles (MV) and rubella (RuV) virus eradication. According to the World Health Organisation guidelines, a national plan was approved in Italy in 2013 to achieve the MV/RuV elimination by 2015, and active MV/RuV integrated surveillance initiated. Towards this purpose, a regional laboratory centre was set up on 1 September 2013 in Lombardy, Northern Italy. This paper aimed at: (1) evaluating measles-mumps-rubella (MMR) vaccine coverage and MV/RuV notified cases retrospectively; and (2) presenting the results of MV/RuV integrated surveillance (laboratory confirmed and viral genetic profiles).   The 95% target for MMR vaccine coverage was achieved in 2001, and coverage increased until 2007 (96.6%), but then a decreasing trend was observed. Since 2000 to 2014, 3026 rubella cases were notified, with nearly 58% of them in the 2002 epidemic. From 2009, less than 45 RuV cases per year were reported. From 2000 to 2014, 5024 measles cases were notified. Since 2008, three large outbreaks (in 2008, 2011, and 2013) were observed. From data obtained during our surveillance activity, there were no rubella cases, and 57.5% (46/80) collected samples were MV-positive by real-time RT-PCR. A fragment of the MV N gene was sequenced from 37 MV-positive samples; D8, D9, and B3 genotypes were detected. Data obtained retrospectively and from active surveillance underline the necessity to achieve and maintain high vaccination coverage and to improve surveillance and the effectiveness of healthcare actions.

  4. Polymorphisms in key innate immune genes and their effects on measles vaccine responses and vaccine failure in children from Mozambique.

    PubMed

    Clifford, Holly D; Hayden, Catherine M; Khoo, Siew-Kim; Naniche, Denise; Mandomando, Inacio M; Zhang, Guicheng; Richmond, Peter; Le Souëf, Peter N

    2012-09-21

    Despite an effective vaccine, measles remains a major health problem globally, particularly in developing countries. More than 30% of children show primary vaccine failure and therefore remain vulnerable to measles. Genetic variation in key innate pathogen recognition receptors, such as the measles cell entry receptors CD46 and SLAM, measles attachment receptor DC-SIGN, the antiviral toll-like receptors (TLR)3, TLR7 and TLR8, and the cytosolic antiviral receptor RIG-I, may significantly affect measles IgG antibody responses. Measles is still highly prevalent in developing countries such as those in Africa however there is no previous data on the effect of these innate immune genes in a resident African population. Polymorphisms (n=29) in the candidate genes were genotyped in a cohort of vaccinated children (n=238) aged 6 months-14 years from Mozambique, Africa who either had vaccine failure and contracted measles (cases; n=66) or controls (n=172). Contrasting previous associations with measles responses in Caucasians and/or strong evidence for candidacy, we found little indication that these key innate immune genes affect measles IgG responses in our cohort of Mozambican children. We did however identify that CD46 and TLR8 variants may be involved in the occurrence of measles vaccine failure. This study highlights the importance of genetic studies in resident, non-Caucasian populations, from areas where determining the factors that may affect measles control is of a high priority.

  5. Decreasing Seroprevalence of Measles Antibodies after Vaccination – Possible Gap in Measles Protection in Adults in the Czech Republic

    PubMed Central

    Smetana, Jan; Chlibek, Roman; Hanovcova, Irena; Sosovickova, Renata; Smetanova, Libuse; Gal, Peter; Dite, Petr

    2017-01-01

    Aims In recent years, Europe has recorded an increase in the number of measles outbreaks despite the implementation of vaccination into the National Immunization Programs. The Czech Republic introduced vaccination against measles into National Immunization Program in 1969. The aim of this study was to determine seroprevalence of IgG antibodies against measles in adults. Methods Our study was designed as a prospective, multicenter cohort study. Samples of blood were taken from adults aged 18 years and over. Specific IgG antibodies were determined by ELISA method. Results A number of 1911 sera samples were obtained. The total seropositivity reached 83.3%, 14.3% of the results were negative and 2.4% were borderline. When comparing the individual age groups, the highest antibody seropositivity (> 96%) was detected in persons aged 50 years and over who were naturally infected in pre-vaccine era. The lowest seropositivity was recorded in the age groups 30–39 years (61.5%), 40–49 years (77.5%) and 18–29 years (81.1%). Conclusions A long term high rate of seropositivity persists after natural measles infection. By contrast, it decreases over time after vaccination. Similarly, the concentrations of antibodies in persons with measles history persist for a longer time at a higher level than in vaccinated persons. Our results indicate possible gap in measles protection in adults born after implementation of vaccination into the National Immunization Programs. There are two probable reasons, decrease of measles antibody seropositivity in time after vaccination in setting of limited natural booster and one-dose vaccination schedule used in the first years after implementation. PMID:28085960

  6. Decreasing Seroprevalence of Measles Antibodies after Vaccination - Possible Gap in Measles Protection in Adults in the Czech Republic.

    PubMed

    Smetana, Jan; Chlibek, Roman; Hanovcova, Irena; Sosovickova, Renata; Smetanova, Libuse; Gal, Peter; Dite, Petr

    2017-01-01

    In recent years, Europe has recorded an increase in the number of measles outbreaks despite the implementation of vaccination into the National Immunization Programs. The Czech Republic introduced vaccination against measles into National Immunization Program in 1969. The aim of this study was to determine seroprevalence of IgG antibodies against measles in adults. Our study was designed as a prospective, multicenter cohort study. Samples of blood were taken from adults aged 18 years and over. Specific IgG antibodies were determined by ELISA method. A number of 1911 sera samples were obtained. The total seropositivity reached 83.3%, 14.3% of the results were negative and 2.4% were borderline. When comparing the individual age groups, the highest antibody seropositivity (> 96%) was detected in persons aged 50 years and over who were naturally infected in pre-vaccine era. The lowest seropositivity was recorded in the age groups 30-39 years (61.5%), 40-49 years (77.5%) and 18-29 years (81.1%). A long term high rate of seropositivity persists after natural measles infection. By contrast, it decreases over time after vaccination. Similarly, the concentrations of antibodies in persons with measles history persist for a longer time at a higher level than in vaccinated persons. Our results indicate possible gap in measles protection in adults born after implementation of vaccination into the National Immunization Programs. There are two probable reasons, decrease of measles antibody seropositivity in time after vaccination in setting of limited natural booster and one-dose vaccination schedule used in the first years after implementation.

  7. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; O'Byrne, Megan M; Jacobson, Robert M; Pankratz, V Shane; Poland, Gregory A

    2012-03-09

    Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5, 7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.

  8. Reasons for Non-vaccination among Patients Who Acquired Measles Lessons from the Local Measles Epidemics in Japan

    PubMed Central

    Takahashi, K; Kanda, H; Kim, J-Y

    2014-01-01

    ABSTRACT A survey was conducted at a private general hospital, exploring the reasons why children with measles had missed opportunities for vaccination during the local measles epidemics that occurred in Japan between 1999 and 2003. The responses from parents/guardians of confirmed measles patients (n = 120) indicated the following: more than half of the parents/guardians were too busy or forgot to have their children immunized and 32% refrained from immunization due to anti-vaccine views. Healthcare workers should consider that parents/guardians who are willing to immunize their children may miss opportunities to do so because they are busy, and not because of anti-vaccine attitudes. Healthcare workers should keep in mind that it is important to provide honest information on the potential risks and benefits of the vaccine, while informing parents/guardians of the vaccination schedule. PMID:25803382

  9. Frequency of Measles Virus-Specific CD4+ and CD8+ T Cells in Subjects Seronegative or Highly Seropositive for Measles Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Dhiman, Neelam; Jacobson, Robert M.; Vierkant, Robert A.; Poland, Gregory A.

    2003-01-01

    The protective effect of measles immunization is due to humoral and cell-mediated immune responses. Little is known about cell-mediated immunity (CMI) to measles vaccine virus, the relative contribution of CD4+ and CD8+ T cells to variability in such immune responses, and the immunologic longevity of the CMI after measles vaccination in humans. Our study characterizes cellular immune response in subjects seronegative or highly seropositive for measles vaccine immunoglobulin G-specific antibody, aged 15 to 25 years, previously immunized with two doses of measles-mumps-rubella II vaccine. We evaluated the ability of subjects to respond to measles vaccine virus by measuring measles virus-specific T-cell proliferation. We examined the frequencies of measles virus-specific memory Th1 and Th2 cells by an ELISPOT assay. Our results demonstrated that proliferation of T cells in seronegative subjects was significantly lower than that for highly seropositive subjects (P = 0.003). Gamma interferon (IFN-γ) secretion predominated over interleukin 4 (IL-4) secretion in response to measles virus in both groups. The median frequency of measles virus-reactive CD8+ T cells secreting IFN-γ was 0.09% in seronegative subjects and 0.43% in highly seropositive subjects (P = 0.04). The median frequency of CD4+ T cells secreting IL-4 in response to measles virus was 0.03% in seronegative subjects and 0.09% in highly seropositive subjects (P = 0.005). These data confirm the presence of measles virus-specific cellular immune responses post-measles vaccine immunization in humans. The detection of measles virus-induced IFN-γ and IL-4 production by ELISPOT can be used to identify measles virus-specific low-frequency memory T cells in subjects immunized with measles vaccine. These differences agree in directionality with the observed antibody response phenotype. PMID:12738640

  10. Appetising solutions: an edible vaccine for measles.

    PubMed

    Webster, Diane E; Thomas, Merlin C; Strugnell, Richard A; Dry, Ian B; Wesselingh, Steve L

    2002-05-06

    The cultivation of plants with specific properties has been the foundation of medicine for milennia. Modern biotechnology may one day extend their medicinal uses to include the delivery of vaccines. Edible vaccines that are heat stable, easy to administer and cheap to produce have the potential to redress many of the production, distribution and delivery limitations faced by traditional vaccines. Published data have shown that the concept of an edible vaccine is valid. Transition from a model system into a practical reality still has some way to go, including managing issues of oral tolerance, genetically modified organism safety, and effective vaccine doses. Successful edible vaccines have the potential to transform health policy and practice in both developed and developing countries.

  11. Measles vaccination in humanitarian emergencies: a review of recent practice

    PubMed Central

    2011-01-01

    Background The health needs of children and adolescents in humanitarian emergencies are critical to the success of relief efforts and reduction in mortality. Measles has been one of the major causes of child deaths in humanitarian emergencies and further contributes to mortality by exacerbating malnutrition and vitamin A deficiency. Here, we review measles vaccination activities in humanitarian emergencies as documented in published literature. Our main interest was to review the available evidence focusing on the target age range for mass vaccination campaigns either in response to a humanitarian emergency or in response to an outbreak of measles in a humanitarian context to determine whether the current guidance required revision based on recent experience. Methods We searched the published literature for articles published from January 1, 1998 to January 1, 2010 reporting on measles in emergencies. As definitions and concepts of emergencies vary and have changed over time, we chose to consider any context where an application for either a Consolidated Appeals Process or a Flash Appeal to the UN Central Emergency Revolving Fund (CERF) occurred during the period examined. We included publications from countries irrespective of their progress in measles control as humanitarian emergencies may occur in any of these contexts and as such, guidance applies irrespective of measles control goals. Results Of the few well-documented epidemic descriptions in humanitarian emergencies, the age range of cases is not limited to under 5 year olds. Combining all data, both from preventive and outbreak response interventions, about 59% of cases in reports with sufficient data reviewed here remain in children under 5, 18% in 5-15 and 2% above 15 years. In instances where interventions targeted a reduced age range, several reports concluded that the age range should have been extended to 15 years, given that a significant proportion of cases occurred beyond 5 years of age

  12. Measles Vaccination is Best for Children: The Argument for Relying on Herd Immunity Fails.

    PubMed

    Bester, Johan Christiaan

    2017-08-16

    This article examines an argument which may negatively influence measles vaccination uptake. According to the argument, an individual child in a highly vaccinated society may be better off by being non-vaccinated; the child does not risk vaccine adverse effects and is protected against measles through herd immunity. Firstly, the conclusion of the argument is challenged by showing that herd immunity's protection is unreliable and inferior to vaccination. Secondly, the logic of the argument is challenged by showing that the argument is inherently self-defeating and therefore logically inconsistent. In practice the argument cannot be used to protect children against measles. Measles vaccination is undoubtedly best for children, even in highly vaccinated societies. Only if a medical contraindication to vaccination exists should vaccination be waived in favour of reliance on herd immunity. This places obligations on those who stand in care relationships with the child: parents, healthcare providers, and the state.

  13. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  14. Vaccine-associated measles in the low-incidence country of Korea over a 10-year period.

    PubMed

    Choe, Young June; Eom, Hye Suk; Bae, Geun-Ryang

    2014-01-01

    As the incidence of measles decreases, cases reported as suspected measles will increasingly involve rash associated with measles vaccination itself. In this study, we assessed vaccine-associated measles cases reported in Korea between 2002 and 2012 using a standardized assessment and following by the World Health Organization case definition criteria. We retrospectively analyzed data regarding (i) wild-type measles and (ii) vaccine-associated measles in patients aged 12-23 months. The presence or absence of fever, rash, cough, coryza, conjunctivitis, and Koplik spots were reviewed. Males were more likely to be reported with vaccine-associated measles than with wild-type measles (68% vs. 47%, P < 0.05). The number of patients with wild-type measles peaked between April and July, whereas that of patients with vaccine-associated measles remained relatively constant throughout the year. However, after excluding the cases reported during the 2007 outbreak in Korea, the trend was similar between the two groups. Cough, coryza, and conjunctivitis were more likely to be present in patients with wild-type measles (32-61% vs. 10-43%, P < 0.05); conversely, the absence of these symptoms was noted in most patients with vaccine-associated measles. We therefore conclude that cough, coryza, and conjunctivitis may be useful as key positive findings to distinguish between wild-type measles and vaccine-associated measles infection among 12-23-month-old patients in a country with a low incidence of measles.

  15. Knowledge synthesis of benefits and adverse effects of measles vaccination: the Lasbela balance sheet

    PubMed Central

    2009-01-01

    Background In preparation for a cluster-randomized controlled trial of a community intervention to increase the demand for measles vaccination in Lasbela district of Pakistan, a balance sheet summarized published evidence on benefits and possible adverse effects of measles vaccination. Methods The balance sheet listed: 1) major health conditions associated with measles; 2) the risk among the unvaccinated who contract measles; 3) the risk among the vaccinated; 4) the risk difference between vaccinated and unvaccinated; and 5) the likely net gain from vaccination for each condition. Results Two models revealed very different projections of net gain from measles vaccine. A Lasbela-specific combination of low period prevalence of measles among the unvaccinated, medium vaccination coverage and low vaccine efficacy rate, as revealed by the baseline survey, resulted in less-than-expected gains attributable to vaccination. Modelled on estimates where the vaccine had greater efficacy, the gains from vaccination would be more substantial. Conclusion Specific local conditions probably explain the low rates among the unvaccinated while the high vaccine failure rate is likely due to weaknesses in the vaccination delivery system. Community perception of these realities may have had some role in household decisions about whether to vaccinate, although the major discouraging factor was inadequate access. The balance sheet may be useful as a communication tool in other circumstances, applied to up-to-date local evidence. PMID:19828064

  16. Post-vaccine measles in a child with concomitant influenza, Sicily, Italy, March 2015.

    PubMed

    Tramuto, F; Dones, P; D Angelo, C; Casuccio, N; Vitale, F

    2015-05-21

    We describe the occurrence of measles in an 18 month-old patient in Sicily, Italy, in March 2015, who received the first dose of a measles-containing vaccine seven days before onset of prodromal symptoms. Measles virus infection was confirmed by PCR and detection of specific immunoglobulin; viral genotyping permitted the confirmation of a vaccine-associated illness. The patient had a concurrent influenza virus infection, during a seasonal epidemic outbreak of influenza.

  17. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

    PubMed

    Billeter, M A; Naim, H Y; Udem, S A

    2009-01-01

    An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

  18. MMRV (measles, mumps, rubella, and varicella) vaccine - what you need to know

    MedlinePlus

    ... usually wait until they recover before getting MMRV vaccine. Children who are only mildly ill may usually get ... than getting measles, mumps, rubella, or chickenpox. Most children who get MMRV vaccine do not have any problems with it. Mild ...

  19. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate.

  20. Measles

    MedlinePlus

    Measles is an infectious disease caused by a virus. It spreads easily from person to person. It ... down Tiny white spots inside the mouth Sometimes measles can lead to serious problems. There is no ...

  1. Migration as a risk factor for measles after a mass vaccination campaign, Burkina Faso, 2002.

    PubMed

    Yaméogo, K Robert; Perry, Robert T; Yaméogo, André; Kambiré, Chantal; Kondé, M Kader; Nshimirimana, Déogratias; Kezaala, Robert; Hersh, Bradley S; Cairns, K Lisa; Strebel, Peter

    2005-06-01

    Shortly after a measles supplementary immunization activity (SIA) targeting children from 9 months to 14 years of age that achieved high coverage, Burkina Faso had a large, serologically confirmed measles outbreak. To investigate the causes of this first reported failure of a widely successful measles control strategy we conducted a case-control study. Serologically confirmed measles cases aged > or =9 months at the time of the SIA in 6 heavily affected districts were frequency matched on age to 3 controls recruited from people frequenting health centres in the same districts. Between January and July 2002, 1287 measles cases were reported throughout Burkina Faso. Of the 707 cases that were serologically confirmed, 358 (51%) were from 9 months to 14 years of age and 265 (37%) were > or =15 years of age. Among cases and controls from 9 months to 14 years of age significant risk factors for measles were lack of measles vaccination and, in the unvaccinated, recent travel to Cote d'Ivoire. Of the recent measles cases in Cote d'Ivoire 54% were there when exposed to measles. Among adults, risk factors included non-vaccination and the lack of school attendance during childhood. Vaccine effectiveness was estimated to be 98%. Migration of children between Cote d'Ivoire and Burkina Faso played a major role in the failure of the SIA to interrupt measles transmission. Synchronization of measles control activities should be a high priority in countries with regions where much migration occurs.

  2. The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches

    PubMed Central

    Haralambieva, Iana H; Ovsyannikova, Inna G; Pankratz, V Shane; Kennedy, Richard B; Jacobson, Robert M; Poland, Gregory A

    2013-01-01

    The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development. PMID:23256739

  3. The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; Pankratz, V Shane; Kennedy, Richard B; Jacobson, Robert M; Poland, Gregory A

    2013-01-01

    The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of 'vaccinomics' for novel vaccine development.

  4. Measles

    MedlinePlus

    ... Issues Listen Español Text Size Email Print Share Measles Page Content Article Body Measles was once a common disease among preschool and ... of growing up. This is no longer true. Measles has not been completely eliminated as a childhood ...

  5. Measles vaccination coverage and seroprevalence of anti-measles antibody in south-east Islamic Republic of Iran.

    PubMed

    Izadi, S; Mokhtari-Azad, T; Zahraei, S M

    2015-09-08

    Discrepancies often exist between recorded immunization coverage and the real immunity level in a community. To estimate the vaccination coverage against measles in south-east Islamic Republic of Iran, a crosssectional study was conducted in 3 districts during summer 2011. Using probability proportional to size cluster sampling, 1368 children aged 30-54 months were selected. Serum samples of 663 who had received 2 injections of mumpsmeasles- rubella (MMR) vaccine were checked for anti-measles IgG. Vaccination coverage for the second dose of MMR vaccine was 93.7%. The prevalence of anti-measles IgG in those who had received at least 2 MMR vaccine doses was 94.6%. There was a statistically significant association between the serological results and variables that reflected poor accessibility to health services. Combining serological results with coverage data, the proportion of the community protected against measles was estimated as 88.6%, which was below the limits defined for the measles elimination goals.

  6. Comparative efficacy of a canine distemper-measles and a standard measles vaccine for immunization of rhesus macaques (Macaca mulatta).

    PubMed

    Christe, Kari L; McChesney, Michael B; Spinner, Abigail; Rosenthal, Ann N; Allen, Philip C; Valverde, Celia R; Roberts, Jeffrey A; Lerche, Nicholas W

    2002-10-01

    Measles virus (MV), a highly infective paramyxovirus, has caused sporadic epizootics characterized by high morbidity and increased mortality in nonhuman primates. Measles vaccines for human use, although effective, are cost prohibitive for use in primate colonies. We compared the efficacy of one or two doses of Vanguard D-M, a canine distemper-measles (CD-M) vaccine, with a single dose of Attenuvax, a human measles vaccine. Compared with 81% of animals inoculated with Attenuvax, all animals inoculated with one or two doses of Vanguard developed detectable MV antibodies. One year after immunization, six juveniles from each vaccine group, along with three unvaccinated controls, were challenged with pathogenic MV and were monitored for clinical signs of disease, viremia, viral shedding, and immune response. All uninoculated controls developed clinical disease and viremia, and shed virus in nasopharangeal secretions. Subclinical viremia without viral shedding was identified in two Attenuvax- and two single-dose Vanguard-inoculated animals. Viremia was not detected in any two-dose Vanguard-inoculated animals. Significantly higher neutralization antibody titers were observed in animals receiving Vanguard. Results of this study indicate that Vanguard is at least as efficacious as Attenuvax for protection of rhesus macaques. The considerably lower cost of Vanguard makes vaccination against measles in large breeding colonies economically feasible.

  7. Current vaccination status regarding measles among university students in Dresden, Germany.

    PubMed

    Riemenschneider, Henna; Schübel, Jeannine; Bergmann, Antje; Kugler, Joachim; Voigt, Karen

    2015-12-01

    Germany aimed to eliminate measles by 2015, but vaccination coverage is still insufficient, especially in respect to adolescents and young adults. A cross-sectional survey with 711 students studying a range of subjects showed a high acceptance regarding vaccination. Actual self-reported vaccination rates were lower; only 65.5% of medical students and 25.3%-39.4% of other student groups reported complete vaccination against measles. Of the students, 12.6%-45% did not know their vaccination status. Vaccination acceptance did not correlate with vaccination behavior: accessible vaccination opportunities at universities should be offered.

  8. Effective Vaccine Communication during the Disneyland Measles Outbreak

    PubMed Central

    Broniatowski, David Andre; Hilyard, Karen M.; Dredze, Mark

    2016-01-01

    Vaccine refusal rates have increased in recent years, highlighting the need for effective risk communication, especially over social media. Fuzzy-trace theory predicts that individuals encode bottom-line meaning ("gist") and statistical information ("verbatim") in parallel and that articles expressing a clear gist will be most compelling. We coded news articles (n=4,686) collected during the 2014–2015 Disneyland measles for content including statistics, stories, or opinions containing bottom-line gists regarding vaccines and vaccine-preventable illnesses. We measured the extent to which articles were compelling by how frequently they were shared on Facebook. The most widely shared articles expressed bottom-line opinions, although articles containing statistics were also more likely to be shared than articles lacking statistics. Stories had limited impact on Facebook shares. Results support Fuzzy Trace Theory's predictions regarding the distinct yet parallel impact of categorical gist and statistical verbatim information on public health communication. PMID:27179915

  9. Effective vaccine communication during the disneyland measles outbreak.

    PubMed

    Broniatowski, David A; Hilyard, Karen M; Dredze, Mark

    2016-06-14

    Vaccine refusal rates have increased in recent years, highlighting the need for effective risk communication, especially over social media. Fuzzy-trace theory predicts that individuals encode bottom-line meaning ("gist") and statistical information ("verbatim") in parallel and those articles expressing a clear gist will be most compelling. We coded news articles (n=4581) collected during the 2014-2015 Disneyland measles for content including statistics, stories, or bottom-line gists regarding vaccines and vaccine-preventable illnesses. We measured the extent to which articles were compelling by how frequently they were shared on Facebook. The most widely shared articles expressed bottom-line gists, although articles containing statistics were also more likely to be shared than articles lacking statistics. Stories had limited impact on Facebook shares. Results support Fuzzy Trace Theory's predictions regarding the distinct yet parallel impact of categorical gist and statistical verbatim information on public health communication.

  10. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... sample of the vaccine virus dilution used. (3) On the day of challenge, serum samples shall be obtained... be used in lieu of the 20 dog requirement. A beta value of 0.05 and a tolerance level of 0.78...

  11. Household experience and costs of seeking measles vaccination in rural Guinea-Bissau.

    PubMed

    Byberg, S; Fisker, A B; Rodrigues, A; Balde, I; Enemark, U; Aaby, P; Benn, C S; Griffiths, U K

    2017-01-01

    Children younger than 12 months of age are eligible for childhood vaccines through the public health system in Guinea-Bissau. To limit open vial wastage, a restrictive vial opening policy has been implemented; 10-dose measles vaccine vials are only opened if six or more children aged 9-11 months are present at the vaccination post. Consequently, mothers who bring their child for measles vaccination can be told to return another day. We aimed to describe the household experience and estimate household costs of seeking measles vaccination in rural Guinea-Bissau. Within a national sample of village clusters under demographic surveillance, we interviewed mothers of children aged 9-21 months about their experience with seeking measles vaccination. From information about time and money spent, we calculated household costs of seeking measles vaccination. We interviewed mothers of 1308 children of whom 1043 (80%) had sought measles vaccination at least once. Measles vaccination coverage was 70% (910/1308). Coverage decreased with increasing distance to the health centre. On average, mothers who had taken their child for vaccination took their child 1.4 times. Mean costs of achieving 70% coverage were 2.04 USD (SD 3.86) per child taken for vaccination. Half of the mothers spent more than 2 h seeking vaccination and 11% spent money on transportation. We found several indications of missed opportunities for measles vaccination resulting in suboptimal coverage. The household costs comprised 3.3% of the average monthly income and should be taken into account when assessing the costs of delivering vaccinations. © 2016 John Wiley & Sons Ltd.

  12. Development of Recombinant Measles Virus-Based Vaccines.

    PubMed

    Mühlebach, Michael D; Hutzler, Stefan

    2017-01-01

    This chapter describes the development of recombinant measles virus (MV)-based vaccines starting from plasmid DNA. Live-attenuated measles vaccines are very efficient and safe. Since the availability of a reverse genetic system to manipulate MV genomes and to generate respective recombinant viruses, a considerable number of recombinant viruses has been generated that present antigens of foreign pathogens during MV replication. Thereby, robust humoral and cellular immune responses can be induced, which have shown protective capacity in a substantial number of experiments.For this purpose, the foreign antigen-encoding genes are cloned into additional transcription units of plasmid based full-length MV vaccine strain genomes, which in turn are used to rescue recombinant MV by providing both full-length viral RNA genomes respective anti-genomes together with all protein components of the viral ribonucleoprotein complex after transient transfection of the so-called rescue cells. Infectious centers form among these transfected cells, which allow clonal isolation of single recombinant viruses that are subsequently amplified, characterized in vitro, and then evaluated for their immunogenicity in appropriate preclinical animal models.

  13. Development and evaluation of the TD97 measles virus vaccine

    SciTech Connect

    Suzuki, K.; Morita, M.; Katoh, M.; Kidokoro, M.; Saika, S.; Yoshizawa, S.; Hashizume, S.; Horiuchi, K.; Okabe, N.; Shinozaki, T. )

    1990-11-01

    The TD97 strain vaccine virus was prepared from the Tanabe strain measles virus by low-temperature passages in primary cell cultures and ultraviolet (UV) mutagenesis. The TD97 strain exhibited the following characteristics: highly temperature sensitive, neither multiplying nor forming any plaques at 40 degrees C in Vero cells; genetically stable, maintaining high temperature sensitivity after ten successive passages in CE cells at 30 degrees C or 35 degrees C; and M proteins of this virus about 1 KD slower in mobility in SDS-PAGE than that of the Tanabe strain. The TD97 strain was further confirmed to be attenuated by an inoculation test into primate brain. In field trials, 752 healthy children were inoculated with a live virus vaccine prepared with this strain, and the following results were obtained: the seroconversion rate was 97% (517/533), and the average HI antibody titer was 2(5.2). An antibody-increasing effect was also observed in children who were initially seropositive. In children who seroconverted, the rates of fever were 15.7% (55/351) for 37.5 degrees C or higher and 4.0% (14/351) for 39 degrees C or higher. The rash rate was 7.7% (27/351), and the incidence of local reaction was 5.4% (19/351). The TD97 strain is thus considered to be suitable in use for an attenuated measles vaccine.

  14. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  15. Immune response to 1 and 2 dose regimens of measles vaccine in Pakistani children.

    PubMed

    Hussain, Hamidah; Akram, Dure Samin; Chandir, Subhash; Khan, Aamir J; Memon, Ashraf; Halsey, Neal A

    2013-12-01

    Measles is a significant problem in Pakistan despite vaccine coverage rates reported at 80%. The purpose of this study was to determine the serologic response in children after one dose of measles vaccine at 9 mo versus two doses at 9 and 15 mo of age. From March through December 2006, children were enrolled from immunization clinics and squatter settlements in Karachi. Blood samples were taken from children in Group A at 9-10 mo of age prior to measles vaccine and 8 to 11 weeks later; from children in Group B at 16-17 mo of age after receiving 2 doses of measles vaccine; and from children in Group C who had received at least one dose of measles vaccine by 5 y of age. After the first dose of measles vaccine, 107/147 (73%) of children in Group A were seropositive, 157/180 (87%) of children in Group B were seropositive after two doses and 126/200 (63%) of children in Group C were seropositive at 5 y of age. The post-vaccination geometric mean antibody concentrations were higher in females than males in groups A (irrespective of pre-vaccination antibody levels) and B. The serologic response to one and two doses of measles vaccine was lower in children in Karachi than has been reported in many other countries. Two doses of vaccine were significantly better than one dose. An in-depth investigation is needed to determine the reason for the lower-than-expected protection rates. Differences in immunogenicity between genders need to be further studied. Recent introduction of supplemental measles vaccine doses should help control measles in Pakistan.

  16. Genetic Variants in the IL-4/IL-13 Pathway Influence Measles Vaccine Responses and Vaccine Failure in Children from Mozambique.

    PubMed

    Clifford, Holly D; Hayden, Catherine M; Khoo, Siew-Kim; Naniche, Denise; Mandomando, Inacio M; Zhang, Guicheng; Richmond, Peter; Le Souëf, Peter N

    2017-09-01

    Despite effective measles vaccines, measles still causes severe morbidity and mortality worldwide, particularly in developing countries. The Th2 pathway involving interleukin (IL)-4 and IL-13 cytokines, and their receptor IL-4Rα, play important roles in the Th1/Th2 balance and antibody production. A Th2 skewing of the cytokine milieu may affect vaccine responses. We investigated IL-4, IL-13, and IL-4Rα polymorphisms and their impact on measles IgG responses and measles vaccine failure, in two separate cohorts: 12-month-old Australian children immunized with measles-mumps-rubella vaccine (n = 137) and a case/control cohort of children aged 6 months-14 years from Mozambique, Africa (n = 89), some of whom were vaccinated, but still contracted measles (vaccine failure). We found that IL-4Rα haplotypes for Val75Ile, Ser503Pro, and Arg576Gln were associated with measles IgG in Mozambican children (p = 0.016 and p = 0.032 for Val.Pro.Arg and Val.Ser.Arg, respectively), but not Australian children. IL-4Rα 503Pro was more prevalent in Mozambique vaccine failure cases compared with controls (p = 0.008). We showed that the impact of Th2 genes on measles vaccine responses differs between ethnicities and IL-4Rα polymorphisms may work in combination to affect measles antibody responses and vaccine failure in Mozambican children. Studies in this area are particularly important in developing countries like Mozambique where measles is still a major health issue.

  17. How Can We Identify the Elimination of Infectious Diseases? Experience From an Active Measles Laboratory Surveillance System in the Republic of Korea.

    PubMed

    Yang, Tae Un; Kang, Hae Ji; Eom, Hye Eun; Park, Young-Joon; Park, Ok; Kim, Su Jin; Nam, Jeong-Gu; Kim, Sung Soon; Jeong, Eun Kyeong

    2015-11-01

    Global efforts have markedly decreased the disease burden of vaccine-preventable diseases. Many countries have made considerable progress toward the elimination of measles. As elimination is approached, the very low incidence achieved by high vaccination coverage has underscored the need for a sensitive and timely surveillance system. In the Republic of Korea, an active laboratory surveillance system (ALSS) was implemented to supplement the existing passive surveillance system in 2006. The ALSS connects 5 major commercial laboratories and the national measles reference laboratory, where referred samples with positive or equivocal results are retested. Annually, from 2009 to 2013, 3714 suspected cases were detected through the ALSS, an expansion of 8- to 57-fold, compared with only the passive surveillance system. The ALSS, with its sensitivity and timeliness, is a reasonable strategy to supplement the existing measles surveillance system and to help identify the elimination of measles.

  18. [Effectiveness, population-level effects, and heath economics of measles and rubella vaccination].

    PubMed

    Wichmann, O; Ultsch, B

    2013-09-01

    Vaccination against measles and rubella has been included in national immunization programs worldwide for several decades. In this article, we present the evidence related to the effectiveness of measles and rubella vaccination based on published systematic reviews, and we describe the epidemiological and health economic effects of vaccination at a population level. Several observational studies demonstrate the high effectiveness (> 90 %) of both measles and rubella vaccination. The global measles mortality reduction and the dramatic decrease in rubella and measles incidences after introduction of routine immunization contribute to the very high quality of evidence. The countries of the Americas have proved that it is feasible to eliminate measles and rubella by strengthening infant immunization through routine vaccination services and by conducting supplemental immunization activities in other childhood age groups so as to close immunity gaps. An economic evaluation of measles and rubella vaccination specifically for the healthcare system in Germany does not exist. However, we conducted a systematic review and identified 11 health-economic studies from other industrialized countries and one for a hypothetical industrialized country. Results indicate that vaccination against measles and rubella had either a cost-effective or even a cost-saving potential, which could be assumed with some limitations also for the German setting. In conclusion, there is compelling evidence that the available vaccines are very effective and that measles and rubella elimination is feasible if adequate vaccination strategies are implemented. In Germany, catch-up vaccination programs are urgently needed for children, adolescents, and young adults specifically in the western federal states.

  19. Response to measles-mumps-rubella vaccine in children on dialysis.

    PubMed

    Schulman, S L; Deforest, A; Kaiser, B A; Polinsky, M S; Baluarte, H J

    1992-03-01

    Ten children receiving maintenance dialysis were immunized with the standard dose of measles-mumps-rubella vaccine between 15 and 33 months of age. Immune responses to vaccination were determined using commercially available enzyme-linked immunosorbent assays for measles, mumps, and rubella viruses. Eight children responded to measles vaccine, 5 to mumps vaccine, 8 to rubella vaccine, and only 3 children to all three vaccines, compared with a seroconversion rate of over 90% to all three vaccines in healthy children (P less than 0.0001). We contend that the relatively poor immunocompetence of our dialysis patients explains their less than optimal vaccine response and suggest that children vaccinated while undergoing dialysis be tested to confirm serological evidence of immunity.

  20. Transport networks and inequities in vaccination: remoteness shapes measles vaccine coverage and prospects for elimination across Africa.

    PubMed

    Metcalf, C J E; Tatem, A; Bjornstad, O N; Lessler, J; O'Reilly, K; Takahashi, S; Cutts, F; Grenfell, B T

    2015-05-01

    Measles vaccination is estimated to have averted 13·8 million deaths between 2000 and 2012. Persisting heterogeneity in coverage is a major contributor to continued measles mortality, and a barrier to measles elimination and introduction of rubella-containing vaccine. Our objective is to identify determinants of inequities in coverage, and how vaccine delivery must change to achieve elimination goals, which is a focus of the WHO Decade of Vaccines. We combined estimates of travel time to the nearest urban centre (⩾50 000 people) with vaccination data from Demographic Health Surveys to assess how remoteness affects coverage in 26 African countries. Building on a statistical mapping of coverage against age and geographical isolation, we quantified how modifying the rate and age range of vaccine delivery affects national coverage. Our scenario analysis considers increasing the rate of delivery of routine vaccination, increasing the target age range of routine vaccination, and enhanced delivery to remote areas. Geographical isolation plays a key role in defining vaccine inequity, with greater inequity in countries with lower measles vaccine coverage. Eliminating geographical inequities alone will not achieve thresholds for herd immunity, indicating that changes in delivery rate or age range of routine vaccination will be required. Measles vaccine coverage remains far below targets for herd immunity in many countries on the African continent and is likely to be inadequate for achieving rubella elimination. The impact of strategies such as increasing the upper age range eligible for routine vaccination should be considered.

  1. [Risk factors for delayed or missed measles vaccination in young children].

    PubMed

    Schönberger, K; Grote, V; von Kries, R; Kalies, H

    2009-11-01

    Because of low measles vaccine coverage rates, measles outbreaks have been observed several times during recent years in Germany. The aim of this study is to identify parents' attitudes and beliefs towards immunisations and socio-economic factors which are associated with delayed or missed first measles vaccination in young children. We used data from a representative German-wide immunisation survey on 2116 children born between 1 January 2002 and December 2004 by collecting precise vaccination information from vaccination cards. The influence of socio-economic determinants and parental attitudes towards immunisations on the timing of the first measles dose was analysed by using multivariable Cox regression. Of these children 46.8% (95% CI: 44.5-49.1) received their first measles dose according to the recommendations of the standing committee on vaccination (STIKO) by month 15. In multivariable analysis, fathers aged 28-33 years and birth order as well as parents' belief in homeopathy and other parental attitudes indicating lack of knowledge about the importance of vaccinations significantly influenced an early immunisation. Not general opposition, but insufficient parental knowledge about the harmfulness of measles infection seemed to be responsible for the low measles vaccination rates.

  2. Multicenter Safety and Immunogenicity Trial of an Attenuated Measles Vaccine for NHP.

    PubMed

    Yee, Joann L; McChesney, Michael B; Christe, Kari L

    2015-10-01

    Measles is a highly contagious viral disease in NHP. The infection can range from asymptomatic to rapidly fatal, resulting in significant morbidity and mortality in captive populations. In addition to appropriate quarantine practices, restricted access, the immunization of all personnel in contact with NHP, and the wearing of protective clothing including face masks, measles immunization further reduces the infection risk. Commercially available measles vaccines are effective for use in NHP, but interruptions in their availability have prevented the implementation of ongoing, consistent vaccination programs. This need for a readily available vaccine led us to perform a broad, multicenter safety and immunogenicity study of another candidate vaccine, MVac (Serum Institute of India), a monovalent measles vaccine derived from live Edmonston-Zagreb strain virus that had been attenuated after 22 passages on human diploid cells.

  3. Measles cases in highly vaccinated population of Novosibirsk, Russia, 2000-2005.

    PubMed

    Atrasheuskaya, A V; Kulak, M V; Neverov, A A; Rubin, S; Ignatyev, G M

    2008-04-16

    While the proportion of measles cases in vaccinees is expected to increase as vaccine coverage increases, such cases must be carefully investigated. The present study was conducted to examine possible contributions to vaccine failures (VFs) and to genetically characterize measles virus (MV) strains circulating in Novosibirsk, Russia during 2000-2005. Totally, 27 adult measles patients admitted to a regional hospital were prospectively enrolled in our study. Genetic characterization of the MV strains revealed circulation of genotypes A, D4 and D6 between 2000 and 2003 years; a genotype D6 MV was associated with the 2005 measles outbreak. Based on IgG avidity testing, half of the vaccinated patients demonstrated evidence of secondary vaccine failure (SVF). Patients, representing both levels of vaccine failure in our study were characterized by the lack of protective titers of neutralizing antibodies against circulating MVs, despite high IgG levels in many cases and high IgG avidity in SVF cases.

  4. Measles outbreak in a community with very low vaccine coverage, the Netherlands.

    PubMed Central

    van den Hof, S.; Meffre, C. M.; Conyn-van Spaendonck, M. A.; Woonink, F.; de Melker, H. E.; van Binnendijk, R. S.

    2001-01-01

    A 1999-2000 measles epidemic in the Netherlands started with an outbreak in an orthodox reformed elementary school with 7% vaccine coverage. The overall attack rate was 37%: 213 clinical cases among the 255 participating pupils (response 62%) and 327 household members. The attack rate ranged from 0% for the oldest groups of pupils to 88% for the youngest, who had not been exposed in previous measles epidemics. None of 25 vaccinated pupils had clinical symptoms. Among pupils with clinical symptoms, the self-reported complication rate was 25%. These data confirm that measles infection causes severe disease and that vaccination is the most effective means of preventing the disease and its complications. The data also show that clusters of persons refraining from vaccination interfere with measles elimination even in populations with very high overall vaccine coverage (96%). PMID:11485681

  5. Multicenter Safety and Immunogenicity Trial of an Attenuated Measles Vaccine for NHP

    PubMed Central

    Yee, JoAnn L; McChesney, Michael B; Christe, Kari L

    2015-01-01

    Measles is a highly contagious viral disease in NHP. The infection can range from asymptomatic to rapidly fatal, resulting in significant morbidity and mortality in captive populations. In addition to appropriate quarantine practices, restricted access, the immunization of all personnel in contact with NHP, and the wearing of protective clothing including face masks, measles immunization further reduces the infection risk. Commercially available measles vaccines are effective for use in NHP, but interruptions in their availability have prevented the implementation of ongoing, consistent vaccination programs. This need for a readily available vaccine led us to perform a broad, multicenter safety and immunogenicity study of another candidate vaccine, MVac (Serum Institute of India), a monovalent measles vaccine derived from live Edmonston–Zagreb strain virus that had been attenuated after 22 passages on human diploid cells. PMID:26473350

  6. Investigation of an outbreak of measles: failure to vaccinate or vaccine failure in a community of predominantly fishermen in Kerala.

    PubMed

    Nujum, Zinia T; Varghese, Sara

    2015-01-01

    Measles outbreaks continue to occur in developing countries. This study attempted to explore the context of an outbreak of measles in a community of predominantly fishermen in Kerala to find out whether the outbreak was the result of a failure to vaccinate or failure of the vaccine itself. A cross sectional study was conducted in Mukkola village of Thiruvananthapuram district, Kerala, India. A total of 215 children of ages between 9 and 35 months were studied. Documented evidence of measles vaccination was available only in 71.6% (65.57-77.62) of the children. The risk factors for not being immunized against measles were being third or higher in birth order and having: a father whose occupation is fishing, low family income, lower parental education, Muslim religion and poor knowledge regarding measles and its vaccine. Of the 215 children studied, 43 had a history of measles. Thirty percent of these 43 children were younger than the age of vaccination. Unvaccinated children, children third or higher in birth order and children of families with more than 5 members had a significantly higher risk of contracting measles. Vaccine effectiveness was 76.6% (95% CI: 75.96-77.99). The prevalence of missed vaccination opportunities was found to be 15.8% (34/215). Even with the relatively low vaccine effectiveness, this outbreak could have been prevented by higher vaccination coverage. Lowering the age at administration of the first dose of measles vaccine needs to be considered. Effective utilization of opportunities for vaccination could enhance coverage and prevent outbreaks in the future.

  7. Paternal education status significantly influences infants' measles vaccination uptake, independent of maternal education status.

    PubMed

    Rammohan, Anu; Awofeso, Niyi; Fernandez, Renae C

    2012-05-08

    Despite increased funding of measles vaccination programs by national governments and international aid agencies, structural factors encumber attainment of childhood measles immunisation to levels which may guarantee herd immunity. One of such factors is parental education status. Research on the links between parental education and vaccination has typically focused on the influence of maternal education status. This study aims to demonstrate the independent influence of paternal education status on measles immunisation. Comparable nationally representative survey data were obtained from six countries with the highest numbers of children missing the measles vaccine in 2008. Logistic regression analysis was applied to examine the influence of paternal education on uptake of the first dose of measles vaccination, independent of maternal education, whilst controlling for confounding factors such as respondent's age, urban/rural residence, province/state of residence, religion, wealth and occupation. The results of the analysis show that even if a mother is illiterate, having a father with an education of Secondary (high school) schooling and above is statistically significant and positively correlated with the likelihood of a child being vaccinated for measles, in the six countries analysed. Paternal education of secondary or higher level was significantly and independently correlated with measles immunisation uptake after controlling for all potential confounders. The influence of paternal education status on measles immunisation uptake was investigated and found to be statistically significant in six nations with the biggest gaps in measles immunisation coverage in 2008. This study underscores the imperative of utilising both maternal and paternal education as screening variables to identify children at risk of missing measles vaccination prospectively.

  8. Paternal education status significantly influences infants’ measles vaccination uptake, independent of maternal education status

    PubMed Central

    2012-01-01

    Background Despite increased funding of measles vaccination programs by national governments and international aid agencies, structural factors encumber attainment of childhood measles immunisation to levels which may guarantee herd immunity. One of such factors is parental education status. Research on the links between parental education and vaccination has typically focused on the influence of maternal education status. This study aims to demonstrate the independent influence of paternal education status on measles immunisation. Methods Comparable nationally representative survey data were obtained from six countries with the highest numbers of children missing the measles vaccine in 2008. Logistic regression analysis was applied to examine the influence of paternal education on uptake of the first dose of measles vaccination, independent of maternal education, whilst controlling for confounding factors such as respondent’s age, urban/rural residence, province/state of residence, religion, wealth and occupation. Results The results of the analysis show that even if a mother is illiterate, having a father with an education of Secondary (high school) schooling and above is statistically significant and positively correlated with the likelihood of a child being vaccinated for measles, in the six countries analysed. Paternal education of secondary or higher level was significantly and independently correlated with measles immunisation uptake after controlling for all potential confounders. Conclusions The influence of paternal education status on measles immunisation uptake was investigated and found to be statistically significant in six nations with the biggest gaps in measles immunisation coverage in 2008. This study underscores the imperative of utilising both maternal and paternal education as screening variables to identify children at risk of missing measles vaccination prospectively. PMID:22568861

  9. The recombinant globular head domain of the measles virus hemagglutinin protein as a subunit vaccine against measles.

    PubMed

    Lobanova, Liubov M; Eng, Nelson F; Satkunarajah, Malathy; Mutwiri, George K; Rini, James M; Zakhartchouk, Alexander N

    2012-04-26

    Despite the availability of live attenuated measles virus (MV) vaccines, a large number of measles-associated deaths occur among infants in developing countries. The development of a measles subunit vaccine may circumvent the limitations associated with the current live attenuated vaccines and eventually contribute to global measles eradication. Therefore, the goal of this study was to test the feasibility of producing the recombinant globular head domain of the MV hemagglutinin (H) protein by stably transfected human cells and to examine the ability of this recombinant protein to elicit MV-specific immune responses. The recombinant protein was purified from the culture supernatant of stably transfected HEK293T cells secreting a tagged version of the protein. Two subcutaneous immunizations with the purified recombinant protein alone resulted in the production of MV-specific serum IgG and neutralizing antibodies in mice. Formulation of the protein with adjuvants (polyphosphazene or alum) further enhanced the humoral immune response and in addition resulted in the induction of cell-mediated immunity as measured by the production of MV H-specific interferon gamma (IFN-γ) and interleukin 5 (IL-5) by in vitro re-stimulated splenocytes. Furthermore, the inclusion of polyphosphazene into the vaccine formulation induced a mixed Th1/Th2-type immune response. In addition, the purified recombinant protein retained its immunogenicity even after storage at 37°C for 2 weeks.

  10. A measles outbreak in a middle school with high vaccination coverage and evidence of prior immunity among cases, Beijing, P.R. China.

    PubMed

    Ma, Rui; Lu, Li; Zhangzhu, Jiazi; Chen, Meng; Yu, Xiali; Wang, Fengshuang; Peng, Xiaoran; Wu, Jiang

    2016-04-04

    Age-appropriate receipt of ≥ 2 measles-containing vaccine (MCV) doses has been considered evidence of immunity against measles. Transmission of measles is rarely reported among such persons. We report a measles outbreak in a middle school in Beijing that has high coverage with ≥ 2 documented MCV doses. History of previous measles and documentation of MCV receipt were collected for all individuals. Cases were identified by active surveillance and confirmed by laboratory tests. Measles immunoglobulin G (IgG) titers and clinical presentations were obtained for each case. Of 1331 individuals without a prior history of measles, 1172 (88.1% [95%CI:86.4-91.5%]) and 1078 (81.0% [95%CI:78.9-83.1%]) had age-appropriate receipt of ≥ 2 MCV doses by domestic and U.S. CDC/ACIP criteria, respectively. Thirteen measles cases occurred in the outbreak. The index case and 3 secondary cases were students. The 9 tertiary cases included 2 teachers and 7 students. All 11 student cases received ≥ 2 age-appropriate MCV doses by Chinese domestic criteria; 8 were age-appropriately vaccinated by U.S. CDC/ACIP criteria. Measles IgG was detected during the acute phase of measles for all but 2 cases -the first case and 1 tertiary case. Among students with age-appropriate receipt of ≥ 2 MCV doses, the length of time since the last MCV was significantly associated with risk of measles: for the 1172 students, the risk was 4.6 [OR5.6;95%CI:1.4-22.9] and 5.5 [OR6.5;95%CI:1.4-29.8] times higher when the last MCV dose was 5-9 years and ≥ 10 years prior, respectively, compared with <5 years prior; for the 1078 students, the risk was 4.1 [OR5.1;95%CI:1.3-20.7] times higher when the last MCV dose was 5-9 years prior compared with <5 years prior. This is the first report from China showing measles transmission among persons with prior evidence of immunity. Secondary vaccine failure may have played an important role in measles transmission. Further laboratory surveillance is needed to assess the

  11. Immunogenicity of a recombinant measles HIV-1 subtype C vaccine.

    PubMed

    Stebbings, Richard; Li, Bo; Lorin, Clarisse; Koutsoukos, Marguerite; Février, Michèle; Mee, Edward T; Page, Mark; Almond, Neil; Tangy, Frédéric; Voss, Gérald

    2013-12-09

    The HIV epidemic is greatest in Sub-Saharan Africa and India where HIV-1 subtype C is predominant. To control the spread of HIV in these parts of the world a preventive HIV-1 subtype C vaccine is urgently required. Here we report the immunogenicity of a candidate HIV-1 subtype C vaccine delivered by a recombinant measles vector carrying an insert encoding HIV-1 subtype C Gag, RT and Nef (MV1-F4), in MHC-typed non-human primates. HIV-1 specific cytokine secreting CD4+ and CD8+ T cell responses were detected in 15 out of 16 vaccinees. These HIV-specific T cell responses persisted in lymphoid tissues. Anti-HIV-1 antibody responses were detected in 15 out of 16 vaccinees and titres were boosted by a second immunisation carried out 84 days later. These findings support further exploration of the MV1-F4 vector as a candidate HIV-1 subtype C vaccine or as part of a wider vaccine strategy. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Strategic planning for measles control: using data to inform optimal vaccination strategies.

    PubMed

    Simons, Emily; Mort, Molly; Dabbagh, Alya; Strebel, Peter; Wolfson, Lara

    2011-07-01

    In response to repeated requests for assistance in evaluating the health benefit and cost implications of adjustments to national measles immunization strategies, the World Health Organization (WHO) has developed the Measles Strategic Planning (MSP) tool to harness routinely available data to estimate effectiveness and cost effectiveness of vaccination strategies. The MSP tool estimates measles incidence and mortality through a country-specific cohort model, using a probability of infection dependent on population immunity levels. This method approximates measles transmission dynamics without requiring detailed data that would prohibit use in low- and middle-income countries. Coupled with cost data, the tool estimates incremental costs and cost effectiveness of user-defined vaccination strategies over 5-10 year planning periods. The MSP tool produces valid estimates of measles incidence in settings with low to moderate vaccination coverage. Early adopters report that the tool facilitates decision making by minimizing the amount of time required to assess the impact of vaccination strategies on population immunity. By clearly illustrating what vaccination strategies can effectively protect against measles at the least cost to immunization programs, the MSP tool supports evidence-based decision making for effective and comprehensive measles control. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.

  13. Spotlight on measles in Italy: why outbreaks of a vaccine-preventable infection continue in the 21st century.

    PubMed

    Piccirilli, Giulia; Lazzarotto, Tiziana; Chiereghin, Angela; Serra, Laura; Gabrielli, Liliana; Lanari, Marcello

    2015-03-01

    Measles is a serious infectious disease that can lead to significant morbidity and mortality. Remarkable progress has been made through measles vaccination in reducing the number of people dying from measles. In the last years, concerns about the safety of vaccines have led to decline in immunization coverage rates and new outbreaks of measles in many European countries, including Italy. We believe that it is important to reinforce the message that measles vaccine is safe and highly effective through appropriate information campaigns and public awareness.

  14. Association Between Vaccine Refusal and Vaccine-Preventable Diseases in the United States: A Review of Measles and Pertussis.

    PubMed

    Phadke, Varun K; Bednarczyk, Robert A; Salmon, Daniel A; Omer, Saad B

    2016-03-15

    Parents hesitant to vaccinate their children may delay routine immunizations or seek exemptions from state vaccine mandates. Recent outbreaks of vaccine-preventable diseases in the United States have drawn attention to this phenomenon. Improved understanding of the association between vaccine refusal and the epidemiology of these diseases is needed. To review the published literature to evaluate the association between vaccine delay, refusal, or exemption and the epidemiology of measles and pertussis, 2 vaccine-preventable diseases with recent US outbreaks. Search of PubMed through November 30, 2015, for reports of US measles outbreaks that have occurred since measles was declared eliminated in the United States (after January 1, 2000), endemic and epidemic pertussis since the lowest point in US pertussis incidence (after January 1, 1977), and for studies that assessed disease risk in the context of vaccine delay or exemption. We identified 18 published measles studies (9 annual summaries and 9 outbreak reports), which described 1416 measles cases (individual age range, 2 weeks-84 years; 178 cases younger than 12 months) and more than half (56.8%) had no history of measles vaccination. Of the 970 measles cases with detailed vaccination data, 574 cases were unvaccinated despite being vaccine eligible and 405 (70.6%) of these had nonmedical exemptions (eg, exemptions for religious or philosophical reasons, as opposed to medical contraindications; 41.8% of total). Among 32 reports of pertussis outbreaks, which included 10,609 individuals for whom vaccination status was reported (age range, 10 days-87 years), the 5 largest statewide epidemics had substantial proportions (range, 24%-45%) of unvaccinated or undervaccinated individuals. However, several pertussis outbreaks also occurred in highly vaccinated populations, indicating waning immunity. Nine reports (describing 12 outbreaks) provided detailed vaccination data on unimmunized cases; among 8 of these outbreaks

  15. Measles

    MedlinePlus

    ... the period 2012-2020. The Plan provides clear strategies for country immunization managers, working with domestic and international partners, to achieve the 2015 and 2020 measles and rubella control and elimination goals. By the end of 2015 ...

  16. [Microbiological Surveillance of Measles and Rubella in Spain. Laboratory Network].

    PubMed

    Echevarría, Juan Emilio; Fernández García, Aurora; de Ory, Fernando

    2015-01-01

    The Laboratory is a fundamental component on the surveillance of measles and rubella. Cases need to be properly confirmed to ensure an accurate estimation of the incidence. Strains should be genetically characterized to know the transmission pattern of these viruses and frequently, outbreaks and transmission chains can be totally discriminated only after that. Finally, the susceptibility of the population is estimated on the basis of sero-prevalence surveys. Detection of specific IgM response is the base of the laboratory diagnosis of these diseases. It should be completed with genomic detection by RT-PCR to reach an optimal efficiency, especially when sampling is performed early in the course of the disease. Genotyping is performed by genomic sequencing according to reference protocols of the WHO. Laboratory surveillance of measles and rubella in Spain is organized as a net of regional laboratories with different capabilities. The National Center of Microbiology as National Reference Laboratory (NRL), supports regional laboratories ensuring the availability of all required techniques in the whole country and watching for the quality of the results. The NRL is currently working in the implementation of new molecular techniques based on the analysis of genomic hypervariable regions for the strain characterization at sub-genotypic levels and use them in the surveillance.

  17. Impact of vaccination on the incidence of measles in Mozambique in the period 2000 to 2011.

    PubMed

    Muloliwa, Artur Manuel; Camacho, Luiz Antonio Bastos; Verani, José Fernando Souza; Simões, Taynãna César; Dgedge, Martinho do Carmo

    2013-02-01

    The aim of this study was to contribute to the better planning of measles elimination actions in Mozambique, by considering the impact of vaccination actions over the period 2000 to 2011. Descriptive and ecological studies and case records made available by the Ministry of Health were used to analyze measles vaccination coverage. Statistical analysis was performed using time series and spatial analysis. Vaccine coverage rates ranged from 82% to 99%. Coverage rates in Maputo city were under 70% and in Niassa province they were over 100%. Coverage showed a clustered pattern in the districts. The measles incidence rate was 1.58 per 100,000 inhabitants (0.00-40.08 per 100,000 inhabitants); districts bordering neighboring countries presented high incidence rates. Although measles morbidity and mortality has decreased in Mozambique, vaccine coverage has been insufficient to interrupt measles transmission. Enhanced surveillance, including investigation of cases and outbreaks, and improvements in measles vaccination are recommended in order to achieve a homogenous coverage rate of ≥ 95% for both routine and mass vaccination campaigns.

  18. Molecular relationship between field and vaccine strain of measles virus and its persistence in Pakistan

    PubMed Central

    2012-01-01

    Background Countrywide 5.9 million, 0-11 Month old children are immunized annually by EPI (Expended Program on Immunization) against 8 vaccine preventable diseases including measles and so on. Unfortunately the basic immunity centers are not uniform throughout the country. Each center provides services to about 27000 people which is inadequate. The purpose of this study was to explore the development of EPI Pakistan in terms of immunization of measles. Methods Nucleotide sequences were analyzed by neighbor joining method (bootstrap test) using Bio- edit and MEGA-5 software to find evolutionary relationship between wild type measles strain and vaccine strain (Edmonston strain) used in Pakistan. For statistical analysis of data SPSS 16 was used. Results Currently 1.3 vaccinators are working at each U C (union council) which according to national EPI policy should be at least 2. About 56% and 44% children of age 0-11 months did not received second dose of measles in the last two years respectively. Out of these 4231 cases which were reported last year, 1370 have received their first dose of measles vaccine. Conclusion Seroconversion and seroprevalence study of the vaccine and field strain of measles virus is needed to confirm whether its failure is due to service unavailability or vaccine in-affectivity. PMID:22284834

  19. Impact of changing the measles vaccine vial size on Niger's vaccine supply chain: a computational model.

    PubMed

    Assi, Tina-Marie; Brown, Shawn T; Djibo, Ali; Norman, Bryan A; Rajgopal, Jayant; Welling, Joel S; Chen, Sheng-I; Bailey, Rachel R; Kone, Souleymane; Kenea, Hailu; Connor, Diana L; Wateska, Angela R; Jana, Anirban; Wisniewski, Stephen R; Van Panhuis, Willem G; Burke, Donald S; Lee, Bruce Y

    2011-06-02

    Many countries, such as Niger, are considering changing their vaccine vial size presentation and may want to evaluate the subsequent impact on their supply chains, the series of steps required to get vaccines from their manufacturers to patients. The measles vaccine is particularly important in Niger, a country prone to measles outbreaks. We developed a detailed discrete event simulation model of the vaccine supply chain representing every vaccine, storage location, refrigerator, freezer, and transport device (e.g., cold trucks, 4 × 4 trucks, and vaccine carriers) in the Niger Expanded Programme on Immunization (EPI). Experiments simulated the impact of replacing the 10-dose measles vial size with 5-dose, 2-dose and 1-dose vial sizes. Switching from the 10-dose to the 5-dose, 2-dose and 1-dose vial sizes decreased the average availability of EPI vaccines for arriving patients from 83% to 82%, 81% and 78%, respectively for a 100% target population size. The switches also changed transport vehicle's utilization from a mean of 58% (range: 4-164%) to means of 59% (range: 4-164%), 62% (range: 4-175%), and 67% (range: 5-192%), respectively, between the regional and district stores, and from a mean of 160% (range: 83-300%) to means of 161% (range: 82-322%), 175% (range: 78-344%), and 198% (range: 88-402%), respectively, between the district to integrated health centres (IHC). The switch also changed district level storage utilization from a mean of 65% to means of 64%, 66% and 68% (range for all scenarios: 3-100%). Finally, accounting for vaccine administration, wastage, and disposal, replacing the 10-dose vial with the 5 or 1-dose vials would increase the cost per immunized patient from $0.47US to $0.71US and $1.26US, respectively. The switch from the 10-dose measles vaccines to smaller vial sizes could overwhelm the capacities of many storage facilities and transport vehicles as well as increase the cost per vaccinated child.

  20. Impact of changing the measles vaccine vial size on Niger's vaccine supply chain: a computational model

    PubMed Central

    2011-01-01

    Background Many countries, such as Niger, are considering changing their vaccine vial size presentation and may want to evaluate the subsequent impact on their supply chains, the series of steps required to get vaccines from their manufacturers to patients. The measles vaccine is particularly important in Niger, a country prone to measles outbreaks. Methods We developed a detailed discrete event simulation model of the vaccine supply chain representing every vaccine, storage location, refrigerator, freezer, and transport device (e.g., cold trucks, 4 × 4 trucks, and vaccine carriers) in the Niger Expanded Programme on Immunization (EPI). Experiments simulated the impact of replacing the 10-dose measles vial size with 5-dose, 2-dose and 1-dose vial sizes. Results Switching from the 10-dose to the 5-dose, 2-dose and 1-dose vial sizes decreased the average availability of EPI vaccines for arriving patients from 83% to 82%, 81% and 78%, respectively for a 100% target population size. The switches also changed transport vehicle's utilization from a mean of 58% (range: 4-164%) to means of 59% (range: 4-164%), 62% (range: 4-175%), and 67% (range: 5-192%), respectively, between the regional and district stores, and from a mean of 160% (range: 83-300%) to means of 161% (range: 82-322%), 175% (range: 78-344%), and 198% (range: 88-402%), respectively, between the district to integrated health centres (IHC). The switch also changed district level storage utilization from a mean of 65% to means of 64%, 66% and 68% (range for all scenarios: 3-100%). Finally, accounting for vaccine administration, wastage, and disposal, replacing the 10-dose vial with the 5 or 1-dose vials would increase the cost per immunized patient from $0.47US to $0.71US and $1.26US, respectively. Conclusions The switch from the 10-dose measles vaccines to smaller vial sizes could overwhelm the capacities of many storage facilities and transport vehicles as well as increase the cost per vaccinated child. PMID

  1. [Measles vaccination by the aerosol method in Mexico].

    PubMed

    Fernández-de Castro, J; Kumate-Rodríguez, J; Sepúlveda, J; Ramírez-Isunza, J M; Valdespino-Gómez, J L

    1997-01-01

    The present work describes the anti-measles vaccination program by the inhaled aerosol method undertaken in Mexico between 1988 and 1990. Detailed descriptions are given of the equipment, staff, training programs, promotion and campaigns. The vaccine is specified: Edmonston-Zagreb strain cultured in diploid cells at the Instituto Nacional de Virología of the Secretaría de Salud in Mexico with titres varying from 1045 plaque forming units (PFU/ml) to 1048 PFU/ml administered in a 30 sec inhalation with aerosol. During this exposure period, 2800 to 4000 PFU per child are estimated to enter the child, of which approximately 25% is the retained doses, i.e. 700 to 1000 PFU/child. A total of 3760684 children of school and pre-school age have been vaccinated in 13 of the 32 federal entities of the country. No undesirable effects of any importance were observed, and the limited serological and field studies support the effectiveness and security of this method. On the other hand, the method is much cheaper, faster and better accepted by the population than the subcutaneous injection.

  2. Influenza vaccine concurrently administered with a combination measles, mumps, and rubella vaccine to young children.

    PubMed

    Lum, Lucy Chai See; Borja-Tabora, Charissa Fay; Breiman, Robert F; Vesikari, Timo; Sablan, Benjamin P; Chay, Oh Moh; Tantracheewathorn, Taweewong; Schmitt, Heinz-Josef; Lau, Yu-Lung; Bowonkiratikachorn, Piyaporn; Tam, John S; Lee, Bee Wah; Tan, Kah Kee; Pejcz, Jerzy; Cha, Sungho; Gutierrez-Brito, Maricruz; Kaltenis, Petras; Vertruyen, Andre; Czajka, Hanna; Bojarskas, Jurgis; Brooks, W Abdullah; Cheng, Sheau-Mei; Rappaport, Ruth; Baker, Sherryl; Gruber, William C; Forrest, Bruce D

    2010-02-10

    Children aged 11 to <24 months received 2 intranasal doses of live attenuated influenza vaccine (LAIV) or placebo, 35+/-7 days apart. Dose 1 was administered concomitantly with a combined measles, mumps, and rubella vaccine (Priorix). Seroresponses to measles and mumps were similar between groups. Compared with placebo, response rates to rubella in LAIV+Priorix recipients were statistically lower at a 15 IU/mL threshold (83.9% vs 78.0%) and the prespecified noninferiority criteria were not met. In a post hoc analysis using an alternate widely accepted threshold of 10 IU/mL, the noninferiority criteria were met (93.4% vs 89.8%). Concomitant administration with Priorix did not affect the overall influenza protection rate of LAIV (78.4% and 63.8% against antigenically similar influenza strains and any strain, respectively).

  3. The Measles Vaccination Narrative in Twitter: A Quantitative Analysis

    PubMed Central

    Radzikowski, Jacek; Jacobsen, Kathryn H; Croitoru, Arie; Crooks, Andrew; Delamater, Paul L

    2016-01-01

    Background The emergence of social media is providing an alternative avenue for information exchange and opinion formation on health-related issues. Collective discourse in such media leads to the formation of a complex narrative, conveying public views and perceptions. Objective This paper presents a study of Twitter narrative regarding vaccination in the aftermath of the 2015 measles outbreak, both in terms of its cyber and physical characteristics. We aimed to contribute to the analysis of the data, as well as presenting a quantitative interdisciplinary approach to analyze such open-source data in the context of health narratives. Methods We collected 669,136 tweets referring to vaccination from February 1 to March 9, 2015. These tweets were analyzed to identify key terms, connections among such terms, retweet patterns, the structure of the narrative, and connections to the geographical space. Results The data analysis captures the anatomy of the themes and relations that make up the discussion about vaccination in Twitter. The results highlight the higher impact of stories contributed by news organizations compared to direct tweets by health organizations in communicating health-related information. They also capture the structure of the antivaccination narrative and its terms of reference. Analysis also revealed the relationship between community engagement in Twitter and state policies regarding child vaccination. Residents of Vermont and Oregon, the two states with the highest rates of non-medical exemption from school-entry vaccines nationwide, are leading the social media discussion in terms of participation. Conclusions The interdisciplinary study of health-related debates in social media across the cyber-physical debate nexus leads to a greater understanding of public concerns, views, and responses to health-related issues. Further coalescing such capabilities shows promise towards advancing health communication, thus supporting the design of more

  4. The Measles Vaccination Narrative in Twitter: A Quantitative Analysis.

    PubMed

    Radzikowski, Jacek; Stefanidis, Anthony; Jacobsen, Kathryn H; Croitoru, Arie; Crooks, Andrew; Delamater, Paul L

    2016-01-01

    The emergence of social media is providing an alternative avenue for information exchange and opinion formation on health-related issues. Collective discourse in such media leads to the formation of a complex narrative, conveying public views and perceptions. This paper presents a study of Twitter narrative regarding vaccination in the aftermath of the 2015 measles outbreak, both in terms of its cyber and physical characteristics. We aimed to contribute to the analysis of the data, as well as presenting a quantitative interdisciplinary approach to analyze such open-source data in the context of health narratives. We collected 669,136 tweets referring to vaccination from February 1 to March 9, 2015. These tweets were analyzed to identify key terms, connections among such terms, retweet patterns, the structure of the narrative, and connections to the geographical space. The data analysis captures the anatomy of the themes and relations that make up the discussion about vaccination in Twitter. The results highlight the higher impact of stories contributed by news organizations compared to direct tweets by health organizations in communicating health-related information. They also capture the structure of the antivaccination narrative and its terms of reference. Analysis also revealed the relationship between community engagement in Twitter and state policies regarding child vaccination. Residents of Vermont and Oregon, the two states with the highest rates of non-medical exemption from school-entry vaccines nationwide, are leading the social media discussion in terms of participation. The interdisciplinary study of health-related debates in social media across the cyber-physical debate nexus leads to a greater understanding of public concerns, views, and responses to health-related issues. Further coalescing such capabilities shows promise towards advancing health communication, thus supporting the design of more effective strategies that take into account the complex

  5. Parental migration and children's timely measles vaccination in rural China: a cross-sectional study.

    PubMed

    Tang, Xianyan; Geater, Alan; McNeil, Edward; Zhou, Hongxia; Deng, Qiuyun; Dong, Aihu; Li, Qiao

    2016-07-01

    With the rapid economic development in China, millions of rural residents are migrating to the cities to gain employment, resulting in numerous left-behind children (LBC). Simultaneously, outbreaks of measles continue to occur, yet the effect of parental migration on children's vaccination status is largely unknown. This study aimed to evaluate the association between parental migration and children's timely measles vaccination in rural China, after adjusting for family socio-economic status (SES) indicators. We conducted a cross-sectional survey using multistage sampling among children aged 18-54 months in rural Guangxi of China. Information on measles vaccination status was obtained from the child's vaccination certificate, and data on SES were collected by interviewing the child's primary guardian. Family SES and vaccination coverage were compared between LBC and non-left-behind children (NLBC) using weighted logistic regression, while the delay in vaccination was compared using Kaplan-Meier survival analysis. Of the 1216 study children, 46% were LBC and 54% were NLBC. Compared to NLBC, the coverage of timely measles vaccination was significantly lower, and the median delay period was longer among LBC. After adjusting for SES indicators, LBC were significantly more likely to have an untimely vaccination for their first dose of measles vaccine than NLBC (OR = 1.33, 95% CI = 1.02-1.75). Due to the negative effect of parental migration and family SES, LBC were more likely to encounter serious delays of measles vaccination in rural China. Optimising vaccination policies could facilitate timely vaccination among LBC in rural China. © 2016 John Wiley & Sons Ltd.

  6. Overview of measles and mumps vaccine: origin, present, and future of vaccine production.

    PubMed

    Betáková, T; Svetlíková, D; Gocník, M

    2013-01-01

    Measles and mumps are common viral childhood diseases that can cause serious complications. Vaccination remains the most efficient way to control the spread of these viruses. The manufacturing capability for viral vaccines produced in embryonated hen eggs and conventional/classical cell substrates, such as chicken embryo fibroblast or primary dog kidney cell substrates, is no longer sufficient. This limitation can be overcome by utilizing other recognized cell substrates such as Madin Darby Canine Kidney (MDCK), Chinese Hamster Ovary (CHO), Vero (monkey origin) cells, MRC-5 (human diploid) or as an alternative, introducing new cell substrates of human or avian origin. A very important factor in vaccine production is the safety and immunogenicity of the final vaccine, where the proper choice of cell substrate used for virus propagation is made. All substrates used in vaccine production must be fully characterized to avoid the contamination of hidden unknown pathogens which is difficult to achieve in primary cell substrates.

  7. Public Health and Economic Consequences of Vaccine Hesitancy for Measles in the United States.

    PubMed

    Lo, Nathan C; Hotez, Peter J

    2017-09-01

    Routine childhood vaccination is declining in some regions of the United States due to vaccine hesitancy, which risks the resurgence of many infectious diseases with public health and economic consequences. There are ongoing policy debates on the state and national level, including legislation around nonmedical (personal-belief) exemptions for childhood vaccination and possibly a special government commission on vaccine safety, which may affect vaccine coverage. To estimate the number of measles cases in US children and the associated economic costs under scenarios of different levels of vaccine hesitancy, using the case example of measles, mumps, and rubella (MMR) vaccination and measles. Publicly available data from the US Centers for Disease Control and Prevention were used to simulate county-level MMR vaccination coverage in children (age 2-11 years) in the United States. A stochastic mathematical model was adapted for infectious disease transmission that estimated a distribution for outbreak size as it relates to vaccine coverage. Economic costs per measles case were obtained from the literature. The predicted effects of increasing the prevalence of vaccine hesitancy as well as the removal of nonmedical exemptions were estimated. The model was calibrated to annual measles cases in US children over recent years, and the model prediction was validated using an independent data set from England and Wales. Annual measles cases in the United States and the associated public sector costs. A 5% decline in MMR vaccine coverage in the United States would result in an estimated 3-fold increase in measles cases for children aged 2 to 11 years nationally every year, with an additional $2.1 million in public sector costs. The numbers would be substantially higher if unvaccinated infants, adolescents, and adult populations were also considered. There was variation around these estimates due to the stochastic elements of measles importation and sensitivity of some model

  8. Parental attitudes towards measles vaccination in the canton of Aargau, Switzerland: a latent class analysis.

    PubMed

    Weiss, Carine; Schröpfer, Daniel; Merten, Sonja

    2016-08-11

    Despite the successes of routine national childhood vaccination programmes, measles remains a public health concern. The purpose of this paper is to investigate how patterns of parental attitudes are linked to the decision-making process for or against MMR vaccination. This exploratory study was designed to identify distinct patterns of attitudes towards or against measles vaccination through Latent Class Analysis (LCA) in a sub-sample of mothers living in the canton of Aargau in Switzerland. Parents of young children below 36 months of age were randomly selected through parents' counsellors' registries. Among other questions, respondents were asked to state their agreement in response to 14 belief statements regarding measles vaccination on a 5-point Likert scale. To identify groups of parents showing distinct patterns of attitudes and beliefs regarding measles vaccination, we used Latent Class Analysis (LCA). The LCA showed three classes of parents with different attitudes and believes towards measles vaccination: The biggest group (class 1) are those having positive attitudes towards immunisation, followed by the second biggest group (class 2) which is characterised by having fearful attitudes and by showing uncertainty about immunisation. The third group (class 3) shows distinct patterns of critical attitudes against immunisation. Within this group over 90 % agree or totally agree that immunisation is an artificial intrusion into the natural immune system and therefore want to vaccinate their children only if necessary. We find that parents in the Canton Aargau who hesitate to vaccinate their children against measles, mumps and rubella show distinct opinions and attitudes. Health professionals should be aware of these perceptions to tailor their messages accordingly and positively influence these parents to vaccinate their children. Special attention needs to be given to those parents who are planning to vaccinate their children but are not following the

  9. Case Based Measles Surveillance in Pune: Evidence to Guide Current and Future Measles Control and Elimination Efforts in India

    PubMed Central

    Bose, Anindya Sekhar; Jafari, Hamid; Sosler, Stephen; Narula, Arvinder Pal Singh; Kulkarni, V. M.; Ramamurty, Nalini; Oommen, John; Jadi, Ramesh S.; Banpel, R. V.; Henao-Restrepo, Ana Maria

    2014-01-01

    Background According to WHO estimates, 35% of global measles deaths in 2011 occurred in India. In 2013, India committed to a goal of measles elimination by 2020. Laboratory supported case based measles surveillance is an essential component of measles elimination strategies. Results from a case-based measles surveillance system in Pune district (November 2009 through December 2011) are reported here with wider implications for measles elimination efforts in India. Methods Standard protocols were followed for case identification, investigation and classification. Suspected measles cases were confirmed through serology (IgM) or epidemiological linkage or clinical presentation. Data regarding age, sex, vaccination status were collected and annualized incidence rates for measles and rubella cases calculated. Results Of the 1011 suspected measles cases reported to the surveillance system, 76% were confirmed measles, 6% were confirmed rubella, and 17% were non-measles, non-rubella cases. Of the confirmed measles cases, 95% were less than 15 years of age. Annual measles incidence rate was more than 250 per million persons and nearly half were associated with outbreaks. Thirty-nine per cent of the confirmed measles cases were vaccinated with one dose of measles vaccine (MCV1). Conclusion Surveillance demonstrated high measles incidence and frequent outbreaks in Pune where MCV1 coverage in infants was above 90%. Results indicate that even high coverage with a single dose of measles vaccine was insufficient to provide population protection and prevent measles outbreaks. An effective measles and rubella surveillance system provides essential information to plan, implement and evaluate measles immunization strategies and monitor progress towards measles elimination. PMID:25290339

  10. Comparative studies of measles vaccines in a controlled trial in the USSR*

    PubMed Central

    Bolotovskij, V. M.; Nefedova, L. A.; Gelikman, B. G.; Zargaryants, A. T.; Zetilova, L. P.; Nastasina, K. T.

    1966-01-01

    This paper describes the results of a study of measles vaccines carried out in the USSR on 866 children aged 12-54 months as part of a WHO-sponsored collaborative programme of investigation on live and killed measles vaccines. The live vaccines studied were Beckenham 20, Enders Edmonston B, Milovanović, Schwarz and Smorodincev. Of these, Beckenham 20 caused the most reaction (as assessed by pyrexia and rash) and Milovanović the least. Antibody responses were highest for Beckenham 20 and Schwarz vaccines and for Enders Edmonston vaccine plus gamma-globulin. A study was also made of the effect of one inoculation of Pfizer (killed) vaccine followed by one of Enders Edmonston B or Smorodincev live vaccine; very few reactions were observed in children vaccinated in this way and the antibody response was good. PMID:5296534

  11. Factors affecting the seroconversion rate of 12-month-old babies after the first injection of measles vaccine in the southeast of Iran.

    PubMed

    Zahraei, Seyed Mohsen; Izadi, Shahrokh; Mokhtari-Azad, Talat

    2016-12-01

    Within the past few years, several measles outbreaks have occurred in the southeast of Iran. To learn about the effectiveness of the immunization services for producing a serologic response against measles, this follow-up study was designed and implemented in the southeast of Iran. In Iran, all routine immunization services provided by the public sector are free of charge. The follow-up study was designed and implemented in 5 Urban Health Centers located in 3 districts of Sistan-va-BaluchestanProvince, Iran. In the pre-vaccination phase, 270 12-month-old babies were blood sampled; and in the post-vaccination phase, 4 to 7 weeks after Measles, Mumps, Rubella (MMR) vaccination, 236 of them were blood sampled (34 dropouts), and their sera were tested for IgG anti-measles antibodies, using indirect ELISA, in the National Reference Measles Laboratory. Out of the 236 participants, who had been blood sampled in the post-vaccination phase, 10 (3.7%) were excluded from the calculations of seroconversion rate, because they had protective levels of antibody before the vaccination. The seroconversion rate for the remaining 226 participants was 91.2% (95% confidence interval: 86.7 to 94.5). Among the variables studied, stunting (height-for-age z-score < -2) showed a strong relationship with the remaining seronegative after the vaccination (odds ratio = 5.6; 95% confidence interval: 1.7-18.2). The chance of seroconversion was inversely related to the mothers' levels of education (up to 9 y of education vs. above nine years) (odds ratio = 0.2; 95% confidence interval: 0.06-0.4). In the study population, the seroconversion rates for anti-measles antibodies after MMR vaccination are acceptable, even though in order to achieve the elimination goal, higher standards need to be achieved.

  12. Does Measles Vaccination Reduce the Risk of Acute Respiratory Infection (ARI) and Diarrhea in Children: A Multi-Country Study?

    PubMed Central

    Bawankule, Rahul; Singh, Abhishek; Kumar, Kaushalendra; Shetye, Sadanand

    2017-01-01

    Background Pneumonia and diarrhea occur either as complications or secondary infections in measles affected children. So, the integrated Global Action Plan for Pneumonia and Diarrhea (GAPPD) by WHO and UNICEF includes measles vaccination as preventive measure in children. The objective of the study is to examine the effect of measles vaccination on Acute Respiratory Infection (ARI) and diarrhea in children in the Democratic Republic of Congo, Ethiopia, India, Nigeria, and Pakistan. Methods We analyzed data from the most recent rounds of Demographic and Health Surveys (DHS) in the selected countries. We included children age 12–59 months in the analysis. We used multivariable binary logistic regression to examine the effect of measles vaccination on ARI and diarrhea in children. We also estimated Vaccination Effectiveness (VE). Findings More than 60 percent of the children age 12–59 months were given measles vaccine before the survey in the Democratic Republic of Congo, Ethiopia, India and Pakistan. Children who were given the measles vaccine were less likely to suffer from ARI than unvaccinated children in India and Pakistan. Children who were given the measles vaccine had a lower risk of diarrhea than those who did not receive it in all the selected countries except Ethiopia. Measles vaccination was associated with reduction in ARI cases by 15–30 percent in India and Pakistan, and diarrhea cases by 12–22 percent in the Democratic Republic of Congo, India, Nigeria and Pakistan. Conclusion The receipt of the measles vaccine was associated with decrease in ARI and diarrhea in children. The immunization program must ensure that each child gets the recommended doses of measles vaccine at the appropriate age. The measles vaccination should be given more attention as a preventive intervention under the Global Action Plan for Pneumonia and Diarrhea (GAPPD) in all low and middle-income countries. PMID:28076428

  13. Does Measles Vaccination Reduce the Risk of Acute Respiratory Infection (ARI) and Diarrhea in Children: A Multi-Country Study?

    PubMed

    Bawankule, Rahul; Singh, Abhishek; Kumar, Kaushalendra; Shetye, Sadanand

    2017-01-01

    Pneumonia and diarrhea occur either as complications or secondary infections in measles affected children. So, the integrated Global Action Plan for Pneumonia and Diarrhea (GAPPD) by WHO and UNICEF includes measles vaccination as preventive measure in children. The objective of the study is to examine the effect of measles vaccination on Acute Respiratory Infection (ARI) and diarrhea in children in the Democratic Republic of Congo, Ethiopia, India, Nigeria, and Pakistan. We analyzed data from the most recent rounds of Demographic and Health Surveys (DHS) in the selected countries. We included children age 12-59 months in the analysis. We used multivariable binary logistic regression to examine the effect of measles vaccination on ARI and diarrhea in children. We also estimated Vaccination Effectiveness (VE). More than 60 percent of the children age 12-59 months were given measles vaccine before the survey in the Democratic Republic of Congo, Ethiopia, India and Pakistan. Children who were given the measles vaccine were less likely to suffer from ARI than unvaccinated children in India and Pakistan. Children who were given the measles vaccine had a lower risk of diarrhea than those who did not receive it in all the selected countries except Ethiopia. Measles vaccination was associated with reduction in ARI cases by 15-30 percent in India and Pakistan, and diarrhea cases by 12-22 percent in the Democratic Republic of Congo, India, Nigeria and Pakistan. The receipt of the measles vaccine was associated with decrease in ARI and diarrhea in children. The immunization program must ensure that each child gets the recommended doses of measles vaccine at the appropriate age. The measles vaccination should be given more attention as a preventive intervention under the Global Action Plan for Pneumonia and Diarrhea (GAPPD) in all low and middle-income countries.

  14. Knowledge and risk perception of measles and factors associated with vaccination decisions in subjects consulting university affiliated public hospitals in Lyon, France, after measles infection.

    PubMed

    Toure, Abdoulaye; Saadatian-Elahi, Mitra; Floret, Daniel; Lina, Bruno; Casalegno, Jean-Sebastien; Vanhems, Philippe

    2014-01-01

    In 2011, a large number of European countries faced measles outbreaks, France accounting for more than half of the reported cases. The Rhône-Alpes region, located in south-east France, was one of the most affected provinces, with an incidence rate of 97.9 cases per 100 000 inhabitants. We conducted a retrospective survey of adults and parents of children consulting university affiliated public hospitals because of measles infections between January 1, 2010 and September 2012 in Lyon, France. Our main objectives were to evaluate (1) the level of study population knowledge of measles, (2) vaccination practices, and (3) changes in opinion with regard to measles vaccination after disease onset. Overall, 73.64% of patients were not vaccinated or partially vaccinated. The main reason for non-vaccination in children was inappropriate age while among non-vaccinated adults, 29.3% could not give any reason. In total, 29.1% of the responding parents and 24.2% of adult cases were opposed to vaccination "in principle." A large number of patients did not recognize measles as a serious illness and were unaware of its complications. Among parents of infected children, knowledge of transmission mode (odds ratio [OR] = 5.9; 95% confidence interval [95% CI]: 1.64-21.26), perceived severity of measles (OR = 1.5; 95% CI: 1.06-2.13), and absence of hepatitis B vaccination (OR = 0.17; 95% CI: 0.04-0.65) were independently associated with a more positive opinion about measles vaccination after disease onset. In adult patients, low education level (OR = 3.39; 95% CI: 1.03-11.11) and lack of knowledge of sequelae (OR = 10.19; 95% CI: 1.14-91.31) were linked with a more positive opinion. Individuals affected by vaccine-preventable diseases are interesting populations to study disease impact on vaccine perception.

  15. [Evaluation of the response to vaccination against poliomyelitis and measles in malnourished children in Morocco].

    PubMed

    Caidi, H; Bennis, I F; Mouan, N; El Aouad, R

    2004-01-01

    We made a comparative survey of the poliovirus antibodies (anti-poliovirus type 1, anti-poliovirus type 2 and anti-poliovirus type 3) and the measles antibodies in malnourished but completely vaccinated children (37) and control children (34). The age range was 10 months to 5 years. Immunization in children with protein-energy malnutrition was low for both vaccines. Seroprevalence rates of the polio 1, polio 2, polio 3 antibodies and the measles antibodies in the control group were 94.1%, 97.1%, 91.2% and 82.4% respectively. In malnourished children the respective rates were in some cases significantly lower being: 40.5% (P = 0.001), 59.5% (P = 0.001), 40.5% and 35.1%. Malnutrition is a major determinant of the humoral response to oral polio and measles vaccines and must be given due consideration to prevent vaccination failure.

  16. The causal effect of childhood measles vaccination on educational attainment: A mother fixed-effects study in rural South Africa.

    PubMed

    Anekwe, Tobenna D; Newell, Marie-Louise; Tanser, Frank; Pillay, Deenan; Bärnighausen, Till

    2015-09-11

    Because measles vaccination prevents acute measles disease and morbidities secondary to measles, such as undernutrition, blindness, and brain damage, the vaccination may also lead to higher educational attainment. However, there has been little evidence to support this hypothesis at the population level. In this study, we estimate the causal effect of childhood measles vaccination on educational attainment among children born between 1995 and 2000 in South Africa. We use longitudinal data on measles vaccination status and school grade attainment among 4783 children. The data were collected by the Wellcome Trust Africa Centre Demographic Information System (ACDIS), which is one of Africa's largest health and demographic surveillance systems. ACDIS is located in a poor, predominantly rural, Zulu-speaking community in KwaZulu-Natal, South Africa. Using mother fixed-effects regression, we compare the school grade attainment of siblings who are discordant in their measles vaccination status but share the same mother and household. This fixed-effects approach controls for confounding due to both observed and unobserved factors that do not vary between siblings, including sibling-invariant mother and household characteristics such as attitudes toward risk, conscientiousness, and aspirations for children. We further control for a range of potential confounders that vary between siblings, such as sex of the child, year of birth, mother's age at child's birth, and birth order. We find that measles vaccination on average increases school grade attainment by 0.188 grades (95% confidence interval, 0.0424-0.334; p=0.011). Measles vaccination increased educational attainment in this poor, largely rural community in South Africa. For every five to seven children vaccinated against measles, one additional school grade was gained. The presence of a measles vaccination effect in this community is plausible because (i) measles vaccination prevents measles complications including

  17. The causal effect of childhood measles vaccination on educational attainment: A mother fixed-effects study in rural South Africa

    PubMed Central

    Anekwe, Tobenna D.; Newell, Marie-Louise; Tanser, Frank; Pillay, Deenan; Bärnighausen, Till

    2015-01-01

    Background Because measles vaccination prevents acute measles disease and morbidities secondary to measles, such as undernutrition, blindness, and brain damage, the vaccination may also lead to higher educational attainment. However, there has been little evidence to support this hypothesis at the population level. In this study, we estimate the causal effect of childhood measles vaccination on educational attainment among children born between 1995 and 2000 in South Africa. Methods and findings We use longitudinal data on measles vaccination status and school grade attainment among 4783 children. The data were collected by the Wellcome Trust Africa Centre Demographic Information System (ACDIS), which is one of Africa's largest health and demographic surveillance systems. ACDIS is located in a poor, predominantly rural, Zulu-speaking community in KwaZulu-Natal, South Africa. Using mother fixed-effects regression, we compare the school grade attainment of siblings who are discordant in their measles vaccination status but share the same mother and household. This fixed-effects approach controls for confounding due to both observed and unobserved factors that do not vary between siblings, including sibling-invariant mother and household characteristics such as attitudes toward risk, conscientiousness, and aspirations for children. We further control for a range of potential confounders that vary between siblings, such as sex of the child, year of birth, mother's age at child's birth, and birth order. We find that measles vaccination on average increases school grade attainment by 0.188 grades (95% confidence interval, 0.0424–0.334; p = 0.011). Conclusions Measles vaccination increased educational attainment in this poor, largely rural community in South Africa. For every five to seven children vaccinated against measles, one additional school grade was gained. The presence of a measles vaccination effect in this community is plausible because (i) measles

  18. Measles-Mumps-Rubella vaccine for children with egg allergy: Is admission for inpatient vaccination necessary?

    PubMed

    Tan, M S; Teoh, E J; Hor, C P; Yeoh, A A C

    2016-08-01

    Children who develop any hypersensitivity reaction to eggs are routinely referred to hospital for Measles-Mumps-Rubella (MMR) vaccination as inpatients to prevent anaphylaxis. We aimed to study the association between hypersensitivity reactions after egg exposure and similar reactions after MMR immunisation; and examine the necessity of hospital admission for vaccination. A prospective observational study was conducted in Paediatric Department in Bukit Mertajam Hospital, Penang, between March and December 2014. Children referred from local polyclinics for inpatient MMR vaccination because of a history of egg allergy were recruited. The children were observed in the ward for post vaccination allergic reactions. Concurrently, a group of children without egg allergy was recruited from those admitted for other illnesses but had recent MMR vaccination at polyclinics. Parents of these children were interviewed and asked if they had observed any reactions post vaccination. In both groups, sociodemographics, medical history and family history of atopy were collected. Eighty-seven subjects were recruited in this study. Fifty-four infants with egg allergy had previous mild allergic reactions after exposure to eggs or egg-related products. They were associated with a family history of egg hypersensitivity, personal history of acute gastroenteritis and upper respiratory tract infections. Two of them developed cutaneous rashes post vaccination during observation, but none developed anaphylactic or anaphylactoid reactions. Two infants among those without egg allergy had post vaccination fever. There was no association between egg allergy and hypersensitivity reactions to MMR vaccine (p=0.632). MMR vaccine can be safely administered to children with mild egg allergy, hence admission for vaccination in the hospital is not warranted. Risk stratification is required to ensure only infants with severe reactions will be admitted for vaccination.

  19. Measles Vaccination Coverage among Latino Children Aged 12 to 59 Months in Los Angeles County: A Household Survey.

    ERIC Educational Resources Information Center

    Ewert, Donnell P.; And Others

    1991-01-01

    Examines the results of a household survey of measles vaccination coverage among Hispanic American children aged 12 to 59 months. Between 81 percent and 91 percent of the children have been vaccinated, a percentage insufficient to stop the high rate of measles transmission within this population. Recommends that public health efforts be focused on…

  20. Measles Vaccination Coverage among Latino Children Aged 12 to 59 Months in Los Angeles County: A Household Survey.

    ERIC Educational Resources Information Center

    Ewert, Donnell P.; And Others

    1991-01-01

    Examines the results of a household survey of measles vaccination coverage among Hispanic American children aged 12 to 59 months. Between 81 percent and 91 percent of the children have been vaccinated, a percentage insufficient to stop the high rate of measles transmission within this population. Recommends that public health efforts be focused on…

  1. Waning of Maternal Antibodies Against Measles, Mumps, Rubella, and Varicella in Communities With Contrasting Vaccination Coverage

    PubMed Central

    Waaijenborg, Sandra; Hahné, Susan J. M.; Mollema, Liesbeth; Smits, Gaby P.; Berbers, Guy A. M.; van der Klis, Fiona R. M.; de Melker, Hester E.; Wallinga, Jacco

    2013-01-01

    Background. The combined measles, mumps, and rubella (MMR) vaccine has been successfully administered for >20 years. Because of this, protection by maternal antibodies in infants born to vaccinated mothers might be negatively affected. Methods. A large cross-sectional serologic survey was conducted in the Netherlands during 2006–2007. We compared the kinetics of antibody concentrations in children and women of childbearing age in the highly vaccinated general population with those in orthodox Protestant communities that were exposed to outbreaks. Results. The estimated duration of protection by maternal antibodies among infants in the general population, most of whom were born to vaccinated mothers, was short: 3.3 months for measles, 2.7 months for mumps, 3.9 months for rubella, and 3.4 months for varicella. The duration of protection against measles was 2 months longer for infants born in the orthodox communities, most of whom had unvaccinated mothers. For rubella, mothers in the orthodox communities had higher concentrations of antibodies as compared to the general population. Conclusion. Children of mothers vaccinated against measles and, possibly, rubella have lower concentrations of maternal antibodies and lose protection by maternal antibodies at an earlier age than children of mothers in communities that oppose vaccination. This increases the risk of disease transmission in highly vaccinated populations. PMID:23661802

  2. An evaluation of the 2012 measles mass vaccination campaign in Guinea

    PubMed Central

    Doumtsop, Jean Gerard Tatou; Malano, Emmanuel Roland; Diallo, Ibrahima Telly; Sirimah, Camara

    2014-01-01

    Introduction To estimate the post-campaign level of measles vaccination coverage in Guinea. Methods Interview of parents and observation of measles vaccination cards of children aged 9 to 59 months during the mass measles campaign. A nationwide cluster randomized sample under health District stratification. Results 64.2% (95%CI = 60.9% to 67.4%) of children were vaccinated and had their measles vaccination card. With respect to card and history 90.5% (95%CI = 88.3% to 92.3%) were vaccinated. The estimation was found to be between 72.7% and 81.9%. Coverage with card increased from 55.5% to 79.30% with the level of education of parents but that was not statistically significant, (X2(trend) =3.087 P= 0.07). However coverage with card significantly increased with profession from 55.1% for farmers followed by 59.2% for other manual workers to 73.8% for sellers, ending by 74.5% for settled technicians (X2 (trend) =12.16 P= 0.0005). For unvaccinated children, lack of information accounted for the main reason (37.03%) followed by parents’ occupation (23.45%), parents’ sickness (8.6%), children's sickness (4.9%) and others including vaccinators absent in the post or parents’ belief that it was a door to door campaign. Conclusion The mass measles vaccination campaign achieved an approximate coverage of 75%. Although not enough for effective control of measles, it has covered an important gap left over by the routine immunization coverage 42%. Appropriate measures are needed to improve coverage in routine immunization and specific actions should be taken to target farmers and other manual workers’ families but also uneducated groups for both routine immunization and mass campaigns. PMID:25184021

  3. Epidemiologic and laboratory surveillance of the measles outbreak in the Federation of Bosnia and Herzegovina, February 2014-April 2015.

    PubMed

    Salimović-Bešić, I; Šeremet, M; Hübschen, J M; Hukić, M; Tihić, N; Ahmetagić, S; Delibegović, Z; Pilav, A; Mulaomerović, M; Ravlija, J; Muller, C P; Dedeić-Ljubović, A

    2016-06-01

    A measles outbreak with two epidemic waves involving 4649 probable and laboratory-confirmed cases was recorded in six out of ten cantons of the Federation of Bosnia and Herzegovina between February 2014 and April 2015. The majority of the patients had never received measles vaccination (3115/4649, 67.00%), and the vaccination status of another 23% was unknown (1066/4649). A total of 281 blood samples were tested serologically. Virus detection was performed using 44 nasopharyngeal swabs. About 57% (161/281) of the laboratory-investigated sera were immunoglobulin M positive, and 95% (42/44) of the swabs were reverse transcriptase-PCR positive. Phylogenetic analysis of sequences obtained from 30 swab samples showed circulation of two variants of genotype D8, but no genotype D4 strains as detected in 2007. Similar involvement of all age groups indicates a problem with vaccine refusal resulting from antivaccination activities in addition to gaps in immunization coverage during the war and postwar period (1992-1998). Differences in ethnicity, vaccine coverage, compliance with review policies of vaccination records and potentially also travel habits may partially explain why only six of ten cantons were affected by the outbreak. The second epidemic wave may in part be due to large-scale migrations due to catastrophic floods in 2014. As a result of the epidemic, 6- to 12-month-old children may now be vaccinated against measles during outbreaks, and public health recommendations for interventions have been strengthened. Additional efforts are required to implement the measures throughout the cantons. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

  5. Description of two measles outbreaks in the Lazio Region, Italy (2006-2007). Importance of pockets of low vaccine coverage in sustaining the infection

    PubMed Central

    2010-01-01

    Background Despite the launch of the national plan for measles elimination, in Italy, immunization coverage remains suboptimal and outbreaks continue to occur. Two measles outbreaks, occurred in Lazio region during 2006-2007, were investigated to identify sources of infection, transmission routes, and assess operational implications for elimination of the disease. Methods Data were obtained from several sources, the routine infectious diseases surveillance system, field epidemiological investigations, and molecular genotyping of virus by the national reference laboratory. Results Overall 449 cases were reported, sustained by two different stereotypes overlapping for few months. Serotype D4 was likely imported from Romania by a Roma/Sinti family and subsequently spread to the rest of the population. Serotype B3 was responsible for the second outbreak which started in a secondary school. Pockets of low vaccine coverage individuals (Roma/Sinti communities, high school students) facilitated the reintroduction of serotypes not endemic in Italy and facilitated the measles infection to spread. Conclusions Communities with low vaccine coverage represent a more serious public health threat than do sporadic susceptible individuals. The successful elimination of measles will require additional efforts to immunize low vaccine coverage population groups, including hard-to-reach individuals, adolescents, and young adults. An enhanced surveillance systems, which includes viral genotyping to document chains of transmission, is an essential tool for evaluating strategy to control and eliminate measles PMID:20219143

  6. Optimal vaccine schedules to maintain measles elimination with a two-dose routine policy.

    PubMed

    McKEE, A; Shea, K; Ferrari, M J

    2017-01-01

    Measles was eliminated in the Americas in 2002 by a combination of routine immunizations and supplementary immunization activities. Recent outbreaks underscore the importance of reconsidering vaccine policy in order to maintain elimination. We constructed an age-structured dynamical model for the distribution of immunity in a population with routine immunization and without disease, and analysed the steady state for an idealized age structure and for real age structures of countries in the Americas. We compared the level of immunity maintained by current policy in these countries to the level maintainable by an optimal policy. The optimal age target for the first routine dose of measles vaccine depends on the timing and coverage of both doses. Similarly, the optimal age target for the second dose of measles vaccine depends on the timing and coverage of the first dose. The age targets for the first and second doses of measles vaccine should be adjusted for the post-elimination era, by specifically accounting for current context, including realized coverage of both doses, and altered maternal immunity. Doing so can greatly improve the proportion immune within a population, and therefore the chances of maintaining measles elimination, without changing coverage.

  7. Impact on Epidemic Measles of Vaccination Campaigns Triggered by Disease Outbreaks or Serosurveys: A Modeling Study.

    PubMed

    Lessler, Justin; Metcalf, C Jessica E; Cutts, Felicity T; Grenfell, Bryan T

    2016-10-01

    Routine vaccination supplemented by planned campaigns occurring at 2-5 y intervals is the core of current measles control and elimination efforts. Yet, large, unexpected outbreaks still occur, even when control measures appear effective. Supplementing these activities with mass vaccination campaigns triggered when low levels of measles immunity are observed in a sample of the population (i.e., serosurveys) or incident measles cases occur may provide a way to limit the size of outbreaks. Measles incidence was simulated using stochastic age-structured epidemic models in settings conducive to high or low measles incidence, roughly reflecting demographic contexts and measles vaccination coverage of four heterogeneous countries: Nepal, Niger, Yemen, and Zambia. Uncertainty in underlying vaccination rates was modeled. Scenarios with case- or serosurvey-triggered campaigns reaching 20% of the susceptible population were compared to scenarios without triggered campaigns. The best performing of the tested case-triggered campaigns prevent an average of 28,613 (95% CI 25,722-31,505) cases over 15 y in our highest incidence setting and 599 (95% CI 464-735) cases in the lowest incidence setting. Serosurvey-triggered campaigns can prevent 89,173 (95% CI, 86,768-91,577) and 744 (612-876) cases, respectively, but are triggered yearly in high-incidence settings. Triggered campaigns reduce the highest cumulative incidence seen in simulations by up to 80%. While the scenarios considered in this strategic modeling exercise are reflective of real populations, the exact quantitative interpretation of the results is limited by the simplifications in country structure, vaccination policy, and surveillance system performance. Careful investigation into the cost-effectiveness in different contexts would be essential before moving forward with implementation. Serologically triggered campaigns could help prevent severe epidemics in the face of epidemiological and vaccination uncertainty

  8. A microneedle patch containing measles vaccine is immunogenic in non-human primates.

    PubMed

    Edens, Chris; Collins, Marcus L; Goodson, James L; Rota, Paul A; Prausnitz, Mark R

    2015-09-08

    Very high vaccination coverage is required to eliminate measles, but achieving high coverage can be constrained by the logistical challenges associated with subcutaneous injection. To simplify the logistics of vaccine delivery, a patch containing micron-scale polymeric needles was formulated to encapsulate the standard dose of measles vaccine (1000 TCID₅₀) and the immunogenicity of the microneedle patch was compared with subcutaneous injection in rhesus macaques. The microneedle patch was administered without reconstitution with diluent, dissolved in skin within 10 min, and caused only mild, transient skin erythema. Both groups of rhesus macaques generated neutralizing antibody responses to measles that were consistent with protection and the neutralizing antibody titers were equivalent. In addition, the microneedle patches maintained an acceptable level of potency after storage at elevated temperature suggesting improved thermostability compared to standard lyophilized vaccine. In conclusion, a measles microneedle patch vaccine was immunogenic in non-human primates, and this approach offers a promising delivery method that could help increase vaccination coverage.

  9. A Microneedle Patch Containing Measles Vaccine is Immunogenic in Non-human Primates

    PubMed Central

    Edens, Chris; Collins, Marcus L.; Goodson, James L.; Rota, Paul A.; Prausnitz, Mark R.

    2015-01-01

    Very high vaccination coverage is required to eliminate measles, but achieving high coverage can be constrained by the logistical challenges associated with subcutaneous injection. To simplify logistics of vaccine delivery, a patch containing micron-scale polymeric needles was formulated to encapsulate the standard dose of measles vaccine (1000 TCID50) and the immunogenicity of the microneedle patch was compared with subcutaneous injection in rhesus macaques. The microneedle patch was administered without reconstitution with diluent, dissolved in skin within 10 minutes, and caused only mild, transient skin erythema. Both groups of rhesus macaques generated neutralizing antibody responses to measles that were consistent with protection and the neutralizing antibody titers were equivalent. In addition, the microneedle patches maintained an acceptable level of potency after storage at elevated temperature suggesting improved thermostability compared to standard lyophilized vaccine. In conclusion, a measles microneedle patch vaccine was immunogenic in non-human primates, and this approach offers a promising delivery method that could help increase vaccination coverage. PMID:25770786

  10. Consistency of HLA associations between two independent measles vaccine cohorts: a replication study.

    PubMed

    Ovsyannikova, Inna G; Pankratz, V Shane; Vierkant, Robert A; Jacobson, Robert M; Poland, Gregory A

    2012-03-09

    Associations between HLA genotypes and measles vaccine humoral and cellular immune responses were examined to better understand immunogenetic drivers of vaccine response. Two independent study cohorts of healthy schoolchildren were examined: cohort one, 346 children between 12 and 18 years of age; and cohort two, 388 children between 11 and 19 years of age. All received two age-appropriate doses of measles-containing vaccine. The purpose of this study was to identify and replicate associations between HLA genes and immune responses following measles vaccination found in our first cohort. Associations of comparable magnitudes and with similar p-values were observed between B*3503 (1st cohort p=0.01; 2nd cohort p=0.07), DQA1*0201 (1st cohort p=0.03; 2nd cohort p=0.03), DQB1*0303 (1st cohort p=0.10; 2 cohort p=0.02), DQB1*0602 (1st cohort p=0.07; 2nd cohort p=0.10), and DRB1*0701 (1st cohort p=0.03; 2nd cohort p=0.07) alleles and measles-specific antibody levels. Suggestive, yet consistent, associations were observed between the B7 (1st cohort p=0.01; 2nd cohort p=0.08) supertype and higher measles antibody levels in both cohorts. Also, in both cohorts, the B*0801 and DRB1*0301 alleles, C*0802 and DPA1*0202 alleles, and DRB1*1303 alleles displayed consistent associations with variations in IFN-γ, IL-2 and IL-10 secretion, respectively. This study emphasizes the importance of replicating HLA associations with measles vaccine-induced humoral and cellular immune responses and increases confidence in the results. These data will inform strategies for functional studies and novel vaccine development, including epitope-based measles vaccines. This is the first HLA association replication study with measles vaccine-specific immune responses to date.

  11. Measles Vaccination of Nonhuman Primates Provides Partial Protection against Infection with Canine Distemper Virus

    PubMed Central

    de Vries, Rory D.; Ludlow, Martin; Verburgh, R. Joyce; van Amerongen, Geert; Yüksel, Selma; Nguyen, D. Tien; McQuaid, Stephen; Osterhaus, Albert D. M. E.; Duprex, W. Paul

    2014-01-01

    ABSTRACT Measles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus (CDV). Natural CDV infection causing clinical signs has never been reported in humans, but recent outbreaks in captive macaques have shown that CDV can cause disease in primates. We studied the virulence and tropism of recombinant CDV expressing enhanced green fluorescent protein in naive and measles-vaccinated cynomolgus macaques. In naive animals CDV caused viremia and fever and predominantly infected CD150+ lymphocytes and dendritic cells. Virus was reisolated from the upper and lower respiratory tracts, but infection of epithelial or neuronal cells was not detectable at the time points examined, and the infections were self-limiting. This demonstrates that CDV readily infects nonhuman primates but suggests that additional mutations are necessary to achieve full virulence in nonnatural hosts. Partial protection against CDV was observed in measles-vaccinated macaques, as demonstrated by accelerated control of virus replication and limited shedding from the upper respiratory tract. While neither CDV infection nor MV vaccination induced detectable cross-reactive neutralizing antibodies, MV-specific neutralizing antibody levels of MV-vaccinated macaques were boosted by CDV challenge infection, suggesting that cross-reactive VN epitopes exist. Rapid increases in white blood cell counts in MV-vaccinated macaques following CDV challenge suggested that cross-reactive cellular immune responses were also present. This study demonstrates that zoonotic morbillivirus infections can be controlled by measles vaccination. IMPORTANCE Throughout history viral zoonoses have had a substantial impact on human health. Given the drive toward global eradication of measles, it is essential to

  12. Recombinant Measles AIK-C Vaccine Strain Expressing the prM-E Antigen of Japanese Encephalitis Virus.

    PubMed

    Higuchi, Akira; Toriniwa, Hiroko; Komiya, Tomoyoshi; Nakayama, Tetsuo

    2016-01-01

    An inactivated Japanese encephalitis virus (JEV) vaccine, which induces neutralizing antibodies, has been used for many years in Japan. In the present study, the JEV prM-E protein gene was cloned, inserted at the P/M junction of measles AIK-C cDNA, and an infectious virus was recovered. The JEV E protein was expressed in B95a cells infected with the recombinant virus. Cotton rats were inoculated with recombinant virus. Measles PA antibodies were detected three weeks after immunization. Neutralizing antibodies against JEV developed one week after inoculation, and EIA antibodies were detected three weeks after immunization. The measles AIK-C-based recombinant virus simultaneously induced measles and JEV immune responses, and may be a candidate for infant vaccines. Therefore, the present strategy of recombinant viruses based on a measles vaccine vector would be applicable to the platform for vaccine development.

  13. Effect of age on the risk of Fever and seizures following immunization with measles-containing vaccines in children.

    PubMed

    Rowhani-Rahbar, Ali; Fireman, Bruce; Lewis, Edwin; Nordin, James; Naleway, Allison; Jacobsen, Steven J; Jackson, Lisa A; Tse, Alison; Belongia, Edward A; Hambidge, Simon J; Weintraub, Eric; Baxter, Roger; Klein, Nicola P

    2013-12-01

    IMPORTANCE The first dose of live attenuated measles-containing vaccines is associated with an increased risk of febrile seizures 7 to 10 days following immunization among 12- to 23-month-old children. The combination measles, mumps, rubella, and varicella vaccine is associated with a 2-fold increased risk of febrile seizures 7 to 10 days following immunization compared with the separately administered measles, mumps, and rubella and varicella vaccines. It is unknown whether the magnitude of these increased risks depends on age at immunization. OBJECTIVE To examine the potential modifying effect of age on the risk of fever and seizures following immunization with measles-containing vaccines. DESIGN, SETTING, AND PARTICIPANTS Retrospective cohort study at 8 Vaccine Safety Datalink sites of a total of 840,348 children 12 to 23 months of age who had received a measles-containing vaccine from 2001 through 2011. EXPOSURES Any measles-containing vaccines and measles-containing vaccines by type. MAIN OUTCOMES AND MEASURES Fever and seizure events occurring during a 42-day postimmunization observation period. RESULTS In the analysis of any measles-containing vaccines, the increased risk of seizures during the 7- to 10-day risk interval, using the remainder of the observation period as the control interval, was significantly greater among older children (relative risk, 6.5; 95% CI, 5.3-8.1; attributable risk, 9.5 excess cases per 10,000 doses; 95% CI, 7.6-11.5) than among younger children (relative risk, 3.4; 95% CI, 3.0-3.9; attributable risk = 4.0 excess cases per 10,000 doses; 95% CI, 3.4-4.6). The relative risk of postimmunization fever was significantly greater among older children than among younger children; however, its attributable risk was not. In the analysis of vaccine type, measles, mumps, rubella, and varicella vaccine was associated with a 1.4-fold increase in the risk of fever and 2-fold increase in the risk of seizures compared with measles, mumps, and

  14. Environmental tobacco exposure is associated with vaccine modified measles in junior high school students.

    PubMed

    Suzuki, Shuichi; Sato, Kazuki; Watanabe, Hiroko; Nezu, Yoko; Nishimuta, Toshiyuki

    2015-11-01

    Vaccine modified measles (VMM) affects individuals with attenuated vaccine induced immunity. An outbreak of measles occurred in a junior high school, starting from an unvaccinated eighth-grade student who developed natural measles and affected a majority of students who were immunized with a low potent strain of measles vaccine (TD97). To determine whether environmental tobacco smoke (ETS) exposure was associated with the development of VMM in this population, a questionnaire was used asking whether students had VMM symptoms during the outbreak and the smoking status of family members. VMM was defined in the study population as occurrence of fever and/or erythema, along with documented history of measles vaccination. A total of 513 students (85.9%) responded. Overall, the presence of in-house smokers did not differ between VMM students (49.3%) and non-VMM students (50.2%). However, in the ninth grade, presence of an in-house smoker was significantly higher in the family of VMM students (54.0%) than in non-VMM students (36.6%) (P = 0.044). Urinary cotinine levels were also measured in selected students (n = 37). Among families with at least one smoker, urinary cotinine levels were significantly higher in VMM students than in non-VMM students (P = 0.032). Furthermore, a multivariable logistic regression analysis showed that a high urinary cotinine level (>10 ng/mg creatinine; 13.5 percentile) was associated with the development of VMM. Our findings suggest that a high level of ETS exposure may be associated with an increased risk of VMM in a population with attenuated vaccine induced immunity against measles.

  15. Cluster Survey Evaluation of a Measles Vaccination Campaign in Jharkhand, India, 2012

    PubMed Central

    Scobie, Heather M.; Ray, Arindam; Routray, Satyabrata; Bose, Anindya; Bahl, Sunil; Sosler, Stephen; Wannemuehler, Kathleen; Kumar, Rakesh; Haldar, Pradeep; Anand, Abhijeet

    2015-01-01

    Introduction India was the last country in the world to implement a two-dose strategy for measles-containing vaccine (MCV) in 2010. As part of measles second-dose introduction, phased measles vaccination campaigns were conducted during 2010–2013, targeting 131 million children 9 months to <10 years of age. We performed a post-campaign coverage survey to estimate measles vaccination coverage in Jharkhand state. Methods A multi-stage cluster survey was conducted 2 months after the phase 2 measles campaign occurred in 19 of 24 districts of Jharkhand during November 2011–March 2012. Vaccination status of children 9 months to <10 years of age was documented based on vaccination card or mother’s recall. Coverage estimates and 95% confidence intervals (95% CI) for 1,018 children were calculated using survey methods. Results In the Jharkhand phase 2 campaign, MCV coverage among children aged 9 months to <10 years was 61.0% (95% CI: 54.4–67.7%). Significant differences in coverage were observed between rural (65.0%; 95% CI: 56.8–73.2%) and urban areas (45.6%; 95% CI: 37.3–53.9%). Campaign awareness among mothers was low (51.5%), and the most commonly reported reason for non-vaccination was being unaware of the campaign (69.4%). At the end of the campaign, 53.7% (95% CI: 46.5–60.9%) of children 12 months to <10 years of age received ≥2 MCV doses, while a large proportion of children remained under-vaccinated (34.0%, 95% CI: 28.0–40.0%) or unvaccinated (12.3%, 95% CI: 9.3–16.2%). Conclusions Implementation of the national measles campaign was a significant achievement towards measles elimination in India. In Jharkhand, campaign performance was below the target coverage of ≥90% set by the Government of India, and challenges in disseminating campaign messages were identified. Efforts towards increasing two-dose MCV coverage are needed to achieve the recently adopted measles elimination goal in India and the South-East Asia region. PMID:26010084

  16. Cluster survey evaluation of a measles vaccination campaign in Jharkhand, India, 2012.

    PubMed

    Scobie, Heather M; Ray, Arindam; Routray, Satyabrata; Bose, Anindya; Bahl, Sunil; Sosler, Stephen; Wannemuehler, Kathleen; Kumar, Rakesh; Haldar, Pradeep; Anand, Abhijeet

    2015-01-01

    India was the last country in the world to implement a two-dose strategy for measles-containing vaccine (MCV) in 2010. As part of measles second-dose introduction, phased measles vaccination campaigns were conducted during 2010-2013, targeting 131 million children 9 months to <10 years of age. We performed a post-campaign coverage survey to estimate measles vaccination coverage in Jharkhand state. A multi-stage cluster survey was conducted 2 months after the phase 2 measles campaign occurred in 19 of 24 districts of Jharkhand during November 2011-March 2012. Vaccination status of children 9 months to <10 years of age was documented based on vaccination card or mother's recall. Coverage estimates and 95% confidence intervals (95% CI) for 1,018 children were calculated using survey methods. In the Jharkhand phase 2 campaign, MCV coverage among children aged 9 months to <10 years was 61.0% (95% CI: 54.4-67.7%). Significant differences in coverage were observed between rural (65.0%; 95% CI: 56.8-73.2%) and urban areas (45.6%; 95% CI: 37.3-53.9%). Campaign awareness among mothers was low (51.5%), and the most commonly reported reason for non-vaccination was being unaware of the campaign (69.4%). At the end of the campaign, 53.7% (95% CI: 46.5-60.9%) of children 12 months to <10 years of age received ≥ 2 MCV doses, while a large proportion of children remained under-vaccinated (34.0%, 95% CI: 28.0-40.0%) or unvaccinated (12.3%, 95% CI: 9.3-16.2%). Implementation of the national measles campaign was a significant achievement towards measles elimination in India. In Jharkhand, campaign performance was below the target coverage of ≥ 90% set by the Government of India, and challenges in disseminating campaign messages were identified. Efforts towards increasing two-dose MCV coverage are needed to achieve the recently adopted measles elimination goal in India and the South-East Asia region.

  17. Seroprotection status of hepatitis B and measles vaccines in children with type 1 diabetes mellitus.

    PubMed

    Onal, Zerrin; Ersen, Atilla; Bayramoglu, Elvan; Yaroglu Kazancı, Selcen; Onal, Hasan; Adal, Erdal

    2016-09-01

    Type 1 diabetes mellitus (T1DM) is speculated to have an impaired immunological response to vaccines. This paper aimed to investigate the presence of specific antibodies against hepatitis B virus (HBV) and measles in diabetic children who had been immunized according to the standard national calendar of immunization. Two hundred and one diabetic children and 140 healthy controls were prospectively evaluated. Antibodies against hepatitis B (anti-HBs) and measles were detected in all individuals who completed the vaccination schedule. We noted onset of T1DM, duration of the disease, diabetes-related autoantibodies and mean HbA1c levels. Some 72.6% of diabetics and 82.1% of controls had anti-HBs (+) (p=0.04). We found a reduced efficacy of measles vaccination in anti-HBs (-) diabetic children (p=0.009), even though there was no significant difference between the study and control groups. Onset of the disease was earlier in anti-HBs (-) diabetics than in controls (p=0.038). No difference with respect to other parameters was found. Our data showed a reduced seroprotection rate for HBV vaccination in diabetic children and for measles with anti-HBs (-) diabetics. Larger studies should be encouraged to confirm the vaccine efficacy in diabetic children and to elucidate possible pathogenic mechanisms.

  18. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    ... eyes. Rarely, serious problems can occur with these viruses, including pneumonia, meningitis, deafness and death. Measles, mumps ... have greatly lowered the number of cases. These viruses are still common in parts of the world ...

  19. Evaluation of measles-rubella vaccination for mothers in early puerperal phase.

    PubMed

    Hisano, Michi; Kato, Tatsuo; Inoue, Eisuke; Sago, Haruhiko; Yamaguchi, Koushi

    2016-02-24

    The postpartum period is an ideal opportunity to vaccinate mothers with inadequate immunity to vaccine-preventable diseases including measles and rubella. A prospective study of measles-rubella (MR) vaccination in the early puerperal phase was conducted in 171 mothers, who had insufficient antibody titers when screened for immunity to measles (≤ 1:4 on the neutralization test [NT]) or rubella (≤ 1:16 on the hemagglutination inhibition [HI] test) during pregnancy. To evaluate the efficacy of MR vaccination in the postpartum period, we determined their post-vaccination antibody titers and immune responses to vaccination, and investigated the association between these and their prolactin (PRL) levels and Th1/Th2 ratios at the time of vaccination. We also examined the passage of viral RNA and antigen into breast milk. Of the 169 participants who completed the study schedule, 117 and 101 had low antibody titers against measles and rubella, respectively. In the measles-seronegative group, the antibody-positive rate was 87% on the NT assay, and the NT geometric mean antibody titer was 11.4 (95% confidence interval [CI], 10.0-13.0). In the rubella-seronegative group, the antibody-positive rate was 88% on the HI test assay, and the HI geometric mean antibody titer was 64.0 (95% CI, 53.9-76.0). There was no association between the post-vaccination antibody titers and the PRL levels or Th1/Th2 ratios at the time of vaccination. In the rubella-seronegative group, subjects with higher Th1/Th2 ratios showed higher rates of responsiveness than those with lower ratios (P=0.045). Although measles virus RNA was isolated from the breast milk of two vaccinated mothers, breastfeeding was not associated with clinical disease in any infants. MR vaccination in the early puerperal phase is considered an effective way to prevent the diseases, regardless of the mother's immunological status and hormonal milieu. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Predicting the impact of measles vaccination in England and Wales: model validation and analysis of policy options.

    PubMed Central

    Babad, H. R.; Nokes, D. J.; Gay, N. J.; Miller, E.; Morgan-Capner, P.; Anderson, R. M.

    1995-01-01

    Measles incidence in England and Wales has fallen to an all-time low. Attention is now focused on preventing local outbreaks, and, in the long run, on the elimination of indigenous measles. A realistic age-structured (RAS) mathematical model of measles transmission is used to reconstruct the impact of measles vaccination in England and Wales from 1968 to the present and to evaluate the merits of future policy options. In general, the predictions of the model show good agreement with long-term age stratified case reports and seroprevalence surveys. The model underestimates the proportion of cases that are notified in 0-2-year-old children. However, recent work suggests a high degree of misdiagnosis in this age group. Projections on the basis of the existing vaccination strategy in the UK suggest that the present level of measles vaccine coverage will be insufficient to eliminate small seasonal outbreaks of measles. This result is, however, sensitive to the assumed level of vaccine efficacy. Explorations of a variety of changes to current vaccination strategy favour a 2-dose schedule with the second dose administered at age 4 years irrespective of vaccination history. A vaccination campaign in school-age children, to reduce deficits in herd immunity, would accelerate progress towards measles elimination. PMID:7705494

  1. Measles and rubella vaccination coverage in Haiti, 2012: progress towards verifying and challenges to maintaining measles and rubella elimination.

    PubMed

    Tohme, Rania A; François, Jeannot; Wannemuehler, Kathleen; Magloire, Roc; Danovaro-Holliday, M Carolina; Flannery, Brendan; Cavallaro, Kathleen F; Fitter, David L; Purcell, Nora; Dismer, Amber; Tappero, Jordan W; Vertefeuille, John F; Hyde, Terri B

    2014-09-01

    We conducted a nationwide survey to assess measles containing vaccine (MCV) coverage among children aged 1-9 years in Haiti and identify factors associated with vaccination before and during the 2012 nationwide supplementary immunisation activities (SIA). Haiti was stratified into five geographic regions (Metropolitan Port-au-Prince, North, Centre, South and West), 40 clusters were randomly selected in each region, and 35 households were selected per cluster. Among the 7000 visited households, 75.8% had at least one child aged 1-9 years; of these, 5279 (99.5%) households consented to participate in the survey. Of 9883 children enrolled, 91% received MCV before and/or during the SIA; 31% received MR for the first time during the SIA, and 50.7% received two doses of MCV (one before and one during the 2012 SIA). Among the 1685 unvaccinated children during the SIA, the primary reason of non-vaccination was caregivers not being aware of the SIA (31.0%). Children aged 1-4 years had significantly lower MR SIA coverage than those aged 5-9 years (79.5% vs. 84.8%) (P < 0.0001). A higher proportion of children living in the West (12.3%) and Centre (11.2%) regions had never been vaccinated than in other regions (4.8-9.1%). Awareness, educational level of the mother and region were significantly associated with MR vaccination during and before the SIA (P < 0.001). The 2012 SIA successfully increased MR coverage; however, to maintain measles and rubella elimination, coverage needs to be further increased among children aged 1-4 years and in regions with lower coverage. © 2014 John Wiley & Sons Ltd.

  2. Measles and rubella vaccination coverage in Haiti, 2012: progress towards verifying and challenges to maintaining measles and rubella elimination

    PubMed Central

    Tohme, Rania A.; François, Jeannot; Wannemuehler, Kathleen; Magloire, Roc; Danovaro-Holliday, M. Carolina; Flannery, Brendan; Cavallaro, Kathleen F.; Fitter, David L.; Purcell, Nora; Dismer, Amber; Tappero, Jordan W.; Vertefeuille, John F.; Hyde, Terri B.

    2015-01-01

    Objectives We conducted a nationwide survey to assess measles containing vaccine (MCV) coverage among children aged 1–9 years in Haiti and identify factors associated with vaccination before and during the 2012 nationwide supplementary immunisation activities (SIA). Methods Haiti was stratified into five geographic regions (Metropolitan Port-au-Prince, North, Centre, South and West), 40 clusters were randomly selected in each region, and 35 households were selected per cluster. Results Among the 7000 visited households, 75.8% had at least one child aged 1–9 years; of these, 5279 (99.5%) households consented to participate in the survey. Of 9883 children enrolled, 91% received MCV before and/or during the SIA; 31% received MR for the first time during the SIA, and 50.7% received two doses of MCV (one before and one during the 2012 SIA). Among the 1685 unvaccinated children during the SIA, the primary reason of non-vaccination was caregivers not being aware of the SIA (31.0%). Children aged 1–4 years had significantly lower MR SIA coverage than those aged 5–9 years (79.5% vs. 84.8%) (P < 0.0001). A higher proportion of children living in the West (12.3%) and Centre (11.2%) regions had never been vaccinated than in other regions (4.8–9.1%). Awareness, educational level of the mother and region were significantly associated with MR vaccination during and before the SIA (P < 0.001). Conclusions The 2012 SIA successfully increased MR coverage; however, to maintain measles and rubella elimination, coverage needs to be further increased among children aged 1–4 years and in regions with lower coverage. PMID:25041586

  3. Early childhood measles vaccinations are not associated with paediatric IBD: a population-based analysis.

    PubMed

    Shaw, Souradet Y; Blanchard, James F; Bernstein, Charles N

    2015-04-01

    Early childhood vaccinations have been hypothesized to contribute to the emergence of paediatric inflammatory bowel disease [IBD] in developed countries. Using linked population-based administrative databases, we aimed to explore the association between vaccination with measles-containing vaccines and the risk for IBD. This was a case-control study using the University of Manitoba IBD Epidemiology Database [UMIBDED]. The UMIBDED was linked to the Manitoba Immunization Monitoring System [MIMS], a population-based database of immunizations administered in Manitoba. All paediatric IBD cases in Manitoba, born after 1989 and diagnosed before March 31, 2008, were included. Controls were matched to cases on the basis of age, sex, and region of residence at time of diagnosis. Measles-containing vaccinations received in the first 2 years of life were documented, with vaccinations categorized as 'None' or 'Complete', with completeness defined according to Manitoba's vaccination schedule. Conditional logistic regression models were fitted to the data, with models adjusted for physician visits in the first 2 years of life and area-level socioeconomic status at case date. A total of 951 individuals [117 cases and 834 controls] met eligibility criteria, with average age of diagnosis among cases at 11 years. The proportion of IBD cases with completed vaccinations was 97%, compared with 94% of controls. In models adjusted for physician visits and area-level socioeconomic status, no statistically significant association was detected between completed measles vaccinations and the risk of IBD (adjusted odds ratio [AOR]: 1.5; 95% confidence interval [CI]: 0.5-4.4; p = 0.419]. No significant association between completed measles-containing vaccination in the first 2 years of life and paediatric IBD could be demonstrated in this population-based study. Copyright © 2015 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For

  4. Lack of association between measles virus vaccine and autism with enteropathy: a case-control study.

    PubMed

    Hornig, Mady; Briese, Thomas; Buie, Timothy; Bauman, Margaret L; Lauwers, Gregory; Siemetzki, Ulrike; Hummel, Kimberly; Rota, Paul A; Bellini, William J; O'Leary, John J; Sheils, Orla; Alden, Errol; Pickering, Larry; Lipkin, W Ian

    2008-09-04

    The presence of measles virus (MV) RNA in bowel tissue from children with autism spectrum disorders (ASD) and gastrointestinal (GI) disturbances was reported in 1998. Subsequent investigations found no associations between MV exposure and ASD but did not test for the presence of MV RNA in bowel or focus on children with ASD and GI disturbances. Failure to replicate the original study design may contribute to continued public concern with respect to the safety of the measles, mumps, and rubella (MMR) vaccine. The objective of this case-control study was to determine whether children with GI disturbances and autism are more likely than children with GI disturbances alone to have MV RNA and/or inflammation in bowel tissues and if autism and/or GI episode onset relate temporally to receipt of MMR. The sample was an age-matched group of US children undergoing clinically-indicated ileocolonoscopy. Ileal and cecal tissues from 25 children with autism and GI disturbances and 13 children with GI disturbances alone (controls) were evaluated by real-time reverse transcription (RT)-PCR for presence of MV RNA in three laboratories blinded to diagnosis, including one wherein the original findings suggesting a link between MV and ASD were reported. The temporal order of onset of GI episodes and autism relative to timing of MMR administration was examined. We found no differences between case and control groups in the presence of MV RNA in ileum and cecum. Results were consistent across the three laboratory sites. GI symptom and autism onset were unrelated to MMR timing. Eighty-eight percent of ASD cases had behavioral regression. This study provides strong evidence against association of autism with persistent MV RNA in the GI tract or MMR exposure. Autism with GI disturbances is associated with elevated rates of regression in language or other skills and may represent an endophenotype distinct from other ASD.

  5. Measles outbreak in a poorly vaccinated region in Cameroon: a case series study, public health challenges and recommendations.

    PubMed

    Njim, Tsi; Aminde, Leopold Ndemnge; Feteh, Fambombi Vitalis; Ngum, Joel Mbigha; Moustapha, Chandini Aliyou

    2015-01-01

    Measles is a highly contagious viral infection and still a leading cause of vaccine-preventable deaths in Africa; especially in unvaccinated populations. We reviewed the medical reports of the measles outbreak that occurred in Misaje, in the North west region of Cameroon from 11/03/2015 to 14/05/2015. Six measles cases were recorded during this period; three of them complicated by bacterial infections. Measles should be considered as a differential diagnosis for any febrile rash especially among poorly vaccinated populations. Primary preventive methods implemented by clinicians could help control outbreaks; especially with delays in public health intervention. Also, gaps in health policies in Cameroon should be addressed to scale up vaccination coverage in remote communities like Misaje to reduce the incidence of measles outbreaks.

  6. Introducing combined measles, mumps and rubella vaccine in Chandigarh, India: issues and concerns.

    PubMed

    Bhatnagar, Nidhi; Kaur, Ravneet; Gupta, Madhu; Sharma, Deepak

    2014-06-01

    Cyclical outbreaks of mumps have been noticed across Chandigarh city during winter months. Chandigarh does not provide measles, mumps and rubella (MMR) vaccination in the State immunization schedule. Epidemiological shift in age at diagnosis of mumps was noticed with higher incidence in older children and adults. Increased occurrence of complications can be predicted with this age shift. Silent burden of rubella with serious outcomes in newborns further strengthen the case for MMR vaccine inclusion in routine immunization program of Chandigarh.

  7. Experimental study of a further attenuated live measles vaccine of the Sugiyama strain in Iran

    PubMed Central

    Mirchamsy, H.; Shafyi, A.; Rafyi, M. R.; Bahrami, S.; Nazari, P.; Fatemie, S.

    1974-01-01

    After encouraging results of the mass vaccination programme in Iran, in which 5 million children in rural areas were vaccinated with the Japanese Sugiyama strain at its 82nd passage in baby calf kidney, and a progressive decrease in the incidence of measles as well as a reduction of excessive infant mortality, a further attenuated vaccine, produced with the same strain, cloned in Japan, was compared in a field trial with the parent vaccine. The new strain caused fewer reactions than the original strain. Seroconversion with a geometric mean antibody titre of 6·1 was observed in 95% of susceptible children. PMID:4522721

  8. Factors associated with delayed measles vaccination among children in Shenzhen, China: A case-control study

    PubMed Central

    Lin, Weiyan; Xiong, Yongzhen; Tang, Hao; Chen, Baoli; Ni, Jindong

    2015-01-01

    A delay in the first dose of measles-containing vaccine (MCV1) may contribute to outbreaks of measles, resulting in a high age-specific incidence in infants <1 y of age. To determine the factors associated with delayed MCV1 vaccinations, we used data from the China Information Management System for Immunization Programming. Additionally, the parents/guardians of 430 children whose MCV1 vaccinations were delayed, as well as the parents/guardians of 424 children who received timely vaccinations, were surveyed by telephone. Children were less likely to receive timely MCV1 vaccinations if they belonged to an immigrant group, were male, had poor health status, had a father whose occupation e.g., a manager, had a history of delays in other Expanded Programs on Immunization (EPI) vaccinations, had parents who did not believe vaccinations were important for their children, and experienced shorter travel times to and longer waiting times in EPI clinics. The children of mothers whose occupational status (technician) were more likely to receive timely MCV1 vaccinations. The timeliness of MCV1 vaccinations should be considered as an additional indicator of the quality of vaccination programs. PMID:25668667

  9. Factors associated with delayed measles vaccination among children in Shenzhen, China: a case-control study.

    PubMed

    Lin, Weiyan; Xiong, Yongzhen; Tang, Hao; Chen, Baoli; Ni, Jindong

    2014-01-01

    A delay in the first dose of measles-containing vaccine (MCV1) may contribute to outbreaks of measles, resulting in a high age-specific incidence in infants<1 y of age. To determine the factors associated with delayed MCV1 vaccinations, we used data from the China Information Management System for Immunization Programming. Additionally, the parents/guardians of 430 children whose MCV1 vaccinations were delayed, as well as the parents/guardians of 424 children who received timely vaccinations, were surveyed by telephone. Children were less likely to receive timely MCV1 vaccinations if they belonged to an immigrant group, were male, had poor health status, had a father whose occupation e.g., a manager, had a history of delays in other Expanded Programs on Immunization (EPI) vaccinations, had parents who did not believe vaccinations were important for their children, and experienced shorter travel times to and longer waiting times in EPI clinics. The children of mothers whose occupational status (technician) were more likely to receive timely MCV1 vaccinations. The timeliness of MCV1 vaccinations should be considered as an additional indicator of the quality of vaccination programs.

  10. Seroprevalence of measles, mumps and rubella among young adults, after 20 years of universal 2-dose MMR vaccination in Israel.

    PubMed

    Levine, Hagai; Zarka, Salman; Ankol, Omer E; Rozhavski, Vladi; Davidovitch, Nadav; Aboudy, Yair; Balicer, Ran D

    2015-01-01

    Evidence-based vaccination policy is important for the global and local efforts of achieving control over measles. In 2007, the first Israeli birth cohort to be twice vaccinated during childhood with Measles-Mumps-Rubella vaccine reached adulthood. In parallel, Israel experienced its largest measles outbreak since 1994. We aimed to assess the seroprevalence of measles IgG antibodies and concordance with rubella and mumps seroprevalence among young Israeli adults born 1988-9 in comparison to previous birth cohorts, in order to inform evidence based prevention policy. We conducted a seroprevalence study of IgG antibodies among 439 Israeli adults born in 1988-9, based on a representative sample of sera collected at age 18-19 upon recruitment to mandatory military service in 2007. In total, 85.7% were seropositive for measles as compared with 95.6% in the 1996 recruitment (P < 0.001). The absolute decline was significant both for males (8.8%, P = 0.001) and females (12.1%, P < 0.001). There were no significant differences in seropositivity by gender, years of education, country of birth or smoking status. Rubella seropositivity among measles seropositives was 90.4%, significantly (P < 0.001) higher than 72.1% among measles seronegatives. Mumps seropositivity among measles seropositives was 87.0%, significantly (P < 0.001) higher than 62.3% among measles seronegatives. Results were similar for Israeli-born only. Our findings indicate that measles seroprevalence decreased after the last change in vaccination policy and reach sub-optimal level. Until global eradication is reached, a proactive vaccination program to supplement routine childhood vaccination program should be considered in Israel and in other countries.

  11. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future.

  12. Framework for Optimal Global Vaccine Stockpile Design for Vaccine-Preventable Diseases: Application to Measles and Cholera Vaccines as Contrasting Examples.

    PubMed

    Thompson, Kimberly M; Duintjer Tebbens, Radboud J

    2016-07-01

    Managing the dynamics of vaccine supply and demand represents a significant challenge with very high stakes. Insufficient vaccine supplies can necessitate rationing, lead to preventable adverse health outcomes, delay the achievements of elimination or eradication goals, and/or pose reputation risks for public health authorities and/or manufacturers. This article explores the dynamics of global vaccine supply and demand to consider the opportunities to develop and maintain optimal global vaccine stockpiles for universal vaccines, characterized by large global demand (for which we use measles vaccines as an example), and nonuniversal (including new and niche) vaccines (for which we use oral cholera vaccine as an example). We contrast our approach with other vaccine stockpile optimization frameworks previously developed for the United States pediatric vaccine stockpile to address disruptions in supply and global emergency response vaccine stockpiles to provide on-demand vaccines for use in outbreaks. For measles vaccine, we explore the complexity that arises due to different formulations and presentations of vaccines, consideration of rubella, and the context of regional elimination goals. We conclude that global health policy leaders and stakeholders should procure and maintain appropriate global vaccine rotating stocks for measles and rubella vaccine now to support current regional elimination goals, and should probably also do so for other vaccines to help prevent and control endemic or epidemic diseases. This work suggests the need to better model global vaccine supplies to improve efficiency in the vaccine supply chain, ensure adequate supplies to support elimination and eradication initiatives, and support progress toward the goals of the Global Vaccine Action Plan.

  13. Knowledge and risk perception of measles and factors associated with vaccination decisions in subjects consulting university affiliated public hospitals in Lyon, France, after measles infection

    PubMed Central

    Toure, Abdoulaye; Saadatian-Elahi, Mitra; Floret, Daniel; Lina, Bruno; Casalegno, Jean-Sebastien; Vanhems, Philippe

    2014-01-01

    In 2011, a large number of European countries faced measles outbreaks, France accounting for more than half of the reported cases. The Rhône-Alpes region, located in south-east France, was one of the most affected provinces, with an incidence rate of 97.9 cases per 100 000 inhabitants.   We conducted a retrospective survey of adults and parents of children consulting university affiliated public hospitals because of measles infections between January 1, 2010 and September 2012 in Lyon, France. Our main objectives were to evaluate (1) the level of study population knowledge of measles, (2) vaccination practices, and (3) changes in opinion with regard to measles vaccination after disease onset. Overall, 73.64% of patients were not vaccinated or partially vaccinated. The main reason for non-vaccination in children was inappropriate age while among non-vaccinated adults, 29.3% could not give any reason. In total, 29.1% of the responding parents and 24.2% of adult cases were opposed to vaccination “in principle.” A large number of patients did not recognize measles as a serious illness and were unaware of its complications. Among parents of infected children, knowledge of transmission mode (odds ratio [OR] = 5.9; 95% confidence interval [95% CI]: 1.64–21.26), perceived severity of measles (OR = 1.5; 95% CI: 1.06–2.13), and absence of hepatitis B vaccination (OR = 0.17; 95% CI: 0.04–0.65) were independently associated with a more positive opinion about measles vaccination after disease onset. In adult patients, low education level (OR = 3.39; 95% CI: 1.03–11.11) and lack of knowledge of sequelae (OR = 10.19; 95% CI: 1.14–91.31) were linked with a more positive opinion. Individuals affected by vaccine-preventable diseases are interesting populations to study disease impact on vaccine perception. PMID:24637343

  14. Measles Outbreak Among Previously Immunized Healthcare Workers, the Netherlands, 2014.

    PubMed

    Hahné, Susan J M; Nic Lochlainn, Laura M; van Burgel, Nathalie D; Kerkhof, Jeroen; Sane, Jussi; Yap, Kioe Bing; van Binnendijk, Rob S

    2016-12-15

     We investigated a measles outbreak among healthcare workers (HCWs) by assessing laboratory characteristics, measles vaccine effectiveness, and serological correlates for protection.  Cases were laboratory-confirmed measles in HCWs from hospital X during weeks 12-20 of 2014. We assessed cases' severity and infectiousness by using a questionnaire. We tested cases' sera for measles immunoglobulin M, immunoglobulin G, avidity, and plaque reduction neutralization (PRN). Throat swabs and oral fluid samples were tested by quantitative polymerase chain reaction. We calculated attack rates (ARs) by vaccination status and estimated measles vaccine effectiveness as 1 - [ARvaccinated/ARunvaccinated].  Eight HCWs were notified as measles cases; 6 were vaccinated with measles vaccine twice, 1 was vaccinated once, and 1 was unvaccinated. All 6 twice-vaccinated cases had high avidity and PRN titers. None reported severe measles or onward transmission. Two of 4 investigated twice-vaccinated cases had pre-illness PRN titers of >120 mIU/mL. Among 106 potentially exposed HCWs, the estimated effectiveness of 2 doses of measles vaccine was 52% (95% confidence interval [CI], -207%-93%).  Measles occurred in 6 twice-vaccinated HCWs, despite 2 having adequate pre-exposure neutralizing antibodies. None of the twice-vaccinated cases had severe measles, and none had onward transmission, consistent with laboratory findings suggesting a secondary immune response. Improving 2-dose MMR coverage among HCWs would have likely reduced the size of this outbreak. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Mutual interference on the immune response to yellow fever vaccine and a combined vaccine against measles, mumps and rubella.

    PubMed

    Nascimento Silva, Juliana Romualdo; Camacho, Luiz Antonio B; Siqueira, Marilda M; Freire, Marcos de Silva; Castro, Yvone P; Maia, Maria de Lourdes S; Yamamura, Anna Maya Y; Martins, Reinaldo M; Leal, Maria de Luz F

    2011-08-26

    A randomized trial was conducted to assess the immunogenicity and reactogenicity of yellow fever vaccines (YFV) given either simultaneously in separate injections, or 30 days or more after a combined measles-mumps-rubella (MMR) vaccine. Volunteers were also randomized to YFV produced from 17DD and WHO-17D-213 substrains. The study group comprised 1769 healthy 12-month-old children brought to health care centers in Brasilia for routine vaccination. The reactogenicity was of the type and frequency expected for the vaccines and no severe adverse event was associated to either vaccine. Seroconversion and seropositivity 30 days or more after vaccination against yellow fever was similar across groups defined by YFV substrain. Subjects injected YFV and MMR simultaneously had lower seroconversion rates--90% for rubella, 70% for yellow fever and 61% for mumps--compared with those vaccinated 30 days apart--97% for rubella, 87% for yellow fever and 71% for mumps. Seroconversion rates for measles were higher than 98% in both comparison groups. Geometric mean titers for rubella and for yellow fever were approximately three times higher among those who got the vaccines 30 days apart. For measles and mumps antibodies GMTs were similar across groups. MMR's interference in immune response of YFV and YFV's interference in immune response of rubella and mumps components of MMR had never been reported before but are consistent with previous observations from other live vaccines. These results may affect the recommendations regarding primary vaccination with yellow fever vaccine and MMR. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Recent resurgence of measles in a community with high vaccination coverage.

    PubMed

    Ni, Jin Dong; Xiong, Yong Zhen; Li, Tao; Yu, Xiu Nian; Qian, Bang Qun

    2015-03-01

    Even though 2-dose measles vaccination coverage rate was maintained at more than 95%, the largest measles outbreaks since 1996 still occurred in Wuhu city, P R China. A total of 916 cases were reported during 2005-2010. The annual incidence was 6.7 cases per 100,000 population with the peak incidence of 17.6 cases per 100,000 population in 2008. The highest age-specific incidence rate was 222.1 per 100,000 population and occurred in infants aged between 8 and 12 months; the second was 151.9 per 100,000 population in infants aged <8 months. Also, 200 cases occurred in those aged to 22 to 30 years old, accounting for 21.8% of total cases, with the age-specific incidence being 12.8 per 100,000 population. The characteristics related to age distribution have changed in recent measles outbreaks. It underlines the need for vaccination of susceptible young adults and timely administration of the first dose of the measles vaccine.

  17. Protection of Mice from Fatal Measles Encephalitis by Vaccination with Vaccinia Virus Recombinants Encoding Either the Hemagglutinin or the Fusion Protein

    NASA Astrophysics Data System (ADS)

    Drillien, Robert; Spehner, Daniele; Kirn, Andre; Giraudon, Pascale; Buckland, Robin; Wild, Fabian; Lecocq, Jean-Pierre

    1988-02-01

    Vaccinia virus recombinants encoding the hemagglutinin or fusion protein of measles virus have been constructed. Infection of cell cultures with the recombinants led to the synthesis of authentic measles proteins as judged by their electrophoretic mobility, recognition by antibodies, glycosylation, proteolytic cleavage, and presentation on the cell surface. Mice vaccinated with a single dose of the recombinant encoding the hemagglutinin protein developed antibodies capable of both inhibiting hemagglutination activity and neutralizing measles virus, whereas animals vaccinated with the recombinant encoding the fusion protein developed measles neutralizing antibodies. Mice vaccinated with either of the recombinants resisted a normally lethal intracerebral inoculation of a cell-associated measles virus subacute sclerosing panencephalitis strain.

  18. Reaching hard-to-reach individuals: Nonselective versus targeted outbreak response vaccination for measles.

    PubMed

    Minetti, Andrea; Hurtado, Northan; Grais, Rebecca F; Ferrari, Matthew

    2014-01-15

    Current mass vaccination campaigns in measles outbreak response are nonselective with respect to the immune status of individuals. However, the heterogeneity in immunity, due to previous vaccination coverage or infection, may lead to potential bias of such campaigns toward those with previous high access to vaccination and may result in a lower-than-expected effective impact. During the 2010 measles outbreak in Malawi, only 3 of the 8 districts where vaccination occurred achieved a measureable effective campaign impact (i.e., a reduction in measles cases in the targeted age groups greater than that observed in nonvaccinated districts). Simulation models suggest that selective campaigns targeting hard-to-reach individuals are of greater benefit, particularly in highly vaccinated populations, even for low target coverage and with late implementation. However, the choice between targeted and nonselective campaigns should be context specific, achieving a reasonable balance of feasibility, cost, and expected impact. In addition, it is critical to develop operational strategies to identify and target hard-to-reach individuals.

  19. Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector.

    PubMed

    Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A; Knuchel, Marlyse C; Naim, Hussein Y

    2013-03-01

    The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 10 ( 20) . The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors.

  20. 75 FR 48715 - Proposed Vaccine Information Materials for Measles, Mumps, Rubella, and Varicella Vaccines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-11

    ... Measles virus causes rash, cough, runny nose, eye irritation, and fever. It can lead to ear infection... (chickenpox) can be serious diseases: Measles Causes rash, cough, runny nose, eye irritation, fever. Can...

  1. Safety of measles-containing vaccines in 1-year-old children.

    PubMed

    Klein, Nicola P; Lewis, Edwin; Fireman, Bruce; Hambidge, Simon J; Naleway, Allison; Nelson, Jennifer C; Belongia, Edward A; Yih, W Katherine; Nordin, James D; Hechter, Rulin C; Weintraub, Eric; Baxter, Roger

    2015-02-01

    All measles-containing vaccines are associated with several types of adverse events, including seizure, fever, and immune thrombocytopenia purpura (ITP). Because the measles-mumps-rubella-varicella (MMRV) vaccine compared with the separate measles-mumps-rubella (MMR) and varicella (MMR + V) vaccine increases a toddler's risk for febrile seizures, we investigated whether MMRV is riskier than MMR + V and whether either vaccine elevates the risk for additional safety outcomes. Study children were aged 12 to 23 months in the Vaccine Safety Datalink from 2000 to 2012. Nine study outcomes were investigated: 7 main outcomes (anaphylaxis, ITP, ataxia, arthritis, meningitis/encephalitis, acute disseminated encephalomyelitis, and Kawasaki disease), seizure, and fever. Comparing MMRV with MMR + V, relative risk was estimated by using stratified exact binomial tests. Secondary analyses examined post-MMRV or MMR + V risk versus comparison intervals; risk and comparison intervals were then contrasted for MMRV versus MMR+V. We evaluated 123,200 MMRV and 584,987 MMR + V doses. Comparing MMRV with MMR + V, risks for the 7 main outcomes were not significantly different. Several outcomes had few or zero postvaccination events. Comparing risk versus comparison intervals, ITP risk was higher after MMRV (odds ratio [OR]: 11.3 [95% confidence interval (CI): 1.9 to 68.2]) and MMR + V (OR: 10 [95% CI: 4.5 to 22.5]) and ataxia risk was lower after both vaccines (MMRV OR: 0.8 [95% CI: 0.5 to 1]; MMR + V OR: 0.8 [95% CI: 0.7 to 0.9]). Compared with MMR + V, MMRV increased risk of seizure and fever 7 to 10 days after vaccination. This study did not identify any new safety concerns comparing MMRV with MMR + V or after either the MMRV or the MMR + V vaccine. This study provides reassurance that these outcomes are unlikely after either vaccine. Copyright © 2015 by the American Academy of Pediatrics.

  2. A risk stratification approach to assessing for true cases of measles in a highly vaccinated population.

    PubMed

    Bond, Katherine; Martin-Gall, Veronica; Franklin, Lucinda; Sutton, Brett

    2016-08-01

    In Australia, the notification rate for measles fluctuates greatly between baseline and outbreak periods. We aimed to identify characteristics of notified cases that allow risk stratification in order to improve the efficiency of the public health response in an outbreak setting. Retrospective descriptive case series for all measles notifications made to the Victorian Government Department of Health between 1 August and 30 September 2013. A total of 151 notifications were included in the analyses, of which 17 (11%) were confirmed as measles. Applying the clinical criteria of the measles case definition or identifying susceptible cases (determined by vaccination status) correctly identified all measles cases. Requiring cases to meet both criteria reduced sensitivity to 88%, but improved the positive predictive value (48% vs 25%) and retained a high negative predictive value (98.33%). Application of a risk stratification approach based on these features would have saved intensive public health follow-up for 79.5% of notifications in this outbreak. Immune status and clinical features can reliably be used to predict which notifications are unlikely to become confirmed cases. Risk stratification and modification of current surveillance practices may provide for a more efficient public health response, particularly during periods of increased case notification. © 2016 Public Health Association of Australia.

  3. Evaluation of Combination Measles-Mumps-Rubella-Varicella Vaccine Introduction in Australia.

    PubMed

    Macartney, Kristine; Gidding, Heather F; Trinh, Lieu; Wang, Han; Dey, Aditi; Hull, Brynley; Orr, Karen; McRae, Jocelynne; Richmond, Peter; Gold, Michael; Crawford, Nigel; Kynaston, Jennifer A; McIntyre, Peter; Wood, Nicholas

    2017-08-14

    Incorporating combination vaccines, such as the measles-mumps-rubella-varicella (MMRV) vaccine, into immunization schedules should be evaluated from a benefit-risk perspective. Use of MMRV vaccine poses challenges due to a recognized increased risk of febrile seizures (FSs) when used as the first dose in the second year of life. Conversely, completion by age 2 years of measles, mumps, rubella, and varicella immunization may offer improved disease control. To evaluate the effect on safety and coverage of earlier (age 18 months) scheduling of MMRV vaccine as the second dose of measles-containing vaccine (MCV) in Australia. Prospective active sentinel safety surveillance comparing the relative incidence (RI) of FSs in toddlers given MMRV and measles-mumps-rubella (MMR) and a national cohort study of vaccine coverage rates and timeliness before and after MMRV vaccine introduction were conducted. All Australian children aged 11 to 72 months were included in the coverage analysis, and 1471 Australian children aged 11 to 59 months were included in the FS analysis, with a focus on those aged 11 to 23 months. MMRV vaccine safety, specifically, the RI of FSs after MMRV vaccine at age 18 months, compared with risk following MMR vaccine and vaccine uptake for 2-dose MCV and single-dose varicella vaccine, focusing on timeliness. Of the 1471 children, the median age at first FS was 21 months (interquartile range [IQR], 14-31 months). Three hundred ninety-one children were aged 11 to 23 months and had at least 1 FS included in the analysis; of these, 207 (52.9%) were male. A total of 278 children (71.1%) had received MMR followed by MMRV vaccine, 97 (24.8%) had received MMR vaccine only, and 16 (4.1%) had received neither vaccine. There was no increased risk of FSs (RI, 1.08; 95% CI, 0.55-2.13) in the 5 to 12 days following MMRV vaccine given as the second MCV to toddlers. Febrile seizures occurred after dose 1 of MMR vaccine at a known low increased risk (RI, 2.71; 95% CI, 1

  4. Impact on Epidemic Measles of Vaccination Campaigns Triggered by Disease Outbreaks or Serosurveys: A Modeling Study

    PubMed Central

    Metcalf, C. Jessica E.; Cutts, Felicity T.; Grenfell, Bryan T.

    2016-01-01

    Background Routine vaccination supplemented by planned campaigns occurring at 2–5 y intervals is the core of current measles control and elimination efforts. Yet, large, unexpected outbreaks still occur, even when control measures appear effective. Supplementing these activities with mass vaccination campaigns triggered when low levels of measles immunity are observed in a sample of the population (i.e., serosurveys) or incident measles cases occur may provide a way to limit the size of outbreaks. Methods and Findings Measles incidence was simulated using stochastic age-structured epidemic models in settings conducive to high or low measles incidence, roughly reflecting demographic contexts and measles vaccination coverage of four heterogeneous countries: Nepal, Niger, Yemen, and Zambia. Uncertainty in underlying vaccination rates was modeled. Scenarios with case- or serosurvey-triggered campaigns reaching 20% of the susceptible population were compared to scenarios without triggered campaigns. The best performing of the tested case-triggered campaigns prevent an average of 28,613 (95% CI 25,722–31,505) cases over 15 y in our highest incidence setting and 599 (95% CI 464–735) cases in the lowest incidence setting. Serosurvey-triggered campaigns can prevent 89,173 (95% CI, 86,768–91,577) and 744 (612–876) cases, respectively, but are triggered yearly in high-incidence settings. Triggered campaigns reduce the highest cumulative incidence seen in simulations by up to 80%. While the scenarios considered in this strategic modeling exercise are reflective of real populations, the exact quantitative interpretation of the results is limited by the simplifications in country structure, vaccination policy, and surveillance system performance. Careful investigation into the cost-effectiveness in different contexts would be essential before moving forward with implementation. Conclusions Serologically triggered campaigns could help prevent severe epidemics in the

  5. Innovations in communication technologies for measles supplemental immunization activities: lessons from Kenya measles vaccination campaign, November 2012

    PubMed Central

    Mbabazi, William B; Tabu, Collins W; Chemirmir, Caleb; Kisia, James; Ali, Nasra; Corkum, Melissa G; Bartley, Gene L

    2015-01-01

    Background To achieve a measles free world, effective communication must be part of all elimination plans. The choice of communication approaches must be evidence based, locally appropriate, interactive and community owned. In this article, we document the innovative approach of using house visits supported by a web-enabled mobile phone application to create a real-time platform for adaptive management of supplemental measles immunization days in Kenya. Methods One thousand nine hundred and fifty-two Red Cross volunteers were recruited, trained and deployed to conduct house-to-house canvassing in 11 urban districts of Kenya. Three days before the campaigns, volunteers conducted house visits with a uniform approach and package of messages. All house visits were documented using a web-enabled mobile phone application (episurveyor®) that in real-time relayed information collected to all campaign management levels. During the campaigns, volunteers reported daily immunizations to their co-ordinators. Post-campaign house visits were also conducted within 4 days, to verify immunization of eligible children, assess information sources and detect adverse events following immunization. Results Fifty-six per cent of the 164 643 households visited said that they had heard about the planned 2012 measles vaccination campaign 1–3 days before start dates. Twenty-five per cent of households were likely to miss the measles supplemental dose if they had not been reassured by the house visit. Pre- and post-campaign reasons for refusal showed that targeted communication reduced misconceptions, fear of injections and trust in herbal remedies. Daily reporting of immunizations using mobile phones informed changes in service delivery plans for better immunization coverage. House visits were more remembered (70%) as sources of information compared with traditional mass awareness channels like megaphones (41%) and radio (37%). Conclusions In high-density settlements, house-to-house visits

  6. Innovations in communication technologies for measles supplemental immunization activities: lessons from Kenya measles vaccination campaign, November 2012.

    PubMed

    Mbabazi, William B; Tabu, Collins W; Chemirmir, Caleb; Kisia, James; Ali, Nasra; Corkum, Melissa G; Bartley, Gene L

    2015-06-01

    To achieve a measles free world, effective communication must be part of all elimination plans. The choice of communication approaches must be evidence based, locally appropriate, interactive and community owned. In this article, we document the innovative approach of using house visits supported by a web-enabled mobile phone application to create a real-time platform for adaptive management of supplemental measles immunization days in Kenya. One thousand nine hundred and fifty-two Red Cross volunteers were recruited, trained and deployed to conduct house-to-house canvassing in 11 urban districts of Kenya. Three days before the campaigns, volunteers conducted house visits with a uniform approach and package of messages. All house visits were documented using a web-enabled mobile phone application (episurveyor®) that in real-time relayed information collected to all campaign management levels. During the campaigns, volunteers reported daily immunizations to their co-ordinators. Post-campaign house visits were also conducted within 4 days, to verify immunization of eligible children, assess information sources and detect adverse events following immunization. Fifty-six per cent of the 164 643 households visited said that they had heard about the planned 2012 measles vaccination campaign 1-3 days before start dates. Twenty-five per cent of households were likely to miss the measles supplemental dose if they had not been reassured by the house visit. Pre- and post-campaign reasons for refusal showed that targeted communication reduced misconceptions, fear of injections and trust in herbal remedies. Daily reporting of immunizations using mobile phones informed changes in service delivery plans for better immunization coverage. House visits were more remembered (70%) as sources of information compared with traditional mass awareness channels like megaphones (41%) and radio (37%). In high-density settlements, house-to-house visits are easy and more penetrative compared

  7. Febrile seizures following measles and varicella vaccines in young children in Australia.

    PubMed

    Macartney, Kristine K; Gidding, Heather F; Trinh, Lieu; Wang, Han; McRae, Jocelynne; Crawford, Nigel; Gold, Michael; Kynaston, Anne; Blyth, Christopher; Yvonne, Zurynski; Elliott, Elizabeth; Booy, Robert; Buttery, Jim; Marshall, Helen; Nissen, Michael; Richmond, Peter; McInytre, Peter B; Wood, Nicholas

    2015-03-10

    Febrile seizures (FS) are common in childhood with incidence peaking in the second year of life when measles and varicella-containing vaccines are administered. This study aimed to examine the vaccine-attributable risk of FS following separate administration of MMR and monovalent varicella vaccines (VV) prior to a planned change to MMRV as the second dose of measles-containing vaccine at 18 months of age. All FS cases in children aged <5 years from 1st January 2012 to 30th April 2013 were identified from emergency department (ED) and inpatient databases at five Australian tertiary paediatric hospitals participating in PAEDS (Paediatric Active Enhanced Disease Surveillance). Immunization records were obtained from the Australian Childhood Immunization Register (ACIR). The relative incidence (RI) of FS following MMR dose 1 (MMR1) and VV in children aged 11-23 months was determined using the self-controlled case series (SCCS) method and used to calculate attributable risk. There were 2013 FS episodes in 1761 children. The peak age at FS was 18 months. The risk of FS was significantly increased 5-12 days post receipt of MMR1 at 12 months (RI=1.9 [95% CI: 1.3-2.9]), but not after VV at 18 months (RI=0.6 [95% CI: 0.3-1.2]. The estimated excess annual number of FS post MMR1 was 24 per 100,000 vaccinated children aged 11-23 months (95% CI=7-49 cases per 100,000) or 1 per 4167 doses. Our study detected the expected increased FS risk post MMR1 vaccine at 12 months, but monovalent varicella vaccine at age 18 months was not associated with increased risk of FS. This provides baseline data to assess the risk of FS post MMRV, introduced in Australia as the second dose of measles-containing vaccine at 18 months of age in July 2013. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Measles, mumps and rubella vaccine, autism and inflammatory bowel disease: advising concerned parents.

    PubMed

    Elliman, David A C; Bedford, Helen E

    2002-01-01

    Measles, mumps and rubella (MMR) vaccine has been used for almost 30 years in the US, 20 years in Sweden and Finland, and over 10 years in most of the rest of Europe. During this time, it has brought about a dramatic reduction in the morbidity and mortality due to measles and mumps, as well as a considerable reduction in the number of babies with the congenital rubella syndrome. In spite of extensive evidence confirming the efficacy and safety of the vaccine, concerns have recently been raised about a possible link with autism and bowel problems. These arose principally from a research group in the UK, but have now spread to other countries. In the UK this has caused a fall in the uptake of the vaccine with fears of possible outbreaks of measles and mumps in some groups of children. Over the last 3 years a number of studies have addressed this possible link between MMR and autism and inflammatory bowel disease. Studies from the US, UK, Sweden, and Finland have all failed to demonstrate a link. Amongst others, the American Academy of Pediatrics, the Royal College of Paediatrics and Child Health, the Institute of Medicine, and the World Health Organization have all considered the evidence and endorsed the continuing use of the vaccine. No regulatory body in the world has changed its policy as a result of this hypothesized link. Professionals and parents can be assured that MMR is well tried and tested and one of the most successful interventions in healthcare.

  9. Autism and measles-mumps-rubella vaccination: controversy laid to rest?

    PubMed

    DeStefano, F; Chen, R T

    2001-01-01

    It has been suggested that vaccination, particularly with measles-mumps-rubella (MMR) vaccine, may be related to the development of autism. The main evidence for a possible association is that the prevalence of autism has been increasing at the same time that infant vaccination coverage has increased, and that in some cases there is an apparent temporal association in which autistic characteristics are first noted shortly after vaccination. Although the prevalence of autism and similar disorders appears to have increased recently, it is not clear if this is an actual increase or the result of increased recognition and changes in diagnostic criteria. The apparent onset of autism in close proximity to vaccination may be a coincidental temporal association. The clinical evidence in support of an association derives from a series of 12 patients with inflammatory bowel conditions and regressive developmental disorders, mostly autism. The possibility that measles vaccine may cause autism through a persistent bowel infection has generated much interest, since it provides a possible biological mechanism. Epidemiological studies, however, have not found an association between MMR vaccination and autism. The epidemiological findings are consistent with current understanding of the pathogenesis of autism, which has a strong genetic component and in which the neurological defects probably occur early in embryonic development. It seems unlikely that a vaccination that is given after birth could cause autism. A minority of cases of autism may have onset after 1 year of age (regressive autism), but the single epidemiological study that included such cases did not find an association with MMR vaccination. Currently, the weight of the available epidemiological and related evidence does not support a causal association between MMR vaccine, or any other vaccine or vaccine constituent, and autism.

  10. Measles Outbreak in High Risk Areas of Delhi: Epidemiological Investigation and Laboratory Confirmation.

    PubMed

    Raoot, Amita; Dewan, Dharmendra Kumar; Dubey, A P; Batra, R K; Seth, Suresh

    2016-03-01

    To describe epidemiological and laboratory characteristics of the measles outbreaks recorded in the urban slums of Delhi (designated as high risk areas under the Polio program), from February through July 2014. As a part of surveillance and containment measures, an extensive field investigation for measles case search (WHO definition) through 'house to house survey' was conducted by district health teams and field volunteers of National Polio Surveillance Project (NPSP), WHO, Delhi from February through July, 2014. The data generated by the health teams was collected and analyzed. About 1.1 million households in the high risk areas of Delhi were surveyed for epidemiological investigations. A total of 1337 suspected measles cases were reported. The case fatality rate (CFR) was 1.2 %. Statistical analysis showed significant relation between age of the child (measles case) and immunization status. Higher numbers of reported cases were above 5 y and less than 9 mo of age. Measles IgM was detected in 132 cases and D8 strain was isolated on genotyping. The outbreak was predominantly localized to the high risk areas (urban slums) of the city. Low CFR was reported during the outbreaks. The outbreaks highlight the need to extend the reach of immunization services to urban slums and strengthen measles surveillance including laboratory based surveillance.

  11. Real-time investigation of measles epidemics with estimate of vaccine efficacy.

    PubMed

    Ejima, Keisuke; Omori, Ryosuke; Aihara, Kazuyuki; Nishiura, Hiroshi

    2012-01-01

    As part of measles elimination effort, evaluation of the vaccination program and real-time assessment of the epidemic dynamics constitute two important tasks to improve and strengthen the control. The present study aimed to develop an epidemiological modeling method which can be applied to estimating the vaccine efficacy at an individual level while conducting the timely investigation of the epidemic. The multivariate renewal process model was employed to describe the temporal evolution of infection by vaccination history, jointly estimating the time-dependent reproduction number and the vaccine efficacy. Analyzing the enhanced surveillance data of measles in Aichi prefecture, Japan from 2007-08, the vaccine efficacy was estimated at 96.7% (95% confidence interval: 95.8, 97.4). Using an age structured model, the vaccine efficacy among those aged from 5-19 years was shown to be smaller than that among those from 0-4 years. The age-dependent vaccine efficacy estimate informs the age-groups to be targeted for revaccination. Because the estimation method can rest on readily available epidemiological data, the proposed model has a potential to be integrated with routine surveillance.

  12. Successful administration of measles-rubella-mumps vaccine by graded challenge in a case with anaphylaxis after prior vaccination.

    PubMed

    Tuncel, Tuba; Sancakli, Ozlem; Ozdogru, Ece

    2017-04-01

    Egg allergy is one of the most common food allergies during childhood along with cow's milk allergy. The measles-mumpsrubella (MMR) vaccine is included in the pediatric immunization schedule and contains egg protein. The currently accepted opinion is that the MMR vaccination should be done in a single dose under medical observation in patients with egg allergy. Although it is reported that the MMR vaccine is safe for that patients, there are some patients who developed anaphylaxis. Generally, the development of anaphylaxis after the previous vaccination is reported as a contraindication. We present a successful administration of MMR vaccine by gradually increased doses for a patient who developed anaphylaxis after the previous vaccination. Sociedad Argentina de Pediatría.

  13. A correlation of measles specific antibodies and the number of plasmacytoid dendritic cells is observed after measles vaccination in 9 month old infants

    PubMed Central

    García-León, Miguel L; Bonifaz, Laura C; Espinosa-Torres, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino; Santos-Preciado, José I; Wong-Chew, Rosa M

    2015-01-01

    Measles virus (MeV) represents one of the main causes of death among young children, particularly in developing countries. Upon infection, MeV controls both interferon induction (IFN) and the interferon signaling pathway which results in a severe host immunosuppression that can persists for up to 6 mo after infection. Despite the global biology of MeV infection is well studied, the role of the plasmacytoid dendritic cells (pDCs) during the host innate immune response after measles vaccination remains largely uncharacterized. Here we investigated the role of pDCs, the major producers of interferon in response to viral infections, in the development of adaptive immune response against MeV vaccine. We report that there is a strong correlation between pDCs population and the humoral immune response to Edmonston Zagreb (EZ) measles vaccination in 9-month-old mexican infants. Five infants were further evaluated after vaccination, showing a clear increase in pDCs at baseline, one week and 3 months after immunization. Three months postvaccination they showed increase in memory T-cells and pDCs populations, high induction of adaptive immunity and also observed a correlation between pDCs number and the humoral immune response. These findings suggest that the development and magnitude of the adaptive immune response following measles immunization is directly dependent on the number of pDCs of the innate immune response. PMID:26075901

  14. A correlation of measles specific antibodies and the number of plasmacytoid dendritic cells is observed after measles vaccination in 9 month old infants.

    PubMed

    García-León, Miguel L; Bonifaz, Laura C; Espinosa-Torres, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino; Santos-Preciado, José I; Wong-Chew, Rosa M

    2015-01-01

    Measles virus (MeV) represents one of the main causes of death among young children, particularly in developing countries. Upon infection, MeV controls both interferon induction (IFN) and the interferon signaling pathway which results in a severe host immunosuppression that can persists for up to 6 mo after infection. Despite the global biology of MeV infection is well studied, the role of the plasmacytoid dendritic cells (pDCs) during the host innate immune response after measles vaccination remains largely uncharacterized. Here we investigated the role of pDCs, the major producers of interferon in response to viral infections, in the development of adaptive immune response against MeV vaccine. We report that there is a strong correlation between pDCs population and the humoral immune response to Edmonston Zagreb (EZ) measles vaccination in 9-month-old mexican infants. Five infants were further evaluated after vaccination, showing a clear increase in pDCs at baseline, one week and 3 months after immunization. Three months postvaccination they showed increase in memory T-cells and pDCs populations, high induction of adaptive immunity and also observed a correlation between pDCs number and the humoral immune response. These findings suggest that the development and magnitude of the adaptive immune response following measles immunization is directly dependent on the number of pDCs of the innate immune response.

  15. Control of a measles outbreak by prohibiting non-vaccinated susceptible students from attending school in Akita Prefecture, Japan.

    PubMed

    Takimoto, Noriaki; Takahashi, Yoshihiro; Ishiyama, Akira; Kishimoto, Kaoru; Iwama, Renji; Nakano, Megumi

    2011-01-01

    In 2007-2008, a measles outbreak occurred among children above the age of 10 years in Akita Prefecture, northeastern Japan (population, approximately 1,120,000 at the time). Our group controlled the outbreak by (i) implementing a publically financed urgent vaccination program and (ii) prohibiting non-vaccinated and non-infected students from attending school as per regulations of the school public health law. We encouraged high-risk students to undergo a vaccination program, which resulted in the successful containment of the outbreak without the development of any severe cases. After the outbreak, the Akita Prefectural Government began an annual"Akita measles elimination month" every April, and no measles case found in Akita Prefecture during 2009-2010 subsequently. Our outbreak response initiative can be applied nationally for the complete elimination of measles throughout Japan.

  16. Measles Virus Neutralizing Antibodies in Intravenous Immunoglobulins:is an Increase by Re-Vaccination of Plasma Donors possible?

    PubMed

    Modrof, Jens; Tille, Björn; Farcet, Maria R; McVey, John; Schreiner, Jessica A; Borders, Charles M; Gudino, Maria; Fitzgerald, Peter; Simon, Toby L; Kreil, Thomas R

    2017-08-18

    We report a screen of plasma donors which confirmed that widespread use of childhood measles vaccination since 1963 resulted in a decrease of average measles virus antibody titers in plasma donors, which is reflected in intravenous immunoglobulins (IVIG). The measles virus antibody titer is, however, a potency requirement for IVIG, as defined in FDA regulation. To mitigate the decline in measles virus antibody titers in IVIG and to ensure consistent product release, re-vaccination of plasma donors was investigated as a means to boost titers. However, re-vaccination induced titer increases were only about two-fold, and short lived. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  17. German Measles (Rubella)

    MedlinePlus

    ... Spread the Word Shop AAP Find a Pediatrician Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases Healthy Children > Health Issues > Vaccine Preventable Diseases > German Measles (Rubella) Health Issues ...

  18. Effect of jet injection on infectivity of measles, mumps, and rubella vaccine in a bench model.

    PubMed

    Coughlin, Melissa M; Collins, Marcus; Saxon, Gene; Jarrahian, Courtney; Zehrung, Darin; Cappello, Chris; Dhere, Rajeev; Royals, Michael; Papania, Mark; Rota, Paul A

    2015-08-26

    Disposable-syringe jet injectors (DSJIs) with single-use, auto disable, needle-free syringes offer the opportunity to avoid hazards associated with injection using a needle and syringe. Clinical studies have evaluated DSJIs for vaccine delivery, but most studies have focused on inactivated, subunit, or DNA vaccines. Questions have been raised about possible damage to live attenuated viral vaccines by forces generated during the jet injection process. This study examines the effect of jet injection on the integrity of measles, mumps, and rubella vaccine (MMR), measured by viral RNA content and infectivity. Three models of DSJIs were evaluated, each generating a different ejection force. Following jet injection, the RNA content for each of the vaccine components was measured using RT-qPCR immediately after injection and following passage in Vero cells. Jet injection was performed with and without pig skin as a simulation of human skin. There was little to no reduction of RNA content immediately following jet injection with any of the three DSJIs. Samples passaged in Vero cells showed no loss in infectivity of the measles vaccine following jet injection. Mumps vaccine consistently showed increased replication following jet injection. Rubella vaccine showed no loss after jet injection alone but some infectivity loss following injection through pig skin with two of the devices. Overall, these data demonstrated that forces exerted on a live attenuated MMR vaccine did not compromise vaccine infectivity. The bench model and protocol used in this study can be applied to evaluate the impact of jet injection on other live virus vaccines.

  19. High Concentrations of Measles Neutralizing Antibodies and High-Avidity Measles IgG Accurately Identify Measles Reinfection Cases

    PubMed Central

    Rota, Jennifer S.; Hickman, Carole J.; Mercader, Sara; Redd, Susan; McNall, Rebecca J.; Williams, Nobia; McGrew, Marcia; Walls, M. Laura; Rota, Paul A.; Bellini, William J.

    2016-01-01

    In the United States, approximately 9% of the measles cases reported from 2012 to 2014 occurred in vaccinated individuals. Laboratory confirmation of measles in vaccinated individuals is challenging since IgM assays can give inconclusive results. Although a positive reverse transcription (RT)-PCR assay result from an appropriately timed specimen can provide confirmation, negative results may not rule out a highly suspicious case. Detection of high-avidity measles IgG in serum samples provides laboratory evidence of a past immunologic response to measles from natural infection or immunization. High concentrations of measles neutralizing antibody have been observed by plaque reduction neutralization (PRN) assays among confirmed measles cases with high-avidity IgG, referred to here as reinfection cases (RICs). In this study, we evaluated the utility of measuring levels of measles neutralizing antibody to distinguish RICs from noncases by receiver operating characteristic curve analysis. Single and paired serum samples with high-avidity measles IgG from suspected measles cases submitted to the CDC for routine surveillance were used for the analysis. The RICs were confirmed by a 4-fold rise in PRN titer or by RT-quantitative PCR (RT-qPCR) assay, while the noncases were negative by both assays. Discrimination accuracy was high with serum samples collected ≥3 days after rash onset (area under the curve, 0.953; 95% confidence interval [CI], 0.854 to 0.993). Measles neutralizing antibody concentrations of ≥40,000 mIU/ml identified RICs with 90% sensitivity (95% CI, 74 to 98%) and 100% specificity (95% CI, 82 to 100%). Therefore, when serological or RT-qPCR results are unavailable or inconclusive, suspected measles cases with high-avidity measles IgG can be confirmed as RICs by measles neutralizing antibody concentrations of ≥40,000 mIU/ml. PMID:27335386

  20. Measles-mumps-rubella-varicella combination vaccine (ProQuad): a guide to its use in children in the E.U.

    PubMed

    Scott, Lesley J

    2015-04-01

    In the EU, the live attenuated, tetravalent measles-mumps-rubella-varicella vaccine ProQuad is indicated for simultaneous vaccination against measles, mumps, rubella and varicella in individuals from 12 months of age using a two-dose schedule and may be used in infants from 9 months of age to conform with a national vaccination schedule, outbreak situations or travel to a region with a high prevalence of measles. Clinical data in young children indicates that vaccination with ProQuad is as immunogenic as the component vaccines, provides long-term protection against these potentially serious childhood infections and has an acceptable safety profile. Combining the viral strains of the measles-mumps-rubella vaccine M-M-RVAXPRO and the varicella vaccine Varivax in ProQuad reduces the complexity of vaccination schedules, thereby potentially improving vaccination coverage and the timeliness of vaccination.

  1. Tolerability of Early Measles-Mumps-Rubella Vaccination in Infants Aged 6-14 Months During a Measles Outbreak in The Netherlands in 2013-2014.

    PubMed

    van der Maas, Nicoline A T; Woudenberg, T; Hahné, S J M; de Melker, H E

    2016-05-01

    In 2013-2014, a measles outbreak spread through the Netherlands. To protect young infants, measles-mumps-rubella (MMR) vaccination was offered to those aged 6-14 months in municipalities with routine first-dose MMR vaccine coverage of <90%. We assessed the tolerability of this early administration of MMR vaccine. After study entry (n = 1866), parents of eligible infants (n = 10 097) completed a questionnaire (n = 1304). For infants who received an early MMR vaccine dose (n = 962), we asked for information about adverse events (AEs) associated with the dose. AE frequencies were compared between infants aged 6-8, 9-11, and 12-14 months. Using multivariable logistic regression, we assessed the association between the risk of AEs and age at early MMR vaccination. The response rate was 13%. Parents of 59 infants (6.1%) and 350 infants (36.4%) who received early MMR vaccination reported local and systemic AEs, respectively. Parents of infants vaccinated at 6-8 months of age reported systemic AEs less frequently (32%) than parents of children vaccinated at 9-11 months (45%) and 12-14 months (43%) of age (P= <.001). For local AEs, there were no differences (5%, 7%, and 10%, respectively;P= .08). Compared with vaccination at 6 months, all older infants except those aged 14 months showed an increased risk for any AE and for systemic AEs starting 5-12 days after vaccination. Early MMR vaccination is well tolerated, with the lowest AE frequencies found in infants aged 6-8 months. It is a safe intervention for protecting young infants against measles. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America.

  2. Maternally derived measles immunity in era of vaccine-protected mothers.

    PubMed

    Lennon, J L; Black, F L

    1986-05-01

    Measles hemagglutinin-inhibiting and neutralizing antibody titers are lower in women young enough to have been immunized by vaccination than in older women. In the children of both young and older mothers the antibody is concentrated 1.7-fold across the placenta, and the child's initial titer remains proportional to that of its mother. The transferred antibody is diluted by the baby's growth and degraded with a mean half-life of 48 days. By 8 1/2 months of age, 95% of the children of the mothers born since 1963 would have become susceptible to measles and responsive to immunization; the same level of susceptibility is not reached by children of mothers born before 1958 until 11 1/2 months of age. Among the offspring of younger mothers, a small group remains, about 2% of the total, with titers high enough to provide protection for 12 months, and these children would be poorly served if the age for vaccination were reduced for all. However, selective early vaccination of children of young mothers who have low antibody titers would eliminate an important focus of measles susceptibility.

  3. A comparison of canine distemper vaccine and measles vaccine for the prevention of canine distemper in young puppies.

    PubMed

    Chalmers, W S; Baxendale, W

    1994-10-08

    Two groups of six-week-old beagle puppies were vaccinated with either high titre canine distemper virus or human measles virus, a third group remaining unvaccinated. All the puppies were subsequently challenged by the nasopharyngeal route at 10 weeks old with the virulent Snyder-Hill strain of canine distemper. Severe clinical signs were observed in 90 per cent of the unvaccinated dogs but both groups of vaccinated dogs survived the challenge. High temperatures were recorded in 20 per cent of the measles vaccinates and abdominal petechial rashes were observed in 60 per cent of them. The only clinical signs observed in the puppies vaccinated with distemper virus were transient rashes in 20 per cent of the group. The high titre canine distemper vaccine stimulated a humoral response quickly in 78 per cent of the puppies in the presence of maternally derived antibody and protected them against challenge with the virulent Snyder-Hill strain of distemper virus. The remaining dogs responded sluggishly but were still protected against challenge. The results of field surveys showed that 95 per cent of young puppies with different levels of maternally derived antibodies responded to the distemper component in a vaccine also containing canine parvovirus. No incompatibility was observed between the two components.

  4. Immunogenicity of a recombinant measles-HIV-1 clade B candidate vaccine.

    PubMed

    Stebbings, Richard; Février, Michèle; Li, Bo; Lorin, Clarisse; Koutsoukos, Marguerite; Mee, Edward; Rose, Nicola; Hall, Joanna; Page, Mark; Almond, Neil; Voss, Gerald; Tangy, Frédéric

    2012-01-01

    Live attenuated measles virus is one of the most efficient and safest vaccines available, making it an attractive candidate vector for a HIV/AIDS vaccine aimed at eliciting cell-mediated immune responses (CMI). Here we have characterized the potency of CMI responses generated in mice and non-human primates after intramuscular immunisation with a candidate recombinant measles vaccine carrying an HIV-1 insert encoding Clade B Gag, RT and Nef (MV1-F4). Eight Mauritian derived, MHC-typed cynomolgus macaques were immunised with 10(5) TCID(50) of MV1-F4, four of which were boosted 28 days later with the same vaccine. F4 and measles virus (MV)-specific cytokine producing T cell responses were detected in 6 and 7 out of 8 vaccinees, respectively. Vaccinees with either M6 or recombinant MHC haplotypes demonstrated the strongest cytokine responses to F4 peptides. Polyfunctional analysis revealed a pattern of TNFα and IL-2 responses by CD4+ T cells and TNFα and IFNγ responses by CD8+ T cells to F4 peptides. HIV-specific CD4+ and CD8+ T cells expressing cytokines waned in peripheral blood lymphocytes by day 84, but CD8+ T cell responses to F4 peptides could still be detected in lymphoid tissues more than 3 months after vaccination. Anti-F4 and anti-MV antibody responses were detected in 6 and 8 out of 8 vaccinees, respectively. Titres of anti-F4 and MV antibodies were boosted in vaccinees that received a second immunisation. MV1-F4 carrying HIV-1 Clade B inserts induces robust boostable immunity in non-human primates. These results support further exploration of the MV1-F4 vector modality in vaccination strategies that may limit HIV-1 infectivity.

  5. Measles Outbreak Associated With Low Vaccine Effectiveness Among Adults in Pohnpei State, Federated States of Micronesia, 2014.

    PubMed

    Hales, Craig M; Johnson, Eliaser; Helgenberger, Louisa; Papania, Mark J; Larzelere, Maribeth; Gopalani, Sameer V; Lebo, Emmaculate; Wallace, Greg; Moturi, Edna; Hickman, Carole J; Rota, Paul A; Alexander, Hinden S; Marin, Mona

    2016-03-01

    Background.  A measles outbreak in Pohnpei State, Federated States of Micronesia in 2014 affected many persons who had received ≥1 dose of measles-containing vaccine (MCV). A mass vaccination campaign targeted persons aged 6 months to 49 years, regardless of prior vaccination. Methods.  We evaluated vaccine effectiveness (VE) of MCV by comparing secondary attack rates among vaccinated and unvaccinated contacts after household exposure to measles. Results.  Among 318 contacts, VE for precampaign MCV was 23.1% (95% confidence interval [CI], -425 to 87.3) for 1 dose, 63.4% (95% CI, -103 to 90.6) for 2 doses, and 95.9% (95% CI, 45.0 to 100) for 3 doses. Vaccine effectiveness was 78.7% (95% CI, 10.1 to 97.7) for campaign doses received ≥5 days before rash onset in the primary case and 50.4% (95% CI, -52.1 to 87.9) for doses received 4 days before to 3 days after rash onset in the primary case. Vaccine effectiveness for most recent doses received before 2010 ranged from 51% to 57%, but it increased to 84% for second doses received in 2010 or later. Conclusions.  Low VE was a major source of measles susceptibility in this outbreak; potential reasons include historical cold chain inadequacies or waning of immunity. Vaccine effectiveness of campaign doses supports rapid implementation of vaccination campaigns in outbreak settings.

  6. Trend of measles, mumps, and rubella incidence following the measles-rubella catch up vaccination in the Republic of Korea, 2001.

    PubMed

    Choe, Young June; Eom, Hye-Eun; Cho, Sung-Il

    2017-09-01

    Following the introduction of measles-rubella (MR) catch-up vaccination in 2001 and two dose measles-mumps-rubella (MMR2) keep-up program in 2002, the incidence of measles, mumps, and rubella was not evaluated systematically. To describe the recent changes in epidemiology, a population-based incidence study from 2001 to 2015 using national notifiable disease surveillance data was conducted. Between 2001 and 2015, there was decrease in the incidence of measles and rubella, whereas a steady increase in mump incidence was noted. The age distribution of mumps cases has shifted to the older age group, whereas rubella became more frequent in younger age group. The incidence of mumps showed an increase in every birth cohorts, except for the decrease in incidence for catch-up vaccination cohort from 131 cases in 2007-2011 to 64 cases per 100 000 in 2012-2015. Continuing in monitoring of mumps and strengthening of the high two-dose MMR vaccination coverage should be taken place in Korea. © 2017 Wiley Periodicals, Inc.

  7. A large population-based association study between HLA and KIR genotypes and measles vaccine antibody responses.

    PubMed

    Ovsyannikova, Inna G; Schaid, Daniel J; Larrabee, Beth R; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A

    2017-01-01

    Human antibody response to measles vaccine is highly variable in the population. Host genes contribute to inter-individual antibody response variation. The killer cell immunoglobulin-like receptors (KIR) are recognized to interact with HLA molecules and possibly influence humoral immune response to viral antigens. To expand on and improve our previous work with HLA genes, and to explore the genetic contribution of KIR genes to the inter-individual variability in measles vaccine-induced antibody responses, we performed a large population-based study in 2,506 healthy immunized subjects (ages 11 to 41 years) to identify HLA and KIR associations with measles vaccine-induced neutralizing antibodies. After correcting for the large number of statistical tests of allele effects on measles-specific neutralizing antibody titers, no statistically significant associations were found for either HLA or KIR loci. However, suggestive associations worthy of follow-up in other cohorts include B*57:01, DQB1*06:02, and DRB1*15:05 alleles. Specifically, the B*57:01 allele (1,040 mIU/mL; p = 0.0002) was suggestive of an association with lower measles antibody titer. In contrast, the DQB1*06:02 (1,349 mIU/mL; p = 0.0004) and DRB1*15:05 (2,547 mIU/mL; p = 0.0004) alleles were suggestive of an association with higher measles antibodies. Notably, the associations with KIR genotypes were strongly nonsignificant, suggesting that KIR loci in terms of copy number and haplotypes are not likely to play a major role in antibody response to measles vaccination. These findings refine our knowledge of the role of HLA and KIR alleles in measles vaccine-induced immunity.

  8. A large population-based association study between HLA and KIR genotypes and measles vaccine antibody responses

    PubMed Central

    Ovsyannikova, Inna G.; Schaid, Daniel J.; Larrabee, Beth R.; Haralambieva, Iana H.; Kennedy, Richard B.; Poland, Gregory A.

    2017-01-01

    Human antibody response to measles vaccine is highly variable in the population. Host genes contribute to inter-individual antibody response variation. The killer cell immunoglobulin-like receptors (KIR) are recognized to interact with HLA molecules and possibly influence humoral immune response to viral antigens. To expand on and improve our previous work with HLA genes, and to explore the genetic contribution of KIR genes to the inter-individual variability in measles vaccine-induced antibody responses, we performed a large population-based study in 2,506 healthy immunized subjects (ages 11 to 41 years) to identify HLA and KIR associations with measles vaccine-induced neutralizing antibodies. After correcting for the large number of statistical tests of allele effects on measles-specific neutralizing antibody titers, no statistically significant associations were found for either HLA or KIR loci. However, suggestive associations worthy of follow-up in other cohorts include B*57:01, DQB1*06:02, and DRB1*15:05 alleles. Specifically, the B*57:01 allele (1,040 mIU/mL; p = 0.0002) was suggestive of an association with lower measles antibody titer. In contrast, the DQB1*06:02 (1,349 mIU/mL; p = 0.0004) and DRB1*15:05 (2,547 mIU/mL; p = 0.0004) alleles were suggestive of an association with higher measles antibodies. Notably, the associations with KIR genotypes were strongly nonsignificant, suggesting that KIR loci in terms of copy number and haplotypes are not likely to play a major role in antibody response to measles vaccination. These findings refine our knowledge of the role of HLA and KIR alleles in measles vaccine-induced immunity. PMID:28158231

  9. [Economic evaluation on different two-dose-vaccination-strategies related to Measles, Mumps and Rubella Combined Attenuated Live Vaccine].

    PubMed

    He, H Q; Zhang, B; Yan, R; Li, Q; Fu, J; Tang, X W; Zhou, Y; Deng, X; Xie, S Y

    2016-08-10

    To evaluate the economic effect of Measles, Mumps and Rubella Combined Attenuated Live Vaccine (MMR) under different two-dose vaccination programs. A hypothetical birth cohort of 750 000 infants over their lifetime, was followed up from birth through death in Zhejiang province. The current MMR vaccination strategie would include three different ones: 1) Childlern were vaccinated with Measles-Rubella Combined Attenuated Live Vaccine and MMR, respectively at the age of 8 months and 18 months. 2) Children receive MMR at 8 months and 18 months, 3) Strategy 1 plus an additional vaccination of MMR at 4 years of age. Incremental cost-effectiveness ratio (ICER), incremental cost-benefit ratio (ICBR) and incremental net benefit (INB) were applied to calculate the health economic difference for Strategy 2 and Strategy 3 as compared to Strategy 1. Univariate sensitivity analysis was used to assess the robustness of results with main parameters, including the rate of immunization coverage, effectiveness of the vaccines, incidence and burdens of the related diseases, cost of vaccines and the vaccination program itself. ICER, ICBR and INB for Strategy 2 and Strategy 3 appeared as 2 012.51∶1 RMB Yuan per case and 4 238.72∶1 RMB Yuan per case, 1∶3.14 and 1∶1.58, 21 277 800 RMB Yuan and 9 276 500 RMB Yuan, respectively. Only slight changes (<20%) were found under the univariate sensitivity analysis, with varied values on main parameters. Based on the current national immunization program, infants vaccinated with MMR at 8 months of age, generated more health economic effects than the Strategy 3.

  10. Acetaminophen (paracetamol) use, measles-mumps-rubella vaccination, and autistic disorder: the results of a parent survey.

    PubMed

    Schultz, Stephen T; Klonoff-Cohen, Hillary S; Wingard, Deborah L; Akshoomoff, Natacha A; Macera, Caroline A; Ji, Ming

    2008-05-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80 control children. Acetaminophen use after measles-mumps-rubella vaccination was significantly associated with autistic disorder when considering children 5 years of age or less (OR 6.11, 95% CI 1.42-26.3), after limiting cases to children with regression in development (OR 3.97, 95% CI 1.11-14.3), and when considering only children who had post-vaccination sequelae (OR 8.23, 95% CI 1.56-43.3), adjusting for age, gender, mother's ethnicity, and the presence of illness concurrent with measles-mumps-rubella vaccination. Ibuprofen use after measles-mumps-rubella vaccination was not associated with autistic disorder. This preliminary study found that acetaminophen use after measles-mumps-rubella vaccination was associated with autistic disorder.

  11. Measles vaccine efficacy determined from secondary attack rates during a severe epidemic.

    PubMed

    McCormick, J B; Halsey, N; Rosenberg, R

    1977-01-01

    In February, March, and April 1974, a severe epidemic of measles, with 71 cases and three deaths, occurred on the Cheyenne and Standing Rock Sioux Indian Reservations in South and North Dakota. The attack rate was 9.0 cases per 1,000 persons, and associated with the illness were 24 cases of pneumonia and ten cases of otitis media. Age-specific attack rates were highest in those under one year of age. Using secondary attack rates in persons under nine years of age who were vaccinated and unvaccinated family contacts of cases, vaccine efficacy was measured as 97.3% (95% confidence interval 80.1 to 99.9%).

  12. A randomized trial of a standard dose of Edmonston-Zagreb measles vaccine given at 4.5 months of age: effect on total hospital admissions.

    PubMed

    Martins, Cesario L; Benn, Christine S; Andersen, Andreas; Balé, Carlito; Schaltz-Buchholzer, Frederik; Do, Vu An; Rodrigues, Amabelia; Aaby, Peter; Ravn, Henrik; Whittle, Hilton; Garly, May-Lill

    2014-06-01

    Observational studies and trials from low-income countries indicate that measles vaccine has beneficial nonspecific effects, protecting against non-measles-related mortality. It is not known whether measles vaccine protects against hospital admissions. Between 2003 and 2007, 6417 children who had received the third dose of diphtheria, tetanus, and pertussis vaccine were randomly assigned to receive measles vaccine at 4.5 months or no measles vaccine; all children were offered measles vaccine at 9 months of age. Using hospital admission data from the national pediatric ward in Bissau, Guinea-Bissau, we compared admission rates between enrollment and the 9-month vaccination in Cox models, providing admission hazard rate ratios (HRRs) for measles vaccine versus no measles vaccine. All analyses were conducted stratified by sex and reception of neonatal vitamin A supplementation (NVAS). Before enrollment the 2 groups had similar admission rates. Following enrollment, the measles vaccine group had an admission HRR of 0.70 (95% confidence interval [CI], .52-.95), with a ratio of 0.53 (95% CI, .32-.86) for girls and 0.86 (95% CI, .58-1.26) for boys. For children who had not received NVAS, the admission HRR was 0.53 (95% CI, .34-.84), with an effect of 0.30 (95% CI, .13-.70) for girls and 0.73 (95% CI, .42-1.28) for boys (P = .08, interaction test). The reduction in admissions was separately significant for measles infection (admission HRR, 0 [95% CI, 0-.24]) and respiratory infections (admission HRR, 0.37 [95% CI, .16-.89]). Early measles vaccine may have major benefits for infant morbidity patterns and healthcare costs. Clinical trials registration NCT00168558.

  13. Measles virus genetic evolution throughout an imported epidemic outbreak in a highly vaccinated population.

    PubMed

    Muñoz-Alía, Miguel Ángel; Fernández-Muñoz, Rafael; Casasnovas, José María; Porras-Mansilla, Rebeca; Serrano-Pardo, Ángela; Pagán, Israel; Ordobás, María; Ramírez, Rosa; Celma, María Luisa

    2015-01-22

    Measles virus circulates endemically in African and Asian large urban populations, causing outbreaks worldwide in populations with up-to-95% immune protection. We studied the natural genetic variability of genotype B3.1 in a population with 95% vaccine coverage throughout an imported six month measles outbreak. From first pass viral isolates of 47 patients we performed direct sequencing of genomic cDNA. Whilst no variation from index case sequence occurred in the Nucleocapsid gene hyper-variable carboxy end, in the Hemagglutinin gene, main target for neutralizing antibodies, we observed gradual nucleotide divergence from index case along the outbreak (0% to 0.380%, average 0.138%) with the emergence of transient and persistent non-synonymous and synonymous mutations. Little or no variation was observed between the index and last outbreak cases in Phosphoprotein, Nucleocapsid, Matrix and Fusion genes. Most of the H non-synonymous mutations were mapped on the protein surface near antigenic and receptors binding sites. We estimated a MV-Hemagglutinin nucleotide substitution rate of 7.28 × 10-6 substitutions/site/day by a Bayesian phylogenetic analysis. The dN/dS analysis did not suggest significant immune or other selective pressures on the H gene during the outbreak. These results emphasize the usefulness of MV-H sequence analysis in measles epidemiological surveillance and elimination programs, and in detection of potentially emergence of measles virus neutralization-resistant mutants. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Exploring The Impact Of The US Measles Outbreak On Parental Awareness Of And Support For Vaccination.

    PubMed

    Cacciatore, Michael A; Nowak, Glen; Evans, Nathaniel J

    2016-02-01

    Despite consensus among health officials that childhood immunizations are a safe and effective means of protecting people from disease, some parents remain hesitant about vaccinating their children. This hesitancy has been linked to a lack of confidence in recommended vaccinations as well as a desire to delay or further space out scheduled vaccinations but also outright refusal of vaccines. Using two national surveys of parents of children ages five and younger, collected immediately prior to and in the weeks following the 2014-15 US measles outbreak, this study examined the awareness of this vaccine-preventable disease outbreak among parents and whether awareness of the outbreak affected their beliefs about childhood vaccination, confidence, and intentions. The study found that while most parents were aware of the outbreak, many were not, and the level of familiarity mattered, particularly on measures of confidence in vaccines and support for mandates requiring childhood vaccination. Increases in vaccine-related concerns were found as well, indicating that disease outbreaks foster not just awareness of vaccines and their potential to prevent disease but a range of parental responses.

  15. Genetic polymorphisms in host antiviral genes: associations with humoral and cellular immunity to measles vaccine.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; Umlauf, Benjamin J; Vierkant, Robert A; Shane Pankratz, V; Jacobson, Robert M; Poland, Gregory A

    2011-11-08

    Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella (MMR) vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction for FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and

  16. Measles outbreak among the Dukpa tribe of Buxa hills in West Bengal, India: epidemiology and vaccine efficacy.

    PubMed

    Bhuniya, Satinath; Maji, Dipankar; Mandal, Debasis; Mondal, Nilanjan

    2013-01-01

    Although measles is a vaccine preventable disease, its occurrence and outbreaks are common in India. Four remote and inaccessible hamlets, inhabited by the Dukpa tribe, at Buxa Hills under Kalchini Block of Jalpaiguri District, West Bengal experienced a measles outbreak during the months of April-June, 2011. The authors conducted an investigation to assess vaccine coverage, vaccine efficacy (VE) and to describe the patterns of measles outbreaks in this community. The over-all attack rate was 14.3%; that among males and females were 12.6% and 16.0% respectively (P = 0.189). Attack rate was highest (40%) in 0 to <5 years followed by that in the 5 to <15 years (36.5%). VE was 66.3% (95% of the confidence interval 46.9-78.6%). There is an urgent need to increase the vaccination coverage through special tactics for reaching the unreached.

  17. Measles in the Democratic Republic of Congo: an urgent wake-up call to adapt vaccination implementation strategies.

    PubMed

    Gerard, S P; Kyrousis, E; Zachariah, R

    2014-03-21

    All countries in Africa have made a commitment to eliminate measles by 2020. This is laudable, as measles elimination will have a crucial impact on reducing childhood mortality. An important operational challenge is the resurgence of measles outbreaks in a number of countries; one of the main reasons for this is that many children are being missed by vaccination programmes. In the Democratic Republic of Congo (DRC), outbreaks continue unabated despite repeated vaccination campaigns and high reported coverage by the Ministry of Health. This paper brings into question the effectiveness of the current approach and the need for better reflection on bottlenecks and strategies that can address this issue. If we are to eliminate measles by 2020, there will be a need for impetus, a need for decisive action to reach that goal and prevent unnecessary childhood deaths in countries such as the DRC.

  18. Measles in the Democratic Republic of Congo: an urgent wake-up call to adapt vaccination implementation strategies

    PubMed Central

    Kyrousis, E.; Zachariah, R.

    2014-01-01

    All countries in Africa have made a commitment to eliminate measles by 2020. This is laudable, as measles elimination will have a crucial impact on reducing childhood mortality. An important operational challenge is the resurgence of measles outbreaks in a number of countries; one of the main reasons for this is that many children are being missed by vaccination programmes. In the Democratic Republic of Congo (DRC), outbreaks continue unabated despite repeated vaccination campaigns and high reported coverage by the Ministry of Health. This paper brings into question the effectiveness of the current approach and the need for better reflection on bottlenecks and strategies that can address this issue. If we are to eliminate measles by 2020, there will be a need for impetus, a need for decisive action to reach that goal and prevent unnecessary childhood deaths in countries such as the DRC. PMID:26423753

  19. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  20. Vaccine effectiveness and risk factors associated with measles among children presenting to the hospitals of Karachi, Pakistan.

    PubMed

    Zahidie, Aysha; Wasim, Saba; Fatmi, Zafar

    2014-12-01

    To determine the risk factors regarding guardian's practices associated with development of Measles and also find out effectiveness of Measles vaccine among children less than 12 years of age presenting to the hospitals of Karachi. Matched case control study. Multicenter surveillance was conducted in 11 public and private sector hospitals of Karachi from January 2011 to September 2012 in consultation with World Health Organization Measles Surveillance Cell. Cases were children aged less than 12 years with Measles presenting to the hospitals. Controls for cases were enrolled from the same hospitals without Measles, matched for age and gender. Studied variables were analyzed by multivariate conditional logistic regression analysis adjusted for age and gender. Measles cases were more likely to have mothers with 'lower education' [adjusted matched Odds Ratio or mOR: 3.2 (95% CI: 1.2 - 7.6), for < 5 years of schooling adjusted mOR: 2.2 (95% CI: 1.0 - 5.7) for 6 - 10 years of schooling]. Children with Measles were also more likely to be not given breast milk in initial 2 years of life [adjusted mOR: 2.6, 95% CI 1.0 - 7.0]. Cases were also more likely to have never received vaccination [adjusted mOR: 10.1, 95% CI 4.5 - 22.5] and having no other children vaccinated at home [adjusted mOR: 3, 95% CI 1.5 - 5.3]. Vaccine effectiveness for single dose was found to be 87.4 (95% CI: 76.1 - 93.4), while for two doses it was approximately 93% (95% CI: 86.2 - 96.6). For Measles elimination, mother's education on breast feeding and appropriate weaning practices is required.

  1. Evaluation of Measles-Mumps-Rubella Vaccination Among Newly Arrived Refugees.

    PubMed

    Lee, Deborah; Weinberg, Michelle; Benoit, Stephen

    2017-05-01

    To assess US availability and use of measles-mumps-rubella (MMR) vaccination documentation for refugees vaccinated overseas. We selected 1500 refugee records from 14 states from March 2013 through July 2015 to determine whether overseas vaccination records were available at the US postarrival health assessment and integrated into the Advisory Committee on Immunization Practices schedule. We assessed number of doses, dosing interval, and contraindications. Twelve of 14 (85.7%) states provided data on 1118 (74.5%) refugees. Overseas records for 972 (86.9%) refugees were available, most from the Centers for Disease Control and Prevention's Electronic Disease Notification system (66.9%). Most refugees (829; 85.3%) were assessed appropriately for MMR vaccination; 37 (3.8%) should have received MMR vaccine but did not; 106 (10.9%) did not need the MMR vaccine but were vaccinated. Overseas documentation was available at most clinics, and MMR vaccinations typically were given when needed. Further collaboration between refugee health clinics and state immunization information systems would improve accessibility of vaccination documentation.

  2. Ex vivo analysis of cytotoxic T lymphocytes to measles antigens during infection and after vaccination in Gambian children.

    PubMed Central

    Jaye, A; Magnusen, A F; Sadiq, A D; Corrah, T; Whittle, H C

    1998-01-01

    The study of cytotoxic T cell responses to measles antigens during infection and after vaccination may provide insight into the immunopathology of the infection. It will also provide a knowledge of the immunity conferred by wild or attenuated virus, which will help in the design of new vaccines. Direct cytotoxic T cell responses, which did not require in vitro restimulation, were measured from peripheral blood by a standard 51Cr-release assay in 35 patients with acute measles, using HLA class I matched allogeneic B cells as targets. 77% showed specific responses to measles fusion protein, 69% to the hemagglutinin, and 50% to the nucleoprotein. These responses, which were related to severity of disease and history of previous vaccination, had waned by 14-24 wk after measles when memory responses to the same antigens could be elicited by restimulation in 71% of the 13 patients tested. A similar pattern followed vaccination: direct cytotoxic responses to fusion and hemagglutinin proteins were shown in 70% of the 20 children tested while 50% responded to the nucleoprotein. These responses, which were mediated by both CD8(+) and CD4(+) cells, faded over 6 wk when memory responses could be restimulated. Thus, a vigorous cytotoxic T lymphocyte response to fusion, hemagglutinin, and nucleoproteins is important in both natural and vaccine-induced immunity to measles. PMID:9835622

  3. Asthma and allergy in children with and without prior measles, mumps, and rubella vaccination.

    PubMed

    Timmermann, Clara Amalie Gade; Osuna, Christa Elyse; Steuerwald, Ulrike; Weihe, Pál; Poulsen, Lars K; Grandjean, Philippe

    2015-12-01

    The existing literature on the association between measles vaccination and subsequent risk of allergic disease is inconclusive. The aim of this study was, therefore, to determine whether measles, mumps, and rubella (MMR) vaccination administered in early childhood was associated with asthma and allergic diseases at ages 5, 7 and 13 yrs in a birth cohort. In the Faroe Islands, 640 children were followed from birth. Follow-up examinations at ages 5, 7 and 13 yrs included a physical examination and a maternal questionnaire about the child's health. At age 7, total and grass-specific IgE was quantified in the child's serum, and at age 13, the children underwent skin prick tests (SPT). The child's vaccination card was reviewed at examinations. At age 5, 533 of 555 children had been vaccinated for MMR. After confounder adjustment, we found early life MMR vaccination to be associated with a two-third reduction in the odds of asthma (OR: 0.33, 95% CI: 0.12; 0.90) and hypersensitivity/allergy (OR: 0.32, 95% CI: 0.11; 0.88) at age 5, and the substantially decreased odds of asthma were replicated at age 13 (OR: 0.22, 95% CI: 0.08; 0.56). At age 7, serum total IgE was reduced by 62.8% (CI 95%: -84.3%; -11.9%) in the vaccinated children. MMR vaccination was not significantly associated with allergic rhinoconjuctivitis symptoms, eczema, or SPT reactions at age 13. MMR vaccination early in life may have a protective effect against allergy at least up to age 7 and against asthma through age 13 yrs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Lack of association between measles-mumps-rubella vaccination and autism in children: a case-control study.

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka; Majewska, Renata

    2010-05-01

    The first objective of the study was to determine whether there is a relationship between the measles-mumps-rubella (MMR) vaccination and autism in children. The second objective was to examine whether the risk of autism differs between use of MMR and the single measles vaccine. Case-control study. The 96 cases with childhood or atypical autism, aged 2 to 15, were included into the study group. Controls consisted of 192 children individually matched to cases by year of birth, sex, and general practitioners. Data on autism diagnosis and vaccination history were from physicians. Data on the other probable autism risk factors were collected from mothers. Logistic conditional regression was used to assess the risk of autism resulting from vaccination. Assessment was made for children vaccinated (1) Before diagnosis of autism, and (2) Before first symptoms of autism onset. Odds ratios were adjusted to mother's age, medication during pregnancy, gestation time, perinatal injury and Apgar score. For children vaccinated before diagnosis, autism risk was lower in children vaccinated with MMR than in the nonvaccinated (OR: 0.17, 95% CI: 0.06-0.52) as well as to vaccinated with single measles vaccine (OR: 0.44, 95% CI: 0.22-0.91). The risk for vaccinated versus nonvaccinated (independent of vaccine type) was 0.28 (95% CI: 0.10-0.76). The risk connected with being vaccinated before onset of first symptoms was significantly lower only for MMR versus single vaccine (OR: 0.47, 95% CI: 0.22-0.99). The study provides evidence against the association of autism with either MMR or a single measles vaccine.

  5. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    ... women of childbearing age who do not have immunity to MMR receive the vaccine before pregnancy. In ... that have health conditions that severely lower their immunity (such as HIV/AIDS or steroid treatments) or ...

  6. CHRONOVAC VOYAGEUR: A study of the immune response to yellow fever vaccine among infants previously immunized against measles.

    PubMed

    Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel

    2017-09-25

    For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27

  7. Acute Bilateral Photoreceptor Degeneration in an Infant After Vaccination Against Measles and Rubella.

    PubMed

    Kuniyoshi, Kazuki; Hatsukawa, Yoshikazu; Kimura, Sadami; Fujino, Takahiro; Ohguro, Hiroshi; Nakai, Rie; Sunami, Kenta; Mishima, So-Ichiro; Sato, Tomoko; Kusaka, Shunji; Suzuki, Yasuhiro; Shimomura, Yoshikazu

    2017-05-01

    Ocular inflammation is occasionally observed after vaccinations, and most of them resolve without permanent visual disturbances. However, there are some rare cases of severe ocular complications following vaccinations. To report the findings in an infant boy who developed an acute loss of vision bilaterally after Haemophilus influenzae type b, Pneumococcal conjugate vaccination, and measles and rubella vaccination. His vision did not recover. A retrospective review of the medical records of a 13-month-old Japanese boy. Fundus and fluorescein angiographic findings, ultrasonographic and optical coherence tomographic images, and electroretinographic findings. A healthy 13-month-old boy had an acute loss of vision in both eyes 31 days after Haemophilus influenzae type b and Pneumococcal conjugate vaccinations and 24 days after a measles and rubella vaccination. He also developed a common cold 10 days before the vision loss. Ultrasonography showed an exudative retinal detachment 1 day after the onset of the visual reduction; however, his fundi appeared normal 4 days later. His eyes did not pursue objects, and pupillary light reflexes were not present. No signs of anterior uveitis were noted. He was treated with corticosteroids, but his vision did not improve. The retinal vessels gradually attenuated, and diffuse small white punctate lesions appeared in the deep retina. Optical coherence tomography showed a thinner outer nuclear layer and an absent ellipsoid zone. The electroretinograms were nonrecordable. These findings suggested a severe impairment of the photoreceptors, especially their outer segments. Western blot analysis of the patient's sera detected an antibody against recoverin, a calcium-binding protein of photoreceptors. We hypothesize that an infection induced severe chorioretinitis with an exudative retinal detachment, which then produced an autoantibody against recoverin. The autoantibody then altered the function of the photoreceptors very rapidly. The

  8. [Vaccination against measles. The situation in Mexico and America. Advances in the method of aerosol immunization].

    PubMed

    Fernández de Castro, J; Kumate, J

    1990-07-01

    We present general comments on the epidemiology of measles considering the pre-vaccine era as well as the post-vaccine period in which some changes can be observed: the decrease in morbidity and mortality, the extension of the inter-epidemic interval, the increase in the mean age of infection, etc. We make some estimations about the vaccine coverage and the ideal age of immunization for the goal of eradication (assuming a lifelong immunity for the vaccinees). The technical problems in measles immunization are also revised explaining why no continental country has been able to eliminate the disease. We describe the epidemiological situation in North America, Mexico and Latin American countries. Lastly we present the Mexican experience with the inhaled aerosolised vaccine: the studies in Monterrey (Sabin et al, 1982), other investigation in Mexico, D.F. and in the State of Jalisco, as well as the mass campaigns in Aguascalientes in 1988 and in Coahuila and Nuevo León in 1989. We propose it as an effective, harmless, simple, inexpensive and practical method.

  9. Difficulties in Eliminating Measles and Controlling Rubella and Mumps: A Cross-Sectional Study of a First Measles and Rubella Vaccination and a Second Measles, Mumps, and Rubella Vaccination

    PubMed Central

    Wang, Zhifang; Yan, Rui; He, Hanqing; Li, Qian; Chen, Guohua; Yang, Shengxu; Chen, Enfu

    2014-01-01

    Background The reported coverage of the measles–rubella (MR) or measles–mumps–rubella (MMR) vaccine is greater than 99.0% in Zhejiang province. However, the incidence of measles, mumps, and rubella remains high. In this study, we assessed MMR seropositivity and disease distribution by age on the basis of the current vaccination program, wherein the first dose of MR is administered at 8 months and the second dose of MMR is administered at 18–24 months. Methods Cross-sectional serological surveys of MMR antibodies were conducted by collecting epidemiological data in Zhejiang province, China in 2011. In total, 1015 participants were randomly selected from two surveillance sites. Serum MMR-specific immunoglobulin G levels were tested by enzyme-linked immunosorbent assay. The geometric mean titers and seroprevalence with 95% confidence intervals (CIs) were calculated by age and gender. Proportions of different dose of vaccine by age by vaccine were also identified. Statistically significant differences between categories were assessed by the Chi-square test. Results Over 95% seroprevalence rates of measles were seen in all age groups except <7 months infants. Children aged 5–9 years were shown lower seropositivity rates of mumps while elder adolescences and young adults were presented lower rubella seroprevalence. Especially, rubella seropositivity was significantly lower in female adults than in male. Nine measles cases were unvaccinated or unknown vaccination history. Among them, 66.67% (6/9) patients were aged 20–29 years while 33.33% (3/9) were infants aged 8–12 months. In addition, 57.75% (648/1122) patients with mumps were children aged 5–9 years, and 50.54% (94/186) rubella cases were aged 15–39 years. Conclusions A timely two-dose MMR vaccination schedule is recommended, with the first dose at 8 months and the second dose at 18–24 months. An MR vaccination speed-up campaign may be necessary for elder adolescents and young adults, particularly

  10. Progress Toward Measles Elimination - South-East Asia Region, 2003-2013.

    PubMed

    Thapa, Arun; Khanal, Sudhir; Sharapov, Umid; Swezy, Virginia; Sedai, Tika; Dabbagh, Alya; Rota, Paul; Goodson, James L; McFarland, Jeffrey

    2015-06-12

    In 2013, the 66th session of the Regional Committee of the World Health Organization (WHO) South-East Asia Region adopted the goal of measles elimination and rubella and congenital rubella syndrome control by 2020 after rigorous prior consultations. The recommended strategies include 1) achieving and maintaining ≥95% coverage with 2 doses of measles- and rubella-containing vaccine in every district through routine or supplementary immunization activities (SIAs); 2) developing and sustaining a sensitive and timely case-based measles surveillance system that meets recommended performance indicators; 3) developing and maintaining an accredited measles laboratory network; and 4) achieving timely identification, investigation, and response to measles outbreaks. This report updates previous reports and summarizes progress toward measles elimination in the South-East Asia Region during 2003-2013. Within the region, coverage with the first dose of a measles-containing vaccine (MCV1) increased from 67% to 78%; an estimated 286 million children (95% of the target population) were vaccinated in SIAs; measles incidence decreased 73%, from 59 to 16 cases per million population; and estimated measles deaths decreased 63%. To achieve measles elimination in the region, additional efforts are needed in countries with <95% 2-dose routine MCV coverage, particularly in India and Indonesia, to strengthen routine immunization services, conduct periodic high-quality SIAs, and strengthen measles case-based surveillance and laboratory diagnosis of measles.

  11. Contrasting female-male mortality ratios after routine vaccinations with pentavalent vaccine versus measles and yellow fever vaccine. A cohort study from urban Guinea-Bissau.

    PubMed

    Fisker, Ane B; Biering-Sørensen, Sofie; Lund, Najaaraq; Djana, Queba; Rodrigues, Amabelia; Martins, Cesario L; Benn, Christine S

    2016-08-31

    In addition to protection against the target diseases, vaccines may have non-specific effects (NSEs). Measles vaccine (MV) has beneficial NSEs, providing protection against non-measles deaths, most so for girls. By contrast, though protecting against diphtheria, tetanus and pertussis, DTP vaccine is associated with increased female mortality relative to male mortality. In 2008, Guinea-Bissau replaced DTP with the DTP-containing pentavalent vaccine (Penta; DTP-H. influenza type B-Hepatitis B) at 6, 10 and 14weeks and yellow fever vaccine (YF) was to be given with MV. We investigated possible sex-differential mortality rates following Penta and MV+YF vaccination. Bandim Health Project (BHP) registers vaccines given by the three government health centres in the study area and vital status through demographic surveillance. We assessed the association between sex and mortality by vaccination status in Cox proportional hazards models with age as underlying timescale. Follow-up was censored at a subsequent vaccination contact or after 6months of follow-up. Between September 2008 and April 2011, we registered 23,448 vaccination contacts for children aged 42-365days; 17,313 were for Penta and 3028 for MV (2907 co-administered with YF). During follow-up 112 children died. The female/male mortality rate ratio was 1.73 (1.11-2.70) following Penta and 0.38 (0.12-1.19) after MV (p=0.02 for same effect). Adjusting for maternal education or weight-for-age at the time of vaccination did not change the estimates. Penta appears to have the same negative effects on mortality as those seen for DTP. Assessing post-vaccination mortality for boys and girls is necessary to improve the vaccination programme. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Pediatric measles vaccine expressing a dengue tetravalent antigen elicits neutralizing antibodies against all four dengue viruses.

    PubMed

    Brandler, Samantha; Ruffie, Claude; Najburg, Valérie; Frenkiel, Marie-Pascale; Bedouelle, Hughes; Desprès, Philippe; Tangy, Frédéric

    2010-09-24

    Dengue disease is an increasing global health problem that threatens one-third of the world's population. To control this emerging arbovirus, an efficient preventive vaccine is still needed. Because four serotypes of dengue virus (DV) coexist and antibody-dependent enhanced infection may occur, most strategies developed so far rely on the administration of tetravalent formulations of four live attenuated or chimeric viruses. Here, we evaluated a new strategy based on the expression of a single minimal tetravalent DV antigen by a single replicating viral vector derived from pediatric live-attenuated measles vaccine (MV). We generated a recombinant MV vector expressing a DV construct composed of the four envelope domain III (EDIII) from the four DV serotypes fused with the ectodomain of the membrane protein (ectoM). After two injections in mice susceptible to MV infection, the recombinant vector induced neutralizing antibodies against the four serotypes of dengue virus. When immunized mice were further inoculated with live DV from each serotype, a strong memory neutralizing response was raised against all four serotypes. A combined measles-dengue vaccine might be attractive to immunize infants against both diseases where they co-exist.

  13. Protection from SARS coronavirus conferred by live measles vaccine expressing the spike glycoprotein.

    PubMed

    Escriou, Nicolas; Callendret, Benoît; Lorin, Valérie; Combredet, Chantal; Marianneau, Philippe; Février, Michèle; Tangy, Frédéric

    2014-03-01

    The recent identification of a novel human coronavirus responsible of a SARS-like illness in the Middle-East a decade after the SARS pandemic, demonstrates that reemergence of a SARS-like coronavirus from an animal reservoir remains a credible threat. Because SARS is contracted by aerosolized contamination of the respiratory tract, a vaccine inducing mucosal long-term protection would be an asset to control new epidemics. To this aim, we generated live attenuated recombinant measles vaccine (MV) candidates expressing either the membrane-anchored SARS-CoV spike (S) protein or its secreted soluble ectodomain (Ssol). In mice susceptible to measles virus, recombinant MV expressing the anchored full-length S induced the highest titers of neutralizing antibodies and fully protected immunized animals from intranasal infectious challenge with SARS-CoV. As compared to immunization with adjuvanted recombinant Ssol protein, recombinant MV induced stronger and Th1-biased responses, a hallmark of live attenuated viruses and a highly desirable feature for an antiviral vaccine. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Impact of unfounded vaccine safety concerns on the nationwide measles-rubella immunization campaign, Georgia, 2008.

    PubMed

    Khetsuriani, N; Imnadze, P; Baidoshvili, L; Jabidze, L; Tatishili, N; Kurtsikashvili, G; Lezhava, T; Laurent, E; Martin, R

    2010-09-07

    Vaccine safety fears following media reports of adverse events led to low (50.3%) coverage in a supplementary measles-rubella immunization campaign in Georgia in 2008. Review of adverse events associated with the campaign identified 432 reports (<0.1% of ∼ 493,000 vaccinees) including 338 (78.2%) cases of syncope. There were no deaths. Causality assessment was performed for 79 cases perceived by providers as severe and with clinical details available. Conditions likely caused by the vaccine were identified in 13 (16.5%) cases (allergic and local reactions, thrombocytopenia). Thirty-seven (46.8%) cases had symptoms consistent with syncope or anxiety attack; 36 (97.3%) of them were initially misdiagnosed as anaphylactic shock/allergies/"postvaccinal reactions". Twenty-nine (36.7%) cases had coincidental illnesses. Safety fears were unfounded and exaggerated by media reports and providers' difficulties in recognizing syncope/anxiety attacks. Risk communication strategies to address perceived vaccine safety concerns are urgently needed to ensure that the goal of measles and rubella elimination in the European Region of the World Health Organization is met.

  15. Comparison of Immunoglobulin G Subclass Profiles Induced by Measles Virus in Vaccinated and Naturally Infected Individuals

    PubMed Central

    Isa, María Beatríz; Martínez, Laura; Giordano, Miguel; Passeggi, Carlos; de Wolff, María Cristina; Nates, Silvia

    2002-01-01

    A total of 258 human sera positive for measles antibodies were divided into four different groups: group 1 contained 54 sera from children after natural measles infection (immunoglobulin M [IgM] positive, early infection phase), group 2 contained 28 sera from children after measles vaccination (IgM positive, early infection phase), group 3 contained 100 sera from healthy adults (natural long-lasting immunity), and group 4 contained 76 sera from healthy children (postvaccinal long-lasting immunity). In the early phase of infection, the percent distributions of measles virus-specific IgG isotypes were similar between natural and postvaccinal immune responses. IgG1 and IgG4 were the dominant isotypes, with mean levels of detection of 100% (natural infection) and 100% (postvaccinal) for IgG1 and 96% (natural infection) and 92% (postvaccinal) for IgG4. In comparison, the IgG4 geometric mean titer (GMT) in the early phase of natural infection was significantly higher than the IgG4 GMT detected in the postvaccinal immune response (80 versus 13; 95% confidence interval). In the memory phase, IgG2 and IgG3 responses decreased significantly in both natural infection and postvaccinal groups, while IgG1 levels were maintained. In contrast, the IgG4 postvaccinal immune response decreased strongly in the memory phase, whereas IgG4 natural long-lasting immunity remained unchanged (9 versus 86%; P < 0.05). The results obtained suggest that IgG4 isotype could be used in the early phase of infection as a quantitative marker and in long-lasting immunity as a qualitative marker to differentiate between natural and postvaccinal immune responses. PMID:11986279

  16. No evidence of an increase of bacterial and viral infections following Measles, Mumps and Rubella vaccine.

    PubMed

    Stowe, Julia; Andrews, Nick; Taylor, Brent; Miller, Elizabeth

    2009-02-25

    The suggestion that multi-antigen vaccines might overload the immune system has led to calls for single antigen vaccines. In 2003 we showed that rather than an increase there appeared to be a reduced risk of severe bacterial infection in the three months following Measles, Mumps and Rubella vaccine (MMR). The present analysis of illnesses in a general population is based on an additional 10 years of data for bacterial infections and also includes admissions with viral infections. Analyses were carried out using the self-controlled case-series method and separately for bacterial and viral infection cases, using risk periods of 0-30 days, 31-60 days and 61-90 days post MMR vaccine. An analysis was also carried out for those cases which were given MMR and Meningococcal serogroup C (MCC) vaccines concomitantly. A reduced risk was seen in the 0-30-day period for both bacterial infection (relative incidence=0.68, 95% CI 0.54-0.86) and viral infections (relative incidence=0.68, 95% CI 0.49-0.93). There was no increased risk in any period when looking at combined viral or bacterial infections or for individual infections with the single exception of an increased risk in the 31-60 days post vaccination period for herpes infections (relative incidence=1.69, 95% CI 1.06-2.70). For the children given Meningococcal group C vaccines concomitantly no significantly increased risk was seen in either the bacterial (relative incidence=0.54, 95% CI 0.26-1.13) or viral cases (relative incidence=0.46, 95% CI 0.11-1.93). Our study confirms that the MMR vaccine does not increase the risk of invasive bacterial or viral infection in the 90 days after the vaccination and does not support the hypothesis that there is an induced immune deficiency due to overload from multi-antigen vaccines.

  17. Measles virus.

    PubMed

    Naim, Hussein Y

    2015-01-01

    Measles was an inevitable infection during the human development with substantial degree of morbidity and mortality. The severity of measles virus (MV) infection was largely contained by the development of a live attenuated vaccine that was introduced into the vaccination programs. However, all efforts to eradicate the disease failed and continued to annually result in significant deaths. The development of molecular biology techniques allowed the rescue of MV from cDNA that enabled important insights into a variety of aspects of the biology of the virus and its pathogenesis. Subsequently these technologies facilitated the development of novel vaccine candidates that induce immunity against measles and other pathogens. Based on the promising prospective, the use of MV as a recombinant vaccine and a therapeutic vector is addressed.

  18. Missed Opportunities for Measles, Mumps, Rubella Vaccination Among Departing U.S. Adult Travelers Receiving Pretravel Health Consultations.

    PubMed

    Hyle, Emily P; Rao, Sowmya R; Jentes, Emily S; Parker Fiebelkorn, Amy; Hagmann, Stefan H F; Taylor Walker, Allison; Walensky, Rochelle P; Ryan, Edward T; LaRocque, Regina C

    2017-07-18

    Measles outbreaks continue to occur in the United States and are mostly due to infections in returning travelers. To describe how providers assessed the measles immunity status of departing U.S. adult travelers seeking pretravel consultation and to assess reasons given for nonvaccination among those considered eligible to receive the measles, mumps, rubella (MMR) vaccine. Observational study in U.S. pretravel clinics. 24 sites associated with Global TravEpiNet (GTEN), a Centers for Disease Control and Prevention-funded consortium. Adults (born in or after 1957) attending pretravel consultations at GTEN sites (2009 to 2014). Structured questionnaire completed by traveler and provider during pretravel consultation. 40 810 adult travelers were included; providers considered 6612 (16%) to be eligible for MMR vaccine at the time of pretravel consultation. Of the MMR-eligible, 3477 (53%) were not vaccinated at the visit; of these, 1689 (48%) were not vaccinated because of traveler refusal, 966 (28%) because of provider decision, and 822 (24%) because of health systems barriers. Most MMR-eligible travelers who were not vaccinated were evaluated in the South (2262 travelers [65%]) or at nonacademic centers (1777 travelers [51%]). Nonvaccination due to traveler refusal was most frequent in the South (1432 travelers [63%]) and in nonacademic centers (1178 travelers [66%]). These estimates could underrepresent the opportunities for MMR vaccination because providers accepted verbal histories of disease and vaccination as evidence of immunity. Of U.S. adult travelers who presented for pretravel consultation at GTEN sites, 16% met criteria for MMR vaccination according to the provider's assessment, but fewer than half of these travelers were vaccinated. An increase in MMR vaccination of eligible U.S. adult travelers could reduce the likelihood of importation and transmission of measles virus. Centers for Disease Control and Prevention, National Institutes of Health, and the

  19. Measles & rubella outbreaks in Maharashtra State, India.

    PubMed

    Vaidya, Sunil R; Kamble, Madhukar B; Chowdhury, Deepika T; Kumbhar, Neelakshi S

    2016-02-01

    Under the outbreak-based measles surveillance in Maharashtra State the National Institute of Virology at Pune receives 3-5 serum samples from each outbreak and samples from the local hospitals in Pune for laboratory diagnosis. This report describes one year data on the measles and rubella serology, virus isolation and genotyping. Maharashtra State Health Agencies investigated 98 suspected outbreaks between January-December 2013 in the 20 districts. Altogether, 491 serum samples were received from 20 districts and 126 suspected cases from local hospitals. Samples were tested for the measles and rubella IgM antibodies by commercial enzyme immunoassay (EIA). To understand the diagnostic utility, a subset of serum samples (n=53) was tested by measles focus reduction neutralization test (FRNT). Further, 37 throat swabs and 32 urine specimens were tested by measles reverse transcription (RT)-PCR and positive products were sequenced. Virus isolation was performed in Vero hSLAM cells. Of the 98 suspected measles outbreaks, 61 were confirmed as measles, 12 as rubella and 21 confirmed as the mixed outbreaks. Four outbreaks remained unconfirmed. Of the 126 cases from the local hospitals, 91 were confirmed for measles and three for rubella. Overall, 93.6 per cent (383/409) confirmed measles cases were in the age group of 0-15 yr. Measles virus was detected in 18 of 38 specimens obtained from the suspected cases. Sequencing of PCR products revealed circulation of D4 (n=9) and D8 (n=9) strains. Four measles viruses (three D4 & one D8) were isolated. Altogether, 94 measles and rubella outbreaks were confirmed in 2013 in the State of Maharasthra indicating the necessity to increase measles vaccine coverage in the State.

  20. Closer look at autism and the measles-mumps-rubella vaccine.

    PubMed

    Hensley, Emily; Briars, Leslie

    2010-01-01

    To educate pharmacists regarding the hypothesis that the measles-mumps-rubella (MMR) vaccine is linked to the development of autism. Articles published from 1998 to 2009 were identified through electronic searches of Medline. Articles were included if they evaluated or reviewed a possible link between the MMR vaccine and autism or discussed MMR epidemiology, legal proceedings involving the MMR vaccine and autism, or health professionals' impact on immunization decisions. A total of 27 articles were identified. Of the articles, 74% (20 of 27) were included in the review because of their relevance to the study topic. The evidence presented does not show a causal relationship between the MMR vaccine and autism. Myths presented to potentially support any relationship between the MMR vaccine and autism have not been proven. Expert testimony refuting initial scientific theories has led to Supreme Court decisions that do not support a link between the MMR vaccine and autism. Pharmacists and all health care providers are responsible for informing and educating parents and families regarding this information so that they can make informed decisions about immunizations.

  1. Immunogenicity of next-generation HPV vaccines in non-human primates: Measles-vectored HPV vaccine versus Pichia pastoris recombinant protein vaccine.

    PubMed

    Gupta, Gaurav; Giannino, Viviana; Rishi, Narayan; Glueck, Reinhard

    2016-09-07

    Human papillomavirus (HPV) infection is the most common sexually transmitted disease worldwide. HPVs are oncogenic small double-stranded DNA viruses that are the primary causal agent of cervical cancer and other types of cancers, including in the anus, oropharynx, vagina, vulva, and penis. Prophylactic vaccination against HPV is an attractive strategy for preventing cervical cancer and some other types of cancers. However, there are few safe and effective vaccines against HPV infections. Current first-generation commercial HPV vaccines are expensive to produce and deliver. The goal of this study was to develop an alternate potent HPV recombinant L1-based vaccines by producing HPV virus-like particles into a vaccine that is currently used worldwide. Live attenuated measles virus (MV) vaccines have a well-established safety and efficacy record, and recombinant MV (rMV) produced by reverse genetics may be useful for generating candidate HPV vaccines to meet the needs of the developing world. We studied in non-human primate rMV-vectored HPV vaccine in parallel with a classical alum adjuvant recombinant HPV16L1 and 18L1 protein vaccine produced in Pichia pastoris. A combined prime-boost approach using both vaccines was evaluated, as well as immune interference due to pre-existing immunity against the MV. The humoral immune response induced by the MV, Pichia-expressed vaccine, and their combination as priming and boosting approaches was found to elicit HPV16L1 and 18L1 specific total IgG and neutralizing antibody titres. Pre-existing antibodies against measles did not prevent the immune response against HPV16L1 and 18L1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Live attenuated measles and mumps viral strain-containing vaccines and hearing loss: Vaccine Adverse Event Reporting System (VAERS), United States, 1990--2003.

    PubMed

    Asatryan, Armenak; Pool, Vitali; Chen, Robert T; Kohl, Katrin S; Davis, Robert L; Iskander, John K

    2008-02-26

    Hearing loss (HL) is a known complication of wild measles and mumps viral infections. As vaccines against measles and mumps contain live attenuated viral strains, it is biologically plausible that in some individuals HL could develop as a complication of vaccination against measles and/or mumps. Our objectives for this study were: to find and describe all cases of HL reported in the scientific literature and to the US Vaccine Adverse Events Reporting System (VAERS) for the period 1990--2003; and to determine reporting rate of HL after live attenuated measles and/or mumps viral strain-containing vaccines (MMCV) administration. We searched published reports for cases of HL identified after vaccination with MMCV. We also searched for reports of HL after MMCV administration submitted to VAERS from 1990 through 2003 and determined the dose-adjusted reporting rate of HL. Our main outcome measure was reported cases of HL after immunization with MMCV which were classified as idiopathic. We found 11 published case reports of HL following MMCV. The review of the VAERS reports identified 44 cases of likely idiopathic sensorineural HL after MMCV administration. The onset of HL in the majority of VAERS and published cases was consistent with the incubation periods of wild measles and mumps viruses. Based on the annual usage of measles-mumps-rubella (MMR) vaccine, we estimated the reporting rate of HL to be 1 case per 6-8 million doses. Thus, HL following MMCV has been reported in the literature and to the VAERS. Further studies are needed to better understand if there is a causal relationship between MMCV and HL.

  3. Mumps antibody in the Thai population 17 years after the universal measles mumps rubella vaccination program.

    PubMed

    Ngaovithunvong, Varisara; Wanlapakorn, Nasamon; Tesapirat, Lita; Suratannon, Narrissara; Poovorawan, Yong

    2016-08-02

    mumps vaccination implementation in the form of MMR - measles, mumps, and rubella) in Thailand for first-grade school students since 1997 and for infants 9-12 months of age since 2010 resulted in a dramatic decline in the incidence of and deaths from mumps. However, there has been a resurgence of mumps outbreaks in Thailand, even in vaccinated populations. We aimed to determine the current seroprevalence of IgG antibodies to mumps in those 0-60 years of age from four different geographic areas of Thailand, and compare the results with our previous serosurvey in 2004. Seropositivity rates in children 0-7 years of age increased significantly from 45.8% in 2004 to 72.3% in 2014 after the launch of the MMR vaccine for infants. In the 8-14-year age group who had received one dose of mumps vaccination, the seropositivity rate was 66.7%. In the 15-19-year age group the seropositivity rate was the lowest, at 52.5%. Our findings correspond well with the vaccination schedules, as the highest seropositivity rate was found in children between 0 and 7 years of age. For those older than 7, there was a decline in seropositivity rate despite good vaccine coverage and reached its lowest in the 15-19-year age group. This suggested that certain population groups might be incompletely vaccinated, or the humoral immunity provided by vaccination gradually declined over time. We recommend a booster dose of MMR vaccine for Thai adolescents in order to prevent future mumps outbreaks.

  4. Measles: effect of a two-dose vaccination programme in Catalonia, Spain.

    PubMed Central

    Godoy, P.; Domínguez, A.; Salleras, L.

    1999-01-01

    The study reports incidences of measles in Catalonia, Spain, as detected by surveillance, and analyses the specific characteristics of the outbreaks reported for the period 1986-95. Incidences per 100,000 inhabitants were calculated for the period 1971-95. The following variables were studied: year of presentation, number of cases, median age, transmission setting, cases with a record of vaccination and preventable cases. Associations between variables were determined using odds ratios (OR). The incidence of measles declined from 306.3 cases in 1971 to 30.9 in 1995. A total of 50 outbreaks were investigated. The outbreaks that occurred in the last two years of the study had a higher likelihood of having a transmission setting other than primary school (OR = 3.9); a median case age > 10 years (OR = 7.2); and fewer than 6 cases (OR = 2.3). The characteristics of recent outbreaks, marked by a rise both in transmission outside the primary-school setting and in median age, indicate the need for the introduction of a specific vaccination programme at the end of adolescence in addition to control of school-related outbreaks. PMID:10083711

  5. Biosafety considerations for attenuated measles virus vectors used in virotherapy and vaccination

    PubMed Central

    Baldo, Aline; Galanis, Evanthia; Tangy, Frédéric; Herman, Philippe

    2016-01-01

    ABSTRACT Attenuated measles virus (MV) is one of the most effective and safe vaccines available, making it attractive candidate vector to prevent infectious diseases. Attenuated MV have acquired the ability to use the complement regulator CD46 as a major receptor to mediate virus entry and intercellular fusion. Therefore, attenuated MV strains preferentially infect and destroy a wide variety of cancer cells making them also attractive oncolytic vectors. The use of recombinant MV vector has to comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The present article highlights the main characteristics of MV and recombinant MV vectors used for vaccination and virotherapy and discusses these features from a biosafety point of view. PMID:26631840

  6. Recombinant measles virus-HPV vaccine candidates for prevention of cervical carcinoma

    PubMed Central

    Cantarella, Giuseppina; Liniger, Matthias; Zuniga, Armando; Schiller, John T.; Billeter, Martin; Naim, Hussein Y.; Glueck, Reinhard

    2012-01-01

    Cervical cancer is mainly associated with HPV genotype 16 infection. Recombinant measles virus (rMV) expressing HPV genotype 16 L1 capsid protein was generated by construction of an antigenomic plasmid, followed by rescue using the human “helper” cell line 293-3-46. In cell cultures the recombinant MV-L1 virus replicated practically as efficiently as the standard attenuated MV established as commercial vaccine, devoid of the transgene. The high genetic stability of MVb2-L1 was confirmed by 10 serial viral transfers in cell culture. In transgenic mice expressing the MV receptor CD46 the recombinant induced strong humoral immune responses against both MV and HPV; the antibodies against L1 exhibited mainly neutralizing capacity. Our data suggest that MV is a promising vehicle for development of inexpensive and efficient vaccines protecting from HPV infection. PMID:19200837

  7. Acetaminophen (Paracetamol) Use, Measles-Mumps-Rubella Vaccination, and Autistic Disorder: The Results of a Parent Survey

    ERIC Educational Resources Information Center

    Schultz, Stephen T.; Klonoff-Cohen, Hillary S.; Wingard, Deborah L.; Akshoomoff, Natacha A.; Macera, Caroline A.; Ji, Ming

    2008-01-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80…

  8. Acetaminophen (Paracetamol) Use, Measles-Mumps-Rubella Vaccination, and Autistic Disorder: The Results of a Parent Survey

    ERIC Educational Resources Information Center

    Schultz, Stephen T.; Klonoff-Cohen, Hillary S.; Wingard, Deborah L.; Akshoomoff, Natacha A.; Macera, Caroline A.; Ji, Ming

    2008-01-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80…

  9. A measles outbreak in Catania, Sicily: the importance of high vaccination coverage and early notification of cases for health and economic reasons.

    PubMed

    Celesia, Benedetto Maurizio; Fontana, Rossella; Pinzone, Marilia Rita; Cuccia, Mario; Bellissimo, Francesco; Rapisarda, Liliana; Rinnone, Sebastiano; Rapisarda, Venerando; Pavone, Piero; Cacopardo, Bruno; Nunnari, Giuseppe

    2014-09-01

    Measles is a paediatric exanthematous disease. Even though vaccination has dramatically reduced measles morbidity and mortality, outbreaks still occur due to insufficient vaccination coverage and importation of the virus from endemic regions. Although child vaccination coverage in Italy has been broadened (from 74% in 2000 to 90.1% in 2011), outbreaks are still observed at a regional level. We describe epidemiological and clinical characteristics of cases reported from January 2009 to May 2010 to the Epidemiology Service of the Provincial Health Authority of Catania. We obtained demographic data and vaccination status from the database of the Epidemiology Service and clinical features and laboratory data from medical records. In all, 522 cases were notified: 286 males (54%), median age 12 years (interquartile range (IQR) 4-18); 401 cases (77%) were notified by the hospital, and 121 (23%) by general practitioners. Only one patient had been previously vaccinated. 52 cases were hospitalized, median age 18 years (IQR 17-23). We observed hypertransaminasaemia in 20 patients (38%), thrombocytopenia in 22 patients (42%) and a creatine phosphokinase increase in 16 (30%). Complications (pneumonia, haemorrhagic cystitis, acute hepatitis) occurred in 10 patients (19%), all older than 18. Recent outbreaks show that immunization practices are still insufficient. Most cases were recorded in adolescents and young adults; even if the vaccine has limited virus circulation in childhood, it did not prevent the infection of other age groups. The number of notifications also suggests that the phenomenon is underestimated. In order to monitor the disease we need early notification of cases and increased vaccination coverage.

  10. A population-based study of measles, mumps, and rubella vaccination and autism.

    PubMed

    Madsen, Kreesten Meldgaard; Hviid, Anders; Vestergaard, Mogens; Schendel, Diana; Wohlfahrt, Jan; Thorsen, Poul; Olsen, Jørn; Melbye, Mads

    2002-11-07

    It has been suggested that vaccination against measles, mumps, and rubella (MMR) is a cause of autism. We conducted a retrospective cohort study of all children born in Denmark from January 1991 through December 1998. The cohort was selected on the basis of data from the Danish Civil Registration System, which assigns a unique identification number to every live-born infant and new resident in Denmark. MMR-vaccination status was obtained from the Danish National Board of Health. Information on the children's autism status was obtained from the Danish Psychiatric Central Register, which contains information on all diagnoses received by patients in psychiatric hospitals and outpatient clinics in Denmark. We obtained information on potential confounders from the Danish Medical Birth Registry, the National Hospital Registry, and Statistics Denmark. Of the 537,303 children in the cohort (representing 2,129,864 person-years), 440,655 (82.0 percent) had received the MMR vaccine. We identified 316 children with a diagnosis of autistic disorder and 422 with a diagnosis of other autistic-spectrum disorders. After adjustment for potential confounders, the relative risk of autistic disorder in the group of vaccinated children, as compared with the unvaccinated group, was 0.92 (95 percent confidence interval, 0.68 to 1.24), and the relative risk of another autistic-spectrum disorder was 0.83 (95 percent confidence interval, 0.65 to 1.07). There was no association between the age at the time of vaccination, the time since vaccination, or the date of vaccination and the development of autistic disorder. This study provides strong evidence against the hypothesis that MMR vaccination causes autism. Copyright 2002 Massachusetts Medical Society

  11. Self-reported histories of disease and vaccination against measles, mumps, rubella and varicella in health care personnel in Japan.

    PubMed

    Kumakura, Shunichi; Onoda, Keiichi; Hirose, Masahiro

    2014-03-01

    Health care personnel are required to be immune against vaccine-preventable diseases, such as measles, mumps, rubella, and varicella. The aim of this study is to evaluate the accuracy of self-reported histories of disease and vaccination against measles, mumps, rubella, and varicella in order to determine the immune status of health care personnel. A self-reported questionnaire of history of previous disease and vaccination against these diseases was administered to a total of 910 health care personnel in Shimane university hospital in Japan, whose results were compared with serological evidences. There were numerous subjects who did not remember a history of disease (greater than 33% each) and of vaccination (greater than 58% each). Self-reported history of disease and vaccination had high positive predictive value against either disease for testing positive for antiviral antibodies. However, a considerable number of false-negative subjects could be found; 88.9% of subjects for measles, 89.3% for mumps, 62.2% for rubella and 96.3% for varicella in the population who had neither a self-reported history of disease nor a vaccination against each disease. In addition, regardless of the disease in question, a negative predictive value in self-reported history of disease and vaccination was remarkably low. These results suggest that self-reported history of disease and vaccination was not predictive to determine the accurate immune status of health care personnel against measles, mumps, rubella, and varicella. A seroprevalence survey, followed by an adequate immunization program for susceptible subjects, is crucial to prevent and control infection in hospital settings.

  12. Measles outbreaks and progress toward measles preelimination --- African region, 2009-2010.

    PubMed

    2011-04-01

    In 2008, the World Health Organization (WHO) African Region (AFR) measles technical advisory group (TAG) recommended establishing a measles preelimination goal, to be achieved by the end of 2012. The goal sets the following targets for the 46 AFR countries: ≥98% reduction in estimated regional measles mortality compared with 2000; measles incidence of <5 cases per 1 million population per year nationally; >90% national measles-containing vaccine (MCV) first dose (MCV1) coverage and >80% MCV1 coverage in all districts; and ≥95% MCV coverage by supplementary immunization activities (SIAs) in all districts. The goal also sets surveillance performance targets of ≥2 cases of nonmeasles febrile rash illness per 100,000 population, ≥1 suspected measles cases investigated with blood specimens in ≥80% of districts, and routine reporting from all districts. In addition, introduction of a routine second MCV dose (MCV2) was recommended for countries meeting specific criteria for MCV1 coverage and measles surveillance. This report updates progress toward the preelimination goal during 2009--2010 and summarizes measles outbreaks occurring in AFR countries since 2008. Of the 46 AFR countries, 12 (26%) reported measles incidence of <5 cases per 1 million population during 2010, compared with 28 (61%) in 2008. Furthermore, 28 (61%) countries reported a laboratory-confirmed measles outbreak during 2009--2010. The recent measles outbreaks highlight the need for renewed dedication by donors and governments to ensure that national multiyear vaccination plans, national budgetary line items, and financial commitments exist for routine immunization services and measles control activities.

  13. Co-administration of live measles and yellow fever vaccines and inactivated pentavalent vaccines is associated with increased mortality compared with measles and yellow fever vaccines only. An observational study from Guinea-Bissau.

    PubMed

    Fisker, Ane Bærent; Ravn, Henrik; Rodrigues, Amabelia; Østergaard, Marie Drivsholm; Bale, Carlito; Benn, Christine Stabell; Aaby, Peter

    2014-01-23

    Studies from low-income countries indicate that co-administration of inactivated diphtheria-tetanus-pertussis (DTP) vaccine and live attenuated measles vaccine (MV) is associated with increased mortality compared with receiving MV only. Pentavalent (DTP-H. Influenza type B-Hepatitis B) vaccine is replacing DTP in many low-income countries and yellow fever vaccine (YF) has been introduced to be given together with MV. Pentavalent and YF vaccines were introduced in Guinea-Bissau in 2008. We investigated whether co-administration of pentavalent vaccine with MV and yellow fever vaccine has similar negative effects. In 2007-2011, we conducted a randomised placebo-controlled trial of vitamin A at routine vaccination contacts among children aged 6-23 months in urban and rural Guinea-Bissau. In the present study, we included 2331 children randomised to placebo who received live vaccines only (MV or MV+YF) or a combination of live and inactivated vaccines (MV+DTP or MV+YF+pentavalent). Mortality was compared in Cox proportional hazards models stratified for urban/rural enrolment adjusted for age and unevenly distributed baseline factors. While DTP was still used 685 children received MV only and 358 MV+DTP; following the change in programme, 940 received MV+YF only and 348 MV+YF+pentavalent. During 6 months of follow-up, the adjusted mortality rate ratio (MRR) for co-administered live and inactivated vaccines compared with live vaccines only was 3.24 (1.20-8.73). For MV+YF+pentavalent compared with MV+YF only, the adjusted MRR was 7.73 (1.79-33.4). In line with previous studies of DTP, the present results indicate that pentavalent vaccine co-administered with MV and YF is associated with increased mortality. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Progress Toward Measles Elimination - Nepal, 2007-2014.

    PubMed

    Khanal, Sudhir; Sedai, Tika Ram; Choudary, Ganga Ram; Giri, Jagat Narain; Bohara, Rajendra; Pant, Rajendra; Gautam, Mukunda; Sharapov, Umid M; Goodson, James L; Alexander, James; Dabbagh, Alya; Strebel, Peter; Perry, Robert T; Bah, Sunil; Abeysinghe, Nihal; Thapa, Arun

    2016-03-04

    In 2013, the 66th session of the Regional Committee of the World Health Organization (WHO) South-East Asia Region (SEAR) established a goal to eliminate measles and to control rubella and congenital rubella syndrome (CRS) in SEAR by 2020. Current recommended measles elimination strategies in the region include 1) achieving and maintaining ≥95% coverage with 2 doses of measles-containing vaccine (MCV) in every district, delivered through the routine immunization program or through supplementary immunization activities (SIAs); 2) developing and sustaining a sensitive and timely measles case-based surveillance system that meets minimum recommended performance indicators; 3) developing and maintaining an accredited measles laboratory network; and 4) achieving timely identification, investigation, and response to measles outbreaks. In 2013, Nepal, one of the 11 SEAR member states, adopted a goal for national measles elimination by 2019. This report updates a previous report and summarizes progress toward measles elimination in Nepal during 2007-2014. During 2007-2014, estimated coverage with the first MCV dose (MCV1) increased from 81% to 88%. Approximately 3.9 and 9.7 million children were vaccinated in SIAs conducted in 2008 and 2014, respectively. Reported suspected measles incidence declined by 13% during 2007-2014, from 54 to 47 cases per 1 million population. However, in 2014, 81% of districts did not meet the measles case-based surveillance performance indicator target of ≥2 discarded non-measles cases per 100,000 population per year. To achieve and maintain measles elimination, additional measures are needed to strengthen routine immunization services to increase coverage with MCV1 and a recently introduced second dose of MCV (MCV2) to ≥95% in all districts, and to enhance sensitivity of measles case-based surveillance by adopting a more sensitive case definition, expanding case-based surveillance sites nationwide, and ensuring timely transport of

  15. Recombinant measles virus vaccine expressing the Nipah virus glycoprotein protects against lethal Nipah virus challenge.

    PubMed

    Yoneda, Misako; Georges-Courbot, Marie-Claude; Ikeda, Fusako; Ishii, Miho; Nagata, Noriyo; Jacquot, Frederic; Raoul, Hervé; Sato, Hiroki; Kai, Chieko

    2013-01-01

    Nipah virus (NiV) is a member of the genus Henipavirus, which emerged in Malaysia in 1998. In pigs, infection resulted in a predominantly non-lethal respiratory disease; however, infection in humans resulted in over 100 deaths. Nipah virus has continued to re-emerge in Bangladesh and India, and person-to-person transmission appeared in the outbreak. Although a number of NiV vaccine studies have been reported, there are currently no vaccines or treatments licensed for human use. In this study, we have developed a recombinant measles virus (rMV) vaccine expressing NiV envelope glycoproteins (rMV-HL-G and rMV-Ed-G). Vaccinated hamsters were completely protected against NiV challenge, while the mortality of unvaccinated control hamsters was 90%. We trialed our vaccine in a non-human primate model, African green monkeys. Upon intraperitoneal infection with NiV, monkeys showed several clinical signs of disease including severe depression, reduced ability to move and decreased food ingestion and died at 7 days post infection (dpi). Intranasal and oral inoculation induced similar clinical illness in monkeys, evident around 9 dpi, and resulted in a moribund stage around 14 dpi. Two monkeys immunized subcutaneously with rMV-Ed-G showed no clinical illness prior to euthanasia after challenge with NiV. Viral RNA was not detected in any organ samples collected from vaccinated monkeys, and no pathological changes were found upon histopathological examination. From our findings, we propose that rMV-NiV-G is an appropriate NiV vaccine candidate for use in humans.

  16. An immune competent mouse model for the characterization of recombinant measles vaccines.

    PubMed

    Marty, René R; Knuchel, Marlyse C; Morin, Teldja Neige Azzouz; Naim, Hussein Y

    2015-01-01

    Today, immune compromised interferon-α-receptor deficient mice expressing hCD46 (IFNARCD46tg) are usually used for measles virus (MV) based vaccine characterization. However, for the development of MV-based recombinant vaccine candidates (rMV), an immune competent mouse model is desirable in order to induce and evaluate meaningful immune response. In this study, humoral and cellular immune response induced by rMV in immune competent mice expressing human MV receptor CD46 (hCD46tg) were compared with those induced in wild-type black/6, and IFNARCD46tg mice.   All three strains developed humoral and cellular response against MV, whereas only hCD46tg and IFNARCD46tg mice developed a humoral response against the transgene. Differences were observed in the magnitude of the response, where the IFNARCD46tg mice displayed the strongest immune responses, followed by the hCD46tg mice and the black/6 mice. Interestingly, hCD46tg and wt black/6 mice showed a predominant CD4(+) T-cell response against MV-N, whereas IFNARCD46tg mice developed both, CD4(+) and CD8(+) T-cell response against MV-N. Analysis of the cytokine profile of MV-N specific CD4(+) T-cells and transgene (SIVgag) specific CD8(+) T-cells revealed qualitative differences of the T-cell responses; noticeably a significant reduction of the frequency of CD4(+)IL-2(+) expressing cells in IFNARCD46tg mice as compared with hCD46tg or wt black/6 mice. We show in this study significant quantitative and qualitative differences in immune responses between immune competent and immune-compromised mice. Our results therefore highlight the importance of the animal model and support the use of hCD46tg mice as mouse model for the characterization of the immunological profile induced by recombinant measles virus vaccine candidates.

  17. Time is of the essence: exploring a measles outbreak response vaccination in Niamey, Niger.

    PubMed

    Grais, R F; Conlan, A J K; Ferrari, M J; Djibo, A; Le Menach, A; Bjørnstad, O N; Grenfell, B T

    2008-01-06

    The current World Health Organization recommendations for response during measles epidemics focus on case management rather than outbreak response vaccination (ORV) campaigns, which may occur too late to impact morbidity and mortality and have a high cost per case prevented. Here, we explore the potential impact of an ORV campaign conducted during the 2003-2004 measles epidemic in Niamey, Niger. We measured the impact of this intervention and also the potential impact of alternative strategies. Using a unique geographical, epidemiologic and demographic dataset collected during the epidemic, we developed an individual-based simulation model. We estimate that a median of 7.6% [4.9-8.9] of cases were potentially averted as a result of the outbreak response, which vaccinated approximately 57% (84563 of an estimated 148600) of children in the target age range (6-59 months), 23 weeks after the epidemic started. We found that intervening early (up to 60 days after the start of the epidemic) and expanding the age range to all children aged 6 months to 15 years may lead to a much larger (up to 90%) reduction in the number of cases in a West African urban setting like Niamey. Our results suggest that intervening earlier even with lower target coverage (approx. 60%), but a wider age range, may be more effective than intervening later with high coverage (more than 90%) in similar settings. This has important implications for the implementation of reactive vaccination interventions as they can be highly effective if the response is fast with respect to the spread of the epidemic.

  18. Introduction of standard measles vaccination in an urban African community in 1979 and overall child survival: a reanalysis of data from a cohort study

    PubMed Central

    Mogensen, Søren Wengel; Aaby, Peter; Smedman, Lars; Martins, Cesário L; Rodrigues, Amabelia; Benn, Christine S; Ravn, Henrik

    2016-01-01

    Objective To examine the effect of the first introduction of measles vaccine (MV) in Guinea-Bissau in 1979. Setting Urban community study of the anthropometric status of all children under 6 years of age. Participants The study cohort included 1451 children in December 1978; 82% took part in the anthropometric survey. The cohort was followed for 2 years. Intervention In December 1979, the children were re-examined anthropometrically. The participating children, aged 6 months to 6 years, were offered MV if they did not have a history of measles infection. There were no routine vaccinations in 1979–1980. Primary and secondary outcome measures Age-adjusted mortality rate ratios (MRRs) for measles vaccinated and not vaccinated children; changes in nutritional status. Results The nutritional status deteriorated significantly from 1978 to 1979. Nonetheless, children who received MV at the December 1979 examination had significantly lower mortality in the following year (1980) compared with the children who had been present in the December 1978 examination but were not measles vaccinated. Among children still living in the community in December 1979, measles-vaccinated children aged 6–71 months had a mortality rate of 18/1000 person-years during the following year compared with 51/1000 person-years for absent children who were not measles vaccinated (MRR=0.30 (0.12–0.73)). The effect of MV was not explained by prevention of measles infection as the unvaccinated children did not die of measles infection. Conclusions MV may have beneficial non-specific effects on child survival not related to the prevention of measles infection. PMID:27998896

  19. Evaluation of an expanded case definition for vaccine-modified measles in a school outbreak in South Korea in 2010.

    PubMed

    Choe, Young June; Hu, Jae Kyung; Song, Kyung Min; Cho, Heeyeon; Yoon, Hee Sook; Kim, Seung Tae; Lee, Han Jung; Kim, Kisoon; Bae, Geun-Ryang; Lee, Jong-Koo

    2012-01-01

    In this study, we have described the clinical characteristics of vaccine-modified measles to assess the performance of an expanded case definition in a school outbreak that occurred in 2010. The sensitivity, specificity, and the positive and negative predictive values were evaluated. Among 74 cases of vaccine-modified measles, 47 (64%) met the original case definition. Fever and rash were observed in 73% (54/74); fever was the most common (96%, 71/74) presenting symptom, and rash was noted in 77% (57/74) of the cases. The original case definition showed an overall sensitivity of 63.5% and a specificity of 100.0%. The expanded case definition combining fever and rash showed a higher sensitivity (72.9%) but a lower specificity (88.2%) than the original. The presence of fever and one or more of cough, coryza, or conjunctivitis scored the highest sensitivity among the combinations of signs and symptoms (77.0%), but scored the lowest specificity (52.9%). The expanded case definition was sensitive in identifying suspected cases of vaccine-modified measles. We suggest using this expanded definition for outbreak investigation in a closed community, and consider further discussions on expanding the case definition of measles for routine surveillance in South Korea.

  20. Utilization and impact of European immunization week to increase measles, mumps, rubella vaccine uptake in Austria in 2016.

    PubMed

    Kreidl, P; de Kat, Catharina

    2017-09-05

    This paper describes engagement in European Immunization Week (EIW) in Tyrol, Austria in April 2016 and an assessment of its possible impact on demand for measles, mumps, rubella vaccination (MMR). It further describes the output of a knowledge, attitudes and practice (KAP) survey conducted during EIW, showing that 93% (188/202) of respondents were in favor of vaccination in general and 90% (192/214) perceived MMR vaccination to be important. MMR vaccination was perceived as important by more participants than other vaccinations. The number of MMR doses administered by public health services in the province of Tyrol during EIW was greater than in the previous week, and EIW activities thus potentially resulted in increased MMR vaccine uptake in Tyrol during the observed period. The annual EIW campaign provides important opportunities to address vaccine hesitancy by raising awareness about immunization, to identify barriers to immunization and test possible solutions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Using cost-effectiveness analysis to support research and development portfolio prioritization for product innovations in measles vaccination.

    PubMed

    Garrison, Louis P; Bauch, Chris T; Bresnahan, Brian W; Hazlet, Tom K; Kadiyala, Srikanth; Veenstra, David L

    2011-07-01

    Several potential measles vaccine innovations are in development to address the shortcomings of the current vaccine. Funders need to prioritize their scarce research and development resources. This article demonstrates the usefulness of cost-effectiveness analysis to support these decisions. This study had 4 major components: (1) identifying potential innovations, (2) developing transmission models to assess mortality and morbidity impacts, (3) estimating the unit cost impacts, and (4) assessing aggregate cost-effectiveness in United Nations Children's Fund countries through 2049. Four promising technologies were evaluated: aerosol delivery, needle-free injection, inhalable dry powder, and early administration DNA vaccine. They are projected to have a small absolute impact in terms of reducing the number of measles cases in most scenarios because of already improving vaccine coverage. Three are projected to reduce unit cost per dose by $0.024 to $0.170 and would improve overall cost-effectiveness. Each will require additional investments to reach the market. Over the next 40 years, the aggregate cost savings could be substantial, ranging from $98.4 million to $689.4 million. Cost-effectiveness analysis can help to inform research and development portfolio prioritization decisions. Three new measles vaccination technologies under development hold promise to be cost-saving from a global perspective over the long-term, even after considering additional investment costs. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.

  2. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.

    PubMed

    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A

    2013-06-01

    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.

  3. Phylogenetic and epidemiological analysis of measles outbreaks in Denmark, 2013 to 2014.

    PubMed

    Rasmussen, Lasse Dam; Fonager, Jannik; Knudsen, Lisbet Krause; Andersen, Peter Henrik Senten; Rønn, Jesper; Poulsen, Mille Weismann; Franck, Kristina Træholt; Fischer, Thea Kølsen

    2015-01-01

    Despite the introduction of safe, effective vaccines decades ago and joint global public health efforts to eliminate measles, this vaccine-preventable disease continues to pose threats to children's health worldwide. During 2013 and 2014, measles virus was introduced into Denmark through several independent importations. This resulted in a number of secondary cases (n=7), with two clusters in 2013 and one in 2014. In total, there were 44 cases of measles. Most cases (n=41) were laboratory confirmed by detection of measles virus genome by real-time reverse transcription (RT)-PCR and IgM antibodies. The viruses from confirmed cases were genotyped by sequencing. Only one genotype circulated each year, i.e. D8 and B3, respectively. Sequencing of measles virus from different clinical specimens from the same patients revealed that sequence variants of measles viruses might co-exist and co-transmit during an outbreak. The majority of the cases were unvaccinated (n=27) or recipients of one dose of measles-mumps-rubella (MMR) vaccine (n=7). In addition, two fully vaccinated adult cases were reported in 2014. We demonstrate the transmission of measles virus in a population in which the two-dose MMR vaccination coverage rate was 80% and how even vaccinated individuals may be at risk of contracting measles once transmission has been established.

  4. Absence of detectable measles virus genome sequence in blood of autistic children who have had their MMR vaccination during the routine childhood immunization schedule of UK.

    PubMed

    Afzal, M A; Ozoemena, L C; O'Hare, A; Kidger, K A; Bentley, M L; Minor, P D

    2006-05-01

    Leukocyte preparations from children with documented evidence of MMR vaccination and confirmed diagnosis of autism were examined by several assays designed to target multiple regions of the measles virus genome sequence. No sample was found positive by any method. The assays applied were highly sensitive, specific and robust in nature, and were based on the amplification of measles virus RNA transcripts by real-time quantitative RT-PCR (QRT-PCR) as well as by conventional RT-PCR-nested PCR. The assays applied were potentially able to detect measles virus RNA down to single figure copy numbers per reaction. The amount of total nucleic acid extract of leukocytes subjected to various measles virus-specific investigations was several fold higher than minimally required of a sample where measles virus persistence is well documented. This study failed to substantiate reports of the persistence of measles virus in autistic children with development regression.

  5. Measles-mumps-rubella vaccine and autistic spectrum disorder: report from the New Challenges in Childhood Immunizations Conference convened in Oak Brook, Illinois, June 12-13, 2000.

    PubMed

    Halsey, N A; Hyman, S L

    2001-05-01

    . Most data indicate increased recognition and reporting as primary factors, but the epidemiologic data are insufficient to determine if there has been a true increase in the incidence of ASD. Increased reporting of ASD in recent years has occurred long after the introduction of MMR vaccine in the United States in 1971 and widespread use of this vaccine in the 1970s for routine immunization of children at 12 to 15 months of age. Appropriate detailed studies are needed to define the true incidence and prevalence of ASD. Epidemiologic studies in Europe indicate no association between MMR vaccine and ASD. Some children with ASD have gastrointestinal symptoms, but an increased rate of any specific gastrointestinal disorder in children with ASD has not been established. Studies to detect evidence of measles virus in intestinal tissue specimens from patients with IBD or autism with gastrointestinal symptoms have not used uniform techniques. Several laboratories have found no evidence of measles viruses in tissue specimens from patients with IBD, but 2 groups have found evidence of measles virus using different techniques. A group that found evidence of measles virus in affected tissue specimens from patients with IBD has also reported detecting portions of measles virus in peripheral blood lymphocytes and intestinal tissue specimens from patients with autism and gastrointestinal disorders. Finding a portion of a virus using molecular techniques does not constitute evidence for a causal relationship, because some viruses persist in unaffected hosts. Additional controlled studies in several laboratories are needed to determine if portions of measles virus persist in intestinal and other tissues of people with and without gastrointestinal disease and/or ASD. Although the possible association with MMR vaccine has received much public and political attention and there are many who have derived their own conclusions based on personal experiences, the available evidence does not

  6. Use of combination measles, mumps, rubella, and varicella vaccine: recommendations of the Advisory Committee on Immunization Practices (ACIP).

    PubMed

    Marin, Mona; Broder, Karen R; Temte, Jonathan L; Snider, Dixie E; Seward, Jane F

    2010-05-07

    This report presents new recommendations adopted in June 2009 by CDC's Advisory Committee on Immunization Practices (ACIP) regarding use of the combination measles, mumps, rubella, and varicella vaccine (MMRV, ProQuad, Merck & Co., Inc.). MMRV vaccine was licensed in the United States in September 2005 and may be used instead of measles, mumps, rubella vaccine (MMR, M-M-RII, Merck & Co., Inc.) and varicella vaccine (VARIVAX, Merck & Co., Inc.) to implement the recommended 2-dose vaccine schedule for prevention of measles, mumps, rubella, and varicella among children aged 12 months-12 years. At the time of its licensure, use of MMRV vaccine was preferred for both the first and second doses over separate injections of equivalent component vaccines (MMR vaccine and varicella vaccine), which was consistent with ACIP's 2006 general recommendations on use of combination vaccines (CDC. General recommendations on immunization: recommendations of the Advisory Committee on Immunization Practices [ACIP]. MMWR 2006;55;[No. RR-15]). Since July 2007, supplies of MMRV vaccine have been temporarily unavailable as a result of manufacturing constraints unrelated to efficacy or safety. MMRV vaccine is expected to be available again in the United States in May 2010. In February 2008, on the basis of preliminary data from two studies conducted postlicensure that suggested an increased risk for febrile seizures 5-12 days after vaccination among children aged 12-23 months who had received the first dose of MMRV vaccine compared with children the same age who had received the first dose of MMR vaccine and varicella vaccine administered as separate injections at the same visit, ACIP issued updated recommendations regarding MMRV vaccine use (CDC. Update: recommendations from the Advisory Committee on Immunization Practices [ACIP] regarding administration of combination MMRV vaccine. MMWR 2008;57:258-60). These updated recommendations expressed no preference for use of MMRV vaccine over

  7. [Measles surveillance in Germany. From sentinel to mandatory surveillance].

    PubMed

    Siedler, A; Grüber, A; Mankertz, A

    2013-09-01

    From September 1999 to March 2011, sentinel surveillance of measles was conducted by a self-selected sample of private physicians in Germany. From 2001, when mandatory surveillance for measles was established, two surveillance systems worked in parallel. The aim of this article is to summarize the strengths and limitations of sentinel versus mandatory surveillance. Active monthly reporting included case-based questionnaires on patients with (suspected) measles or zeroreporting. For confirmation of measles, the diagnostic patient specimens were sent to regional laboratories for serological tests or to the National Reference Laboratory (NRC). In the NRC in addition to serological tests measles-virus (MV) detection by PCR in urine, throat swabs, and oral fluid (since 2003) as well as MVgenotyping was offered. From January 2000 to December 2010, 934 out of 1,488 participating sentinel-practices did not see any measles case, while 554 reported 3,573 suspected cases. Measles was confirmed by laboratory testing in 801 cases, excluded in 473 cases, and the diagnosis remained uncertain in 215 cases. Of 3,100 analyzed cases, 2,712 (87 %) were unvaccinated, 217 (7 %) and 32 (1 %) were vaccinated with one or two doses, respectively, and for 139 (4 %) cases the vaccination status was unknown. The main reason for not being vaccinated against measles was refusal (n = 1,383). The confirmation rate was lower in the vaccinated than in the unvaccinated patients (19 % vs. 63 %). Since 2006, sentinel-cases have differed from notified cases by region and age. The proportion of sentinel cases from all NRC-investigated cases decreased from more than  50 % (2002) to less than  5 % (since 2007). Sentinel surveillance allowed for the detection of trends, delivered additional information for measles prevention, and played a major role in measles diagnostics. Since mandatory surveillance was established and sentinel surveillance no longer reflected the epidemiologic

  8. Eradication of measles: remaining challenges.

    PubMed

    Holzmann, Heidemarie; Hengel, Hartmut; Tenbusch, Matthias; Doerr, H W

    2016-06-01

    Measles virus (MeV) is an aerosol-borne and one of the most contagious pathogenic viruses known. Almost every MeV infection becomes clinically manifest and can lead to serious and even fatal complications, especially under conditions of malnutrition in developing countries, where still 115,000 to 160,000 patients die from measles every year. There is no specific antiviral treatment. In addition, MeV infections cause long-lasting memory B and T cell impairment, predisposing people susceptible to opportunistic infections for years. A rare, but fatal long-term consequence of measles is subacute sclerosing panencephalitis. Fifteen years ago (2001), WHO has launched a programme to eliminate measles by a worldwide vaccination strategy. This is promising, because MeV is a human-specific morbillivirus (i.e. without relevant animal reservoir), safe and potent vaccine viruses are sufficiently produced since decades for common application, and millions of vaccine doses have been used globally without any indications of safety and efficacy issues. Though the prevalence of wild-type MeV infection has decreased by >90 % in Europe, measles is still not eliminated and has even re-emerged with recurrent outbreaks in developed countries, in which effective vaccination programmes had been installed for decades. Here, we discuss the crucial factors for a worldwide elimination of MeV: (1) efficacy of current vaccines, (2) the extremely high contagiosity of MeV demanding a >95 % vaccination rate based on two doses to avoid primary vaccine failure as well as the installation of catch-up vaccination programmes to fill immunity gaps and to achieve herd immunity, (3) the implications of sporadic cases of secondary vaccine failure, (4) organisation, acceptance and drawbacks of modern vaccination campaigns, (5) waning public attention to measles, but increasing concerns from vaccine-associated adverse reactions in societies with high socio-economic standards and (6) clinical

  9. A recombinant measles vaccine expressing chikungunya virus-like particles is strongly immunogenic and protects mice from lethal challenge with chikungunya virus.

    PubMed

    Brandler, Samantha; Ruffié, Claude; Combredet, Chantal; Brault, Jean-Baptiste; Najburg, Valérie; Prevost, Marie-Christine; Habel, André; Tauber, Erich; Desprès, Philippe; Tangy, Frédéric

    2013-08-12

    Chikungunya virus (CHIKV), a mosquito-transmitted alphavirus, recently reemerged in the Indian Ocean, India and Southeast Asia, causing millions of cases of severe polyarthralgia. No specific treatment to prevent disease or vaccine to limit epidemics is currently available. Here we describe a recombinant live-attenuated measles vaccine (MV) expressing CHIKV virus-like particles comprising capsid and envelope structural proteins from the recent CHIKV strain La Reunion. Immunization of mice susceptible to measles virus induced high titers of CHIKV antibodies that neutralized several primary isolates. Specific cellular immune responses were also elicited. A single immunization with this vaccine candidate protected all mice from a lethal CHIKV challenge, and passive transfer of immune sera conferred protection to naïve mice. Measles vaccine is one of the safest and most effective human vaccines. A recombinant MV-CHIKV virus could make a safe and effective vaccine against chikungunya that deserves to be further tested in human trials.

  10. An evaluation of respiratory administration of measles vaccine for prevention of acute lower respiratory infections in children

    PubMed Central

    2011-01-01

    Background Measles was responsible for an estimated 100,000 deaths worldwide in 2008. Despite being a vaccine-preventable disease, measles remains a major cause of morbidity and mortality in young children. Although a safe and effective injectable measles vaccine has been available for over 50 years it has not been possible to achieve the uniformly high levels of coverage (required to achieve measles eradication) in most parts of the developing world. Aerosolised measles vaccines are now under development with the hope of challenging the delivery factors currently limiting the coverage of the existing vaccine. Methods We used a modified CHNRI methodology for setting priorities in health research investments to assess the strengths and weaknesses of this emerging intervention to decrease the burden of childhood pneumonia. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging aerosol vaccines against measles relevant to several criteria of interest. Although there are a number of different aerosol vaccine approaches under development, for the purpose of this exercise, all were considered as one intervention. The criteria of interest were: answerability; cost of development, production and implementation; efficacy and effectiveness; deliverability, affordability and sustainability; maximum potential impact on disease burden reduction; acceptability to the end users and health workers; and effect on equity. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies). The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to the sensitive nature of their involvement in such exercises. They answered questions from the CHNRI framework and their “collective optimism” towards each criterion was documented on a

  11. Socio-demographic determinants of timely adherence to BCG, Penta3, measles, and complete vaccination schedule in Burkina Faso.

    PubMed

    Schoeps, A; Ouédraogo, N; Kagoné, M; Sié, A; Müller, O; Becher, H

    2013-12-17

    To identify the determinants of timely vaccination among young children in the North-West of Burkina Faso. This study included 1665 children between 12 and 23 months of age from the Nouna Health and Demographic Surveillance System, born between September 2006 and December 2008. The effect of socio-demographic variables on timely adherence to the complete vaccination schedule was studied in multivariable ordinal logistic regression with 3 distinct endpoints: (i) complete timely adherence, (ii) failure, and (iii) missing vaccination. Three secondary endpoints were timely vaccination with BCG, Penta3, and measles, which were studied with standard multivariable logistic regression. Mothers' education, socio-economic status, season of birth, and area of residence were significantly associated with failure of timely adherence to the complete vaccination schedule. Year of birth, ethnicity, and the number of siblings was significantly related to timely vaccination with Penta3 but not with BCG or measles vaccination. Children living in rural areas were more likely to fail timely vaccination with BCG than urban children (OR=1.79, 95%CI=1.24-2.58 (proximity to health facility), OR=3.02, 95%CI=2.18-4.19 (long distance to health facility)). In contrast, when looking at Penta3 and measles vaccination, children living in rural areas were far less likely to have failed timely vaccinations than urban children. Mother's education positively influenced timely adherence to the vaccination schedule (OR=1.42, 95%CI 1.06-1.89). There was no effect of household size or the age of the mother. Additional health facilities and encouragement of women to give birth in these facilities could improve timely vaccination with BCG. Rural children had an advantage over the urban children in timely vaccination, which is probably attributable to outreach vaccination teams amongst other factors. As urban children rely on their mothers' own initiative to get vaccinated, urban mothers should be

  12. Universal measles-mumps-rubella vaccination to new recruits and the incidence of mumps in the military.

    PubMed

    Moon, Jong Youn; Jung, Jaehun; Huh, Kyungmin

    2017-07-13

    In response to the resurgence of mumps, the Korean Armed Forces started the measles-mumps-rubella (MMR) vaccination to all new recruits regardless of prior vaccination history. We evaluated the effectiveness of the vaccination by comparing the incidence between the military and civilian populations before and after implementation of the new policy. The standardized incidence ratio of mumps in the military was 7.06 in the prevaccine period, which declined to 0.96 in the postvaccine period. Vaccine effectiveness was estimated at 86.4%. Incidence rate ratio was lower in the 1996-1998 birth cohort (BC) compared with 1989-1995 BC (0.10 vs. 0.55), suggesting higher effectiveness of vaccination in the 1996-1998 BC. Our data provide evidence for the use of the MMR vaccination in the prevention of mumps in high-risk adults. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Efficacy of intralesional injection of mumps-measles-rubella vaccine in patients with wart

    PubMed Central

    Zamanian, Abbas; Mobasher, Pezhman; Jazi, Ghazaleh Ahmadi

    2014-01-01

    Background: In the previous studies, it has been shown that mumps-measles-rubella (MMR) vaccine resulted in regression of warts via immunomodulatory effect and induction of immune system. Due to the high prevalence of warts in various populations, we evaluated the efficacy of MMR vaccine injection in the treatment of cutaneous warts. Materials and Methods: This double-blind randomized controlled clinical trial was conducted in Hazrat-e-Rasoul Hospital in Tehran in 2011-2012 on 24 patients with warts who were allocated to two groups including MMR group and normal saline group. MMR vaccine was injected intralesionally in the MMR group, whereas normal saline was injected into the lesions in the second group. These injections were repeated every 2 weeks intervals for maximum 3 injections. All patients were followed up every 15-day interval up to 45 days and then up to 6 months regarding relapses and finally, side effects, probable relapse, and therapeutic outcomes were evaluated and compared. Results: At the end of follow-up period, therapeutic outcomes in the MMR group included no cure in 2 cases, relative cure in 4 cases, and complete cure in 18 cases. In normal saline group, these rates included no cure in seven cases, relative cure in nine cases, and complete cure in six cases (P < 0.001). No significant complication occurred in the two groups. Conclusion: MMR vaccine may result in desirable therapeutic response. The hypothesis that is considered here is that MMR vaccine, via induction of cellular and humoral immune system, accelerates the destruction of virus and infected host cells. PMID:24804181

  14. Measles virus-specific antibody levels in individuals in Argentina who received a one-dose vaccine.

    PubMed

    Argüelles, Marcelo H; Orellana, Mariana L; Castello, Alejandro A; Villegas, Guillermo A; Masini, Matilde; Belizan, Alejandra L; González Ayala, Silvia; Vera, Osmar D; Glikmann, Graciela

    2006-08-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease.

  15. Measles Virus-Specific Antibody Levels in Individuals in Argentina Who Received a One-Dose Vaccine

    PubMed Central

    Argüelles, Marcelo H.; Orellana, Mariana L.; Castello, Alejandro A.; Villegas, Guillermo A.; Masini, Matilde; Belizan, Alejandra L.; González Ayala, Silvia; Vera, Osmar D.; Glikmann, Graciela

    2006-01-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease. PMID:16891485

  16. A postmarket safety comparison of 2 vaccination strategies for measles, mumps, rubella and varicella in Italy

    PubMed Central

    Cocchio, Silvia; Zanoni, Giovanna; Opri, Roberta; Russo, Francesca; Baldo, Vincenzo

    2016-01-01

    ABSTRACT It is strategically important to monitor the safety profile of vaccination schedules in order to achieve and maintain high levels of coverage. We analyzed the cohort of individuals actively invited for measles, mumps, rubella and varicella (MMRV) vaccination in the Veneto region (north-east Italy) from 8/1/2013 to 7/31/2014, assessing the onset of adverse events (AE) relating to 2 different vaccination strategies for MMRV (MMR+V vs MMRV). During the vaccination session at 14 months old, parents were given a form for recording local and systemic reactions to vaccinations for 4 weeks afterwards. Overall, 12,288 forms were returned, and 84.6% of them were included in this analysis (5,130 relating to MMR+V and 5,265 to MMRV); 37.3% of the sample reported no AEs, with no difference between the 2 groups. Local reactions were more common in the MMR+V group (9.6% vs 2.9%; RR 3.33; 95% CI 2.79–3.98), while there was no difference in general reactions between the 2 groups (50% MMR+V vs 52% MMRV). The events most often reported were “fever <39.5°C,” which was more frequently associated with the MMRV strategy (p<0.001), and “skin blotches and marks,” which occurred more often in the MMR+V group (p<0.001). Reports of “fever ≥39.5°C” were equally distributed between the 2 groups. Sixteen cases of febrile seizures were reported (0.14% in the MMR+V group and 0.17% in the MMRV group). Similar safety profiles were identified for the 2 vaccination strategies. Although the method used to record reactions to vaccination demanded considerable resources, it enabled important information to be collected on parents' perception of the AEs occurring in response to their child's vaccination. PMID:26528829

  17. Obstacles in measles elimination: an in-depth description of a measles outbreak in Ghent, Belgium, spring 2011

    PubMed Central

    2013-01-01

    Background From Mid-February to April 2011 one of the largest measles-outbreak in Flanders, since the start of the 2-dose vaccination scheme in 1995, took place in Ghent, Belgium. The outbreak started in a day care center, infecting children too young to be vaccinated, after which it spread to anthroposophic schools with a low measles, mumps and rubella vaccination coverage. This report describes the outbreak and evaluates the control measures and interventions. Methods Data collection was done through the system of mandatory notification of the public health authority. Vaccination coverage in the schools was assessed by a questionnaire and the electronic immunization database ‘Vaccinnet’. A case was defined as anyone with laboratory confirmed measles or with clinical symptoms and an epidemiological link to a laboratory confirmed case. Towards the end of the outbreak we only sought laboratory confirmation for persons with an atypical clinical presentation or without an epidemiological link. In search for an index patient we determined the measles IgG level of infants from the day care center. Results A total of 65 cases were reported of which 31 were laboratory confirmed. Twenty-five were confirmed by PCR and/or IgM. In 6 infants, too young to be vaccinated, only elevated measles IgG levels were found. Most cases (72%) were young children (0–9 years old). All but two cases were completely unimmunized. In the day care center all the infants who were too young to be vaccinated (N=14) were included as cases. Thirteen of them were laboratory confirmed. Eight of these infants were hospitalized with symptoms suspicious for measles. Vaccination coverage in the affected anthroposophic schools was low, 45-49% of the pupils were unvaccinated. We organized vaccination campaigns in the schools and vaccinated 79 persons (25% of those unvaccinated or incompletely vaccinated). Conclusions Clustering of unvaccinated persons, in a day care center and in anthroposophic schools

  18. Successful immunization of infants with and without maternal antibody by aerosolized measles vaccine. II. Vaccine comparisons and evidence for multiple antibody response.

    PubMed

    Sabin, A B; Flores Arechiga, A; Fernández de Castro, J; Albrecht, P; Sever, J L; Shekarchi, I

    1984-05-11

    In 4- and 5-month-old infants in whom the undiluted chick embryo fibroblast (CEF) Schwarz strain measles vaccine had a poor immunogenic effect, there was an increase in immunogenicity when the high sugar concentration was diminished without reference to added albumin. The human diploid cell (HDC) measles vaccine was still superior in this age group even in a lower concentration of the Ikić, Edmonston-Zagreb strain of virus. More aerosolized, HDC Ikić strain virus was required for high seroconversion rates in 4- and 5-month-old infants who had higher titers of prevaccination plaque-neutralizing (PN) antibodies. Some of these infants had a delayed immune response that was absent at six weeks but present at three months after vaccination. The data provided evidence that the PN and enzyme-linked immunosorbent assay techniques measured different antibodies that develop and persist in different ways in 4- to 5-month-old infants. The HDC lyophilized measles vaccine yielded unexpectedly high seroconversion rates after subcutaneous injection of 5,000 plaque-forming units (PFUs) in 4-, 5-, and 6-month-old infants: 69%, 89%, and 100% respectively, at 14 weeks. In 12- to 23-month-old infants there was seroconversion of 92% and 100% at six weeks after inhalation of an estimated 175 PFUs of the CEF vaccine and 375 PFUs of the HDC vaccine, respectively. Within six weeks after vaccination, the PN antibody titers were significantly higher with the CEF vaccine (geometric mean titer of 2,275) than with the HDC vaccine (geometric mean titer of 343).

  19. Measles vaccine coverage and immune response in children of Caiabi and Metuktire Indian tribes living in malarial endemic area: Parque indígena do Xingu, Central Brazil.

    PubMed

    Spindel, R; Baruzzi, R G; Souza, V A; Ferreira, A W; Avila, S L

    2001-07-01

    Measles vaccination efficiency was evaluated in children from two Indian tribes - Caiabi and Metuktire - living in the Amazon region, in the Parque Indigena do Xingu (PIX). The population sample, selected at random, made up 37 Caiabi and 28 Metuktire children, aged from 20-75 months (40%). For operational and epidemiological reasons, measles vaccine is given from 6 months of age. The average age of children when they received the vaccine was 11.5 months for the first dose and 20 months for the second. The search for IgG antibodies against measles virus and Plasmodium falciparum was made through immunofluorescence assay (IFA). Measles vaccine coverage has reached 60% at 12 months of age and 92% at 18 months, whereas post-vaccine serum conversion was 95% in Caiabi children (geometric mean of titres (GMT) 126) and 89% in Metuktire (GMT 109). The difference in GMT is not statistically significant. Seventy-three per cent of Caiabi children (GMT 101) and 100% of Metuktire children (GMT135) were plasmodium antibody positive, showing they had been exposed to malarial infection. Despite the differences detected, the immune response to measles vaccine was satisfactory in both groups, with a positive percentage consistent with that achieved in non-malarial areas in Americas. The results show the efficiency of a vaccination programme in an indigenous area despite the difficulties in reaching the villages and maintaining the cold chain, and also despite the malaria endemicity.

  20. [Antibody persistence following on different vaccination strategies of domestic measles, mumps and rubella combined attenuated live vaccine: a 3-year follow-up study].

    PubMed

    He, H Q; Li, Q; Yan, R; Zhou, Y; Tang, X W; Deng, X; Xie, S Y; Chen, Z P

    2017-04-06

    Objective: To assess the 3-year antibody persistence after vaccination of domestic measles, mumps and rubella combined attenuated live vaccine (MMR) with different program. Methods: Children from three different vaccination strategies (Group 8 m MR: 8 months and 18 months vaccinated with measles-rubella combined attenuated live vaccine and domestic MMR,respectively; Group 8 m MMR: 8 months and 18 months both vaccinated with domestic MMR; Group 12 m MMR: 12 months and 22 months both vaccinated with domestic MMR ) were followed up in Zhejiang province in July 2015. There were 170 participants in Group 8 m MR, 171 participants in Group 8 m MMR and 173 participants in Group 12 m MMR selected by simple random sampling method .Blood samples (venous blood 2-3 ml) were collected 1 month after the first dose vaccination of MMR (only in Group 8 m MMR and Group 12 m MMR) and 3 years (36-38 months) after the last dose vaccination of MMR and tested for antibody IgG against Measles, Mumps and Rubella using ELISA. Seropostive rate and Geometric mean concentration (GMC) were calculated and compared among different groups by Chi-square test or Fisher exact test and Kruskal-Wallis H test. Results: A total of 514 participants (8 m MR: 170; 8 m MMR:171; 12 m MMR:173) were enrolled. The overall seropositivity rate of measles, mumps and rubella was 98.1% (504), 93.4% (480) and 88.1% (453), respectively, with corresponding GMC was 1 012.33 mU/ml, 502.87 U/ml and 50.53 U/ml respectively. There was no significant difference of seropositivity rate for measles among three groups (all groups were>97%). The highest seropositivity rate for mumps was found in the Group 12 m MMR with the rate of 98.8% (171/173), followed by Group 8 m MMR and Group 8 m MR with 93.0% (159/171) and 88.2%(150/170) respectively (Fisher exact test, P<0.001). The highest seropositivity rate for rubella was also found in the Group 12 m MMR with the rate of 94.8% (164/173), followed by Group 8 m MMR and Group 8 m MR with

  1. Intralesional immunotherapy of common warts: successful treatment with mumps, measles and rubella vaccine.

    PubMed

    Nofal, A; Nofal, E

    2010-10-01

    Despite numerous therapeutic modalities reported in the literature, treatment of common warts remains a continuing challenge and there is no universal consensus about optimal treatment. Recently, intralesional immunotherapy by different antigens has proved efficacy in the treatment of different types of warts. To evaluate the efficacy and safety of intralesional mumps, measles and rubella (MMR) vaccine in the treatment of common warts. The study included 135 patients with single or multiple recalcitrant or non-recalcitrant common warts. They were randomly assigned to two groups; the first group (85 patients) received intralesional MMR vaccine, and the second group (50 patients) received intralesional saline as a control group. Both treatments were injected into single lesions or largest wart in case of multiple lesions at 2-week intervals until complete clearance or for a maximum of five treatments. Follow-up was made every 2 months for 6 months to detect any recurrence. A highly significant difference was found between the therapeutic response of common warts to MMR vaccine and saline control group (P < 0.001). In the MMR group, complete response was achieved in 80% and 84.6% of patients presenting with recalcitrant and multiple warts respectively. No recurrence was observed in the MMR group and side effects included pain during injection and flu-like symptoms. Intralesional immunotherapy by MMR vaccine is a promising effective and safe treatment modality for common warts, particularly the multiple ones. © 2010 The Authors. Journal of the European Academy of Dermatology and Venereology © 2010 European Academy of Dermatology and Venereology.

  2. Evaluation of impact of measles rubella campaign on vaccination coverage and routine immunization services in Bangladesh.

    PubMed

    Uddin, Md Jasim; Adhikary, Gourab; Ali, Md Wazed; Ahmed, Shahabuddin; Shamsuzzaman, Md; Odell, Chris; Hashiguchi, Lauren; Lim, Stephen S; Alam, Nurul

    2016-08-12

    Like other countries in Asia, measles-rubella (MR) vaccine coverage in Bangladesh is suboptimal whereas 90-95 % coverage is needed for elimination of these diseases. The Ministry of Health and Family Welfare (MOHFW) of the Government of Bangladesh implemented MR campaign in January-February 2014 to increase MR vaccination coverage. Strategically, the MOHFW used both routine immunization centres and educational institutions for providing vaccine to the children aged 9 months to <15 years. The evaluation was carried out to assess the impact of the campaign on MR vaccination and routine immunization services. Both quantitative and qualitative evaluations were done before and after implementation of the campaign. Quantitative data were presented with mean (standard deviation, SD) for continuous variables and with proportion for categorical variables. The overall and age- and sex-specific coverage rates were calculated for each region and then combined. Categorical variables were compared by chi-square statistics. Multiple logistic regression analysis were performed to estimate odds ratios (OR) and 95 % confidence intervals (CI) of coverage associated with covariates, with adjustment for other covariates. Qualitative data were analyzed using content analysis. The evaluations found MR coverage was very low (<13 %) before the campaign and it rose to 90 % after the campaign. The pre-post campaign difference in MR coverage in each stratum was highly significant (p < 0.001). The campaign achieved high coverage despite relatively low level (23 %) of interpersonal communication with caregivers through registration process. Child registration was associated with higher MR coverage (OR 2.91, 95 % CI 1.91-4.44). Children who attended school were more likely to be vaccinated (OR 8.97, 95 % CI 6.17-13.04) compared to those who did not attend school. Children of caregivers with primary or secondary or higher education had higher coverage compared to children of

  3. Comparing the health and social protection effects of measles vaccination strategies in Ethiopia: An extended cost-effectiveness analysis.

    PubMed

    Driessen, Julia; Olson, Zachary D; Jamison, Dean T; Verguet, Stéphane

    2015-08-01

    Vaccination coverage rates often mask wide variation in access, uptake, and cost of providing vaccination. Financial incentives have been effective at creating demand for social services in a variety of settings. Using methods of extended cost-effectiveness analysis, we compare the health and economic implications of three different vaccine delivery strategies for measles vaccination in Ethiopia: i) routine immunization, ii) routine immunization with financial incentives, and iii) mass campaigns, known as supplemental immunization activities (SIAs). We examine annual birth cohorts of almost 3,000,000 births over a ten year period, exploring variation in these outcomes based on economic status to understand how various options may improve equity. SIAs naturally achieve higher levels of vaccine coverage, but at higher costs. Routine immunization combined with financial incentives bolsters demand among more economically vulnerable households. The relative appeal of routine immunization with financial incentives and SIAs will depend on the policy environment, including short-term financial limitations, time horizons, and the types of outcomes that are desired. While the impact of financial incentives has been more thoroughly studied in other policy arenas, such as education, consideration of this approach alongside standard vaccination models such as SIAs is timely given the dialog around measles eradication. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Deciphering the relative weights of demographic transition and vaccination in the decrease of measles incidence in Italy.

    PubMed

    Merler, Stefano; Ajelli, Marco

    2014-02-22

    In Italy, during the course of the past century to the present-day, measles incidence underwent a remarkable decreasing trend that started well before the introduction of the national immunization programme. In this work, we aim at examining to what extent both the demographic transition, characterized by declining mortality and fertility rates over time, and the vaccination programme are responsible for the observed epidemiological pattern. Making use of a non-stationary, age-structured disease transmission model, we show that in the pre-vaccination era, from 1901 to 1982, the decline in birth rates has resulted in a drastic decrease in the effective transmission rate, which in turn has determined a declining trend of measles incidence (from 25.2 to 10.3 infections per 1000 individuals). However, since 1983, vaccination appears to have become the major contributing factor in the decrease of measles incidence, which otherwise would have remained stable as a consequence of the nearly constant birth rates. This led to a remarkable decrease in the effective transmission rate, to a level well below the critical threshold for disease persistence. These findings call for the adoption of epidemiological models, which deviate the age structure from stationary equilibrium solutions, to better understand the biology of infectious diseases and evaluate immunization programmes.

  5. Non-specific effects of diphtheria-tetanus-pertussis and measles vaccinations? An analysis of surveillance data from Navrongo, Ghana.

    PubMed

    Welaga, Paul; Nielsen, Jens; Adjuik, Martin; Debpuur, Cornelius; Ross, David A; Ravn, Henrik; Benn, Christine S; Aaby, Peter

    2012-12-01

    Studies from low-income countries have suggested that routine vaccinations may have non-specific effects on child mortality; measles vaccine (MV) is associated with lower mortality and diphtheria-tetanus-pertussis (DTP) with relatively higher mortality. We used data from Navrongo, Ghana, to examine the impact of vaccinations on child mortality. Vaccination status was assessed at the initiation of a trial of vitamin A supplementation and after 12 and 24 months of follow-up. Within the placebo group, we compared the mortality over the first 4 months and the full 2 years of follow-up for different vaccination status groups with different likelihoods of additional vaccinations during follow-up. The frequency of additional vaccinations was assessed among children whose vaccination card was seen at 12 and 24 months of follow-up. Among children with a vaccination card, more than 75% received missing DTP or MV during the first 12 months of follow-up, whereas only 25% received these vaccines among children with no vaccination card at enrollment. Children without a card at enrollment had a significant threefold higher mortality over the 2-year follow-up period than those fully vaccinated. The small group of children with DTP3-4 but no MV at enrollment had lower mortality than children without a card and had the same mortality as fully vaccinated children. In contrast, children with 1-2 DTP doses but no MV had a higher mortality during the first 4 months than children without a card [MRR = 1.65 (0.95, 2.87)]; compared with the fully vaccinated children, they had significantly higher mortality after 4 months [MRR = 2.38 (1.07, 5.30)] and after 2 years [MRR = 2.41 (1.41, 4.15)]. Children with 0-2 DTP doses at enrollment had higher mortality after 4 months (MRR = 1.67 (0.82, 3.43) and after 2 years [MRR = 1.85 (1.16, 2.95)] than children who had all three doses of DTP at enrollment. As hypothesised, DTP vaccination was associated with higher child mortality than measles

  6. Risk of febrile seizure after measles-mumps-rubella-varicella vaccine: A systematic review and meta-analysis.

    PubMed

    Ma, Shu-Juan; Xiong, Yi-Quan; Jiang, Li-Na; Chen, Qing

    2015-07-17

    Considering the febrile seizure rate, there is no longer a clear preference for use of measles-mumps-rubella-varicella (MMRV) vaccine over separate measles-mumps-rubella (MMR) and varicella (V) vaccine. This work was undertaken to assess the risk of febrile seizure after MMRV vaccine in children. We searched PubMed, Embase, BIOSIS Previews, Scopus, Web of Science, Cochrane Library and other databases through 12 December 2014. Meta-analysis was conducted using R version 3.1.2 and Stata version 12.0. A total of thirty-nine studies were included. Thirty-one published or unpublished clinical trials involving about 40,000 subjects did not show significant differences in incidence of febrile seizure or vaccine related febrile seizure between MMRV and MMR with or without varicella vaccine after any doses, in the risk windows of 0-28, 0-42 or 0-56 days and 7-10 days. In addition, these studies showed that the receipt of concomitant use of MMRV and other pediatric vaccines was not a significant predictor of febrile seizure. Eight post-marketing observations involving more than 3,200,000 subjects were included. No evidence suggested elevated risk of febrile seizure associated with MMRV vaccine among children aged 4-6 years old during 7-10 days or 0-42 days after vaccination. However, an approximately 2-fold increase in risk of seizure or febrile seizure during 7-10 days or 5-12 days after MMRV vaccination was found among children aged 10-24 months, although the highest incidence of seizure was still lower than 2.95‰. First MMRV vaccine dose in children aged 10-24 months was associated with an elevated risk of seizure or febrile seizure. Further post-marketing restudies based on more rigorous study design are needed to confirm the findings. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Noninterference of Rotavirus Vaccine With Measles-Rubella Vaccine at 9 Months of Age and Improvements in Antirotavirus Immunity: A Randomized Trial

    PubMed Central

    Zaman, K.; Fleming, Jessica A.; Victor, John C.; Yunus, Mohammad; Bari, Tajul Islam A.; Azim, Tasnim; Rahman, Mustafizur; Mowla, Syed Mohammad Niaz; Bellini, William J.; McNeal, Monica; Icenogle, Joseph P.; Lopman, Ben; Parashar, Umesh; Cortese, Margaret M.; Steele, A. Duncan; Neuzil, Kathleen M.

    2016-01-01

    Background. The burden of rotavirus morbidity and mortality is high in children aged <5 years in developing countries, and evaluations indicate waning protection from rotavirus immunization in the second year. An additional dose of rotavirus vaccine may enhance the immune response and lengthen the period of protection against disease, but coadministration of this dose should not interfere with immune responses to concurrently given vaccines. Methods. A total of 480 9-month-old participants from Matlab, Bangladesh, were enrolled in a study with a primary objective to establish noninferiority of concomitant administration of measles-rubella vaccine (MR) and a third dose of human rotavirus vaccine (HRV; MR + HRV), compared with MR given alone. Secondary objectives included noninferiority of rubella antibody seroconversion and evaluating rotavirus IgA/IgG seroresponses in MR + HRV recipients. Results. Two months after vaccination, 75.3% and 74.3% of MR + HRV and MR recipients, respectively, had seroprotective levels of measles virus antibodies; 100.0% and 99.6%, respectively, showed anti–rubella virus immunoglobulin G (IgG) seroprotection. In the MR + HRV group, antirotavirus immunoglobulin A and IgG seropositivity frequencies before vaccination (52.7% and 66.3%, respectively) increased to 69.6% and 88.3% after vaccination. Conclusions. Vaccine-induced measles and rubella antibody responses are not negatively affected by concomitant administration of HRV. The HRV dose increases antirotavirus serum antibody titers and the proportion of infants with detectable antirotavirus antibody. Clinical Trials Registration. NCT01700621. PMID:26823338

  8. Comparison of the immunogenicity and safety of measles vaccine administered alone or with live, attenuated Japanese encephalitis SA 14-14-2 vaccine in Philippine infants.

    PubMed

    Gatchalian, Salvacion; Yao, Yafu; Zhou, Benli; Zhang, Lei; Yoksan, Sutee; Kelly, Kim; Neuzil, Kathleen M; Yaïch, Mansour; Jacobson, Julie

    2008-04-24

    Japanese encephalitis (JE) virus is a major cause of disease, disability, and death in Asia. An effective, live, attenuated JE vaccine (LJEV) is available; however, its use in routine immunization schedules is hampered by lack of data on concomitant administration with measles vaccine (MV). This study evaluated the immunogenicity and reactogenicity of LJEV and MV when administered at the same or separate study visits in infants younger than 1 year of age. Three groups of healthy infants were randomized to receive LJEV at age of 8 months and MV at 9 months (Group 1; n=100); MV and LJEV together at 9 months (Group 2; n=236); or MV and LJEV at 9 and 10 months, respectively (Group 3; n=235). Blood was obtained 4 weeks after each vaccine administration to determine antibody levels for measles and JE. Reactogenicity was assessed by parental diaries and clinic visits. Four weeks after immunization, measles seroprotection rates (defined as > or =340 mIU/ml) were high and comparable in all three groups and specifically, rates in the combined MV-LJEV (Group 2) were not statistically inferior to those in Group 3 receiving MV separately (96% versus 100%, respectively). Likewise, the LJEV seroprotection rates were high and similar between the three groups. The reactogenicity profiles of the three vaccine schedules were also analogous. LJEV and MV administered together are well tolerated and immunogenic in infants younger than 1 year. These results should facilitate incorporation of LJEV into routine immunization schedules with MV.

  9. Successful immunization of infants at 6 months of age with high dose Edmonston-Zagreb measles vaccine. Cite Soleil/JHU Project Team.

    PubMed

    Job, J S; Halsey, N A; Boulos, R; Holt, E; Farrell, D; Albrecht, P; Brutus, J R; Adrien, M; Andre, J; Chan, E

    1991-04-01

    A group of 2097 Haitian infants 6 to 11 months of age were randomized to receive Schwarz or Edmonston-Zagreb strain measles vaccines containing 10- to 500-fold more vaccine viral particles than standard potency vaccines. No unusual adverse reactions were noted. Edmonston-Zagreb vaccines were more effective than equivalent doses of Schwarz vaccines as measured by the proportion of vaccinated children with measles antibody concentrations greater than or equal to 200 mIU/ml 2 months after vaccination and the persistence of antibody at 18 to 24 months of age. High titer Edmonston-Zagreb vaccine administered at 6 months of age induced antibody concentrations greater than or equal to 200 mIU/ml in 83% of infants by plaque reduction neutralization and 93% of infants by enzyme-linked immunosorbent assay with high rates of antibody persistence at 12 to 24 months of age. The World Health Organization recommends high titer Edmonston-Zagreb measles vaccines for routine use at 6 months of age in areas where measles is an important cause of mortality in young infants.

  10. Mass Measles Vaccination Campaign in Aila Cyclone-Affected Areas of West Bengal, India: An In-depth Analysis and Experiences

    PubMed Central

    Mallik, Sarmila; Mandal, Pankaj Kumar; Ghosh, Pramit; Manna, Nirmalya; Chatterjee, Chitra; Chakrabarty, Debadatta; Bagchi, Saumendra Nath; Dasgupta, Samir

    2011-01-01

    Disaster-affected populations are highly vulnerable to outbreaks of measles. Therefore, a mass vaccination against measles was conducted in Aila cyclone-affected blocks of West Bengal, India in July 2009. The objectives of the present report were to conduct an in depth analysis of the campaign, and to discuss the major challenges. A block level micro-plan, which included mapping of the villages, health facilities, temporary settlements of disaster-affected population, communications available, formation of vaccination team, information education communication, vaccine storage, waste disposal, surveillance for adverse events following immunization, supervision and monitoring was developed. The rate of six months to five years old children, who were vaccinated by measles vaccine, was 70.7% and that of those who received one dose of vitamin A was 71.3%. Wastage factor for vaccine doses and auto-disable syringes were 1.09 and 1.07, respectively. Only 13 cases of adverse events following immunization were reported. An average of 0.91 puncture-proof containers per vaccination session was used. Despite the major challenges faced due to difficult to reach areas, inadequate infrastructure, manpower and communication, problems of vaccine storage and transport, the campaign achieved a remarkable success regarding measles vaccine coverage, improvements of cold chain infrastructure, formulating an efficient surveillance and reporting system for adverse events following immunization, building self-confidence of the stakeholders, and developing a biomedical waste disposal system. PMID:23115416

  11. Andean region: measles on the way out.

    PubMed

    1996-10-01

    In August 1996, health officials, program managers, epidemiologists, laboratory representatives, UNICEF, Rotary International, and Pan American Health Organization staff attended the VII Andean EPI Meeting in Quito, Ecuador, to review the progress of the Expanded Program on Immunization (EPI). All Andean countries have conducted catch-up measles vaccination campaigns targeting children 9 months to 15 years old. These campaigns achieved 90% vaccine coverage and a strong reduction in measles incidence (only 7 confirmed cases in 1996). Follow-up campaigns were conducted during 1995-1996 in Colombia, Peru, and Chile. They were expected in Bolivia, Ecuador, Peru, and Venezuela during 1997-1999. The Andean countries implemented a national surveillance system for measles in 1995. Meeting representatives made eight recommendations regarding measles. For example, health officials should reach and maintain routine vaccination coverage greater than 95% for children 12-23 months old in each municipality. Laboratory representatives proposed recommendations on uniform criteria for measles diagnosis. The last indigenous wild poliovirus in the Americas was isolated in 1991. Imported wild poliovirus remains a concern. The Andean countries are expanding surveillance of neonatal tetanus activities. Since 1989 the frequency of neonatal tetanus has been falling in the Andean region, especially in Bolivia and Peru. The impact of migration on the control of neonatal tetanus should be a higher priority. Participants repeated the need for systematic use and continuous monitoring of EPI indicators (e.g., vaccination coverage). Three countries plan on analyzing surveys on missed opportunities for vaccination in 1996. Three countries presented progress reports on hepatitis B vaccination and surveillance. Participants issued recommendations on quality control of vaccines. The responsibility for quality control lies with the manufacturers and the government. Vaccines for invasive diseases (e

  12. Treatment of recalcitrant warts with intralesional measles, mumps, and rubella vaccine: a promising approach.

    PubMed

    Nofal, Ahmad; Nofal, Eman; Yosef, Ayman; Nofal, Hager

    2015-06-01

    Recalcitrant warts represent a frustrating challenge for both patients and physicians. Although many destructive and immunotherapeutic modalities are available for the treatment of warts, an ideal, universally effective approach has not been explored to date. Recently, intralesional antigen immunotherapy has shown promising efficacy in the treatment of warts. The aim of the study was to evaluate the efficacy and safety of intralesional measles, mumps, and rubella (MMR) vaccine in the treatment of recalcitrant warts. The study included 70 adult patients with multiple recalcitrant extragenital warts of different sizes and durations, with or without distant warts. They were directly injected, without a pre-sensitization skin test, with 0.3 intralesional MMR vaccine into the largest wart at 2-week intervals until complete clearance or for a maximum of five treatments. Follow-up was made every month for six months to detect any recurrence. Sixty-five patients, 35 men and 30 women, completed the study, and five patients discontinued for various reasons. Complete clearance of the lesions was observed in 41 patients (63%), partial response in 15 patients (23%), and no response in nine patients (14%). Complete response was demonstrated in 74.5% of those presenting with distant warts. Side effects were mild and insignificant in the form of pain during injection, itching, erythema, and edema at the site of injection and flu-like symptoms. Recurrence was detected in two patients only. Intralesional immunotherapy by MMR vaccine is a promising, effective, and safe treatment modality for recalcitrant warts. © 2014 The International Society of Dermatology.

  13. Mumps Antibody Response in Young Adults After a Third Dose of Measles-Mumps-Rubella Vaccine

    PubMed Central

    Fiebelkorn, Amy Parker; Coleman, Laura A.; Belongia, Edward A.; Freeman, Sandra K.; York, Daphne; Bi, Daoling; Zhang, Cheryl; Ngo, Laurie; Rubin, Steven

    2014-01-01

    Background  Mumps outbreaks in populations with high 2-dose measles-mumps-rubella (MMR) vaccine coverage raise the question whether a third dose of MMR vaccine (MMR3) is needed. However, data on the immunogenicity of MMR3 are limited. We assessed mumps virus neutralizing antibody levels pre- and post-MMR3 in a nonoutbreak setting. Methods  Mumps antibody titers were assessed at baseline, 1 month, and 1 year after MMR3 in subjects aged 18–28 years. Results  At baseline, 5 of 656 (0.8%) subjects had seronegative mumps neutralizing antibody titers and 38 (5.8%) had low titers. One year post-MMR3, these numbers declined to 3 (0.5%) and 16 (2.4%), respectively. Subjects with low baseline titers were more likely to have low 1-month and 1-year titers (R2 = 0.81–0.87, P < .0001). Compared to baseline, geometric mean titers were significantly higher at 1 month (P < .0001) and 1 year (P < .01) post-MMR3; however, reverse cumulative distribution curves showed only minimal shifts in mumps titers from baseline to 1 month and 1 year. Conclusions  Very few subjects had negative or low baseline mumps titers. Nonetheless, mumps titers had modest but significant increases when measured 1 month and 1 year post-MMR3. This temporary increase in titers could decrease susceptibility to disease during outbreaks, but may have limited value for routine use in vaccinated populations. PMID:25734162

  14. Modified measles versus rubella versus atypical measles: One and same thing.

    PubMed

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or rubella or atypical cases. Similarities

  15. Modified measles versus rubella versus atypical measles: One and same thing

    PubMed Central

    Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

    2015-01-01

    Introduction: In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Results: Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. Discussion: On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or

  16. Poor immune responses of newborn rhesus macaques to measles virus DNA vaccines expressing the hemagglutinin and fusion glycoproteins.

    PubMed

    Polack, Fernando P; Lydy, Shari L; Lee, Sok-Hyong; Rota, Paul A; Bellini, William J; Adams, Robert J; Robinson, Harriet L; Griffin, Diane E

    2013-02-01

    A vaccine that would protect young infants against measles could facilitate elimination efforts and decrease morbidity and mortality in developing countries. However, immaturity of the immune system is an important obstacle to the development of such a vaccine. In this study, DNA vaccines expressing the measles virus (MeV) hemagglutinin (H) protein or H and fusion (F) proteins, previously shown to protect juvenile macaques, were used to immunize groups of 4 newborn rhesus macaques. Monkeys were inoculated intradermally with 200 μg of each DNA at birth and at 10 months of age. As controls, 2 newborn macaques were similarly vaccinated with DNA encoding the influenza virus H5, and 4 received one dose of the current live attenuated MeV vaccine (LAV) intramuscularly. All monkeys were monitored for development of MeV-specific neutralizing and binding IgG antibody and cytotoxic T lymphocyte (CTL) responses. These responses were poor compared to the responses induced by LAV. At 18 months of age, all monkeys were challenged intratracheally with a wild-type strain of MeV. Monkeys that received the DNA vaccine encoding H and F, but not H alone, were primed for an MeV-specific CD8(+) CTL response but not for production of antibody. LAV-vaccinated monkeys were protected from rash and viremia, while DNA-vaccinated monkeys developed rashes, similar to control monkeys, but had 10-fold lower levels of viremia. We conclude that vaccination of infant macaques with DNA encoding MeV H and F provided only partial protection from MeV infection.

  17. Factors associated with non-vaccination against measles in northeastern Brazil: Clues about causes of the 2015 outbreak.

    PubMed

    Rocha, Hermano A L; Correia, Luciano L; Campos, Jocileide S; Silva, Anamaria C; Andrade, Francisca O; Silveira, Dirlene I; Machado, Márcia M; Leite, Álvaro J; Cunha, Antônio J L A

    2015-09-11

    Measles is a highly contagious disease that can be effectively prevented through vaccination. The recent increase in vaccination coverage was successful in reducing the mortality globally of the disease by 74%. As a whole, the Americas have been considered a disease-free zone. However, it is known that if an immunization programs fails, there will be an accumulation of susceptible people that can lead to disease outbreaks. Recently, both the United States and Brazil faced outbreaks of measles. The present study aims to identify the determining factors of non-vaccination in Brazil in two different vaccination coverage moments, to provide clues as to the causes of current outbreaks. Data were drawn from five population-based cross-sectional studies that surveyed a representative sample of preschool children from 1987 to 2007 (9585 children in total). To assess children's vaccination status, two different information sources were used: information provided by mothers and information from children's health cards. Multivariate analyses with logistic binary regression models were conducted. After adjustment for confounding factors, it was observed that in 1987, with 48.2% vaccination coverage, socioeconomic, maternal, nutritional factors and access to health facilities were important, while in 2007 (96.7% coverage), nutritional and maternal factors were important. Distinct patterns of determinants of non-vaccination were also found. In addition, the low coverage in 1987 resulted in a current pool of adults who were not immunized as children; this may have contributed to the beginning of the current Brazilian outbreak. Globally, there are two standards of vaccination coverage (low and high). Therefore, discussion of the determinants of non-vaccination is important. Our findings suggest vulnerable groups should receive special attention to ensure they are protected. It is also important to consider the possible impact of pools of adults not immunized.

  18. Pediatric measles vaccine expressing a dengue antigen induces durable serotype-specific neutralizing antibodies to dengue virus.

    PubMed

    Brandler, Samantha; Lucas-Hourani, Marianne; Moris, Arnaud; Frenkiel, Marie-Pascale; Combredet, Chantal; Février, Michèle; Bedouelle, Hugues; Schwartz, Olivier; Desprès, Philippe; Tangy, Frédéric

    2007-12-12

    Dengue disease is an increasing global health problem that threatens one-third of the world's population. Despite decades of efforts, no licensed vaccine against dengue is available. With the aim to develop an affordable vaccine that could be used in young populations living in tropical areas, we evaluated a new strategy based on the expression of a minimal dengue antigen by a vector derived from pediatric live-attenuated Schwarz measles vaccine (MV). As a proof-of-concept, we inserted into the MV vector a sequence encoding a minimal combined dengue antigen composed of the envelope domain III (EDIII) fused to the ectodomain of the membrane protein (ectoM) from DV serotype-1. Immunization of mice susceptible to MV resulted in a long-term production of DV1 serotype-specific neutralizing antibodies. The presence of ectoM was critical to the immunogenicity of inserted EDIII. The adjuvant capacity of ectoM correlated with its ability to promote the maturation of dendritic cells and the secretion of proinflammatory and antiviral cytokines and chemokines involved in adaptive immunity. The protective efficacy of this vaccine should be studied in non-human primates. A combined measles-dengue vaccine might provide a one-shot approach to immunize children against both diseases where they co-exist.

  19. [Vaccination coverage among health care workers in the pediatric emergency and intensive care department of Edouard Herriot hospital in 2007, against influenza, pertussis, varicella, and measles].

    PubMed

    Hees, L; Afroukh, N; Floret, D

    2009-01-01

    The aim of this study was to determine the vaccination coverage among the medical and paramedical health care workers of the pediatric intensive care and emergency department of Edouard Herriot hospital in Lyon, with respect to influenza, pertussis, varicella, and measles, 4 diseases with air transmission and vaccination recommendations. During February and March 2007, a questionnaire was given by hand to 123 health care workers by a medical student working there or available in the intensive care unit. The response rate to the questionnaire was 68.3%. The vaccination coverage against influenza was 42.8%; men and medical health care workers were better vaccinated. With respect to vaccination against pertussis, one third had received an injection in adulthood, adults under age 30 and medical health care workers were better vaccinated, but the difference was not statistically significant. Ten health care workers were not vaccinated and had no history of measles: only 1 had had a measles serology and none were vaccinated. Eleven had no history of varicella: 6 had had a varicella serology and none were vaccinated. Vaccination coverage against influenza is higher than what has been reported in the literature, possibly because of a mobile vaccination campaign against influenza made during winter 2006 in this pediatric department. Vaccination coverage against pertussis is encouraging and probably the consequence of an awareness of the gravity of the disease among infants. Individual information is necessary for health care workers on the nosocomial risk for influenza and pertussis in infants, and vaccination must be proposed. Serology against varicella and measles is compulsory for all health care workers with no history and no vaccination against these 2 diseases, to track and vaccinate the nonimmunized personnel. Occupational physicians have a very important role to play in meeting this goal.

  20. When, and how, should we introduce a combination measles-mumps-rubella (MMR) vaccine into the national childhood expanded immunization programme in South Africa?

    PubMed

    Cameron, Neil A

    2012-09-07

    This article briefly reviews the history and epidemiology of measles, mumps and rubella disease and the case for introducing combination measles-mumps-rubella (MMR) vaccine into the national childhood immunization schedule in South Africa. Despite adopting the World Health Organization's Measles Elimination strategy in 1996 and achieving a significant decrease the incidence of measles, added effort is needed in South and southern Africa to reach the goal to eliminate endogenous spread measles. Mumps is still common disease of childhood and while there are few sequelae, even the rare complications are important in large populations. Congenital rubella syndrome is seldom reported, but it is estimated that of the million or so children born every year in South Africa over 600 infants are affected to some degree by rubella infection. The naturally acquired immunity to rubella in women of childbearing age in South Africa has been estimated at over 90%, so that introducing a rubella containing vaccine in childhood may paradoxically increase the proportion of girls reaching puberty still susceptible to rubella. The elimination of endogenous measles and rubella is being achieved in many countries in South America, and despite the recent measles epidemic, must still be seriously considered for South and southern Africa. Current constraints and potential steps needed to reach the goal in South Africa are discussed.

  1. Measles-mumps-rubella vaccine and the development of autism or inflammatory bowel disease: the controversy should end.

    PubMed

    D'Souza, Jennifer; Todd, Timothy

    2003-07-01

    Vaccines have been administered to millions of individuals, usually infants and children, with few serious adverse effects. In 1998 a report suggested that there may be a link between the measles-mumps-rubella vaccine and the development of behavioral abnormalities (i.e., autism) and inflammatory bowel disease in children. This report generated considerable media and political attention, which many feared would result in a decreased willingness of parents to immunize their children against these contagious diseases. Over the past decade, an increasing number of healthcare practitioners have been credentialed to administer vaccinations. Therefore, it is imperative for all medical professionals to understand the controversy surrounding this issue and to be able to appropriately educate and advise parents accordingly. This review article evaluated the primary and secondary literature pertaining to this topic and concluded that the available epidemiological and scientific evidence does not support a causal association between the MMR vaccine and autism or inflammatory bowel disease.

  2. [Measles and pregnancy].

    PubMed

    Anselem, Olivia; Tsatsaris, Vassilis; Lopez, Emmanuel; Krivine, Anne; Le Ray, Camille; Loulergue, Pierre; Floret, Daniel; Goffinet, Francois; Launay, Odile

    2011-11-01

    Because of insufficient vaccine coverage, there is an outbreak of measles since 2008 in France with an increasing incidence of cases, most of them among children less than 1 year old or young adults. When measles occurs during pregnancy, maternal and fetal morbidity is increased. Particularly pregnant women are exposed to a higher risk of severe respiratory distress that might cause death. Measles virus can be detected in the placenta. Placental infection appears to be involved in some cases of fetal death. The virus is not responsible for congenital defects but can induce histologic damages inside the placenta which may lead to fetal death. Major perinatal risks are also miscarriage and prematurity. When measles occurs in late pregnancy, congenital infection is possible with variable expression and a risk of subacute sclerosing panencephalitis. Non immune pregnant women or neonates exposed to measles should receive an immunoglobulin prophylaxis within 6 days after contact in order to reduce the risk of infection and severe morbidity. In case of declared measles infection, symptomatic treatment can be proposed and tocolysis can be used if preterm labor is associated. Daily fetal monitoring during the 14 days following the beginning of the eruption can be offered when the fetus is viable. Vaccination is recommended for the people born in France after 1980 with 2 doses of vaccine against measles, rubeola and mumps. Measles vaccine, an attenuated living vaccine, should not be administered during pregnancy but must be proposed before pregnancy or during the post-partum period.

  3. Non-specific effect of measles vaccination on overall child mortality in an area of rural India with high vaccination coverage: a population-based case-control study.

    PubMed Central

    Kabir, Zubair; Long, Jean; Reddaiah, Vankadara P.; Kevany, John; Kapoor, Suresh K.

    2003-01-01

    OBJECTIVE: To determine whether vaccination against measles in a population with sustained high vaccination coverage and relatively low child mortality reduces overall child mortality. METHODS: In April and May 2000, a population-based, case-control study was conducted at Ballabgarh (an area in rural northern India). Eligible cases were 330 children born between 1 January 1991 and 31 December 1998 who died aged 12-59 months. A programme was used to match 320 controls for age, sex, family size, and area of residence from a birth cohort of 15 578 born during the same time period. FINDINGS: The analysis used 318 matched pairs and suggested that children aged 12-59 months who did not receive measles vaccination in infancy were three times more likely to die than those vaccinated against measles. Children from lower caste households who were not vaccinated in infancy had the highest risk of mortality (odds ratio, 8.9). A 27% increase in child mortality was attributable to failure to vaccinate against measles in the study population. CONCLUSION: Measles vaccine seems to have a non-specific reducing effect on overall child mortality in this population. If true, children in lower castes may reap the greatest gains in survival. The findings should be interpreted with caution because the nutritional status of the children was not recorded and may be a residual confounder. "All-cause mortality" is a potentially useful epidemiological endpoint for future vaccine trials. PMID:12764490

  4. Measles Edmonston Vaccine Strain Derivatives have Potent Oncolytic Activity against Osteosarcoma

    PubMed Central

    Musibay, Evidio Domingo; Allen, Cory; Kurokawa, Cheyne; Hardcastle, Jayson J.; Aderca, Ileana; Msaouel, Pavlos; Bansal, Aditya; Jiang, Huailei; DeGrado, Timothy R.; Galanis, Evanthia

    2015-01-01

    Osteosarcoma is the most common primary bone tumor affecting children and young adults, and development of metastatic disease is associated with poor prognosis. The purpose of this study was to evaluate the antitumor efficacy of virotherapy with engineered measles virus (MV) vaccine strains in the treatment of osteosarcoma. Cell lines derived from pediatric patients with osteosarcoma (HOS, MG63, 143B, KHOS-312H, U2-OS and SJSA1) were examined for MV-GFP and MV-NIS gene expression and cytotoxicity as defined by syncytial formation, cell death, and eradication of cell monolayers: significant antitumor activity was demonstrated. Findings were correlated with in vivo efficacy in subcutaneous, orthotopic (tibial bone), and lung metastatic osteosarcoma xenografts treated with the MV derivative MV-NIS via the intratumoral (IT) or intravenous (IV) route. Following treatment, we observed decrease in tumor growth of subcutaneous xenografts (p=0.0374) and prolongation of survival in mice with orthotopic (p<0.0001) and pulmonary metastatic osteosarcoma tumors (p=0.0207). Expression of the NIS transgene in MV-NIS infected tumors allowed for SPECT-CT and PET-CT imaging of virus infected tumors in vivo. Our data support the translational potential of MV-based virotherapy approaches in the treatment of recurrent and metastatic osteosarcoma. PMID:25394505

  5. A ‘post-honeymoon’ measles epidemic in Burundi: mathematical model-based analysis and implications for vaccination timing

    PubMed Central

    Corey, Katelyn C.

    2016-01-01

    Using a mathematical model with realistic demography, we analyze a large outbreak of measles in Muyinga sector in rural Burundi in 1988–1989. We generate simulated epidemic curves and age × time epidemic surfaces, which we qualitatively and quantitatively compare with the data. Our findings suggest that supplementary immunization activities (SIAs) should be used in places where routine vaccination cannot keep up with the increasing numbers of susceptible individuals resulting from population growth or from logistical problems such as cold chain maintenance. We use the model to characterize the relationship between SIA frequency and SIA age range necessary to suppress measles outbreaks. If SIAs are less frequent, they must expand their target age range. PMID:27672515

  6. A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform

    PubMed Central

    Malczyk, Anna H.; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A.; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan

    2015-01-01

    ABSTRACT In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR−/−)-CD46Ge mice with 2 × 105 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. IMPORTANCE Although MERS-CoV has not yet acquired extensive distribution

  7. A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform.

    PubMed

    Malczyk, Anna H; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan; Mühlebach, Michael D

    2015-11-01

    In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR(-/-))-CD46Ge mice with 2 × 10(5) 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. Although MERS-CoV has not yet acquired extensive distribution, being mainly confined to

  8. Seroprevalence of Anti-Rubella and Anti-Measles IgG Antibodies in Pregnant Women in Shiraz, Southern Iran: Outcomes of a Nationwide Measles-Rubella Mass Vaccination Campaign

    PubMed Central

    Honarvar, Behnam; Moghadami, Mohsen; Moattari, Afagh; Emami, Amir; Odoomi, Neda; Bagheri Lankarani, Kamran

    2013-01-01

    Objective Nonimmune pregnant women are at risk of developing congenital rubella syndrome and measles complications. We aimed to identify pregnant women susceptible to rubella or measles in order to determine the need for immunity screening and supplemental immunization in women of childbearing age. Method This seroprevalence survey was conducted by convenience sampling in obstetric hospitals affiliated with Shiraz University of Medical Sciences (southern Iran). Serum IgG levels were measured by ELISA. Result Mean age of the 175 pregnant women was 27.3±5.3 (range 16 to 42) years. The geometric mean concentration of anti-rubella IgG was 14.9 IU/mL (CI 95%,14.1–15.5), and that of anti-measles IgG was 13.8 IU/mL (CI 95%, 13–14.5). One hundred sixty-eight women (96%) had a protective serologic level (>11 IU/mL) of IgG against rubella, and 143 (81.7%) had a protective level against measles. Except for a significant inverse correlation that was showed by univariate analysis between anti-rubella IgG and the women’s age (P = 0.01), immunity did not correlate with demographic or obstetric characteristics or medical history. There was no significant correlation between anti-rubella and anti-measles IgG levels (P = 0.25). Conclusion Nearly a decade after Iran’s nationwide measles-rubella vaccination campaign for the population aged 5–25 years, most pregnant women up to 34 years of age had humoral immunity against rubella. We recommend rubella immunity screening or catch-up immunization for women older than 35 years who wish to become pregnant, and measles immunity screening and appropriate vaccination for all women of childbearing age. PMID:23383049

  9. Predictors of Uptake and Timeliness of Newly Introduced Pneumococcal and Rotavirus Vaccines, and of Measles Vaccine in Rural Malawi: A Population Cohort Study.

    PubMed

    Mvula, Hazzie; Heinsbroek, Ellen; Chihana, Menard; Crampin, Amelia C; Kabuluzi, Storn; Chirwa, Geoffrey; Mwansambo, Charles; Costello, Anthony; Cunliffe, Nigel A; Heyderman, Robert S; French, Neil; Bar-Zeev, Naor

    2016-01-01

    Malawi introduced pneumococcal conjugate vaccine (PCV13) and monovalent rotavirus vaccine (RV1) in 2011 and 2012 respectively, and is planning the introduction of a second-dose measles vaccine (MV). We assessed predictors of availability, uptake and timeliness of these vaccines in a rural Malawian setting. Commencing on the first date of PCV13 eligibility we conducted a prospective population-based birth cohort study of 2,616 children under demographic surveillance in Karonga District, northern Malawi who were eligible for PCV13, or from the date of RV1 introduction both PCV13 and RV1. Potential predictors of vaccine uptake and timeliness for PCV13, RV1 and MV were analysed respectively using robust Poisson and Cox regression. Vaccine coverage was high for all vaccines, ranging from 86.9% for RV1 dose 2 to 95.4% for PCV13 dose 1. Median time delay for PCV13 dose 1 was 17 days (IQR 7-36), 19 days (IQR 8-36) for RV1 dose 1 and 20 days (IQR 3-46) for MV. Infants born to lower educated or farming mothers and those living further away from the road or clinic were at greater risk of being not fully vaccinated and being vaccinated late. Delays in vaccination were also associated with non-facility birth. Vaccine stock-outs resulted in both a delay in vaccine timeliness and in a decrease in completion of schedule. Despite high vaccination coverage in this setting, delays in vaccination were common. We identified programmatic and socio-demographic risk factors for uptake and timeliness of vaccination. Understanding who remains most vulnerable to be unvaccinated allows for focussed delivery thereby increasing population coverage and maximising the equitable benefits of universal vaccination programmes.

  10. Association of autistic spectrum disorder and the measles, mumps, and rubella vaccine: a systematic review of current epidemiological evidence.

    PubMed

    Wilson, Kumanan; Mills, Ed; Ross, Cory; McGowan, Jessie; Jadad, Alex

    2003-07-01

    To systematically review the evidence for and against the existence of an association between autistic spectrum disorder (ASD) and the measles, mumps, and rubella (MMR) vaccine. We conducted a systematic review of the medical literature to identify all controlled epidemiological articles examining for an association between ASD and the MMR vaccine. We extracted data from the articles on the characteristics and objectives of the study as well as evidence of an association. Twelve articles met the inclusion criteria. One study found no difference in the rates of ASD and the MMR vaccine in children who were vaccinated and those who were not. Six studies examined for evidence of an increase in ASD associated with an increase in the MMR vaccine coverage, none of which showed evidence of an association. Four studies examined if a variant form of ASD was associated with the MMR vaccine, none of which showed evidence of an association. Eight studies attempted to determine if there was a temporal association between developing ASD and receiving the MMR vaccine. Of these, 1 study identified an increase in parental concern in the 6-month period following vaccination with MMR in one of its analyses. The results of all other studies showed no association between ASD and the MMR vaccine. The current literature does not suggest an association between ASD and the MMR vaccine; however, limited epidemiological evidence exists to rule out a link between a rare variant form of ASD and the MMR vaccine. Given the real risks of not vaccinating and that the risks and existence of variant ASD remain theoretical, current policies should continue to advocate the use of the MMR vaccine.

  11. Measles vaccination coverage estimates from surveys, clinic records, and immune markers in oral fluid and blood: a population-based cross-sectional study

    PubMed Central

    2013-01-01

    Background Recent outbreaks of measles and polio in low-income countries illustrate that conventional methods for estimating vaccination coverage do not adequately identify susceptible children. Immune markers of protection against vaccine-preventable diseases in oral fluid (OF) or blood may generate more accurate measures of effective vaccination history, but questions remain about whether antibody surveys are feasible and informative tools for monitoring immunization program performance compared to conventional vaccination coverage indicators. This study compares six indicators of measles vaccination status, including immune markers in oral fluid and blood, from children in rural Bangladesh and evaluates the implications of using each indicator to estimate measles vaccination coverage. Methods A cross-sectional population-based study of children ages 12–16 months in Mirzapur, Bangladesh, ascertained measles vaccination (MCV1) history from conventional indicators: maternal report, vaccination card records, ‘card + history’ and EPI clinic records. Oral fluid from all participants (n = 1226) and blood from a subset (n = 342) were tested for measles IgG antibodies as indicators of MCV1 history and compared to conventional MCV1 coverage indicators. Results Maternal report yielded the highest MCV1 coverage estimates (90.8%), followed by EPI records (88.6%), and card + history (84.2%). Seroprotection against measles by OF (57.3%) was significantly lower than other indicators, even after adjusting for incomplete seroconversion and assay performance (71.5%). Among children with blood results, 88.6% were seroprotected, which was significantly higher than coverage by card + history and OF serostatus but consistent with coverage by maternal report and EPI records. Children with vaccination cards or EPI records were more likely to have a history of receiving MCV1 than those without cards or records. Despite similar MCV1 coverage estimates across

  12. Similar Antibody Levels in 3-Year-Old Children Vaccinated Against Measles, Mumps, and Rubella at the Age of 12 Months or 18 Months.

    PubMed

    Kontio, Mia; Palmu, Arto A; Syrjänen, Ritva K; Lahdenkari, Mika; Ruokokoski, Esa; Davidkin, Irja; Vaarala, Outi; Melin, Merit

    2016-06-15

    Measles-mumps-rubella (MMR) vaccinations have been offered to Finnish children at 14-18 months and 6 years of age. In May 2011, the recommended age for the first vaccine dose was lowered to 12 months because of the European measles epidemic. Fingertip capillary blood samples were collected from 3-year-old Finnish children vaccinated once with MMR vaccine at 11-19 months of age. The immunoglobulin G (IgG) antibodies to all 3 MMR antigens were measured with enzyme-linked immunosorbent assay. Neutralizing antibodies and the avidity of antibodies were measured for measles virus. From April through October 2013, 187 children were enrolled. Equally high proportions of the samples were seropositive for measles virus, mumps virus, or rubella virus antibodies, and there were no significant differences in the IgG antibody concentrations in children vaccinated at 11-13 months of age, compared with those vaccinated at 17-19 months of age. However, among children vaccinated at 11-13 months of age, boys had lower antibody concentrations than girls. Neutralizing measles virus antibody titers were above the threshold for protective immunity in all 78 samples analyzed. The measles virus antibody avidity indexes were high for all children. MMR induces similar antibody responses in 12-month-old children as compared to 18-month-old children, but in boys increasing age appears to improve the antibody responses. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  13. Measles elimination: progress and challenges.

    PubMed

    Cutts, F T; Henao-Restrepo, A; Olivé, J M

    1999-10-29

    The accelerating progress in reducing measles incidence and mortality in many parts of the world has led to calls for its global eradication during the next 10-15 years. Three regions have established goals of elimination of indigenous transmission of measles. The strategy used in the Americas of a mass 'catchup' campaign of children 9 months to 15 years of age, high coverage through routine vaccination of infants, intensive surveillance and follow-up campaigns to prevent excessive build-up of susceptibles has had great success in reducing measles transmission close to zero. However, while these developments are impressive, much remains to be done to reduce measles-associated mortality in western and central Africa, where less than half of children are currently receiving measles vaccine and half a million children die from measles each year. The obstacles to global measles eradication are perceived to be predominantly political and financial. There are also technical questions, however. These include the refinement of measles elimination strategies in the light of recent outbreaks in the Americas; the implications of the HIV epidemic for measles elimination, issues around injection safety, and concerns about the possibility that secondary vaccine failures will contribute in sustaining transmission in highly vaccinated populations. The global priorities are to improve measles control in low income countries, increase awareness among industrialized countries of the importance of measles, and conduct studies to answer the technical questions about measles elimination strategies.

  14. Enabling implementation of the Global Vaccine Action Plan: developing investment cases to achieve targets for measles and rubella prevention.

    PubMed

    Thompson, Kimberly M; Strebel, Peter M; Dabbagh, Alya; Cherian, Thomas; Cochi, Stephen L

    2013-04-18

    Global prevention and control of infectious diseases requires significant investment of financial and human resources and well-functioning leadership and management structures. The reality of competing demands for limited resources leads to trade-offs and questions about the relative value of specific investments. Developing investment cases can help to provide stakeholders with information about the benefits, costs, and risks associated with available options, including examination of social, political, governance, and ethical issues. We describe the process of developing investment cases for globally coordinated management of action plans for measles and rubella as tools for enabling the implementation of the Global Vaccine Action Plan (GVAP). We focus on considerations related to the timing of efforts to achieve measles and rubella goals independently and within the context of ongoing polio eradication efforts, other immunization priorities, and other efforts to control communicable diseases or child survival initiatives. Our analysis suggests that the interactions between the availability and sustainability of financial support, sufficient supplies of vaccines, capacity of vaccine delivery systems, and commitments at all levels will impact the feasibility and timing of achieving national, regional, and global goals. The timing of investments and achievements will determine the net financial and health benefits obtained. The methodology, framing, and assumptions used to characterize net benefits and uncertainties in the investment cases will impact estimates and perceptions about the value of prevention achieved overall by the GVAP. We suggest that appropriately valuing the benefits of investments of measles and rubella prevention will require the use of integrated dynamic disease, economic, risk, and decision analytic models in combination with consideration of qualitative factors, and that synthesizing information in the form of investment cases may help

  15. Similar immunogenicity of measles-mumps-rubella (MMR) vaccine administrated at 8 months versus 12 months age in children.

    PubMed

    He, Hanqing; Chen, Enfu; Chen, Haiping; Wang, Zhifang; Li, Qian; Yan, Rui; Guo, Jing; Zhou, Yang; Pan, Jinren; Xie, Shuyun

    2014-06-30

    Two doses of measles-mumps-rubella (MMR) strategy has been recommended by World Health Organization and is also widely adopted in many countries. In order to provide the evidence for perfecting the immunization strategy of MMR, this study evaluated the safety and immunogenicity of MMR with different two-dose schedule in infants. 280 participants were enrolled and randomly allocated to Group 1 (first dose at 8 months) or Group 2 (first dose at 12 months), and both groups administered the second dose at 10 months later. Solicited local and general symptoms after each vaccination with MMR were mild and infrequent in all participants of two groups. After administration of the first dose of MMR, seropositive rates were 100% in both groups for measles, 89.3% in Group 1 and 87.1% in Group 2 for mumps (P=0.578), 92.0% in Group 1 and 92.9% in Group 2 (P=0.393). The seropositive rates of mumps decreased significantly (from >86% to <65%) both in two groups (P<0.001) 10 months after the first dose of MMR, but no significant change was found in measles and rubella. All children get the positive titer for three vaccines in two groups after given the second dose MMR, higher seroconversion rate was found for mumps both in two groups (71.7% vs 77.2%, P=0.370). In conclusion, this study indicated that the MMR was well tolerated and immunogenic against measles, mumps and rubella with schedule of first dose both at 8 months and 12 months age. Our findings strongly supported that two doses of MMR can be introduced by replacing the first dose of MR in current EPI with MMR at 8 months age and the second dose at 18 months in China.

  16. Measles, mumps, rubella and VZV: importance of serological testing of vaccine-preventable diseases in young adults living with HIV in Germany.

    PubMed

    Schwarze-Zander, C; Draenert, R; Lehmann, C; Stecher, M; Boesecke, C; Sammet, S; Wasmuth, J C; Seybold, U; Gillor, D; Wieland, U; Kümmerle, T; Strassburg, C P; Mankertz, A; Eis-Hübinger, A M; Jäger, G; Fätkenheuer, G; Bogner, J R; Rockstroh, J K; Vehreschild, J J

    2017-01-01

    Measles, mumps, rubella (MMR) and varicella zoster virus (VZV) infection can cause serious diseases and complications in the HIV-positive population. Due to successful vaccination programmes measles, mumps and congenital rubella syndrome has become neglected in Germany. However, recent outbreaks of measles have occurred from import-associated cases. In this cross-sectional study the serostatus for MMR and VZV in 2013 HIV-positive adults from three different university outpatient clinics in Bonn (n = 544), Cologne (n = 995) and Munich (n = 474) was analysed. Sera were tested for MMR- and VZV-specific immunglobulin G antibodies using commercial immunoassays. Seronegativity was found in 3% for measles, 26% for mumps, 11% for rubella and 2% for VZV. Regarding MMR, 35% of patients lacked seropositivity against at least one infectious agent. In multivariable analysis younger age was strongly associated with seronegativity against all four viruses, measles, mumps, rubella (P < 0·001, P < 0·001 and P = 0·001, respectively) and VZV (P = 0·001). In conclusion, there is high need for MMR and VZV vaccination in people living with HIV in Germany born in 1970 or later. Thus, systematic MMR and VZV antibody screening and vaccination should be implemented in the HIV-positive population to prevent serious disease and complications of vaccine-preventable diseases.

  17. Two-year antibody persistence in children vaccinated at 12-15 months with a measles-mumps-rubella virus vaccine without human serum albumin.

    PubMed

    Berry, Andrea A; Abu-Elyazeed, Remon; Diaz-Perez, Clemente; Mufson, Maurice A; Harrison, Christopher J; Leonardi, Michael; Twiggs, Jerry D; Peltier, Christopher; Grogg, Stanley; Carbayo, Antonio; Shapiro, Steven; Povey, Michael; Baccarini, Carmen; Innis, Bruce L; Henry, Ouzama

    2017-07-03

    One combined measles-mumps-rubella (MMR) vaccine without Human Serum Albumin (HSA) is currently licensed in the USA (M-M-R II; Merck, USA) and another has been developed (Priorix™ [MMR-RIT, GSK, Belgium]). In this follow-up study, children from USA or Puerto Rico, who had received one dose of M-M-R II or MMR-RIT at 12-15 months of age in the primary study (NCT00861744), were followed-up for 2 y post-vaccination. Anti-measles and anti-rubella antibodies were measured using Enzyme-Linked Immunosorbent Assay (ELISA), and anti-mumps antibodies using ELISA and plaque reduction neutralization (PRN) assays. Serious adverse events (SAEs) were recorded during the entire follow-up. The according-to-protocol (ATP) persistence cohort included 752 children (M-M-R II = 186, MMR-RIT = 566), who received primary vaccination at a mean age of 12.3 ( ± 0.67) months. 104 children were revaccinated with MMR-containing vaccines; therefore, serology results for timepoints after revaccination were excluded from the analysis. Seropositivity for measles (Year 1≥ 98.3%; Year 2≥ 99.4%) and rubella (Year 1≥ 98.9%; Year 2 = 100%) remained as high at Year 2 as at Day 42. Similarly, seropositivity for mumps determined by ELISA (Year 1≥ 90.1%; Year 2≥ 94.1%) and PRN assays (Year 1≥ 87.5%; Year 2≥ 91.7%) persisted. Thirty-three SAEs were recorded in 23 children; 2 SAEs (inguinal adenitis and idiopathic thrombocytopenic purpura) and one SAE (febrile convulsion) were considered as potentially related to MMR-RIT and M-M-R II, respectively. This study showed that antibodies against measles, mumps and rubella persisted for up to 2 y post-vaccination with either MMR vaccine in children aged 12-15 months, and that both vaccines were well-tolerated during the follow-up period.

  18. Two-year antibody persistence in children vaccinated at 12–15 months with a measles-mumps-rubella virus vaccine without human serum albumin

    PubMed Central

    Berry, Andrea A.; Abu-Elyazeed, Remon; Diaz-Perez, Clemente; Mufson, Maurice A.; Harrison, Christopher J.; Leonardi, Michael; Twiggs, Jerry D.; Peltier, Christopher; Grogg, Stanley; Carbayo, Antonio; Shapiro, Steven; Povey, Michael; Baccarini, Carmen; Innis, Bruce L.; Henry, Ouzama

    2017-01-01

    ABSTRACT One combined measles-mumps-rubella (MMR) vaccine without Human Serum Albumin (HSA) is currently licensed in the USA (M-M-R II; Merck, USA) and another has been developed (Priorix™ [MMR-RIT, GSK, Belgium]). In this follow-up study, children from USA or Puerto Rico, who had received one dose of M-M-R II or MMR-RIT at 12–15 months of age in the primary study (NCT00861744), were followed-up for 2 y post-vaccination. Anti-measles and anti-rubella antibodies were measured using Enzyme-Linked Immunosorbent Assay (ELISA), and anti-mumps antibodies using ELISA and plaque reduction neutralization (PRN) assays. Serious adverse events (SAEs) were recorded during the entire follow-up. The according-to-protocol (ATP) persistence cohort included 752 children (M-M-R II = 186, MMR-RIT = 566), who received primary vaccination at a mean age of 12.3 ( ± 0.67) months. 104 children were revaccinated with MMR-containing vaccines; therefore, serology results for timepoints after revaccination were excluded from the analysis. Seropositivity for measles (Year 1≥ 98.3%; Year 2≥ 99.4%) and rubella (Year 1≥ 98.9%; Year 2 = 100%) remained as high at Year 2 as at Day 42. Similarly, seropositivity for mumps determined by ELISA (Year 1≥ 90.1%; Year 2≥ 94.1%) and PRN assays (Year 1≥ 87.5%; Year 2≥ 91.7%) persisted. Thirty-three SAEs were recorded in 23 children; 2 SAEs (inguinal adenitis and idiopathic thrombocytopenic purpura) and one SAE (febrile convulsion) were considered as potentially related to MMR-RIT and M-M-R II, respectively. This study showed that antibodies against measles, mumps and rubella persisted for up to 2 y post-vaccination with either MMR vaccine in children aged 12–15 months, and that both vaccines were well-tolerated during the follow-up period. PMID:28481690

  19. Live attenuated measles vaccine expressing HIV-1 Gag virus like particles covered with gp160DELTAV1V2 is strongly immunogenic

    SciTech Connect

    Guerbois, Mathilde; Moris, Arnaud; Combredet, Chantal; Najburg, Valerie; Ruffie, Claude; Fevrier, Michele; Cayet, Nadege; Brandler, Samantha; Schwartz, Olivier; Tangy, Frederic

    2009-05-25

    Although a live attenuated HIV vaccine is not currently considered for safety reasons, a strategy inducing both T cells and neutralizing antibodies to native assembled HIV-1 particles expressed by a replicating virus might mimic the advantageous characteristics of live attenuated vaccine. To this aim, we generated a live attenuated recombinant measles vaccine expressing HIV-1 Gag virus-like particles (VLPs) covered with gp160DELTAV1V2 Env protein. The measles-HIV virus replicated efficiently in cell culture and induced the intense budding of HIV particles covered with Env. In mice sensitive to MV infection, this recombinant vaccine stimulated high levels of cellular and humoral immunity to both MV and HIV with neutralizing activity. The measles-HIV virus infected human professional antigen-presenting cells, such as dendritic cells and B cells, and induced efficient presentation of HIV-1 epitopes and subsequent activation of human HIV-1 Gag-specific T cell clones. This candidate vaccine will be next tested in non-human primates. As a pediatric vaccine, it might protect children and adolescents simultaneously from measles and HIV.

  20. Enhancing global vaccine pharmacovigilance: Proof-of-concept study on aseptic meningitis and immune thrombocytopenic purpura following measles-mumps containing vaccination.

    PubMed

    Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N; Romio, Silvana A; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L F

    2017-05-27

    New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders'Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the

  1. An economic analysis of the current universal 2-dose measles-mumps-rubella vaccination program in the United States.

    PubMed

    Zhou, Fangjun; Reef, Susan; Massoudi, Mehran; Papania, Mark J; Yusuf, Hussain R; Bardenheier, Barbara; Zimmerman, Laura; McCauley, Mary M

    2004-05-01

    To evaluate the economic impact of the current 2-dose measles-mumps-rubella (MMR) vaccination program in the United States, a decision tree-based analysis was conducted with population-based vaccination coverage and disease incidence data. All costs were estimated for a hypothetical US birth cohort of 3803295 infants born in 2001. The 2-dose MMR vaccination program was cost-saving from both the direct cost and societal perspectives compared with the absence of MMR vaccination, with net savings (net present value) from the direct cost and societal perspectives of US dollars 3.5 billion and US dollars 7.6 billion, respectively. The direct and societal benefit-cost ratios for the MMR vaccination program were 14.2 and 26.0. Analysis of the incremental benefit-cost of the second dose showed that direct and societal benefit-cost ratios were 0.31 and 0.49, respectively. Varying the proportion of vaccines purchased and administered in the public versus the private sector had little effect on the results. From both perspectives under even the most conservative assumptions, the national 2-dose MMR vaccination program is highly cost-beneficial and results in substantial cost savings.

  2. Association of BCG, DTP, and measles containing vaccines with childhood mortality: systematic review

    PubMed Central

    Soares-Weiser, Karla; López-López, José A; Kakourou, Artemisia; Chaplin, Katherine; Christensen, Hannah; Martin, Natasha K; Sterne, Jonathan A C; Reingold, Arthur L

    2016-01-01

    Objectives To evaluate the effects on non-specific and all cause mortality, in children under 5, of Bacillus Calmette-Guérin (BCG), diphtheria-tetanus-pertussis (DTP), and standard titre measles containing vaccines (MCV); to examine internal validity of the studies; and to examine any modifying effects of sex, age, vaccine sequence, and co-administration of vitamin A. Design Systematic review, including assessment of risk of bias, and meta-analyses of similar studies. Study eligibility criteria Clinical trials, cohort studies, and case-control studies of the effects on mortality of BCG, whole cell DTP, and standard titre MCV in children under 5. Data sources Searches of Medline, Embase, Global Index Medicus, and the WHO International Clinical Trials Registry Platform, supplemented by contact with experts in the field. To avoid overlap in children studied across the included articles, findings from non-overlapping birth cohorts were identified. Results Results from 34 birth cohorts were identified. Most evidence was from observational studies, with some from short term clinical trials. Most studies reported on all cause (rather than non-specific) mortality. Receipt of BCG vaccine was associated with a reduction in all cause mortality: the average relative risks were 0.70 (95% confidence interval 0.49 to 1.01) from five clinical trials and 0.47 (0.32 to 0.69) from nine observational studies at high risk of bias. Receipt of DTP (almost always with oral polio vaccine) was associated with a possible increase in all cause mortality on average (relative risk 1.38, 0.92 to 2.08) from 10 studies at high risk of bias; this effect seemed stronger in girls than in boys. Receipt of standard titre MCV was associated with a reduction in all cause mortality (relative risks 0.74 (0.51 to 1.07) from four clinical trials and 0.51 (0.42 to 0.63) from 18 observational studies at high risk of bias); this effect seemed stronger in girls than in boys. Seven observational studies

  3. Timeliness and completeness of measles vaccination among children in rural areas of Guangxi, China: A stratified three-stage cluster survey.

    PubMed

    Tang, Xianyan; Geater, Alan; McNeil, Edward; Zhou, Hongxia; Deng, Qiuyun; Dong, Aihu

    2017-07-01

    Large-scale outbreaks of measles occurred in 2013 and 2014 in rural Guangxi, a region in Southwest China with high coverage for measles-containing vaccine (MCV). This study aimed to estimate the timely vaccination coverage, the timely-and-complete vaccination coverage, and the median delay period for MCV among children aged 18-54 months in rural Guangxi. Based on quartiles of measles incidence during 2011-2013, a stratified three-stage cluster survey was conducted from June through August 2015. Using weighted estimation and finite population correction, vaccination coverage and 95% confidence intervals (CIs) were calculated. Weighted Kaplan-Meier analyses were used to estimate the median delay periods for the first (MCV1) and second (MCV2) doses of the vaccine. A total of 1216 children were surveyed. The timely vaccination coverage rate was 58.4% (95% CI, 54.9%-62.0%) for MCV1, and 76.9% (95% CI, 73.6%-80.0%) for MCV2. The timely-and-complete vaccination coverage rate was 47.4% (95% CI, 44.0%-51.0%). The median delay period was 32 (95% CI, 27-38) days for MCV1, and 159 (95% CI, 118-195) days for MCV2. The timeliness and completeness of measles vaccination was low, and the median delay period was long among children in rural Guangxi. Incorporating the timeliness and completeness into official routine vaccination coverage statistics may help appraise the coverage of vaccination in China. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  4. Observational study on immune response to yellow fever and measles vaccines in 9 to 15-month old children. Is it necessary to wait 4 weeks between two live attenuated vaccines?

    PubMed

    Michel, R; Berger, F; Ravelonarivo, J; Dussart, P; Dia, M; Nacher, M; Rogier, S; Moua, D; Sarr, F D; Diop, O M; Sall, A A; Baril, L

    2015-05-11

    The use of 2 live attenuated vaccines (LAV) is recommended to be simultaneous or after an interval of at least four weeks between injections. The primary objective of this study was to compare the humoral response to yellow fever (YF) and measles vaccines among children vaccinated against these two diseases, either simultaneously or separated by an interval of 7-28 days. A prospective, multicenter observational study was conducted among children aged 9-15 months. The primary endpoint was the occurrence of positive yellow fever antibodies after YF vaccine by estimating the titers of neutralizing antibodies from venous blood samples. Children vaccinated against YF 7-28 days after receiving the vaccine against measles (test group) were compared with children vaccinated the same day against these two diseases (referent group). Analysis was performed on 284 children. Of them, fifty-four belonged to the test group. Measles serology was positive in 91.7% of children. Neutralizing antibodies against YF were detected in 90.7% of the test group and 92.9 of the referent group (p=0.6). In addition, quantitative analysis of the immune response did not show a lower response to YF vaccination when it took place 1-28 days after measles vaccination. In 1965, Petralli showed a lower response to the smallpox vaccine when injected 4-20 days after measles vaccination. Since then, recommendations are to observe an interval of four weeks between LAV not injected on the same day. Other published studies failed to show a significant difference in the immune response to a LAV injected 1-28 days after another LAV. These results suggest that the usual recommendations for immunization with two LAV may not be correct. In low income countries, the current policy should be re-evaluated. This re-evaluation should also be applied to travelers to yellow fever endemic countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Seroepidemiology and phylogenetic characterisation of measles virus in Ireland, 2004-2013.

    PubMed

    O' Riordan, Bernadette; Carr, Michael J; Connell, Jeff; Dunford, Linda; Hall, William W; Hassan, Jaythoon

    2014-08-01

    Ireland is classified as an area of high measles incidence. A World Health Organisation-European Region strategic plan exists for measles elimination by 2015. To retrospectively investigate measles outbreaks using all patient samples (sera and oral fluid) received for measles laboratory diagnosis and characterise the genetic diversity of circulating measles genotypes in Ireland. 704 cases of acute measles infection as determined by the presence of measles specific IgM in sera and oral fluids were confirmed at the National Virus Reference Laboratory. Measles positive samples (n=116) were examined by genotyping, sequence analysis and phylogenetic characterisation. Three measles outbreaks occurred over the study period: 2004, 2009/2010 and 2011. Measles IgM positivity ranged from 22-29% in outbreak years to 5-10% in the intervening years. Age profile analysis revealed that whereas individuals >10 years accounted for only 8% of cases in the 2004 outbreak, this increased to 33% and 29% in the 2009/2010 and 2011 outbreaks, respectively. The <1 year cohort accounted for 18-20% of cases in all outbreaks. Phylogenetic analysis demonstrated both indigenous transmission and also importation events. Clade D viruses were exclusively found circulating in Ireland, with autochthonous transmission of diverse genotype D4 strains associated with large outbreaks across Europe. More recently, genotype D8 was identified and these were associated with importation events. This study provides a comprehensive genetic analysis of circulating measles genotypes in Ireland and discriminated between indigenous and imported viral strains. Notably, an increase in laboratory-confirmed measles cases in the greater than 10 years of age group was seen over the study period. This information is valuable to inform vaccination strategies with a focus on those populations who remain susceptible to measles infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Distributing insecticide-treated bednets during measles vaccination: a low-cost means of achieving high and equitable coverage.

    PubMed Central

    Grabowsky, Mark; Nobiya, Theresa; Ahun, Mercy; Donna, Rose; Lengor, Miata; Zimmerman, Drake; Ladd, Holly; Hoekstra, Edward; Bello, Aliu; Baffoe-Wilmot, Aba; Amofah, George

    2005-01-01

    OBJECTIVE: To achieve high and equitable coverage of insecticide-treated bednets by integrating their distribution into a measles vaccination campaign. METHODS: In December 2002 in the Lawra district in Ghana, a measles vaccination campaign lasting 1 week targeted all children aged 9 months-15 years. Families with one or more children less than five years old were targeted to receive a free insecticide-treated bednet. The Ghana Health Service, with support from the Ghana Red Cross and UNICEF, provided logistical support, volunteer workers and social mobilization during the campaign. Volunteers visited homes to inform caregivers about the campaign and encourage them to participate. We assessed pre-campaign coverage of bednets by interviewing caregivers leaving vaccination and distribution sites. Five months after distribution, a two-stage cluster survey using population-proportional sampling assessed bednet coverage, retention and use. Both the pre-campaign and post-campaign survey assessed household wealth using an asset inventory. FINDINGS: At the campaign exit interview 636/776 (82.0%) caregivers reported that they had received a home visit by a Red Cross volunteer before the campaign and that 32/776 (4.1%) of the youngest children in each household who were less than 5 years of age slept under an insecticide-treated bednet. Five months after distribution caregivers reported that 204/219 (93.2%) of children aged 9 months to 5 years had been vaccinated during the campaign; 234/248 (94.4%) of households were observed to have an insecticide-treated bednet; and 170/249 (68.3%) were observed to have a net hung over a bed. Altogether 222/248 (89.5%) caregivers reported receiving at least one insecticide-treated bednet during the campaign, and 153/254 (60.2%) said that on the previous night their youngest child had slept under a bednet received during the campaign. For households in the poorest quintile, post-campaign coverage of insecticide-treated bednets was 10 times

  7. The effectiveness of measles-mumps-rubella (MMR) vaccination in the prevention of pediatric hospitalizations for targeted and untargeted infections: A retrospective cohort study.

    PubMed

    La Torre, Giuseppe; Saulle, Rosella; Unim, Brigid; Meggiolaro, Angela; Barbato, Angelo; Mannocci, Alice; Spadea, Antonietta

    2017-08-03

    To evaluate the effectiveness of the measles-mumps-rubella (MMR) vaccine in reducing hospitalizations for infectious disease, targeted and not targeted, as well as from respiratory diseases in children in Rome. The cohort was recomposed through record linkage of 2 archives (vaccination register and hospital discharge records. The analysis included 11,004 children. 20.9% did not receive the MMR vaccination, 49% and 30.1% received one and 2 doses. There were no hospitalizations for rubella, 2 for mumps, and 12 for measles. The vaccine was highly protective against measles and mumps hospitalizations (HR = 0.10; 95% CI: 0.03.0.34). Regarding all infectious diseases there were 414 hospitalizations, and the vaccine was protective (HR = 0.29; 95% CI: 0.25 to 0.34). Concerning respiratory diseases, there were 809 admissions (7.4%), and the vaccine was highly protective (HR: 0.18; 95% CI: 0.07 to 0.48). MMR vaccination is effective for the primary prevention of target and not targeted infectious diseases and may also limit hospitalizations for respiratory diseases.

  8. A case study of a graphical misrepresentation: drawing the wrong conclusions about the measles, mumps and rubella virus vaccine.

    PubMed

    Cox, Anthony R; Kirkham, Harold

    2007-01-01

    Graphs have been used in attempts to show a relationship between the measles, mumps and rubella virus (MMR) vaccine and autism. We examine the topic of graphical representation of data in general, and one of these graphs in particular: the one that appeared in a 1999 letter to The Lancet. That graph combined data from England and from California, USA. The author alleged that this graph illustrated a rise in autism rates linked to the use of the MMR vaccine. By examining the presentation closely, we are able to show how this graph misrepresented the data used. We give advice for both authors and publishers in the use of such graphical treatments of data.

  9. Measles Case Fatality Rate in Bihar, India, 2011–12

    PubMed Central

    Murhekar, Manoj V.; Ahmad, Mohammad; Shukla, Hemant; Abhishek, Kunwar; Perry, Robert T.; Bose, Anindya S.; Shimpi, Rahul; Kumar, Arun; Kaliaperumal, Kanagasabai; Sethi, Raman; Selvaraj, Vadivoo; Kamaraj, Pattabi; Routray, Satyabrata; Das, Vidya Nand; Menabde, Nata; Bahl, Sunil

    2014-01-01

    Background Updated estimates of measles case fatality rates (CFR) are critical for monitoring progress towards measles elimination goals. India accounted for 36% of total measles deaths occurred globally in 2011. We conducted a retrospective cohort study to estimate measles CFR and identify the risk factors for measles death in Bihar–one of the north Indian states historically known for its low vaccination coverage. Methods We systematically selected 16 of the 31 laboratory-confirmed measles outbreaks occurring in Bihar during 1 October 2011 to 30 April 2012. All households of the villages/urban localities affected by these outbreaks were visited to identify measles cases and deaths. We calculated CFR and used multivariate analysis to identify risk factors for measles death. Results The survey found 3670 measles cases and 28 deaths (CFR: 0.78, 95% confidence interval: 0.47–1.30). CFR was higher among under-five children (1.22%) and children belonging to scheduled castes/tribes (SC/ST, 1.72%). On multivariate analysis, independent risk factors associated with measles death were age <5 years, SC/ST status and non-administration of vitamin A during illness. Outbreaks with longer interval between the occurrence of first case and notification of the outbreak also had a higher rate of deaths. Conclusions Measles CFR in Bihar was low. To further reduce case fatality, health authorities need to ensure that SC/ST are targeted by the immunization programme and that outbreak investigations target for vitamin A treatment of cases in high risk groups such as SC/ST and young children and ensure regular visits by health-workers in affected villages to administer vitamin A to new cases. PMID:24824641

  10. Measles case fatality rate in Bihar, India, 2011-12.

    PubMed

    Murhekar, Manoj V; Ahmad, Mohammad; Shukla, Hemant; Abhishek, Kunwar; Perry, Robert T; Bose, Anindya S; Shimpi, Rahul; Kumar, Arun; Kaliaperumal, Kanagasabai; Sethi, Raman; Selvaraj, Vadivoo; Kamaraj, Pattabi; Routray, Satyabrata; Das, Vidya Nand; Menabde, Nata; Bahl, Sunil

    2014-01-01

    Updated estimates of measles case fatality rates (CFR) are critical for monitoring progress towards measles elimination goals. India accounted for 36% of total measles deaths occurred globally in 2011. We conducted a retrospective cohort study to estimate measles CFR and identify the risk factors for measles death in Bihar-one of the north Indian states historically known for its low vaccination coverage. We systematically selected 16 of the 31 laboratory-confirmed measles outbreaks occurring in Bihar during 1 October 2011 to 30 April 2012. All households of the villages/urban localities affected by these outbreaks were visited to identify measles cases and deaths. We calculated CFR and used multivariate analysis to identify risk factors for measles death. The survey found 3670 measles cases and 28 deaths (CFR: 0.78, 95% confidence interval: 0.47-1.30). CFR was higher among under-five children (1.22%) and children belonging to scheduled castes/tribes (SC/ST, 1.72%). On multivariate analysis, independent risk factors associated with measles death were age <5 years, SC/ST status and non-administration of vitamin A during illness. Outbreaks with longer interval between the occurrence of first case and notification of the outbreak also had a higher rate of deaths. Measles CFR in Bihar was low. To further reduce case fatality, health authorities need to ensure that SC/ST are targeted by the immunization programme and that outbreak investigations target for vitamin A treatment of cases in high risk groups such as SC/ST and young children and ensure regular visits by health-workers in affected villages to administer vitamin A to new cases.

  11. Measles - The epidemiology of elimination.

    PubMed

    Durrheim, David N; Crowcroft, Natasha S; Strebel, Peter M

    2014-12-05

    Tremendous progress has been made globally to reduce the contribution of measles to the burden of childhood deaths and measles cases have dramatically decreased with increased two dose measles-containing vaccine coverage. As a result the Global Vaccine Action Plan, endorsed by the World Health Assembly, has targeted measles elimination in at least five of the six World Health Organisation Regions by 2020. This is an ambitious goal, since measles control requires the highest immunisation coverage of any vaccine preventable disease, which means that the health system must be able to reach every community. Further, while measles remains endemic in any country, importations will result in local transmission and outbreaks in countries and Regions that have interrupted local endemic measles circulation. One of the lines of evidence that countries and Regions must address to confirm measles elimination is a detailed description of measles epidemiology over an extended period. This information is incredibly valuable as predictable epidemiological patterns emerge as measles elimination is approached and achieved. These critical features, including the source, size and duration of outbreaks, the seasonality and age-distribution of cases, genotyping pointers and effective reproduction rate estimates, are discussed with illustrative examples from the Region of the Americas, which eliminated measles in 2002, and the Western Pacific Region, which has established a Regional Verification Commission to review progress towards elimination in all member countries.

  12. [Progress towards the 2012 measles elimination goal in Japan].

    PubMed

    Tanaka-Taya, Keiko

    2010-06-01

    The WHO Western Pacific Regional Office including Japan sets 2012 as the target year of the measles elimination. Japan notified "National Measles Elimination Plan in December 2007" aiming at being eliminate measles from the country by 2012. In 2009, total 741 cases (5.80 per 1,000,000 population) were reported (as of January 7, 2010). It was a remarkable decrease compared with 11,015 cases in 2008. However, the vaccination rate as of the end of 2008 fiscal year (the end of March) doesn't reach 95%. The first vaccination rate was 94%, and the second vaccinations for age groups of 5-6 years, 12-13 years and 17-18 years were 92%, 85%, and 77%, respectively. To prevent the spread of measles and eliminate in Japan, the whole nation recognizes that measles is a serious illness related to the life, and the department of the public health, the education, the medical units, and the research laboratories make an effort aiming at the goal for measles elimination is necessary.

  13. Dose-Dependent Protection against or Exacerbation of Disease by a Polylactide Glycolide Microparticle-Adsorbed, Alphavirus-Based Measles Virus DNA Vaccine in Rhesus Macaques▿

    PubMed Central

    Pan, Chien-Hsiung; Nair, Nitya; Adams, Robert J.; Zink, M. Christine; Lee, Eun-Young; Polack, Fernando P.; Singh, Manmohan; O'Hagan, Derek T.; Griffin, Diane E.

    2008-01-01

    Measles remains an important cause of vaccine-preventable child mortality. Development of a low-cost, heat-stable vaccine for infants under the age of 6 months could improve measles control by facilitating delivery at the time of other vaccines and by closing a window of susceptibility prior to immunization at 9 months of age. DNA vaccines hold promise for development, but achieving protective levels of antibody has been difficult and there is an incomplete understanding of protective immunity. In the current study, we evaluated the use of a layered alphavirus DNA/RNA vector encoding measles virus H (SINCP-H) adsorbed onto polylactide glycolide (PLG) microparticles. In mice, antibody and T-cell responses to PLG-formulated DNA were substantially improved compared to those to naked DNA. Rhesus macaques received two doses of PLG/SINCP-H delivered either intramuscularly (0.5 mg) or intradermally (0.5 or 0.1 mg). Antibody and T-cell responses were induced but not sustained. On challenge, the intramuscularly vaccinated monkeys did not develop rashes and had lower viremias than vector-treated control monkeys. Monkeys vaccinated with the same dose intradermally developed rashes and viremia. Monkeys vaccinated intradermally with the low dose developed more severe rashes, with histopathologic evidence of syncytia and intense dermal and epidermal inflammation, eosinophilia, and higher viremia compared to vector-treated control monkeys. Protection after challenge correlated with gamma interferon-producing T cells and with early production of high-avidity antibody that bound wild-type H protein. We conclude that PLG/SINCP-H is most efficacious when delivered intramuscularly but does not provide an advantage over standard DNA vaccines for protection against measles. PMID:18287579

  14. The Inverse Method for a Childhood Infectious Disease Model with Its Application to Pre-vaccination and Post-vaccination Measles Data.

    PubMed

    Kong, Jude D; Jin, Chaochao; Wang, Hao

    2015-12-01

    In this paper, we improve the classic SEIR model by separating the juvenile group and the adult group to better describe the dynamics of childhood infectious diseases. We perform stability analysis to study the asymptotic dynamics of the new model, and perform sensitivity analysis to uncover the relative importance of the parameters on infection. The transmission rate is a key parameter in controlling the spread of an infectious disease as it directly determines the disease incidence. However, it is essentially impossible to measure the transmission rate for certain infectious diseases. We introduce an inverse method for our new model, which can extract the time-dependent transmission rate from either prevalence data or incidence data in existing open databases. Pre- and post-vaccination measles data sets from Liverpool and London are applied to estimate the time-varying transmission rate. From the Fourier transform of the transmission rate of Liverpool and London, we observe two spectral peaks with frequencies 1/year and 3/year. These dominant frequencies are robust with respect to different initial values. The dominant 1/year frequency is consistent with common belief that measles is driven by seasonal factors such as environmental changes and immune system changes and the 3/year frequency indicates the superiority of school contacts in driving measles transmission over other seasonal factors. Our results show that in coastal cities, the main modulator of the transmission of measles virus, paramyxovirus, is school seasons. On the other hand, in landlocked cities, both weather and school seasons have almost the same influence on paramyxovirus transmission.

  15. Assessment of the Epidemiology and Burden of Measles in Southern Mozambique

    PubMed Central

    Mandomando, Inácio; Naniche, Denise; Pasetti, Marcela F.; Cuberos, Lilian; Sanz, Sergi; Vallès, Xavier; Sigauque, Betuel; Macete, Eusébio; Nhalungo, Delino; Kotloff, Karen L.; Levine, Myron M.; Alonso, Pedro L.

    2011-01-01

    Measles has been a major killer among vaccine-preventable diseases in children < 5 years of age in developing countries. Despite progress in global efforts to reduce mortality, measles remains a public health problem. Hospital-based measles surveillance was conducted in Manhica, Mozambique (July 2001–September 2004). Suspected cases and community-based controls were enrolled, and blood was collected for immunoglobulin M (IgM) confirmation. Two hundred fifty-three suspected cases and 477 controls were enrolled, with 85% (216 of 253) cases reported during a measles outbreak. Measles-IgM confirmation was 30% among suspected cases and 5% in controls. Fifty-eight percent (14 of 24) of laboratory-confirmed cases had records indicating previous measles vaccination. Mortality was 3% (8 of 246) among cases and 1% among controls (6 of 426). Forty-five percent (33 of 74) of cases were < 24 months of age and 22% occurred in infants < 9 months of age and were associated with a high case-fatality rate (25%). Our data suggest that improved diagnostics, new tools to protect infants < 9 months of age, and a supplemental dose of measles vaccine could assist measles control. PMID:21734140

  16. Progress Toward Measles Elimination - Bangladesh, 2000-2016.

    PubMed

    Khanal, Sudhir; Bohara, Rajendra; Chacko, Stephen; Sharifuzzaman, Mohammad; Shamsuzzaman, Mohammad; Goodson, James L; Dabbagh, Alya; Kretsinger, Katrina; Dhongde, Deepak; Liyanage, Jayantha; Bahl, Sunil; Thapa, Arun

    2017-07-21

    In 2013, at the 66th session of the Regional Committee of the World Health Organization (WHO) South-East Asia Region (SEAR), a regional goal was established to eliminate measles and control rubella and congenital rubella syndrome* by 2020 (1). WHO-recommended measles elimination strategies in SEAR countries include 1) achieving and maintaining ≥95% coverage with 2 doses of measles-containing vaccine (MCV) in every district, delivered through the routine immunization program or through supplementary immunization activities (SIAs)(†); 2) developing and sustaining a sensitive and timely measles case-based surveillance system that meets targets for recommended performance indicators; and 3) developing and maintaining an accredited measles laboratory network (2). In 2014, Bangladesh, one of 11 countries in SEAR, adopted a national goal for measles elimination by 2018 (2,3). This report describes progress and challenges toward measles elimination in Bangladesh during 2000-2016. Estimated coverage with the first MCV dose (MCV1) increased from 74% in 2000 to 94% in 2016. The second MCV dose (MCV2) was introduced in 2012, and MCV2 coverage increased from 35% in 2013 to 93% in 2016. During 2000-2016, approximately 108.9 million children received MCV during three nationwide SIAs conducted in phases. During 2000-2016, reported confirmed measles incidence decreased 82%, from 34.2 to 6.1 per million population. However, in 2016, 56% of districts did not meet the surveillance performance target of ≥2 discarded nonmeasles, nonrubella cases(§) per 100,000 population. Additional measures that include increasing MCV1 and MCV2 coverage to ≥95% in all districts with additional strategies for hard-to-reach populations, increasing sensitivity of measles case-based surveillance, and ensuring timely transport of specimens to the national laboratory will help achieve measles elimination.

  17. Critical prevalence of antibodies minimizing vaccination costs for hepatitis A, hepatitis B, varicella, measles and tetanus in adults and adolescents in Catalonia, Spain.

    PubMed

    Plans-Rubió, Pedro

    2004-09-28

    The prevalence of seropositive individuals that makes costs of vaccinating all individuals equal to that for screening and vaccination of susceptible individuals is defined as the critical prevalence of antibodies (p*). Screening and vaccination is more efficient when the prevalence of seropositive individuals (p) in the population is higher than p*. In this study, the formula to obtain p* was derived from the cost-effectiveness equations, showing that it depends on screening and vaccination costs, programme compliance, screening test performance, vaccine efficacy and disease costs. The formula was used to determine the least costly vaccination strategy for hepatitis A and B, varicella, measles and tetanus in adults and adolescents in Catalonia. The least costly vaccination strategy was vaccination without screening (since p was lower than p*) for hepatitis B, measles and tetanus in adults and adolescents (5-14 years) and for hepatitis A in individuals aged 5-24 years, and screening and vaccination (since p was higher than p*) for varicella in adults and adolescents and for hepatitis A in adults aged >24 years. Vaccination strategies based on the critical prevalence of antibodies could maximize the immunity level in the community from available resources.

  18. Safety and immunogenicity of inactivated poliovirus vaccine when given with measles-rubella combined vaccine and yellow fever vaccine and when given via different administration routes: a phase 4, randomised, non-inferiority trial in The Gambia.

    PubMed

    Clarke, Ed; Saidu, Yauba; Adetifa, Jane U; Adigweme, Ikechukwu; Hydara, Mariama Badjie; Bashorun, Adedapo O; Moneke-Anyanwoke, Ngozi; Umesi, Ama; Roberts, Elishia; Cham, Pa Modou; Okoye, Michael E; Brown, Kevin E; Niedrig, Matthias; Chowdhury, Panchali Roy; Clemens, Ralf; Bandyopadhyay, Ananda S; Mueller, Jenny; Jeffries, David J; Kampmann, Beate

    2016-08-01

    The introduction of the inactivated poliovirus vaccine (IPV) represents a crucial step in the polio eradication endgame. This trial examined the safety and immunogenicity of IPV given alongside the measles-rubella and yellow fever vaccines at 9 months and when given as a full or fractional dose using needle and syringe or disposable-syringe jet injector. We did a phase 4, randomised, non-inferiority trial at three periurban government clinics in west Gambia. Infants aged 9-10 months who had already received oral poliovirus vaccine were randomly assigned to receive the IPV, measles-rubella, and yellow fever vaccines, singularly or in combination. Separately, IPV was given as a full intramuscular or fractional intradermal dose by needle and syringe or disposable-syringe jet injector at a second visit. The primary outcomes were seroprevalence rates for poliovirus 4-6 weeks post-vaccination and the rate of seroconversion between baseline and post-vaccination serum samples for measles, rubella, and yellow fever; and the post-vaccination antibody titres generated against each component of the vaccines. We did a per-protocol analysis with a non-inferiority margin of 10% for poliovirus seroprevalence and measles, rubella, and yellow fever seroconversion, and (1/3) log2 for log2-transformed antibody titres. This trial is registered with ClinicalTrials.gov, number NCT01847872. Between July 10, 2013, and May 8, 2014, we assessed 1662 infants for eligibility, of whom 1504 were enrolled into one of seven groups for vaccine interference and one of four groups for fractional dosing and alternative route of administration. The rubella and yellow fever antibody titres were reduced by co-administration but the seroconversion rates achieved non-inferiority in both cases (rubella, -4·5% [95% CI -9·5 to -0·1]; yellow fever, 1·2% [-2·9 to 5·5]). Measles and poliovirus responses were unaffected (measles, 6·8% [95% CI -1·4 to 14·9]; poliovirus serotype 1, 1·6% [-6·7 to 4·7

  19. [Surveillance Plan on Recent Outbreak of Measles and Rubella in Catalonia, Spain].

    PubMed

    Jané, Mireia; Torner, Nuria; Vidal, Ma José

    2015-01-01

    Measles and rubella are two immuno-preventive illnesses. In Catalonia, since 1988 all children are given two doses of measles and rubella vaccine with high levels of vaccination coverage. The measles elimination programme has been carried out since 1990 in Catalonia. This programme includes achieving and keeping high immunization levels among population with high vaccination coverage, intense epidemiological surveillance and an immediate response to the appearance of a case or outbreak. In 2014, the measles incidence rate was 1.9 cases/ 100,000 inhabitants. There were 4 recent outbreaks in 2006, 2011, 2013 and 2014 that affected 381, 289, 31 and 124 people respectively. All outbreaks were triggered by an imported case. In 2011 and 2014 measles outbreaks, 6% and 5.5% of affected people were health care workers. All outbreaks presented a great variety of measles genotypes. Concerning rubella elimination programme, since 2002, 68 cases of postnatal rubella and 5 cases of congenital rubella were confirmed. Regarding measles and rubella surveillance and control, in addition to strengthen vaccination coverage, it is essential immediate notification, within the first 24 hours since suspicion and laboratory confirmation. In addition there is a need to enforce vaccination among health care workers as well as in other susceptible and unvaccinated people. It is recommended to vaccinate all people who were born after 1966 and who have not been vaccinated with two doses of trivalent measles-mumps-rubella vaccine. Furthermore, we have to emphasize that the progress concerning genotypes study allows identifying various imported cases from other European countries with active outbreaks, aspect that makes easier the surveillance of these illnesses.

  20. Addressing issues of vaccination literacy and psychological empowerment in the measles-mumps-rubella (MMR) vaccination decision-making: a qualitative study.

    PubMed

    Fadda, Marta; Depping, Miriam K; Schulz, Peter J

    2015-09-02

    Whether or not to vaccinate one's child is one of the first health-related decisions parents have to make after their child's birth. For the past 20 years, the share of parents choosing not to immunize their children has increased in many countries, for various reasons. Among these, rumors affirming that vaccinations contain dangerous chemicals or might trigger severe chronic diseases have negatively affected parental attitudes towards pediatric immunizations, particularly the vaccination against measles, mumps and rubella (MMR), raising a number of public health concerns. The primary aim of this qualitative study is to understand what drives parents' decision, giving special attention to vaccination literacy and psychological empowerment in such a context. Twenty individual semi-structured interviews were conducted in the Canton of Ticino (Switzerland) between January and June 2014. Participants were either mothers or fathers of children less than 1 year old living in Switzerland. An inductive thematic analysis was performed to identify the main themes with regard to vaccination literacy and psychological empowerment in the MMR vaccination decision-making. Parents' reports yielded four main themes: (a) the paradox of the free choice, referring to the misinterpretation of current vaccination policies; (b) giving up the power, pointing at the outcomes of a low perceived competence; (c) a far-reaching decision, reflecting the importance attributed to the MMR choice and the different levels of impact the decision can have; (d) the demand for shared-decision making, referring to the parental needs in relation to the child's healthcare provider. Understanding what drives parents' management of their children's immunization schedule in terms of vaccination literacy and psychological empowerment can help health professionals to communicate more effectively with parents in order to facilitate an informed decision, and stakeholders to design tailored health education

  1. Measles Virus Neutralizing Antibody Response, Cell-Mediated Immunity, and Immunoglobulin G Antibody Avidity Before and After Receipt of a Third Dose of Measles, Mumps, and Rubella Vaccine in Young Adults.

    PubMed

    Fiebelkorn, Amy Parker; Coleman, Laura A; Belongia, Edward A; Freeman, Sandra K; York, Daphne; Bi, Daoling; Kulkarni, Ashwin; Audet, Susette; Mercader, Sara; McGrew, Marcia; Hickman, Carole J; Bellini, William J; Shivakoti, Rupak; Griffin, Diane E; Beeler, Judith

    2016-04-01

    Two doses of measles, mumps, and rubella (MMR) vaccine are 97% effective against measles, but waning antibody immunity to measles and failure of the 2-dose vaccine occur. We administered a third MMR dose (MMR3) to young adults and assessed immunogenicity over 1 year. Measles virus (MeV) neutralizing antibody concentrations, cell-mediated immunity (CMI), and immunoglobulin G (IgG) antibody avidity were assessed at baseline and 1 month and 1 year after MMR3 receipt. Of 662 subjects at baseline, 1 (0.2%) was seronegative for MeV-neutralizing antibodies (level, <8 mIU/mL), and 23 (3.5%) had low antibody levels (8-120 mIU/mL). One month after MMR3 receipt, 1 subject (0.2%) was seronegative, and 6 (0.9%) had low neutralizing antibodies, with only 21 of 662 (3.2%) showing a ≥ 4-fold rise in neutralizing antibodies. One year after MMR3 receipt, no subject was seronegative, and 10 of 617 (1.6%) had low neutralizing antibody levels. CMI analyses showed low levels of spot-forming cells after stimulation, suggesting the presence of T-cell memory, but the response was minimal after MMR3 receipt. MeV IgG avidity did not correlate with findings of neutralization analyses. Most subjects were seropositive before MMR3 receipt, and very few had a secondary immune response after MMR3 receipt. Similarly, CMI and avidity analyses showed minimal qualitative improvements in immune response after MMR3 receipt. We did not find compelling data to support a routine third dose of MMR vaccine. Published by Oxford University Press for the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  2. Lot-to-lot consistency study of the fully liquid pentavalent DTwP-HepB-Hib vaccine Quinvaxem® demonstrating clinical equivalence, suitability of the vaccine as a booster and concomitant administration with measles vaccine

    PubMed Central

    Aspinall, Sanet; Traynor, Deirdre; Bedford, Philip; Hartmann, Katharina

    2012-01-01

    This double-blind, randomized study evaluated the immunogenicity and safety of three production lots of the fully liquid combination DTwP-Hep-Hib vaccine, Quinvaxem® (Crucell, The Netherlands) in 360 healthy infants aged 42–64 d old given at 6, 10 and 14 weeks of age (Core Study). The Core Study was followed by an open-label Booster Phase evaluating immunogenicity and safety of a booster dose of Quinvaxem® given with either concomitant or deferred measles vaccine in 227 infants who completed the Core Study. One month after the third dose of Quinvaxem® immune responses reflecting seroprotection or seroconversion were observed in more than 90% of infants for all three vaccine lots. Quinvaxem® elicited a strong booster response as demonstrated by a large increase in antibodies against all antigens, which appeared to be unaffected by concomitant administration of the measles vaccine. Safety results were in line with previous reports for Quinvaxem® with no unexpected adverse events (AEs) being reported. In the Core Study and Booster Phase, Quinvaxem® was well tolerated. No study vaccine-related serious AEs were reported. Thus, Quinvaxem® was immunogenic and well-tolerated when administered to infants according to a 6–10–14 week vaccination schedule. The three production lots had consistent reactogenicity and immunogenicity profiles. The booster dose of Quinvaxem® was also immunogenic and safe, regardless of whether a monovalent measles vaccine was administered concomitantly or one month later. PMID:22854660

  3. Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350

    PubMed Central

    Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong

    2012-01-01

    Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906

  4. Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350.

    PubMed

    Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C Kathy; Jin, Hong

    2012-01-01

    Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1(st) or the 3(rd) position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3(rd) position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation.

  5. Early exposure to the combined measles-mumps-rubella vaccine and thimerosal-containing vaccines and risk of autism spectrum disorder.

    PubMed

    Uno, Yota; Uchiyama, Tokio; Kurosawa, Michiko; Aleksic, Branko; Ozaki, Norio

    2015-05-15

    This case-control study investigated the relationship between the risk of Autism Spectrum Disorder (ASD) onset, and early exposure to the combined Measles-Mumps-Rubella (MMR) vaccine and thimerosal consumption measured from vaccinations in the highly genetically homogenous Japanese population. Vaccination histories at 1, 3, 6, 12, 18, 24, and 36 months from birth were investigated in ASD cases (189 samples), and controls (224 samples) matching age and sex in each case. Crude odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated to determine relationship between MMR vaccination and ASD. The differences in mean values of the thimerosal dosage between cases and controls were analyzed using an unpaired t-test. MMR vaccination and thimerosal dosage were also investigated using a conditional multiple-regression model. There were no significant differences in MMR vaccination and thimerosal dosage between cases and controls at any age. Furthermore, the ORs (95% CIs) of MMR vaccination and thimerosal dosage associated with ASD in the conditional multiple regression model were, respectively, 0.875 (0.345-2.222) and 1.205 (0.862-1.683) at age 18 months, 0.724 (0.421-1.243) and 1.343 (0.997-1.808) at 24 months, and 1.040 (0.648-1.668) and 0.844 (0.632-1.128) at 36 months. Thus, there were no significant differences. No convincing evidence was found in this study that MMR vaccination and increasing thimerosal dose were associated with an increased risk of ASD onset. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Measles-mumps-rubella vaccination timing and autism among young african american boys: a reanalysis of CDC data

    PubMed Central

    2014-01-01

    Background A significant number of children diagnosed with autism spectrum disorder suffer a loss of previously-acquired skills, suggesting neurodegeneration or a type of progressive encephalopathy with an etiological basis occurring after birth. The purpose of this study is to investigate the effectof the age at which children got their first Measles-Mumps-Rubella (MMR) vaccine on autism incidence. This is a reanalysis of the data set, obtained from the U.S. Centers for Disease Control and Protection (CDC), used for the Destefano et al. 2004 publication on the timing of the first MMR vaccine and autism diagnoses. Methods The author embarked on the present study to evaluate whether a relationship exists between child age when the first MMR vaccine was administered among cases diagnosed with autism and controls born between 1986 through 1993 among school children in metropolitan Atlanta. The Pearson’s chi-squared method was used to assess relative risks of receiving an autism diagnosis within the total cohort as well as among different race and gender categories. Results When comparing cases and controls receiving their first MMR vaccine before and after 36 months of age, there was a statistically significant increase in autism cases specifically among African American males who received the first MMR prior to 36 months of age. Relative risks for males in general and African American males were 1.69 (p=0.0138) and 3.36 (p=0.0019), respectively. Additionally, African American males showed an odds ratio of 1.73 (p=0.0200) for autism cases in children receiving their first MMR vaccine prior to 24 months of age versus 24 months of age and thereafter. Conclusions The present study provides new epidemiologic evidence showing that African American males receiving the MMR vaccine prior to 24 months of age or 36 months of age are more likely to receive an autism diagnosis. PMID:25114790

  7. Immunization against measles by aerosol.

    PubMed

    Sabin, A B

    1983-01-01

    About 20 years ago, Japanese and American investigators found that inhalation of relatively small amounts of aerosolized, partly attenuated measles vaccines was consistently immunogenic in nearly all susceptible children. The resulting modified measles was not transmissible to susceptible children. In 1965-1966, Japanese investigators showed that levels of neutralizing antibody produced by killed measles virus vaccine, which prevented subsequent immunization when live vaccine was given subcutaneously, did not prevent the immunogenic effect of the same vaccine given by aerosol. This raised the possibility that aerosolized vaccine may be immunogenic in infants with residual maternal antibody, in whom subcutaneously injected vaccine is ineffective. In 1971, Soviet investigators reported the high effectiveness and complete lack of febrile and other clinical reactions in 3,306 children who were exposed in large groups in large tents or chambers to aerosols of the more-attenuated measles vaccines that were currently available. An inexpensive nebulizer and the procedure for administration of aerosolized vaccine to individual children are here described. If the good results reported from the USSR can also be obtained with this simple method of vaccination by aerosol, it may be possible to carry out mass vaccinations against measles with thousands of nonprofessional personnel and thereby quickly eliminate measles in countries where it is still a serious public health problem.

  8. Immunogenicity and safety of measles-mumps-rubella vaccine delivered by disposable-syringe jet injector in healthy Brazilian infants: a randomized non-inferiority study.

    PubMed

    de Menezes Martins, Reinaldo; Curran, Birute; Maia, Maria de Lourdes Sousa; Ribeiro, Maria das Graças Tavares; Camacho, Luiz Antonio Bastos; da Silva Freire, Marcos; Yamamura, Anna Maya Yoshida; Siqueira, Marilda Mendonça; Lemos, Maria Cristina F; de Albuquerque, Elizabeth Maciel; von Doellinger, Vanessa dos Reis; Homma, Akira; Saganic, Laura; Jarrahian, Courtney; Royals, Michael; Zehrung, Darin

    2015-03-01

    This study aimed to determine if immunogenicity to measles-mumps-rubella vaccine delivered to infants via a disposable-syringe jet injector (DSJI) was non-inferior to that administered by needle and syringe (NS). Vaccination safety was evaluated, as were the use, performance, and acceptability of each delivery method. The DSJI was the PharmaJet 2009 generation-1 device (G1) and the vaccine was measles-mumps-rubella vaccine from Bio-Manguinhos. Five hundred eighty-two healthy Brazilian infants were randomized to receive vaccine via G1 or NS. Seroconversion rates against measles and mumps viruses in the G1 treatment group did not meet non-inferiority criteria when compared with the NS group; however, responses in the G1 group to rubella virus were non-inferior to those of NS vaccinees. Most adverse events were mild or moderate. Crying after injection was more frequent in the NS group, and local skin reactions were more common in the G1 group. Five serious adverse events were judged causally unrelated to treatment and all resolved. Parents/guardians expressed a strong preference for G1 over NS for their children. Vaccinators found the G1 easy to use but noted incomplete vaccine delivery in some cases. Although the G1 has been superseded by an updated device, our results are important for the continued improvement and evaluation of DSJIs, which have the potential to overcome many of the challenges and risks associated with needle-based injections worldwide. Recommendations for future DSJI clinical studies include rigorous training of vaccinators, quantitative measurement of wetness on the skin following injection, and regular monitoring of device and vaccinator performance. Copyright © 2014. Published by Elsevier Inc.

  9. Impact of an Intervention to Use a Measles, Rubella, and Polio Mass Vaccination Campaign to Strengthen Routine Immunization Services in Nepal.

    PubMed

    Wallace, Aaron S; Bohara, Rajendra; Stewart, Steven; Subedi, Giri; Anand, Abhijeet; Burnett, Eleanor; Giri, Jagat; Shrestha, Jagat; Gurau, Suraj; Dixit, Sameer; Rajbhandari, Rajesh; Schluter, W William

    2017-07-01

    The potential to strengthen routine immunization (RI) services through supplementary immunization activities (SIAs) is an important benefit of global measles and rubella elimination and polio eradication strategies. However, little evidence exists on how best to use SIAs to strengthen RI. As part the 2012 Nepal measles-rubella and polio SIA, we developed an intervention package designed to improve RI processes and evaluated its effect on specific RI process measures. The intervention package was incorporated into existing SIA activities and materials to improve healthcare providers' RI knowledge and practices throughout Nepal. In 1 region (Central Region) we surveyed the same 100 randomly selected health facilities before and after the SIA and evaluated the following RI process measures: vaccine safety, RI planning, RI service delivery, vaccine supply chain, and RI data recording practices. Data collection included observations of vaccination sessions, interviews with the primary healthcare provider who administered vaccines at each facility, and administrative record reviews. Pair-matched analytical methods were used to determine whether statistically significant changes in the selected RI process measures occurred over time. After the SIA, significant positive changes were measured in healthcare provider knowledge of adverse events following immunization (11% increase), availability of RI microplans (+17%) and maps (+12%), and awareness of how long a reconstituted measles vial can be used before it must be discarded (+14%). For the SIA, 42% of providers created an SIA high-risk villages list, and >50% incorporated this information into RI outreach session site planning. Significant negative changes occurred in correct knowledge of measles vaccination contraindications (-11%), correct definition for a measles outbreak (-21%), and how to treat a child with a severe adverse event following immunization (-10%). Twenty percent of providers reported cancelling ≥1 RI

  10. PACT- and RIG-I-Dependent Activation of Type I Interferon Production by a Defective Interfering RNA Derived from Measles Virus Vaccine

    PubMed Central

    Ho, Ting-Hin; Kew, Chun; Lui, Pak-Yin; Chan, Chi-Ping; Satoh, Takashi; Akira, Shizuo

    2015-01-01

    ABSTRACT The live attenuated measles virus vaccine is highly immunostimulatory. Identification and characterization of its components that activate the innate immune response might provide new strategies and agents for the rational design and development of chemically defined adjuvants. In this study, we report on the activation of type I interferon (IFN) production by a defective interfering (DI) RNA isolated from the Hu-191 vaccine strain of measles virus. We found that the Hu-191 virus induced IFN-β much more potently than the Edmonston strain. In the search for IFN-inducing species in Hu-191, we identified a DI RNA specifically expressed by this strain. This DI RNA, which was of the copy-back type, was predicted to fold into a hairpin structure with a long double-stranded stem region of 206 bp, and it potently induced the expression of IFN-β. Its IFN-β-inducing activity was further enhanced when both cytoplasmic RNA sensor RIG-I and its partner, PACT, were overexpressed. On the contrary, this activity was abrogated in cells deficient in PACT or RIG-I. The DI RNA was found to be associated with PACT in infected cells. In addition, both the 5′-di/triphosphate end and the double-stranded stem region on the DI RNA were essential for its activation of PACT and RIG-I. Taken together, our findings support a model in which a viral DI RNA is sensed by PACT and RIG-I to initiate an innate antiviral response. Our work might also provide a foundation for identifying physiological PACT ligands and developing novel adjuvants or antivirals. IMPORTANCE The live attenuated measles virus vaccine is one of the most successful human vaccines and has largely contained the devastating impact of a highly contagious virus. Identifying the components in this vaccine that stimulate the host immune response and understanding their mechanism of action might help to design and develop better adjuvants, vaccines, antivirals, and immunotherapeutic agents. We identified and characterized

  11. Using Locally Derived Seroprevalence Data on Measles, Mumps, Rubella, and Varicella by Birth Cohort to Determine Risks for Vaccine-Preventable Diseases During International Travel.

    PubMed

    Rosario-Rosario, Gisela; Gareca, Marcelo; Kincaid, Hope; Knouse, Mark C

    2015-01-01

    Measles, mumps, rubella, and varicella (MMRV) were common childhood diseases in the United States prior to the introduction of their respective vaccines. Measles was declared eliminated in the United States in 2000. However, 628 cases were reported in 2014, the majority of which have been linked to international travel. The study team set out to investigate the seroprevalence of MMRV in our local population to determine whether such a process can lead to meaningful recommendations for assessing travelers at risk. We conducted a cross-sectional seroprevalence study using a quota sampling method. A total of 460 leftover serum samples were collected from individuals born prior to 1996, who live in the Lehigh Valley region of southeast Pennsylvania. The samples were allocated to five birth-year cohorts, and the seroprevalence of each cohort to MMRV was compared. Additionally, overall seroprevalence of each disease was compared with data from prior national studies. Gender differences within each birth cohort were also assessed. The overall seroprevalence values of measles, mumps, rubella, and varicella were 85.8, 82.8, 96.6, and 97.4%, respectively. There were significant associations between seroprevalence and birth cohort for measles (p = 0.01) as well as mumps (p = 0.037). The overall seroprevalence for our study sample was significantly different from the national seroprevalence results of measles, mumps, and rubella. Our study showed dramatically lower immunity rates for measles and mumps than those shown by prior national seroprevalence studies. The rates in many of the later birth cohorts born after 1966 were significantly lower than the rates reported as necessary to sustain herd immunity. Given that patients' immunization records are not always available or complete, collecting local seroprevalence data may be necessary to more accurately recommend antibody testing and vaccination during pre-travel assessments. © 2015 International Society of Travel

  12. Is there a 'regressive phenotype' of Autism Spectrum Disorder associated with the measles-mumps-rubella vaccine? A CPEA Study.

    PubMed

    Richler, Jennifer; Luyster, Rhiannon; Risi, Susan; Hsu, Wan-Ling; Dawson, Geraldine; Bernier, Raphael; Dunn, Michelle; Hepburn, Susan; Hyman, Susan L; McMahon, William M; Goudie-Nice, Julie; Minshew, Nancy; Rogers, Sally; Sigman, Marian; Spence, M Anne; Goldberg, Wendy A; Tager-Flusberg, Helen; Volkmar, Fred R; Lord, Catherine

    2006-04-01

    A multi-site study of 351 children with Autism Spectrum Disorders (ASD) and 31 typically developing children used caregiver interviews to describe the children's early acquisition and loss of social-communication milestones. For the majority of children with ASD who had experienced a regression, pre-loss development was clearly atypical. Children who had lost skills also showed slightly poorer outcomes in verbal IQ and social reciprocity, a later mean age of onset of autistic symptoms, and more gastrointestinal symptoms than children with ASD and no regression. There was no evidence that onset of autistic symptoms or of regression was related to measles-mumps-rubella vaccination. The implications of these findings for the existence of a 'regressive phenotype' of ASD are discussed.

  13. Biological Feasibility of Measles Eradication

    PubMed Central

    Strebel, Peter

    2011-01-01

    Recent progress in reducing global measles mortality has renewed interest in measles eradication. Three biological criteria are deemed important for disease eradication: (1) humans are the sole pathogen reservoir; (2) accurate diagnostic tests exist; and (3) an effective, practical intervention is available at reasonable cost. Interruption of transmission in large geographical areas for prolonged periods further supports the feasibility of eradication. Measles is thought by many experts to meet these criteria: no nonhuman reservoir is known to exist, accurate diagnostic tests are available, and attenuated measles vaccines are effective and immunogenic. Measles has been eliminated in large geographical areas, including the Americas. Measles eradication is biologically feasible. The challenges for measles eradication will be logistical, political, and financial. PMID:21666201

  14. Vaccine-induced measles virus-specific T cells do not prevent infection or disease but facilitate subsequent clearance of viral RNA.

    PubMed

    Lin, Wen-Hsuan W; Pan, Chien-Hsiung; Adams, Robert J; Laube, Beth L; Griffin, Diane E

    2014-04-15

    Infection with wild-type measles virus (MeV) induces lifelong protection from reinfection, and parenteral delivery of the live attenuated measles vaccine (LAV) also provides protection from measles. The level of neutralizing antibody is a good indicator of protection, but the independent roles of MeV-specific antibody and T cells have not been identified. In this study, macaques immunized with LAV through a nebulizer and a mouthpiece developed MeV-specific T-cell responses but not neutralizing antibodies. Upon challenge with wild-type MeV, these animals developed rashes and viremias similar to those in naive animals but cleared viral RNA from blood 25 to 40 days faster. The nebulizer-immunized animals also had more robust MeV-specific CD4(+) and CD8(+) T-cell responses than the naive animals after challenge, characterized by a higher number and better durability of gamma interferon (IFN-γ)-producing cells. Induction of MeV-specific circulating CD4(+) and CD8(+) T cells capable of producing multiple cytokines correlated with clearance of viral RNA in the nebulizer-immunized macaques. These studies demonstrated that MeV-specific T-cell immunity alone did not prevent measles, but T-cell priming enhanced the magnitude, durability, and polyfunctionality of MeV-specific T cells after challenge infection and correlated with more rapid clearance of MeV RNA. IMPORTANCE The components of vaccine-induced immunity necessary for protection from infection and disease have not been clearly identified for most vaccines. Vaccine development usually focuses on induction of antibody, but T-cell-based vaccines are also under development. The live attenuated measles vaccine (LAV) given subcutaneously induces both T cells and neutralizing antibody and provides solid protection from infection. LAV delivered to the upper respiratory tract through a nebulizer and mouthpiece induced a T-cell response but no neutralizing antibody. These T-cell-primed macaques demonstrated no protection from

  15. Mumps Postexposure Prophylaxis with a Third Dose of Measles-Mumps-Rubella Vaccine, Orange County, New York, USA

    PubMed Central

    Lawler, Jacqueline; Curns, Aaron T.; Brandeburg, Christina; Wallace, Gregory S.

    2013-01-01

    Although the measles-mumps-rubella (MMR) vaccine is not recommended for mumps postexposure prophylaxis (PEP), data on its effectiveness are limited. During the 2009–2010 mumps outbreak in the northeastern United States, we assessed effectiveness of PEP with a third dose of MMR vaccine among contacts in Orthodox Jewish households who were given a third dose within 5 days of mumps onset in the household’s index patient. We compared mumps attack rates between persons who received a third MMR dose during the first incubation period after onset in the index patient and 2-dose vaccinated persons who had not. Twenty-eight (11.7%) of 239 eligible household members received a third MMR dose as PEP. Mumps attack rates were 0% among third-dose recipients versus 5.2% among 2-dose recipients without PEP (p = 0.57). Although a third MMR dose administered as PEP did not have a significant effect, it may offer some benefits in specific outbreak contexts. PMID:23965729

  16. Reemergence of Measles in the Americas: The Genotype B3 2011-2012 Outbreak in Ecuador.

    PubMed

    Le, Nicole K; Mhaskar, Rahul; Hoare, Ismael; Espinel, Mauricio; Fernanda Rivadeneira, María; Malavade, Sharad; Izurieta, Ricardo

    2017-06-02

    This study characterizes a measles outbreak which occurred in Ecuador in 2011-2012, analyzing data from 3700 suspected cases of measles reported to Ecuador's Ministry of Public Health. The study population had a large age range and included 333 confirmed cases of measles. The greatest number of cases were found in the <1 year (32.43%, n = 108) and 1-4 year (30.03%, n = 100) age-groups. Compared to Mestizos, indigenous people had the highest number of cases (68.2%, n = 227), as well as a higher risk of infection (OR 7.278 (CI 5.251-10.087)). The greatest protection from measles was observed in individuals who received two doses of the measles vaccine. Residents of Pastaza (OR 6.645 CI (3.183-13.873)) and Tungurahua (OR 8.346 CI (5.570-12.507)) had a higher risk of infection than the other provinces. Of the 17 laboratory confirmed cases, all were identified as genotype B3. Age-group, ethnicity, measles vaccinations, and residence in Tungurahua and Pastaza were correlated with rates of measles infection in the outbreak. Tungurahua and Pastaza, where the outbreak originated, have large indigenous populations. Indigenous children <1 year of age showed the highest incidence. It is likely that indigenous women do not have immunity to the virus, and so are unable to confer measles resistance to their newborns.

  17. Reemergence of Measles in the Americas: The Genotype B3 2011–2012 Outbreak in Ecuador

    PubMed Central

    Le, Nicole K.; Mhaskar, Rahul; Hoare, Ismael; Espinel, Mauricio; Fernanda Rivadeneira, María; Malavade, Sharad; Izurieta, Ricardo

    2017-01-01

    This study characterizes a measles outbreak which occurred in Ecuador in 2011–2012, analyzing data from 3700 suspected cases of measles reported to Ecuador’s Ministry of Public Health. The study population had a large age range and included 333 confirmed cases of measles. The greatest number of cases were found in the <1 year (32.43%, n = 108) and 1–4 year (30.03%, n = 100) age-groups. Compared to Mestizos, indigenous people had the highest number of cases (68.2%, n = 227), as well as a higher risk of infection (OR 7.278 (CI 5.251–10.087)). The greatest protection from measles was observed in individuals who received two doses of the measles vaccine. Residents of Pastaza (OR 6.645 CI (3.183–13.873)) and Tungurahua (OR 8.346 CI (5.570–12.507)) had a higher risk of infection than the other provinces. Of the 17 laboratory confirmed cases, all were identified as genotype B3. Age-group, ethnicity, measles vaccinations, and residence in Tungurahua and Pastaza were correlated with rates of measles infection in the outbreak. Tungurahua and Pastaza, where the outbreak originated, have large indigenous populations. Indigenous children <1 year of age showed the highest incidence. It is likely that indigenous women do not have immunity to the virus, and so are unable to confer measles resistance to their newborns. PMID:28574449

  18. Characterization of Endogenous Avian Leukosis Viruses in Chicken Embryonic Fibroblast Substrates Used in Production of Measles and Mumps Vaccines

    PubMed Central

    Johnson, Jeffrey A.; Heneine, Walid

    2001-01-01

    Previous findings of low levels of reverse transcriptase (RT) activity in chick cell-derived measles and mumps vaccines showed this activity to be associated with virus particles containing RNA of both subgroup E endogenous avian leukosis viruses (ALV-E) and endogenous avian viruses (EAV). These particles originate from chicken embryonic fibroblast (CEF) substrates used for propagating vaccine strains. To better characterize vaccine-associated ALV-E, we examined the endogenous ALV proviruses (ev loci) present in a White Leghorn CEF substrate pool by restriction fragment length polymorphism. Five ev loci were detected, ev-1, ev-3, ev-6, ev-18, andev-19. Both ev-18 and ev-19 can express infectious ALV-E, while ev-1, ev-3, and ev-6 are defective. We analyzed the full-length sequence of ev-1 and identified an adenosine insertion within the pol RT-β region at position 5026, which results in a truncated RT-β and integrase. We defined the 1,692-bp deletion in the gag-pol region of ev-3, and we found that in ev-6, sequences from the 5′ long terminal repeat to the 5′ pol region were absent. Based on the sequences of the ev loci, RT-PCR assays were developed to examine expression of ALV-E particles (EV) in CEF supernatants. Both ev-1- and ev-3-like RNA sequences were identified, as well as two other RNA sequences with intact pol regions, presumably of ev-18 and ev-19 origin. Inoculation of susceptible quail fibroblasts with CEF culture supernatants from both 5-azacytidine-induced and noninduced CEF led to ALV infection, confirming the presence of infectious ALV-E. Our data demonstrate that both defective and nondefective ev loci can be present in CEF vaccine substrates and suggest that both ev classes may contribute to the ALV present in vaccines. PMID:11264350

  19. A measles outbreak in children under 15 months of age in La Rioja, Spain, 2005-2006.

    PubMed

    Perucha, M; Ramalle-Gómara, E; Lezaun, M E; Blanco, A; Quiñones, C; Blasco, M; González, M A; Cuesta, C; Echevarría, J E; Mosquera, M M; de Ory, F

    2006-01-01

    This paper describes a measles outbreak in La Rioja, Spain, which began in December 2005 and mainly affected children under 15 months of age who were not yet immunised with MMR vaccine. The measles cases were detected by the mandatory reporting system, under which laboratories must report every confirmed measles case. Cases were classified in accordance with the National Measles Elimination Plan: suspected and laboratory-confirmed. In the period 14 December 2005 to 19 February 2006, 29 suspected cases of measles were investigated, and 18 were confirmed. The mean incubation period was 13.8 days (range: 9 to 18). Of the 18 confirmed cases, only two were in adults. MMR vaccination was recommended for all household contacts, as well as for children aged 6 to 14 months who attended the daycare centres where the cases had appeared. At these centres, the second dose of MMR was administered ahead of schedule for children under three years of age. It was recommended that the first dose of MMR vaccine be administered ahead of schedule for all children aged 9 to 14 months. During an outbreak of measles, children aged 6 months or older, who have not previously been vaccinated against measles, mumps and rubella, should receive a first dose as soon as possible, and those who have had a first dose should receive a second dose as soon as possible, provided that a minimum of one month has elapsed between the two doses.

  20. A Measles Outbreak at a College with a Prematriculation Immunization Requirement.

    ERIC Educational Resources Information Center

    Hersh, Bradley S.; And Others

    1991-01-01

    Reports a retrospective cohort study among students living in campus dormitories to examine potential risk factors for measles vaccine failure. As in secondary schools, measles outbreaks can occur among highly vaccinated college populations. Requiring two doses of measles vaccine for college entrants should help reduce measles outbreaks in college…

  1. A Measles Outbreak at a College with a Prematriculation Immunization Requirement.

    ERIC Educational Resources Information Center

    Hersh, Bradley S.; And Others

    1991-01-01

    Reports a retrospective cohort study among students living in campus dormitories to examine potential risk factors for measles vaccine failure. As in secondary schools, measles outbreaks can occur among highly vaccinated college populations. Requiring two doses of measles vaccine for college entrants should help reduce measles outbreaks in college…

  2. [The active offering of measles, rubella and mumps vaccine in new mothers: the experience of health facilities in one of the Local Health Unit of Rome, Lazio, Italy].

    PubMed

    Santoro, Viviana; Pettinicchio, Valentina; Lancia, Andreina; Vazzoler, Cristiana; De Luca, Francesca; Franco, Elisabetta

    2016-01-01

    Rubella is a contagious disease that can be very serious, especially in unvaccinated pregnant women. The best way to be protected is getting vaccinated: MMR vaccine is very effective at protecting people against measles, mumps, and rubella, and preventing the complications caused by these diseases. According to PASSI 2012-2015 (the Italian behavioral risk factor surveillance system) in the territory of ex ASL Roma C only 56% of women between 18 and 49 years were immunized against rubella, thanks to vaccination (34%) or past infection detected by rubeotest (22%); 2% was susceptible and 42% of respondents did not know their immune status against rubella. The Italian National Plan for the Elimination of Measles and Congenital Rubella (PNEMoRc) 2010-15 had the aim to reduce the prevalence of rubella susceptibility in young women (<5%), to reduce the prevalence of congenital rubella and to increase MMR vaccination coverage. This plan suggested to promote actions to spread correct information about MMR vaccine in the general population and healthcare workers and to offer this vaccine to susceptible women during every appropriate contact with the Family planning clinics. In order to ensure and monitor these recommendations, a recovery procedure for MMR vaccine was activated in 2015 for women who contacted the health facilities for their first child vaccination. A form was developed in order to collect information about women's immune status against rubella and measles. According to this tool all women who stated they had never been vaccinated for rubella or MMR and/or did not remember vaccination and/or had never had a rubeotest were considered susceptible to rubella. Women susceptible to rubella were invited to undergo vaccination. Data collected during one year activity were recorded and analyzed with Epinfo 7.0 software. We collected 1801 correctly filled forms; 88.6% (1595) of women were evaluated immune to rubella and 11.4% susceptible. The prevalence of

  3. Age-stratified seroprevalence of measles, mumps and rubella (MMR) virus infections in Switzerland after the introduction of MMR mass vaccination.

    PubMed

    Matter, L; Germann, D; Bally, F; Schopfer, K

    1997-01-01

    We have performed age-stratified seroprevalence studies for MMR to evaluate these vaccinations. Serum samples submitted for diagnostic testing were randomly selected for unlinked anonymous panels. IgG antibodies were tested by ELISA and indirect immunofluorescence. In the vaccination cohort (age 1.5 to 6.5 years), seroprevalence attained 80%. For measles and mumps it continued to increase to 95%, while for rubella it declined transiently to 60% between 7 and 12 years of age. We observed no differences according to gender in any age group in 1991-1992. (Semi)quantitative values of the IgG antibodies against all three viruses increased during adolescence, suggesting wild virus circulation. In 1992, MMR vaccination has reached < 80% of the children during their second year of age. Due to previous monovalent measles and mumps vaccinations in pre-school children and due to endemic and epidemic activity, particularly of mumps virus, a trough of the seroprevalence in adolescents was evident only for rubella. MMR vaccination campaigns performed at school since 1987 have increase seroprevalence in this population segment and have probably over-compensated for the expected shift to the right of the seroprevalence curves. A more compulsive implementation of the recommended childhood vaccination schedule and continued efforts at catchup vaccinations during school age especially for rubella are necessary to avoid the accumulation of susceptible young adults during the forthcoming decades.

  4. Immunogenicity and reactogenicity of tetravalent vaccine for measles, mumps, rubella and varicella (MMRV) in healthy children: a meta-analysis of randomized controlled trials.

    PubMed

    Leung, Julia Hy; Hirai, Hoyee W; Tsoi, Kelvin Kf

    2015-01-01

    Varicella is a highly infectious childhood disease. Tetravalent measles-mumps-rubella-varicella (MMRV) vaccine was introduced as one-syringe dose. To evaluate the immunogenicity and reactogenicity of MMRV vaccine versus trivalent MMR with varicella (V) vaccines in healthy children and to assess the respective safety issue. Randomized controlled trials (RCTs) were searched from the OVID databases. Trials were eligible if healthy children were randomized to receive MMRV or MMR+V vaccine. Seroconversions in serum antibody titers were the primary outcomes; adverse events were the secondary outcomes. Ten RCTs with 8961 healthy children were identified. MMRV and MMR+V vaccines showed comparable immunogenicity against measles (relative risk [RR] = 0.99, 95% CI = 0.98-1.00), mumps (RR = 0.99, 95% CI = 0.97-1.00), rubella (RR = 1.00, 95% CI = 1.00-1.01) and varicella (RR = 0.98, 95% CI = 0.95-1.01). At least 93% of children in both groups had seroconverted within 6 weeks. MMRV group showed significantly higher incidences of fever (RR = 1.19, 95% CI = 1.09-1.31) and rash (RR = 1.23, 95% CI = 1.06-1.43). The immunogenicities of MMRV and MMR+V vaccines were comparable in healthy children; however, MMRV vaccination showed higher incidences of fever and rash.

  5. Parents' attitude towards the second dose of measles, mumps and rubella vaccine: a case-control study.

    PubMed

    Petrovic, M; Roberts, R J; Ramsay, M; Charlett, A

    2003-12-01

    In response to media scares and subsequent falls in measles, mumps and rubella (MMR) vaccine uptake, a case-control study was conducted to identify factors associated with non-uptake of the second dose of the vaccine in children resident in North Wales. Subjects were selected from parents of children scheduled for the second dose between October and December 1997. Postal questionnaires were used to compare knowledge, attitudes and practice of non-acceptors (cases) and acceptors (controls). Of non-acceptors, 92.1% (95% CI 82.2-97.5%) stated that they would allow another child to have at least one dose of MMR, and 39.2% (95% CI 25.8-53.9%) both doses of MMR vaccine. Non-acceptors were more likely to report having obtained information from newspapers/television (OR 2.04, 95% CI 1.03-4.02) or from the general practitioner (OR 2.02, 95% CI 1.07-3.86) and to report having 'a lot' or 'some' influence from newspapers/television (OR 3.52, 95% CI 1.57-7.86). The 'combination of three vaccines in one jab' was identified as a worry by 55.1% (95% CI 40.2-69.3%) of non-acceptors and 38.5% (95% CI 30.6-46.9%) of acceptors. On this evidence, catch-up campaigns would be an effective way of increasing coverage; also health professionals need tools to enable them to communicate effectively in the face of ongoing scares.

  6. Catching measles in an appropriately vaccinated group: a well-circumscribed outbreak in the South East of Ireland, September-November 2013.

    PubMed

    O'Connor, B; Cotter, S; Heslin, J; Lynam, B; McGOVERN, E; Murray, H; Parker, G; Doyle, S

    2016-11-01

    A measles outbreak occurred in a school in a small town in the South East of Ireland in September-November 2013. Most (and all early) cases had one dose of the measles-mumps- rubella (MMR) vaccination. All suspected cases were followed up, in order to advise on sampling and provide public health advice to them and their contacts. MMR vaccination control measures were instituted in the town. These included early second MMR in primary schools and childcare facilities, bringing forward the planned school MMR catch-up programme, early first MMR dose for children aged 6-12 months and targeted advice to unvaccinated children. There were 20 cases (17 confirmed) of measles associated with the outbreak. Fifteen cases occurred in the index school, with four in pre-school-age children (<4 years) who had clear epidemiological links with children at the school. This was a well-circumscribed outbreak occurring, unusually, in a well-vaccinated population. The outbreak came late to the attention of Department of Public Health staff but prompt action, once notified, and institution of control measures resulted in quick termination of the outbreak and prevention of cases in a neighbouring city.

  7. Effect of an Early Dose of Measles Vaccine on Morbidity Between 18 Weeks and 9 Months of Age: A Randomized, Controlled Trial in Guinea-Bissau.

    PubMed

    Do, Vu An; Biering-Sørensen, Sofie; Fisker, Ane Bærent; Balé, Carlito; Rasmussen, Stine Møller; Christensen, Lone Damkjær; Jensen, Kristoffer Jarlov; Martins, Cesário; Aaby, Peter; Benn, Christine Stabell

    2017-04-15

    Children in Guinea-Bissau receive measles vaccine (MV) at 9 months of age, but studies have shown that an additional dose before 9 months of age might have beneficial nonspecific effects. Within a randomized trial designed to examine nonspecific effects of early MV receipt on mortality, we conducted a substudy to investigate the effect of early MV receipt on morbidity. Children were randomly assigned at a ratio of 2:1 to receive 2 doses of MV at 18 weeks and age 9 months (intervention group) or 1 dose of MV at age 9 months, in accordance with current practice (control group). Children were visited weekly from enrollment to age 9 months; the mother reported morbidity, and the field assistants examined the children. Using Cox and binomial regression models, we compared the 2 randomization groups. Among the 1592 children, early measles vaccination was not associated with a higher risk of the well-known adverse events of fever, rash, and convulsions within the first 14 days. From 15 days after randomization to age 9 months, early measles vaccination was associated with reductions in maternally reported diarrhea (hazard ratio [HR], 0.89; 95% confidence interval [CI], .82-.97), vomiting (HR, 0.86; 95% CI, .75-.98), and fever (HR, 0.93; 95% CI, .87-1.00). Early MV receipt was associated with reduced general morbidity in the following months, supporting that early MV receipt may improve the general health of children.

  8. Large measles outbreak introduced by asylum seekers and spread among the insufficiently vaccinated resident population, Berlin, October 2014 to August 2015.

    PubMed

    Werber, Dirk; Hoffmann, Alexandra; Santibanez, Sabine; Mankertz, Annette; Sagebiel, Daniel

    2017-08-24

    The largest measles outbreak in Berlin since 2001 occurred from October 2014 to August 2015. Overall, 1,344 cases were ascertained, 86% (with available information) unvaccinated, including 146 (12%) asylum seekers. Median age was 17 years (interquartile range: 4-29 years), 26% were hospitalised and a 1-year-old child died. Measles virus genotyping uniformly revealed the variant 'D8-Rostov-Don' and descendants. The virus was likely introduced by and initially spread among asylum seekers before affecting Berlin's resident population. Among Berlin residents, the highest incidence was in children aged < 2 years, yet most cases (52%) were adults. Post-exposure vaccinations in homes for asylum seekers, not always conducted, occurred later (median: 7.5 days) than the recommended 72 hours after onset of the first case and reached only half of potential contacts. Asylum seekers should not only have non-discriminatory, equitable access to vaccination, they also need to be offered measles vaccination in a timely fashion, i.e. immediately upon arrival in the receiving country. Supplementary immunisation activities targeting the resident population, particularly adults, are urgently needed in Berlin. This article is copyright of The Authors, 2017.

  9. Positive predictive value and effectiveness of measles case-based surveillance in Uganda, 2012-2015.

    PubMed

    Nsubuga, Fred; Ampaire, Immaculate; Kasasa, Simon; Luzze, Henry; Kisakye, Annet

    2017-01-01

    Disease surveillance is a critical component in the control and elimination of vaccine preventable diseases. The Uganda National Expanded Program on Immunization strives to have a sensitive surveillance system within the Integrated Disease Surveillance and Response (IDSR) framework. We analyzed measles surveillance data to determine the effectiveness of the measles case-based surveillance system and estimate its positive predictive value in order to inform policy and practice. An IDSR alert was defined as ≥1 suspected measles case reported by a district in a week, through the electronic Health Management Information System. We defined an alert in the measles case-based surveillance system (CBS) as ≥1 suspected measles case with a blood sample collected for confirmation during the corresponding week in a particular district. Effectiveness of CBS was defined as having ≥80% of IDSR alerts with a blood sample collected for laboratory confirmation. Positive predictive value was defined as the proportion of measles case-patients who also had a positive measles serological result (IgM +). We reviewed case-based surveillance data with laboratory confirmation and measles surveillance data from the electronic Health Management Information System from 2012-2015. A total of 6,974 suspected measles case-persons were investigated by the measles case-based surveillance between 2012 and 2015. Of these, 943 (14%) were measles specific IgM positive. The median age of measles case-persons between 2013 and 2015 was 4.0 years. Between 2013 and 2015, 72% of the IDSR alerts reported in the electronic Health Management Information System, had blood samples collected for laboratory confirmation. This was however less than the WHO recommended standard of ≥80%. The PPV of CBS between 2013 and 2015 was 8.6%. In conclusion, the effectiveness of measles case-based surveillance was sub-optimal, while the PPV showed that true measles cases have significantly reduced in Uganda. We

  10. Can measles be eradicated globally?

    PubMed Central

    de Quadros, Ciro A.

    2004-01-01

    Measles is one of the most infectious diseases. Before measles vaccine was introduced, nearly everyone contracted the disease at some point in childhood. By the late 1980s, most countries had incorporated measles vaccine into their routine immunization programmes. Globally, about 800 000 children nevertheless still die from measles annually, half of them in Africa. Eradicating measles would therefore play an important role in improving children's survival. The 24th Pan American Sanitary Conference in 1994 established a goal of eradicating measles from the Americas. Progress to date has been remarkable and the disease is no longer endemic in the Americas, with most countries having documented interruption of transmission. As of November 2003, 12 months had elapsed since the last indigenous case was detected in Venezuela. This experience shows that measles transmission can be interrupted, and that this can be sustained over a long period of time. Global eradication is feasible if an appropriate strategy is implemented. Even under a new paradigm in which immunization is not discontinued after measles is eradicated, eradication will be a good investment to avoid expensive epidemics and save the lives of almost one million children annually. A world free of measles by 2015 is not a dream. PMID:15042236

  11. The effects of vitamin A supplementation with measles vaccine on leucocyte counts and in vitro cytokine production.

    PubMed

    Jensen, Kristoffer Jarlov; Fisker, Ane Bærent; Andersen, Andreas; Sartono, Erliyani; Yazdanbakhsh, Maria; Aaby, Peter; Erikstrup, Christian; Benn, Christine Stabell

    2016-02-28

    As WHO recommends vitamin A supplementation (VAS) at vaccination contacts after age 6 months, many children receive VAS together with measles vaccine (MV). We aimed to investigate the immunological effect of VAS given with MV. Within a randomised placebo-controlled trial investigating the effect on overall mortality of providing VAS with vaccines in Guinea-Bissau, we conducted an immunological sub-study of VAS v. placebo with MV, analysing leucocyte counts, whole blood in vitro cytokine production, vitamin A status and concentration of C-reactive protein (CRP). VAS compared with placebo was associated with an increased frequency of CRP ≥ 5 mg/l (28 v. 12%; P=0·005). Six weeks after supplementation, VAS had significant sex-differential effects on leucocyte, lymphocyte, monocyte and basophil cell counts, decreasing them in males but increasing them in females. Mainly in females, the effect of VAS on cytokine responses differed by previous VAS: in previous VAS recipients, VAS increased the pro-inflammatory and T helper cell type 1 (Th1) cytokine responses, whereas VAS decreased these responses in previously unsupplemented children. In previous VAS recipients, VAS was associated with increased IFN-γ responses to phytohaemagglutinin in females (geometric mean ratio (GMR): 3·97; 95% CI 1·44, 10·90) but not in males (GMR 0·44; 95% CI 0·14, 1·42); the opposite was observed in previously unsupplemented children. Our results corroborate that VAS provided with MV has immunological effects, which may depend on sex and previous VAS. VAS may increase the number of leucocytes, but also repress both the innate and lymphocyte-derived cytokine responses in females, whereas this repression may be opposite if the females have previously received VAS.

  12. Two-year experience of using the measles, mumps and rubella vaccine as intralesional immunotherapy for warts.

    PubMed

    Na, C H; Choi, H; Song, S H; Kim, M S; Shin, B S

    2014-07-01

    The currently available treatments for warts, including cryosurgery, laser surgery, electrosurgery, and topical keratolytic applications, are often very painful and can induce disfiguring scars. Recently, intralesional immunotherapy with skin test antigens and vaccines has been shown to be effective in the management of warts. To evaluate the efficacy of a new intralesional immunotherapy for warts, using the measles, mumps and rubella (MMR) vaccine. A retrospective study was performed, and we enrolled 136 patients with various types of warts into the study, which was for a duration of 2 years. Patients were treated for a total of six times at 2-week intervals. The treatment response was classified as one of three levels, based on reduction in the size and number of warts, and patients with complete response (CR) were checked for recurrence. Clinical evaluations were carried out using photographs and medical records. Over half (51.5%) of patients experienced > 50% reduction in the size and number of warts, and 46.7% who had distant warts (in different locations) showed good response. Common warts showed significantly higher treatment response than other types of warts (P < 0.05). However, other clinical variables did not have any effect on efficacy. Almost all the patients reported mild pain during the injection, but other side effects were rarely observed. Only 5.6% of patients who experienced CR had recurrence of warts after 6 months. We suggest that intralesional immunotherapy with MMR vaccine is a tolerable and effective method for patients who are sensitive to pain, concerned about side effects, or have common warts. Treatment response is improved by increasing the number of injections. © 2014 British Association of Dermatologists.

  13. Encephalopathy after whole-cell pertussis or measles vaccination: lack of evidence for a causal association in a retrospective case-control study.

    PubMed

    Ray, Paula; Hayward, Jean; Michelson, David; Lewis, Edwin; Schwalbe, Joan; Black, Steve; Shinefield, Henry; Marcy, Michael; Huff, Ken; Ward, Joel; Mullooly, John; Chen, Robert; Davis, Robert

    2006-09-01

    Whole-cell pertussis (wP) and measles vaccines are effective in preventing disease but have also been suspected of increasing the risk of encephalopathy or encephalitis. Although many countries now use acellular pertussis vaccines, wP vaccine is still widely used in the developing world. It is therefore important to evaluate whether wP vaccine increases the risk of neurologic disorders. A retrospective case-control study was performed at 4 health maintenance organizations. Records from January 1, 1981, through December 31, 1995, were examined to identify children aged 0 to 6 years old hospitalized with encephalopathy or related conditions. The cause of the encephalopathy was categorized as known, unknown or suspected but unconfirmed. Up to 3 controls were matched to each case. Conditional logistic regression was used to analyze the relative risk of encephalopathy after vaccination with diphtheria-tetanus-pertussis (DTP) or measles-mumps-rubella (MMR) vaccines in the 90 days before disease onset as defined by chart review compared with an equivalent period among controls indexed by matching on case onset date. Four-hundred fifty-two cases were identified. Cases were no more likely than controls to have received either vaccine during the 90 days before disease onset. When encephalopathies of known etiology were excluded, the odds ratio for case children having received DTP within 7 days before onset of disease was 1.22 (95% confidence interval [CI] = 0.45-3.31, P = 0.693) compared with control children. For MMR in the 90 days before onset of encephalopathy, the odds ratio was 1.23 (95% confidence interval = 0.51-2.98, P = 0.647). In this study of more than 2 million children, DTP and MMR vaccines were not associated with an increased risk of encephalopathy after vaccination.

  14. Combination Measles-Mumps-Rubella-Varicella Vaccine in Healthy Children: A Systematic Review and Meta-analysis of Immunogenicity and Safety.

    PubMed

    Ma, Shu-Juan; Li, Xing; Xiong, Yi-Quan; Yao, A-Ling; Chen, Qing

    2015-11-01

    A combined measles-mumps-rubella-varicella (MMRV) vaccine is expected to facilitate universal immunization against these 4 diseases. This study was undertaken to synthesize current research findings of the immunogenicity and safety of MMRV in healthy children.We searched PubMed, Embase, BIOSIS Previews, Web of Science, Cochrane Library, and other databases through September 9, 2014. Eligible randomized controlled trials (RCTs) were selected and collected independently by 2 reviewers. Meta-analysis was conducted using Stata 12.0 and RevMan 5.3.Twenty-four RCTs were included in qualitative synthesis. Nineteen RCTs compared single MMRV dose with measles-mumps-rubella vaccine with or without varicella vaccine (MMR + V/MMR). Similar seroconversion rates of these 4 viruses were found between comparison groups. There were comparable geometric mean titers (GMTs) against mumps and varicella viruses between MMRV group and MMR + V/MMR group. MMRV group achieved enhanced immune response to measles component, with GMT ratio of 1.66 (95% confidence interval [CI] 1.48, 1.86; P < 0.001) for MMRV versus MMR and 1.62 (95% CI 1.51, 1.70; P < 0.001) for MMRV versus MMR + V. Meanwhile, immune response to rubella component in MMRV group was slightly reduced, GMT ratios were 0.81 (95% CI 0.78, 0.85; P < 0.001) and 0.79 (95% CI 0.76, 0.83; P < 0.001), respectively. Well tolerated safety profiles were demonstrated except higher incidence of fever (relative risks 1.12-