Science.gov

Sample records for measles vaccination schedule

  1. Measles

    MedlinePlus

    ... most, measles protection is part of the measles-mumps-rubella vaccine (MMR) or measles-mumps-rubella-varicella vaccine (MMRV) given when they're ... Encephalitis Rubella (German Measles) Your Child's Immunizations: Measles, Mumps & Rubella Vaccine (MMR) Immunization Schedule Frequently Asked Questions ...

  2. Measles 50 Years After Use of Measles Vaccine.

    PubMed

    Goodson, James L; Seward, Jane F

    2015-12-01

    In response to severe measles, the first measles vaccine was licensed in the United States in 1963. Widespread use of measles vaccines for more than 50 years has significantly reduced global measles morbidity and mortality. However, measles virus continues to circulate, causing infection, illness, and an estimated 400 deaths worldwide each day. Measles is preventable by vaccine, and humans are the only reservoir. Clinicians should promote and provide on-time vaccination for all patients and keep measles in their differential diagnosis of febrile rash illness for rapid case detection, confirmation of measles infection, isolation, treatment, and appropriate public health response.

  3. Measles vaccination before the measles-mumps-rubella vaccine.

    PubMed

    Hendriks, Jan; Blume, Stuart

    2013-08-01

    At the beginning of the 1960s, it was clear that a vaccine against measles would soon be available. Although measles was (and remains) a killer disease in the developing world, in the United States and Western Europe this was no longer so. Many parents and many medical practitioners considered measles an inevitable stage of a child's development. Debating the desirability of measles immunization, public health experts reasoned differently. In the United States, introduction of the vaccine fit well with Kennedy's and Johnson's administrations' political commitments. European policymakers proceeded cautiously, concerned about the acceptability of existing vaccination programs. In Sweden and the Netherlands, recent experience in controlling polio led researchers to prefer an inactivated virus vaccine. Although in the early 1970s attempts to develop a sufficiently potent inactivated vaccine were abandoned, we have argued that the debates and initiatives of the time during the vaccine's early history merit reflection in today's era of standardization and global markets.

  4. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Measles Vaccine. 113.313 Section 113... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture... for preparing the production seed virus for vaccine production. All serials of vaccine shall...

  5. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Measles Vaccine. 113.313 Section 113... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture... for preparing the production seed virus for vaccine production. All serials of vaccine shall...

  6. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Measles Vaccine. 113.313 Section 113... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture... for preparing the production seed virus for vaccine production. All serials of vaccine shall...

  7. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Measles Vaccine. 113.313 Section 113... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture... for preparing the production seed virus for vaccine production. All serials of vaccine shall...

  8. 9 CFR 113.313 - Measles Vaccine.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Measles Vaccine. 113.313 Section 113... Vaccines § 113.313 Measles Vaccine. Measles Vaccine shall be prepared from virus-bearing cell culture... for preparing the production seed virus for vaccine production. All serials of vaccine shall...

  9. Measles vaccination and inflammatory bowel disease: controversy laid to rest?

    PubMed

    Davis, R L; Bohlke, K

    2001-01-01

    The increasing incidence of Crohn's disease has lead to speculation about changes in exposures to environmental or infectious agents. Considerable attention has focused on the role of measles infection and/or vaccination in the pathogenesis of Crohn's disease and ulcerative colitis. Current evidence regarding the association between measles vaccination and inflammatory bowel disease (IBD) comprises analytic epidemiological studies, a case-series report and ecological studies. The first of these, a 1995 cohort study, found an association between measles vaccination and Crohn's disease and ulcerative colitis, but was widely questioned on methodological grounds. This was followed by a 1997 case-control study showing no association between measles vaccination and IBD. In 1998, public concern was rekindled by a report of 12 children with nonspecific colitis, ileal-lymphoid-nodular hyperplasia, and developmental disorders largely attributed to measles-mumps-rubella vaccine, but the nature of the report limited its scientific conclusions. Two additional studies, one case-control and one cohort, then followed and neither found an association with measles vaccination. Of the several ecological studies of measles vaccine coverage or measles schedule changes, none found an association with rates of IBD. The role of measles infection in IBD has been examined more extensively with studies of in utero measles exposure, measles infection early in life, and laboratory based investigations. An initial report of high rates of Crohn's disease among pregnancies affected by measles infection was followed by negative studies. Numerous case-control and ecological studies of children with measles infections early in life have also had discordant findings. Of three recent cohort studies, two showed no relationship between infection with early measles exposure and risk for IBD, while one found an approximate 3-fold elevation in risk. Laboratory investigations into persistent measles

  10. Measles Vaccination Before the Measles-Mumps-Rubella Vaccine

    PubMed Central

    Hendriks, Jan

    2013-01-01

    At the beginning of the 1960s, it was clear that a vaccine against measles would soon be available. Although measles was (and remains) a killer disease in the developing world, in the United States and Western Europe this was no longer so. Many parents and many medical practitioners considered measles an inevitable stage of a child’s development. Debating the desirability of measles immunization, public health experts reasoned differently. In the United States, introduction of the vaccine fit well with Kennedy’s and Johnson’s administrations’ political commitments. European policymakers proceeded cautiously, concerned about the acceptability of existing vaccination programs. In Sweden and the Netherlands, recent experience in controlling polio led researchers to prefer an inactivated virus vaccine. Although in the early 1970s attempts to develop a sufficiently potent inactivated vaccine were abandoned, we have argued that the debates and initiatives of the time during the vaccine’s early history merit reflection in today’s era of standardization and global markets. PMID:23763422

  11. Measles

    MedlinePlus

    ... measles protection is part of the measles-mumps-rubella vaccine (MMR) or measles-mumps-rubella-varicella vaccine (MMRV) given when they're 12 ... to Ease My Child's Fear of Shots? Encephalitis Rubella (German Measles) Your Child's Immunizations: Measles, Mumps & Rubella ...

  12. Absence of detectable measles virus genome sequence in blood of autistic children who have had their MMR vaccination during the routine childhood immunization schedule of UK.

    PubMed

    Afzal, M A; Ozoemena, L C; O'Hare, A; Kidger, K A; Bentley, M L; Minor, P D

    2006-05-01

    Leukocyte preparations from children with documented evidence of MMR vaccination and confirmed diagnosis of autism were examined by several assays designed to target multiple regions of the measles virus genome sequence. No sample was found positive by any method. The assays applied were highly sensitive, specific and robust in nature, and were based on the amplification of measles virus RNA transcripts by real-time quantitative RT-PCR (QRT-PCR) as well as by conventional RT-PCR-nested PCR. The assays applied were potentially able to detect measles virus RNA down to single figure copy numbers per reaction. The amount of total nucleic acid extract of leukocytes subjected to various measles virus-specific investigations was several fold higher than minimally required of a sample where measles virus persistence is well documented. This study failed to substantiate reports of the persistence of measles virus in autistic children with development regression.

  13. Arthritis after mumps and measles vaccination.

    PubMed Central

    Nussinovitch, M; Harel, L; Varsano, I

    1995-01-01

    Measles, mumps, and rubella vaccine carries a risk of joint symptoms particularly in children under 5 years. A boy who presented with an inflamed knee after measles and mumps vaccination is reported; synovial fluid aspirated from the joint contained 4.3 x 10(9)/l leucocytes. It is thought that the mumps component is the aetiological cause of acute monoarthritis. PMID:7763072

  14. Measles Vaccination in the Presence or Absence of Maternal Measles Antibody: Impact on Child Survival

    PubMed Central

    Aaby, Peter; Martins, Cesário L.; Garly, May-Lill; Andersen, Andreas; Fisker, Ane B.; Claesson, Mogens H.; Ravn, Henrik; Rodrigues, Amabelia; Whittle, Hilton C.; Benn, Christine S.

    2014-01-01

    Background. Measles vaccine (MV) has a greater effect on child survival when administered in early infancy, when maternal antibody may still be present. Methods. To test whether MV has a greater effect on overall survival if given in the presence of maternal measles antibody, we reanalyzed data from 2 previously published randomized trials of a 2-dose schedule with MV given at 4–6 months and at 9 months of age. In both trials antibody levels had been measured before early measles vaccination. Results. In trial I (1993–1995), the mortality rate was 0.0 per 1000 person-years among children vaccinated with MV in the presence of maternal antibody and 32.3 per 1000 person-years without maternal antibody (mortality rate ratio [MRR], 0.0; 95% confidence interval [CI], 0–.52). In trial II (2003–2007), the mortality rate was 4.2 per 1000 person-years among children vaccinated in presence of maternal measles antibody and 14.5 per 1000 person-years without measles antibody (MRR, 0.29; 95% CI, .09–.91). Possible confounding factors did not explain the difference. In a combined analysis, children who had measles antibody detected when they received their first dose of MV at 4–6 months of age had lower mortality than children with no maternal antibody, the MRR being 0.22 (95% CI, .07–.64) between 4–6 months and 5 years. Conclusions. Child mortality in low-income countries may be reduced by vaccinating against measles in the presence of maternal antibody, using a 2-dose schedule with the first dose at 4–6 months (earlier than currently recommended) and a booster dose at 9–12 months of age. Clinical Trials Registration. NCT00168558. PMID:24829213

  15. NLM Grantee's "HealthMap" Helps Uncover Measles Vaccination Gap

    MedlinePlus

    ... of NLM NLM Grantee's "HealthMap" Helps Uncover Measles Vaccination Gap Inadequate vaccine coverage is likely a driving ... stop this and future measles outbreaks is through vaccination." The research indicates that vaccine coverage among the ...

  16. Measles and measles vaccination in an African village*

    PubMed Central

    Morley, David C.; Woodland, Margaret; Krugman, Saul; Friedman, Harriet; Grab, Bernard

    1964-01-01

    Over the last five years, a number of reports have appeared drawing attention to the serious results of measles in young West African children. This is borne out by observations over a three-year period on children in the village of Imesi, which showed measles to be a severe and often fatal disease. The original live attenuated measles vaccine developed by Enders has been shown to give good protection and, in combination with immune serum, has been widely used in the USA. However, the need to combine it with immune serum severely limits its usefulness, owing to the small quantities of serum available and the high cost. In the present study, the reaction produced by the original vaccine with immune serum was compared with the reaction produced by a further attenuated vaccine without serum. The latter gave significantly fewer and less severe reactions, but produced a satisfactory serological response. This new vaccine should facilitate large-scale immunization of children in areas such as West Africa where protection against measles is urgently required. PMID:14196817

  17. [Costs and benefits of measles vaccination].

    PubMed

    Ambrosch, F; Wiedermann, G; Harasek, G

    1978-02-23

    Former calculations of the medical benefit of measles immunization, concerning frequency of measles complications, effectiveness and risk of vaccination, showed that measles vaccination is a very useful measure. As the decision to introduce vaccination on a broad scale depends on financial deliberations, too, a cost-benefit analysis for Austria has been performed and the cost-benefit ratio as well as the cost-benefit difference calculated. The costs of measles vaccination which is performed mainly by private pediatricians at the present time, include costs of vaccine, physician and additional antipyretic and is 257.90 AS. The average costs of therapy per child consist of home treatment (287.20 AS), hospital treatment (162.50 AS) and care of residual cerebral damage (88.50 AS). Together with the costs of one week vacation which is warranted in Austria for the nursing of a sick child once a year, this makes a total sum of 1081.--AS. From these data the cost-benefit ratio was calculated by 2.95, the cost-benefit difference by 715.--AS per child. 5 years after the start of general measles vaccination of 1 year old children the accumulated costs of vaccination are equalled by the profit gained by prevention of the disease. The annual cost-benefit difference is positive after 3 years. 10 years after introduction of general vaccination the accumulated cost-benefit difference in Austria would be approximately 167 Mill. AS.

  18. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  19. Measles

    MedlinePlus

    ... stop it in its tracks. Doctors call this "herd immunity." Measles isn't very common, but it is ... t get the vaccine get some protection through herd immunity. During a measles outbreak, some people who haven' ...

  20. Measles

    MedlinePlus

    ... it in its tracks. Doctors call this "herd immunity." Measles isn't very common, but it is ... get the vaccine get some protection through herd immunity. During a measles outbreak, some people who haven' ...

  1. [Measles, mumps, and rubella vaccine. Resurgence of measles in Europe].

    PubMed

    Garcés-Sánchez, María; Renales-Toboso, María; Bóveda-García, María; Díez-Domingo, Javier

    2015-12-01

    Measles is a rash illness of moderate severity and high risk of serious complications, with recovery in several weeks. It is a viral disease caused by one of the most infectious and contagious pathogens that exists, whose only known reservoir is human. In 1998, the European Region of the WHO set a target of eliminating measles by 2010. This goal has not been achieved. Furthermore, it has been observed the resurgence of the disease in some parts of Europe. We review the disease and its vaccines as well as the epidemiological and social factors that have so far prevented the total control of the disease.

  2. Measles vaccination using a microneedle patch.

    PubMed

    Edens, Chris; Collins, Marcus L; Ayers, Jessica; Rota, Paul A; Prausnitz, Mark R

    2013-07-25

    Measles vaccination programs would benefit from delivery methods that decrease cost, simplify logistics, and increase safety. Conventional subcutaneous injection is limited by the need for skilled healthcare professionals to reconstitute and administer injections, and by the need for safe needle handling and disposal to reduce the risk of disease transmission through needle re-use and needlestick injury. Microneedles are micron-scale, solid needles coated with a dry formulation of vaccine that dissolves in the skin within minutes after patch application. By avoiding the use of hypodermic needles, vaccination using a microneedle patch could be carried out by minimally trained personnel with reduced risk of blood-borne disease transmission. The goal of this study was to evaluate measles vaccination using a microneedle patch to address some of the limitations of subcutaneous injection. Viability of vaccine virus dried onto a microneedle patch was stabilized by incorporation of the sugar, trehalose, and loss of viral titer was less than 1 log10(TCID50) after storage for at least 30 days at room temperature. Microneedle patches were then used to immunize cotton rats with the Edmonston-Zagreb measles vaccine strain. Vaccination using microneedles at doses equaling the standard human dose or one-fifth the human dose generated neutralizing antibody levels equivalent to those of a subcutaneous immunization at the same dose. These results show that measles vaccine can be stabilized on microneedles and that vaccine efficiently reconstitutes in vivo to generate a neutralizing antibody response equivalent to that generated by subcutaneous injection.

  3. Measles vaccination using a microneedle patch☆

    PubMed Central

    Edens, Chris; Collins, Marcus L.; Ayers, Jessica; Rota, Paul A.; Prausnitz, Mark R.

    2013-01-01

    Measles vaccination programs would benefit from delivery methods that decrease cost, simplify logistics, and increase safety. Conventional subcutaneous injection is limited by the need for skilled healthcare professionals to reconstitute and administer injections, and by the need for safe needle handling and disposal to reduce the risk of disease transmission through needle re-use and needlestick injury. Microneedles are micron-scale, solid needles coated with a dry formulation of vaccine that dissolves in the skin within minutes after patch application. By avoiding the use of hypodermic needles, vaccination using a microneedle patch could be carried out by minimally trained personnel with reduced risk of blood-borne disease transmission. The goal of this study was to evaluate measles vaccination using a microneedle patch to address some of the limitations of subcutaneous injection. Viability of vaccine virus dried onto a microneedle patch was stabilized by incorporation of the sugar, trehalose, and loss of viral titer was less than 1 log10(TCID50) after storage for at least 30 days at room temperature. Microneedle patches were then used to immunize cotton rats with the Edmonston-Zagreb measles vaccine strain. Vaccination using microneedles at doses equaling the standard human dose or one-fifth the human dose generated neutralizing antibody levels equivalent to those of a subcutaneous immunization at the same dose. These results show that measles vaccine can be stabilized on microneedles and that vaccine efficiently reconstitutes in vivo to generate a neutralizing antibody response equivalent to that generated by subcutaneous injection. PMID:23044406

  4. Childhood Vaccine Schedule

    MedlinePlus

    ... Navigation Bar Home Current Issue Past Issues Childhood Vaccine Schedule Past Issues / Spring 2008 Table of Contents ... please turn Javascript on. When to Vaccinate What Vaccine Why Birth (or any age if not previously ...

  5. Reasons for Non-vaccination among Patients Who Acquired Measles Lessons from the Local Measles Epidemics in Japan

    PubMed Central

    Takahashi, K; Kanda, H; Kim, J-Y

    2014-01-01

    ABSTRACT A survey was conducted at a private general hospital, exploring the reasons why children with measles had missed opportunities for vaccination during the local measles epidemics that occurred in Japan between 1999 and 2003. The responses from parents/guardians of confirmed measles patients (n = 120) indicated the following: more than half of the parents/guardians were too busy or forgot to have their children immunized and 32% refrained from immunization due to anti-vaccine views. Healthcare workers should consider that parents/guardians who are willing to immunize their children may miss opportunities to do so because they are busy, and not because of anti-vaccine attitudes. Healthcare workers should keep in mind that it is important to provide honest information on the potential risks and benefits of the vaccine, while informing parents/guardians of the vaccination schedule. PMID:25803382

  6. Measles

    MedlinePlus

    ... case and death rates, are key public health strategies to reduce global measles deaths. The measles vaccine has been in ... 2012, the M&R Initiative launched a new Global Measles and Rubella ... strategies for country immunization managers, working with domestic and ...

  7. Measles vaccination and prevention in big cities in China.

    PubMed

    Meina, Li; Xiaodong, Liu; Lulu, Zhang

    2015-01-01

    Despite the tremendous progress in controlling measles in China, there was measles outbreak in Beijing which was a result of cluster of unvaccinated people or people failure to vaccinate. In order to accelerate measles control efforts and achieve and high levels of measles immunity, it is helpful to implement more targeted management strategy.

  8. Measles in the United Kingdom 1990-2008 and the effectiveness of measles vaccines.

    PubMed

    Jick, Hershel; Hagberg, Katrina Wilcox

    2010-06-23

    We identified all children in the UK General Practice Research Database diagnosed with measles from 1990 to 2008 and calculated annual incidence according to age and geographic region by dividing the number of cases per year by the number of children who were active in the population. We evaluated the effectiveness of the measles vaccines by comparing the vaccination histories of children who were diagnosed with measles (cases) to children who were not (controls). The annual incidence of measles fell after the introduction of the MMR vaccine in late 1988. However, a modest outbreak of measles occurred in 1994, leading to large nationwide programs to immunize children. Since 1996, the incidence of measles has fallen by more than 80%. Prior measles vaccination is highly effective and has substantially reduced the risk of measles.

  9. Decreasing Seroprevalence of Measles Antibodies after Vaccination – Possible Gap in Measles Protection in Adults in the Czech Republic

    PubMed Central

    Smetana, Jan; Chlibek, Roman; Hanovcova, Irena; Sosovickova, Renata; Smetanova, Libuse; Gal, Peter; Dite, Petr

    2017-01-01

    Aims In recent years, Europe has recorded an increase in the number of measles outbreaks despite the implementation of vaccination into the National Immunization Programs. The Czech Republic introduced vaccination against measles into National Immunization Program in 1969. The aim of this study was to determine seroprevalence of IgG antibodies against measles in adults. Methods Our study was designed as a prospective, multicenter cohort study. Samples of blood were taken from adults aged 18 years and over. Specific IgG antibodies were determined by ELISA method. Results A number of 1911 sera samples were obtained. The total seropositivity reached 83.3%, 14.3% of the results were negative and 2.4% were borderline. When comparing the individual age groups, the highest antibody seropositivity (> 96%) was detected in persons aged 50 years and over who were naturally infected in pre-vaccine era. The lowest seropositivity was recorded in the age groups 30–39 years (61.5%), 40–49 years (77.5%) and 18–29 years (81.1%). Conclusions A long term high rate of seropositivity persists after natural measles infection. By contrast, it decreases over time after vaccination. Similarly, the concentrations of antibodies in persons with measles history persist for a longer time at a higher level than in vaccinated persons. Our results indicate possible gap in measles protection in adults born after implementation of vaccination into the National Immunization Programs. There are two probable reasons, decrease of measles antibody seropositivity in time after vaccination in setting of limited natural booster and one-dose vaccination schedule used in the first years after implementation. PMID:28085960

  10. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate.

  11. Genetic characterization of measles vaccine strains.

    PubMed

    Bankamp, Bettina; Takeda, Makoto; Zhang, Yan; Xu, Wenbo; Rota, Paul A

    2011-07-01

    The complete genomic sequences of 9 measles vaccine strains were compared with the sequence of the Edmonston wild-type virus. AIK-C, Moraten, Rubeovax, Schwarz, and Zagreb are vaccine strains of the Edmonston lineage, whereas CAM-70, Changchun-47, Leningrad-4 and Shanghai-191 were derived from 4 different wild-type isolates. Nucleotide substitutions were found in the noncoding regions of the genomes as well as in all coding regions, leading to deduced amino acid substitutions in all 8 viral proteins. Although the precise mechanisms involved in the attenuation of individual measles vaccines remain to be elucidated, in vitro assays of viral protein functions and recombinant viruses with defined genetic modifications have been used to characterize the differences between vaccine and wild-type strains. Although almost every protein contributes to an attenuated phenotype, substitutions affecting host cell tropism, virus assembly, and the ability to inhibit cellular antiviral defense mechanisms play an especially important role in attenuation.

  12. Mumps, measles and rubella vaccination in children with PFAPA syndrome.

    PubMed

    Kraszewska-G Omba, Barbara; Matkowska-Kocjan, Agnieszka; Mi Kiewicz, Katarzyna; Szyma Ska-Toczek, Zofia; Wójcik, Marta; Bany, Dorota; Szenborn, Leszek

    2016-11-21

    There is no published data regarding immunologic response to vaccinations in children with PFAPA syndrome (periodic fever, aphthous stomatitis, pharyngitis and cervical adenitis). The aim of this study was to evaluate mumps, measles and rubella immunity in children with PFAPA. 31 children with PFAPA syndrome and 22 healthy children (control group - CG) were recruited to the study. All children were previously vaccinated with one dose of MMR vaccine according to the Polish obligatory vaccination schedule. The patients from both groups were evaluated for anti-measles, anti-mumps and anti-rubella IgG antibodies concentrations (ELISA tests; the reference values for protective antibody levels were 150IU/L, 16RU/L and 11IU/ml respectively). The percentage of patients with protective antibodies levels was as follows: measles - 93.55% of PFAPA and 95.45% of CG patients (p=0.77); mumps - 74.19% of PFAPA and 95.45% of CG patients (p=0.02); rubella - 80.65% of PFAPA and 90.9% of CG patients (p=0.30).

  13. Measles Virus Infection Among Vaccinated and Unvaccinated Children in Nigeria

    PubMed Central

    Adeniji, Johnson A.; Olusola, Babatunde A.; Motayo, Babatunde O.; Akintunde, Grace B.

    2015-01-01

    Abstract This study investigated measles infection in vaccinated and unvaccinated children presenting with fever and maculopapular rash during measles outbreaks in the southern and western states of Nigeria. Measles, an acute viral illness caused by a virus in the family Paramyxoviridae, is a vaccine-preventable disease. Measles outbreak is common in Nigeria, despite the national immunization program. Children presenting with symptoms of measles infection in general hospitals and health centers in the states of southern and western Nigeria were recruited for this study. Vaccination history, clinical details, and 5 mL of blood were obtained from the children. Their sera samples were screened for specific immunoglobulin M antibodies to measles virus. Of 234 children tested (124 [53.2%] female), 133 (56.8%) had previously been vaccinated against measles virus, while 93 (39.7%) had not been vaccinated. Vaccination information for eight children could not be retrieved. One hundred and forty-three (62.4%) had measles IgM antibodies. Of these, 79 (55.3%) had been vaccinated for measles, while 65 (44.7%) had not. Despite the ongoing vaccination program in Nigeria, a high number of children are still being infected with measles, despite their vaccination status. Therefore, there is need to identify the reason for the low level of vaccine protection. PMID:26102341

  14. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future.

  15. Measles-mumps-rubella-varicella combination vaccine (ProQuad): a guide to its use in children in the E.U.

    PubMed

    Scott, Lesley J

    2015-04-01

    In the EU, the live attenuated, tetravalent measles-mumps-rubella-varicella vaccine ProQuad is indicated for simultaneous vaccination against measles, mumps, rubella and varicella in individuals from 12 months of age using a two-dose schedule and may be used in infants from 9 months of age to conform with a national vaccination schedule, outbreak situations or travel to a region with a high prevalence of measles. Clinical data in young children indicates that vaccination with ProQuad is as immunogenic as the component vaccines, provides long-term protection against these potentially serious childhood infections and has an acceptable safety profile. Combining the viral strains of the measles-mumps-rubella vaccine M-M-RVAXPRO and the varicella vaccine Varivax in ProQuad reduces the complexity of vaccination schedules, thereby potentially improving vaccination coverage and the timeliness of vaccination.

  16. Variability in Humoral Immunity to Measles Vaccine: New Developments

    PubMed Central

    Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Whitaker, Jennifer A.; Poland, Gregory A.

    2015-01-01

    Despite the existence of an effective measles vaccine, resurgence in measles cases in the United States and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms, provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination. PMID:26602762

  17. [Safety and tolerability of monovalent measles and combined measles, mumps, rubella, and varicella vaccines].

    PubMed

    Mentzer, D; Meyer, H; Keller-Stanislawski, B

    2013-09-01

    Although effective monovalent and combined measles vaccines have been available for several decades in Germany, measles outbreaks continue to occur leading to severe cases of measles and even death. Possible reasons for the low acceptance of the measles vaccination are concerns about adverse events and serious complications following vaccination. In this report, we have summarized and assessed all adverse events reported in Germany from 2001 to 2012 after vaccination with monovalent- and combined measles-containing vaccines. A total of 1,696 suspected adverse reaction reports describing 5,297 adverse events were sent to the Paul Ehrlich Institute (PEI) between 1 January 2001 and 31 December 2012. The calculated mean reporting rate was 5.7 reports per 100,000 vaccine doses released by the PEI. Analysis of the reports indicates that measles-containing vaccines are well tolerated with a constantly low rate of adverse events reported. Compared to the high rate of serious complications following wild-type measles infection, the benefit of measles-containing vaccines clearly outweighs the anticipated risks of adverse events.

  18. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  19. Measles

    MedlinePlus

    ... protects against measles, mumps, and rubella, can cause autism. Parents and caregivers should know that: Large studies ... no connection between this or any vaccine and autism. Reviews by all major health organizations in the ...

  20. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy In every pregnancy, a woman starts out with a 3-5% chance of having a baby with a birth defect. ... exposure to measles, mumps, rubella, and the MMR vaccine may increase the risk for birth defects above ...

  1. Measles vaccination response during Kosi floods, Bihar, India 2008.

    PubMed

    Varkey, Sherin; Krishna, Gopal; Pradhan, Narottam; Gupta, Satish Kumar; Caravotta, Jorge; Hombergh, Henri Vanden; Hoekstra, Edward; Askari, Sufia; Kansal, O P

    2009-11-01

    The Kosi floods of Bihar in 2008 led to initial rapid displacement followed by rehabilitation of the affected population. Strategically planned phase-wise activity of supplementary as well as primary measles vaccination combined with a variety of other interventions proved to be successful in preventing outbreaks and deaths due to measles. While 70% supplementary measles vaccination coverage was achieved in relief camps, the coverage of primary measles doses in the latter phases was dependant on accessibility of villages and previous vaccination status of eligible beneficiaries. The integrated diseases surveillance system, which became operational during the floods, also complemented the vaccination efforts by providing daily figures of cases with fever and rash. The overall response was not only successful in terms of preventing measles mortality, but also provided vital lessons that may be useful for planning future vaccination responses in emergency settings.

  2. A short clinical review of vaccination against measles

    PubMed Central

    Barlow, Gavin; Metcalfe, Neil H

    2014-01-01

    Major epidemics of measles are again in the news across the UK because of our failure to maintain population herd immunity. This situation has occurred primarily because of a loss of public confidence in the measles, mumps and rubella (MMR) vaccine, which was never restored following the Wakefield debacle, and a lack of awareness of the potential morbidity and mortality associated with measles. This article provides healthcare professionals with a succinct overview of important clinical aspects of measles and also describes the history of measles vaccination in the UK. Restoration of herd immunity will require higher public acceptance of the MMR vaccine in the context of recognition that measles remains an important infection. While achievement of this appears to be challenging, recent UK-based research suggests that it can be ascertained. PMID:25057386

  3. Predicting the impact of measles vaccination in England and Wales: model validation and analysis of policy options.

    PubMed Central

    Babad, H. R.; Nokes, D. J.; Gay, N. J.; Miller, E.; Morgan-Capner, P.; Anderson, R. M.

    1995-01-01

    Measles incidence in England and Wales has fallen to an all-time low. Attention is now focused on preventing local outbreaks, and, in the long run, on the elimination of indigenous measles. A realistic age-structured (RAS) mathematical model of measles transmission is used to reconstruct the impact of measles vaccination in England and Wales from 1968 to the present and to evaluate the merits of future policy options. In general, the predictions of the model show good agreement with long-term age stratified case reports and seroprevalence surveys. The model underestimates the proportion of cases that are notified in 0-2-year-old children. However, recent work suggests a high degree of misdiagnosis in this age group. Projections on the basis of the existing vaccination strategy in the UK suggest that the present level of measles vaccine coverage will be insufficient to eliminate small seasonal outbreaks of measles. This result is, however, sensitive to the assumed level of vaccine efficacy. Explorations of a variety of changes to current vaccination strategy favour a 2-dose schedule with the second dose administered at age 4 years irrespective of vaccination history. A vaccination campaign in school-age children, to reduce deficits in herd immunity, would accelerate progress towards measles elimination. PMID:7705494

  4. Clinical safety issues of measles, mumps and rubella vaccines.

    PubMed Central

    Afzal, M. A.; Minor, P. D.; Schild, G. C.

    2000-01-01

    The clinical safety of measles and measles-mumps-rubella vaccines has been questioned in recent reports that propose a possible link between measles virus or measles vaccines and the occurrence of juvenile Crohn disease and autism. This article reviews the outcomes of several laboratory investigations which were carried out independently to identify the presence or absence of measles virus in the intestinal tissues derived from cases of inflammatory bowel disease. One research group reported the presence of measles virus particles and genomic RNA in inflammatory bowel disease tissues, but this could not be confirmed by other groups, despite use of techniques that are highly specific and sensitive for the detection of measles virus nucleic acid in clinical specimens down to the molecular level. Based on the published data reviewed here, it can be concluded that there is no direct association between measles virus or measles vaccines and the development of Crohn disease, a conclusion which is supported by most epidemiological findings. PMID:10743285

  5. Introducing combined measles, mumps and rubella vaccine in Chandigarh, India: issues and concerns.

    PubMed

    Bhatnagar, Nidhi; Kaur, Ravneet; Gupta, Madhu; Sharma, Deepak

    2014-06-01

    Cyclical outbreaks of mumps have been noticed across Chandigarh city during winter months. Chandigarh does not provide measles, mumps and rubella (MMR) vaccination in the State immunization schedule. Epidemiological shift in age at diagnosis of mumps was noticed with higher incidence in older children and adults. Increased occurrence of complications can be predicted with this age shift. Silent burden of rubella with serious outcomes in newborns further strengthen the case for MMR vaccine inclusion in routine immunization program of Chandigarh.

  6. Perspective on Global Measles Epidemiology and Control and the Role of Novel Vaccination Strategies

    PubMed Central

    Coughlin, Melissa M.; Beck, Andrew S.; Bankamp, Bettina; Rota, Paul A.

    2017-01-01

    Measles is a highly contagious, vaccine preventable disease. Measles results in a systemic illness which causes profound immunosuppression often leading to severe complications. In 2010, the World Health Assembly declared that measles can and should be eradicated. Measles has been eliminated in the Region of the Americas, and the remaining five regions of the World Health Organization (WHO) have adopted measles elimination goals. Significant progress has been made through increased global coverage of first and second doses of measles-containing vaccine, leading to a decrease in global incidence of measles, and through improved case based surveillance supported by the WHO Global Measles and Rubella Laboratory Network. Improved vaccine delivery methods will likely play an important role in achieving measles elimination goals as these delivery methods circumvent many of the logistic issues associated with subcutaneous injection. This review highlights the status of global measles epidemiology, novel measles vaccination strategies, and describes the pathway toward measles elimination. PMID:28106841

  7. Perspective on Global Measles Epidemiology and Control and the Role of Novel Vaccination Strategies.

    PubMed

    Coughlin, Melissa M; Beck, Andrew S; Bankamp, Bettina; Rota, Paul A

    2017-01-19

    Measles is a highly contagious, vaccine preventable disease. Measles results in a systemic illness which causes profound immunosuppression often leading to severe complications. In 2010, the World Health Assembly declared that measles can and should be eradicated. Measles has been eliminated in the Region of the Americas, and the remaining five regions of the World Health Organization (WHO) have adopted measles elimination goals. Significant progress has been made through increased global coverage of first and second doses of measles-containing vaccine, leading to a decrease in global incidence of measles, and through improved case based surveillance supported by the WHO Global Measles and Rubella Laboratory Network. Improved vaccine delivery methods will likely play an important role in achieving measles elimination goals as these delivery methods circumvent many of the logistic issues associated with subcutaneous injection. This review highlights the status of global measles epidemiology, novel measles vaccination strategies, and describes the pathway toward measles elimination.

  8. Recombinant measles AIK-C vaccine strain expressing heterologous virus antigens.

    PubMed

    Nakayama, Tetsuo; Sawada, Akihito; Yamaji, Yoshiaki; Ito, Takashi

    2016-01-04

    Further attenuated measles vaccines were developed more than 50 years ago and have been used throughout the world. Recombinant measles vaccine candidates have been developed and express several heterologous virus protective antigens. Immunogenicity and protective actions were confirmed using experimental animals: transgenic mice, cotton rats, and primates. The recent development of measles vaccine-based vectored vaccine candidates has been reviewed and some information on recombinant measles vaccines expressing respiratory syncytial virus proteins has been shown and discussed.

  9. Adding interventions to mass measles vaccinations in India

    PubMed Central

    Verguet, Stéphane; Morris, Shaun K; Sharma, Jitendar K; Ram, Usha; Gauvreau, Cindy; Jones, Edward; Jha, Prabhat; Jit, Mark

    2016-01-01

    Abstract Objective To quantify the impact on mortality of offering a hypothetical set of technically feasible, high-impact interventions for maternal and child survival during India’s 2010–2013 measles supplementary immunization activity. Methods We developed Lives Saved Tool models for 12 Indian states participating in the supplementary immunization, based on state- and sex-specific data on mortality from India’s Million Deaths Study and on health services coverage from Indian household surveys. Potential add-on interventions were identified through a literature review and expert consultations. We quantified the number of lives saved for a campaign offering measles vaccine alone versus a campaign offering measles vaccine with six add-on interventions (nutritional screening and complementary feeding for children, vitamin A and zinc supplementation for children, multiple micronutrient and calcium supplementation in pregnancy, and free distribution of insecticide-treated bednets). Findings The measles vaccination campaign saved an estimated 19 016 lives of children younger than 5 years. A hypothetical campaign including measles vaccine with add-on interventions was projected to save around 73 900 lives (range: 70 200–79 300), preventing 73 700 child deaths (range: 70 000–79 000) and 300 maternal deaths (range: 200–400). The most effective interventions in the whole package were insecticide-treated bednets, measles vaccine and preventive zinc supplementation. Girls accounted for 66% of expected lives saved (12 712/19 346) for the measles vaccine campaign, and 62% of lives saved (45 721/74 367) for the hypothetical campaign including add-on interventions. Conclusion In India, a measles vaccination campaign including feasible, high-impact interventions could substantially increase the number of lives saved and mitigate gender-related inequities in child mortality. PMID:27843161

  10. A game dynamic model for vaccine skeptics and vaccine believers: measles as an example.

    PubMed

    Shim, Eunha; Grefenstette, John J; Albert, Steven M; Cakouros, Brigid E; Burke, Donald S

    2012-02-21

    Widespread avoidance of Measles-Mumps-Rubella vaccination (MMR), with a consequent increase in the incidence of major measles outbreaks, demonstrates that the effectiveness of vaccination programs can be thwarted by the public misperceptions of vaccine risk. By coupling game theory and epidemic models, we examine vaccination choice among populations stratified into two behavioral groups: vaccine skeptics and vaccine believers. The two behavioral groups are assumed to be heterogeneous with respect to their perceptions of vaccine and infection risks. We demonstrate that the pursuit of self-interest among vaccine skeptics often leads to vaccination levels that are suboptimal for a population, even if complete coverage is achieved among vaccine believers. The demand for measles vaccine across populations driven by individual self-interest was found to be more sensitive to the proportion of vaccine skeptics than to the extent to which vaccine skeptics misperceive the risk of vaccine. Furthermore, as the number of vaccine skeptics increases, the probability of infection among vaccine skeptics increases initially, but it decreases once the vaccine skeptics begin receiving the vaccination, if both behavioral groups are vaccinated according to individual self-interest. Our results show that the discrepancy between the coverages of measles vaccine that are driven by self-interest and those driven by population interest becomes larger when the cost of vaccination increases. This research illustrates the importance of public education on vaccine safety and infection risk in order to maintain vaccination levels that are sufficient to maintain herd immunity.

  11. The strategy for prevention of measles and rubella prevalence with measles-rubella (MR) vaccine in Japan.

    PubMed

    Ihara, Toshiaki

    2009-05-21

    To eliminate the indigenous measles and rubella virus by 2012 in Japan, the strategy fro prevention of measles and rubella prevalence with measles-rubella (MR) vaccine was proposed. Since the vast majority of 1-year old infants are susceptible to measles and rubella, the first MR vaccine, the first MR vaccine should be administered at 1-year old to sustain the herd immunity. Since significant elevation of measles and rubella antibody titers were eliminated in a half of children after the second dose, the second dose of of MR vaccine within 1 year before elementary school entry is the effective maneuver. Moreover, supplement MR vaccination to the teenage group and 20-29 years' group might be necessary, because the mean measles antibody titers in this group were significantly lower compared with those in the older individuals' groups.

  12. Current progress in pulmonary delivery of measles vaccine.

    PubMed

    Griffin, Diane E

    2014-06-01

    Due to the high infectivity of measles virus, achieving sufficient population immunity to interrupt transmission requires two doses of live attenuated measles virus vaccine. Subcutaneous delivery of vaccine by injection requires trained personnel, maintenance of a cold chain and safe disposal of used needles and syringes. Pulmonary vaccine delivery offers the opportunity for cost-savings and improved coverage, but requires re-licensure. Two aerosol vaccine formulations, nebulized liquid and dry powder, and multiple delivery devices have been evaluated in humans and macaques. Nebulized liquid vaccine is effective for a second dose of vaccine in older children, but less effective for primary vaccination of infants. Dry powder vaccine provides solid protection in macaques and boosts responses in immune adults, but has not yet been tested in infants.

  13. Aerosolized measles and measles-rubella vaccines induce better measles antibody booster responses than injected vaccines: randomized trials in Mexican schoolchildren.

    PubMed Central

    Bennett, John V.; Fernandez de Castro, Jorge; Valdespino-Gomez, Jose Luis; Garcia-Garcia, Ma de Lourdes; Islas-Romero, Rocio; Echaniz-Aviles, Gabriela; Jimenez-Corona, Aida; Sepulveda-Amor, Jaime

    2002-01-01

    OBJECTIVE: To compare antibody responses and side-effects of aerosolized and injected measles vaccines after revaccination of children enrolling in elementary schools. METHODS: Vaccines for measles (Edmonston-Zagreb) or measles-rubella (Edmonston-Zagreb with RA27/3) were given by aerosol or injection to four groups of children. An additional group received Schwarz measles vaccine by injection. These five groups received vaccines in usual standard titre doses. A sixth group received only 1000 plaque-forming units of Edmonston-Zagreb vaccine by aerosol. The groups were randomized by school. Concentrations of neutralizing antibodies were determined in blood specimens taken at baseline and four months after vaccination from randomized subgroups (n = 28-31) of children in each group. FINDINGS: After baseline antibody titres were controlled for, the frequencies of fourfold or greater increases in neutralizing antibodies did not differ significantly between the three groups that received vaccine by aerosol (range 52%-64%), but they were significantly higher than those for the three groups that received injected vaccine (range 4%-23%). Mean increases in titres and post-vaccination geometric mean titres paralleled these findings. Fewer side-effects were noted after aerosol than injection administration of vaccine. CONCLUSION: Immunogenicity of measles vaccine when administered by aerosol is superior to that when the vaccine is given by injection. This advantage persists with aerosolized doses less than or equal to one-fifth of usual injected doses. The efficacy and cost-effectiveness of measles vaccination by aerosol should be further evaluated in mass campaigns. PMID:12471401

  14. [Vaccination schedule of the Spanish Association of Pediatrics: recommendations 2007].

    PubMed

    Bernaola Iturbe, E; Giménez Sánchez, F; Baca Cots, M; de Juan Martín, F; Díez Domingo, J; Garcés Sánchez, M; Gómez-Campderá, A; Martinón-Torres, F; Picazo, J J; Pineda Solás, V

    2007-01-01

    The Vaccine Advisory Committee of the Spanish Association of Pediatrics provides information on the new developments in vaccines that have taken place in 2006 and recommends certain modifications to the Immunization Schedule for 2007. To ensure early protection, the measles-mumps-rubella (MMR) vaccine booster dose should be administered when children start school (3-4 years). Based on existing scientific evidence, the importance of universal heptavalent conjugate pneumococcal vaccination, as occurs in most similar European countries and in the autonomous community of Madrid in Spain, is confirmed. The safety and efficacy of rotavirus and human papilloma virus vaccines, as well as their use in our environment, is discussed and the role of pediatricians in their implementation is stressed. The recommended immunization schedule for children and adolescents starting vaccination late is also discussed.

  15. Immunogenic measles antigens expressed in plants: role as an edible vaccine for adults.

    PubMed

    Muller, Claude P; Marquet-Blouin, Estelle; Fack, Fred; Damien, Benjamin; Steinmetz, Andŕe; Bouche, Fabienne B

    2003-01-30

    Vaccine-induced immunity against measles is less robust than natural immunity. Waning of immunity in vaccines may eventually require a revaccination of adults. Measles antigens expressed in plants have been shown to be antigenic and immunogenic both after invasive and oral vaccination. Strategies for the vaccination of adults, the potential of an oral measles vaccine produced in edible plants and the design of suitable antigens are discussed.

  16. Successful administration of measles-rubella-mumps vaccine by graded challenge in a case with anaphylaxis after prior vaccination.

    PubMed

    Tuncel, Tuba; Sancakli, Ozlem; Ozdogru, Ece

    2017-04-01

    Egg allergy is one of the most common food allergies during childhood along with cow's milk allergy. The measles-mumpsrubella (MMR) vaccine is included in the pediatric immunization schedule and contains egg protein. The currently accepted opinion is that the MMR vaccination should be done in a single dose under medical observation in patients with egg allergy. Although it is reported that the MMR vaccine is safe for that patients, there are some patients who developed anaphylaxis. Generally, the development of anaphylaxis after the previous vaccination is reported as a contraindication. We present a successful administration of MMR vaccine by gradually increased doses for a patient who developed anaphylaxis after the previous vaccination.

  17. Measles incidence rate and a phylogenetic study of contemporary genotype H1 measles strains in China: is an improved measles vaccine needed?

    PubMed

    Shi, Jingwei; Zheng, Jingtong; Huang, Honglan; Hu, Yu; Bian, Jiang; Xu, Deqi; Li, Fan

    2011-12-01

    The incidence of measles in China has increased over the last decade. To evaluate the genetic variation of measles strains, 16 measles wild-type virus strains were isolated from 14 vaccinated cases and 2 nonvaccinated cases in Jilin Province during 2005-2006, and their nucleoprotein (N) and hemagglutinin (H) genes were amplified by RT-PCR. The amplified products were sequenced and compared with the Edmonston virus and the existing vaccine strains (Changchun-47 and Shanghai-191). The results showed that the variation rate between the vaccine and wild-type strains was 9.8-12.0% in the N gene and 5.9-6.9% in the H gene, respectively. In addition, cross-neutralization assays revealed that although sera obtained from infants following primary vaccination effectively neutralized vaccine strains, the capacity in neutralizing H1 wild-type measles virus isolates was decreased fourfold. Antigenic ratios testing revealed that the antigenic relatedness between wild-type measles viruses and existing vaccine strains was notably low. These data suggest that the increased incidence of measles in Jilin Province may be attributed to the antigenic drift between wild-type and vaccine strains. Our findings strengthen the recommendation of supplemental immunization with existing vaccines and also strongly suggest a need for developing new vaccines to better control measles virus outbreaks.

  18. A further study on measles vaccination in Nigerian children*

    PubMed Central

    Hendrickse, R. G.; Montefiore, D.; Sherman, P. M.; Sofoluwe, G. O.

    1965-01-01

    Measles is a serious disease in Nigeria, causing severe morbidity and appreciable mortality; it occurs almost exclusively in the pre-school child with a peak incidence in the second year of life. A safe measles vaccine would be of inestimable value both in that country and in other areas where the disease constitutes a grave menace. Studies using vaccines of the Enders Edmonston B type have shown that while these are efficient immunizing agents, severe reactions are too frequent to permit of their wide general use. In the quest for safer vaccines, and in accordance with the recommendations of a WHO Scientific Group, a field trial was undertaken in Western Nigeria in May 1964 to make direct comparisons of the antigenicity and reaction rates of three further-attenuated measles vaccines (Schwarz, Beckenham 20 and Beckenham 20/2) and Enders Edmonston B vaccine plus gamma-globulin. A control group was also included. Analysis of the clinical responses demonstrated that reactions were similar, and of minimal severity, in all vaccine groups. Neutralizing antibody responses showed that all the vaccines used were effective immunizing agents. From the point of view of ease of administration and expense, however, further-attenuated vaccines seem preferable to Enders Edmonston B administered with gamma-globulin. PMID:5294305

  19. Effectiveness and timing of vaccination during school measles outbreak.

    PubMed

    Bonačić Marinović, Axel Antonio; Swaan, Corien; Wichmann, Ole; van Steenbergen, Jim; Kretzschmar, Mirjam

    2012-09-01

    Despite high vaccination coverage in most European countries, large community outbreaks of measles do occur, normally clustered around schools and resulting from suboptimal vaccination coverage. To determine whether or when it is worth implementing outbreak-response vaccination campaigns in schools, we used stochastic outbreak models to reproduce a public school outbreak in Germany, where no vaccination campaign was implemented. We assumed 2 scenarios covering the baseline vaccination ratio range (91.3%-94.3%) estimated for that school and computed outbreaks assuming various vaccination delays. In one scenario, reacting (i.e., implementing outbreak-response vaccination campaigns) within 12-24 days avoided large outbreaks and reacting within 50 days reduced outbreak size. In the other scenario, reacting within 6-14 days avoided large outbreaks and reacting within 40 days reduced the outbreak size. These are realistic time frames for implementing school outbreak response vaccination campaigns. High baseline vaccination ratios extended the time needed for effective response.

  20. 75 FR 48715 - Proposed Vaccine Information Materials for Measles, Mumps, Rubella, and Varicella Vaccines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-11

    ... HUMAN SERVICES Centers for Disease Control and Prevention Proposed Vaccine Information Materials for Measles, Mumps, Rubella, and Varicella Vaccines AGENCY: Centers for Disease Control and Prevention (CDC... National Childhood Vaccine Injury Act (NCVIA) (42 U.S.C. 300aa-26), the CDC must develop...

  1. Measles-mumps-rubella vaccine and the development of autism.

    PubMed

    Miller, Elizabeth

    2003-07-01

    The measles-mumps-rubella (MMR) vaccine has been postulated to cause a form of autism characterized by regression and bowel symptoms, and onset occurring shortly after vaccination. It is also claimed that, as a result, there has been a dramatic increase in autism prevalence. These hypotheses have now been tested in a number of epidemiologic studies that are reviewed in this article. None has found any evidence of the existence of a phenotypically distinct form of autism in children who received the MMR vaccine or of a clustering of onset symptoms in children who are autistic after receiving the MMR vaccine. There is no proof that the overall risk of autism is higher in children who were vaccinated with MMR or of an increase in autism prevalence associated with the use of the MMR vaccine. No epidemiologic evidence suggests an association between MMR vaccination and autism. Moreover, epidemiologic evidence against such an association is compelling.

  2. Measles Outbreak in a Vaccinated School Population: Epidemiology, Chains of Transmission and the Role of Vaccine Failures.

    ERIC Educational Resources Information Center

    Nkowane, Benjamin M.; And Others

    1987-01-01

    An outbreak of measles occurred in a high school with a documented vaccination level of 98 percent. When measles is introduced in a highly vaccinated population, vaccine failures may play some role in transmission but such transmission is not usually sustained. (Author/LHW)

  3. Exploring The Impact Of The US Measles Outbreak On Parental Awareness Of And Support For Vaccination.

    PubMed

    Cacciatore, Michael A; Nowak, Glen; Evans, Nathaniel J

    2016-02-01

    Despite consensus among health officials that childhood immunizations are a safe and effective means of protecting people from disease, some parents remain hesitant about vaccinating their children. This hesitancy has been linked to a lack of confidence in recommended vaccinations as well as a desire to delay or further space out scheduled vaccinations but also outright refusal of vaccines. Using two national surveys of parents of children ages five and younger, collected immediately prior to and in the weeks following the 2014-15 US measles outbreak, this study examined the awareness of this vaccine-preventable disease outbreak among parents and whether awareness of the outbreak affected their beliefs about childhood vaccination, confidence, and intentions. The study found that while most parents were aware of the outbreak, many were not, and the level of familiarity mattered, particularly on measures of confidence in vaccines and support for mandates requiring childhood vaccination. Increases in vaccine-related concerns were found as well, indicating that disease outbreaks foster not just awareness of vaccines and their potential to prevent disease but a range of parental responses.

  4. Safety of measles-containing vaccines in post-marketing surveillance in Anhui, China.

    PubMed

    Meng, Fan-Ya; Sun, Yong; Shen, Yong-Gang; Pan, Hai-Feng; Tang, Ji-Hai; Wang, Bin-Bing; Wu, Chang-Hao; Ye, Dong-Qing

    2017-01-01

    The safety of measles vaccination is of great interest and importance to public health practice and the general society. We have analyzed the adverse events following immunization (AEFIs) of currently used measles-containing vaccines (including live attenuated measles vaccine, live attenuated measles and rubella combined vaccine, live attenuated measles and mumps combined vaccine, live attenuated Measles, Mumps and Rubella Combined Vaccine) in Anhui Province, China. From 2009 to 2014, 9.9 million doses of measles-containing vaccines were administrated and 1893 AEFIs were found (191.4 per million doses), of which, 33 serious AEFIs (3.3 per million vaccine doses) were reported. 59.4% (1124 cases) were male cases, and 85.1% (1611 cases) occurred in persons aged < 1 year. 93.3% (1766 cases) occurred at the first dose of vaccination and 95.9% (1815 cases) were found within 3 days after vaccination. This study presents up-to-date data and suggests that the measles-containing vaccines used in Anhui Province of China are safe.

  5. Safety of measles-containing vaccines in post-marketing surveillance in Anhui, China

    PubMed Central

    Meng, Fan-Ya; Sun, Yong; Shen, Yong-Gang; Pan, Hai-Feng; Tang, Ji-Hai; Wang, Bin-Bing; Wu, Chang-Hao; Ye, Dong-Qing

    2017-01-01

    The safety of measles vaccination is of great interest and importance to public health practice and the general society. We have analyzed the adverse events following immunization (AEFIs) of currently used measles-containing vaccines (including live attenuated measles vaccine, live attenuated measles and rubella combined vaccine, live attenuated measles and mumps combined vaccine, live attenuated Measles, Mumps and Rubella Combined Vaccine) in Anhui Province, China. From 2009 to 2014, 9.9 million doses of measles-containing vaccines were administrated and 1893 AEFIs were found (191.4 per million doses), of which, 33 serious AEFIs (3.3 per million vaccine doses) were reported. 59.4% (1124 cases) were male cases, and 85.1% (1611 cases) occurred in persons aged < 1 year. 93.3% (1766 cases) occurred at the first dose of vaccination and 95.9% (1815 cases) were found within 3 days after vaccination. This study presents up-to-date data and suggests that the measles-containing vaccines used in Anhui Province of China are safe. PMID:28192490

  6. Polymorphisms in key innate immune genes and their effects on measles vaccine responses and vaccine failure in children from Mozambique.

    PubMed

    Clifford, Holly D; Hayden, Catherine M; Khoo, Siew-Kim; Naniche, Denise; Mandomando, Inacio M; Zhang, Guicheng; Richmond, Peter; Le Souëf, Peter N

    2012-09-21

    Despite an effective vaccine, measles remains a major health problem globally, particularly in developing countries. More than 30% of children show primary vaccine failure and therefore remain vulnerable to measles. Genetic variation in key innate pathogen recognition receptors, such as the measles cell entry receptors CD46 and SLAM, measles attachment receptor DC-SIGN, the antiviral toll-like receptors (TLR)3, TLR7 and TLR8, and the cytosolic antiviral receptor RIG-I, may significantly affect measles IgG antibody responses. Measles is still highly prevalent in developing countries such as those in Africa however there is no previous data on the effect of these innate immune genes in a resident African population. Polymorphisms (n=29) in the candidate genes were genotyped in a cohort of vaccinated children (n=238) aged 6 months-14 years from Mozambique, Africa who either had vaccine failure and contracted measles (cases; n=66) or controls (n=172). Contrasting previous associations with measles responses in Caucasians and/or strong evidence for candidacy, we found little indication that these key innate immune genes affect measles IgG responses in our cohort of Mozambican children. We did however identify that CD46 and TLR8 variants may be involved in the occurrence of measles vaccine failure. This study highlights the importance of genetic studies in resident, non-Caucasian populations, from areas where determining the factors that may affect measles control is of a high priority.

  7. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; O'Byrne, Megan M; Jacobson, Robert M; Pankratz, V Shane; Poland, Gregory A

    2012-03-09

    Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5, 7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.

  8. Appetising solutions: an edible vaccine for measles.

    PubMed

    Webster, Diane E; Thomas, Merlin C; Strugnell, Richard A; Dry, Ian B; Wesselingh, Steve L

    2002-05-06

    The cultivation of plants with specific properties has been the foundation of medicine for milennia. Modern biotechnology may one day extend their medicinal uses to include the delivery of vaccines. Edible vaccines that are heat stable, easy to administer and cheap to produce have the potential to redress many of the production, distribution and delivery limitations faced by traditional vaccines. Published data have shown that the concept of an edible vaccine is valid. Transition from a model system into a practical reality still has some way to go, including managing issues of oral tolerance, genetically modified organism safety, and effective vaccine doses. Successful edible vaccines have the potential to transform health policy and practice in both developed and developing countries.

  9. Vaccine-associated measles in the low-incidence country of Korea over a 10-year period.

    PubMed

    Choe, Young June; Eom, Hye Suk; Bae, Geun-Ryang

    2014-01-01

    As the incidence of measles decreases, cases reported as suspected measles will increasingly involve rash associated with measles vaccination itself. In this study, we assessed vaccine-associated measles cases reported in Korea between 2002 and 2012 using a standardized assessment and following by the World Health Organization case definition criteria. We retrospectively analyzed data regarding (i) wild-type measles and (ii) vaccine-associated measles in patients aged 12-23 months. The presence or absence of fever, rash, cough, coryza, conjunctivitis, and Koplik spots were reviewed. Males were more likely to be reported with vaccine-associated measles than with wild-type measles (68% vs. 47%, P < 0.05). The number of patients with wild-type measles peaked between April and July, whereas that of patients with vaccine-associated measles remained relatively constant throughout the year. However, after excluding the cases reported during the 2007 outbreak in Korea, the trend was similar between the two groups. Cough, coryza, and conjunctivitis were more likely to be present in patients with wild-type measles (32-61% vs. 10-43%, P < 0.05); conversely, the absence of these symptoms was noted in most patients with vaccine-associated measles. We therefore conclude that cough, coryza, and conjunctivitis may be useful as key positive findings to distinguish between wild-type measles and vaccine-associated measles infection among 12-23-month-old patients in a country with a low incidence of measles.

  10. Post-vaccine measles in a child with concomitant influenza, Sicily, Italy, March 2015.

    PubMed

    Tramuto, F; Dones, P; D Angelo, C; Casuccio, N; Vitale, F

    2015-05-21

    We describe the occurrence of measles in an 18 month-old patient in Sicily, Italy, in March 2015, who received the first dose of a measles-containing vaccine seven days before onset of prodromal symptoms. Measles virus infection was confirmed by PCR and detection of specific immunoglobulin; viral genotyping permitted the confirmation of a vaccine-associated illness. The patient had a concurrent influenza virus infection, during a seasonal epidemic outbreak of influenza.

  11. Comparison of the immunogenicity and safety of measles vaccine administered alone or with live, attenuated Japanese encephalitis SA 14-14-2 vaccine in Philippine infants.

    PubMed

    Gatchalian, Salvacion; Yao, Yafu; Zhou, Benli; Zhang, Lei; Yoksan, Sutee; Kelly, Kim; Neuzil, Kathleen M; Yaïch, Mansour; Jacobson, Julie

    2008-04-24

    Japanese encephalitis (JE) virus is a major cause of disease, disability, and death in Asia. An effective, live, attenuated JE vaccine (LJEV) is available; however, its use in routine immunization schedules is hampered by lack of data on concomitant administration with measles vaccine (MV). This study evaluated the immunogenicity and reactogenicity of LJEV and MV when administered at the same or separate study visits in infants younger than 1 year of age. Three groups of healthy infants were randomized to receive LJEV at age of 8 months and MV at 9 months (Group 1; n=100); MV and LJEV together at 9 months (Group 2; n=236); or MV and LJEV at 9 and 10 months, respectively (Group 3; n=235). Blood was obtained 4 weeks after each vaccine administration to determine antibody levels for measles and JE. Reactogenicity was assessed by parental diaries and clinic visits. Four weeks after immunization, measles seroprotection rates (defined as > or =340 mIU/ml) were high and comparable in all three groups and specifically, rates in the combined MV-LJEV (Group 2) were not statistically inferior to those in Group 3 receiving MV separately (96% versus 100%, respectively). Likewise, the LJEV seroprotection rates were high and similar between the three groups. The reactogenicity profiles of the three vaccine schedules were also analogous. LJEV and MV administered together are well tolerated and immunogenic in infants younger than 1 year. These results should facilitate incorporation of LJEV into routine immunization schedules with MV.

  12. [Review of the 2016 Swiss immunization schedule and technology update for improving vaccine management].

    PubMed

    Diana, Alessandro

    2016-05-11

    The 2016 immunization schedule published by the Swiss Federal Office of Public Health includes three new clauses: reimbursement of the additional Human Papillomavirus (HPV) vaccination in young males (11-26 years) as recommended by local canton programs, the end of franchise exemption for the measles, mumps and rubella (MMR) vaccination, and the creation of a new system of indemnities and moral compensation in the event of personal injury resulting from vaccinations. This article presents the main features of the 2016 immunization schedule with details of the technology available to physicians to improve vaccine management.

  13. MMRV (measles, mumps, rubella, and varicella) vaccine - what you need to know

    MedlinePlus

    ... usually wait until they recover before getting MMRV vaccine. Children who are only mildly ill may usually get ... than getting measles, mumps, rubella, or chickenpox. Most children who get MMRV vaccine do not have any problems with it. Mild ...

  14. The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; Pankratz, V Shane; Kennedy, Richard B; Jacobson, Robert M; Poland, Gregory A

    2013-01-01

    The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of 'vaccinomics' for novel vaccine development.

  15. Current vaccination status regarding measles among university students in Dresden, Germany.

    PubMed

    Riemenschneider, Henna; Schübel, Jeannine; Bergmann, Antje; Kugler, Joachim; Voigt, Karen

    2015-12-01

    Germany aimed to eliminate measles by 2015, but vaccination coverage is still insufficient, especially in respect to adolescents and young adults. A cross-sectional survey with 711 students studying a range of subjects showed a high acceptance regarding vaccination. Actual self-reported vaccination rates were lower; only 65.5% of medical students and 25.3%-39.4% of other student groups reported complete vaccination against measles. Of the students, 12.6%-45% did not know their vaccination status. Vaccination acceptance did not correlate with vaccination behavior: accessible vaccination opportunities at universities should be offered.

  16. Comparative efficacy of a canine distemper-measles and a standard measles vaccine for immunization of rhesus macaques (Macaca mulatta).

    PubMed

    Christe, Kari L; McChesney, Michael B; Spinner, Abigail; Rosenthal, Ann N; Allen, Philip C; Valverde, Celia R; Roberts, Jeffrey A; Lerche, Nicholas W

    2002-10-01

    Measles virus (MV), a highly infective paramyxovirus, has caused sporadic epizootics characterized by high morbidity and increased mortality in nonhuman primates. Measles vaccines for human use, although effective, are cost prohibitive for use in primate colonies. We compared the efficacy of one or two doses of Vanguard D-M, a canine distemper-measles (CD-M) vaccine, with a single dose of Attenuvax, a human measles vaccine. Compared with 81% of animals inoculated with Attenuvax, all animals inoculated with one or two doses of Vanguard developed detectable MV antibodies. One year after immunization, six juveniles from each vaccine group, along with three unvaccinated controls, were challenged with pathogenic MV and were monitored for clinical signs of disease, viremia, viral shedding, and immune response. All uninoculated controls developed clinical disease and viremia, and shed virus in nasopharangeal secretions. Subclinical viremia without viral shedding was identified in two Attenuvax- and two single-dose Vanguard-inoculated animals. Viremia was not detected in any two-dose Vanguard-inoculated animals. Significantly higher neutralization antibody titers were observed in animals receiving Vanguard. Results of this study indicate that Vanguard is at least as efficacious as Attenuvax for protection of rhesus macaques. The considerably lower cost of Vanguard makes vaccination against measles in large breeding colonies economically feasible.

  17. Measles vaccination coverage and seroprevalence of anti-measles antibody in south-east Islamic Republic of Iran.

    PubMed

    Izadi, S; Mokhtari-Azad, T; Zahraei, S M

    2015-09-08

    Discrepancies often exist between recorded immunization coverage and the real immunity level in a community. To estimate the vaccination coverage against measles in south-east Islamic Republic of Iran, a crosssectional study was conducted in 3 districts during summer 2011. Using probability proportional to size cluster sampling, 1368 children aged 30-54 months were selected. Serum samples of 663 who had received 2 injections of mumpsmeasles- rubella (MMR) vaccine were checked for anti-measles IgG. Vaccination coverage for the second dose of MMR vaccine was 93.7%. The prevalence of anti-measles IgG in those who had received at least 2 MMR vaccine doses was 94.6%. There was a statistically significant association between the serological results and variables that reflected poor accessibility to health services. Combining serological results with coverage data, the proportion of the community protected against measles was estimated as 88.6%, which was below the limits defined for the measles elimination goals.

  18. Measles

    MedlinePlus

    Measles is an infectious disease caused by a virus. It spreads easily from person to person. It ... down Tiny white spots inside the mouth Sometimes measles can lead to serious problems. There is no ...

  19. Measles

    MedlinePlus

    ... Issues Listen Español Text Size Email Print Share Measles Page Content Article Body Measles was once a common disease among preschool and ... of growing up. This is no longer true. Measles has not been completely eliminated as a childhood ...

  20. Effective vaccine communication during the disneyland measles outbreak.

    PubMed

    Broniatowski, David A; Hilyard, Karen M; Dredze, Mark

    2016-06-14

    Vaccine refusal rates have increased in recent years, highlighting the need for effective risk communication, especially over social media. Fuzzy-trace theory predicts that individuals encode bottom-line meaning ("gist") and statistical information ("verbatim") in parallel and those articles expressing a clear gist will be most compelling. We coded news articles (n=4581) collected during the 2014-2015 Disneyland measles for content including statistics, stories, or bottom-line gists regarding vaccines and vaccine-preventable illnesses. We measured the extent to which articles were compelling by how frequently they were shared on Facebook. The most widely shared articles expressed bottom-line gists, although articles containing statistics were also more likely to be shared than articles lacking statistics. Stories had limited impact on Facebook shares. Results support Fuzzy Trace Theory's predictions regarding the distinct yet parallel impact of categorical gist and statistical verbatim information on public health communication.

  1. Factors associated with poor adherence to MMR vaccination in parents who follow vaccination schedule.

    PubMed

    Restivo, Vincenzo; Napoli, Giuseppe; Marsala, Maria Grazia Laura; Bonanno, Valentina; Sciuto, Valentina; Amodio, Emanuele; Calamusa, Giuseppe; Vitale, Francesco; Firenze, Alberto

    2015-01-01

    Due to median vaccination coverage far from elimination level, Italy is still an European country with high number of measles cases per million of people. In this study we explored potential socioeconomic, medical and demographic factors which could influence the propensity of family members for measles vaccination schedule. A cross-sectional study was performed through a questionnaire administered to the parents of children who received the first dose of MMR vaccine in two different vaccination centers in the Palermo area from November 2012 to May 2013. Overall, the role played by internet (OR 19.8 P = 0.001) and the large number of children in a family (OR 7.3 P ≤ 0.001) were the factors more associated to be unvaccinated, whereas the birth order of the child (OR 0.3 P = < 0.05 for the oldest children vs. the closer young one) and reporting a lack of MMR vaccination as a "personal decision" (OR 0.19 P ≤ 0.01) inversely correlated with the risk of quitting vaccination. These findings can be useful for a better knowledge of disaffection to vaccination practice in local settings and could contribute to improve and maintain timely uptake, suggesting approaches to optimize the uptake of MMR tailored to the needs of local populations.

  2. Development and evaluation of the TD97 measles virus vaccine

    SciTech Connect

    Suzuki, K.; Morita, M.; Katoh, M.; Kidokoro, M.; Saika, S.; Yoshizawa, S.; Hashizume, S.; Horiuchi, K.; Okabe, N.; Shinozaki, T. )

    1990-11-01

    The TD97 strain vaccine virus was prepared from the Tanabe strain measles virus by low-temperature passages in primary cell cultures and ultraviolet (UV) mutagenesis. The TD97 strain exhibited the following characteristics: highly temperature sensitive, neither multiplying nor forming any plaques at 40 degrees C in Vero cells; genetically stable, maintaining high temperature sensitivity after ten successive passages in CE cells at 30 degrees C or 35 degrees C; and M proteins of this virus about 1 KD slower in mobility in SDS-PAGE than that of the Tanabe strain. The TD97 strain was further confirmed to be attenuated by an inoculation test into primate brain. In field trials, 752 healthy children were inoculated with a live virus vaccine prepared with this strain, and the following results were obtained: the seroconversion rate was 97% (517/533), and the average HI antibody titer was 2(5.2). An antibody-increasing effect was also observed in children who were initially seropositive. In children who seroconverted, the rates of fever were 15.7% (55/351) for 37.5 degrees C or higher and 4.0% (14/351) for 39 degrees C or higher. The rash rate was 7.7% (27/351), and the incidence of local reaction was 5.4% (19/351). The TD97 strain is thus considered to be suitable in use for an attenuated measles vaccine.

  3. Development of Recombinant Measles Virus-Based Vaccines.

    PubMed

    Mühlebach, Michael D; Hutzler, Stefan

    2017-01-01

    This chapter describes the development of recombinant measles virus (MV)-based vaccines starting from plasmid DNA. Live-attenuated measles vaccines are very efficient and safe. Since the availability of a reverse genetic system to manipulate MV genomes and to generate respective recombinant viruses, a considerable number of recombinant viruses has been generated that present antigens of foreign pathogens during MV replication. Thereby, robust humoral and cellular immune responses can be induced, which have shown protective capacity in a substantial number of experiments.For this purpose, the foreign antigen-encoding genes are cloned into additional transcription units of plasmid based full-length MV vaccine strain genomes, which in turn are used to rescue recombinant MV by providing both full-length viral RNA genomes respective anti-genomes together with all protein components of the viral ribonucleoprotein complex after transient transfection of the so-called rescue cells. Infectious centers form among these transfected cells, which allow clonal isolation of single recombinant viruses that are subsequently amplified, characterized in vitro, and then evaluated for their immunogenicity in appropriate preclinical animal models.

  4. Immune response to 1 and 2 dose regimens of measles vaccine in Pakistani children.

    PubMed

    Hussain, Hamidah; Akram, Dure Samin; Chandir, Subhash; Khan, Aamir J; Memon, Ashraf; Halsey, Neal A

    2013-12-01

    Measles is a significant problem in Pakistan despite vaccine coverage rates reported at 80%. The purpose of this study was to determine the serologic response in children after one dose of measles vaccine at 9 mo versus two doses at 9 and 15 mo of age. From March through December 2006, children were enrolled from immunization clinics and squatter settlements in Karachi. Blood samples were taken from children in Group A at 9-10 mo of age prior to measles vaccine and 8 to 11 weeks later; from children in Group B at 16-17 mo of age after receiving 2 doses of measles vaccine; and from children in Group C who had received at least one dose of measles vaccine by 5 y of age. After the first dose of measles vaccine, 107/147 (73%) of children in Group A were seropositive, 157/180 (87%) of children in Group B were seropositive after two doses and 126/200 (63%) of children in Group C were seropositive at 5 y of age. The post-vaccination geometric mean antibody concentrations were higher in females than males in groups A (irrespective of pre-vaccination antibody levels) and B. The serologic response to one and two doses of measles vaccine was lower in children in Karachi than has been reported in many other countries. Two doses of vaccine were significantly better than one dose. An in-depth investigation is needed to determine the reason for the lower-than-expected protection rates. Differences in immunogenicity between genders need to be further studied. Recent introduction of supplemental measles vaccine doses should help control measles in Pakistan.

  5. [Effectiveness, population-level effects, and heath economics of measles and rubella vaccination].

    PubMed

    Wichmann, O; Ultsch, B

    2013-09-01

    Vaccination against measles and rubella has been included in national immunization programs worldwide for several decades. In this article, we present the evidence related to the effectiveness of measles and rubella vaccination based on published systematic reviews, and we describe the epidemiological and health economic effects of vaccination at a population level. Several observational studies demonstrate the high effectiveness (> 90 %) of both measles and rubella vaccination. The global measles mortality reduction and the dramatic decrease in rubella and measles incidences after introduction of routine immunization contribute to the very high quality of evidence. The countries of the Americas have proved that it is feasible to eliminate measles and rubella by strengthening infant immunization through routine vaccination services and by conducting supplemental immunization activities in other childhood age groups so as to close immunity gaps. An economic evaluation of measles and rubella vaccination specifically for the healthcare system in Germany does not exist. However, we conducted a systematic review and identified 11 health-economic studies from other industrialized countries and one for a hypothetical industrialized country. Results indicate that vaccination against measles and rubella had either a cost-effective or even a cost-saving potential, which could be assumed with some limitations also for the German setting. In conclusion, there is compelling evidence that the available vaccines are very effective and that measles and rubella elimination is feasible if adequate vaccination strategies are implemented. In Germany, catch-up vaccination programs are urgently needed for children, adolescents, and young adults specifically in the western federal states.

  6. Response to measles-mumps-rubella vaccine in children on dialysis.

    PubMed

    Schulman, S L; Deforest, A; Kaiser, B A; Polinsky, M S; Baluarte, H J

    1992-03-01

    Ten children receiving maintenance dialysis were immunized with the standard dose of measles-mumps-rubella vaccine between 15 and 33 months of age. Immune responses to vaccination were determined using commercially available enzyme-linked immunosorbent assays for measles, mumps, and rubella viruses. Eight children responded to measles vaccine, 5 to mumps vaccine, 8 to rubella vaccine, and only 3 children to all three vaccines, compared with a seroconversion rate of over 90% to all three vaccines in healthy children (P less than 0.0001). We contend that the relatively poor immunocompetence of our dialysis patients explains their less than optimal vaccine response and suggest that children vaccinated while undergoing dialysis be tested to confirm serological evidence of immunity.

  7. Transport networks and inequities in vaccination: remoteness shapes measles vaccine coverage and prospects for elimination across Africa.

    PubMed

    Metcalf, C J E; Tatem, A; Bjornstad, O N; Lessler, J; O'Reilly, K; Takahashi, S; Cutts, F; Grenfell, B T

    2015-05-01

    Measles vaccination is estimated to have averted 13·8 million deaths between 2000 and 2012. Persisting heterogeneity in coverage is a major contributor to continued measles mortality, and a barrier to measles elimination and introduction of rubella-containing vaccine. Our objective is to identify determinants of inequities in coverage, and how vaccine delivery must change to achieve elimination goals, which is a focus of the WHO Decade of Vaccines. We combined estimates of travel time to the nearest urban centre (⩾50 000 people) with vaccination data from Demographic Health Surveys to assess how remoteness affects coverage in 26 African countries. Building on a statistical mapping of coverage against age and geographical isolation, we quantified how modifying the rate and age range of vaccine delivery affects national coverage. Our scenario analysis considers increasing the rate of delivery of routine vaccination, increasing the target age range of routine vaccination, and enhanced delivery to remote areas. Geographical isolation plays a key role in defining vaccine inequity, with greater inequity in countries with lower measles vaccine coverage. Eliminating geographical inequities alone will not achieve thresholds for herd immunity, indicating that changes in delivery rate or age range of routine vaccination will be required. Measles vaccine coverage remains far below targets for herd immunity in many countries on the African continent and is likely to be inadequate for achieving rubella elimination. The impact of strategies such as increasing the upper age range eligible for routine vaccination should be considered.

  8. When, and how, should we introduce a combination measles-mumps-rubella (MMR) vaccine into the national childhood expanded immunization programme in South Africa?

    PubMed

    Cameron, Neil A

    2012-09-07

    This article briefly reviews the history and epidemiology of measles, mumps and rubella disease and the case for introducing combination measles-mumps-rubella (MMR) vaccine into the national childhood immunization schedule in South Africa. Despite adopting the World Health Organization's Measles Elimination strategy in 1996 and achieving a significant decrease the incidence of measles, added effort is needed in South and southern Africa to reach the goal to eliminate endogenous spread measles. Mumps is still common disease of childhood and while there are few sequelae, even the rare complications are important in large populations. Congenital rubella syndrome is seldom reported, but it is estimated that of the million or so children born every year in South Africa over 600 infants are affected to some degree by rubella infection. The naturally acquired immunity to rubella in women of childbearing age in South Africa has been estimated at over 90%, so that introducing a rubella containing vaccine in childhood may paradoxically increase the proportion of girls reaching puberty still susceptible to rubella. The elimination of endogenous measles and rubella is being achieved in many countries in South America, and despite the recent measles epidemic, must still be seriously considered for South and southern Africa. Current constraints and potential steps needed to reach the goal in South Africa are discussed.

  9. [Single or double dose of vaccine needed for the eradication of measles in Spain?].

    PubMed

    Vitoria Miñana, I; Morales Suárez-Varela, M; Cotanda Gutiérrez, P; Asensi Botet, F

    1993-02-01

    A descriptive and retrospective epidemiological study of measles vaccinations was realized. This study involved 112 children hospitalized in Valencia (Spain) for measles during the period from January 1983 to December 1988. We compared children that had received vaccination and those children that had not. Statistically significant differences were observed in regards to the age of the child (p < 0.025) and the year in which the cases were diagnosed (p < 0.05). The evolution of measles in Spain and in the United States shows the need for revaccinations, as well as the need to augment the coverage of vaccinations in order to eradicate this disease.

  10. Progress towards Rapid Detection of Measles Vaccine Strains: a Tool To Inform Public Health Interventions.

    PubMed

    Hacker, Jill K

    2017-03-01

    Rapid differentiation of vaccine from wild-type strains in suspect measles cases is a valuable epidemiological tool that informs the public health response to this highly infectious disease. Few public health laboratories sequence measles virus-positive specimens to determine genotype, and the vaccine-specific real-time reverse transcriptase PCR (rRT-PCR) assay described by F. Roy et al. (J. Clin. Microbiol. 55:735-743, 2017, https://doi.org/10.1128/JCM.01879-16) offers a rapid, easily adoptable method to identify measles vaccine strains in suspect cases.

  11. Investigation of an outbreak of measles: failure to vaccinate or vaccine failure in a community of predominantly fishermen in Kerala.

    PubMed

    Nujum, Zinia T; Varghese, Sara

    2015-01-01

    Measles outbreaks continue to occur in developing countries. This study attempted to explore the context of an outbreak of measles in a community of predominantly fishermen in Kerala to find out whether the outbreak was the result of a failure to vaccinate or failure of the vaccine itself. A cross sectional study was conducted in Mukkola village of Thiruvananthapuram district, Kerala, India. A total of 215 children of ages between 9 and 35 months were studied. Documented evidence of measles vaccination was available only in 71.6% (65.57-77.62) of the children. The risk factors for not being immunized against measles were being third or higher in birth order and having: a father whose occupation is fishing, low family income, lower parental education, Muslim religion and poor knowledge regarding measles and its vaccine. Of the 215 children studied, 43 had a history of measles. Thirty percent of these 43 children were younger than the age of vaccination. Unvaccinated children, children third or higher in birth order and children of families with more than 5 members had a significantly higher risk of contracting measles. Vaccine effectiveness was 76.6% (95% CI: 75.96-77.99). The prevalence of missed vaccination opportunities was found to be 15.8% (34/215). Even with the relatively low vaccine effectiveness, this outbreak could have been prevented by higher vaccination coverage. Lowering the age at administration of the first dose of measles vaccine needs to be considered. Effective utilization of opportunities for vaccination could enhance coverage and prevent outbreaks in the future.

  12. Multicenter Safety and Immunogenicity Trial of an Attenuated Measles Vaccine for NHP.

    PubMed

    Yee, Joann L; McChesney, Michael B; Christe, Kari L

    2015-10-01

    Measles is a highly contagious viral disease in NHP. The infection can range from asymptomatic to rapidly fatal, resulting in significant morbidity and mortality in captive populations. In addition to appropriate quarantine practices, restricted access, the immunization of all personnel in contact with NHP, and the wearing of protective clothing including face masks, measles immunization further reduces the infection risk. Commercially available measles vaccines are effective for use in NHP, but interruptions in their availability have prevented the implementation of ongoing, consistent vaccination programs. This need for a readily available vaccine led us to perform a broad, multicenter safety and immunogenicity study of another candidate vaccine, MVac (Serum Institute of India), a monovalent measles vaccine derived from live Edmonston-Zagreb strain virus that had been attenuated after 22 passages on human diploid cells.

  13. Multicenter Safety and Immunogenicity Trial of an Attenuated Measles Vaccine for NHP

    PubMed Central

    Yee, JoAnn L; McChesney, Michael B; Christe, Kari L

    2015-01-01

    Measles is a highly contagious viral disease in NHP. The infection can range from asymptomatic to rapidly fatal, resulting in significant morbidity and mortality in captive populations. In addition to appropriate quarantine practices, restricted access, the immunization of all personnel in contact with NHP, and the wearing of protective clothing including face masks, measles immunization further reduces the infection risk. Commercially available measles vaccines are effective for use in NHP, but interruptions in their availability have prevented the implementation of ongoing, consistent vaccination programs. This need for a readily available vaccine led us to perform a broad, multicenter safety and immunogenicity study of another candidate vaccine, MVac (Serum Institute of India), a monovalent measles vaccine derived from live Edmonston–Zagreb strain virus that had been attenuated after 22 passages on human diploid cells. PMID:26473350

  14. Measles cases in highly vaccinated population of Novosibirsk, Russia, 2000-2005.

    PubMed

    Atrasheuskaya, A V; Kulak, M V; Neverov, A A; Rubin, S; Ignatyev, G M

    2008-04-16

    While the proportion of measles cases in vaccinees is expected to increase as vaccine coverage increases, such cases must be carefully investigated. The present study was conducted to examine possible contributions to vaccine failures (VFs) and to genetically characterize measles virus (MV) strains circulating in Novosibirsk, Russia during 2000-2005. Totally, 27 adult measles patients admitted to a regional hospital were prospectively enrolled in our study. Genetic characterization of the MV strains revealed circulation of genotypes A, D4 and D6 between 2000 and 2003 years; a genotype D6 MV was associated with the 2005 measles outbreak. Based on IgG avidity testing, half of the vaccinated patients demonstrated evidence of secondary vaccine failure (SVF). Patients, representing both levels of vaccine failure in our study were characterized by the lack of protective titers of neutralizing antibodies against circulating MVs, despite high IgG levels in many cases and high IgG avidity in SVF cases.

  15. The recombinant globular head domain of the measles virus hemagglutinin protein as a subunit vaccine against measles.

    PubMed

    Lobanova, Liubov M; Eng, Nelson F; Satkunarajah, Malathy; Mutwiri, George K; Rini, James M; Zakhartchouk, Alexander N

    2012-04-26

    Despite the availability of live attenuated measles virus (MV) vaccines, a large number of measles-associated deaths occur among infants in developing countries. The development of a measles subunit vaccine may circumvent the limitations associated with the current live attenuated vaccines and eventually contribute to global measles eradication. Therefore, the goal of this study was to test the feasibility of producing the recombinant globular head domain of the MV hemagglutinin (H) protein by stably transfected human cells and to examine the ability of this recombinant protein to elicit MV-specific immune responses. The recombinant protein was purified from the culture supernatant of stably transfected HEK293T cells secreting a tagged version of the protein. Two subcutaneous immunizations with the purified recombinant protein alone resulted in the production of MV-specific serum IgG and neutralizing antibodies in mice. Formulation of the protein with adjuvants (polyphosphazene or alum) further enhanced the humoral immune response and in addition resulted in the induction of cell-mediated immunity as measured by the production of MV H-specific interferon gamma (IFN-γ) and interleukin 5 (IL-5) by in vitro re-stimulated splenocytes. Furthermore, the inclusion of polyphosphazene into the vaccine formulation induced a mixed Th1/Th2-type immune response. In addition, the purified recombinant protein retained its immunogenicity even after storage at 37°C for 2 weeks.

  16. Spotlight on measles in Italy: why outbreaks of a vaccine-preventable infection continue in the 21st century.

    PubMed

    Piccirilli, Giulia; Lazzarotto, Tiziana; Chiereghin, Angela; Serra, Laura; Gabrielli, Liliana; Lanari, Marcello

    2015-03-01

    Measles is a serious infectious disease that can lead to significant morbidity and mortality. Remarkable progress has been made through measles vaccination in reducing the number of people dying from measles. In the last years, concerns about the safety of vaccines have led to decline in immunization coverage rates and new outbreaks of measles in many European countries, including Italy. We believe that it is important to reinforce the message that measles vaccine is safe and highly effective through appropriate information campaigns and public awareness.

  17. [Study of measles history, vaccination, antibody status, and vaccination effectiveress for school teachers].

    PubMed

    Ichinohe, Sadato; Ogawa, Tomoko

    2011-05-01

    To determine an efficient measles vaccination program for school teachers, we studied knowledge about measles history, immunization, and immunity status among 269 school teachers in Ichihara City in 2009. We found that (1) many are uncertain about disease and immunization history, with neither history related to the immunity status of neutralizing antibody titer (NT), (2) particle agglutination (PA) and enzyme immunoassay (EIA) testing have replaced NT in commercial laboratories, but persons having antibodies fewer than 8-fold of the NT titer as a sensitivity desigration for measles, and 11 false-positive immunity results are indicated in PA testing (cutoff: 256-fold) and 140 false-positive sensitivity results in EIA testing (cutoff: 16.0 EIA), and (3) sensitivity cases are 7.1% in the naturally infected generation born before 1977 and 23.7% in the vaccinated generation born after 1978. Given "herd" immunity, we concluded that all vaccinated-generation persons should be administered additional vaccination regardless of sensitivity due to history, immunization, and PA or EIA antibody testing.

  18. Impact of vaccination on the incidence of measles in Mozambique in the period 2000 to 2011.

    PubMed

    Muloliwa, Artur Manuel; Camacho, Luiz Antonio Bastos; Verani, José Fernando Souza; Simões, Taynãna César; Dgedge, Martinho do Carmo

    2013-02-01

    The aim of this study was to contribute to the better planning of measles elimination actions in Mozambique, by considering the impact of vaccination actions over the period 2000 to 2011. Descriptive and ecological studies and case records made available by the Ministry of Health were used to analyze measles vaccination coverage. Statistical analysis was performed using time series and spatial analysis. Vaccine coverage rates ranged from 82% to 99%. Coverage rates in Maputo city were under 70% and in Niassa province they were over 100%. Coverage showed a clustered pattern in the districts. The measles incidence rate was 1.58 per 100,000 inhabitants (0.00-40.08 per 100,000 inhabitants); districts bordering neighboring countries presented high incidence rates. Although measles morbidity and mortality has decreased in Mozambique, vaccine coverage has been insufficient to interrupt measles transmission. Enhanced surveillance, including investigation of cases and outbreaks, and improvements in measles vaccination are recommended in order to achieve a homogenous coverage rate of ≥ 95% for both routine and mass vaccination campaigns.

  19. Influenza vaccine concurrently administered with a combination measles, mumps, and rubella vaccine to young children.

    PubMed

    Lum, Lucy Chai See; Borja-Tabora, Charissa Fay; Breiman, Robert F; Vesikari, Timo; Sablan, Benjamin P; Chay, Oh Moh; Tantracheewathorn, Taweewong; Schmitt, Heinz-Josef; Lau, Yu-Lung; Bowonkiratikachorn, Piyaporn; Tam, John S; Lee, Bee Wah; Tan, Kah Kee; Pejcz, Jerzy; Cha, Sungho; Gutierrez-Brito, Maricruz; Kaltenis, Petras; Vertruyen, Andre; Czajka, Hanna; Bojarskas, Jurgis; Brooks, W Abdullah; Cheng, Sheau-Mei; Rappaport, Ruth; Baker, Sherryl; Gruber, William C; Forrest, Bruce D

    2010-02-10

    Children aged 11 to <24 months received 2 intranasal doses of live attenuated influenza vaccine (LAIV) or placebo, 35+/-7 days apart. Dose 1 was administered concomitantly with a combined measles, mumps, and rubella vaccine (Priorix). Seroresponses to measles and mumps were similar between groups. Compared with placebo, response rates to rubella in LAIV+Priorix recipients were statistically lower at a 15 IU/mL threshold (83.9% vs 78.0%) and the prespecified noninferiority criteria were not met. In a post hoc analysis using an alternate widely accepted threshold of 10 IU/mL, the noninferiority criteria were met (93.4% vs 89.8%). Concomitant administration with Priorix did not affect the overall influenza protection rate of LAIV (78.4% and 63.8% against antigenically similar influenza strains and any strain, respectively).

  20. [Measles vaccination by the aerosol method in Mexico].

    PubMed

    Fernández-de Castro, J; Kumate-Rodríguez, J; Sepúlveda, J; Ramírez-Isunza, J M; Valdespino-Gómez, J L

    1997-01-01

    The present work describes the anti-measles vaccination program by the inhaled aerosol method undertaken in Mexico between 1988 and 1990. Detailed descriptions are given of the equipment, staff, training programs, promotion and campaigns. The vaccine is specified: Edmonston-Zagreb strain cultured in diploid cells at the Instituto Nacional de Virología of the Secretaría de Salud in Mexico with titres varying from 1045 plaque forming units (PFU/ml) to 1048 PFU/ml administered in a 30 sec inhalation with aerosol. During this exposure period, 2800 to 4000 PFU per child are estimated to enter the child, of which approximately 25% is the retained doses, i.e. 700 to 1000 PFU/child. A total of 3760684 children of school and pre-school age have been vaccinated in 13 of the 32 federal entities of the country. No undesirable effects of any importance were observed, and the limited serological and field studies support the effectiveness and security of this method. On the other hand, the method is much cheaper, faster and better accepted by the population than the subcutaneous injection.

  1. Use of combination measles, mumps, rubella, and varicella vaccine: recommendations of the Advisory Committee on Immunization Practices (ACIP).

    PubMed

    Marin, Mona; Broder, Karen R; Temte, Jonathan L; Snider, Dixie E; Seward, Jane F

    2010-05-07

    This report presents new recommendations adopted in June 2009 by CDC's Advisory Committee on Immunization Practices (ACIP) regarding use of the combination measles, mumps, rubella, and varicella vaccine (MMRV, ProQuad, Merck & Co., Inc.). MMRV vaccine was licensed in the United States in September 2005 and may be used instead of measles, mumps, rubella vaccine (MMR, M-M-RII, Merck & Co., Inc.) and varicella vaccine (VARIVAX, Merck & Co., Inc.) to implement the recommended 2-dose vaccine schedule for prevention of measles, mumps, rubella, and varicella among children aged 12 months-12 years. At the time of its licensure, use of MMRV vaccine was preferred for both the first and second doses over separate injections of equivalent component vaccines (MMR vaccine and varicella vaccine), which was consistent with ACIP's 2006 general recommendations on use of combination vaccines (CDC. General recommendations on immunization: recommendations of the Advisory Committee on Immunization Practices [ACIP]. MMWR 2006;55;[No. RR-15]). Since July 2007, supplies of MMRV vaccine have been temporarily unavailable as a result of manufacturing constraints unrelated to efficacy or safety. MMRV vaccine is expected to be available again in the United States in May 2010. In February 2008, on the basis of preliminary data from two studies conducted postlicensure that suggested an increased risk for febrile seizures 5-12 days after vaccination among children aged 12-23 months who had received the first dose of MMRV vaccine compared with children the same age who had received the first dose of MMR vaccine and varicella vaccine administered as separate injections at the same visit, ACIP issued updated recommendations regarding MMRV vaccine use (CDC. Update: recommendations from the Advisory Committee on Immunization Practices [ACIP] regarding administration of combination MMRV vaccine. MMWR 2008;57:258-60). These updated recommendations expressed no preference for use of MMRV vaccine over

  2. The Measles Vaccination Narrative in Twitter: A Quantitative Analysis

    PubMed Central

    Radzikowski, Jacek; Jacobsen, Kathryn H; Croitoru, Arie; Crooks, Andrew; Delamater, Paul L

    2016-01-01

    Background The emergence of social media is providing an alternative avenue for information exchange and opinion formation on health-related issues. Collective discourse in such media leads to the formation of a complex narrative, conveying public views and perceptions. Objective This paper presents a study of Twitter narrative regarding vaccination in the aftermath of the 2015 measles outbreak, both in terms of its cyber and physical characteristics. We aimed to contribute to the analysis of the data, as well as presenting a quantitative interdisciplinary approach to analyze such open-source data in the context of health narratives. Methods We collected 669,136 tweets referring to vaccination from February 1 to March 9, 2015. These tweets were analyzed to identify key terms, connections among such terms, retweet patterns, the structure of the narrative, and connections to the geographical space. Results The data analysis captures the anatomy of the themes and relations that make up the discussion about vaccination in Twitter. The results highlight the higher impact of stories contributed by news organizations compared to direct tweets by health organizations in communicating health-related information. They also capture the structure of the antivaccination narrative and its terms of reference. Analysis also revealed the relationship between community engagement in Twitter and state policies regarding child vaccination. Residents of Vermont and Oregon, the two states with the highest rates of non-medical exemption from school-entry vaccines nationwide, are leading the social media discussion in terms of participation. Conclusions The interdisciplinary study of health-related debates in social media across the cyber-physical debate nexus leads to a greater understanding of public concerns, views, and responses to health-related issues. Further coalescing such capabilities shows promise towards advancing health communication, thus supporting the design of more

  3. Overview of measles and mumps vaccine: origin, present, and future of vaccine production.

    PubMed

    Betáková, T; Svetlíková, D; Gocník, M

    2013-01-01

    Measles and mumps are common viral childhood diseases that can cause serious complications. Vaccination remains the most efficient way to control the spread of these viruses. The manufacturing capability for viral vaccines produced in embryonated hen eggs and conventional/classical cell substrates, such as chicken embryo fibroblast or primary dog kidney cell substrates, is no longer sufficient. This limitation can be overcome by utilizing other recognized cell substrates such as Madin Darby Canine Kidney (MDCK), Chinese Hamster Ovary (CHO), Vero (monkey origin) cells, MRC-5 (human diploid) or as an alternative, introducing new cell substrates of human or avian origin. A very important factor in vaccine production is the safety and immunogenicity of the final vaccine, where the proper choice of cell substrate used for virus propagation is made. All substrates used in vaccine production must be fully characterized to avoid the contamination of hidden unknown pathogens which is difficult to achieve in primary cell substrates.

  4. Alternative dosage schedules with HPV VLP vaccines

    PubMed Central

    Stanley, Margaret A.; Sudenga, Staci L.; Giuliano, Anna R.

    2014-01-01

    Summary Human papillomavirus (HPV) vaccines can prevent multiple cancers in women and men. Difficulties in the cost and completion of the three-dose vaccine series have led to considerations of alternative dose schedules. In clinical trials, three doses given within a 12-month period versus the standard six-month period yielded comparable results, and immunogenicity appears comparable with two doses in adolescent females compared to the three-dose series in adult females. While the data are generally supportive of moving to a two-dose vaccine schedule among young female adolescents, the adoption of a two-dose vaccine schedule still poses a potential risk to the strength and longevity of the immune response. Public health authorities implementing a two-dose vaccine schedule should devise risk management strategies to minimize the potential impact on cancer prevention. PMID:25001893

  5. Similar immunogenicity of measles-mumps-rubella (MMR) vaccine administrated at 8 months versus 12 months age in children.

    PubMed

    He, Hanqing; Chen, Enfu; Chen, Haiping; Wang, Zhifang; Li, Qian; Yan, Rui; Guo, Jing; Zhou, Yang; Pan, Jinren; Xie, Shuyun

    2014-06-30

    Two doses of measles-mumps-rubella (MMR) strategy has been recommended by World Health Organization and is also widely adopted in many countries. In order to provide the evidence for perfecting the immunization strategy of MMR, this study evaluated the safety and immunogenicity of MMR with different two-dose schedule in infants. 280 participants were enrolled and randomly allocated to Group 1 (first dose at 8 months) or Group 2 (first dose at 12 months), and both groups administered the second dose at 10 months later. Solicited local and general symptoms after each vaccination with MMR were mild and infrequent in all participants of two groups. After administration of the first dose of MMR, seropositive rates were 100% in both groups for measles, 89.3% in Group 1 and 87.1% in Group 2 for mumps (P=0.578), 92.0% in Group 1 and 92.9% in Group 2 (P=0.393). The seropositive rates of mumps decreased significantly (from >86% to <65%) both in two groups (P<0.001) 10 months after the first dose of MMR, but no significant change was found in measles and rubella. All children get the positive titer for three vaccines in two groups after given the second dose MMR, higher seroconversion rate was found for mumps both in two groups (71.7% vs 77.2%, P=0.370). In conclusion, this study indicated that the MMR was well tolerated and immunogenic against measles, mumps and rubella with schedule of first dose both at 8 months and 12 months age. Our findings strongly supported that two doses of MMR can be introduced by replacing the first dose of MR in current EPI with MMR at 8 months age and the second dose at 18 months in China.

  6. Does Measles Vaccination Reduce the Risk of Acute Respiratory Infection (ARI) and Diarrhea in Children: A Multi-Country Study?

    PubMed Central

    Bawankule, Rahul; Singh, Abhishek; Kumar, Kaushalendra; Shetye, Sadanand

    2017-01-01

    Background Pneumonia and diarrhea occur either as complications or secondary infections in measles affected children. So, the integrated Global Action Plan for Pneumonia and Diarrhea (GAPPD) by WHO and UNICEF includes measles vaccination as preventive measure in children. The objective of the study is to examine the effect of measles vaccination on Acute Respiratory Infection (ARI) and diarrhea in children in the Democratic Republic of Congo, Ethiopia, India, Nigeria, and Pakistan. Methods We analyzed data from the most recent rounds of Demographic and Health Surveys (DHS) in the selected countries. We included children age 12–59 months in the analysis. We used multivariable binary logistic regression to examine the effect of measles vaccination on ARI and diarrhea in children. We also estimated Vaccination Effectiveness (VE). Findings More than 60 percent of the children age 12–59 months were given measles vaccine before the survey in the Democratic Republic of Congo, Ethiopia, India and Pakistan. Children who were given the measles vaccine were less likely to suffer from ARI than unvaccinated children in India and Pakistan. Children who were given the measles vaccine had a lower risk of diarrhea than those who did not receive it in all the selected countries except Ethiopia. Measles vaccination was associated with reduction in ARI cases by 15–30 percent in India and Pakistan, and diarrhea cases by 12–22 percent in the Democratic Republic of Congo, India, Nigeria and Pakistan. Conclusion The receipt of the measles vaccine was associated with decrease in ARI and diarrhea in children. The immunization program must ensure that each child gets the recommended doses of measles vaccine at the appropriate age. The measles vaccination should be given more attention as a preventive intervention under the Global Action Plan for Pneumonia and Diarrhea (GAPPD) in all low and middle-income countries. PMID:28076428

  7. Knowledge and risk perception of measles and factors associated with vaccination decisions in subjects consulting university affiliated public hospitals in Lyon, France, after measles infection.

    PubMed

    Toure, Abdoulaye; Saadatian-Elahi, Mitra; Floret, Daniel; Lina, Bruno; Casalegno, Jean-Sebastien; Vanhems, Philippe

    2014-01-01

    In 2011, a large number of European countries faced measles outbreaks, France accounting for more than half of the reported cases. The Rhône-Alpes region, located in south-east France, was one of the most affected provinces, with an incidence rate of 97.9 cases per 100 000 inhabitants. We conducted a retrospective survey of adults and parents of children consulting university affiliated public hospitals because of measles infections between January 1, 2010 and September 2012 in Lyon, France. Our main objectives were to evaluate (1) the level of study population knowledge of measles, (2) vaccination practices, and (3) changes in opinion with regard to measles vaccination after disease onset. Overall, 73.64% of patients were not vaccinated or partially vaccinated. The main reason for non-vaccination in children was inappropriate age while among non-vaccinated adults, 29.3% could not give any reason. In total, 29.1% of the responding parents and 24.2% of adult cases were opposed to vaccination "in principle." A large number of patients did not recognize measles as a serious illness and were unaware of its complications. Among parents of infected children, knowledge of transmission mode (odds ratio [OR] = 5.9; 95% confidence interval [95% CI]: 1.64-21.26), perceived severity of measles (OR = 1.5; 95% CI: 1.06-2.13), and absence of hepatitis B vaccination (OR = 0.17; 95% CI: 0.04-0.65) were independently associated with a more positive opinion about measles vaccination after disease onset. In adult patients, low education level (OR = 3.39; 95% CI: 1.03-11.11) and lack of knowledge of sequelae (OR = 10.19; 95% CI: 1.14-91.31) were linked with a more positive opinion. Individuals affected by vaccine-preventable diseases are interesting populations to study disease impact on vaccine perception.

  8. [Evaluation of the response to vaccination against poliomyelitis and measles in malnourished children in Morocco].

    PubMed

    Caidi, H; Bennis, I F; Mouan, N; El Aouad, R

    2004-01-01

    We made a comparative survey of the poliovirus antibodies (anti-poliovirus type 1, anti-poliovirus type 2 and anti-poliovirus type 3) and the measles antibodies in malnourished but completely vaccinated children (37) and control children (34). The age range was 10 months to 5 years. Immunization in children with protein-energy malnutrition was low for both vaccines. Seroprevalence rates of the polio 1, polio 2, polio 3 antibodies and the measles antibodies in the control group were 94.1%, 97.1%, 91.2% and 82.4% respectively. In malnourished children the respective rates were in some cases significantly lower being: 40.5% (P = 0.001), 59.5% (P = 0.001), 40.5% and 35.1%. Malnutrition is a major determinant of the humoral response to oral polio and measles vaccines and must be given due consideration to prevent vaccination failure.

  9. The causal effect of childhood measles vaccination on educational attainment: A mother fixed-effects study in rural South Africa

    PubMed Central

    Anekwe, Tobenna D.; Newell, Marie-Louise; Tanser, Frank; Pillay, Deenan; Bärnighausen, Till

    2015-01-01

    Background Because measles vaccination prevents acute measles disease and morbidities secondary to measles, such as undernutrition, blindness, and brain damage, the vaccination may also lead to higher educational attainment. However, there has been little evidence to support this hypothesis at the population level. In this study, we estimate the causal effect of childhood measles vaccination on educational attainment among children born between 1995 and 2000 in South Africa. Methods and findings We use longitudinal data on measles vaccination status and school grade attainment among 4783 children. The data were collected by the Wellcome Trust Africa Centre Demographic Information System (ACDIS), which is one of Africa's largest health and demographic surveillance systems. ACDIS is located in a poor, predominantly rural, Zulu-speaking community in KwaZulu-Natal, South Africa. Using mother fixed-effects regression, we compare the school grade attainment of siblings who are discordant in their measles vaccination status but share the same mother and household. This fixed-effects approach controls for confounding due to both observed and unobserved factors that do not vary between siblings, including sibling-invariant mother and household characteristics such as attitudes toward risk, conscientiousness, and aspirations for children. We further control for a range of potential confounders that vary between siblings, such as sex of the child, year of birth, mother's age at child's birth, and birth order. We find that measles vaccination on average increases school grade attainment by 0.188 grades (95% confidence interval, 0.0424–0.334; p = 0.011). Conclusions Measles vaccination increased educational attainment in this poor, largely rural community in South Africa. For every five to seven children vaccinated against measles, one additional school grade was gained. The presence of a measles vaccination effect in this community is plausible because (i) measles

  10. Measles Vaccination Coverage among Latino Children Aged 12 to 59 Months in Los Angeles County: A Household Survey.

    ERIC Educational Resources Information Center

    Ewert, Donnell P.; And Others

    1991-01-01

    Examines the results of a household survey of measles vaccination coverage among Hispanic American children aged 12 to 59 months. Between 81 percent and 91 percent of the children have been vaccinated, a percentage insufficient to stop the high rate of measles transmission within this population. Recommends that public health efforts be focused on…

  11. Mutual interference on the immune response to yellow fever vaccine and a combined vaccine against measles, mumps and rubella.

    PubMed

    Nascimento Silva, Juliana Romualdo; Camacho, Luiz Antonio B; Siqueira, Marilda M; Freire, Marcos de Silva; Castro, Yvone P; Maia, Maria de Lourdes S; Yamamura, Anna Maya Y; Martins, Reinaldo M; Leal, Maria de Luz F

    2011-08-26

    A randomized trial was conducted to assess the immunogenicity and reactogenicity of yellow fever vaccines (YFV) given either simultaneously in separate injections, or 30 days or more after a combined measles-mumps-rubella (MMR) vaccine. Volunteers were also randomized to YFV produced from 17DD and WHO-17D-213 substrains. The study group comprised 1769 healthy 12-month-old children brought to health care centers in Brasilia for routine vaccination. The reactogenicity was of the type and frequency expected for the vaccines and no severe adverse event was associated to either vaccine. Seroconversion and seropositivity 30 days or more after vaccination against yellow fever was similar across groups defined by YFV substrain. Subjects injected YFV and MMR simultaneously had lower seroconversion rates--90% for rubella, 70% for yellow fever and 61% for mumps--compared with those vaccinated 30 days apart--97% for rubella, 87% for yellow fever and 71% for mumps. Seroconversion rates for measles were higher than 98% in both comparison groups. Geometric mean titers for rubella and for yellow fever were approximately three times higher among those who got the vaccines 30 days apart. For measles and mumps antibodies GMTs were similar across groups. MMR's interference in immune response of YFV and YFV's interference in immune response of rubella and mumps components of MMR had never been reported before but are consistent with previous observations from other live vaccines. These results may affect the recommendations regarding primary vaccination with yellow fever vaccine and MMR.

  12. Waning of Maternal Antibodies Against Measles, Mumps, Rubella, and Varicella in Communities With Contrasting Vaccination Coverage

    PubMed Central

    Waaijenborg, Sandra; Hahné, Susan J. M.; Mollema, Liesbeth; Smits, Gaby P.; Berbers, Guy A. M.; van der Klis, Fiona R. M.; de Melker, Hester E.; Wallinga, Jacco

    2013-01-01

    Background. The combined measles, mumps, and rubella (MMR) vaccine has been successfully administered for >20 years. Because of this, protection by maternal antibodies in infants born to vaccinated mothers might be negatively affected. Methods. A large cross-sectional serologic survey was conducted in the Netherlands during 2006–2007. We compared the kinetics of antibody concentrations in children and women of childbearing age in the highly vaccinated general population with those in orthodox Protestant communities that were exposed to outbreaks. Results. The estimated duration of protection by maternal antibodies among infants in the general population, most of whom were born to vaccinated mothers, was short: 3.3 months for measles, 2.7 months for mumps, 3.9 months for rubella, and 3.4 months for varicella. The duration of protection against measles was 2 months longer for infants born in the orthodox communities, most of whom had unvaccinated mothers. For rubella, mothers in the orthodox communities had higher concentrations of antibodies as compared to the general population. Conclusion. Children of mothers vaccinated against measles and, possibly, rubella have lower concentrations of maternal antibodies and lose protection by maternal antibodies at an earlier age than children of mothers in communities that oppose vaccination. This increases the risk of disease transmission in highly vaccinated populations. PMID:23661802

  13. Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

  14. A Microneedle Patch Containing Measles Vaccine is Immunogenic in Non-human Primates

    PubMed Central

    Edens, Chris; Collins, Marcus L.; Goodson, James L.; Rota, Paul A.; Prausnitz, Mark R.

    2015-01-01

    Very high vaccination coverage is required to eliminate measles, but achieving high coverage can be constrained by the logistical challenges associated with subcutaneous injection. To simplify logistics of vaccine delivery, a patch containing micron-scale polymeric needles was formulated to encapsulate the standard dose of measles vaccine (1000 TCID50) and the immunogenicity of the microneedle patch was compared with subcutaneous injection in rhesus macaques. The microneedle patch was administered without reconstitution with diluent, dissolved in skin within 10 minutes, and caused only mild, transient skin erythema. Both groups of rhesus macaques generated neutralizing antibody responses to measles that were consistent with protection and the neutralizing antibody titers were equivalent. In addition, the microneedle patches maintained an acceptable level of potency after storage at elevated temperature suggesting improved thermostability compared to standard lyophilized vaccine. In conclusion, a measles microneedle patch vaccine was immunogenic in non-human primates, and this approach offers a promising delivery method that could help increase vaccination coverage. PMID:25770786

  15. A microneedle patch containing measles vaccine is immunogenic in non-human primates.

    PubMed

    Edens, Chris; Collins, Marcus L; Goodson, James L; Rota, Paul A; Prausnitz, Mark R

    2015-09-08

    Very high vaccination coverage is required to eliminate measles, but achieving high coverage can be constrained by the logistical challenges associated with subcutaneous injection. To simplify the logistics of vaccine delivery, a patch containing micron-scale polymeric needles was formulated to encapsulate the standard dose of measles vaccine (1000 TCID₅₀) and the immunogenicity of the microneedle patch was compared with subcutaneous injection in rhesus macaques. The microneedle patch was administered without reconstitution with diluent, dissolved in skin within 10 min, and caused only mild, transient skin erythema. Both groups of rhesus macaques generated neutralizing antibody responses to measles that were consistent with protection and the neutralizing antibody titers were equivalent. In addition, the microneedle patches maintained an acceptable level of potency after storage at elevated temperature suggesting improved thermostability compared to standard lyophilized vaccine. In conclusion, a measles microneedle patch vaccine was immunogenic in non-human primates, and this approach offers a promising delivery method that could help increase vaccination coverage.

  16. Consistency of HLA associations between two independent measles vaccine cohorts: a replication study.

    PubMed

    Ovsyannikova, Inna G; Pankratz, V Shane; Vierkant, Robert A; Jacobson, Robert M; Poland, Gregory A

    2012-03-09

    Associations between HLA genotypes and measles vaccine humoral and cellular immune responses were examined to better understand immunogenetic drivers of vaccine response. Two independent study cohorts of healthy schoolchildren were examined: cohort one, 346 children between 12 and 18 years of age; and cohort two, 388 children between 11 and 19 years of age. All received two age-appropriate doses of measles-containing vaccine. The purpose of this study was to identify and replicate associations between HLA genes and immune responses following measles vaccination found in our first cohort. Associations of comparable magnitudes and with similar p-values were observed between B*3503 (1st cohort p=0.01; 2nd cohort p=0.07), DQA1*0201 (1st cohort p=0.03; 2nd cohort p=0.03), DQB1*0303 (1st cohort p=0.10; 2 cohort p=0.02), DQB1*0602 (1st cohort p=0.07; 2nd cohort p=0.10), and DRB1*0701 (1st cohort p=0.03; 2nd cohort p=0.07) alleles and measles-specific antibody levels. Suggestive, yet consistent, associations were observed between the B7 (1st cohort p=0.01; 2nd cohort p=0.08) supertype and higher measles antibody levels in both cohorts. Also, in both cohorts, the B*0801 and DRB1*0301 alleles, C*0802 and DPA1*0202 alleles, and DRB1*1303 alleles displayed consistent associations with variations in IFN-γ, IL-2 and IL-10 secretion, respectively. This study emphasizes the importance of replicating HLA associations with measles vaccine-induced humoral and cellular immune responses and increases confidence in the results. These data will inform strategies for functional studies and novel vaccine development, including epitope-based measles vaccines. This is the first HLA association replication study with measles vaccine-specific immune responses to date.

  17. Measles Vaccination of Nonhuman Primates Provides Partial Protection against Infection with Canine Distemper Virus

    PubMed Central

    de Vries, Rory D.; Ludlow, Martin; Verburgh, R. Joyce; van Amerongen, Geert; Yüksel, Selma; Nguyen, D. Tien; McQuaid, Stephen; Osterhaus, Albert D. M. E.; Duprex, W. Paul

    2014-01-01

    ABSTRACT Measles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus (CDV). Natural CDV infection causing clinical signs has never been reported in humans, but recent outbreaks in captive macaques have shown that CDV can cause disease in primates. We studied the virulence and tropism of recombinant CDV expressing enhanced green fluorescent protein in naive and measles-vaccinated cynomolgus macaques. In naive animals CDV caused viremia and fever and predominantly infected CD150+ lymphocytes and dendritic cells. Virus was reisolated from the upper and lower respiratory tracts, but infection of epithelial or neuronal cells was not detectable at the time points examined, and the infections were self-limiting. This demonstrates that CDV readily infects nonhuman primates but suggests that additional mutations are necessary to achieve full virulence in nonnatural hosts. Partial protection against CDV was observed in measles-vaccinated macaques, as demonstrated by accelerated control of virus replication and limited shedding from the upper respiratory tract. While neither CDV infection nor MV vaccination induced detectable cross-reactive neutralizing antibodies, MV-specific neutralizing antibody levels of MV-vaccinated macaques were boosted by CDV challenge infection, suggesting that cross-reactive VN epitopes exist. Rapid increases in white blood cell counts in MV-vaccinated macaques following CDV challenge suggested that cross-reactive cellular immune responses were also present. This study demonstrates that zoonotic morbillivirus infections can be controlled by measles vaccination. IMPORTANCE Throughout history viral zoonoses have had a substantial impact on human health. Given the drive toward global eradication of measles, it is essential to

  18. Recombinant Measles AIK-C Vaccine Strain Expressing the prM-E Antigen of Japanese Encephalitis Virus.

    PubMed

    Higuchi, Akira; Toriniwa, Hiroko; Komiya, Tomoyoshi; Nakayama, Tetsuo

    2016-01-01

    An inactivated Japanese encephalitis virus (JEV) vaccine, which induces neutralizing antibodies, has been used for many years in Japan. In the present study, the JEV prM-E protein gene was cloned, inserted at the P/M junction of measles AIK-C cDNA, and an infectious virus was recovered. The JEV E protein was expressed in B95a cells infected with the recombinant virus. Cotton rats were inoculated with recombinant virus. Measles PA antibodies were detected three weeks after immunization. Neutralizing antibodies against JEV developed one week after inoculation, and EIA antibodies were detected three weeks after immunization. The measles AIK-C-based recombinant virus simultaneously induced measles and JEV immune responses, and may be a candidate for infant vaccines. Therefore, the present strategy of recombinant viruses based on a measles vaccine vector would be applicable to the platform for vaccine development.

  19. Effect of age on the risk of Fever and seizures following immunization with measles-containing vaccines in children.

    PubMed

    Rowhani-Rahbar, Ali; Fireman, Bruce; Lewis, Edwin; Nordin, James; Naleway, Allison; Jacobsen, Steven J; Jackson, Lisa A; Tse, Alison; Belongia, Edward A; Hambidge, Simon J; Weintraub, Eric; Baxter, Roger; Klein, Nicola P

    2013-12-01

    IMPORTANCE The first dose of live attenuated measles-containing vaccines is associated with an increased risk of febrile seizures 7 to 10 days following immunization among 12- to 23-month-old children. The combination measles, mumps, rubella, and varicella vaccine is associated with a 2-fold increased risk of febrile seizures 7 to 10 days following immunization compared with the separately administered measles, mumps, and rubella and varicella vaccines. It is unknown whether the magnitude of these increased risks depends on age at immunization. OBJECTIVE To examine the potential modifying effect of age on the risk of fever and seizures following immunization with measles-containing vaccines. DESIGN, SETTING, AND PARTICIPANTS Retrospective cohort study at 8 Vaccine Safety Datalink sites of a total of 840,348 children 12 to 23 months of age who had received a measles-containing vaccine from 2001 through 2011. EXPOSURES Any measles-containing vaccines and measles-containing vaccines by type. MAIN OUTCOMES AND MEASURES Fever and seizure events occurring during a 42-day postimmunization observation period. RESULTS In the analysis of any measles-containing vaccines, the increased risk of seizures during the 7- to 10-day risk interval, using the remainder of the observation period as the control interval, was significantly greater among older children (relative risk, 6.5; 95% CI, 5.3-8.1; attributable risk, 9.5 excess cases per 10,000 doses; 95% CI, 7.6-11.5) than among younger children (relative risk, 3.4; 95% CI, 3.0-3.9; attributable risk = 4.0 excess cases per 10,000 doses; 95% CI, 3.4-4.6). The relative risk of postimmunization fever was significantly greater among older children than among younger children; however, its attributable risk was not. In the analysis of vaccine type, measles, mumps, rubella, and varicella vaccine was associated with a 1.4-fold increase in the risk of fever and 2-fold increase in the risk of seizures compared with measles, mumps, and

  20. Environmental tobacco exposure is associated with vaccine modified measles in junior high school students.

    PubMed

    Suzuki, Shuichi; Sato, Kazuki; Watanabe, Hiroko; Nezu, Yoko; Nishimuta, Toshiyuki

    2015-11-01

    Vaccine modified measles (VMM) affects individuals with attenuated vaccine induced immunity. An outbreak of measles occurred in a junior high school, starting from an unvaccinated eighth-grade student who developed natural measles and affected a majority of students who were immunized with a low potent strain of measles vaccine (TD97). To determine whether environmental tobacco smoke (ETS) exposure was associated with the development of VMM in this population, a questionnaire was used asking whether students had VMM symptoms during the outbreak and the smoking status of family members. VMM was defined in the study population as occurrence of fever and/or erythema, along with documented history of measles vaccination. A total of 513 students (85.9%) responded. Overall, the presence of in-house smokers did not differ between VMM students (49.3%) and non-VMM students (50.2%). However, in the ninth grade, presence of an in-house smoker was significantly higher in the family of VMM students (54.0%) than in non-VMM students (36.6%) (P = 0.044). Urinary cotinine levels were also measured in selected students (n = 37). Among families with at least one smoker, urinary cotinine levels were significantly higher in VMM students than in non-VMM students (P = 0.032). Furthermore, a multivariable logistic regression analysis showed that a high urinary cotinine level (>10 ng/mg creatinine; 13.5 percentile) was associated with the development of VMM. Our findings suggest that a high level of ETS exposure may be associated with an increased risk of VMM in a population with attenuated vaccine induced immunity against measles.

  1. Vaccine-Preventable Diseases In Pediatric Patients: A Review Of Measles, Mumps, Rubella, And Varicella.

    PubMed

    Levine, Deborah A

    2016-12-01

    Vaccine-preventable diseases such as measles, mumps, rubella, and varicella continue to plague children and adults worldwide. Although public health programs have helped decrease the prevalence and sequelae of these diseases, outbreaks still occur. To limit the spread of these diseases, emergency clinicians must be able to readily identify the characteristic presentations of the rashes associated with measles, rubella, and varicella, as well as the common presenting features associated with mumps. Diagnostic laboratory studies are not usually necessary, as a complete history and physical examination usually lead to an accurate diagnosis. Treatment for these vaccine-preventable diseases usually consists of supportive care, but, in some cases, severe complications and death may occur. This issue provides a review of the clinical features, differential diagnoses, potential complications, and treatment options for measles, mumps, rubella, and varicella.

  2. Measles outbreak in a poorly vaccinated region in Cameroon: a case series study, public health challenges and recommendations.

    PubMed

    Njim, Tsi; Aminde, Leopold Ndemnge; Feteh, Fambombi Vitalis; Ngum, Joel Mbigha; Moustapha, Chandini Aliyou

    2015-01-01

    Measles is a highly contagious viral infection and still a leading cause of vaccine-preventable deaths in Africa; especially in unvaccinated populations. We reviewed the medical reports of the measles outbreak that occurred in Misaje, in the North west region of Cameroon from 11/03/2015 to 14/05/2015. Six measles cases were recorded during this period; three of them complicated by bacterial infections. Measles should be considered as a differential diagnosis for any febrile rash especially among poorly vaccinated populations. Primary preventive methods implemented by clinicians could help control outbreaks; especially with delays in public health intervention. Also, gaps in health policies in Cameroon should be addressed to scale up vaccination coverage in remote communities like Misaje to reduce the incidence of measles outbreaks.

  3. Experimental study of a further attenuated live measles vaccine of the Sugiyama strain in Iran

    PubMed Central

    Mirchamsy, H.; Shafyi, A.; Rafyi, M. R.; Bahrami, S.; Nazari, P.; Fatemie, S.

    1974-01-01

    After encouraging results of the mass vaccination programme in Iran, in which 5 million children in rural areas were vaccinated with the Japanese Sugiyama strain at its 82nd passage in baby calf kidney, and a progressive decrease in the incidence of measles as well as a reduction of excessive infant mortality, a further attenuated vaccine, produced with the same strain, cloned in Japan, was compared in a field trial with the parent vaccine. The new strain caused fewer reactions than the original strain. Seroconversion with a geometric mean antibody titre of 6·1 was observed in 95% of susceptible children. PMID:4522721

  4. Age-stratified seroprevalence of measles, mumps and rubella (MMR) virus infections in Switzerland after the introduction of MMR mass vaccination.

    PubMed

    Matter, L; Germann, D; Bally, F; Schopfer, K

    1997-01-01

    We have performed age-stratified seroprevalence studies for MMR to evaluate these vaccinations. Serum samples submitted for diagnostic testing were randomly selected for unlinked anonymous panels. IgG antibodies were tested by ELISA and indirect immunofluorescence. In the vaccination cohort (age 1.5 to 6.5 years), seroprevalence attained 80%. For measles and mumps it continued to increase to 95%, while for rubella it declined transiently to 60% between 7 and 12 years of age. We observed no differences according to gender in any age group in 1991-1992. (Semi)quantitative values of the IgG antibodies against all three viruses increased during adolescence, suggesting wild virus circulation. In 1992, MMR vaccination has reached < 80% of the children during their second year of age. Due to previous monovalent measles and mumps vaccinations in pre-school children and due to endemic and epidemic activity, particularly of mumps virus, a trough of the seroprevalence in adolescents was evident only for rubella. MMR vaccination campaigns performed at school since 1987 have increase seroprevalence in this population segment and have probably over-compensated for the expected shift to the right of the seroprevalence curves. A more compulsive implementation of the recommended childhood vaccination schedule and continued efforts at catchup vaccinations during school age especially for rubella are necessary to avoid the accumulation of susceptible young adults during the forthcoming decades.

  5. Factors associated with delayed measles vaccination among children in Shenzhen, China: A case-control study

    PubMed Central

    Lin, Weiyan; Xiong, Yongzhen; Tang, Hao; Chen, Baoli; Ni, Jindong

    2015-01-01

    A delay in the first dose of measles-containing vaccine (MCV1) may contribute to outbreaks of measles, resulting in a high age-specific incidence in infants <1 y of age. To determine the factors associated with delayed MCV1 vaccinations, we used data from the China Information Management System for Immunization Programming. Additionally, the parents/guardians of 430 children whose MCV1 vaccinations were delayed, as well as the parents/guardians of 424 children who received timely vaccinations, were surveyed by telephone. Children were less likely to receive timely MCV1 vaccinations if they belonged to an immigrant group, were male, had poor health status, had a father whose occupation e.g., a manager, had a history of delays in other Expanded Programs on Immunization (EPI) vaccinations, had parents who did not believe vaccinations were important for their children, and experienced shorter travel times to and longer waiting times in EPI clinics. The children of mothers whose occupational status (technician) were more likely to receive timely MCV1 vaccinations. The timeliness of MCV1 vaccinations should be considered as an additional indicator of the quality of vaccination programs. PMID:25668667

  6. Factors associated with delayed measles vaccination among children in Shenzhen, China: a case-control study.

    PubMed

    Lin, Weiyan; Xiong, Yongzhen; Tang, Hao; Chen, Baoli; Ni, Jindong

    2014-01-01

    A delay in the first dose of measles-containing vaccine (MCV1) may contribute to outbreaks of measles, resulting in a high age-specific incidence in infants<1 y of age. To determine the factors associated with delayed MCV1 vaccinations, we used data from the China Information Management System for Immunization Programming. Additionally, the parents/guardians of 430 children whose MCV1 vaccinations were delayed, as well as the parents/guardians of 424 children who received timely vaccinations, were surveyed by telephone. Children were less likely to receive timely MCV1 vaccinations if they belonged to an immigrant group, were male, had poor health status, had a father whose occupation e.g., a manager, had a history of delays in other Expanded Programs on Immunization (EPI) vaccinations, had parents who did not believe vaccinations were important for their children, and experienced shorter travel times to and longer waiting times in EPI clinics. The children of mothers whose occupational status (technician) were more likely to receive timely MCV1 vaccinations. The timeliness of MCV1 vaccinations should be considered as an additional indicator of the quality of vaccination programs.

  7. Seroprevalence of measles, mumps and rubella among young adults, after 20 years of universal 2-dose MMR vaccination in Israel.

    PubMed

    Levine, Hagai; Zarka, Salman; Ankol, Omer E; Rozhavski, Vladi; Davidovitch, Nadav; Aboudy, Yair; Balicer, Ran D

    2015-01-01

    Evidence-based vaccination policy is important for the global and local efforts of achieving control over measles. In 2007, the first Israeli birth cohort to be twice vaccinated during childhood with Measles-Mumps-Rubella vaccine reached adulthood. In parallel, Israel experienced its largest measles outbreak since 1994. We aimed to assess the seroprevalence of measles IgG antibodies and concordance with rubella and mumps seroprevalence among young Israeli adults born 1988-9 in comparison to previous birth cohorts, in order to inform evidence based prevention policy. We conducted a seroprevalence study of IgG antibodies among 439 Israeli adults born in 1988-9, based on a representative sample of sera collected at age 18-19 upon recruitment to mandatory military service in 2007. In total, 85.7% were seropositive for measles as compared with 95.6% in the 1996 recruitment (P < 0.001). The absolute decline was significant both for males (8.8%, P = 0.001) and females (12.1%, P < 0.001). There were no significant differences in seropositivity by gender, years of education, country of birth or smoking status. Rubella seropositivity among measles seropositives was 90.4%, significantly (P < 0.001) higher than 72.1% among measles seronegatives. Mumps seropositivity among measles seropositives was 87.0%, significantly (P < 0.001) higher than 62.3% among measles seronegatives. Results were similar for Israeli-born only. Our findings indicate that measles seroprevalence decreased after the last change in vaccination policy and reach sub-optimal level. Until global eradication is reached, a proactive vaccination program to supplement routine childhood vaccination program should be considered in Israel and in other countries.

  8. Framework for Optimal Global Vaccine Stockpile Design for Vaccine-Preventable Diseases: Application to Measles and Cholera Vaccines as Contrasting Examples.

    PubMed

    Thompson, Kimberly M; Duintjer Tebbens, Radboud J

    2016-07-01

    Managing the dynamics of vaccine supply and demand represents a significant challenge with very high stakes. Insufficient vaccine supplies can necessitate rationing, lead to preventable adverse health outcomes, delay the achievements of elimination or eradication goals, and/or pose reputation risks for public health authorities and/or manufacturers. This article explores the dynamics of global vaccine supply and demand to consider the opportunities to develop and maintain optimal global vaccine stockpiles for universal vaccines, characterized by large global demand (for which we use measles vaccines as an example), and nonuniversal (including new and niche) vaccines (for which we use oral cholera vaccine as an example). We contrast our approach with other vaccine stockpile optimization frameworks previously developed for the United States pediatric vaccine stockpile to address disruptions in supply and global emergency response vaccine stockpiles to provide on-demand vaccines for use in outbreaks. For measles vaccine, we explore the complexity that arises due to different formulations and presentations of vaccines, consideration of rubella, and the context of regional elimination goals. We conclude that global health policy leaders and stakeholders should procure and maintain appropriate global vaccine rotating stocks for measles and rubella vaccine now to support current regional elimination goals, and should probably also do so for other vaccines to help prevent and control endemic or epidemic diseases. This work suggests the need to better model global vaccine supplies to improve efficiency in the vaccine supply chain, ensure adequate supplies to support elimination and eradication initiatives, and support progress toward the goals of the Global Vaccine Action Plan.

  9. Recent resurgence of measles in a community with high vaccination coverage.

    PubMed

    Ni, Jin Dong; Xiong, Yong Zhen; Li, Tao; Yu, Xiu Nian; Qian, Bang Qun

    2015-03-01

    Even though 2-dose measles vaccination coverage rate was maintained at more than 95%, the largest measles outbreaks since 1996 still occurred in Wuhu city, P R China. A total of 916 cases were reported during 2005-2010. The annual incidence was 6.7 cases per 100,000 population with the peak incidence of 17.6 cases per 100,000 population in 2008. The highest age-specific incidence rate was 222.1 per 100,000 population and occurred in infants aged between 8 and 12 months; the second was 151.9 per 100,000 population in infants aged <8 months. Also, 200 cases occurred in those aged to 22 to 30 years old, accounting for 21.8% of total cases, with the age-specific incidence being 12.8 per 100,000 population. The characteristics related to age distribution have changed in recent measles outbreaks. It underlines the need for vaccination of susceptible young adults and timely administration of the first dose of the measles vaccine.

  10. Protection of Mice from Fatal Measles Encephalitis by Vaccination with Vaccinia Virus Recombinants Encoding Either the Hemagglutinin or the Fusion Protein

    NASA Astrophysics Data System (ADS)

    Drillien, Robert; Spehner, Daniele; Kirn, Andre; Giraudon, Pascale; Buckland, Robin; Wild, Fabian; Lecocq, Jean-Pierre

    1988-02-01

    Vaccinia virus recombinants encoding the hemagglutinin or fusion protein of measles virus have been constructed. Infection of cell cultures with the recombinants led to the synthesis of authentic measles proteins as judged by their electrophoretic mobility, recognition by antibodies, glycosylation, proteolytic cleavage, and presentation on the cell surface. Mice vaccinated with a single dose of the recombinant encoding the hemagglutinin protein developed antibodies capable of both inhibiting hemagglutination activity and neutralizing measles virus, whereas animals vaccinated with the recombinant encoding the fusion protein developed measles neutralizing antibodies. Mice vaccinated with either of the recombinants resisted a normally lethal intracerebral inoculation of a cell-associated measles virus subacute sclerosing panencephalitis strain.

  11. Safety and Immunogenicity of Sequential Rotavirus Vaccine Schedules

    PubMed Central

    Libster, Romina; McNeal, Monica; Walter, Emmanuel B.; Shane, Andi L.; Winokur, Patricia; Cress, Gretchen; Berry, Andrea A.; Kotloff, Karen L.; Sarpong, Kwabena; Turley, Christine B.; Harrison, Christopher J.; Pahud, Barbara A.; Marbin, Jyothi; Dunn, John; El-Khorazaty, Jill; Barrett, Jill

    2016-01-01

    BACKGROUND AND OBJECTIVES: Although both licensed rotavirus vaccines are safe and effective, it is often not possible to complete the schedule by using the same vaccine formulation. The goal of this study was to investigate the noninferiority of the immune responses to the 2 licensed rotavirus vaccines when administered as a mixed schedule compared with administering a single vaccine formulation alone. METHODS: Randomized, multicenter, open-label study. Healthy infants (6–14 weeks of age) were randomized to receive rotavirus vaccines in 1 of 5 different schedules (2 using a single vaccine for all doses, and 3 using mixed schedules). The group receiving only the monovalent rotavirus vaccine received 2 doses of vaccine and the other 4 groups received 3 doses of vaccine. Serum for immunogenicity testing was obtained 1 month after the last vaccine dose and the proportion of seropositive children (rotavirus immunoglobulin A ≥20 U/mL) were compared in all the vaccine groups. RESULTS: Between March 2011 and September 2013, 1393 children were enrolled and randomized. Immune responses to all the sequential mixed vaccine schedules were shown to be noninferior when compared with the 2 single vaccine reference groups. The proportion of children seropositive to at least 1 vaccine antigen at 1 month after vaccination ranged from 77% to 96%, and was not significantly different among all the study groups. All schedules were well tolerated. CONCLUSIONS: Mixed schedules are safe and induced comparable immune responses when compared with the licensed rotavirus vaccines given alone. PMID:26823540

  12. Reaching hard-to-reach individuals: Nonselective versus targeted outbreak response vaccination for measles.

    PubMed

    Minetti, Andrea; Hurtado, Northan; Grais, Rebecca F; Ferrari, Matthew

    2014-01-15

    Current mass vaccination campaigns in measles outbreak response are nonselective with respect to the immune status of individuals. However, the heterogeneity in immunity, due to previous vaccination coverage or infection, may lead to potential bias of such campaigns toward those with previous high access to vaccination and may result in a lower-than-expected effective impact. During the 2010 measles outbreak in Malawi, only 3 of the 8 districts where vaccination occurred achieved a measureable effective campaign impact (i.e., a reduction in measles cases in the targeted age groups greater than that observed in nonvaccinated districts). Simulation models suggest that selective campaigns targeting hard-to-reach individuals are of greater benefit, particularly in highly vaccinated populations, even for low target coverage and with late implementation. However, the choice between targeted and nonselective campaigns should be context specific, achieving a reasonable balance of feasibility, cost, and expected impact. In addition, it is critical to develop operational strategies to identify and target hard-to-reach individuals.

  13. Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector.

    PubMed

    Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A; Knuchel, Marlyse C; Naim, Hussein Y

    2013-03-01

    The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 10 ( 20) . The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors.

  14. Vaccination schedules in small ruminant farms.

    PubMed

    Lacasta, D; Ferrer, L M; Ramos, J J; González, J M; Ortín, A; Fthenakis, G C

    2015-12-14

    Development and implementation of health management plans is the cornerstone of profitable farms; prevention of microbial diseases by means of vaccination is an integral part of such a plan. In every production type and management system in small ruminants, microbial diseases have a major significance, hence their proper control must be based in good health management practices, including use of effective and safe vaccines. Development of various types of vaccines is evolving very quickly in recent years and the improvement of new type of vaccines offers prospects. The article reviews and discusses vaccination programs and latest advances in development of vaccines against diseases that cause major economic losses in small ruminants. Specifically, vaccination schedules for the following diseases are reviewed: bacterial abortion (abortion associated with Brucella melitensis, Campylobacter spp., Chlamydophila abortus, Coxiella burnetii, Salmonella abortus ovis or Salmonella brandenburg), caseous lymphadenitis, clostridial diseases, colibacillosis, contagious echtyma, epididymitis caused by Brucella ovis, footrot, mammary diseases (contagious agalactia, mastitis), paratuberculosis and respiratory diseases (respiratory disease caused by Mannheimia haemolytica or other Pasteurellaceae).

  15. Measles outbreaks: what does it represent for the elimination strategy in the region of the Americas? A call for the action.

    PubMed

    Avila-Aguero, María L; Camacho-Badilla, Kattia; Ulloa-Gutierrez, Rolando

    2015-01-01

    The US is experiencing a large multi-state measles outbreak that started in California in 2014. At this time, no source case for the outbreak has been identified. Measles was declared eliminated in the US in 2000, because at that time, there were high coverage rates with the two-dose schedule and these vaccines have been very immunogenic. Measles is still endemic in many parts of the world, and outbreaks can occur when unvaccinated groups are exposed to imported measles virus. The current multi-state outbreak underscores the ongoing risk of measles importation, the need for high measles vaccination coverage rates, and the importance of a prompt and appropriate public health response to individual cases and outbreaks. The US outbreak threatens measles control in the Americas. Strengthening immunization programs and keeping vaccination coverage rates above 95% with a two-dose schedule will be necessary for measles control strategies in the Americas.

  16. Immunogenicity and safety of a two-dose regimen of a combined measles, mumps, rubella and varicella live vaccine (ProQuad(®)) in infants from 9 months of age.

    PubMed

    Vesikari, Timo; Becker, Thomas; Gajdos, Vincent; Fiquet, Anne; Thomas, Stéphane; Richard, Patrick; Baudin, Martine

    2012-04-26

    Vaccination against measles, mumps, rubella and varicella (MMRV) is currently recommended in developed countries for infants from 12 months of age. However, measles vaccination at 9 months of age is recommended by the WHO in the Expanded Program on Immunization (EPI) schedule and it is therefore possible that MMR or MMRV vaccines might also be given at this age. This open-label, randomised, comparative study evaluated the immunogenicity and safety of a 2-dose schedule of ProQuad(®) (MMRV vaccine) given at a 3-month interval in healthy infants aged ≥9 months. For measles, the non-inferiority of the response rate post-Dose 2 was reached when Dose 1 was administered at 11 months (98%) compared with 12 months (99%) but was not reached when Dose 1 was administered at 9 months (95%). The response rate to measles post-Dose 1 increased with age, from 73% to 88% and 90% at 9, 11 and 12 months, respectively. For mumps, rubella and varicella, response rates were not different after Dose 1 (>95%) or Dose 2 (>99%) regardless of whether Dose 1 was administered at 9, 11 or 12 months of age. In conclusion, the age of administration of the first of a two-dose regimen of ProQuad may be lowered to 11 months. Dose 1 may be administered at 9 months if early protection is required, but it should be recognised that a second dose is required promptly with a minimum of 3-month interval between doses.

  17. Impact on Epidemic Measles of Vaccination Campaigns Triggered by Disease Outbreaks or Serosurveys: A Modeling Study

    PubMed Central

    Metcalf, C. Jessica E.; Cutts, Felicity T.; Grenfell, Bryan T.

    2016-01-01

    Background Routine vaccination supplemented by planned campaigns occurring at 2–5 y intervals is the core of current measles control and elimination efforts. Yet, large, unexpected outbreaks still occur, even when control measures appear effective. Supplementing these activities with mass vaccination campaigns triggered when low levels of measles immunity are observed in a sample of the population (i.e., serosurveys) or incident measles cases occur may provide a way to limit the size of outbreaks. Methods and Findings Measles incidence was simulated using stochastic age-structured epidemic models in settings conducive to high or low measles incidence, roughly reflecting demographic contexts and measles vaccination coverage of four heterogeneous countries: Nepal, Niger, Yemen, and Zambia. Uncertainty in underlying vaccination rates was modeled. Scenarios with case- or serosurvey-triggered campaigns reaching 20% of the susceptible population were compared to scenarios without triggered campaigns. The best performing of the tested case-triggered campaigns prevent an average of 28,613 (95% CI 25,722–31,505) cases over 15 y in our highest incidence setting and 599 (95% CI 464–735) cases in the lowest incidence setting. Serosurvey-triggered campaigns can prevent 89,173 (95% CI, 86,768–91,577) and 744 (612–876) cases, respectively, but are triggered yearly in high-incidence settings. Triggered campaigns reduce the highest cumulative incidence seen in simulations by up to 80%. While the scenarios considered in this strategic modeling exercise are reflective of real populations, the exact quantitative interpretation of the results is limited by the simplifications in country structure, vaccination policy, and surveillance system performance. Careful investigation into the cost-effectiveness in different contexts would be essential before moving forward with implementation. Conclusions Serologically triggered campaigns could help prevent severe epidemics in the

  18. [Vaccination offers good protection against measles, mumps and rubella. To refuse vaccination would seriously threaten our good immunity status].

    PubMed

    Linde, A; Johansen, K

    2001-08-29

    Since vaccination against measles, rubella and mumps (MMR) was introduced in Sweden in 1982 for children at 1.5 and 12 years of age these diseases have almost completely disappeared. Severe side effects have been rare. Threats against the continued protection from these diseases include a lessening inclination on the part of parents to vaccinate their children, a weakening of the vaccine-induced immunological response with time, and possibly also genetic changes in strains of circulating wild type virus. By law physicians are bound to report diagnosed cases as well as new or severe side effects. Continuous laboratory analysis of antibodies and circulating viruses is also necessary.

  19. Autism and measles-mumps-rubella vaccination: controversy laid to rest?

    PubMed

    DeStefano, F; Chen, R T

    2001-01-01

    It has been suggested that vaccination, particularly with measles-mumps-rubella (MMR) vaccine, may be related to the development of autism. The main evidence for a possible association is that the prevalence of autism has been increasing at the same time that infant vaccination coverage has increased, and that in some cases there is an apparent temporal association in which autistic characteristics are first noted shortly after vaccination. Although the prevalence of autism and similar disorders appears to have increased recently, it is not clear if this is an actual increase or the result of increased recognition and changes in diagnostic criteria. The apparent onset of autism in close proximity to vaccination may be a coincidental temporal association. The clinical evidence in support of an association derives from a series of 12 patients with inflammatory bowel conditions and regressive developmental disorders, mostly autism. The possibility that measles vaccine may cause autism through a persistent bowel infection has generated much interest, since it provides a possible biological mechanism. Epidemiological studies, however, have not found an association between MMR vaccination and autism. The epidemiological findings are consistent with current understanding of the pathogenesis of autism, which has a strong genetic component and in which the neurological defects probably occur early in embryonic development. It seems unlikely that a vaccination that is given after birth could cause autism. A minority of cases of autism may have onset after 1 year of age (regressive autism), but the single epidemiological study that included such cases did not find an association with MMR vaccination. Currently, the weight of the available epidemiological and related evidence does not support a causal association between MMR vaccine, or any other vaccine or vaccine constituent, and autism.

  20. Real-time investigation of measles epidemics with estimate of vaccine efficacy.

    PubMed

    Ejima, Keisuke; Omori, Ryosuke; Aihara, Kazuyuki; Nishiura, Hiroshi

    2012-01-01

    As part of measles elimination effort, evaluation of the vaccination program and real-time assessment of the epidemic dynamics constitute two important tasks to improve and strengthen the control. The present study aimed to develop an epidemiological modeling method which can be applied to estimating the vaccine efficacy at an individual level while conducting the timely investigation of the epidemic. The multivariate renewal process model was employed to describe the temporal evolution of infection by vaccination history, jointly estimating the time-dependent reproduction number and the vaccine efficacy. Analyzing the enhanced surveillance data of measles in Aichi prefecture, Japan from 2007-08, the vaccine efficacy was estimated at 96.7% (95% confidence interval: 95.8, 97.4). Using an age structured model, the vaccine efficacy among those aged from 5-19 years was shown to be smaller than that among those from 0-4 years. The age-dependent vaccine efficacy estimate informs the age-groups to be targeted for revaccination. Because the estimation method can rest on readily available epidemiological data, the proposed model has a potential to be integrated with routine surveillance.

  1. Control of a measles outbreak by prohibiting non-vaccinated susceptible students from attending school in Akita Prefecture, Japan.

    PubMed

    Takimoto, Noriaki; Takahashi, Yoshihiro; Ishiyama, Akira; Kishimoto, Kaoru; Iwama, Renji; Nakano, Megumi

    2011-01-01

    In 2007-2008, a measles outbreak occurred among children above the age of 10 years in Akita Prefecture, northeastern Japan (population, approximately 1,120,000 at the time). Our group controlled the outbreak by (i) implementing a publically financed urgent vaccination program and (ii) prohibiting non-vaccinated and non-infected students from attending school as per regulations of the school public health law. We encouraged high-risk students to undergo a vaccination program, which resulted in the successful containment of the outbreak without the development of any severe cases. After the outbreak, the Akita Prefectural Government began an annual"Akita measles elimination month" every April, and no measles case found in Akita Prefecture during 2009-2010 subsequently. Our outbreak response initiative can be applied nationally for the complete elimination of measles throughout Japan.

  2. A correlation of measles specific antibodies and the number of plasmacytoid dendritic cells is observed after measles vaccination in 9 month old infants.

    PubMed

    García-León, Miguel L; Bonifaz, Laura C; Espinosa-Torres, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino; Santos-Preciado, José I; Wong-Chew, Rosa M

    2015-01-01

    Measles virus (MeV) represents one of the main causes of death among young children, particularly in developing countries. Upon infection, MeV controls both interferon induction (IFN) and the interferon signaling pathway which results in a severe host immunosuppression that can persists for up to 6 mo after infection. Despite the global biology of MeV infection is well studied, the role of the plasmacytoid dendritic cells (pDCs) during the host innate immune response after measles vaccination remains largely uncharacterized. Here we investigated the role of pDCs, the major producers of interferon in response to viral infections, in the development of adaptive immune response against MeV vaccine. We report that there is a strong correlation between pDCs population and the humoral immune response to Edmonston Zagreb (EZ) measles vaccination in 9-month-old mexican infants. Five infants were further evaluated after vaccination, showing a clear increase in pDCs at baseline, one week and 3 months after immunization. Three months postvaccination they showed increase in memory T-cells and pDCs populations, high induction of adaptive immunity and also observed a correlation between pDCs number and the humoral immune response. These findings suggest that the development and magnitude of the adaptive immune response following measles immunization is directly dependent on the number of pDCs of the innate immune response.

  3. A correlation of measles specific antibodies and the number of plasmacytoid dendritic cells is observed after measles vaccination in 9 month old infants

    PubMed Central

    García-León, Miguel L; Bonifaz, Laura C; Espinosa-Torres, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino; Santos-Preciado, José I; Wong-Chew, Rosa M

    2015-01-01

    Measles virus (MeV) represents one of the main causes of death among young children, particularly in developing countries. Upon infection, MeV controls both interferon induction (IFN) and the interferon signaling pathway which results in a severe host immunosuppression that can persists for up to 6 mo after infection. Despite the global biology of MeV infection is well studied, the role of the plasmacytoid dendritic cells (pDCs) during the host innate immune response after measles vaccination remains largely uncharacterized. Here we investigated the role of pDCs, the major producers of interferon in response to viral infections, in the development of adaptive immune response against MeV vaccine. We report that there is a strong correlation between pDCs population and the humoral immune response to Edmonston Zagreb (EZ) measles vaccination in 9-month-old mexican infants. Five infants were further evaluated after vaccination, showing a clear increase in pDCs at baseline, one week and 3 months after immunization. Three months postvaccination they showed increase in memory T-cells and pDCs populations, high induction of adaptive immunity and also observed a correlation between pDCs number and the humoral immune response. These findings suggest that the development and magnitude of the adaptive immune response following measles immunization is directly dependent on the number of pDCs of the innate immune response. PMID:26075901

  4. German Measles (Rubella)

    MedlinePlus

    ... Spread the Word Shop AAP Find a Pediatrician Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases Healthy Children > Health Issues > Vaccine Preventable Diseases > German Measles (Rubella) Health Issues ...

  5. Effect of jet injection on infectivity of measles, mumps, and rubella vaccine in a bench model.

    PubMed

    Coughlin, Melissa M; Collins, Marcus; Saxon, Gene; Jarrahian, Courtney; Zehrung, Darin; Cappello, Chris; Dhere, Rajeev; Royals, Michael; Papania, Mark; Rota, Paul A

    2015-08-26

    Disposable-syringe jet injectors (DSJIs) with single-use, auto disable, needle-free syringes offer the opportunity to avoid hazards associated with injection using a needle and syringe. Clinical studies have evaluated DSJIs for vaccine delivery, but most studies have focused on inactivated, subunit, or DNA vaccines. Questions have been raised about possible damage to live attenuated viral vaccines by forces generated during the jet injection process. This study examines the effect of jet injection on the integrity of measles, mumps, and rubella vaccine (MMR), measured by viral RNA content and infectivity. Three models of DSJIs were evaluated, each generating a different ejection force. Following jet injection, the RNA content for each of the vaccine components was measured using RT-qPCR immediately after injection and following passage in Vero cells. Jet injection was performed with and without pig skin as a simulation of human skin. There was little to no reduction of RNA content immediately following jet injection with any of the three DSJIs. Samples passaged in Vero cells showed no loss in infectivity of the measles vaccine following jet injection. Mumps vaccine consistently showed increased replication following jet injection. Rubella vaccine showed no loss after jet injection alone but some infectivity loss following injection through pig skin with two of the devices. Overall, these data demonstrated that forces exerted on a live attenuated MMR vaccine did not compromise vaccine infectivity. The bench model and protocol used in this study can be applied to evaluate the impact of jet injection on other live virus vaccines.

  6. Measles Outbreak Associated with Vaccine Failure in Adults--Federated States of Micronesia, February-August 2014.

    PubMed

    Breakwell, Lucy; Moturi, Edna; Helgenberger, Louisa; Gopalani, Sameer V; Hales, Craig; Lam, Eugene; Sharapov, Umid; Larzelere, Maribeth; Johnson, Eliaser; Masao, Carolee; Setik, Eleanor; Barrow, Lisa; Dolan, Samantha; Chen, Tai-Ho; Patel, Minal; Rota, Paul; Hickman, Carole; Bellini, William; Seward, Jane; Wallace, Greg; Papania, Mark

    2015-10-02

    On May 15, 2014, CDC was notified of two laboratory-confirmed measles cases in the Federated States of Micronesia (FSM), after 20 years with no reported measles. FSM was assisted by the World Health Organization (WHO), the United Nations Children’s Fund (UNICEF), and CDC in investigating suspected cases, identify contacts, conduct analyses to guide outbreak vaccination response, and review vaccine cold chain practices. During February–August, three of FSM’s four states reported measles cases: Kosrae (139 cases), Pohnpei (251), and Chuuk (3). Two thirds of cases occurred among adults aged ≥20 years; of these, 49% had received ≥2 doses of measles-containing vaccine (MCV). Apart from infants aged <12 months who were too young for routine vaccination, measles incidence was lower among children than adults. A review of current cold chain practices in Kosrae revealed minor weaknesses; however, an absence of historical cold chain maintenance records precluded an evaluation of earlier problems. Each state implemented vaccination campaigns targeting children as young as age 6 months through adults up to age 57 years. The preponderance of cases in this outbreak associated with vaccine failure in adults highlights the need for both thorough case investigation and epidemiologic analysis to guide outbreak response vaccination. Routine childhood vaccination coverage achieved in recent years limited the transmission of measles among children. Even in areas where transmission has not occurred for years, maintaining high 2-dose MCV coverage through routine and supplemental immunization is needed to prevent outbreaks resulting from increased measles susceptibility in the population.

  7. Surveillance and vaccination coverage of measles and rubella in Northern Italy.

    PubMed

    Amendola, Antonella; Bubba, Laura; Piralla, Antonio; Binda, Sandro; Zanetti, Alessandro; Pariani, Elena; Ranghiero, Alberto; Premoli, Marta; Pellegrinelli, Laura; Coppola, Liliana; Gramegna, Maria; Baldanti, Fausto; Zanetti, Alessandro

    2015-01-01

    Measles and rubella are infectious diseases and humans are the only reservoir of these infections. Effective vaccines are available with the potential for measles (MV) and rubella (RuV) virus eradication. According to the World Health Organisation guidelines, a national plan was approved in Italy in 2013 to achieve the MV/RuV elimination by 2015, and active MV/RuV integrated surveillance initiated. Towards this purpose, a regional laboratory centre was set up on 1 September 2013 in Lombardy, Northern Italy. This paper aimed at: (1) evaluating measles-mumps-rubella (MMR) vaccine coverage and MV/RuV notified cases retrospectively; and (2) presenting the results of MV/RuV integrated surveillance (laboratory confirmed and viral genetic profiles).   The 95% target for MMR vaccine coverage was achieved in 2001, and coverage increased until 2007 (96.6%), but then a decreasing trend was observed. Since 2000 to 2014, 3026 rubella cases were notified, with nearly 58% of them in the 2002 epidemic. From 2009, less than 45 RuV cases per year were reported. From 2000 to 2014, 5024 measles cases were notified. Since 2008, three large outbreaks (in 2008, 2011, and 2013) were observed. From data obtained during our surveillance activity, there were no rubella cases, and 57.5% (46/80) collected samples were MV-positive by real-time RT-PCR. A fragment of the MV N gene was sequenced from 37 MV-positive samples; D8, D9, and B3 genotypes were detected. Data obtained retrospectively and from active surveillance underline the necessity to achieve and maintain high vaccination coverage and to improve surveillance and the effectiveness of healthcare actions.

  8. A comparison of canine distemper vaccine and measles vaccine for the prevention of canine distemper in young puppies.

    PubMed

    Chalmers, W S; Baxendale, W

    1994-10-08

    Two groups of six-week-old beagle puppies were vaccinated with either high titre canine distemper virus or human measles virus, a third group remaining unvaccinated. All the puppies were subsequently challenged by the nasopharyngeal route at 10 weeks old with the virulent Snyder-Hill strain of canine distemper. Severe clinical signs were observed in 90 per cent of the unvaccinated dogs but both groups of vaccinated dogs survived the challenge. High temperatures were recorded in 20 per cent of the measles vaccinates and abdominal petechial rashes were observed in 60 per cent of them. The only clinical signs observed in the puppies vaccinated with distemper virus were transient rashes in 20 per cent of the group. The high titre canine distemper vaccine stimulated a humoral response quickly in 78 per cent of the puppies in the presence of maternally derived antibody and protected them against challenge with the virulent Snyder-Hill strain of distemper virus. The remaining dogs responded sluggishly but were still protected against challenge. The results of field surveys showed that 95 per cent of young puppies with different levels of maternally derived antibodies responded to the distemper component in a vaccine also containing canine parvovirus. No incompatibility was observed between the two components.

  9. Measles Outbreak Associated With Low Vaccine Effectiveness Among Adults in Pohnpei State, Federated States of Micronesia, 2014.

    PubMed

    Hales, Craig M; Johnson, Eliaser; Helgenberger, Louisa; Papania, Mark J; Larzelere, Maribeth; Gopalani, Sameer V; Lebo, Emmaculate; Wallace, Greg; Moturi, Edna; Hickman, Carole J; Rota, Paul A; Alexander, Hinden S; Marin, Mona

    2016-03-01

    Background.  A measles outbreak in Pohnpei State, Federated States of Micronesia in 2014 affected many persons who had received ≥1 dose of measles-containing vaccine (MCV). A mass vaccination campaign targeted persons aged 6 months to 49 years, regardless of prior vaccination. Methods.  We evaluated vaccine effectiveness (VE) of MCV by comparing secondary attack rates among vaccinated and unvaccinated contacts after household exposure to measles. Results.  Among 318 contacts, VE for precampaign MCV was 23.1% (95% confidence interval [CI], -425 to 87.3) for 1 dose, 63.4% (95% CI, -103 to 90.6) for 2 doses, and 95.9% (95% CI, 45.0 to 100) for 3 doses. Vaccine effectiveness was 78.7% (95% CI, 10.1 to 97.7) for campaign doses received ≥5 days before rash onset in the primary case and 50.4% (95% CI, -52.1 to 87.9) for doses received 4 days before to 3 days after rash onset in the primary case. Vaccine effectiveness for most recent doses received before 2010 ranged from 51% to 57%, but it increased to 84% for second doses received in 2010 or later. Conclusions.  Low VE was a major source of measles susceptibility in this outbreak; potential reasons include historical cold chain inadequacies or waning of immunity. Vaccine effectiveness of campaign doses supports rapid implementation of vaccination campaigns in outbreak settings.

  10. Immunogenicity of a recombinant measles-HIV-1 clade B candidate vaccine.

    PubMed

    Stebbings, Richard; Février, Michèle; Li, Bo; Lorin, Clarisse; Koutsoukos, Marguerite; Mee, Edward; Rose, Nicola; Hall, Joanna; Page, Mark; Almond, Neil; Voss, Gerald; Tangy, Frédéric

    2012-01-01

    Live attenuated measles virus is one of the most efficient and safest vaccines available, making it an attractive candidate vector for a HIV/AIDS vaccine aimed at eliciting cell-mediated immune responses (CMI). Here we have characterized the potency of CMI responses generated in mice and non-human primates after intramuscular immunisation with a candidate recombinant measles vaccine carrying an HIV-1 insert encoding Clade B Gag, RT and Nef (MV1-F4). Eight Mauritian derived, MHC-typed cynomolgus macaques were immunised with 10(5) TCID(50) of MV1-F4, four of which were boosted 28 days later with the same vaccine. F4 and measles virus (MV)-specific cytokine producing T cell responses were detected in 6 and 7 out of 8 vaccinees, respectively. Vaccinees with either M6 or recombinant MHC haplotypes demonstrated the strongest cytokine responses to F4 peptides. Polyfunctional analysis revealed a pattern of TNFα and IL-2 responses by CD4+ T cells and TNFα and IFNγ responses by CD8+ T cells to F4 peptides. HIV-specific CD4+ and CD8+ T cells expressing cytokines waned in peripheral blood lymphocytes by day 84, but CD8+ T cell responses to F4 peptides could still be detected in lymphoid tissues more than 3 months after vaccination. Anti-F4 and anti-MV antibody responses were detected in 6 and 8 out of 8 vaccinees, respectively. Titres of anti-F4 and MV antibodies were boosted in vaccinees that received a second immunisation. MV1-F4 carrying HIV-1 Clade B inserts induces robust boostable immunity in non-human primates. These results support further exploration of the MV1-F4 vector modality in vaccination strategies that may limit HIV-1 infectivity.

  11. A large population-based association study between HLA and KIR genotypes and measles vaccine antibody responses

    PubMed Central

    Ovsyannikova, Inna G.; Schaid, Daniel J.; Larrabee, Beth R.; Haralambieva, Iana H.; Kennedy, Richard B.; Poland, Gregory A.

    2017-01-01

    Human antibody response to measles vaccine is highly variable in the population. Host genes contribute to inter-individual antibody response variation. The killer cell immunoglobulin-like receptors (KIR) are recognized to interact with HLA molecules and possibly influence humoral immune response to viral antigens. To expand on and improve our previous work with HLA genes, and to explore the genetic contribution of KIR genes to the inter-individual variability in measles vaccine-induced antibody responses, we performed a large population-based study in 2,506 healthy immunized subjects (ages 11 to 41 years) to identify HLA and KIR associations with measles vaccine-induced neutralizing antibodies. After correcting for the large number of statistical tests of allele effects on measles-specific neutralizing antibody titers, no statistically significant associations were found for either HLA or KIR loci. However, suggestive associations worthy of follow-up in other cohorts include B*57:01, DQB1*06:02, and DRB1*15:05 alleles. Specifically, the B*57:01 allele (1,040 mIU/mL; p = 0.0002) was suggestive of an association with lower measles antibody titer. In contrast, the DQB1*06:02 (1,349 mIU/mL; p = 0.0004) and DRB1*15:05 (2,547 mIU/mL; p = 0.0004) alleles were suggestive of an association with higher measles antibodies. Notably, the associations with KIR genotypes were strongly nonsignificant, suggesting that KIR loci in terms of copy number and haplotypes are not likely to play a major role in antibody response to measles vaccination. These findings refine our knowledge of the role of HLA and KIR alleles in measles vaccine-induced immunity. PMID:28158231

  12. Acetaminophen (paracetamol) use, measles-mumps-rubella vaccination, and autistic disorder: the results of a parent survey.

    PubMed

    Schultz, Stephen T; Klonoff-Cohen, Hillary S; Wingard, Deborah L; Akshoomoff, Natacha A; Macera, Caroline A; Ji, Ming

    2008-05-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80 control children. Acetaminophen use after measles-mumps-rubella vaccination was significantly associated with autistic disorder when considering children 5 years of age or less (OR 6.11, 95% CI 1.42-26.3), after limiting cases to children with regression in development (OR 3.97, 95% CI 1.11-14.3), and when considering only children who had post-vaccination sequelae (OR 8.23, 95% CI 1.56-43.3), adjusting for age, gender, mother's ethnicity, and the presence of illness concurrent with measles-mumps-rubella vaccination. Ibuprofen use after measles-mumps-rubella vaccination was not associated with autistic disorder. This preliminary study found that acetaminophen use after measles-mumps-rubella vaccination was associated with autistic disorder.

  13. A randomized trial of a standard dose of Edmonston-Zagreb measles vaccine given at 4.5 months of age: effect on total hospital admissions.

    PubMed

    Martins, Cesario L; Benn, Christine S; Andersen, Andreas; Balé, Carlito; Schaltz-Buchholzer, Frederik; Do, Vu An; Rodrigues, Amabelia; Aaby, Peter; Ravn, Henrik; Whittle, Hilton; Garly, May-Lill

    2014-06-01

    Observational studies and trials from low-income countries indicate that measles vaccine has beneficial nonspecific effects, protecting against non-measles-related mortality. It is not known whether measles vaccine protects against hospital admissions. Between 2003 and 2007, 6417 children who had received the third dose of diphtheria, tetanus, and pertussis vaccine were randomly assigned to receive measles vaccine at 4.5 months or no measles vaccine; all children were offered measles vaccine at 9 months of age. Using hospital admission data from the national pediatric ward in Bissau, Guinea-Bissau, we compared admission rates between enrollment and the 9-month vaccination in Cox models, providing admission hazard rate ratios (HRRs) for measles vaccine versus no measles vaccine. All analyses were conducted stratified by sex and reception of neonatal vitamin A supplementation (NVAS). Before enrollment the 2 groups had similar admission rates. Following enrollment, the measles vaccine group had an admission HRR of 0.70 (95% confidence interval [CI], .52-.95), with a ratio of 0.53 (95% CI, .32-.86) for girls and 0.86 (95% CI, .58-1.26) for boys. For children who had not received NVAS, the admission HRR was 0.53 (95% CI, .34-.84), with an effect of 0.30 (95% CI, .13-.70) for girls and 0.73 (95% CI, .42-1.28) for boys (P = .08, interaction test). The reduction in admissions was separately significant for measles infection (admission HRR, 0 [95% CI, 0-.24]) and respiratory infections (admission HRR, 0.37 [95% CI, .16-.89]). Early measles vaccine may have major benefits for infant morbidity patterns and healthcare costs. Clinical trials registration NCT00168558.

  14. Measles virus genetic evolution throughout an imported epidemic outbreak in a highly vaccinated population.

    PubMed

    Muñoz-Alía, Miguel Ángel; Fernández-Muñoz, Rafael; Casasnovas, José María; Porras-Mansilla, Rebeca; Serrano-Pardo, Ángela; Pagán, Israel; Ordobás, María; Ramírez, Rosa; Celma, María Luisa

    2015-01-22

    Measles virus circulates endemically in African and Asian large urban populations, causing outbreaks worldwide in populations with up-to-95% immune protection. We studied the natural genetic variability of genotype B3.1 in a population with 95% vaccine coverage throughout an imported six month measles outbreak. From first pass viral isolates of 47 patients we performed direct sequencing of genomic cDNA. Whilst no variation from index case sequence occurred in the Nucleocapsid gene hyper-variable carboxy end, in the Hemagglutinin gene, main target for neutralizing antibodies, we observed gradual nucleotide divergence from index case along the outbreak (0% to 0.380%, average 0.138%) with the emergence of transient and persistent non-synonymous and synonymous mutations. Little or no variation was observed between the index and last outbreak cases in Phosphoprotein, Nucleocapsid, Matrix and Fusion genes. Most of the H non-synonymous mutations were mapped on the protein surface near antigenic and receptors binding sites. We estimated a MV-Hemagglutinin nucleotide substitution rate of 7.28 × 10-6 substitutions/site/day by a Bayesian phylogenetic analysis. The dN/dS analysis did not suggest significant immune or other selective pressures on the H gene during the outbreak. These results emphasize the usefulness of MV-H sequence analysis in measles epidemiological surveillance and elimination programs, and in detection of potentially emergence of measles virus neutralization-resistant mutants.

  15. Measles outbreak among the Dukpa tribe of Buxa hills in West Bengal, India: epidemiology and vaccine efficacy.

    PubMed

    Bhuniya, Satinath; Maji, Dipankar; Mandal, Debasis; Mondal, Nilanjan

    2013-01-01

    Although measles is a vaccine preventable disease, its occurrence and outbreaks are common in India. Four remote and inaccessible hamlets, inhabited by the Dukpa tribe, at Buxa Hills under Kalchini Block of Jalpaiguri District, West Bengal experienced a measles outbreak during the months of April-June, 2011. The authors conducted an investigation to assess vaccine coverage, vaccine efficacy (VE) and to describe the patterns of measles outbreaks in this community. The over-all attack rate was 14.3%; that among males and females were 12.6% and 16.0% respectively (P = 0.189). Attack rate was highest (40%) in 0 to <5 years followed by that in the 5 to <15 years (36.5%). VE was 66.3% (95% of the confidence interval 46.9-78.6%). There is an urgent need to increase the vaccination coverage through special tactics for reaching the unreached.

  16. [Measurement of the in vitro immune response of live attenuated measles virus vaccine and antibody levels in 0 to 10-year-old children].

    PubMed

    Unalan, H; Ustaçelebi, S

    1985-10-01

    The present study was carried out in order to test the antigenic effectiveness of the live attenuated meales vaccine which is routinly employed in our country. Sera obtained from 11 children before and after measles vaccination were tested for measles antibodies by complement fixation and neutralization tests. Sera samples were also collected from 0-10 years old children with history of vaccination, passed measles infection and none at all. These sera were also tested for measles antibody by complement fixation test. Virus isolation and seroconversion studies in children who were admitted to the outpatient clinics of Hacettepe hospital is also presented in this communication.

  17. Genetic polymorphisms in host antiviral genes: associations with humoral and cellular immunity to measles vaccine.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; Umlauf, Benjamin J; Vierkant, Robert A; Shane Pankratz, V; Jacobson, Robert M; Poland, Gregory A

    2011-11-08

    Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella (MMR) vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction for FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and

  18. Measles in the Democratic Republic of Congo: an urgent wake-up call to adapt vaccination implementation strategies.

    PubMed

    Gerard, S P; Kyrousis, E; Zachariah, R

    2014-03-21

    All countries in Africa have made a commitment to eliminate measles by 2020. This is laudable, as measles elimination will have a crucial impact on reducing childhood mortality. An important operational challenge is the resurgence of measles outbreaks in a number of countries; one of the main reasons for this is that many children are being missed by vaccination programmes. In the Democratic Republic of Congo (DRC), outbreaks continue unabated despite repeated vaccination campaigns and high reported coverage by the Ministry of Health. This paper brings into question the effectiveness of the current approach and the need for better reflection on bottlenecks and strategies that can address this issue. If we are to eliminate measles by 2020, there will be a need for impetus, a need for decisive action to reach that goal and prevent unnecessary childhood deaths in countries such as the DRC.

  19. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  20. Ex vivo analysis of cytotoxic T lymphocytes to measles antigens during infection and after vaccination in Gambian children.

    PubMed Central

    Jaye, A; Magnusen, A F; Sadiq, A D; Corrah, T; Whittle, H C

    1998-01-01

    The study of cytotoxic T cell responses to measles antigens during infection and after vaccination may provide insight into the immunopathology of the infection. It will also provide a knowledge of the immunity conferred by wild or attenuated virus, which will help in the design of new vaccines. Direct cytotoxic T cell responses, which did not require in vitro restimulation, were measured from peripheral blood by a standard 51Cr-release assay in 35 patients with acute measles, using HLA class I matched allogeneic B cells as targets. 77% showed specific responses to measles fusion protein, 69% to the hemagglutinin, and 50% to the nucleoprotein. These responses, which were related to severity of disease and history of previous vaccination, had waned by 14-24 wk after measles when memory responses to the same antigens could be elicited by restimulation in 71% of the 13 patients tested. A similar pattern followed vaccination: direct cytotoxic responses to fusion and hemagglutinin proteins were shown in 70% of the 20 children tested while 50% responded to the nucleoprotein. These responses, which were mediated by both CD8(+) and CD4(+) cells, faded over 6 wk when memory responses could be restimulated. Thus, a vigorous cytotoxic T lymphocyte response to fusion, hemagglutinin, and nucleoproteins is important in both natural and vaccine-induced immunity to measles. PMID:9835622

  1. [Vaccination schedule of the Spanish association of paediatrics: recommendations 2010].

    PubMed

    Marès Bermúdez, J; van Esso Arbolave, D; Arístegui Fernández, J; Ruiz Contreras, J; González Hachero, J; Merino Moína, M; Barrio Corrales, F; Alvarez García, F J; Cilleruelo Ortega, M J; Ortigosa Del Castillo, L; Moreno Pérez, D

    2010-06-01

    The Vaccine Advisory Committee of the Spanish Association of Paediatrics updates annually, the immunization schedule, taking into account epidemiological data, as well as evidence of the effectiveness and efficiency of vaccines. This vaccination schedule includes grades of recommendation. The committee has graded as universal vaccines those that all children should receive, as recommended those with a profile of universal vaccination in childhood and which are desirable that all children receive, but that can be prioritized based on resources for its public funding and for risk groups those targeting groups of people in situations of epidemiological risk. The Committee considers as a priority to achieve a common immunization schedule. The Committee reaffirms the recommendation to include pneumococcal vaccination in the routine vaccination schedule. Vaccination against varicella in the second year of life is an effective strategy and therefore a desirable goal. Vaccination against rotavirus is recommended for all infants given the morbidity and high burden on the health care system. The Committee adheres to the recommendations of the Interterritorial Council of the National Health Care System in reference to routine vaccination against HPV for all girls aged 11 to 14 years and stresses the need to vaccinate against influenza and hepatitis A all patients with risk factors for these diseases. Finally, it stresses the need to update incomplete immunization schedules using accelerated immunization schedules.

  2. [Vaccination schedule of the Spanish Association of Pediatrics: recommendations 2004].

    PubMed

    2004-05-01

    The Vaccine Assessment Committee of the Spanish Association of Pediatrics discusses vaccine developments in 2003 and recommends some modifications to the vaccination schedule. The recommendation of substituting the oral polio vaccine for the inactivated polio vaccine, suppressing the fifth dose, is maintained. The introduction of the conjugate pneumococcal vaccine and the varicella vaccine is stressed. Concerning the meningococcal C vaccine, the improvement introduced by being able to immunize with just two doses is discussed. In agreement with the information received from the European Medicines Agency, there appear to be no well-founded reasons to abandon hexavalent preparations.

  3. [Vaccination against measles. The situation in Mexico and America. Advances in the method of aerosol immunization].

    PubMed

    Fernández de Castro, J; Kumate, J

    1990-07-01

    We present general comments on the epidemiology of measles considering the pre-vaccine era as well as the post-vaccine period in which some changes can be observed: the decrease in morbidity and mortality, the extension of the inter-epidemic interval, the increase in the mean age of infection, etc. We make some estimations about the vaccine coverage and the ideal age of immunization for the goal of eradication (assuming a lifelong immunity for the vaccinees). The technical problems in measles immunization are also revised explaining why no continental country has been able to eliminate the disease. We describe the epidemiological situation in North America, Mexico and Latin American countries. Lastly we present the Mexican experience with the inhaled aerosolised vaccine: the studies in Monterrey (Sabin et al, 1982), other investigation in Mexico, D.F. and in the State of Jalisco, as well as the mass campaigns in Aguascalientes in 1988 and in Coahuila and Nuevo León in 1989. We propose it as an effective, harmless, simple, inexpensive and practical method.

  4. Association of BCG, DTP, and measles containing vaccines with childhood mortality: systematic review

    PubMed Central

    Soares-Weiser, Karla; López-López, José A; Kakourou, Artemisia; Chaplin, Katherine; Christensen, Hannah; Martin, Natasha K; Sterne, Jonathan A C; Reingold, Arthur L

    2016-01-01

    Objectives To evaluate the effects on non-specific and all cause mortality, in children under 5, of Bacillus Calmette-Guérin (BCG), diphtheria-tetanus-pertussis (DTP), and standard titre measles containing vaccines (MCV); to examine internal validity of the studies; and to examine any modifying effects of sex, age, vaccine sequence, and co-administration of vitamin A. Design Systematic review, including assessment of risk of bias, and meta-analyses of similar studies. Study eligibility criteria Clinical trials, cohort studies, and case-control studies of the effects on mortality of BCG, whole cell DTP, and standard titre MCV in children under 5. Data sources Searches of Medline, Embase, Global Index Medicus, and the WHO International Clinical Trials Registry Platform, supplemented by contact with experts in the field. To avoid overlap in children studied across the included articles, findings from non-overlapping birth cohorts were identified. Results Results from 34 birth cohorts were identified. Most evidence was from observational studies, with some from short term clinical trials. Most studies reported on all cause (rather than non-specific) mortality. Receipt of BCG vaccine was associated with a reduction in all cause mortality: the average relative risks were 0.70 (95% confidence interval 0.49 to 1.01) from five clinical trials and 0.47 (0.32 to 0.69) from nine observational studies at high risk of bias. Receipt of DTP (almost always with oral polio vaccine) was associated with a possible increase in all cause mortality on average (relative risk 1.38, 0.92 to 2.08) from 10 studies at high risk of bias; this effect seemed stronger in girls than in boys. Receipt of standard titre MCV was associated with a reduction in all cause mortality (relative risks 0.74 (0.51 to 1.07) from four clinical trials and 0.51 (0.42 to 0.63) from 18 observational studies at high risk of bias); this effect seemed stronger in girls than in boys. Seven observational studies

  5. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  6. Epidemiology of two large measles virus outbreaks in Catalonia: what a difference the month of administration of the first dose of vaccine makes.

    PubMed

    Torner, Núria; Anton, Andres; Barrabeig, Irene; Lafuente, Sara; Parron, Ignasi; Arias, César; Camps, Neus; Costa, Josep; Martínez, Ana; Torra, Roser; Godoy, Pere; Minguell, Sofia; Ferrús, Glòria; Cabezas, Carmen; Domínguez, Ángela; Spain

    2013-03-01

    Measles cases in the European Region have been increasing in the last decade; this illustrates the challenge of what we are now encountering in the form of pediatric preventable diseases. In Catalonia, autochthonous measles was declared eliminated in the year 2000 as the result of high measles-mumps-rubella vaccine (MMR) coverage for first and second dose (15 mo and 4 y) since the mid-1990s. From then on, sporadic imported cases and small outbreaks appeared, until in 2006-2007 a large measles outbreak affecting mostly unvaccinated toddlers hit the Barcelona Health Region. Consequently, in January 2008, first dose administration of MMR was lowered from 15 to 12 mo of age. A new honeymoon period went by until the end of 2010, when several importations of cases triggered new sustained transmission of different wild measles virus genotypes, but this time striking young adults. The aim of this study is to show the effect of a change in MMR vaccination schedule policy, and the difference in age incidence and hospitalization rates of affected individuals between both outbreaks.   Epidemiologic data were obtained by case interviews and review of medical records. Samples for virological confirmation and genotyping of cases were collected as established in the Measles Elimination plan guidelines. Incidence rate (IR), rate ratio (RR) and their 95% CI and hospitalization rate (HR) by age group were determined. Statistic z was used for comparing proportions. Total number of confirmed cases was 305 in the 2010 outbreak and 381 in the 2006-2007 outbreak; mean age 20 y (SD 14.8 y; 3 mo to 51 y) vs. 15 mo (SD 13.1 y; 1 mo to 50 y). Highest proportion of cases was set in ≥ 25 y (47%) vs. 24.2% in 2006 (p < 0.001). Differences in IR for ≤ 15 mo (49/100,000 vs. 278.2/100,000; RR: 3,9; 95%CI 2,9-5.4) and in overall HR 29.8% vs. 15.7% were all statistically significant (p < 0.001). The change of the month of age for the administration of the first MMR dose proved successful to

  7. Impact of unfounded vaccine safety concerns on the nationwide measles-rubella immunization campaign, Georgia, 2008.

    PubMed

    Khetsuriani, N; Imnadze, P; Baidoshvili, L; Jabidze, L; Tatishili, N; Kurtsikashvili, G; Lezhava, T; Laurent, E; Martin, R

    2010-09-07

    Vaccine safety fears following media reports of adverse events led to low (50.3%) coverage in a supplementary measles-rubella immunization campaign in Georgia in 2008. Review of adverse events associated with the campaign identified 432 reports (<0.1% of ∼ 493,000 vaccinees) including 338 (78.2%) cases of syncope. There were no deaths. Causality assessment was performed for 79 cases perceived by providers as severe and with clinical details available. Conditions likely caused by the vaccine were identified in 13 (16.5%) cases (allergic and local reactions, thrombocytopenia). Thirty-seven (46.8%) cases had symptoms consistent with syncope or anxiety attack; 36 (97.3%) of them were initially misdiagnosed as anaphylactic shock/allergies/"postvaccinal reactions". Twenty-nine (36.7%) cases had coincidental illnesses. Safety fears were unfounded and exaggerated by media reports and providers' difficulties in recognizing syncope/anxiety attacks. Risk communication strategies to address perceived vaccine safety concerns are urgently needed to ensure that the goal of measles and rubella elimination in the European Region of the World Health Organization is met.

  8. Protection from SARS coronavirus conferred by live measles vaccine expressing the spike glycoprotein.

    PubMed

    Escriou, Nicolas; Callendret, Benoît; Lorin, Valérie; Combredet, Chantal; Marianneau, Philippe; Février, Michèle; Tangy, Frédéric

    2014-03-01

    The recent identification of a novel human coronavirus responsible of a SARS-like illness in the Middle-East a decade after the SARS pandemic, demonstrates that reemergence of a SARS-like coronavirus from an animal reservoir remains a credible threat. Because SARS is contracted by aerosolized contamination of the respiratory tract, a vaccine inducing mucosal long-term protection would be an asset to control new epidemics. To this aim, we generated live attenuated recombinant measles vaccine (MV) candidates expressing either the membrane-anchored SARS-CoV spike (S) protein or its secreted soluble ectodomain (Ssol). In mice susceptible to measles virus, recombinant MV expressing the anchored full-length S induced the highest titers of neutralizing antibodies and fully protected immunized animals from intranasal infectious challenge with SARS-CoV. As compared to immunization with adjuvanted recombinant Ssol protein, recombinant MV induced stronger and Th1-biased responses, a hallmark of live attenuated viruses and a highly desirable feature for an antiviral vaccine.

  9. Pediatric measles vaccine expressing a dengue tetravalent antigen elicits neutralizing antibodies against all four dengue viruses.

    PubMed

    Brandler, Samantha; Ruffie, Claude; Najburg, Valérie; Frenkiel, Marie-Pascale; Bedouelle, Hughes; Desprès, Philippe; Tangy, Frédéric

    2010-09-24

    Dengue disease is an increasing global health problem that threatens one-third of the world's population. To control this emerging arbovirus, an efficient preventive vaccine is still needed. Because four serotypes of dengue virus (DV) coexist and antibody-dependent enhanced infection may occur, most strategies developed so far rely on the administration of tetravalent formulations of four live attenuated or chimeric viruses. Here, we evaluated a new strategy based on the expression of a single minimal tetravalent DV antigen by a single replicating viral vector derived from pediatric live-attenuated measles vaccine (MV). We generated a recombinant MV vector expressing a DV construct composed of the four envelope domain III (EDIII) from the four DV serotypes fused with the ectodomain of the membrane protein (ectoM). After two injections in mice susceptible to MV infection, the recombinant vector induced neutralizing antibodies against the four serotypes of dengue virus. When immunized mice were further inoculated with live DV from each serotype, a strong memory neutralizing response was raised against all four serotypes. A combined measles-dengue vaccine might be attractive to immunize infants against both diseases where they co-exist.

  10. Measles prevention in adolescents: lessons learnt from implementing a high school catch-up vaccination programme in New South Wales, Australia, 2014–2015

    PubMed Central

    Seale, Holly; Sheppeard, Vicky; Campbell-Lloyd, Sue

    2016-01-01

    Introduction In response to a significant increase of measles cases and a high percentage of unvaccinated adolescents in New South Wales, Australia, a measles high school catch-up vaccination programme was implemented between August and December 2014. This study aimed to explore the factors affecting school-based supplementary immunization activities (SIAs) and to inform future SIA and routine school-based vaccination programme implementation and service provision. Methods Focus group analysis was conducted among public health unit (PHU) staff responsible for implementing the SIA catch-up programme. Key areas discussed were pre-programme planning, implementation, resources, consent materials, media activity and future directions for school vaccination programme delivery. Sessions were audio recorded, transcribed verbatim and reviewed. Thematic analysis was conducted to identify the major themes. Results Two independent focus groups with 32 participants were conducted in January 2015. Barriers to the SIA implementation included lead time, consent processes, interagency collaboration, access to the targeted cohort and the impact of introducing a SIA to an already demanding curriculum and school programme immunization schedule. A positive PHU school coordinator rapport and experience of PHU staff facilitated the implementation. Consideration of different approaches for pre-clinic vaccination status checks, student involvement in the vaccination decision, online consent, workforce sharing between health districts and effective programme planning time were identified for improving future SIA implementation. Conclusion Although many barriers to school programme implementation have been identified in this study, with adequate resourcing and lead time, SIAs implemented via a routine school vaccination programme are an appropriate model to target adolescents. PMID:27757258

  11. No evidence of an increase of bacterial and viral infections following Measles, Mumps and Rubella vaccine.

    PubMed

    Stowe, Julia; Andrews, Nick; Taylor, Brent; Miller, Elizabeth

    2009-02-25

    The suggestion that multi-antigen vaccines might overload the immune system has led to calls for single antigen vaccines. In 2003 we showed that rather than an increase there appeared to be a reduced risk of severe bacterial infection in the three months following Measles, Mumps and Rubella vaccine (MMR). The present analysis of illnesses in a general population is based on an additional 10 years of data for bacterial infections and also includes admissions with viral infections. Analyses were carried out using the self-controlled case-series method and separately for bacterial and viral infection cases, using risk periods of 0-30 days, 31-60 days and 61-90 days post MMR vaccine. An analysis was also carried out for those cases which were given MMR and Meningococcal serogroup C (MCC) vaccines concomitantly. A reduced risk was seen in the 0-30-day period for both bacterial infection (relative incidence=0.68, 95% CI 0.54-0.86) and viral infections (relative incidence=0.68, 95% CI 0.49-0.93). There was no increased risk in any period when looking at combined viral or bacterial infections or for individual infections with the single exception of an increased risk in the 31-60 days post vaccination period for herpes infections (relative incidence=1.69, 95% CI 1.06-2.70). For the children given Meningococcal group C vaccines concomitantly no significantly increased risk was seen in either the bacterial (relative incidence=0.54, 95% CI 0.26-1.13) or viral cases (relative incidence=0.46, 95% CI 0.11-1.93). Our study confirms that the MMR vaccine does not increase the risk of invasive bacterial or viral infection in the 90 days after the vaccination and does not support the hypothesis that there is an induced immune deficiency due to overload from multi-antigen vaccines.

  12. Measles virus.

    PubMed

    Naim, Hussein Y

    2015-01-01

    Measles was an inevitable infection during the human development with substantial degree of morbidity and mortality. The severity of measles virus (MV) infection was largely contained by the development of a live attenuated vaccine that was introduced into the vaccination programs. However, all efforts to eradicate the disease failed and continued to annually result in significant deaths. The development of molecular biology techniques allowed the rescue of MV from cDNA that enabled important insights into a variety of aspects of the biology of the virus and its pathogenesis. Subsequently these technologies facilitated the development of novel vaccine candidates that induce immunity against measles and other pathogens. Based on the promising prospective, the use of MV as a recombinant vaccine and a therapeutic vector is addressed.

  13. Immunogenicity of next-generation HPV vaccines in non-human primates: Measles-vectored HPV vaccine versus Pichia pastoris recombinant protein vaccine.

    PubMed

    Gupta, Gaurav; Giannino, Viviana; Rishi, Narayan; Glueck, Reinhard

    2016-09-07

    Human papillomavirus (HPV) infection is the most common sexually transmitted disease worldwide. HPVs are oncogenic small double-stranded DNA viruses that are the primary causal agent of cervical cancer and other types of cancers, including in the anus, oropharynx, vagina, vulva, and penis. Prophylactic vaccination against HPV is an attractive strategy for preventing cervical cancer and some other types of cancers. However, there are few safe and effective vaccines against HPV infections. Current first-generation commercial HPV vaccines are expensive to produce and deliver. The goal of this study was to develop an alternate potent HPV recombinant L1-based vaccines by producing HPV virus-like particles into a vaccine that is currently used worldwide. Live attenuated measles virus (MV) vaccines have a well-established safety and efficacy record, and recombinant MV (rMV) produced by reverse genetics may be useful for generating candidate HPV vaccines to meet the needs of the developing world. We studied in non-human primate rMV-vectored HPV vaccine in parallel with a classical alum adjuvant recombinant HPV16L1 and 18L1 protein vaccine produced in Pichia pastoris. A combined prime-boost approach using both vaccines was evaluated, as well as immune interference due to pre-existing immunity against the MV. The humoral immune response induced by the MV, Pichia-expressed vaccine, and their combination as priming and boosting approaches was found to elicit HPV16L1 and 18L1 specific total IgG and neutralizing antibody titres. Pre-existing antibodies against measles did not prevent the immune response against HPV16L1 and 18L1.

  14. Live attenuated measles and mumps viral strain-containing vaccines and hearing loss: Vaccine Adverse Event Reporting System (VAERS), United States, 1990--2003.

    PubMed

    Asatryan, Armenak; Pool, Vitali; Chen, Robert T; Kohl, Katrin S; Davis, Robert L; Iskander, John K

    2008-02-26

    Hearing loss (HL) is a known complication of wild measles and mumps viral infections. As vaccines against measles and mumps contain live attenuated viral strains, it is biologically plausible that in some individuals HL could develop as a complication of vaccination against measles and/or mumps. Our objectives for this study were: to find and describe all cases of HL reported in the scientific literature and to the US Vaccine Adverse Events Reporting System (VAERS) for the period 1990--2003; and to determine reporting rate of HL after live attenuated measles and/or mumps viral strain-containing vaccines (MMCV) administration. We searched published reports for cases of HL identified after vaccination with MMCV. We also searched for reports of HL after MMCV administration submitted to VAERS from 1990 through 2003 and determined the dose-adjusted reporting rate of HL. Our main outcome measure was reported cases of HL after immunization with MMCV which were classified as idiopathic. We found 11 published case reports of HL following MMCV. The review of the VAERS reports identified 44 cases of likely idiopathic sensorineural HL after MMCV administration. The onset of HL in the majority of VAERS and published cases was consistent with the incubation periods of wild measles and mumps viruses. Based on the annual usage of measles-mumps-rubella (MMR) vaccine, we estimated the reporting rate of HL to be 1 case per 6-8 million doses. Thus, HL following MMCV has been reported in the literature and to the VAERS. Further studies are needed to better understand if there is a causal relationship between MMCV and HL.

  15. Measles: effect of a two-dose vaccination programme in Catalonia, Spain.

    PubMed Central

    Godoy, P.; Domínguez, A.; Salleras, L.

    1999-01-01

    The study reports incidences of measles in Catalonia, Spain, as detected by surveillance, and analyses the specific characteristics of the outbreaks reported for the period 1986-95. Incidences per 100,000 inhabitants were calculated for the period 1971-95. The following variables were studied: year of presentation, number of cases, median age, transmission setting, cases with a record of vaccination and preventable cases. Associations between variables were determined using odds ratios (OR). The incidence of measles declined from 306.3 cases in 1971 to 30.9 in 1995. A total of 50 outbreaks were investigated. The outbreaks that occurred in the last two years of the study had a higher likelihood of having a transmission setting other than primary school (OR = 3.9); a median case age > 10 years (OR = 7.2); and fewer than 6 cases (OR = 2.3). The characteristics of recent outbreaks, marked by a rise both in transmission outside the primary-school setting and in median age, indicate the need for the introduction of a specific vaccination programme at the end of adolescence in addition to control of school-related outbreaks. PMID:10083711

  16. Biosafety considerations for attenuated measles virus vectors used in virotherapy and vaccination

    PubMed Central

    Baldo, Aline; Galanis, Evanthia; Tangy, Frédéric; Herman, Philippe

    2016-01-01

    ABSTRACT Attenuated measles virus (MV) is one of the most effective and safe vaccines available, making it attractive candidate vector to prevent infectious diseases. Attenuated MV have acquired the ability to use the complement regulator CD46 as a major receptor to mediate virus entry and intercellular fusion. Therefore, attenuated MV strains preferentially infect and destroy a wide variety of cancer cells making them also attractive oncolytic vectors. The use of recombinant MV vector has to comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The present article highlights the main characteristics of MV and recombinant MV vectors used for vaccination and virotherapy and discusses these features from a biosafety point of view. PMID:26631840

  17. [Vaccination schedule of the Spanish Association of Paediatrics: recommendations 2011].

    PubMed

    Marès Bermúdez, J; van Esso Arbolave, D; Moreno-Pérez, D; Merino Moína, M; Alvarez García, F J; Cilleruelo Ortega, M J; Arístegui Fernández, J; Ortigosa del Castillo, L; Ruiz-Contreras, J; Barrio Corrales, F; González-Hachero, J

    2011-02-01

    The Advisory Committee on Vaccines of the Spanish Paediatric Association updates annually the immunization schedule, taking into account epidemiological data as well as evidence of the effectiveness and efficiency of vaccines. This vaccination schedule includes grades of recommendation. The committee has graded as universal vaccines those that all children should receive, as recommended, those with a profile of universal vaccines of childhood and as are desirable those that all children may receive, but that can be prioritized based on public funding resources and for risk groups, targeting those groups of people in epidemiological situations of risk. The Committee considers as a priority to achieve a common immunization schedule for Spain. The Committee reaffirms the recommendation to include pneumococcal vaccination in the routine vaccination schedule. Vaccination against varicella in the second year of life is an effective strategy and therefore a desirable goal. Given the morbidity and high burden on the health care system, vaccination against rotavirus is recommended for all infants. Due to the current problems of availability of both vaccines, associated with the recent finding of circovirus, the committee urges that rotavirus vaccination is restarted as soon as possible as it is considered a desirable health benefit for all children in our country. The Committee adheres to the recommendations of the National Health Coordination Council in reference to routine vaccination against HPV for all girls aged 11 to 14 years and stresses the need to vaccinate all patients with risk factors for these diseases against influenza and hepatitis A. Finally, it stresses the need to update incomplete immunizations using accelerated immunization schedules.

  18. Acetaminophen (Paracetamol) Use, Measles-Mumps-Rubella Vaccination, and Autistic Disorder: The Results of a Parent Survey

    ERIC Educational Resources Information Center

    Schultz, Stephen T.; Klonoff-Cohen, Hillary S.; Wingard, Deborah L.; Akshoomoff, Natacha A.; Macera, Caroline A.; Ji, Ming

    2008-01-01

    The present study was performed to determine whether acetaminophen (paracetamol) use after the measles-mumps-rubella vaccination could be associated with autistic disorder. This case-control study used the results of an online parental survey conducted from 16 July 2005 to 30 January 2006, consisting of 83 children with autistic disorder and 80…

  19. Self-reported histories of disease and vaccination against measles, mumps, rubella and varicella in health care personnel in Japan.

    PubMed

    Kumakura, Shunichi; Onoda, Keiichi; Hirose, Masahiro

    2014-03-01

    Health care personnel are required to be immune against vaccine-preventable diseases, such as measles, mumps, rubella, and varicella. The aim of this study is to evaluate the accuracy of self-reported histories of disease and vaccination against measles, mumps, rubella, and varicella in order to determine the immune status of health care personnel. A self-reported questionnaire of history of previous disease and vaccination against these diseases was administered to a total of 910 health care personnel in Shimane university hospital in Japan, whose results were compared with serological evidences. There were numerous subjects who did not remember a history of disease (greater than 33% each) and of vaccination (greater than 58% each). Self-reported history of disease and vaccination had high positive predictive value against either disease for testing positive for antiviral antibodies. However, a considerable number of false-negative subjects could be found; 88.9% of subjects for measles, 89.3% for mumps, 62.2% for rubella and 96.3% for varicella in the population who had neither a self-reported history of disease nor a vaccination against each disease. In addition, regardless of the disease in question, a negative predictive value in self-reported history of disease and vaccination was remarkably low. These results suggest that self-reported history of disease and vaccination was not predictive to determine the accurate immune status of health care personnel against measles, mumps, rubella, and varicella. A seroprevalence survey, followed by an adequate immunization program for susceptible subjects, is crucial to prevent and control infection in hospital settings.

  20. [Vaccination schedule of the Spanish Association of Pediatrics: recommendations 2006].

    PubMed

    2006-01-01

    Based on the evidence available, the Vaccines Advisory Committee (VAC) of the Spanish Association of Pediatrics reports and comments on the new developments in vaccines that have taken place in 2005 and recommends some modifications to the vaccination schedule for 2006. In agreement with changes in the product monographs for the meningococcal C vaccine, the VAC recommends two doses for the three commercially available preparations with a booster dose in the second year of life. The European Medicines Evaluation Agency (EMEA) has temporarily suspended the sale of the Hexavac vaccine due to doubts about its long-term protection against hepatitis B. The VAC continues to support the use of these combined vaccines. Currently only Infranrix Hexa is available in Spain. The recommendation of vaccinating adolescents with a booster dose of pertussis vaccine via the administration of an acellular preparation of low antigenic load together with the adult diphtheria and tetanus vaccine remains valid. Vaccination against chickenpox in susceptible children aged more than 12 months old continues to be recommended. There is wide coverage for the 7-valent pneumococcal conjugate vaccine in many areas of Spain. In view of the studies published, the VAC reiterates the need for universal immunization by introducing this vaccine in the official vaccination schedule. Finally, other vaccines not included in this schedule are discussed, with special mention of the advisability of influenza vaccination in children, according to the recommendations of the VAC available at the beginning of each season on the web site of the Spanish Association of Pediatrics www.aeped.es; www. vacunasaep.org.

  1. An immune competent mouse model for the characterization of recombinant measles vaccines.

    PubMed

    Marty, René R; Knuchel, Marlyse C; Morin, Teldja Neige Azzouz; Naim, Hussein Y

    2015-01-01

    Today, immune compromised interferon-α-receptor deficient mice expressing hCD46 (IFNARCD46tg) are usually used for measles virus (MV) based vaccine characterization. However, for the development of MV-based recombinant vaccine candidates (rMV), an immune competent mouse model is desirable in order to induce and evaluate meaningful immune response. In this study, humoral and cellular immune response induced by rMV in immune competent mice expressing human MV receptor CD46 (hCD46tg) were compared with those induced in wild-type black/6, and IFNARCD46tg mice.   All three strains developed humoral and cellular response against MV, whereas only hCD46tg and IFNARCD46tg mice developed a humoral response against the transgene. Differences were observed in the magnitude of the response, where the IFNARCD46tg mice displayed the strongest immune responses, followed by the hCD46tg mice and the black/6 mice. Interestingly, hCD46tg and wt black/6 mice showed a predominant CD4(+) T-cell response against MV-N, whereas IFNARCD46tg mice developed both, CD4(+) and CD8(+) T-cell response against MV-N. Analysis of the cytokine profile of MV-N specific CD4(+) T-cells and transgene (SIVgag) specific CD8(+) T-cells revealed qualitative differences of the T-cell responses; noticeably a significant reduction of the frequency of CD4(+)IL-2(+) expressing cells in IFNARCD46tg mice as compared with hCD46tg or wt black/6 mice. We show in this study significant quantitative and qualitative differences in immune responses between immune competent and immune-compromised mice. Our results therefore highlight the importance of the animal model and support the use of hCD46tg mice as mouse model for the characterization of the immunological profile induced by recombinant measles virus vaccine candidates.

  2. Time is of the essence: exploring a measles outbreak response vaccination in Niamey, Niger.

    PubMed

    Grais, R F; Conlan, A J K; Ferrari, M J; Djibo, A; Le Menach, A; Bjørnstad, O N; Grenfell, B T

    2008-01-06

    The current World Health Organization recommendations for response during measles epidemics focus on case management rather than outbreak response vaccination (ORV) campaigns, which may occur too late to impact morbidity and mortality and have a high cost per case prevented. Here, we explore the potential impact of an ORV campaign conducted during the 2003-2004 measles epidemic in Niamey, Niger. We measured the impact of this intervention and also the potential impact of alternative strategies. Using a unique geographical, epidemiologic and demographic dataset collected during the epidemic, we developed an individual-based simulation model. We estimate that a median of 7.6% [4.9-8.9] of cases were potentially averted as a result of the outbreak response, which vaccinated approximately 57% (84563 of an estimated 148600) of children in the target age range (6-59 months), 23 weeks after the epidemic started. We found that intervening early (up to 60 days after the start of the epidemic) and expanding the age range to all children aged 6 months to 15 years may lead to a much larger (up to 90%) reduction in the number of cases in a West African urban setting like Niamey. Our results suggest that intervening earlier even with lower target coverage (approx. 60%), but a wider age range, may be more effective than intervening later with high coverage (more than 90%) in similar settings. This has important implications for the implementation of reactive vaccination interventions as they can be highly effective if the response is fast with respect to the spread of the epidemic.

  3. Introduction of standard measles vaccination in an urban African community in 1979 and overall child survival: a reanalysis of data from a cohort study

    PubMed Central

    Mogensen, Søren Wengel; Aaby, Peter; Smedman, Lars; Martins, Cesário L; Rodrigues, Amabelia; Benn, Christine S; Ravn, Henrik

    2016-01-01

    Objective To examine the effect of the first introduction of measles vaccine (MV) in Guinea-Bissau in 1979. Setting Urban community study of the anthropometric status of all children under 6 years of age. Participants The study cohort included 1451 children in December 1978; 82% took part in the anthropometric survey. The cohort was followed for 2 years. Intervention In December 1979, the children were re-examined anthropometrically. The participating children, aged 6 months to 6 years, were offered MV if they did not have a history of measles infection. There were no routine vaccinations in 1979–1980. Primary and secondary outcome measures Age-adjusted mortality rate ratios (MRRs) for measles vaccinated and not vaccinated children; changes in nutritional status. Results The nutritional status deteriorated significantly from 1978 to 1979. Nonetheless, children who received MV at the December 1979 examination had significantly lower mortality in the following year (1980) compared with the children who had been present in the December 1978 examination but were not measles vaccinated. Among children still living in the community in December 1979, measles-vaccinated children aged 6–71 months had a mortality rate of 18/1000 person-years during the following year compared with 51/1000 person-years for absent children who were not measles vaccinated (MRR=0.30 (0.12–0.73)). The effect of MV was not explained by prevention of measles infection as the unvaccinated children did not die of measles infection. Conclusions MV may have beneficial non-specific effects on child survival not related to the prevention of measles infection. PMID:27998896

  4. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.

    PubMed

    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A

    2013-06-01

    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.

  5. Zagreb Regimen, an Abbreviated Intramuscular Schedule for Rabies Vaccination

    PubMed Central

    Ren, Jiangping; Yao, Linong; Sun, Jimin

    2014-01-01

    The Zagreb regimen, an abbreviated intramuscular schedule for rabies vaccination, was developed by I. Vodopija and colleagues of the Zagreb Institute of Public Health in Croatia in the 1980s. It was recommended by WHO as one of the intramuscular (IM) schedules for rabies vaccination in 2010. We reviewed the literature on the immunogenicity, safety, economic burden, and compliance of the Zagreb 2-1-1 regimen. Compared to Essen, another IM schedule recommended by WHO, Zagreb has higher compliance, lower medical cost, and better immunogenicity at an early stage. PMID:25392012

  6. [Vaccination--General concepts. Systematic vaccination schedules for the child and adult in Spain. Impact of vaccination programs].

    PubMed

    Arrazola Martínez, M Pilar; de Juanes Pardo, José Ramón; García de Codes Ilario, Aurelia

    2015-01-01

    One area of major importance in promoting health is the prevention of infectious diseases through vaccination. Vaccine is any preparation intended to generate immunity against a disease by stimulating the production of antibodies. There are two basic types: live attenuated and inactivated, with different characteristics that determine their use. The main properties of a vaccine are safety and protective efficacy. The vaccines can be administered based on individualized directions depending on various factors (personal, environmental…), or systematically as part of the immunization schedules. In Spain, the first childhood immunization schedule was implemented in 1975. The Autonomous Communities are currently responsible for establishing vaccine recommendations. The incidence of vaccine-preventable diseases and vaccination coverage are essential criteria for the evaluation of vaccination programs. In Spain the incidence of vaccine-preventable diseases is low. Vaccination coverage is high in childhood, but in adolescents, adults and groups at risk it is not always appropriate.

  7. A recombinant measles vaccine expressing chikungunya virus-like particles is strongly immunogenic and protects mice from lethal challenge with chikungunya virus.

    PubMed

    Brandler, Samantha; Ruffié, Claude; Combredet, Chantal; Brault, Jean-Baptiste; Najburg, Valérie; Prevost, Marie-Christine; Habel, André; Tauber, Erich; Desprès, Philippe; Tangy, Frédéric

    2013-08-12

    Chikungunya virus (CHIKV), a mosquito-transmitted alphavirus, recently reemerged in the Indian Ocean, India and Southeast Asia, causing millions of cases of severe polyarthralgia. No specific treatment to prevent disease or vaccine to limit epidemics is currently available. Here we describe a recombinant live-attenuated measles vaccine (MV) expressing CHIKV virus-like particles comprising capsid and envelope structural proteins from the recent CHIKV strain La Reunion. Immunization of mice susceptible to measles virus induced high titers of CHIKV antibodies that neutralized several primary isolates. Specific cellular immune responses were also elicited. A single immunization with this vaccine candidate protected all mice from a lethal CHIKV challenge, and passive transfer of immune sera conferred protection to naïve mice. Measles vaccine is one of the safest and most effective human vaccines. A recombinant MV-CHIKV virus could make a safe and effective vaccine against chikungunya that deserves to be further tested in human trials.

  8. Efficacy of intralesional injection of mumps-measles-rubella vaccine in patients with wart

    PubMed Central

    Zamanian, Abbas; Mobasher, Pezhman; Jazi, Ghazaleh Ahmadi

    2014-01-01

    Background: In the previous studies, it has been shown that mumps-measles-rubella (MMR) vaccine resulted in regression of warts via immunomodulatory effect and induction of immune system. Due to the high prevalence of warts in various populations, we evaluated the efficacy of MMR vaccine injection in the treatment of cutaneous warts. Materials and Methods: This double-blind randomized controlled clinical trial was conducted in Hazrat-e-Rasoul Hospital in Tehran in 2011-2012 on 24 patients with warts who were allocated to two groups including MMR group and normal saline group. MMR vaccine was injected intralesionally in the MMR group, whereas normal saline was injected into the lesions in the second group. These injections were repeated every 2 weeks intervals for maximum 3 injections. All patients were followed up every 15-day interval up to 45 days and then up to 6 months regarding relapses and finally, side effects, probable relapse, and therapeutic outcomes were evaluated and compared. Results: At the end of follow-up period, therapeutic outcomes in the MMR group included no cure in 2 cases, relative cure in 4 cases, and complete cure in 18 cases. In normal saline group, these rates included no cure in seven cases, relative cure in nine cases, and complete cure in six cases (P < 0.001). No significant complication occurred in the two groups. Conclusion: MMR vaccine may result in desirable therapeutic response. The hypothesis that is considered here is that MMR vaccine, via induction of cellular and humoral immune system, accelerates the destruction of virus and infected host cells. PMID:24804181

  9. Measles Virus-Specific Antibody Levels in Individuals in Argentina Who Received a One-Dose Vaccine

    PubMed Central

    Argüelles, Marcelo H.; Orellana, Mariana L.; Castello, Alejandro A.; Villegas, Guillermo A.; Masini, Matilde; Belizan, Alejandra L.; González Ayala, Silvia; Vera, Osmar D.; Glikmann, Graciela

    2006-01-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease. PMID:16891485

  10. Measles virus-specific antibody levels in individuals in Argentina who received a one-dose vaccine.

    PubMed

    Argüelles, Marcelo H; Orellana, Mariana L; Castello, Alejandro A; Villegas, Guillermo A; Masini, Matilde; Belizan, Alejandra L; González Ayala, Silvia; Vera, Osmar D; Glikmann, Graciela

    2006-08-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease.

  11. Measles vaccine coverage and immune response in children of Caiabi and Metuktire Indian tribes living in malarial endemic area: Parque indígena do Xingu, Central Brazil.

    PubMed

    Spindel, R; Baruzzi, R G; Souza, V A; Ferreira, A W; Avila, S L

    2001-07-01

    Measles vaccination efficiency was evaluated in children from two Indian tribes - Caiabi and Metuktire - living in the Amazon region, in the Parque Indigena do Xingu (PIX). The population sample, selected at random, made up 37 Caiabi and 28 Metuktire children, aged from 20-75 months (40%). For operational and epidemiological reasons, measles vaccine is given from 6 months of age. The average age of children when they received the vaccine was 11.5 months for the first dose and 20 months for the second. The search for IgG antibodies against measles virus and Plasmodium falciparum was made through immunofluorescence assay (IFA). Measles vaccine coverage has reached 60% at 12 months of age and 92% at 18 months, whereas post-vaccine serum conversion was 95% in Caiabi children (geometric mean of titres (GMT) 126) and 89% in Metuktire (GMT 109). The difference in GMT is not statistically significant. Seventy-three per cent of Caiabi children (GMT 101) and 100% of Metuktire children (GMT135) were plasmodium antibody positive, showing they had been exposed to malarial infection. Despite the differences detected, the immune response to measles vaccine was satisfactory in both groups, with a positive percentage consistent with that achieved in non-malarial areas in Americas. The results show the efficiency of a vaccination programme in an indigenous area despite the difficulties in reaching the villages and maintaining the cold chain, and also despite the malaria endemicity.

  12. Deciphering the relative weights of demographic transition and vaccination in the decrease of measles incidence in Italy.

    PubMed

    Merler, Stefano; Ajelli, Marco

    2014-02-22

    In Italy, during the course of the past century to the present-day, measles incidence underwent a remarkable decreasing trend that started well before the introduction of the national immunization programme. In this work, we aim at examining to what extent both the demographic transition, characterized by declining mortality and fertility rates over time, and the vaccination programme are responsible for the observed epidemiological pattern. Making use of a non-stationary, age-structured disease transmission model, we show that in the pre-vaccination era, from 1901 to 1982, the decline in birth rates has resulted in a drastic decrease in the effective transmission rate, which in turn has determined a declining trend of measles incidence (from 25.2 to 10.3 infections per 1000 individuals). However, since 1983, vaccination appears to have become the major contributing factor in the decrease of measles incidence, which otherwise would have remained stable as a consequence of the nearly constant birth rates. This led to a remarkable decrease in the effective transmission rate, to a level well below the critical threshold for disease persistence. These findings call for the adoption of epidemiological models, which deviate the age structure from stationary equilibrium solutions, to better understand the biology of infectious diseases and evaluate immunization programmes.

  13. Noninterference of Rotavirus Vaccine With Measles-Rubella Vaccine at 9 Months of Age and Improvements in Antirotavirus Immunity: A Randomized Trial

    PubMed Central

    Zaman, K.; Fleming, Jessica A.; Victor, John C.; Yunus, Mohammad; Bari, Tajul Islam A.; Azim, Tasnim; Rahman, Mustafizur; Mowla, Syed Mohammad Niaz; Bellini, William J.; McNeal, Monica; Icenogle, Joseph P.; Lopman, Ben; Parashar, Umesh; Cortese, Margaret M.; Steele, A. Duncan; Neuzil, Kathleen M.

    2016-01-01

    Background. The burden of rotavirus morbidity and mortality is high in children aged <5 years in developing countries, and evaluations indicate waning protection from rotavirus immunization in the second year. An additional dose of rotavirus vaccine may enhance the immune response and lengthen the period of protection against disease, but coadministration of this dose should not interfere with immune responses to concurrently given vaccines. Methods. A total of 480 9-month-old participants from Matlab, Bangladesh, were enrolled in a study with a primary objective to establish noninferiority of concomitant administration of measles-rubella vaccine (MR) and a third dose of human rotavirus vaccine (HRV; MR + HRV), compared with MR given alone. Secondary objectives included noninferiority of rubella antibody seroconversion and evaluating rotavirus IgA/IgG seroresponses in MR + HRV recipients. Results. Two months after vaccination, 75.3% and 74.3% of MR + HRV and MR recipients, respectively, had seroprotective levels of measles virus antibodies; 100.0% and 99.6%, respectively, showed anti–rubella virus immunoglobulin G (IgG) seroprotection. In the MR + HRV group, antirotavirus immunoglobulin A and IgG seropositivity frequencies before vaccination (52.7% and 66.3%, respectively) increased to 69.6% and 88.3% after vaccination. Conclusions. Vaccine-induced measles and rubella antibody responses are not negatively affected by concomitant administration of HRV. The HRV dose increases antirotavirus serum antibody titers and the proportion of infants with detectable antirotavirus antibody. Clinical Trials Registration. NCT01700621. PMID:26823338

  14. Successful immunization of infants at 6 months of age with high dose Edmonston-Zagreb measles vaccine. Cite Soleil/JHU Project Team.

    PubMed

    Job, J S; Halsey, N A; Boulos, R; Holt, E; Farrell, D; Albrecht, P; Brutus, J R; Adrien, M; Andre, J; Chan, E

    1991-04-01

    A group of 2097 Haitian infants 6 to 11 months of age were randomized to receive Schwarz or Edmonston-Zagreb strain measles vaccines containing 10- to 500-fold more vaccine viral particles than standard potency vaccines. No unusual adverse reactions were noted. Edmonston-Zagreb vaccines were more effective than equivalent doses of Schwarz vaccines as measured by the proportion of vaccinated children with measles antibody concentrations greater than or equal to 200 mIU/ml 2 months after vaccination and the persistence of antibody at 18 to 24 months of age. High titer Edmonston-Zagreb vaccine administered at 6 months of age induced antibody concentrations greater than or equal to 200 mIU/ml in 83% of infants by plaque reduction neutralization and 93% of infants by enzyme-linked immunosorbent assay with high rates of antibody persistence at 12 to 24 months of age. The World Health Organization recommends high titer Edmonston-Zagreb measles vaccines for routine use at 6 months of age in areas where measles is an important cause of mortality in young infants.

  15. Mass Measles Vaccination Campaign in Aila Cyclone-Affected Areas of West Bengal, India: An In-depth Analysis and Experiences

    PubMed Central

    Mallik, Sarmila; Mandal, Pankaj Kumar; Ghosh, Pramit; Manna, Nirmalya; Chatterjee, Chitra; Chakrabarty, Debadatta; Bagchi, Saumendra Nath; Dasgupta, Samir

    2011-01-01

    Disaster-affected populations are highly vulnerable to outbreaks of measles. Therefore, a mass vaccination against measles was conducted in Aila cyclone-affected blocks of West Bengal, India in July 2009. The objectives of the present report were to conduct an in depth analysis of the campaign, and to discuss the major challenges. A block level micro-plan, which included mapping of the villages, health facilities, temporary settlements of disaster-affected population, communications available, formation of vaccination team, information education communication, vaccine storage, waste disposal, surveillance for adverse events following immunization, supervision and monitoring was developed. The rate of six months to five years old children, who were vaccinated by measles vaccine, was 70.7% and that of those who received one dose of vitamin A was 71.3%. Wastage factor for vaccine doses and auto-disable syringes were 1.09 and 1.07, respectively. Only 13 cases of adverse events following immunization were reported. An average of 0.91 puncture-proof containers per vaccination session was used. Despite the major challenges faced due to difficult to reach areas, inadequate infrastructure, manpower and communication, problems of vaccine storage and transport, the campaign achieved a remarkable success regarding measles vaccine coverage, improvements of cold chain infrastructure, formulating an efficient surveillance and reporting system for adverse events following immunization, building self-confidence of the stakeholders, and developing a biomedical waste disposal system. PMID:23115416

  16. [Vaccination schedule of the Spanish Association of Pediatrics: recommendations 2005].

    PubMed

    2005-02-01

    The Advisory Committee on Vaccines of the Spanish Association of Pediatrics provides information and comments on the new developments in vaccines that have taken place in 2004 and recommends a few modifications to the Immunization Schedule for 2005. Concerning the meningococcal C vaccine, no change is made to the possibility of administering two doses for the first vaccination with one of the available formulations. The existence of immunization failure in children who have received a first vaccination with three vaccine doses before the age of 12 months is discussed, and the health authorities will probably include a booster dose in the second year of life throughout 2005. The recommendations of the European Medicines Evaluation Agency (EMEA) on hexavalent vaccines continue to be valid and consequently the use of these vaccines should not be stopped. This year the need for adolescents to receive a booster dose of the pertussis vaccine, with administration of an acellular, low antigenic load preparation together with the adult diphtheria and tetanus vaccine is stressed.

  17. [Vaccination schedule of the Spanish association of pediatrics: recommendations 2009].

    PubMed

    Bernaola Iturbe, E; Giménez Sánchez, F; Baca Cots, M; De Juan Martín, F; Diez Domingo, J; Garcés Sánchez, M; Gómez-Campderá, A; Martinón-Torres, F; Picazo, J J; Pineda Solás, V

    2009-01-01

    Based on the available evidence, we, the Vaccine Advisory Committee (CAV) of the Spanish Association of Pediatrics (Asociación Española de Pediatría, AEP), provide information about and comments on vaccine-related innovation during 2008. Modifications to the Vaccine Schedule for 2009 are also discussed. The importance of the recommendation of administration of a varicella booster at start of school (3-4 years of age) is highlighted according to the technical specifications of one of the vaccines. The importance of making the heptavalent pneumococcal conjugate vaccine universally available is reiterated in accordance with the unquestionable results of scientific tests, WHO recommendations, the posture adopted by the majority of neighboring European countries, and the decision taken in 2006 by the autonomous community of Madrid (Spain). New scientific reasons are provided, corroborating the recommendation made by this committee in 2008, for the implementation by Spanish pediatricians of the vaccine against rotavirus and human papilloma virus. With regard to the latter, vaccination should be from 11 to 16 years of age, and then extended, in accordance with the technical specifications of the available vaccine preparations, to 26 years of age. As part of the recommendations, we insist that children in risk groups should be given flu vaccine and hepatitis A vaccine. The committee considers that these two vaccines must also be given, when pediatricians consider it appropriate, to children other than those in risk groups. This recommendation can be regarded as the first step towards a future recommendation of universal vaccination. Finally, this year we include an appendix with recommendations and vaccination strategies to be followed in children who have not previously received vaccines or who have not been completely immunized.

  18. Poor immune responses of newborn rhesus macaques to measles virus DNA vaccines expressing the hemagglutinin and fusion glycoproteins.

    PubMed

    Polack, Fernando P; Lydy, Shari L; Lee, Sok-Hyong; Rota, Paul A; Bellini, William J; Adams, Robert J; Robinson, Harriet L; Griffin, Diane E

    2013-02-01

    A vaccine that would protect young infants against measles could facilitate elimination efforts and decrease morbidity and mortality in developing countries. However, immaturity of the immune system is an important obstacle to the development of such a vaccine. In this study, DNA vaccines expressing the measles virus (MeV) hemagglutinin (H) protein or H and fusion (F) proteins, previously shown to protect juvenile macaques, were used to immunize groups of 4 newborn rhesus macaques. Monkeys were inoculated intradermally with 200 μg of each DNA at birth and at 10 months of age. As controls, 2 newborn macaques were similarly vaccinated with DNA encoding the influenza virus H5, and 4 received one dose of the current live attenuated MeV vaccine (LAV) intramuscularly. All monkeys were monitored for development of MeV-specific neutralizing and binding IgG antibody and cytotoxic T lymphocyte (CTL) responses. These responses were poor compared to the responses induced by LAV. At 18 months of age, all monkeys were challenged intratracheally with a wild-type strain of MeV. Monkeys that received the DNA vaccine encoding H and F, but not H alone, were primed for an MeV-specific CD8(+) CTL response but not for production of antibody. LAV-vaccinated monkeys were protected from rash and viremia, while DNA-vaccinated monkeys developed rashes, similar to control monkeys, but had 10-fold lower levels of viremia. We conclude that vaccination of infant macaques with DNA encoding MeV H and F provided only partial protection from MeV infection.

  19. Factors associated with non-vaccination against measles in northeastern Brazil: Clues about causes of the 2015 outbreak.

    PubMed

    Rocha, Hermano A L; Correia, Luciano L; Campos, Jocileide S; Silva, Anamaria C; Andrade, Francisca O; Silveira, Dirlene I; Machado, Márcia M; Leite, Álvaro J; Cunha, Antônio J L A

    2015-09-11

    Measles is a highly contagious disease that can be effectively prevented through vaccination. The recent increase in vaccination coverage was successful in reducing the mortality globally of the disease by 74%. As a whole, the Americas have been considered a disease-free zone. However, it is known that if an immunization programs fails, there will be an accumulation of susceptible people that can lead to disease outbreaks. Recently, both the United States and Brazil faced outbreaks of measles. The present study aims to identify the determining factors of non-vaccination in Brazil in two different vaccination coverage moments, to provide clues as to the causes of current outbreaks. Data were drawn from five population-based cross-sectional studies that surveyed a representative sample of preschool children from 1987 to 2007 (9585 children in total). To assess children's vaccination status, two different information sources were used: information provided by mothers and information from children's health cards. Multivariate analyses with logistic binary regression models were conducted. After adjustment for confounding factors, it was observed that in 1987, with 48.2% vaccination coverage, socioeconomic, maternal, nutritional factors and access to health facilities were important, while in 2007 (96.7% coverage), nutritional and maternal factors were important. Distinct patterns of determinants of non-vaccination were also found. In addition, the low coverage in 1987 resulted in a current pool of adults who were not immunized as children; this may have contributed to the beginning of the current Brazilian outbreak. Globally, there are two standards of vaccination coverage (low and high). Therefore, discussion of the determinants of non-vaccination is important. Our findings suggest vulnerable groups should receive special attention to ensure they are protected. It is also important to consider the possible impact of pools of adults not immunized.

  20. Pediatric measles vaccine expressing a dengue antigen induces durable serotype-specific neutralizing antibodies to dengue virus.

    PubMed

    Brandler, Samantha; Lucas-Hourani, Marianne; Moris, Arnaud; Frenkiel, Marie-Pascale; Combredet, Chantal; Février, Michèle; Bedouelle, Hugues; Schwartz, Olivier; Desprès, Philippe; Tangy, Frédéric

    2007-12-12

    Dengue disease is an increasing global health problem that threatens one-third of the world's population. Despite decades of efforts, no licensed vaccine against dengue is available. With the aim to develop an affordable vaccine that could be used in young populations living in tropical areas, we evaluated a new strategy based on the expression of a minimal dengue antigen by a vector derived from pediatric live-attenuated Schwarz measles vaccine (MV). As a proof-of-concept, we inserted into the MV vector a sequence encoding a minimal combined dengue antigen composed of the envelope domain III (EDIII) fused to the ectodomain of the membrane protein (ectoM) from DV serotype-1. Immunization of mice susceptible to MV resulted in a long-term production of DV1 serotype-specific neutralizing antibodies. The presence of ectoM was critical to the immunogenicity of inserted EDIII. The adjuvant capacity of ectoM correlated with its ability to promote the maturation of dendritic cells and the secretion of proinflammatory and antiviral cytokines and chemokines involved in adaptive immunity. The protective efficacy of this vaccine should be studied in non-human primates. A combined measles-dengue vaccine might provide a one-shot approach to immunize children against both diseases where they co-exist.

  1. Non-specific effect of measles vaccination on overall child mortality in an area of rural India with high vaccination coverage: a population-based case-control study.

    PubMed Central

    Kabir, Zubair; Long, Jean; Reddaiah, Vankadara P.; Kevany, John; Kapoor, Suresh K.

    2003-01-01

    OBJECTIVE: To determine whether vaccination against measles in a population with sustained high vaccination coverage and relatively low child mortality reduces overall child mortality. METHODS: In April and May 2000, a population-based, case-control study was conducted at Ballabgarh (an area in rural northern India). Eligible cases were 330 children born between 1 January 1991 and 31 December 1998 who died aged 12-59 months. A programme was used to match 320 controls for age, sex, family size, and area of residence from a birth cohort of 15 578 born during the same time period. FINDINGS: The analysis used 318 matched pairs and suggested that children aged 12-59 months who did not receive measles vaccination in infancy were three times more likely to die than those vaccinated against measles. Children from lower caste households who were not vaccinated in infancy had the highest risk of mortality (odds ratio, 8.9). A 27% increase in child mortality was attributable to failure to vaccinate against measles in the study population. CONCLUSION: Measles vaccine seems to have a non-specific reducing effect on overall child mortality in this population. If true, children in lower castes may reap the greatest gains in survival. The findings should be interpreted with caution because the nutritional status of the children was not recorded and may be a residual confounder. "All-cause mortality" is a potentially useful epidemiological endpoint for future vaccine trials. PMID:12764490

  2. [Measles and pregnancy].

    PubMed

    Anselem, Olivia; Tsatsaris, Vassilis; Lopez, Emmanuel; Krivine, Anne; Le Ray, Camille; Loulergue, Pierre; Floret, Daniel; Goffinet, Francois; Launay, Odile

    2011-11-01

    Because of insufficient vaccine coverage, there is an outbreak of measles since 2008 in France with an increasing incidence of cases, most of them among children less than 1 year old or young adults. When measles occurs during pregnancy, maternal and fetal morbidity is increased. Particularly pregnant women are exposed to a higher risk of severe respiratory distress that might cause death. Measles virus can be detected in the placenta. Placental infection appears to be involved in some cases of fetal death. The virus is not responsible for congenital defects but can induce histologic damages inside the placenta which may lead to fetal death. Major perinatal risks are also miscarriage and prematurity. When measles occurs in late pregnancy, congenital infection is possible with variable expression and a risk of subacute sclerosing panencephalitis. Non immune pregnant women or neonates exposed to measles should receive an immunoglobulin prophylaxis within 6 days after contact in order to reduce the risk of infection and severe morbidity. In case of declared measles infection, symptomatic treatment can be proposed and tocolysis can be used if preterm labor is associated. Daily fetal monitoring during the 14 days following the beginning of the eruption can be offered when the fetus is viable. Vaccination is recommended for the people born in France after 1980 with 2 doses of vaccine against measles, rubeola and mumps. Measles vaccine, an attenuated living vaccine, should not be administered during pregnancy but must be proposed before pregnancy or during the post-partum period.

  3. A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform

    PubMed Central

    Malczyk, Anna H.; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A.; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan

    2015-01-01

    ABSTRACT In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR−/−)-CD46Ge mice with 2 × 105 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. IMPORTANCE Although MERS-CoV has not yet acquired extensive distribution

  4. A ‘post-honeymoon’ measles epidemic in Burundi: mathematical model-based analysis and implications for vaccination timing

    PubMed Central

    Corey, Katelyn C.

    2016-01-01

    Using a mathematical model with realistic demography, we analyze a large outbreak of measles in Muyinga sector in rural Burundi in 1988–1989. We generate simulated epidemic curves and age × time epidemic surfaces, which we qualitatively and quantitatively compare with the data. Our findings suggest that supplementary immunization activities (SIAs) should be used in places where routine vaccination cannot keep up with the increasing numbers of susceptible individuals resulting from population growth or from logistical problems such as cold chain maintenance. We use the model to characterize the relationship between SIA frequency and SIA age range necessary to suppress measles outbreaks. If SIAs are less frequent, they must expand their target age range. PMID:27672515

  5. Factors affecting the seroconversion rate of 12-month-old babies after the first injection of measles vaccine in the southeast of Iran.

    PubMed

    Zahraei, Seyed Mohsen; Izadi, Shahrokh; Mokhtari-Azad, Talat

    2016-12-01

    Within the past few years, several measles outbreaks have occurred in the southeast of Iran. To learn about the effectiveness of the immunization services for producing a serologic response against measles, this follow-up study was designed and implemented in the southeast of Iran. In Iran, all routine immunization services provided by the public sector are free of charge. The follow-up study was designed and implemented in 5 Urban Health Centers located in 3 districts of Sistan-va-BaluchestanProvince, Iran. In the pre-vaccination phase, 270 12-month-old babies were blood sampled; and in the post-vaccination phase, 4 to 7 weeks after Measles, Mumps, Rubella (MMR) vaccination, 236 of them were blood sampled (34 dropouts), and their sera were tested for IgG anti-measles antibodies, using indirect ELISA, in the National Reference Measles Laboratory. Out of the 236 participants, who had been blood sampled in the post-vaccination phase, 10 (3.7%) were excluded from the calculations of seroconversion rate, because they had protective levels of antibody before the vaccination. The seroconversion rate for the remaining 226 participants was 91.2% (95% confidence interval: 86.7 to 94.5). Among the variables studied, stunting (height-for-age z-score < -2) showed a strong relationship with the remaining seronegative after the vaccination (odds ratio = 5.6; 95% confidence interval: 1.7-18.2). The chance of seroconversion was inversely related to the mothers' levels of education (up to 9 y of education vs. above nine years) (odds ratio = 0.2; 95% confidence interval: 0.06-0.4). In the study population, the seroconversion rates for anti-measles antibodies after MMR vaccination are acceptable, even though in order to achieve the elimination goal, higher standards need to be achieved.

  6. Enabling implementation of the Global Vaccine Action Plan: developing investment cases to achieve targets for measles and rubella prevention.

    PubMed

    Thompson, Kimberly M; Strebel, Peter M; Dabbagh, Alya; Cherian, Thomas; Cochi, Stephen L

    2013-04-18

    Global prevention and control of infectious diseases requires significant investment of financial and human resources and well-functioning leadership and management structures. The reality of competing demands for limited resources leads to trade-offs and questions about the relative value of specific investments. Developing investment cases can help to provide stakeholders with information about the benefits, costs, and risks associated with available options, including examination of social, political, governance, and ethical issues. We describe the process of developing investment cases for globally coordinated management of action plans for measles and rubella as tools for enabling the implementation of the Global Vaccine Action Plan (GVAP). We focus on considerations related to the timing of efforts to achieve measles and rubella goals independently and within the context of ongoing polio eradication efforts, other immunization priorities, and other efforts to control communicable diseases or child survival initiatives. Our analysis suggests that the interactions between the availability and sustainability of financial support, sufficient supplies of vaccines, capacity of vaccine delivery systems, and commitments at all levels will impact the feasibility and timing of achieving national, regional, and global goals. The timing of investments and achievements will determine the net financial and health benefits obtained. The methodology, framing, and assumptions used to characterize net benefits and uncertainties in the investment cases will impact estimates and perceptions about the value of prevention achieved overall by the GVAP. We suggest that appropriately valuing the benefits of investments of measles and rubella prevention will require the use of integrated dynamic disease, economic, risk, and decision analytic models in combination with consideration of qualitative factors, and that synthesizing information in the form of investment cases may help

  7. Measles elimination: progress and challenges.

    PubMed

    Cutts, F T; Henao-Restrepo, A; Olivé, J M

    1999-10-29

    The accelerating progress in reducing measles incidence and mortality in many parts of the world has led to calls for its global eradication during the next 10-15 years. Three regions have established goals of elimination of indigenous transmission of measles. The strategy used in the Americas of a mass 'catchup' campaign of children 9 months to 15 years of age, high coverage through routine vaccination of infants, intensive surveillance and follow-up campaigns to prevent excessive build-up of susceptibles has had great success in reducing measles transmission close to zero. However, while these developments are impressive, much remains to be done to reduce measles-associated mortality in western and central Africa, where less than half of children are currently receiving measles vaccine and half a million children die from measles each year. The obstacles to global measles eradication are perceived to be predominantly political and financial. There are also technical questions, however. These include the refinement of measles elimination strategies in the light of recent outbreaks in the Americas; the implications of the HIV epidemic for measles elimination, issues around injection safety, and concerns about the possibility that secondary vaccine failures will contribute in sustaining transmission in highly vaccinated populations. The global priorities are to improve measles control in low income countries, increase awareness among industrialized countries of the importance of measles, and conduct studies to answer the technical questions about measles elimination strategies.

  8. Live attenuated measles vaccine expressing HIV-1 Gag virus like particles covered with gp160DELTAV1V2 is strongly immunogenic

    SciTech Connect

    Guerbois, Mathilde; Moris, Arnaud; Combredet, Chantal; Najburg, Valerie; Ruffie, Claude; Fevrier, Michele; Cayet, Nadege; Brandler, Samantha; Schwartz, Olivier; Tangy, Frederic

    2009-05-25

    Although a live attenuated HIV vaccine is not currently considered for safety reasons, a strategy inducing both T cells and neutralizing antibodies to native assembled HIV-1 particles expressed by a replicating virus might mimic the advantageous characteristics of live attenuated vaccine. To this aim, we generated a live attenuated recombinant measles vaccine expressing HIV-1 Gag virus-like particles (VLPs) covered with gp160DELTAV1V2 Env protein. The measles-HIV virus replicated efficiently in cell culture and induced the intense budding of HIV particles covered with Env. In mice sensitive to MV infection, this recombinant vaccine stimulated high levels of cellular and humoral immunity to both MV and HIV with neutralizing activity. The measles-HIV virus infected human professional antigen-presenting cells, such as dendritic cells and B cells, and induced efficient presentation of HIV-1 epitopes and subsequent activation of human HIV-1 Gag-specific T cell clones. This candidate vaccine will be next tested in non-human primates. As a pediatric vaccine, it might protect children and adolescents simultaneously from measles and HIV.

  9. A measles outbreak in children under 15 months of age in La Rioja, Spain, 2005-2006.

    PubMed

    Perucha, M; Ramalle-Gómara, E; Lezaun, M E; Blanco, A; Quiñones, C; Blasco, M; González, M A; Cuesta, C; Echevarría, J E; Mosquera, M M; de Ory, F

    2006-01-01

    This paper describes a measles outbreak in La Rioja, Spain, which began in December 2005 and mainly affected children under 15 months of age who were not yet immunised with MMR vaccine. The measles cases were detected by the mandatory reporting system, under which laboratories must report every confirmed measles case. Cases were classified in accordance with the National Measles Elimination Plan: suspected and laboratory-confirmed. In the period 14 December 2005 to 19 February 2006, 29 suspected cases of measles were investigated, and 18 were confirmed. The mean incubation period was 13.8 days (range: 9 to 18). Of the 18 confirmed cases, only two were in adults. MMR vaccination was recommended for all household contacts, as well as for children aged 6 to 14 months who attended the daycare centres where the cases had appeared. At these centres, the second dose of MMR was administered ahead of schedule for children under three years of age. It was recommended that the first dose of MMR vaccine be administered ahead of schedule for all children aged 9 to 14 months. During an outbreak of measles, children aged 6 months or older, who have not previously been vaccinated against measles, mumps and rubella, should receive a first dose as soon as possible, and those who have had a first dose should receive a second dose as soon as possible, provided that a minimum of one month has elapsed between the two doses.

  10. [The role of the rotavirus vaccine in childhood vaccination schedules].

    PubMed

    Giménez Sánchez, F; Martinón Torres, F; Bernaola Iturbe, E; Baca Cots, M; de Juan Martín, F; Díez Delgado, J; Garcés Sánchez, M; Gómez Campderá, J A; Picazo, J; Pineda Solas, V

    2006-06-01

    Rotavirus is the leading cause of diarrhea in infants. In developed countries, this infection leads to considerable morbidity with a high number of hospitalizations and medical interventions in the winter season, giving rise to substantial medical and social costs. In developing countries, rotavirus is a major cause of mortality in infants due to dehydration, with an estimated 600.000 deaths or more per year worldwide. A vaccine that is easy administrated, safe and with high efficacy would be the ideal means to reduce the burden of this disease and its high economic and social cost and to decrease the number of deaths in low-income countries. Recently, the results of two well-designed clinical trials with a large number of subjects have been reported. Both studies, which used different vaccines, reported high efficacy in the prevention of severe gastroenteritis and hospitalizations caused by rotavirus. When these vaccines become available in Europe, a reduction in hospitalizations, medical consultations, and days of work lost can be expected.

  11. [Childhood immunization schedule 2001-2002. Advisory Committee on Vaccines of the Spanish Association of Pediatrics].

    PubMed

    2001-07-01

    In 1994 the Spanish Association of Pediatrics founded the Advisory Committee on Vaccines with the aim of providing advice on matters related to childhood immunizations and of implementing vaccination schedules. The latest recommendations concern the immunization schedule for 2001-2002, in which indications for the inactivated poliovirus vaccine instead of the attenuated poliovirus vaccine are of prime importance. The advisability of including the vaccine against chicken pox in healthy children is stressed.

  12. Attitudinal and Demographic Predictors of Measles-Mumps-Rubella Vaccine (MMR) Uptake during the UK Catch-Up Campaign 2008–09: Cross-Sectional Survey

    PubMed Central

    Brown, Katrina; Fraser, Graham; Ramsay, Mary; Shanley, Ruth; Cowley, Noel; van Wijgerden, Johan; Toff, Penelope; Falconer, Michelle; Hudson, Michael; Green, John; Kroll, J. Simon; Vincent, Charles; Sevdalis, Nick

    2011-01-01

    Background and Objective Continued suboptimal measles-mumps-rubella (MMR) vaccine uptake has re-established measles epidemic risk, prompting a UK catch-up campaign in 2008–09 for children who missed MMR doses at scheduled age. Predictors of vaccine uptake during catch-ups are poorly understood, however evidence from routine schedule uptake suggests demographics and attitudes may be central. This work explored this hypothesis using a robust evidence-based measure. Design Cross-sectional self-administered questionnaire with objective behavioural outcome. Setting and Participants 365 UK parents, whose children were aged 5–18 years and had received <2 MMR doses before the 2008–09 UK catch-up started. Main Outcome Measures Parents' attitudes and demographics, parent-reported receipt of invitation to receive catch-up MMR dose(s), and catch-up MMR uptake according to child's medical record (receipt of MMR doses during year 1 of the catch-up). Results Perceived social desirability/benefit of MMR uptake (OR = 1.76, 95% CI = 1.09–2.87) and younger child age (OR = 0.78, 95% CI = 0.68–0.89) were the only independent predictors of catch-up MMR uptake in the sample overall. Uptake predictors differed by whether the child had received 0 MMR doses or 1 MMR dose before the catch-up. Receipt of catch-up invitation predicted uptake only in the 0 dose group (OR = 3.45, 95% CI = 1.18–10.05), whilst perceived social desirability/benefit of MMR uptake predicted uptake only in the 1 dose group (OR = 9.61, 95% CI = 2.57–35.97). Attitudes and demographics explained only 28% of MMR uptake in the 0 dose group compared with 61% in the 1 dose group. Conclusions Catch-up MMR invitations may effectively move children from 0 to 1 MMR doses (unimmunised to partially immunised), whilst attitudinal interventions highlighting social benefits of MMR may effectively move children from 1 to 2 MMR doses (partially to fully immunised). Older children may be

  13. Optimal vaccine scheduling in cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Piccoli, B.; Castiglione, F.

    2006-10-01

    Cancer immunotherapy aims at stimulating the immune system to react against cancer stealth capabilities. It consists of repeatedly injecting small doses of a tumor-associated molecule one wants the immune system to recognize, until a consistent immune response directed against the tumor cells is observed. We have applied the theory of optimal control to the problem of finding the optimal schedule of injections of an immunotherapeutic agent against cancer. The method employed works for a general ODE system and can be applied to find the optimal protocol in a variety of clinical problems where the kinetics of the drug or treatment and its influence on the normal physiologic functions have been described by a mathematical model. We show that the choice of the cost function has dramatic effects on the kind of solution the optimization algorithm is able to find. This provides evidence that a careful ODE model and optimization schema must be designed by mathematicians and clinicians using their proper different perspectives.

  14. Rubella (German Measles)

    MedlinePlus

    ... adults) can include headache, loss of appetite, mild conjunctivitis (inflammation of the lining of the eyelids and ... For Parents MORE ON THIS TOPIC Encephalitis Measles Pinkeye (Conjunctivitis) Immunization Schedule Frequently Asked Questions About Immunizations ...

  15. Description of two measles outbreaks in the Lazio Region, Italy (2006-2007). Importance of pockets of low vaccine coverage in sustaining the infection

    PubMed Central

    2010-01-01

    Background Despite the launch of the national plan for measles elimination, in Italy, immunization coverage remains suboptimal and outbreaks continue to occur. Two measles outbreaks, occurred in Lazio region during 2006-2007, were investigated to identify sources of infection, transmission routes, and assess operational implications for elimination of the disease. Methods Data were obtained from several sources, the routine infectious diseases surveillance system, field epidemiological investigations, and molecular genotyping of virus by the national reference laboratory. Results Overall 449 cases were reported, sustained by two different stereotypes overlapping for few months. Serotype D4 was likely imported from Romania by a Roma/Sinti family and subsequently spread to the rest of the population. Serotype B3 was responsible for the second outbreak which started in a secondary school. Pockets of low vaccine coverage individuals (Roma/Sinti communities, high school students) facilitated the reintroduction of serotypes not endemic in Italy and facilitated the measles infection to spread. Conclusions Communities with low vaccine coverage represent a more serious public health threat than do sporadic susceptible individuals. The successful elimination of measles will require additional efforts to immunize low vaccine coverage population groups, including hard-to-reach individuals, adolescents, and young adults. An enhanced surveillance systems, which includes viral genotyping to document chains of transmission, is an essential tool for evaluating strategy to control and eliminate measles PMID:20219143

  16. Distributing insecticide-treated bednets during measles vaccination: a low-cost means of achieving high and equitable coverage.

    PubMed Central

    Grabowsky, Mark; Nobiya, Theresa; Ahun, Mercy; Donna, Rose; Lengor, Miata; Zimmerman, Drake; Ladd, Holly; Hoekstra, Edward; Bello, Aliu; Baffoe-Wilmot, Aba; Amofah, George

    2005-01-01

    OBJECTIVE: To achieve high and equitable coverage of insecticide-treated bednets by integrating their distribution into a measles vaccination campaign. METHODS: In December 2002 in the Lawra district in Ghana, a measles vaccination campaign lasting 1 week targeted all children aged 9 months-15 years. Families with one or more children less than five years old were targeted to receive a free insecticide-treated bednet. The Ghana Health Service, with support from the Ghana Red Cross and UNICEF, provided logistical support, volunteer workers and social mobilization during the campaign. Volunteers visited homes to inform caregivers about the campaign and encourage them to participate. We assessed pre-campaign coverage of bednets by interviewing caregivers leaving vaccination and distribution sites. Five months after distribution, a two-stage cluster survey using population-proportional sampling assessed bednet coverage, retention and use. Both the pre-campaign and post-campaign survey assessed household wealth using an asset inventory. FINDINGS: At the campaign exit interview 636/776 (82.0%) caregivers reported that they had received a home visit by a Red Cross volunteer before the campaign and that 32/776 (4.1%) of the youngest children in each household who were less than 5 years of age slept under an insecticide-treated bednet. Five months after distribution caregivers reported that 204/219 (93.2%) of children aged 9 months to 5 years had been vaccinated during the campaign; 234/248 (94.4%) of households were observed to have an insecticide-treated bednet; and 170/249 (68.3%) were observed to have a net hung over a bed. Altogether 222/248 (89.5%) caregivers reported receiving at least one insecticide-treated bednet during the campaign, and 153/254 (60.2%) said that on the previous night their youngest child had slept under a bednet received during the campaign. For households in the poorest quintile, post-campaign coverage of insecticide-treated bednets was 10 times

  17. A case study of a graphical misrepresentation: drawing the wrong conclusions about the measles, mumps and rubella virus vaccine.

    PubMed

    Cox, Anthony R; Kirkham, Harold

    2007-01-01

    Graphs have been used in attempts to show a relationship between the measles, mumps and rubella virus (MMR) vaccine and autism. We examine the topic of graphical representation of data in general, and one of these graphs in particular: the one that appeared in a 1999 letter to The Lancet. That graph combined data from England and from California, USA. The author alleged that this graph illustrated a rise in autism rates linked to the use of the MMR vaccine. By examining the presentation closely, we are able to show how this graph misrepresented the data used. We give advice for both authors and publishers in the use of such graphical treatments of data.

  18. Measles - The epidemiology of elimination.

    PubMed

    Durrheim, David N; Crowcroft, Natasha S; Strebel, Peter M

    2014-12-05

    Tremendous progress has been made globally to reduce the contribution of measles to the burden of childhood deaths and measles cases have dramatically decreased with increased two dose measles-containing vaccine coverage. As a result the Global Vaccine Action Plan, endorsed by the World Health Assembly, has targeted measles elimination in at least five of the six World Health Organisation Regions by 2020. This is an ambitious goal, since measles control requires the highest immunisation coverage of any vaccine preventable disease, which means that the health system must be able to reach every community. Further, while measles remains endemic in any country, importations will result in local transmission and outbreaks in countries and Regions that have interrupted local endemic measles circulation. One of the lines of evidence that countries and Regions must address to confirm measles elimination is a detailed description of measles epidemiology over an extended period. This information is incredibly valuable as predictable epidemiological patterns emerge as measles elimination is approached and achieved. These critical features, including the source, size and duration of outbreaks, the seasonality and age-distribution of cases, genotyping pointers and effective reproduction rate estimates, are discussed with illustrative examples from the Region of the Americas, which eliminated measles in 2002, and the Western Pacific Region, which has established a Regional Verification Commission to review progress towards elimination in all member countries.

  19. The Inverse Method for a Childhood Infectious Disease Model with Its Application to Pre-vaccination and Post-vaccination Measles Data.

    PubMed

    Kong, Jude D; Jin, Chaochao; Wang, Hao

    2015-12-01

    In this paper, we improve the classic SEIR model by separating the juvenile group and the adult group to better describe the dynamics of childhood infectious diseases. We perform stability analysis to study the asymptotic dynamics of the new model, and perform sensitivity analysis to uncover the relative importance of the parameters on infection. The transmission rate is a key parameter in controlling the spread of an infectious disease as it directly determines the disease incidence. However, it is essentially impossible to measure the transmission rate for certain infectious diseases. We introduce an inverse method for our new model, which can extract the time-dependent transmission rate from either prevalence data or incidence data in existing open databases. Pre- and post-vaccination measles data sets from Liverpool and London are applied to estimate the time-varying transmission rate. From the Fourier transform of the transmission rate of Liverpool and London, we observe two spectral peaks with frequencies 1/year and 3/year. These dominant frequencies are robust with respect to different initial values. The dominant 1/year frequency is consistent with common belief that measles is driven by seasonal factors such as environmental changes and immune system changes and the 3/year frequency indicates the superiority of school contacts in driving measles transmission over other seasonal factors. Our results show that in coastal cities, the main modulator of the transmission of measles virus, paramyxovirus, is school seasons. On the other hand, in landlocked cities, both weather and school seasons have almost the same influence on paramyxovirus transmission.

  20. [Which vaccination schedule, which vaccines? The constraints of time and age].

    PubMed

    Goujon, C

    1997-01-01

    Several factors must be taken into account in planning vaccination schedules for overseas travelers. The first factor is to determine requirements mandated by applicable laws in the destination country and in France governing professional travel such as by military personnel. The other factors involve risk assessment including local health and epidemiological conditions, living conditions during the stay, and personal profile of the traveler (e.g. age and previous vaccination). Tropical areas are not the only destinations where infectious risks requiring vaccinations are found. Vaccination against diseases such as diphtheria and tick-borne encephalitis is necessary for several countries in Europe. Pre-travel planning provides a timely opportunity for updating basic vaccination requirements (e.g. tetanus and polio). For the growing number of elderly travelers, accurate evaluation of immune status may be difficult either because these subjects may never been vaccinated but only exposed to the wild germ during childhood or because their vaccinations may have been performed long ago. In both cases one cannot be sure of the quality of the anamnestic response to booster injections. A frequent limitation on vaccination planning for travelers is time available before departure.

  1. Introduction of sequential inactivated polio vaccine-oral polio vaccine schedule for routine infant immunization in Brazil's National Immunization Program.

    PubMed

    Domingues, Carla Magda Allan S; de Fátima Pereira, Sirlene; Cunha Marreiros, Ana Carolina; Menezes, Nair; Flannery, Brendan

    2014-11-01

    In August 2012, the Brazilian Ministry of Health introduced inactivated polio vaccine (IPV) as part of sequential polio vaccination schedule for all infants beginning their primary vaccination series. The revised childhood immunization schedule included 2 doses of IPV at 2 and 4 months of age followed by 2 doses of oral polio vaccine (OPV) at 6 and 15 months of age. One annual national polio immunization day was maintained to provide OPV to all children aged 6 to 59 months. The decision to introduce IPV was based on preventing rare cases of vaccine-associated paralytic polio, financially sustaining IPV introduction, ensuring equitable access to IPV, and preparing for future OPV cessation following global eradication. Introducing IPV during a national multivaccination campaign led to rapid uptake, despite challenges with local vaccine supply due to high wastage rates. Continuous monitoring is required to achieve high coverage with the sequential polio vaccine schedule.

  2. Measles-mumps-rubella vaccination timing and autism among young african american boys: a reanalysis of CDC data

    PubMed Central

    2014-01-01

    Background A significant number of children diagnosed with autism spectrum disorder suffer a loss of previously-acquired skills, suggesting neurodegeneration or a type of progressive encephalopathy with an etiological basis occurring after birth. The purpose of this study is to investigate the effectof the age at which children got their first Measles-Mumps-Rubella (MMR) vaccine on autism incidence. This is a reanalysis of the data set, obtained from the U.S. Centers for Disease Control and Protection (CDC), used for the Destefano et al. 2004 publication on the timing of the first MMR vaccine and autism diagnoses. Methods The author embarked on the present study to evaluate whether a relationship exists between child age when the first MMR vaccine was administered among cases diagnosed with autism and controls born between 1986 through 1993 among school children in metropolitan Atlanta. The Pearson’s chi-squared method was used to assess relative risks of receiving an autism diagnosis within the total cohort as well as among different race and gender categories. Results When comparing cases and controls receiving their first MMR vaccine before and after 36 months of age, there was a statistically significant increase in autism cases specifically among African American males who received the first MMR prior to 36 months of age. Relative risks for males in general and African American males were 1.69 (p=0.0138) and 3.36 (p=0.0019), respectively. Additionally, African American males showed an odds ratio of 1.73 (p=0.0200) for autism cases in children receiving their first MMR vaccine prior to 24 months of age versus 24 months of age and thereafter. Conclusions The present study provides new epidemiologic evidence showing that African American males receiving the MMR vaccine prior to 24 months of age or 36 months of age are more likely to receive an autism diagnosis. PMID:25114790

  3. Impact of the introduction of rotavirus vaccine on the timeliness of other scheduled vaccines: the Australian experience.

    PubMed

    Hull, Brynley P; Menzies, Robert; Macartney, Kristine; McIntyre, Peter B

    2013-04-08

    Strict age limits for receipt of rotavirus vaccines and simultaneous use of vaccines requiring two (Rotarix(®)) and three (RotaTeq(®)) doses in Australia may impact on coverage and timeliness of other vaccines in the infant schedule. Using data from the Australian Childhood Immunisation Register (ACIR), coverage and timeliness of rotavirus vaccines and changes in timeliness of other infant vaccines following rotavirus vaccine introduction was examined, with particular emphasis on Indigenous infants in whom coverage is less optimal. Final dose rotavirus coverage reached 83% within 21 months of program commencement but remained 7% lower than other vaccines due in infancy. Coverage was 11-17% lower in Indigenous infants. Adherence to the first dose upper age limits for rotavirus vaccine was high with >97% of children vaccinated by the recommended age, but for subsequent rotavirus doses, receipt beyond the upper age limits was more common, especially in Indigenous children. Following rotavirus vaccine introduction, there were improvements in timeliness of receipt of all doses of DTPa-containing and 7-valent pneumococcal conjugate vaccines. High population coverage can be attained with rotavirus vaccines, even with adherence to strict upper age restrictions for vaccine dose administration. Rotavirus vaccine introduction appears to have impacted upon the timeliness of other concomitantly scheduled vaccines. These factors should be considered when rotavirus programs are introduced.

  4. Immunogenicity and safety of measles-mumps-rubella vaccine delivered by disposable-syringe jet injector in healthy Brazilian infants: a randomized non-inferiority study.

    PubMed

    de Menezes Martins, Reinaldo; Curran, Birute; Maia, Maria de Lourdes Sousa; Ribeiro, Maria das Graças Tavares; Camacho, Luiz Antonio Bastos; da Silva Freire, Marcos; Yamamura, Anna Maya Yoshida; Siqueira, Marilda Mendonça; Lemos, Maria Cristina F; de Albuquerque, Elizabeth Maciel; von Doellinger, Vanessa dos Reis; Homma, Akira; Saganic, Laura; Jarrahian, Courtney; Royals, Michael; Zehrung, Darin

    2015-03-01

    This study aimed to determine if immunogenicity to measles-mumps-rubella vaccine delivered to infants via a disposable-syringe jet injector (DSJI) was non-inferior to that administered by needle and syringe (NS). Vaccination safety was evaluated, as were the use, performance, and acceptability of each delivery method. The DSJI was the PharmaJet 2009 generation-1 device (G1) and the vaccine was measles-mumps-rubella vaccine from Bio-Manguinhos. Five hundred eighty-two healthy Brazilian infants were randomized to receive vaccine via G1 or NS. Seroconversion rates against measles and mumps viruses in the G1 treatment group did not meet non-inferiority criteria when compared with the NS group; however, responses in the G1 group to rubella virus were non-inferior to those of NS vaccinees. Most adverse events were mild or moderate. Crying after injection was more frequent in the NS group, and local skin reactions were more common in the G1 group. Five serious adverse events were judged causally unrelated to treatment and all resolved. Parents/guardians expressed a strong preference for G1 over NS for their children. Vaccinators found the G1 easy to use but noted incomplete vaccine delivery in some cases. Although the G1 has been superseded by an updated device, our results are important for the continued improvement and evaluation of DSJIs, which have the potential to overcome many of the challenges and risks associated with needle-based injections worldwide. Recommendations for future DSJI clinical studies include rigorous training of vaccinators, quantitative measurement of wetness on the skin following injection, and regular monitoring of device and vaccinator performance.

  5. PACT- and RIG-I-Dependent Activation of Type I Interferon Production by a Defective Interfering RNA Derived from Measles Virus Vaccine

    PubMed Central

    Ho, Ting-Hin; Kew, Chun; Lui, Pak-Yin; Chan, Chi-Ping; Satoh, Takashi; Akira, Shizuo

    2015-01-01

    ABSTRACT The live attenuated measles virus vaccine is highly immunostimulatory. Identification and characterization of its components that activate the innate immune response might provide new strategies and agents for the rational design and development of chemically defined adjuvants. In this study, we report on the activation of type I interferon (IFN) production by a defective interfering (DI) RNA isolated from the Hu-191 vaccine strain of measles virus. We found that the Hu-191 virus induced IFN-β much more potently than the Edmonston strain. In the search for IFN-inducing species in Hu-191, we identified a DI RNA specifically expressed by this strain. This DI RNA, which was of the copy-back type, was predicted to fold into a hairpin structure with a long double-stranded stem region of 206 bp, and it potently induced the expression of IFN-β. Its IFN-β-inducing activity was further enhanced when both cytoplasmic RNA sensor RIG-I and its partner, PACT, were overexpressed. On the contrary, this activity was abrogated in cells deficient in PACT or RIG-I. The DI RNA was found to be associated with PACT in infected cells. In addition, both the 5′-di/triphosphate end and the double-stranded stem region on the DI RNA were essential for its activation of PACT and RIG-I. Taken together, our findings support a model in which a viral DI RNA is sensed by PACT and RIG-I to initiate an innate antiviral response. Our work might also provide a foundation for identifying physiological PACT ligands and developing novel adjuvants or antivirals. IMPORTANCE The live attenuated measles virus vaccine is one of the most successful human vaccines and has largely contained the devastating impact of a highly contagious virus. Identifying the components in this vaccine that stimulate the host immune response and understanding their mechanism of action might help to design and develop better adjuvants, vaccines, antivirals, and immunotherapeutic agents. We identified and characterized

  6. Is there a 'regressive phenotype' of Autism Spectrum Disorder associated with the measles-mumps-rubella vaccine? A CPEA Study.

    PubMed

    Richler, Jennifer; Luyster, Rhiannon; Risi, Susan; Hsu, Wan-Ling; Dawson, Geraldine; Bernier, Raphael; Dunn, Michelle; Hepburn, Susan; Hyman, Susan L; McMahon, William M; Goudie-Nice, Julie; Minshew, Nancy; Rogers, Sally; Sigman, Marian; Spence, M Anne; Goldberg, Wendy A; Tager-Flusberg, Helen; Volkmar, Fred R; Lord, Catherine

    2006-04-01

    A multi-site study of 351 children with Autism Spectrum Disorders (ASD) and 31 typically developing children used caregiver interviews to describe the children's early acquisition and loss of social-communication milestones. For the majority of children with ASD who had experienced a regression, pre-loss development was clearly atypical. Children who had lost skills also showed slightly poorer outcomes in verbal IQ and social reciprocity, a later mean age of onset of autistic symptoms, and more gastrointestinal symptoms than children with ASD and no regression. There was no evidence that onset of autistic symptoms or of regression was related to measles-mumps-rubella vaccination. The implications of these findings for the existence of a 'regressive phenotype' of ASD are discussed.

  7. Vaccine-induced measles virus-specific T cells do not prevent infection or disease but facilitate subsequent clearance of viral RNA.

    PubMed

    Lin, Wen-Hsuan W; Pan, Chien-Hsiung; Adams, Robert J; Laube, Beth L; Griffin, Diane E

    2014-04-15

    Infection with wild-type measles virus (MeV) induces lifelong protection from reinfection, and parenteral delivery of the live attenuated measles vaccine (LAV) also provides protection from measles. The level of neutralizing antibody is a good indicator of protection, but the independent roles of MeV-specific antibody and T cells have not been identified. In this study, macaques immunized with LAV through a nebulizer and a mouthpiece developed MeV-specific T-cell responses but not neutralizing antibodies. Upon challenge with wild-type MeV, these animals developed rashes and viremias similar to those in naive animals but cleared viral RNA from blood 25 to 40 days faster. The nebulizer-immunized animals also had more robust MeV-specific CD4(+) and CD8(+) T-cell responses than the naive animals after challenge, characterized by a higher number and better durability of gamma interferon (IFN-γ)-producing cells. Induction of MeV-specific circulating CD4(+) and CD8(+) T cells capable of producing multiple cytokines correlated with clearance of viral RNA in the nebulizer-immunized macaques. These studies demonstrated that MeV-specific T-cell immunity alone did not prevent measles, but T-cell priming enhanced the magnitude, durability, and polyfunctionality of MeV-specific T cells after challenge infection and correlated with more rapid clearance of MeV RNA. IMPORTANCE The components of vaccine-induced immunity necessary for protection from infection and disease have not been clearly identified for most vaccines. Vaccine development usually focuses on induction of antibody, but T-cell-based vaccines are also under development. The live attenuated measles vaccine (LAV) given subcutaneously induces both T cells and neutralizing antibody and provides solid protection from infection. LAV delivered to the upper respiratory tract through a nebulizer and mouthpiece induced a T-cell response but no neutralizing antibody. These T-cell-primed macaques demonstrated no protection from

  8. Characterization of Endogenous Avian Leukosis Viruses in Chicken Embryonic Fibroblast Substrates Used in Production of Measles and Mumps Vaccines

    PubMed Central

    Johnson, Jeffrey A.; Heneine, Walid

    2001-01-01

    Previous findings of low levels of reverse transcriptase (RT) activity in chick cell-derived measles and mumps vaccines showed this activity to be associated with virus particles containing RNA of both subgroup E endogenous avian leukosis viruses (ALV-E) and endogenous avian viruses (EAV). These particles originate from chicken embryonic fibroblast (CEF) substrates used for propagating vaccine strains. To better characterize vaccine-associated ALV-E, we examined the endogenous ALV proviruses (ev loci) present in a White Leghorn CEF substrate pool by restriction fragment length polymorphism. Five ev loci were detected, ev-1, ev-3, ev-6, ev-18, andev-19. Both ev-18 and ev-19 can express infectious ALV-E, while ev-1, ev-3, and ev-6 are defective. We analyzed the full-length sequence of ev-1 and identified an adenosine insertion within the pol RT-β region at position 5026, which results in a truncated RT-β and integrase. We defined the 1,692-bp deletion in the gag-pol region of ev-3, and we found that in ev-6, sequences from the 5′ long terminal repeat to the 5′ pol region were absent. Based on the sequences of the ev loci, RT-PCR assays were developed to examine expression of ALV-E particles (EV) in CEF supernatants. Both ev-1- and ev-3-like RNA sequences were identified, as well as two other RNA sequences with intact pol regions, presumably of ev-18 and ev-19 origin. Inoculation of susceptible quail fibroblasts with CEF culture supernatants from both 5-azacytidine-induced and noninduced CEF led to ALV infection, confirming the presence of infectious ALV-E. Our data demonstrate that both defective and nondefective ev loci can be present in CEF vaccine substrates and suggest that both ev classes may contribute to the ALV present in vaccines. PMID:11264350

  9. A Measles Outbreak at a College with a Prematriculation Immunization Requirement.

    ERIC Educational Resources Information Center

    Hersh, Bradley S.; And Others

    1991-01-01

    Reports a retrospective cohort study among students living in campus dormitories to examine potential risk factors for measles vaccine failure. As in secondary schools, measles outbreaks can occur among highly vaccinated college populations. Requiring two doses of measles vaccine for college entrants should help reduce measles outbreaks in college…

  10. Hidden Efficiencies: Making Completion of the Pediatric Vaccine Schedule More Efficient for Physicians

    PubMed Central

    Ciarametaro, Mike; Bradshaw, Steven E.; Guiglotto, Jillian; Hahn, Beth; Meier, Genevieve

    2015-01-01

    Abstract The objective of this work is to demonstrate the potential time and labor savings that may result from increased use of combination vaccinations. The study (GSK study identifier: HO-12-4735) was a model developed to evaluate the efficiency of the pediatric vaccine schedule, using time and motion studies. The model considered vaccination time and the associated labor costs, but vaccination acquisition costs were not considered. We also did not consider any efficacy or safety differences between formulations. The model inputs were supported by a targeted literature review. The reference year for the model was 2012. The most efficient vaccination program using currently available vaccines was predicted to reduce costs through a combination of fewer injections (62%) and less time per vaccination (38%). The most versus the least efficient vaccine program was predicted to result in a 47% reduction in vaccination time and a 42% reduction in labor and supply costs. The estimated administration cost saving with the most versus the least efficient program was estimated to be nearly US $45 million. If hypothetical 6- or 7-valent vaccines are developed using the already most efficient schedule by adding additional antigens (pneumococcal conjugate vaccine and Haemophilus influenzae type b) to the most efficient 5-valent vaccine, the savings are predicted to be even greater. Combination vaccinations reduce the time burden of the childhood immunization schedule and could create the potential to improve vaccination uptake and compliance as a result of fewer required injections. PMID:25634165

  11. Vaccinations

    MedlinePlus

    ... vaccinated? For many years, a set of annual vaccinations was considered normal and necessary for dogs and ... to protect for a full year. Consequently, one vaccination schedule will not work well for all pets. ...

  12. Can measles be eradicated globally?

    PubMed Central

    de Quadros, Ciro A.

    2004-01-01

    Measles is one of the most infectious diseases. Before measles vaccine was introduced, nearly everyone contracted the disease at some point in childhood. By the late 1980s, most countries had incorporated measles vaccine into their routine immunization programmes. Globally, about 800 000 children nevertheless still die from measles annually, half of them in Africa. Eradicating measles would therefore play an important role in improving children's survival. The 24th Pan American Sanitary Conference in 1994 established a goal of eradicating measles from the Americas. Progress to date has been remarkable and the disease is no longer endemic in the Americas, with most countries having documented interruption of transmission. As of November 2003, 12 months had elapsed since the last indigenous case was detected in Venezuela. This experience shows that measles transmission can be interrupted, and that this can be sustained over a long period of time. Global eradication is feasible if an appropriate strategy is implemented. Even under a new paradigm in which immunization is not discontinued after measles is eradicated, eradication will be a good investment to avoid expensive epidemics and save the lives of almost one million children annually. A world free of measles by 2015 is not a dream. PMID:15042236

  13. The effects of vitamin A supplementation with measles vaccine on leucocyte counts and in vitro cytokine production.

    PubMed

    Jensen, Kristoffer Jarlov; Fisker, Ane Bærent; Andersen, Andreas; Sartono, Erliyani; Yazdanbakhsh, Maria; Aaby, Peter; Erikstrup, Christian; Benn, Christine Stabell

    2016-02-28

    As WHO recommends vitamin A supplementation (VAS) at vaccination contacts after age 6 months, many children receive VAS together with measles vaccine (MV). We aimed to investigate the immunological effect of VAS given with MV. Within a randomised placebo-controlled trial investigating the effect on overall mortality of providing VAS with vaccines in Guinea-Bissau, we conducted an immunological sub-study of VAS v. placebo with MV, analysing leucocyte counts, whole blood in vitro cytokine production, vitamin A status and concentration of C-reactive protein (CRP). VAS compared with placebo was associated with an increased frequency of CRP ≥ 5 mg/l (28 v. 12%; P=0·005). Six weeks after supplementation, VAS had significant sex-differential effects on leucocyte, lymphocyte, monocyte and basophil cell counts, decreasing them in males but increasing them in females. Mainly in females, the effect of VAS on cytokine responses differed by previous VAS: in previous VAS recipients, VAS increased the pro-inflammatory and T helper cell type 1 (Th1) cytokine responses, whereas VAS decreased these responses in previously unsupplemented children. In previous VAS recipients, VAS was associated with increased IFN-γ responses to phytohaemagglutinin in females (geometric mean ratio (GMR): 3·97; 95% CI 1·44, 10·90) but not in males (GMR 0·44; 95% CI 0·14, 1·42); the opposite was observed in previously unsupplemented children. Our results corroborate that VAS provided with MV has immunological effects, which may depend on sex and previous VAS. VAS may increase the number of leucocytes, but also repress both the innate and lymphocyte-derived cytokine responses in females, whereas this repression may be opposite if the females have previously received VAS.

  14. Randomized Controlled Trial of Two Dosing Schedules for Human Papillomavirus Vaccination among College Age Males

    PubMed Central

    Lin, Chyongchiou Jeng; Zimmerman, Richard K; Nowalk, Mary Patricia; Huang, Hsin-Hui; Raviotta, Jonathan M.

    2014-01-01

    Background Quadrivalent human papillomavirus (HPV) vaccine, for protection against sexually transmitted HPV infection, is licensed for females and males 9–26 years on a 3-dose schedule (0, 2, and 6 months; Standard schedule). Vaccine uptake has been low and catch-up vaccination of older adolescents using an alternate dosing schedule may increase coverage. This study tested the non-inferiority of the immunogenicity of an alternate dosing schedule (0, 2, 12 months) among college age males. Methods 220 18–25 year old males were randomly assigned to Standard or Alternate schedules. Blood samples were drawn immediately before Dose 1 and 2–6 weeks after Dose 3 and analyzed for antibody titers using a Luminex immunoassay. A value <1.5 for the upper 95% confidence interval (CI) bound of the Standard to Alternate schedule geometric mean titer (GMT) ratio was deemed non-inferior. Results Participants averaged 21.3 years old; 19.1% were non-white; completion rate was 93%. The anti-HPV titers for the Alternate schedule group were non-inferior to those of Standard schedule group for all four HPV vaccine virus types. Our results also demonstrated superiority of the Alternate schedule group for all four HPV vaccine virus types. Conclusion A delayed third dose at 12 months is immunologically non-inferior and superior for four HPV virus types. Using an alternate dosing schedule offers more flexibility to receive the 3-dose HPV vaccine and may result in higher vaccination rates among college-age males. PMID:24342252

  15. Combination Measles-Mumps-Rubella-Varicella Vaccine in Healthy Children: A Systematic Review and Meta-analysis of Immunogenicity and Safety.

    PubMed

    Ma, Shu-Juan; Li, Xing; Xiong, Yi-Quan; Yao, A-Ling; Chen, Qing

    2015-11-01

    A combined measles-mumps-rubella-varicella (MMRV) vaccine is expected to facilitate universal immunization against these 4 diseases. This study was undertaken to synthesize current research findings of the immunogenicity and safety of MMRV in healthy children.We searched PubMed, Embase, BIOSIS Previews, Web of Science, Cochrane Library, and other databases through September 9, 2014. Eligible randomized controlled trials (RCTs) were selected and collected independently by 2 reviewers. Meta-analysis was conducted using Stata 12.0 and RevMan 5.3.Twenty-four RCTs were included in qualitative synthesis. Nineteen RCTs compared single MMRV dose with measles-mumps-rubella vaccine with or without varicella vaccine (MMR + V/MMR). Similar seroconversion rates of these 4 viruses were found between comparison groups. There were comparable geometric mean titers (GMTs) against mumps and varicella viruses between MMRV group and MMR + V/MMR group. MMRV group achieved enhanced immune response to measles component, with GMT ratio of 1.66 (95% confidence interval [CI] 1.48, 1.86; P < 0.001) for MMRV versus MMR and 1.62 (95% CI 1.51, 1.70; P < 0.001) for MMRV versus MMR + V. Meanwhile, immune response to rubella component in MMRV group was slightly reduced, GMT ratios were 0.81 (95% CI 0.78, 0.85; P < 0.001) and 0.79 (95% CI 0.76, 0.83; P < 0.001), respectively. Well tolerated safety profiles were demonstrated except higher incidence of fever (relative risks 1.12-1.60) and measles/rubella-like rash (relative risks 1.44-1.45) in MMRV groups.MMRV had comparable immunogenicity and overall safety profiles to MMR + V/MMR in healthy children based on current evidence.

  16. Priming T-cell responses with recombinant measles vaccine vector in a heterologous prime-boost setting in non-human primates.

    PubMed

    Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina

    2012-09-07

    Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses.

  17. Vaccines (immunizations) - overview

    MedlinePlus

    ... diphtheria, mumps, measles, pertussis (whooping cough), meningitis, and polio. Many of these infections can cause serious or ... MMR - vaccine Pneumococcal conjugate vaccine Pneumococcal polysaccharide ... (vaccine) Rotavirus vaccine Tdap vaccine Tetanus - vaccine

  18. Measles, mumps, and rubella virus vaccine (M-M-R™II): a review of 32 years of clinical and postmarketing experience.

    PubMed

    Lievano, Fabio; Galea, Susan A; Thornton, Michele; Wiedmann, Richard T; Manoff, Susan B; Tran, Trung N; Amin, Manisha A; Seminack, Margaret M; Vagie, Kristen A; Dana, Adrian; Plotkin, Stanley A

    2012-11-06

    M-M-R™II (measles, mumps, and rubella virus vaccine live; Merck, Sharp, & Dohme Corp.) is indicated for simultaneous vaccination against measles, mumps, and rubella in individuals ≥ 12 months of age. Before the vaccine era, these viruses infected most exposed individuals, with subsequent morbidity and mortality. One of the greatest achievements of public health has been to eliminate these 3 diseases in large geographic areas. The safety profile of M-M-R™II is described using data from routine global postmarketing surveillance. Postmarketing surveillance has limitations (including incomplete reporting of case data), but allows collection of real-world information on large numbers of individuals, who may have concurrent medical problems excluding them from clinical trials. It can also identify rare adverse experiences (AEs). Over its 32-year history, ≈ 575 million doses of M-M-R™II have been distributed worldwide, with 17,536 AEs voluntarily reported for an overall rate of 30.5 AEs/1,000,000 doses distributed. This review provides evidence that the vaccine is safe and well-tolerated.

  19. Don't Let Measles Be Your Travel Souvenir

    MedlinePlus

    ... CDC Features Don’t Let Measles Be Your Travel Souvenir Language: English Español (Spanish) Recommend on Facebook ... if you have received MMR vaccine. Before You Travel After You Travel More Information More Information Measles ...

  20. [An update on measles].

    PubMed

    Caseris, M; Burdet, C; Lepeule, R; Houhou, N; Yeni, P; Yazdanpanah, Y; Joly, V

    2015-05-01

    Measles is a highly contagious infectious disease, which needs more than 95% worldwide vaccination coverage of 2 doses to be eradicated. Despite an important involvement of the WHO for massive immunization, goals have not bean reached, and outbreaks can occur at any time in many countries, including Western Europe. In France, 22,000 cases were identified between 2009 and 2011, mainly in infants and young adults, which are not or not enough vaccinated (one dose). In 2012, even though the number of cases has drastically decreased, the outbreak is still going on, especially in South of France. That is why every clinician needs to be concerned about the clinical manifestations of the disease, and its complications. Besides a febrile rash, measles is often responsible of pneumonia and biologic hepatitis in adults. Hepatitis does not seem frequent in children. Clinicians need to be aware of specific complications, like encephalitis in case of cellular immunodepression, high risk of pneumonia in pregnant women. In patients previously vaccinated, incidence of complications is the same but patients are not contagious. Even if measles diagnosis is clinical, blood confirmation by serology is recommended in France when possible. Outcome is mainly favourable, but measles is not well-tolerated with high levels of hospitalisation even without any complication. Vaccination is the only way to protect against it.

  1. Risk analysis of aseptic meningitis after measles-mumps-rubella vaccination in Korean children by using a case-crossover design.

    PubMed

    Ki, Moran; Park, Taesung; Yi, Sung Gon; Oh, Jin Kyoung; Choi, BoYoul

    2003-01-15

    Epidemiologic study of a vaccine's adverse events is not easy; so many countries have no reliable data. Vaccines containing the Urabe or Hoshino strain have been withdrawn from use in several countries. However, the data are not strong enough to form the basis of a recommendation not to use specific strains. The authors used a case-crossover design to estimate the relative risk of aseptic meningitis in children after receiving the measles-mumps-rubella vaccine in Korea. Study subjects were hospitalized children aged 8-36 months who had aseptic meningitis in 1998. Cases were confirmed by hospital chart reviews using previously defined criteria. Through a telephone survey, the authors obtained vaccination date and place information from parents' vaccination records. Study results showed that no significant risk was associated with the Jeryl Lynn or Rubini strain of the vaccine (relative risk = 0.6, 95% confidence interval (CI): 0.18, 1.97). For the Urabe or Hoshino strain, the relative risk was 5.5 (95% CI: 2.6, 11.8); the risk increased in the third week after vaccination (relative risk = 15.6, 95% CI: 5.9, 41.2) and was elevated until the sixth week. The case-crossover design was useful in confirming the risk of acute adverse events after receiving vaccines.

  2. 'Avoiding harm to others' considerations in relation to parental measles, mumps and rubella (MMR) vaccination discussions - an analysis of an online chat forum.

    PubMed

    Skea, Zoë C; Entwistle, Vikki A; Watt, Ian; Russell, Elizabeth

    2008-11-01

    Vaccination against contagious diseases is intended to benefit individuals and contribute to the eradication of such diseases from the population as a whole. The Measles, Mumps and Rubella (MMR) vaccine is widely recommended for all children with the aim of protecting against measles, mumps, and rubella. However, within the UK, there has been significant controversy surrounding its safety. This paper presents findings from a UK study of discussions about MMR in an online chat forum for parents. We observed archived discussions (without posting any messages) and conducted a thematic analysis to explore in more detail how participants discussed particular topics. Most participants were female, had young children, lived in the UK. They had reached a range of decisions regarding MMR vaccination. This analysis focuses on discussions about 'avoiding harm to others,' which were important considerations for many of the participating parents. In the context of concerns about MMR safety, participants expressed a desire to both (a) protect their own child and (b) help protect others by contributing to herd immunity. Parents made a distinction between healthy and vulnerable children which had important implications for their views about who should bear the burden of vaccination. Some parents were quite critical of those who did not vaccinate healthy children, and urged them to do so on grounds of social responsibility. Our findings suggest that social scientists with an interest in vaccination practice should attend carefully to lay understandings of herd immunity as a public good and views about obligations to others in society. Policy makers, too, might consider giving more emphasis to herd immunity in vaccination promotional material, although attention should be paid to the ways in which parents distinguish between healthy and vulnerable children.

  3. A measles outbreak in Catania, Sicily: the importance of high vaccination coverage and early notification of cases for health and economic reasons.

    PubMed

    Celesia, Benedetto Maurizio; Fontana, Rossella; Pinzone, Marilia Rita; Cuccia, Mario; Bellissimo, Francesco; Rapisarda, Liliana; Rinnone, Sebastiano; Rapisarda, Venerando; Pavone, Piero; Cacopardo, Bruno; Nunnari, Giuseppe

    2014-09-01

    Measles is a paediatric exanthematous disease. Even though vaccination has dramatically reduced measles morbidity and mortality, outbreaks still occur due to insufficient vaccination coverage and importation of the virus from endemic regions. Although child vaccination coverage in Italy has been broadened (from 74% in 2000 to 90.1% in 2011), outbreaks are still observed at a regional level. We describe epidemiological and clinical characteristics of cases reported from January 2009 to May 2010 to the Epidemiology Service of the Provincial Health Authority of Catania. We obtained demographic data and vaccination status from the database of the Epidemiology Service and clinical features and laboratory data from medical records. In all, 522 cases were notified: 286 males (54%), median age 12 years (interquartile range (IQR) 4-18); 401 cases (77%) were notified by the hospital, and 121 (23%) by general practitioners. Only one patient had been previously vaccinated. 52 cases were hospitalized, median age 18 years (IQR 17-23). We observed hypertransaminasaemia in 20 patients (38%), thrombocytopenia in 22 patients (42%) and a creatine phosphokinase increase in 16 (30%). Complications (pneumonia, haemorrhagic cystitis, acute hepatitis) occurred in 10 patients (19%), all older than 18. Recent outbreaks show that immunization practices are still insufficient. Most cases were recorded in adolescents and young adults; even if the vaccine has limited virus circulation in childhood, it did not prevent the infection of other age groups. The number of notifications also suggests that the phenomenon is underestimated. In order to monitor the disease we need early notification of cases and increased vaccination coverage.

  4. Immunogenicity and safety of concomitant administration of a measles, mumps and rubella vaccine (M-M-RvaxPro®) and a varicella vaccine (VARIVAX®) by intramuscular or subcutaneous routes at separate injection sites: a randomised clinical trial

    PubMed Central

    Gillet, Yves; Habermehl, Pirmin; Thomas, Stéphane; Eymin, Cécile; Fiquet, Anne

    2009-01-01

    Background When this trial was initiated, the combined measles, mumps and rubella (MMR) vaccine was licensed for subcutaneous administration in all European countries and for intramuscular administration in some countries, whereas varicella vaccine was licensed only for subcutaneous administration. This study evaluated the intramuscular administration of an MMR vaccine (M-M-RvaxPro®) and a varicella vaccine (VARIVAX®) compared with the subcutaneous route. Methods An open-label randomised trial was performed in France and Germany. Healthy children, aged 12 to18 months, received single injections of M-M-RvaxPro and VARIVAX concomitantly at separate injection sites. Both vaccines were administered either intramuscularly (IM group, n = 374) or subcutaneously (SC group, n = 378). Immunogenicity was assessed before vaccination and 42 days after vaccination. Injection-site erythema, swelling and pain were recorded from days 0 to 4 after vaccination. Body temperature was monitored daily between 0 and 42 days after vaccination. Other adverse events were recorded up to 42 days after vaccination and serious adverse events until the second study visit. Results Antibody response rates at day 42 in the per-protocol set of children initially seronegative to measles, mumps, rubella or varicella were similar between the IM and SC groups for all four antigens. Response rates were 94 to 96% for measles, 98% for both mumps and rubella and 86 to 88% for varicella. For children initially seronegative to varicella, 99% achieved the seroconversion threshold (antibody concentrations of ≥ 1.25 gpELISA units/ml). Erythema and swelling were the most frequently reported injection-site reactions for both vaccines. Most injection-site reactions were of mild intensity or small size (≤ 2.5 cm). There was a trend for lower rates of injection-site erythema and swelling in the IM group. The incidence and nature of systemic adverse events were comparable for the two routes of administration

  5. Increasing the Time of Exposure to Aerosol Measles Vaccine Elicits an Immune Response Equivalent to That Seen in 9-Month-Old Mexican Children Given the Same Dose Subcutaneously

    PubMed Central

    García-León, Miguel Leonardo; Espinosa-Torres Torrija, Bogart; Hernández-Pérez, Brenda; Cardiel-Marmolejo, Lino E.; Beeler, Judy A.; Audet, Susette; Santos-Preciado, José Ignacio

    2011-01-01

    Background. A 30-second aerosol measles vaccination successfully primes children 12 months of age and older but is poorly immunogenic when given to 9-month-old children. We examined the immune responses when increasing the duration to aerosol exposure in 9-month-olds. Methods. One hundred and thirteen healthy 9-month-old children from Mexico City were enrolled; 58 received aerosol EZ measles vaccine for 2.5 minutes and 55 subcutaneously. Measles-specific neutralizing antibodies and cellular responses were measured before and at 3 and 6 months postimmunization. Results. Adaptive immunity was induced in 97% after aerosol and 98% after subcutaneous administration. Seroconversion rates and GMCs were 95% and 373 mIU/mL (95% confidence interval [CI], 441–843) following aerosol vaccination and 91% and 306 mIU/mL (95% CI, 367–597) after subcutaneous administration at 3 months. The percentage of children with a measles-specific stimulation index ≥3 was 45% and 60% in the aerosol versus 55% and 59% in the subcutaneous group at 3 and 6 months, respectively. CD8 memory cell frequencies were higher in the aerosol group at 3 months compared with the subcutaneous group. Adverse reactions were comparable in both groups. Conclusions. Increasing exposure time to aerosol measles vaccine elicits immune responses that are comparable to those seen when an equivalent dose is administered by the subcutaneous route in 9-month-old infants. PMID:21742842

  6. Encephalitogenicity of measles virus in marmosets.

    PubMed Central

    Albrecht, P; Lorenz, D; Klutch, M J

    1981-01-01

    Marmosets infected intracerebrally with the wild Edmonston strain of measles virus developed encephalitis, demonstrated histologically and by the fluorescent-antibody technique. The infection remained clinically silent over a 14-day observation period. Animals infected intracerebrally with the JM strain of wild measles virus had only mild encephalitic changes but died of the visceral form of measles infection. Marmosets inoculated with measles vaccine had no encephalitis and remained clinically well. Marmosets appear to be a sensitive indicator of the viscerotropic and neurotropic properties of measles virus. Images PMID:7309241

  7. White Paper on studying the safety of the childhood immunization schedule in the Vaccine Safety Datalink.

    PubMed

    Glanz, Jason M; Newcomer, Sophia R; Jackson, Michael L; Omer, Saad B; Bednarczyk, Robert A; Shoup, Jo Ann; DeStefano, Frank; Daley, Matthew F

    2016-02-15

    While the large majority of parents in the U.S. vaccinate their children according to the recommended immunization schedule, some parents have refused or delayed vaccinating, often citing safety concerns. In response to public concern, the U.S. Institute of Medicine (IOM) evaluated existing research regarding the safety of the recommended immunization schedule. The IOM concluded that although available evidence strongly supported the safety of the currently recommended schedule as a whole, additional observational research was warranted to compare health outcomes between fully vaccinated children and those on a delayed or alternative schedule. In addition, the IOM identified the Vaccine Safety Datalink (VSD) as an important resource for conducting this research. Guided by the IOM findings, the Centers for Disease Control and Prevention (CDC) commissioned a White Paper to assess how the VSD could be used to study the safety of the childhood immunization schedule. Guided by subject matter expert engagement, the resulting White Paper outlines a 4 stage approach for identifying exposure groups of undervaccinated children, presents a list of health outcomes of highest priority to examine in this context, and describes various study designs and statistical methods that could be used to analyze the safety of the schedule. While it appears feasible to study the safety of the recommended immunization schedule in settings such as the VSD, these studies will be inherently complex, and as with all observational studies, will need to carefully address issues of confounding and bias. In light of these considerations, decisions about conducting studies of the safety of the schedule will also need to assess epidemiological evidence of potential adverse events that could be related to the schedule, the biological plausibility of an association between an adverse event and the schedule, and public concern about the safety of the schedule.

  8. A double blind, randomized, active controlled study to assess the safety, tolerability and immunogenicity of measles, mumps rubella, and varicella vaccine (MMRV) manufactured using an alternative process.

    PubMed

    Marshall, Gary S; Senders, Shelly D; Shepard, Julie; Twiggs, Jerry D; Gardner, Julie; Hille, Darcy; Hartzel, Jonathan; Valenzuela, Rowan; Stek, Jon E; Helmond, Frans A

    2016-08-02

    Vaccination against measles, mumps, rubella, and varicella is recommended for all children in the US. Limitations manufacturing Oka/Merck strain varicella-zoster virus have hampered the availability of the combination vaccine (MMRV) against these 4 viruses, which drove the need to investigate an alternative manufacturing process. Healthy children 12-to-23 months of age at 71 US sites were randomized (1:1) to receive MMRV manufactured using an alternative process (MMRVAMP) or the currently licensed MMRV. Subjects received 2 0.5 mL doses 3 months apart. Sera were collected before and 6 weeks after Dose-1. Adverse experiences (AEs) were collected for 42 d after each dose and serious AEs and events of special interest for 180 d after Dose-2. Overall, 706 subjects were randomized to MMRVAMP and 706 to MMRV and 698 and 702 received at least 1 dose of study vaccine, respectively. The risk difference in response rates and geometric mean concentrations of antibody to measles, mumps, rubella, and varicella viruses 6 weeks after Dose-1 met non-inferiority criteria for MMRVAMP versus, MMRV. Response rates met acceptability criteria for each virus, and the seroconversion rate to varicella-zoster virus was 99.5% in both groups. Vaccine-related AEs were mostly mild-to-moderate in intensity and somewhat more common after MMRVAMP. Febrile seizures occurred at similar rates in both groups during the first 42 d after each vaccine dose. MMRVAMP is non-inferior to MMRV and represents an important advancement in maintaining an adequate supply of vaccines against these diseases.

  9. Does oral polio vaccine have non-specific effects on all-cause mortality? Natural experiments within a randomised controlled trial of early measles vaccine

    PubMed Central

    Aaby, Peter; Andersen, Andreas; Martins, Cesário L; Fisker, Ane B; Rodrigues, Amabelia; Whittle, Hilton C; Benn, Christine S

    2016-01-01

    Background BCG and measles vaccine (MV) may have beneficial non-specific effects (NSEs). If an unplanned intervention with a vaccine (a natural experiment) modifies the estimated effect in a randomised controlled trial (RCT), this suggests NSEs. We used this approach to test NSEs of triple oral polio vaccine (OPV). Methods During an RCT of 2 doses of MV at 4.5 and 9 months versus 1 dose of MV at 9 months of age, we experienced 2 natural experiments with OPV. We assessed whether these OPV experiments modified the effect of 2-dose MV in the MV trial. Setting MV RCT conducted in urban Guinea-Bissau 2003–2009. Interventions Natural experiments with OPV due to missing vaccine and the implementation of OPV campaigns. Main outcome measure Changes in the mortality rate ratio (MRR) for 2-dose MV versus 1-dose MV. Results First, the MRR (2-dose/1-dose MV) overall was 0.70 (0.52 to 0.94), but the MRR was 1.04 (0.53 to 2.04) when OPV at birth (OPV0) was not given, suggesting that early priming with OPV was important for the effect of 2-dose MV. The effect of OPV0 depended on age of administration; the MRR (2-dose/1-dose MV) was 0.45 (0.29 to 0.71) for children receiving OPV0 in the first week of life, but 3.63 (0.87 to 15.2) for those receiving OPV0 after the first month of life (p=0.007, test of no interaction). Second, campaign-OPV may have reduced the difference between the randomisation groups since the MRR (2-dose/1-dose MV) was 0.60 (0.42 to 0.85) for children who had not received campaign-OPV before RCT-enrolment versus 0.72 (0.23 to 2.31) and 1.42 (0.70 to 2.90) for children who had received 1 or 2 doses of campaign-OPV-before-enrolment, respectively. Conclusions Bissau had no polio infection during this trial, so OPV0 and campaign-OPV may have NSEs since they modified the effect of 2-dose MV in an RCT. Different interventions may interact to a much larger effect than usually assumed. PMID:28011813

  10. Measles: Make Sure Your Child Is Fully Immunized

    MedlinePlus

    ... your state VFC coordinator . To See If Your Child's Vaccine Is Due Check your child's vaccination record , Contact ... learn more about the VFC program, see the Vaccines for Children Program Q&As The Measles and Rubella Initiative ...

  11. Concomitant administration of hepatitis A vaccine with measles/mumps/rubella/varicella and pneumococcal vaccines in healthy 12- to 23-month-old children.

    PubMed

    Yetman, Robert J; Shepard, Julie S; Duke, Anton; Stek, Jon E; Petrecz, Maria; Klopfer, Stephanie O; Kuter, Barbara J; Schödel, Florian P; Lee, Andrew W

    2013-08-01

    This open-label, multicenter, randomized, comparative study evaluated immunogenicity, safety and tolerability of concomitant (Group 1; n=330) vs. non-concomitant (Group 2; n=323) VAQTA™ (25U/0.5 mL) (hepatitis A vaccine; HAV) with ProQuad™ (measles/mumps/rubella/varicella; MMRV) and Prevnar™ (7-valent pneumococcal; PCV-7) in healthy, 12-23 mo old children. Group 1 received HAV/MMRV/PCV-7 concomitantly on Day 1 and second doses of HAV/MMRV at Week 24. Group 2 received MMRV/PCV-7 on Day 1, HAV at Weeks 6 and 30 and MMRV at Week 34. Hepatitis A seropositivity rate (SPR: ≥10 mIU/mL; 4 weeks postdose 2), varicella zoster-virus (VZV) SPR (≥5 gpELISA units/mL) and geometric mean titers (GMT) to S. pneumoniae were examined. Injection-site and systemic adverse experiences (AEs) and daily temperatures were collected. Hepatitis A SPR were 100% for Group 1 and 99.4% for Group 2 after two HAV doses; risk difference=0.7 (95%CI: -1.4,3.8, non-inferior) regardless of initial serostatus. VZV SPR was 93.3% for Group 1 and 98.3% for Group 2; risk difference=-5.1 (95%CI: -9.3, -1.4; non-inferior). S. pneumoniae GMT fold-difference (7 serotypes) ranged from 0.9 to 1.1; non-inferior. No statistically significant differences in the incidence of individual AEs were seen when HAV was administered concomitantly vs. non-concomitantly. Three (all Group 2 post-administration of MMRV/PCV-7) of 11 serious AEs were considered possibly vaccine-related: dehydration and gastroenteritis (same subject) on Day 52; febrile seizure on Day 9. No deaths were reported. Antibody responses to each vaccine given concomitantly were non-inferior to HAV given non-concomitantly with MMRV and PCV-7. Administration of HAV with PCV-7 and MMRV had an acceptable safety profile in 12- to 23-mo-old children.

  12. Similar challenges but different responses: Media coverage of measles vaccination in the UK and China.

    PubMed

    Ren, Jie; Peters, Hans Peter; Allgaier, Joachim; Lo, Yin-Yueh

    2014-05-01

    For several decades scholars have studied media reporting on scientific issues that involve controversy. Most studies so far have focused on the western world. This article tries to broaden the perspective by considering China and comparing it to a western country. A content analysis of newspaper coverage of vaccination issues in the UK and China shows, first, that the government-supported 'mainstream position' dominates the Chinese coverage while the British media frequently refer to criticism and controversy. Second, scientific expertise in the British coverage is represented by experts from the health and science sector but by experts from health agencies in the Chinese coverage. These results are discussed with respect to implications for risk communication and scientists' involvement in public communication.

  13. [Education or constraint: measles vaccination in France during the belle époque].

    PubMed

    Murard, L; Zylberman, P

    1995-01-01

    The dreadful nature of the epidemic of 1870 explains why smallpox, not cholera, played a central role in the French public health regulations. And yet, France went it alone on the matter. The rules required isolation for the contagious sick and mandatory notification of the disease almost everywhere, nevertheless France relied only on persuasion. True, the public health law of 1902 provided the State with new weapons. But would such a mandatory decree be sufficient to awake popular opinion? There was no resistance to the law, like in England or Germany. However, the new regulations took several decades to be enforced, if only because of the poor state of the sanitary administration. Smallpox vaccination was eventually implemented when the authorities discovered that proximity and easier accessibility to services and facilities are of primary importance for patients.

  14. [Criteria for including vaccines in the immunization schedule of the Spanish Association of Pediatrics].

    PubMed

    Bernaola Iturbe, E; Giménez Sánchez, F; Baca Cots, M; de Juan Martín, F; Díez Domingo, J; Garcés Sánchez, M; Gómez-Campderá, A; Martinón Torres, F; Picazo, J J; Pineda Solás, V

    2008-01-01

    The Vaccine Advisory Committee of the Spanish Association of Pediatrics analyzes and discusses the criteria followed when preparing their yearly Recommended Immunization Schedule for children and adolescents. The relative importance of each criterion in the final recommendation is assessed. Following a review of the current state of affairs of childhood immunization in Spain and of the crucial role played by pediatricians, some reflections are presented on the problems derived from the vaccines recommended by this Committee but not covered by the national health system. Suggestions are made for individual pediatricians who may need to establish specific priorities in the recommendation of these vaccines.

  15. High Concentrations of Measles Neutralizing Antibodies and High-Avidity Measles IgG Accurately Identify Measles Reinfection Cases

    PubMed Central

    Rota, Jennifer S.; Hickman, Carole J.; Mercader, Sara; Redd, Susan; McNall, Rebecca J.; Williams, Nobia; McGrew, Marcia; Walls, M. Laura; Rota, Paul A.; Bellini, William J.

    2016-01-01

    In the United States, approximately 9% of the measles cases reported from 2012 to 2014 occurred in vaccinated individuals. Laboratory confirmation of measles in vaccinated individuals is challenging since IgM assays can give inconclusive results. Although a positive reverse transcription (RT)-PCR assay result from an appropriately timed specimen can provide confirmation, negative results may not rule out a highly suspicious case. Detection of high-avidity measles IgG in serum samples provides laboratory evidence of a past immunologic response to measles from natural infection or immunization. High concentrations of measles neutralizing antibody have been observed by plaque reduction neutralization (PRN) assays among confirmed measles cases with high-avidity IgG, referred to here as reinfection cases (RICs). In this study, we evaluated the utility of measuring levels of measles neutralizing antibody to distinguish RICs from noncases by receiver operating characteristic curve analysis. Single and paired serum samples with high-avidity measles IgG from suspected measles cases submitted to the CDC for routine surveillance were used for the analysis. The RICs were confirmed by a 4-fold rise in PRN titer or by RT-quantitative PCR (RT-qPCR) assay, while the noncases were negative by both assays. Discrimination accuracy was high with serum samples collected ≥3 days after rash onset (area under the curve, 0.953; 95% confidence interval [CI], 0.854 to 0.993). Measles neutralizing antibody concentrations of ≥40,000 mIU/ml identified RICs with 90% sensitivity (95% CI, 74 to 98%) and 100% specificity (95% CI, 82 to 100%). Therefore, when serological or RT-qPCR results are unavailable or inconclusive, suspected measles cases with high-avidity measles IgG can be confirmed as RICs by measles neutralizing antibody concentrations of ≥40,000 mIU/ml. PMID:27335386

  16. Varicella (Chickenpox) Vaccine

    MedlinePlus

    ProQuad® (as a combination product containing Measles Vaccine, Mumps Vaccine, Rubella Vaccine, Varicella Vaccine) ... up to about 1 person in 5) and measles-like rash (about 1 person in 20) than MMR and varicella vaccines given separately. Moderate Problems:Seizure (jerking or staring) ...

  17. Vaxfectin adjuvant improves antibody responses of juvenile rhesus macaques to a DNA vaccine encoding the measles virus hemagglutinin and fusion proteins.

    PubMed

    Lin, Wen-Hsuan W; Vilalta, Adrian; Adams, Robert J; Rolland, Alain; Sullivan, Sean M; Griffin, Diane E

    2013-06-01

    DNA vaccines formulated with the cationic lipid-based adjuvant Vaxfectin induce protective immunity in macaques after intradermal (i.d.) or intramuscular (i.m.) delivery of 0.5 to 1 mg of codon-optimized DNA encoding the hemagglutinin (H) and fusion (F) proteins of measles virus (MeV). To characterize the effect of Vaxfectin at lower doses of H+F DNA, rhesus macaques were vaccinated twice with 20 μg of DNA plus Vaxfectin i.d., 100 μg of DNA plus Vaxfectin i.d., 100 μg of DNA plus Vaxfectin i.m. or 100 μg of DNA plus phosphate-buffered saline (PBS) i.m. using a needleless Biojector device. The levels of neutralizing (P = 0.036) and binding (P = 0.0001) antibodies were higher after 20 or 100 μg of DNA plus Vaxfectin than after 100 μg of DNA plus PBS. Gamma interferon (IFN-γ)-producing T cells were induced more rapidly than antibody, but were not improved with Vaxfectin. At 18 months after vaccination, monkeys were challenged with wild-type MeV. None developed rash or viremia, but all showed evidence of infection. Antibody levels increased, and IFN-γ- and interleukin-17-producing T cells, including cells specific for the nucleoprotein absent from the vaccine, were induced. At 3 months after challenge, MeV RNA was detected in the leukocytes of two monkeys. The levels of antibody peaked 2 to 4 weeks after challenge and then declined in vaccinated animals reflecting low numbers of bone marrow-resident plasma cells. Therefore, Vaxfectin was dose sparing and substantially improved the antibody response to the H+F DNA vaccine. This immune response led to protection from disease (rash/viremia) but not from infection. Antibody responses after challenge were more transient in vaccinated animals than in an unvaccinated animal.

  18. Determinants of European parents' decision on the vaccination of their children against measles, mumps and rubella: A systematic review and meta-analysis

    PubMed Central

    Tabacchi, Garden; Costantino, Claudio; Napoli, Giuseppe; Marchese, Valentina; Cracchiolo, Manuela; Casuccio, Alessandra; Vitale, Francesco; on behalf of the ESCULAPIO working group

    2016-01-01

    ABSTRACT Low measles, mumps and rubella (MMR) immunization levels in European children highlight the importance of identifying determinants of parental vaccine uptake to implement policies for increasing vaccine compliance. The aim of this paper is to identify the main factors associated with partial and full MMR vaccination uptake in European parents, and combine the different studies to obtain overall quantitative measures. This activity is included within the ESCULAPIO project, funded by the Italian Ministry of Health. ORs and CIs were extracted, sources of heterogeneity explored and publication bias assessed. Forty-five papers were retrieved for the qualitative study, 26 of which were included in the meta-analysis. The following factors were associated with lower MMR vaccine uptake: misleading knowledge, beliefs and perceptions on vaccines (OR 0.57, CI 0.37-0.87); negative attitudes and behaviors toward vaccination (OR 0.71, CI 0.52-0.98); demographic characteristics, such as different ethnicity in Southern populations (OR 0.44, CI 0.31-0.61), higher child's age (OR 0.80, CI 0.76-0.85); low socio-economic status (OR 0.64, CI 0.51-0.80), especially low income (OR 0.39, CI 0.25-0.60) and education (OR 0.64, CI 0.48-0.84), high number of children (OR 0.54, CI 0.42-0.69), irregular marital status (OR 0.80, CI 0.66-0.96). The factors explaining heterogeneity were country location, administration modality, collection setting and responses reported on MMR alone or in combination. Findings from this study suggest policy makers to focus communication strategies on providing better knowledge, correct beliefs and perceptions on vaccines, and improving attitudes and behaviors in parents; and to target policies to people of ethnic minority from Southern Europe, low educated and deprived, with higher number of children and non-married marital status. PMID:27163657

  19. The successful induction of T-cell and antibody responses by a recombinant measles virus-vectored tetravalent dengue vaccine provides partial protection against dengue-2 infection

    PubMed Central

    Hu, Hui-Mei; Chen, Hsin-Wei; Hsiao, Yu-Ju; Wu, Szu-Hsien; Chung, Han-Hsuan; Hsieh, Chun-Hsiang; Chong, Pele; Leng, Chih-Hsiang; Pan, Chien-Hsiung

    2016-01-01

    ABSTRACT Dengue has a major impact on global public health, and the use of dengue vaccine is very limited. In this study, we evaluated the immunogenicity and protective efficacy of a dengue vaccine made from a recombinant measles virus (MV) that expresses envelope protein domain III (ED3) of dengue-1 to 4. Following immunization with the MV-vectored dengue vaccine, mice developed specific interferon-gamma and antibody responses against dengue virus and MV. Neutralizing antibodies against MV and dengue viruses were also induced, and protective levels of FRNT50 ≥ 10 to 4 serotypes of dengue viruses were detected in the MV-vectored dengue vaccine-immunized mice. In addition, specific interferon-gamma and antibody responses to dengue viruses were still induced by the MV-vectored dengue vaccine in mice that were pre-infected with MV. This finding suggests that the pre-existing immunity to MV did not block the initiation of immune responses. By contrast, mice that were pre-infected with dengue-3 exhibited no effect in terms of their antibody responses to MV and dengue viruses, but a dominant dengue-3-specific T-cell response was observed. After injection with dengue-2, a detectable but significantly lower viremia and a higher titer of anti-dengue-2 neutralizing antibodies were observed in MV-vectored dengue vaccine-immunized mice versus the vector control, suggesting that an anamnestic antibody response that provided partial protection against dengue-2 was elicited. Our results with regard to T-cell responses and the effect of pre-immunity to MV or dengue viruses provide clues for the future applications of an MV-vectored dengue vaccine. PMID:26901482

  20. Current status of measles in Japan.

    PubMed

    Nakayama, Tetsuo; Zhou, Jianhui; Fujino, Motoko

    2003-03-01

    Approximately 20,000 to 30,000 cases of measles are reported annually in Japan, although the actual number of measles infections is considered to be five to ten times higher than the number of reported cases. Despite the availability of effective and safe live attenuated vaccines, regional outbreaks in Okinawa, transmission in adults, and secondary vaccine failures continue. Recent advances in molecular technology have contributed to molecular epidemiological studies, new concepts of asymptomatic infection, and the identification of different characteristics among measles virus genotypes. Measles virus strains isolated in Japan since 1984 were classified into the genotypes C1 (-1985), D3 (1985-1990), D5 (1990-1997), and Chicago-type D3 (1997-1999) from the results of sequencing the hemagglutinin gene. After 2000, the D5 genotype emerged, and, recently, the H1 genotype, which is now dominant, was introduced from Korea. Some of the currently circulating wild-types have different characteristics (high growth rate at 39 degrees C-40 degrees C). The cumulative vaccine coverage has reached 81%, but most measles cases involved unvaccinated individuals. Measles is a preventable disease and can be eradicated by increasing the vaccine coverage, and promoting the motivation for vaccination, in accordance with the worldwide measles strategy.

  1. Nonspecific effects of vaccines and the reduction of mortality in children.

    PubMed

    Shann, Frank

    2013-02-01

    There is now strong evidence that vaccines have substantial nonspecific (heterologous) effects in children in high-mortality regions. The hypothesis states that, until a different vaccine is given: (1) live vaccines induce a protective nonspecific immune response, whereas inactivate vaccines cause a harmful nonspecific immune response; (2) Bacillus Calmette-Guerin (BCG) vaccine approximately halves mortality from infections other than tuberculosis; (3) provided vitamin A was not given at birth, measles vaccine approximately halves mortality from infections other than measles (this effect may be stronger if the child still has maternal antibody); and (4) whole-cell diphtheria-tetanus-pertussis (DTP) vaccine increases mortality from infections other than diphtheria, tetanus, and pertussis (this effect is stronger in girls than boys). These observations suggest that minor modifications to the routine immunization schedule could reduce child mortality by at least 30%, and they have important implications for the design of randomized trials of vaccines in high-mortality regions.

  2. Wild-Type Measles Virus with the Hemagglutinin Protein of the Edmonston Vaccine Strain Retains Wild-Type Tropism in Macaques

    PubMed Central

    Nagata, Noriyo; Kato, Sei-ich; Ami, Yasushi; Suzaki, Yuriko; Suzuki, Tadaki; Sato, Yuko; Tsunetsugu-Yokota, Yasuko; Mori, Kazuyasu; Van Nguyen, Nguyen; Kimura, Hideki; Nagata, Kyosuke

    2012-01-01

    A major difference between vaccine and wild-type strains of measles virus (MV) in vitro is the wider cell specificity of vaccine strains, resulting from the receptor usage of the hemagglutinin (H) protein. Wild-type H proteins recognize the signaling lymphocyte activation molecule (SLAM) (CD150), which is expressed on certain cells of the immune system, whereas vaccine H proteins recognize CD46, which is ubiquitously expressed on all nucleated human and monkey cells, in addition to SLAM. To examine the effect of the H protein on the tropism and attenuation of MV, we generated enhanced green fluorescent protein (EGFP)-expressing recombinant wild-type MV strains bearing the Edmonston vaccine H protein (MV-EdH) and compared them to EGFP-expressing wild-type MV strains. In vitro, MV-EdH replicated in SLAM+ as well as CD46+ cells, including primary cell cultures from cynomolgus monkey tissues, whereas the wild-type MV replicated only in SLAM+ cells. However, in macaques, both wild-type MV and MV-EdH strains infected lymphoid and respiratory organs, and widespread infection of MV-EdH was not observed. Flow cytometric analysis indicated that SLAM+ lymphocyte cells were infected preferentially with both strains. Interestingly, EGFP expression of MV-EdH in tissues and lymphocytes was significantly weaker than that of the wild-type MV. Taken together, these results indicate that the CD46-binding activity of the vaccine H protein is important for determining the cell specificity of MV in vitro but not the tropism in vivo. They also suggest that the vaccine H protein attenuates MV growth in vivo. PMID:22238320

  3. Status of New Vaccine Introduction - Worldwide, September 2016.

    PubMed

    Loharikar, Anagha; Dumolard, Laure; Chu, Susan; Hyde, Terri; Goodman, Tracey; Mantel, Carsten

    2016-10-21

    Since the global Expanded Program on Immunization (EPI) was launched in 1974, vaccination against six diseases (tuberculosis, polio, diphtheria, tetanus, pertussis, and measles) has prevented millions of deaths and disabilities (1). Significant advances have been made in the development and introduction of vaccines, and licensed vaccines are now available to prevent 25 diseases (2,3). Historically, new vaccines only became available in low-income and middle-income countries decades after being introduced in high-income countries. However, with the support of global partners, including the World Health Organization (WHO) and the United Nations Children's Fund, which assist with vaccine prequalification and procurement, as well as Gavi, the Vaccine Alliance (Gavi) (4), which provides funding and shapes vaccine markets through forecasting and assurances of demand in low-income countries in exchange for lower vaccine prices, vaccines are now introduced more rapidly. Based on data compiled in the WHO Immunization Vaccines and Biologicals Database* (5), this report describes the current status of introduction of Haemophilus influenzae type b (Hib), hepatitis B, pneumococcal conjugate, rotavirus, human papillomavirus, and rubella vaccines, and the second dose of measles vaccine. As of September 2016, a total of 191 (99%) of 194 WHO member countries had introduced Hib vaccine, 190 (98%) had introduced hepatitis B vaccine, 132 (68%) had introduced pneumococcal conjugate vaccine (PCV), and 86 (44%) had introduced rotavirus vaccine into infant vaccination schedules. Human papillomavirus vaccine (HPV) had been introduced in 67 (35%) countries, primarily targeted for routine use in adolescent girls. A second dose of measles-containing vaccine (MCV2) had been introduced in 161 (83%) countries, and rubella vaccine had been introduced in 149 (77%). These efforts support the commitment outlined in the Global Vaccine Action Plan (GVAP), 2011-2020 (2), endorsed by the World Health

  4. Persistence of antibodies in 4-8 year old Austrian children after vaccination with hexavalent DTaP-HBV-IPV/Hib and MMR vaccines.

    PubMed

    Paulke-Korinek, Maria; Fischmeister, Gustav; Grac, Ana; Rendi-Wagner, Pamela; Kundi, Michael; Mohsenzadeh-Rabbani, Afsaneh; Moritz, Katharina; Fenninger, Beate; Jarisch, Reinhart; Jasinska, Joanna; Holzmann, Heidemarie; Wiedermann, Ursula; Kollaritsch, Herwig

    2011-07-18

    To determine the proficiency of the Austrian childhood vaccination schedule to induce long lasting seroprotection against vaccine preventable diseases a seroepidemiological study in 348 children between four and eight years of age was conducted. Antibodies against diphtheria, tetanus, pertussis, hepatitis B, measles, mumps and rubella antigens were assessed in children, who had been vaccinated with hexavalent DTaP-HBV-IPV/Hib vaccines at three, four, five months and in the second year of life and/or MMR vaccines in the second year of life at least once, but mostly twice. High seroprotection rates (SPRs) were detected for tetanus (96%) and measles (90%). SPRs regarding diphtheria and mumps were 81% and 72%, respectively. Rubella-SPRs were 68% in females and 58% in males. Hepatitis B-antibody levels ≥10 mIU/mL were present in 52%; antibodies against pertussis were detected in 27% of the children. SPRs for measles and rubella depended on the interval since last vaccination; mumps-antibodies were significantly lower after one MMR-vaccination only. Antibodies against diphtheria, tetanus and pertussis depended on the interval since last vaccination while HBs-antibodies did not. The low levels of antibodies 1-7 years after vaccination against pertussis, rubella and mumps after only one vaccination should be considered when recommending new vaccination schedules.

  5. Determination of the immunization schedule for field trials with the synthetic malaria vaccine SPf 66.

    PubMed

    Rocha, C L; Murillo, L A; Mora, A L; Rojas, M; Franco, L; Cote, J; Valero, M V; Moreno, A; Amador, R; Nuñez, F

    1992-01-01

    The synthetic malaria vaccine SPf 66 has been shown to be safe, immunogenic and effective in trials performed with controlled groups naturally and experimentally exposed to the disease. In order to continue the trials in open populations, it was necessary to standardize the vaccination characteristics. We have performed four field trials with soldier volunteers with the aim, among others, of defining the number of doses required, the intervals between applications, the protein concentration, and the adjuvant to be used. In these trials, the vaccinated individuals' immune responses were evaluated by assaying anti-SPf 66 antibody titres, in vitro growth inhibition of the P. falciparum parasite, and the vaccinees' capacity to recognize P. falciparum native proteins. From these results we conclude that the best vaccination schedule, for adults, is three doses administered subcutaneously on days 0, 30 and 180, each containing 2 mg of the synthetic polymerized petide SPf 66 adsorbed to alum hydroxide.

  6. Impact of a measles immunisation campaign on measles admissions to a Natal hospital.

    PubMed

    Abdool Karim, S S; Abdool Karim, Q; Chamane, M

    1991-12-07

    During May and June 1990, a national mass measles immunisation campaign was undertaken in South Africa. This study is an assessment of the impact of the campaign on measles admissions to a provincial referral hospital that has specifically designated wards for children with communicable diseases. Data from the measles ward admissions book for the 18 months before the campaign (1 January 1989-30 June 1990) and 6 months after the campaign (1 July 1990-31 December 1990) were compared. Since the campaign, the average number of measles admissions has declined by 64.4% from 87 to 31 per month (P less than 0.01). Before the campaign, 21.3% of measles patients admitted were aged 7-9 months compared with 27.6% after the campaign, highlighting the urgent need to improve the measles vaccination coverage in this age group. An analysis of the geographical source of patients showed that measles continued to occur after the campaign in most of the areas where it existed before the campaign. It is concluded that important gains have been achieved by the campaign. These will be rapidly eroded and epidemics of measles may occur if measles vaccination efforts wane and slump back to pre-campaign levels. It is important to capitalise on the momentum generated through the campaign by continuing to support efforts of existing health care services to improve and maintain high levels of measles immunisation coverage.

  7. Retrospective measles outbreak investigation: Sudan, 2004.

    PubMed

    Coronado, Fátima; Musa, Nisreen; El Tayeb, El Sayed Ahmed; Haithami, Salah; Dabbagh, Alya; Mahoney, Frank; Nandy, Robin; Cairns, Lisa

    2006-10-01

    Recent population-based studies of measles incidence and deaths in Sudan are not available. To determine the epidemiology and case-fatality rate (CFR) of measles, we conducted a retrospective outbreak investigation in two states in northern Sudan. Of 1144 case-patients identified, 92% were <15 years; 48.6% were vaccinated; and 62% received vitamin A before illness. Ten measles-associated deaths were identified (CFR 0.9%; 95% confidence interval 0.16-1.91). CFR determined by this investigation is lower than expected for the region but remains 10 times higher than that in developed countries. Measles control should be strengthened by improving vaccine coverage, measles surveillance and case-management.

  8. Vaccination coverage in French 17-year-old young adults: an assessment of mandatory and recommended vaccination statuses.

    PubMed

    Roblot, F; Robin, S; Chubilleau, C; Giraud, J; Bouffard, B; Ingrand, P

    2016-02-01

    We aimed to assess vaccination coverage (VC) in 17-year-old French young adults (YAs) participating in one mandatory Day of Defence and Citizenship (DDC). Between June 2010 and May 2011, YAs participating in 43 randomly selected mandatory sessions of the DDC programme in Poitou-Charentes (France) were asked to provide their personal vaccination record. Tetanus, diphtheria, polio, hepatitis B, Haemophilus influenzae b, pertussis, measles, mumps and rubella vaccination status were assessed at ages 2, 6, 13 and 17 years. Of 2610 participants, 2111 (81%) supplied documents for evaluation. Of these, 1838 (87%, M:F sex ratio 0·96) were aged 17 years (9% of the global population of this age in the area). The assessment of the 17-year-olds demonstrated the following rates of complete vaccination: diphtheria-tetanus-polio 83%; measles, mumps and rubella 83%; pertussis 69%; H. influenzae b 61%; human papillomavirus 47%; and hepatitis B 40%. At age 6 years, only 46% had received two doses of the vaccine against measles. The YAs were not aware of their status but were in favour of vaccination. VC in YAs is insufficient, particularly for hepatitis B, pertussis and measles. Combined vaccines and the simplification of vaccination schedules should improve VC. Preventive messages should focus on YAs.

  9. Vaccine schedule compliance among very low birth weight infants in Lima, Peru

    PubMed Central

    Ochoa, Theresa J; Zea-Vera, Alonso; Bautista, Rossana; Davila, Carmen; Salazar, José Antonio; Bazán, Carlos; López, Luis; Ecker, Lucie

    2015-01-01

    Objective There is little information about vaccine schedule compliance in very-low-birth-weight infants in developing countries. The aim of the study was to describe the compliance with the vaccine schedule among this population in Lima, Peru. Patients and Methods We conducted a prospective cohort study in four hospitals in Lima in infants with a birth-weight of less than 1500g, followed from birth up to 12 months of age every 2 weeks. The date and age at administration of each vacccine was recorded. Results 222 infants were enrolled. The median birth-weight was 1,250g (range 550-1,499g) and the median gestational age was 30.0 weeks (range 23-37 weeks). The mean age for the first pentavalent (DPT, Hib, HepB) and oral polio vaccine administration was 4.3 ± 1.4 months in infants with a birth-weight of <1000g vs. 3.1 ± 1.0 in infants with a birth-weight 1000- 1500g (p<0.001); 4.1 ± 0.9 vs. 3.3 ± 1.1 for rotavirus (p<0.05); and 5.1 ± 2.1 vs. 4.3 ± 1.8 for the 7-valent pneumococcal conjugated vaccine. Only 35% had received the three doses of oral polio and pentavalent vaccine by seven months, although by nine months 81% had received these vaccines. Conclusions Vaccination of very-low-birth-weight infants in Peru is significantly delayed, especially in infants with a birth-weight of <1000g. Urgent educational interventions targeting physicians and nurses should be implemented in order to improve vaccination rates and timing in these high risk populations. PMID:25448091

  10. A Randomized Trial of an Early Measles Vaccine at 4½ Months of Age in Guinea-Bissau: Sex-Differential Immunological Effects

    PubMed Central

    Andersen, Andreas; Sartono, Erliyani; Martins, Cesario; Garly, May-Lill; Eugen-Olsen, Jesper; Ullum, Henrik; Yazdanbakhsh, Maria; Aaby, Peter; Benn, Christine Stabell; Erikstrup, Christian

    2014-01-01

    Background After measles vaccine (MV), all-cause mortality is reduced more than can be explained by the prevention of measles, especially in females. Objective We aimed to study the biological mechanisms underlying the observed non-specific and sex-differential effects of MV on mortality. Methods Within a large randomised trial of MV at 4.5 months of age blood samples were obtained before and six weeks after randomisation to early MV or no early MV. We measured concentrations of cytokines and soluble receptors from plasma (interleukin-1 receptor agonist (IL-1Ra), IL-6, IL-8, IL-10, tumor necrosis factor (TNF)-α, monocyte chemoattractant protein (MCP)-1, soluble urokinase-type plasminogen activator receptor), and secreted cytokines (interferon-γ, TNF-α, IL-5, IL-10, IL-13, IL-17) after in vitro challenge with innate agonists and recall antigens. We analysed the effect of MV in multiple imputation regression, overall and stratified by sex. The majority of the infants had previously been enrolled in a randomised trial of neonatal vitamin A. Post hoc we explored the potential effect modification by neonatal vitamin A. Results Overall, MV versus no MV was associated with higher plasma MCP-1 levels, but the effect was only significant among females. Additionally, MV was associated with increased plasma IL-1Ra. MV had significantly positive effects on plasma IL-1Ra and IL-8 levels in females, but not in males. These effects were strongest in vitamin A supplemented infants. Vitamin A shifted the effect of MV in a pro-inflammatory direction. Conclusions In this explorative study we found indications of sex-differential effects of MV on several of the plasma biomarkers investigated; in particular MV increased levels in females, most strongly in vitamin A recipients. The findings support that sex and micronutrient supplementation should be taken into account when analysing vaccine effects. Trial Registration clinicaltrials.gov number NCT 00168545 PMID:24835247

  11. Vaccination in elite athletes.

    PubMed

    Gärtner, Barbara C; Meyer, Tim

    2014-10-01

    Public health vaccination guidelines cannot be easily transferred to elite athletes. An enhanced benefit from preventing even mild diseases is obvious but stronger interference from otherwise minor side effects has to be considered as well. Thus, special vaccination guidelines for adult elite athletes are required. In most of them, protection should be strived for against tetanus, diphtheria, pertussis, influenza, hepatitis A, hepatitis B, measles, mumps and varicella. When living or traveling to endemic areas, the athletes should be immune against tick-borne encephalitis, yellow fever, Japanese encephalitis, poliomyelitis, typhoid fever, and meningococcal disease. Vaccination against pneumococci and Haemophilus influenzae type b is only relevant in athletes with certain underlying disorders. Rubella and papillomavirus vaccination might be considered after an individual risk-benefit analysis. Other vaccinations such as cholera, rabies, herpes zoster, and Bacille Calmette-Guérin (BCG) cannot be universally recommended for athletes at present. Only for a very few diseases, a determination of antibody titers is reasonable to avoid unnecessary vaccinations or to control efficacy of an individual's vaccination (especially for measles, mumps, rubella, varicella, hepatitis B and, partly, hepatitis A). Vaccinations should be scheduled in a way that possible side effects are least likely to occur in periods of competition. Typically, vaccinations are well tolerated by elite athletes, and resulting antibody titers are not different from the general population. Side effects might be reduced by an optimal selection of vaccines and an appropriate technique of administration. Very few discipline-specific considerations apply to an athlete's vaccination schedule mainly from the competition and training pattern as well as from the typical geographical distribution of competitive sites.

  12. Seroepidemiology of mumps in the general population of Jiangsu province, China after introduction of a one-dose measles-mumps-rubella vaccine.

    PubMed

    Liu, Yuanbao; Hu, Ying; Deng, Xiuying; Wang, Zhiguo; Lu, Peishan; Ma, Fubao; Zhou, Minghao; Liu, Pei; Min, Jie

    2015-10-01

    The mumps surveillance data from 2004 to 2011 showed that the incidence of mumps remained high after the one-dose measles-mumps-rubella (MMR) vaccine was introduced in China in 2008. A cross-sectional survey of mumps IgG in the general population of Jiangsu province was conducted in 2012 to gain comprehensive information on the immunity profile of the general population. The mean incidence was 15.2 per 100 000 individuals in Jiangsu province from 2004-2013. Two mumps incidence peaks were observed each year after introduction of the one-dose MMR vaccine. The seroprevalence did not significantly differ by region or sex, while the GMC significantly differed by region and sex. The overall GMC in Jiangsu province was 99.1 IU/ml (95% CI: 90.1-108.2), while the seroprevalence was only 59.1% (95% CI: 56.5-61.6). The seroprevalences for the 2 age groups that received the one-dose MMR vaccine, with reported coverage exceeding 95%, were 42.6% and 70.0%, respectively. The data on the incidence, MMR coverage, and seroprevalence in children younger than 6 years of age indicate that a two-dose MMR strategy should be considered. Mumps surveillance should be strengthened in children aged 6-11 and in those aged 12-17 because of their high contact rates and relatively low seroprevalences.

  13. Eradication of measles: remaining challenges.

    PubMed

    Holzmann, Heidemarie; Hengel, Hartmut; Tenbusch, Matthias; Doerr, H W

    2016-06-01

    Measles virus (MeV) is an aerosol-borne and one of the most contagious pathogenic viruses known. Almost every MeV infection becomes clinically manifest and can lead to serious and even fatal complications, especially under conditions of malnutrition in developing countries, where still 115,000 to 160,000 patients die from measles every year. There is no specific antiviral treatment. In addition, MeV infections cause long-lasting memory B and T cell impairment, predisposing people susceptible to opportunistic infections for years. A rare, but fatal long-term consequence of measles is subacute sclerosing panencephalitis. Fifteen years ago (2001), WHO has launched a programme to eliminate measles by a worldwide vaccination strategy. This is promising, because MeV is a human-specific morbillivirus (i.e. without relevant animal reservoir), safe and potent vaccine viruses are sufficiently produced since decades for common application, and millions of vaccine doses have been used globally without any indications of safety and efficacy issues. Though the prevalence of wild-type MeV infection has decreased by >90 % in Europe, measles is still not eliminated and has even re-emerged with recurrent outbreaks in developed countries, in which effective vaccination programmes had been installed for decades. Here, we discuss the crucial factors for a worldwide elimination of MeV: (1) efficacy of current vaccines, (2) the extremely high contagiosity of MeV demanding a >95 % vaccination rate based on two doses to avoid primary vaccine failure as well as the installation of catch-up vaccination programmes to fill immunity gaps and to achieve herd immunity, (3) the implications of sporadic cases of secondary vaccine failure, (4) organisation, acceptance and drawbacks of modern vaccination campaigns, (5) waning public attention to measles, but increasing concerns from vaccine-associated adverse reactions in societies with high socio-economic standards and (6) clinical

  14. Progress Toward Regional Measles Elimination - Worldwide, 2000-2015.

    PubMed

    Patel, Minal K; Gacic-Dobo, Marta; Strebel, Peter M; Dabbagh, Alya; Mulders, Mick N; Okwo-Bele, Jean-Marie; Dumolard, Laure; Rota, Paul A; Kretsinger, Katrina; Goodson, James L

    2016-11-11

    Adopted in 2000, United Nations Millennium Development Goal 4 set a target to reduce child mortality by two thirds by 2015, with measles vaccination coverage as one of the progress indicators. In 2010, the World Health Assembly (WHA) set three milestones for measles control by 2015: 1) increase routine coverage with the first dose of measles-containing vaccine (MCV1) for children aged 1 year to ≥90% nationally and ≥80% in every district; 2) reduce global annual measles incidence to <5 cases per 1 million population; and 3) reduce global measles mortality by 95% from the 2000 estimate (1,2).* In 2012, WHA endorsed the Global Vaccine Action Plan(†) with the objective to eliminate measles in four World Health Organization (WHO) regions by 2015. Countries in all six WHO regions have adopted measles elimination goals. Measles elimination is the absence of endemic measles transmission in a region or other defined geographical area for ≥12 months in the presence of a well performing surveillance system. This report updates a previous report (3) and describes progress toward global measles control milestones and regional measles elimination goals during 2000-2015. During this period, annual reported measles incidence decreased 75%, from 146 to 36 cases per 1 million persons, and annual estimated measles deaths decreased 79%, from 651,600 to 134,200. However, none of the 2015 milestones or elimination goals were met. Countries and their partners need to act urgently to secure political commitment, raise the visibility of measles, increase vaccination coverage, strengthen surveillance, and mitigate the threat of decreasing resources for immunization once polio eradication is achieved.

  15. Comparative immunogenicity of two vaccination schedules of a combined hepatitis A and B vaccine in healthy volunteers.

    PubMed

    De Schryver, A; Verstrepen, K; Vandersmissen, L; Vandermeeren, N; Vernaillen, I; Vranckx, R; Van Damme, P; van Sprundel, M

    2011-04-01

    In 1996, a combined vaccine against both hepatitis A and B was licensed and commercialized and has been recommended for healthcare personnel in Belgium. This study compares the immunogenicity against hepatitis B virus (HBV) and safety of two vaccination schedules (0-1-12 months and 0-1-6 months) with this vaccine. This is a randomized, stratified and controlled study in healthy adult workers, who are not occupationally exposed to HBV. Seroconversion (≥1 IU/L) and seroprotection (≥10 IU/L) rates were compared using Fisher's exact test; geometric mean concentrations (GMCs) of anti-HBs were compared using one-way ANOVA. All statistical analyses were carried out with SPSS 11 on Apple Macintosh. A total of 399 subjects were enrolled in the study, and 356 were analysed according to the protocol. The rate of ≥10 IU/L at 6 months was 70.6% in the group 0-1-12 and 79.9% in the group 0-1-6; this rate decreased to 55.9% at 12 months in the first group. Seroconversion and seroprotective rates against HBV measured at month 13 in group 0-1-12 (98.9% and 95.6%) and measured at month 7 in group 0-1-6 (99.4% and 97.1%) were not statistically significantly different. GMC of anti-HBs after the 0-1-12 schedule was more than two fold higher than after 0-1-6 schedule (P < 0.001). Reported side effects were comparable in both groups with a slight tendency to fewer side effects in the 0-1-12 group after the third dose. The results from our study show that the completed schedule 0-1-12 offers at least equal protective immunogenicity against HBV as the completed 0-1-6 schedule. People not receiving their third dose at 6 months can be given this dose up to 12 months after the first dose. The drawback of this flexibility, however, is the longer time period before the protection becomes effective.

  16. Rubella: Make Sure Your Child Gets Vaccinated

    MedlinePlus

    ... called MMR, which protects against three diseases: measles, mumps, and rubella. MMR vaccine is safe and effective ... MMRV vaccine, which protects against four diseases: measles, mumps, rubella, and varicella (chickenpox). Talk to your child's ...

  17. Epidemiology of two large measles virus outbreaks in Catalonia

    PubMed Central

    Torner, Núria; Anton, Andres; Barrabeig, Irene; Lafuente, Sara; Parron, Ignasi; Arias, César; Camps, Neus; Costa, Josep; Martínez, Ana; Torra, Roser; Godoy, Pere; Minguell, Sofia; Ferrús, Glòria; Cabezas, Carmen; Domínguez, Ángela; Elimination Program Surveillance Network of Spain, the Measles

    2013-01-01

    Measles cases in the European Region have been increasing in the last decade; this illustrates the challenge of what we are now encountering in the form of pediatric preventable diseases. In Catalonia, autochthonous measles was declared eliminated in the year 2000 as the result of high measles-mumps-rubella vaccine (MMR) coverage for first and second dose (15 mo and 4 y) since the mid-1990s. From then on, sporadic imported cases and small outbreaks appeared, until in 2006–2007 a large measles outbreak affecting mostly unvaccinated toddlers hit the Barcelona Health Region. Consequently, in January 2008, first dose administration of MMR was lowered from 15 to 12 mo of age. A new honeymoon period went by until the end of 2010, when several importations of cases triggered new sustained transmission of different wild measles virus genotypes, but this time striking young adults. The aim of this study is to show the effect of a change in MMR vaccination schedule policy, and the difference in age incidence and hospitalization rates of affected individuals between both outbreaks. Epidemiologic data were obtained by case interviews and review of medical records. Samples for virological confirmation and genotyping of cases were collected as established in the Measles Elimination plan guidelines. Incidence rate (IR), rate ratio (RR) and their 95% CI and hospitalization rate (HR) by age group were determined. Statistic z was used for comparing proportions. Total number of confirmed cases was 305 in the 2010 outbreak and 381 in the 2006–2007 outbreak; mean age 20 y (SD 14.8 y; 3 mo to 51 y) vs. 15 mo (SD 13.1 y; 1 mo to 50 y). Highest proportion of cases was set in ≥ 25 y (47%) vs. 24.2% in 2006 (p < 0.001). Differences in IR for ≤ 15 mo (49/100,000 vs. 278.2/100,000; RR: 3,9; 95%CI 2,9–5.4) and in overall HR 29.8% vs. 15.7% were all statistically significant (p < 0.001). The change of the month of age for the administration of the first MMR dose proved successful to

  18. Immune response to the HPV-16/18 AS04-adjuvanted vaccine administered as a 2-dose or 3-dose schedule up to 4 years after vaccination

    PubMed Central

    Romanowski, Barbara; Schwarz, Tino F; Ferguson, Linda M; Ferguson, Murdo; Peters, Klaus; Dionne, Marc; Schulze, Karin; Ramjattan, Brian; Hillemanns, Peter; Behre, Ulrich; Suryakiran, Pemmaraju; Thomas, Florence; Struyf, Frank

    2014-01-01

    This randomized, partially-blind study (ClinicalTrials.gov registration number NCT00541970) evaluated the immunogenicity and safety of 2-dose (2D) schedules of the HPV-16/18 AS04-adjuvanted vaccine. Results to month (M) 24 have been reported previously and we now report data to M48 focusing on the licensed vaccine formulation (20 μg each of HPV-16 and -18 antigens) administered at M0,6 compared with the standard 3-dose (3D) schedule (M0,1,6). Healthy females (age stratified: 9–14, 15–19, 20–25 years) were randomized to receive 2D at M0,6 (n = 240) or 3D at M0,1,6 (n = 239). In the according-to-protocol immunogenicity cohort, all initially seronegative subjects seroconverted for HPV-16 and -18 antibodies and remained seropositive up to M48. For both HPV-16 and -18, geometric mean antibody titer (GMT) ratios (3D schedule in women aged 15–25 years divided by 2D schedule in girls aged 9–14 years) at M36 and M48 were close to 1, as they were at M7 when non-inferiority was demonstrated. The kinetics of HPV-16, -18, -31, and -45 antibody responses were similar for both groups and HPV-16 and -18 GMTs were substantially higher than natural infection titers. The vaccine had a clinically acceptable safety profile in both groups. In summary, antibody responses to a 2D M0,6 schedule of the licensed vaccine formulation in girls aged 9–14 years appeared comparable to the standard 3D schedule in women aged 15–25 years up to 4 years after first vaccination. A 2D schedule could facilitate implementation of HPV vaccination programs and improve vaccine coverage and series completion rates. PMID:24576907

  19. Measles outbreaks and progress toward measles preelimination --- African region, 2009-2010.

    PubMed

    2011-04-01

    In 2008, the World Health Organization (WHO) African Region (AFR) measles technical advisory group (TAG) recommended establishing a measles preelimination goal, to be achieved by the end of 2012. The goal sets the following targets for the 46 AFR countries: ≥98% reduction in estimated regional measles mortality compared with 2000; measles incidence of <5 cases per 1 million population per year nationally; >90% national measles-containing vaccine (MCV) first dose (MCV1) coverage and >80% MCV1 coverage in all districts; and ≥95% MCV coverage by supplementary immunization activities (SIAs) in all districts. The goal also sets surveillance performance targets of ≥2 cases of nonmeasles febrile rash illness per 100,000 population, ≥1 suspected measles cases investigated with blood specimens in ≥80% of districts, and routine reporting from all districts. In addition, introduction of a routine second MCV dose (MCV2) was recommended for countries meeting specific criteria for MCV1 coverage and measles surveillance. This report updates progress toward the preelimination goal during 2009--2010 and summarizes measles outbreaks occurring in AFR countries since 2008. Of the 46 AFR countries, 12 (26%) reported measles incidence of <5 cases per 1 million population during 2010, compared with 28 (61%) in 2008. Furthermore, 28 (61%) countries reported a laboratory-confirmed measles outbreak during 2009--2010. The recent measles outbreaks highlight the need for renewed dedication by donors and governments to ensure that national multiyear vaccination plans, national budgetary line items, and financial commitments exist for routine immunization services and measles control activities.

  20. Progress toward regional measles elimination - worldwide, 2000-2014.

    PubMed

    Perry, Robert T; Murray, Jillian S; Gacic-Dobo, Marta; Dabbagh, Alya; Mulders, Mick N; Strebel, Peter M; Okwo-Bele, Jean-Marie; Rota, Paul A; Goodson, James L

    2015-11-13

    In 2000, the United Nations General Assembly adopted the Millennium Development Goals (MDG), with MDG4 being a two-thirds reduction in child mortality by 2015, and with measles vaccination coverage being one of the three indicators of progress toward this goal.* In 2010, the World Health Assembly established three milestones for measles control by 2015: 1) increase routine coverage with the first dose of measles-containing vaccine (MCV1) for children aged 1 year to ≥90% nationally and ≥80% in every district; 2) reduce global annual measles incidence to fewer than five cases per million population; and 3) reduce global measles mortality by 95% from the 2000 estimate (1).† In 2012, the World Health Assembly endorsed the Global Vaccine Action Plan§ with the objective to eliminate measles in four World Health Organization (WHO) regions by 2015. WHO member states in all six WHO regions have adopted measles elimination goals. This report updates the 2000–2013 report (2) and describes progress toward global control and regional measles elimination during 2000–2014. During this period, annual reported measles incidence declined 73% worldwide, from 146 to 40 cases per million population, and annual estimated measles deaths declined 79%, from 546,800 to 114,900. However, progress toward the 2015 milestones and elimination goals has slowed markedly since 2010. To resume progress toward milestones and goals for measles elimination, a review of current strategies and challenges to improving program performance is needed, and countries and their partners need to raise the visibility of measles elimination, address barriers to measles vaccination, and make substantial and sustained additional investments in strengthening health systems.

  1. Prevention of measles spread on a paediatric ward.

    PubMed

    Tapisiz, A; Polat, M; Kara, S S; Tezer, H; Simsek, H; Aktas, F

    2015-03-01

    Since measles is a highly contagious respiratory infection with significant airborne transmission risk in hospitals, effective prevention measures are crucial. After a mother accompanying her child on a paediatric ward lacking a negative pressure room was diagnosed with measles, exposed persons without evidence of immunity (documentary evidence of receiving two doses of measles-mumps-rubella vaccine) were treated with vaccination or intravenous immunoglobulin (IVIG). The interruption of transmission with these treatments was evaluated. There were 44 children and 101 adults exposed to the index patient. Twenty-five children and 88 adults were considered immune, providing evidence of immunity. Nineteen children and 13 adults were either given vaccination or IVIG for post-exposure prophylaxis (PEP). There were no additional cases of measles after 3 weeks follow-up. We conclude that measles is highly preventable by adequate PEP with vaccination or IVIG in a healthcare setting that lacks the benefit of a negative pressure room.

  2. Hepatitis A vaccine should receive priority in National Immunization Schedule in India.

    PubMed

    Verma, Ramesh; Khanna, Pardeep

    2012-08-01

    Hepatitis A is an acute, usually self-limiting infection of the liver caused by a virus known as hepatitis A virus (HAV). Humans are the only reservoir of the virus; transmission occurs primarily through the fecal-oral route and is closely associated with poor sanitary conditions. The virus has a worldwide distribution and causes about 1.5 million cases of clinical hepatitis each year. The risk of developing symptomatic illness following HAV infection is directly correlated with age. As many 85% of children below 2 y and 50% of those between 2-5 y infected with HAV are anicteric, and among older children and adults, infection usually causes clinical disease, with jaundice occurring in more than 70% of cases. The infection is usually self-limiting with occasional fulminant hepatic failure and mortality. In most developing countries in Asia and Africa, hepatitis A is highly endemic such that a large proportion of the population acquires immunity through asymptomatic infection early in life. HAV is endemic in India; most of the population is infected asymptomatically in early childhood with life-long immunity. Several outbreaks of hepatitis A in various parts of India have been recorded in the past decade such that anti-HAV positivity varied from 26 to 85%. Almost 50% of children of ages 1-5 y were found to be susceptible to HAV. Any one of the licensed vaccines may be used since all have nearly similar efficacy and safety profiles (except for post-exposure prophylaxis / immunocompromised patients, where only inactivated vaccines may be used). Two doses 6 mo apart are recommended for all vaccines. All Hepatitis A vaccines are licensed for use in children aged 1 y or older. However in the Indian scenario, it is preferable to administer the vaccines at age 18 mo or more when maternal antibodies have completely declined. Vaccination at this age is preferable to later since it is easier to integrate with the existing schedule, protects those who have no antibodies, and

  3. Knowledge, Attitudes and Perceptions About Routine Childhood Vaccinations Among Jewish Ultra-Orthodox Mothers Residing in Communities with Low Vaccination Coverage in the Jerusalem District.

    PubMed

    Stein Zamir, Chen; Israeli, Avi

    2017-01-16

    Background and aims Childhood vaccinations are an important component of primary prevention. Maternal and Child Health (MCH) clinics in Israel provide routine vaccinations without charge. Several vaccine-preventable-diseases outbreaks (measles, mumps) emerged in Jerusalem in the past decade. We aimed to study attitudes and knowledge on vaccinations among mothers, in communities with low immunization coverage. Methods A qualitative study including focus groups and semi-structured interviews. Results Low immunization coverage was defined below the district's mean (age 2 years, 2013) for measles-mumps-rubella-varicella 1st dose (MMR1\\MMRV1) and diphtheria-tetanus-pertussis 4th dose (DTaP4), 96 and 89%, respectively. Five communities were included, all were Jewish ultra-orthodox. The mothers' (n = 87) median age was 30 years and median number of children 4. Most mothers (94%) rated vaccinations as the main activity in the MCH clinics with overall positive attitudes. Knowledge about vaccines and vaccination schedule was inadequate. Of vaccines scheduled at ages 0-2 years (n = 13), the mean number mentioned was 3.9 ± 2.8 (median 4, range 0-9). Vaccines mentioned more often were outbreak-related (measles, mumps, polio) and HBV (given to newborns). Concerns about vaccines were obvious, trust issues and religious beliefs were not. Vaccination delay was very common and timeliness was considered insignificant. Practical difficulties in adhering to the recommended schedule prevailed. The vaccinations visits were associated with pain and stress. Overall, there was a sense of self-responsibility accompanied by inability to influence others. Conclusion Investigating maternal knowledge and attitudes on childhood vaccinations provides insights that may assist in planning tailored intervention programs aimed to increase both vaccination coverage and timeliness.

  4. Travel-related hepatitis B: risk factors and prevention using an accelerated vaccination schedule.

    PubMed

    Keystone, Jay S

    2005-10-01

    Rates of global travel and tourism are increasing dramatically, especially to regions with medium or high endemicity for hepatitis A and B, such as Asia, Africa, Latin America, and the Middle East. International travelers to these areas should be protected against both hepatitis A and B, regardless of their anticipated length of stay. However, many travelers depart within weeks of planning their trip (too late to complete the accelerated 0-, 1-, 2-month regimen for hepatitis B), and a majority of those traveling depart without being vaccinated. Although extended-stay travelers are at high risk for hepatitis B, short-stay travelers also are at risk. The most commonly encountered risk factors for travel-related hepatitis B are casual sexual activity with a new partner, medical and dental care abroad, and in the expatriate community, adoption of children who are hepatitis B carriers. Although efficacy studies of accelerated schedules for hepatitis B immunization have not been conducted, the results of immunogenicity studies in healthy volunteers who received an accelerated, 3-dose regimen on a 0-,7-, and 21-day schedule suggest that excellent, rapid, and long-term protection will be conferred. More data are needed to assess the efficacy of accelerated schedules in persons aged >40 years and to determine whether a fourth dose of hepatitis B vaccine is needed in all age groups.

  5. The current state of introduction of human papillomavirus vaccination into national immunisation schedules in Europe: first results of the VENICE2 2010 survey.

    PubMed

    Dorleans, F; Giambi, C; Dematte, L; Cotter, S; Stefanoff, P; Mereckiene, J; O'Flanagan, D; Lopalco, P L; D'Ancona, F; Levy-Bruhl, D

    2010-11-25

    The Venice 2 human papillomavirus vaccination survey evaluates the state of introduction of the HPV vaccination into the national immunisation schedules in the 29 participating countries. As of July 2010, 18 countries have integrated this vaccination. The vaccination policy and achievements vary among those countries regarding target age groups, delivery infrastructures and vaccination coverage reached. Financial constraints remain the major obstacle for the 11 countries who have not yet introduced the vaccination.

  6. A two-dose schedule for combined hepatitis A and B vaccination in children aged 6-15 years.

    PubMed

    Kurugöl, Zafer; Mutlubaş, Fatma; Ozacar, Tijen

    2005-04-22

    A combined hepatitis A and B vaccine, Twinrix, in a paediatric formulation for ages 1-15 years and in an adult formulation for those ages 16 years and older, became commercially available in Turkey as well as in many countries. It is administered according to a three-dose schedule (0, 1 and 6 months). A reduction in the number of doses would improve the compliance rate and reduce administration costs. Therefore, we planned a trial evaluation of the immunogenicity, safety and reactogenicity profile of a high-dose combined hepatitis A and B vaccine, administered in two doses, compared with the profile of a paediatric-dose combined vaccine, administered in three doses, in healthy children aged 6-15 years. One hundred children were randomly attributed to the two study groups. The first group (paediatric-dose vaccine group) received the licensed Twinrix Paediatric, at months 0, 1 and 6; the second group (high-dose vaccine group) received the high-dose vaccine, following a 0, 6 months schedule. The reactogenicity was assessed after each vaccine dose. The immunogenicity was evaluated by testing for anti-HBs and anti-HAV antibodies. Seroconversion rates and geometric mean titres (GMTs) were compared. Both formulations of the combined vaccine were well tolerated. The high-dose combined vaccine administered in two doses, elicits satisfactory immunogenicity profiles, similar to those elicited by the paediatric vaccine administered in three doses. On completion of the vaccination schedule in the two groups all children were protected against hepatitis B and immune for hepatitis A. Anti-HAV GMTs after completion of the vaccination schedule were 7163 mlU/ml in the paediatric-dose group, 8241 mlU/ml in the high-dose group; anti-HBs GMTs were 8679 and 4583 mlU/ml, respectively. These results indicate that a two-dose schedule, compared with the standard three-dose schedule, offers fewer injections for satisfactory protection against the two infections. This means fewer clinic

  7. The Australian Measles Control Campaign, 1998.

    PubMed Central

    Turnbull, F. M.; Burgess, M. A.; McIntyre, P. B.; Lambert, S. B.; Gilbert, G. L.; Gidding, H. F.; Escott, R. G.; Achat, H. M.; Hull, B. P.; Wang, H.; Sam, G. A.; Mead, C. L.

    2001-01-01

    The 1998 Australian Measles Control Campaign had as its aim improved immunization coverage among children aged 1-12 years and, in the longer term, prevention of measles epidemics. The campaign included mass school-based measles-mumps-rubella vaccination of children aged 5-12 years and a catch-up programme for preschool children. More than 1.33 million children aged 5-12 years were vaccinated at school: serological monitoring showed that 94% of such children were protected after the campaign, whereas only 84% had been protected previously. Among preschool children aged 1-3.5 years the corresponding levels of protection were 89% and 82%. During the six months following the campaign there was a marked reduction in the number of measles cases among children in targeted age groups. PMID:11584738

  8. Measles in the 21st Century, a Continuing Preventable Risk to Travelers: Data From the GeoSentinel Global Network.

    PubMed

    Sotir, Mark J; Esposito, Douglas H; Barnett, Elizabeth D; Leder, Karin; Kozarsky, Phyllis E; Lim, Poh L; Gkrania-Klotsas, Effrossyni; Hamer, Davidson H; Kuhn, Susan; Connor, Bradley A; Pradhan, Rashila; Caumes, Eric

    2016-01-15

    Measles remains a risk for travelers, with 94 measles diagnoses reported to the GeoSentinel network from 2000 to 2014, two-thirds since 2010. Asia was the most common exposure region, then Africa and Europe. Efforts to reduce travel-associated measles should target all vaccine-eligible travelers, including catch-up vaccination of susceptible adults.

  9. [Vaccination: a programme for the whole life].

    PubMed

    Lang, Pierre Olivier; Michel, Jean-Pierre

    2010-11-10

    In 2010 in Switzerland, vaccine-preventable infectious diseases still cause a significant morbi-mortality, notably among old adults. While the vaccination-based prevention in the aged population has been neglected for a long time, the two European geriatrics and gerontology societies, EUGMS, IAGG-ER has recently proposed a vaccine schedule dedicated to adults aged over 60 and promote a life-course vaccination programme. To convince of the importance of such measures in Switzerland, this article: recounts the beneficial impact of vaccines on the incidence of measles, pertussis, diphtheria, tetanus as well as influenza and pneumococcal diseases; presents the burden of these infectious diseases among the population no or insufficiently immunized; demonstrates that vaccinating in the respect of a life-course vaccine programme will reduce considerably the burden of these infectious disease.

  10. Vaccination coverage of patients with inborn errors of metabolism and the attitudes of their parents towards vaccines.

    PubMed

    Cerutti, Marta; De Lonlay, Pascale; Menni, Francesca; Parini, Rossella; Principi, Nicola; Esposito, Susanna

    2015-11-27

    To evaluate vaccination coverage of children and adolescents with inborn errors of metabolism (IEMs) and the attitudes of their parents towards vaccination, the vaccination status of 128 patients with IEM and 128 age- and gender-matched healthy controls was established by consulting the official vaccination chart. In children with IEMs, compared with healthy controls, low vaccination rates and/or delays in administration were observed for pneumococcal conjugate, meningococcus C, measles, mumps, rubella, diphtheria-tetanus-pertussis-inactivated polio, Bacillus Calmette-Guerin, and influenza vaccines. Among the parents of IEM patients, vaccine schedule compliance was primarily driven by the doctors at the hospital's reference centres; among the parents of the healthy controls, compliance was driven by the primary care paediatricians. These results show that IEM patients demonstrate sub-optimal vaccination coverage. Further studies of the different vaccines in each IEM disorder and educational programmes aimed at physicians and parents to increase immunization coverage in these patients are urgently needed.

  11. Hepatitis B Vaccine in national immunization schedule: a preventive step in India.

    PubMed

    Verma, Ramesh; Khanna, Pardeep; Prinja, Shankar; Rajput, Meena; Chawla, Suraj; Bairwa, Mohan

    2011-12-01

    Hepatitis B is a disease of the liver caused by Hepatitis B virus (HBV) infection. HBV is transmitted through contact with infected blood or body fluids, unprotected sexual intercourse and the perinatal route but not through casual contact. About two billion people worldwide have been infected with the virus, an estimated 360 million live with chronic infection, and at least 600,000 people die annually from acute or chronic consequences of Hepatitis B, such that Hepatitis B is a major public health problem worldwide. HBV is 50 to 100 times more infectious than HIV. It has been estimated that, of the 25 million infants born every year in India, over one million run the lifetime risk of developing chronic HBV infection. Every year over 100,000 Indians die due to illnesses related to HBV infection. Following the launch of the Global Alliance for Vaccines and Immunization (GAVI) to intensify National Immunization Programs (NIPs) in developing countries worldwide. World Health Organization (WHO) recommends that Hepatitis B vaccine should be given to all infants. Several cost-effectiveness analyses of inclusion of Hepatitis B vaccine in India's NIP have been performed. These indicate that universal childhood Hepatitis B immunization in India will be highly cost-effective. The Government of India is also supporting planned state programs for introducing new vaccines as part of routine immunization. The current immunization schedule for hepatitis B vaccine includes a dose given as early as possible after birth, preferably within 24 hours for all institutional deliveries because the birth dose of Hepatitis B vaccine is effective in preventing perinatal transmission of Hepatitis B. Irrespective of the birth dose, 3 doses are to be given at 6, 10, 14 weeks at the same time as DPT and OPV.

  12. Implication of health care personnel in measles transmission

    PubMed Central

    Torner, Núria; Solano, Ruben; Rius, Cristina; Domínguez, Angela; Surveillance Network of Catalonia, Spain, the Measles Elimination Program

    2014-01-01

    Healthcare personnel (HCP) play an important role in transmission of highly contagious diseases such as measles. Current immunization guidelines in Catalonia include Measles-Mumps-Rubella (MMR) immunization for HCP born after 1967 without evidence of immunity. Despite high vaccination coverage (90%) a high burden of measles cases related to outbreaks have occurred. The aim of this study was to assess the implication of HCP in measles transmission related to healthcare setting. A review of surveillance case data from 2001 to 2013 gathered through the Measles Elimination Program in Catalonia was performed. Twenty six outbreaks involving 797 cases were reported, 52 (6.5%) were HCP aged 21–41 years, 72,5% (38) patient were care personnel (doctors and nurses) and 22,5% (14) other health care related personnel. Forty six 87%) were unvaccinated, 4(10%) had only one dose and 2 had two doses of MMR. In community outbreaks 30 clusters with HCP involved were observed, yet none were identified as index cases. Non-vaccinated HCPs against measles were all under 45 years of age. Vaccination is the only reliable protection against nosocomial spread of measles from HCPs. Assessing vaccination status of HCPs and implementing a 2 dose vaccination in those lacking evidence of immunity is needed in order to set to zero the risk of acquiring and spreading measles in healthcare (HC) settings. PMID:25483548

  13. Is the current prevention strategy based on vaccination coverage and epidemiological surveillance sufficient to achieve measles and rubella elimination in Europe?

    PubMed

    Plans-Rubio, Pedro

    2014-07-01

    Elimination of measles and rubella in Europe is a feasible objective, but it requires achieving a maintaining a high prevalence of protected individuals in order to prevent cases and outbreaks from imported cases. The epidemiology of measles and rubella in Europe in the period 2003-2013 suggests that we are far away from the elimination target for measles, while the situation is better for rubella. In this situation, a new preventive strategy based on serological surveillance systems should be developed in Europe in order to identify and immunise individuals in population groups without sufficient herd immunity against measles and rubella.

  14. Measles: Still a Significant Health Threat.

    PubMed

    Lindberg, Claire; Lanzi, Maria; Lindberg, Kristen

    2015-01-01

    Measles (Rubeola), although considered eradicated in the United States, still causes periodic outbreaks. Vaccine refusal leads to vulnerable pockets of individuals who may become infected once the virus is imported from countries where it is endemic. In turn, these individuals may spread the virus to young infants and to other vulnerable individuals. Many healthcare providers are not familiar with this disease or with the factors that contribute to the risk of spread. Measles causes a serious febrile illness that may lead to pneumonia, blindness, deafness, neurological disorders, and even death. Patients with measles need supportive care and administration of oral vitamin A. The measles vaccine is highly effective and considered extremely safe, but misinformation about the safety of this and other vaccines has decreased immunization coverage in some areas of the country. Mandatory immunization laws exist in every state and have been upheld by courts including the United States Supreme Court, but laws and exemptions vary among states. Nurses can play a strong role in care of patients with measles, case identification, and prevention of transmission. Most importantly, because nurses hold positions of trust in their communities, they should be tireless frontline advocates for immunization. The purpose of this article is to provide information on measles, its transmission, signs and symptoms, treatment, prevention, and relevant laws and regulations.

  15. Mumps Outbreak at a University and Recommendation for a Third Dose of Measles-Mumps-Rubella Vaccine - Illinois, 2015-2016.

    PubMed

    Albertson, Justin P; Clegg, Whitney J; Reid, Heather D; Arbise, Benjamin S; Pryde, Julie; Vaid, Awais; Thompson-Brown, Rachella; Echols, Fredrick

    2016-07-29

    Mumps is an acute viral disease characterized by fever and swelling of the parotid or other salivary glands. On May 1, 2015, the Illinois Department of Public Health (IDPH) confirmed a mumps outbreak at the University of Illinois at Urbana-Champaign. IDPH and the Champaign-Urbana Public Health District (C-UPHD) conducted an investigation and identified 317 cases of mumps during April 2015-May 2016. Because of sustained transmission in a population with high 2-dose coverage with measles-mumps-rubella (MMR) vaccine, a third MMR dose was recommended by IDPH, C-UPHD, and the university's McKinley Health Center. No formal recommendation for or against the use of a third MMR dose has been issued by the Advisory Committee on Immunization Practices (ACIP) (1). However, CDC has provided guidelines for use of a third dose as a control measure during mumps outbreaks in settings in which persons are in close contact with one another, where transmission is sustained despite high 2-dose MMR coverage, and when traditional control measures fail to slow transmission (2).

  16. Vaccination schedules to raise antibody concentrations against epsilon-toxin of Clostridium perfringens in ewes and their triplet lambs.

    PubMed

    de la Rosa, C; Hogue, D E; Thonney, M L

    1997-09-01

    The objective of this experiment was to compare vaccination schedules for ewes and their lambs to raise antibody concentrations to epsilon-toxin of Clostridium perfringens, the causative agent of enterotoxemia. Half of 200 Finnsheep x Dorset ewes were vaccinated with C. perfringens type D toxoid vaccine 3 wk before lambing. Serum samples were obtained from 20 ewes that were to be vaccinated and 20 ewes that would remain unvaccinated before treatment and at wk 2, 1, and 0 before the start of lambing. Antibody concentrations in sera of unvaccinated ewes remained at 2 IU/mL, but they peaked in vaccinated ewes at 15 IU/mL by wk 1 before lambing. Lambs from each of the first 13 and the first 14 sets of triplets from vaccinated and unvaccinated ewes, respectively, received one of three vaccination treatments: no vaccine (control), vaccination on d 1 and 21 of age, or vaccination on d 21 and 42 of age. Antibody concentrations declined in sera of vaccinated ewes from 8.5 IU/mL immediately after lambing to 3 IU/mL 12 wk later. Vaccination of lambs did not increase sera antibody concentration. However, prepartum vaccination of ewes significantly increased lamb antibody concentrations (19 IU/mL) compared with lambs reared by unvaccinated ewes (2 IU/mL). Vaccination of ewes resulted in lambs with higher antibody concentrations until wk 10 postpartum. Concentrations declined to .6 IU/mL in all lambs at 12 wk. Because concentrations of .2 IU/mL may be protective, these results indicate that vaccination of ewes before lambing imparts passive protection in lambs to 12 wk of age, whereas vaccination of young lambs provides no added protection.

  17. Randomized trial of HPV4 vaccine assessing the response to HPV4 vaccine in two schedules among Peruvian female sex workers

    PubMed Central

    Brown, Brandon; Blas, Magaly; Cabral, Alejandra; Carcamo, Cesar; Gravitt, Patti; Halsey, Neal

    2012-01-01

    Two hundred female sex workers (FSWs) in Lima, Peru were randomized to receive HPV4 vaccine in the standard (0, 2, 6 months) or a modified schedule (0, 3, 6 months). One hundred and eighty four (92%) participants completed 3 doses of vaccine. Baseline seropositive rates were 58% for HPV6, 22.5% for HPV11, 41.5% for HPV16, and 13% for HPV18. The final geometric mean antibody titer (GMT) following vaccination was significantly greater for women who were seropositive at baseline compared to seronegative women: HPV6 (GMT ratio=2.3, p<0.01), HPV11 (GMT ratio=2.7, p<0.01), HPV16 (GMT ratio=1.3, p=0.04), and HPV18 (GMT ratio=2.4, p<0.01)). Antibody titers in the modified schedule were not inferior to those in the standard schedule, suggesting the modified schedule may be paired with required STD visits. Although all women benefit from vaccination, administration at a younger age and before sexual debut is needed to achieve maximum protection from vaccine. PMID:22306855

  18. Trends in medical and nonmedical immunization exemptions to measles-containing vaccine in Ontario: an annual cross-sectional assessment of students from school years 2002/03 to 2012/13

    PubMed Central

    Wilson, Sarah E.; Seo, Chi Yon; Lim, Gillian H.; Fediurek, Jill; Crowcroft, Natasha S.; Deeks, Shelley L.

    2015-01-01

    Background: Under Ontario legislation, for select vaccine-preventable diseases nonimmunized or under-immunized students must undergo vaccination or provide a statement of exemption, or risk suspension from school. At the time of this assessment, these diseases included measles, mumps, rubella, diphtheria, tetanus and polio. Methods: Exemptions data for the school years 2002/03 to 2012/13 were obtained from the Immunization Records Information System used in Ontario. Temporal trends were expressed for 7- and 17-year-old students by exemption classification (medical, prior immunity, religious or conscientious belief, total) at the provincial level, by school year and by birth cohort. Regional analysis was conducted for the 2012/13 school year. A temporal trend analysis of exemptions for measles-containing vaccines was performed by using a Poisson distribution with a 2-sided test (α = 5%). Results: For both 7- and 17-year-old students, religious or conscientious exemptions for measles-containing vaccines significantly increased over the study period (p < 0.001 in both age groups), whereas medical exemptions decreased (p < 0.001 in both age groups). The trends were reproduced when examined by birth cohort. The percentage of Ontario students with any exemption classification (total exemptions) remained low (< 2.5%) during the study period, although considerable geographic variation was noted. Interpretation: Ontario data suggest that nonmedical exemptions have increased during the last 11 years, consistent with trends reported elsewhere. The trend toward increasing religious or conscientious exemptions coupled with declining medical exemptions explains why total exemptions have remained stable or decreased at the provincial level. The prominent geographic variability in exemptions suggests that targeted interventions may be suitable for consideration. PMID:26457292

  19. Immunogenicity and safety of measles-mumps-rubella and varicella vaccines coadministered with a fourth dose of Haemophilus influenzae type b and Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine in toddlers: a pooled analysis of randomized trials.

    PubMed

    Bryant, Kristina; McVernon, Jodie; Marchant, Colin; Nolan, Terry; Marshall, Gary; Richmond, Peter; Marshall, Helen; Nissen, Michael; Lambert, Stephen; Aris, Emmanuel; Mesaros, Narcisa; Miller, Jacqueline

    2012-08-01

    A pooled analysis was conducted of 1257 toddlers who received a fourth dose of Haemophilus influenzae type b-Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine (HibMenCY-TT) or Hib conjugate vaccine (Hib polysaccharide conjugated to N. meningitidis outer membrane protein) coadministered with measles-mumps-rubella (MMR) and varicella (VAR) vaccines (NCT00134719/NCT00289783). Noninferiority of immunological responses to MMR and VAR was demonstrated between groups and incidences of MMR- and VAR-specific solicited symptoms were similar, indicating that HibMenCY-TT can be coadministered with MMR and VAR.

  20. Use of a 2-Dose Schedule for Human Papillomavirus Vaccination - Updated Recommendations of the Advisory Committee on Immunization Practices.

    PubMed

    Meites, Elissa; Kempe, Allison; Markowitz, Lauri E

    2016-12-16

    Vaccination against human papillomavirus (HPV) is recommended to prevent HPV infections and HPV-associated diseases, including cancers. Routine vaccination at age 11 or 12 years has been recommended by the Advisory Committee on Immunization Practices (ACIP) since 2006 for females and since 2011 for males (1,2). This report provides recommendations and guidance regarding use of HPV vaccines and updates ACIP HPV vaccination recommendations previously published in 2014 and 2015 (1,2). This report includes new recommendations for use of a 2-dose schedule for girls and boys who initiate the vaccination series at ages 9 through 14 years. Three doses remain recommended for persons who initiate the vaccination series at ages 15 through 26 years and for immunocompromised persons.

  1. Immunosenescence and herd immunity: with an ever-increasing aging population do we need to rethink vaccine schedules?

    PubMed

    Lang, Pierre Olivier; Aspinall, Richard

    2012-02-01

    Vaccination is a powerful public health tool that has been of tremendous benefit in protecting vulnerable populations from specific infections. Moreover, in addition to the direct benefits to vaccinated individuals, the indirect effects of protection at the community level have also been demonstrated and termed 'herd immunity'. The predicted demographic shift in the population landscape towards an ever-increasing aging population and the evidence suggesting that older individuals produce less-than-optimal vaccine responses have raised the question of rethinking vaccine schedules. This article provides evidence that even if herd immunity might be an option to indirectly protect the aging and aged adult population, the highest priorities for the near future must be to understand how vaccine responses in older individuals can be improved, to break down the public, cultural, societal and political barriers to vaccination and to counter the antivaccination movement that inhibits the worldwide spread of lifelong immunization programs.

  2. [Immunization schedule of the Spanish Association of Pediatrics: recommendations 2008].

    PubMed

    Bernaola Iturbe, E; Giménez Sánchez, F; Baca Cots, M; de Juan Martín, F; Díez Domingo, J; Garcés Sánchez, M; Gómez-Campderá, A; Martinón Torres, F; Picazo, J J; Pineda Solás, V

    2008-01-01

    The Vaccine Advisory Committee of the Spanish Association of Pediatrics provides information on the new developments in vaccines that have taken place in 2007, based on the available evidence, and discusses these developments. Certain modifications to the Immunization Schedule for 2008 are recommended. A second varicella vaccine booster dose, administered together with the booster dose of the measles-mumps-rubella (MMR) vaccine when children start school (3-4 years), is recommended to avoid vaccine failures against the varicella-zoster virus. Based on current scientific evidence, the importance of universal heptavalent conjugate pneumococcal vaccination, as carried out in most similar European countries and in the autonomous community of Madrid in Spain, is stressed. Human papilloma virus vaccine is included in the Immunization Schedule for girls from 11 years old, and initially, at least up to the age of 16 years. Vaccination against rotavirus in children starting at 6 weeks and completing the series before 6 months is recommended. Other recommendations included in this year's Immunization Schedule are vaccination against influenza and hepatitis A virus in risk groups and at the pediatrician's discretion, as a first step toward the future recommendation of universal immunization.

  3. Intralesional tuberculin (PPD) versus measles, mumps, rubella (MMR) vaccine in treatment of multiple warts: a comparative clinical and immunological study.

    PubMed

    Shaheen, Maha Adel; Salem, Samar Abdallah M; Fouad, Dina Adel; El-Fatah, Abeer Aly Abd

    2015-01-01

    Intralesional purified protein derivative (PPD) or mumps, measles, rubella (MMR) were not previously compared regarding their efficacy or mechanism of action in treatment of warts. We aimed to compare their efficacy in treatment of multiple warts and investigate their effect on serum interleukin (IL)-4 and IL-12. Thirty patients with multiple warts were included (10 treated with PPD, 10 with MMR, and 10 with normal saline (control)). Injection was done every 3 weeks until clearance or maximum of three treatments. Clinical response of target and distant warts was evaluated. Serum ILs-4 and -12 were assessed before and after treatment. A significantly higher rate of complete response was found in target and distant warts with PPD (60% each) and MMR (80%, 40%, respectively) compared with controls (0%), with no significant difference between both treatments. After treatment, the control group showed the lowest serum IL-12 and IL-4 levels compared with the MMR- and PPD-treated groups with statistically significant difference in between. MMR resulted in a significantly higher serum IL-12 than PPD. With PPD, IL-4 was increased with statistically significant change compared with pretreat-ment level. Intralesional PPD and MMR show comparable efficacy and safety in treatment of multiple warts. Serum ILs-4 and-12 increase following antigen injection.

  4. Progress Toward Measles Elimination - Nepal, 2007-2014.

    PubMed

    Khanal, Sudhir; Sedai, Tika Ram; Choudary, Ganga Ram; Giri, Jagat Narain; Bohara, Rajendra; Pant, Rajendra; Gautam, Mukunda; Sharapov, Umid M; Goodson, James L; Alexander, James; Dabbagh, Alya; Strebel, Peter; Perry, Robert T; Bah, Sunil; Abeysinghe, Nihal; Thapa, Arun

    2016-03-04

    In 2013, the 66th session of the Regional Committee of the World Health Organization (WHO) South-East Asia Region (SEAR) established a goal to eliminate measles and to control rubella and congenital rubella syndrome (CRS) in SEAR by 2020. Current recommended measles elimination strategies in the region include 1) achieving and maintaining ≥95% coverage with 2 doses of measles-containing vaccine (MCV) in every district, delivered through the routine immunization program or through supplementary immunization activities (SIAs); 2) developing and sustaining a sensitive and timely measles case-based surveillance system that meets minimum recommended performance indicators; 3) developing and maintaining an accredited measles laboratory network; and 4) achieving timely identification, investigation, and response to measles outbreaks. In 2013, Nepal, one of the 11 SEAR member states, adopted a goal for national measles elimination by 2019. This report updates a previous report and summarizes progress toward measles elimination in Nepal during 2007-2014. During 2007-2014, estimated coverage with the first MCV dose (MCV1) increased from 81% to 88%. Approximately 3.9 and 9.7 million children were vaccinated in SIAs conducted in 2008 and 2014, respectively. Reported suspected measles incidence declined by 13% during 2007-2014, from 54 to 47 cases per 1 million population. However, in 2014, 81% of districts did not meet the measles case-based surveillance performance indicator target of ≥2 discarded non-measles cases per 100,000 population per year. To achieve and maintain measles elimination, additional measures are needed to strengthen routine immunization services to increase coverage with MCV1 and a recently introduced second dose of MCV (MCV2) to ≥95% in all districts, and to enhance sensitivity of measles case-based surveillance by adopting a more sensitive case definition, expanding case-based surveillance sites nationwide, and ensuring timely transport of

  5. Long-term measles-induced immunomodulation increases overall childhood infectious disease mortality.

    PubMed

    Mina, Michael J; Metcalf, C Jessica E; de Swart, Rik L; Osterhaus, A D M E; Grenfell, Bryan T

    2015-05-08

    Immunosuppression after measles is known to predispose people to opportunistic infections for a period of several weeks to months. Using population-level data, we show that measles has a more prolonged effect on host resistance, extending over 2 to 3 years. We find that nonmeasles infectious disease mortality in high-income countries is tightly coupled to measles incidence at this lag, in both the pre- and post-vaccine eras. We conclude that long-term immunologic sequelae of measles drive interannual fluctuations in nonmeasles deaths. This is consistent with recent experimental work that attributes the immunosuppressive effects of measles to depletion of B and T lymphocytes. Our data provide an explanation for the long-term benefits of measles vaccination in preventing all-cause infectious disease. By preventing measles-associated immune memory loss, vaccination protects polymicrobial herd immunity.

  6. Andean region: measles on the way out.

    PubMed

    1996-10-01

    In August 1996, health officials, program managers, epidemiologists, laboratory representatives, UNICEF, Rotary International, and Pan American Health Organization staff attended the VII Andean EPI Meeting in Quito, Ecuador, to review the progress of the Expanded Program on Immunization (EPI). All Andean countries have conducted catch-up measles vaccination campaigns targeting children 9 months to 15 years old. These campaigns achieved 90% vaccine coverage and a strong reduction in measles incidence (only 7 confirmed cases in 1996). Follow-up campaigns were conducted during 1995-1996 in Colombia, Peru, and Chile. They were expected in Bolivia, Ecuador, Peru, and Venezuela during 1997-1999. The Andean countries implemented a national surveillance system for measles in 1995. Meeting representatives made eight recommendations regarding measles. For example, health officials should reach and maintain routine vaccination coverage greater than 95% for children 12-23 months old in each municipality. Laboratory representatives proposed recommendations on uniform criteria for measles diagnosis. The last indigenous wild poliovirus in the Americas was isolated in 1991. Imported wild poliovirus remains a concern. The Andean countries are expanding surveillance of neonatal tetanus activities. Since 1989 the frequency of neonatal tetanus has been falling in the Andean region, especially in Bolivia and Peru. The impact of migration on the control of neonatal tetanus should be a higher priority. Participants repeated the need for systematic use and continuous monitoring of EPI indicators (e.g., vaccination coverage). Three countries plan on analyzing surveys on missed opportunities for vaccination in 1996. Three countries presented progress reports on hepatitis B vaccination and surveillance. Participants issued recommendations on quality control of vaccines. The responsibility for quality control lies with the manufacturers and the government. Vaccines for invasive diseases (e

  7. Measles outbreak associated with an arriving refugee - Los Angeles County, California, August-September 2011.

    PubMed

    2012-06-01

    Measles is a highly communicable, acute viral illness with potential for severe complications, including death. Although endemic measles was eliminated in the United States in 2000 as a result of widespread vaccination, sporadic measles outbreaks still occur, largely associated with international travel from measles-endemic countries and pockets of unvaccinated persons. On August 26, 2011, the Los Angeles County Department of Public Health (LACDPH) was notified of suspected measles in a refugee from Burma who had arrived in Los Angeles, California, on August 24, after a flight from Kuala Lumpur, Malaysia. Passengers on the flight included 31 other refugees who then traveled to seven other states, widening the measles investigation and response activities. In California alone, 50 staff members from LACDPH and the California Department of Public Health (CDPH) interviewed and reinterviewed 298 contacts. Measles was diagnosed in three contacts of the index patient (patient A). The three contacts with measles were two passengers on the same flight as patient A and a customs worker; no secondary cases were identified. Delayed diagnosis of measles in patient A and delayed notification of health officials precluded use of measles-mumps-rubella (MMR) vaccine as an outbreak intervention. This outbreak emphasizes the importance of maintaining a high level of vaccination coverage and continued high vigilance for measles in the United States, particularly among incoming international travelers; clinicians should immediately isolate persons with suspected measles and promptly report them to health authorities.

  8. Facts about Measles for Adults

    MedlinePlus

    ... HPV (Human Papillomavirus) Influenza (Flu) Measles Meningococcal Disease Mumps Pertussis (Whooping Cough) Pneumococcal Disease Rubella (German Measles) ... HPV (Human Papillomavirus) Influenza (Flu) Measles Meningococcal Disease Mumps Pertussis (Whooping Cough) Pneumococcal Disease Rubella (German Measles) ...

  9. Systematic Review of the Effect of Pneumococcal Conjugate Vaccine Dosing Schedules on Immunogenicity

    PubMed Central

    2014-01-01

    Background: Despite the breadth of studies demonstrating benefits of pneumococcal conjugate vaccine (PCV), uncertainty remains regarding the optimal PCV dosing schedule in infants. Methods: We conducted a systematic literature review of PCV immunogenicity published from 1994 to 2010 (supplemented post hoc with studies from 2011). Studies included for analysis evaluated ≥2 doses of 7-valent or higher product (excluding Aventis-Pasteur PCV11) administered to nonhigh-risk infants ≤6 months of age. Impact of PCV schedule on geometric mean antibody concentration (GMC) and proportion of subjects over 0.35 mcg/mL were assessed at various time points; the GMC 1 month postdose 3 (for various dosing regimens) for serotypes 1, 5, 6B, 14, 19F and 23F was assessed in detail using random effects linear regression, adjusted for product, acellular diphtheria-tetanus-pertussis/whole-cell diphtheria- tetanus-pertussis coadministration, laboratory method, age at first dose and geographic region. Results: From 61 studies, we evaluated 13 two-dose (2+0) and 65 three-dose primary schedules (3+0) without a booster dose, 11 “2+1” (2 primary plus booster) and 42 “3+1” schedules. The GMC after the primary series was higher following 3-dose schedules compared with 2-dose schedules for all serotypes except for serotype 1. Pre- and postbooster GMCs were generally similar regardless of whether 2 or 3 primary doses were given. GMCs were significantly higher for all serotypes when dose 3 was administered in the second year (2+1) compared with ≤6 months of age (3+0). Conclusions: While giving the third dose in the second year of life produces a higher antibody response than when given as part of the primary series in the first 6 months, the lower GMC between the 2-dose primary series and booster may result in less disease protection for infants in that interval than those who completed the 3-dose primary series. Theoretical advantages of higher antibodies induced by giving the third

  10. Measles outbreak in Europe: susceptibility of infants too young to be immunized.

    PubMed

    Leuridan, E; Sabbe, M; Van Damme, P

    2012-09-07

    As women vaccinated against measles transfer low amounts of antibodies, an increasing number of infants lack early protection through maternal antibodies until being immunised themselves. This paper reviews the literature on disease burden of measles in the population too young to be immunized according to the respective national recommendations during recent outbreaks in EU and EEA/EFTA countries. In addition, specific control strategies adopted to protect this young population are reviewed. Pubmed, Unbound Medline, Web of Knowledge and the Eurosurveillance database were searched using MESH terms: measles and epidemiology, measles and infants, prevalence of measles, measles and outbreaks and measles and epidemic. Additionally, data from Euvac.net and ECDC were consulted. Databases were searched from January 2001 to September 2011. Fifty-three papers were included in the analysis. The percentage of all measles cases during outbreaks affecting young infants ranged from 0.25% to 83.0%. Specific control strategies were adopted: e.g. administration of the first or second vaccine dose earlier than recommended. Infants younger than 12 months are often involved in measles outbreaks, and advancing the first vaccine dose could reduce the burden of disease. However, immunization before 9 months of age is not systematically recommended because of dysmature humoral immune responses of infants. High coverage and timely administration of the recommended series of vaccines are the most important measures to decrease measles incidence and measles circulation and protect vulnerable infants from infection.

  11. Introduction of Sequential Inactivated Polio Vaccine–Oral Polio Vaccine Schedule for Routine Infant Immunization in Brazil’s National Immunization Program

    PubMed Central

    Domingues, Carla Magda Allan S.; de Fátima Pereira, Sirlene; Marreiros, Ana Carolina Cunha; Menezes, Nair; Flannery, Brendan

    2015-01-01

    In August 2012, the Brazilian Ministry of Health introduced inactivated polio vaccine (IPV) as part of sequential polio vaccination schedule for all infants beginning their primary vaccination series. The revised childhood immunization schedule included 2 doses of IPV at 2 and 4 months of age followed by 2 doses of oral polio vaccine (OPV) at 6 and 15 months of age. One annual national polio immunization day was maintained to provide OPV to all children aged 6 to 59 months. The decision to introduce IPV was based on preventing rare cases of vaccine-associated paralytic polio, financially sustaining IPV introduction, ensuring equitable access to IPV, and preparing for future OPV cessation following global eradication. Introducing IPV during a national multivaccination campaign led to rapid uptake, despite challenges with local vaccine supply due to high wastage rates. Continuous monitoring is required to achieve high coverage with the sequential polio vaccine schedule. PMID:25316829

  12. Is There a Connection Between Vaccines and Autism?

    MedlinePlus

    ... published in 1998 that suggested that the MMR (measles-mumps-rubella) vaccine , or infection with the naturally occurring measles virus ... delay vaccinations. But this is extremely risky because vaccine-preventable diseases like measles are still very much around. So if an ...

  13. Relevance of the Measles Virus Expression in Cancer - an Update.

    PubMed

    Benharroch, Daniel; Ariad, Samuel; Tadmor, Noa; Nalbandyan, Karen; Lazarev, Irena

    2016-10-01

    Evidence of an association between classical Hodgkin lymphoma and the measles virus has previously been presented by our group. Arguments held against our thesis were reevaluated. Substantiation of a relationship between the measles virus and additional solid tumors was submitted. Moreover, a pathogenic pathway was suggested to support a possible contribution of the measles virus to the development of classical Hodgkin lymphoma. We have chosen to exclude a discussion of measles virotherapy, since this carries distinct implications. We now add new evidence regarding the expression of the measles virus phosphoprotein in a few cancers. We also suggest a role in this context for atypical measles syndrome in malignant tumors. Last, we propose a collaboration which may make the best, on the one hand of our cohort of classical Hodgkin lymphoma, half of which carry the measles virus expression in their tumor cells. The planned study will also look into the patients vaccination records and into a previous history of the measles disease. On the other hand, cohorts of patients diagnosed with late onset measles will be assessed for the eventual diagnosis of atypical measles syndrome and will be followed up for the subsequent development of a malignant tumor.

  14. International measles incidence and immunization coverage.

    PubMed

    Hall, Robert; Jolley, Damien

    2011-07-01

    Measles is exquisitely sensitive to immunization programs. We investigated the decline in measles incidence after immunization with 1 or 2 doses of measles-containing vaccine (MCV), with or without supplementary immunization activities (SIAs). Using data from the World Health Organization, we modeled the impact of measles immunization using a negative binomial regression model. All countries offer measles immunization, and 192 of 193 countries offer a second dose of MCV (MCV2), using either a routine second dose, SIAs, or both. The incidence of measles fell from a median of 70.9 cases/100,000/year when coverage with a first dose of MCV (MCV1) was in the range of 0%-39% to a median of .9 cases/100,000/year when MCV1 coverage was 90%-100%, in both cases with no MCV2. Further reductions followed the introduction of MCV2 and SIAs. Modeling showed that each 1% increase in MCV1 coverage was followed by a 2.0% decrease in incidence in the same and following years (95% confidence interval [CI], 2.0%-1.9%, and 2.1%-1.9%, respectively). For a second dose, a rise of 1% in MCV2 coverage was followed by a decrease in measles incidence by .4% (95% CI, .3%-.5%) in the same year and .3% (95% CI, .2%-.5%) in the following year. SIAs were followed by decreases of measles incidence by 40.3% (95% CI, 46.3%-33.8%) in the same year and 45.2% (95% CI, 51.1%-48.7%) in the following year. A herd immunity effect was demonstrated with MCV1 coverage of >80%, and SIAs are an extraordinarily effective strategy for measles control.

  15. The epidemiological and serological characteristics of measles in Dongguan, China, 2005–2014

    PubMed Central

    Han, Ke; Chen, Shaoli; Tang, Cuifei; Wen, Jinjun; Li, Jingquan; Ni, Jindong; Zheng, Xueli

    2016-01-01

    ABSTRACT This study examined the epidemiological and serological characteristics of measles in Dongguan, China. From 2005 to 2014, a total of 8,224 measles cases were reported in Dongguan, 33.5% of which were aged <1 y and 30.6% >14 y. From 2005 to 2014, the proportion of the <1 y measles cases increased year by year from 24.3% to 47.9%. Of the cases aged ≥8 months (n = 6,768 cases), only 11.6% had been immunized with at least one dose of measles vaccine. Of the 2,213 cases who had never been immunized with measles vaccine, immigrants accounted for 82.4%. 52.4% of the measles cases were diagnosed with pneumonia, and 12 cases died from respiratory failure. Seroprevalence rate in women and their newborns was 86.0% and 82.5%, respectively. Measurement of serum measles antibody levels for infants aged less than 8 months indicated that seroprevalence rate dramatically declined from 97.3% at birth to 9.3% and 13.2% at 6- and 7- month old. The existence of a sufficient pool of unvaccinated people (especially immigrants) and decreased level of passively transferred measles antibodies in infants from vaccinated mothers contributed to the sustained transmission observed in Dongguan. In addition to high routine vaccination coverage, new strategies and innovations for measles vaccination are needed to eliminate measles. PMID:27003239

  16. Bridging non-human primate correlates of protection to reassess the Anthrax Vaccine Adsorbed booster schedule in humans.

    PubMed

    Schiffer, Jarad M; Chen, Ligong; Dalton, Shannon; Niemuth, Nancy A; Sabourin, Carol L; Quinn, Conrad P

    2015-07-17

    Anthrax Vaccine Adsorbed (AVA, BioThrax) is approved for use in humans as a priming series of 3 intramuscular (i.m.) injections (0, 1, 6 months; 3-IM) with boosters at 12 and 18 months, and annually thereafter for those at continued risk of infection. A reduction in AVA booster frequency would lessen the burden of vaccination, reduce the cumulative frequency of vaccine associated adverse events and potentially expand vaccine coverage by requiring fewer doses per schedule. Because human inhalation anthrax studies are neither feasible nor ethical, AVA efficacy estimates are determined using cross-species bridging of immune correlates of protection (COP) identified in animal models. We have previously reported that the AVA 3-IM priming series provided high levels of protection in non-human primates (NHP) against inhalation anthrax for up to 4 years after the first vaccination. Penalized logistic regressions of those NHP immunological data identified that anti-protective antigen (anti-PA) IgG concentration measured just prior to infectious challenge was the most accurate single COP. In the present analysis, cross-species logistic regression models of this COP were used to predict probability of survival during a 43 month study in humans receiving the current 3-dose priming and 4 boosters (12, 18, 30 and 42 months; 7-IM) and reduced schedules with boosters at months 18 and 42 only (5-IM), or at month 42 only (4-IM). All models predicted high survival probabilities for the reduced schedules from 7 to 43 months. The predicted survival probabilities for the reduced schedules were 86.8% (4-IM) and 95.8% (5-IM) at month 42 when antibody levels were lowest. The data indicated that 4-IM and 5-IM are both viable alternatives to the current AVA pre-exposure prophylaxis schedule.

  17. Measles immunisation in children with allergy to egg.

    PubMed Central

    Aickin, R.; Hill, D.; Kemp, A.

    1994-01-01

    OBJECTIVE--To examine the occurrence of adverse reactions to measles vaccine given as a single dose to children with egg allergy, and to determine if the administration of single dose to children with a positive result in an intradermal skin prick test with the vaccine is associated with adverse reactions. DESIGN--Review of results of immunisation and prospective study of 96 consecutively presenting children given intradermal skin testing with the vaccine. SETTING--Children's allergy centre. SUBJECTS--410 children sensitive to egg referred to the allergy unit for advice about measles immunisation. MAIN OUTCOME MEASURES--Nature and severity of reactions associated with the administration of measles vaccine. RESULTS--All children had a positive result in a skin prick test with egg white, and five had a positive result in a skin prick test with vaccine. Of 96 consecutive children, 46 had a positive result in an intradermal test with vaccine. After immunisation with a full dose (0.5 ml) of vaccine adverse reactions were associated with a mild reaction in four children, none of whom required treatment. Only one of the 46 children with a positive result in an intradermal vaccine skin test had a reaction associated with vaccine administration. None of the children with a positive result in a skin prick test with measles vaccine reacted to the vaccine. The rate of minor reactions to the vaccine not requiring treatment was 0.98% (95% confidence interval 0.27% to 2.48%) and serious reactions requiring treatment was 0% (0% to 0.9%). CONCLUSION--Children with IgE mediated allergic reactions to egg protein should be investigated and managed by practitioners with special knowledge in this subject. Measles immunisation should be performed in a setting where any adverse reactions can be dealt with appropriately. Skin tests and measles vaccine and desensitisation are not necessary. PMID:8069138

  18. Phylogenetic and epidemiological analysis of measles outbreaks in Denmark, 2013 to 2014.

    PubMed

    Rasmussen, Lasse Dam; Fonager, Jannik; Knudsen, Lisbet Krause; Andersen, Peter Henrik Senten; Rønn, Jesper; Poulsen, Mille Weismann; Franck, Kristina Træholt; Fischer, Thea Kølsen

    2015-01-01

    Despite the introduction of safe, effective vaccines decades ago and joint global public health efforts to eliminate measles, this vaccine-preventable disease continues to pose threats to children's health worldwide. During 2013 and 2014, measles virus was introduced into Denmark through several independent importations. This resulted in a number of secondary cases (n=7), with two clusters in 2013 and one in 2014. In total, there were 44 cases of measles. Most cases (n=41) were laboratory confirmed by detection of measles virus genome by real-time reverse transcription (RT)-PCR and IgM antibodies. The viruses from confirmed cases were genotyped by sequencing. Only one genotype circulated each year, i.e. D8 and B3, respectively. Sequencing of measles virus from different clinical specimens from the same patients revealed that sequence variants of measles viruses might co-exist and co-transmit during an outbreak. The majority of the cases were unvaccinated (n=27) or recipients of one dose of measles-mumps-rubella (MMR) vaccine (n=7). In addition, two fully vaccinated adult cases were reported in 2014. We demonstrate the transmission of measles virus in a population in which the two-dose MMR vaccination coverage rate was 80% and how even vaccinated individuals may be at risk of contracting measles once transmission has been established.

  19. Timing of HPV vaccine intervals among United States teens with consideration to the current ACIP schedule and the WHO 2-dose schedule.

    PubMed

    Cloessner, Emily A; Stokley, Shannon; Yankey, David; Markowitz, Lauri E

    2016-06-02

    The current recommendation for human papillomavirus (HPV) vaccination in the United States is for 3 doses to be administered over a 6 month period. In April 2014, the World Health Organization (WHO) recommended adoption of a 2-dose schedule, with doses spaced a minimum of 6 months apart, for teens who begin the series before age 15. We analyzed data from the 2013 National Immunization Survey-Teen to examine the timing of second and third dose receipt among US adolescents. All analyses were restricted to adolescents age 13-17 y who had adequate provider data. The Wilcoxon-Mann-Whitney test measured differences in time to receive vaccine doses among demographic and socioeconomic groups. Logistic regression identified socioeconomic characteristics associated with receiving the second dose of HPV vaccine at least 6 months after the first dose. The median time for teens to receive the second dose of HPV vaccine was 2.6 months after the first dose, and the median time to receive the third dose was 4.9 months after the second dose. Minority teens and teens living below the poverty level took significantly longer to receive doses. Among teens that initiated the HPV vaccine series before age 15 y, 28.6% received the second dose at least 6 months after the first dose. If these teens, who met the WHO criteria for up-to-date HPV vaccination, were classified as having completed the vaccination series, overall coverage in the US would increase 3.9 percentage points, with African American and Hispanic teens having the greatest increases in coverage.

  20. Predicting and comparing long-term measles antibody profiles of different immunization policies.

    PubMed Central

    Lee, M. S.; Nokes, D. J.

    2001-01-01

    OBJECTIVE: Measles outbreaks are infrequent and localized in areas with high coverage of measles vaccine. The need is to assess long-term effectiveness of coverage. Since 1991, no measles epidemic affecting the whole island has occurred in Taiwan, China. Epidemiological models are developed to predict the long-term measles antibody profiles and compare the merits of different immunization policies on the island. METHODS: The current measles immunization policy in Taiwan, China, is 1 dose of measles vaccine at 9 months of age and 1 dose of measles, mumps and rubella (MMR) vaccine at 15 months of age, plus a 'mop-up' of MMR-unvaccinated schoolchildren at 6 years of age. Refinements involve a change to a two-dose strategy. Five scenarios based on different vaccination strategies are compared. The models are analysed using Microsoft Excel. FINDINGS: First, making the assumption that measles vaccine-induced immunity will not wane, the predicted measles IgG seroprevalences in preschool children range from 81% (lower bound) to 94% (upper bound) and in schoolchildren reach 97-98% in all strategy scenarios. Results are dependent on the association of vaccine coverage between the first and second dose of vaccine. Second, if it is assumed that vaccine-induced antibody titres decay, the long-term measles seroprevalence will depend on the initial titres post vaccination, decay rates of antibody titres and cut-off of seropositivity. CONCLUSION: If MMR coverage at 12 months of age can reach > 90%, it would be worth changing the current policy to 2 doses at 12 months and 6 years of age to induce higher antibody titres. These epidemiological models could be applied wherever a similar stage of measles elimination has been reached. PMID:11477964

  1. Measles, Mumps, Rubella (MMR)

    MedlinePlus

    ... Measles, Mumps, Rubella (MMR) Meningococcal Disease Pneumococcal Disease Polio Tetanus, Diphtheria, and Pertussis (Tdap) Professional Resources HPV ... Measles, Mumps, Rubella (MMR) Meningococcal Disease Pneumococcal Disease Polio Tetanus, Diphtheria, and Pertussis (Tdap) You May Also ...

  2. Measles: Information for Parents

    MedlinePlus

    ... protect against measles is to get the measles-mumps-rubella shot (called the MMR shot). Doctors recommend ... also protects against Prevents your child from getting mumps and rubella) an uncomfortable rash • and high fever ...

  3. Measles epidemic sweeps through Afghanistan.

    PubMed

    Ahmad, K

    2000-04-22

    This article reports that the measles epidemic continues to spread in at least 7 of the war-ravaged Afghanistan's 30 provinces. The WHO estimated that the case-fatality rate has reached 8-13%. This was further exacerbated by a lack of the most basic health service, which led to thousands of children malnourished and nonimmunized. In Badakhshan province, the districts of Darwaz, Shegnan, Kishem, Khawhan, Kalafgan, Chal and Ishkamish were areas affected by the epidemic. On the other hand, in Samangan province the scene was worst in the district of Darra Souf. Likewise, in the western province of Afghanistan districts of Tolak and Kush Rabat Sango, child death due to measles were also reported. In response, the Global Alliance for Vaccines and Immunization announced that 25 million children would benefit from a donation of US$350 million annually.

  4. Imported Measles Outbreak in a University.

    ERIC Educational Resources Information Center

    Narain, Jai P.; And Others

    1985-01-01

    In 1981, a measles outbreak in an Arkansas university involved 16 students and 4 others. The first two cases were in students who had recently returned from Honduras. Only two of the students were considered adequately immunized. A voluntary immunization clinic held on campus resulted in 67 percent of 3,076 students being vaccinated. (Author/KH)

  5. Rubella (German Measles)

    MedlinePlus

    ... Old Feeding Your 1- to 2-Year-Old Rubella (German Measles) KidsHealth > For Parents > Rubella (German Measles) ... to Call the Doctor en español Rubéola About Rubella Rubella — commonly known as German measles or 3- ...

  6. Measles Elimination Activities in the Western Pacific Region: Experience from the Republic of Korea.

    PubMed

    Choe, Young June; Jee, Youngmee; Oh, Myoung-don; Lee, Jong-Koo

    2015-11-01

    We describe the global status of measles control and elimination, including surveillance and vaccination coverage data provided by the World Health Organization (WHO). Since 2000, two doses of measles vaccine (MCV2) became recommended globally and the achievement of high vaccination coverage has led to dramatic decrease in the measles incidence. Our finding indicates that, in the Western Pacific Region (WPR), substantial progress has been made to control measles transmission in some countries; however, the measles virus continues to circulate, causing outbreaks. The Republic of Korea (ROK) experienced a series of resurgence of measles due to the importation and healthcare-associated transmission in infants, however overall incidence and surveillance indicators met the WHO criteria for measles elimination. The ROK was verified to be measles-free along with Australia, Mongolia, and Macau, China in 2014. One of the effective elimination activities was the establishment of solid keep-up vaccination system in school settings. The lessons learnt from the measles elimination activities in Korea may contribute to enhancing the surveillance schemes and strengthening of vaccination programs in member countries and areas of WPR.

  7. Obstacles in measles elimination: an in-depth description of a measles outbreak in Ghent, Belgium, spring 2011

    PubMed Central

    2013-01-01

    Background From Mid-February to April 2011 one of the largest measles-outbreak in Flanders, since the start of the 2-dose vaccination scheme in 1995, took place in Ghent, Belgium. The outbreak started in a day care center, infecting children too young to be vaccinated, after which it spread to anthroposophic schools with a low measles, mumps and rubella vaccination coverage. This report describes the outbreak and evaluates the control measures and interventions. Methods Data collection was done through the system of mandatory notification of the public health authority. Vaccination coverage in the schools was assessed by a questionnaire and the electronic immunization database ‘Vaccinnet’. A case was defined as anyone with laboratory confirmed measles or with clinical symptoms and an epidemiological link to a laboratory confirmed case. Towards the end of the outbreak we only sought laboratory confirmation for persons with an atypical clinical presentation or without an epidemiological link. In search for an index patient we determined the measles IgG level of infants from the day care center. Results A total of 65 cases were reported of which 31 were laboratory confirmed. Twenty-five were confirmed by PCR and/or IgM. In 6 infants, too young to be vaccinated, only elevated measles IgG levels were found. Most cases (72%) were young children (0–9 years old). All but two cases were completely unimmunized. In the day care center all the infants who were too young to be vaccinated (N=14) were included as cases. Thirteen of them were laboratory confirmed. Eight of these infants were hospitalized with symptoms suspicious for measles. Vaccination coverage in the affected anthroposophic schools was low, 45-49% of the pupils were unvaccinated. We organized vaccination campaigns in the schools and vaccinated 79 persons (25% of those unvaccinated or incompletely vaccinated). Conclusions Clustering of unvaccinated persons, in a day care center and in anthroposophic schools

  8. Interchangeability of meningococcal group C conjugate vaccines with different carrier proteins in the United Kingdom infant immunisation schedule.

    PubMed

    Ladhani, Shamez N; Andrews, Nick J; Waight, Pauline; Hallis, Bassam; Matheson, Mary; England, Anna; Findlow, Helen; Bai, Xilian; Borrow, Ray; Burbidge, Polly; Pearce, Emma; Goldblatt, David; Miller, Elizabeth

    2015-01-29

    An open, non-randomised study was undertaken in England during 2011-12 to evaluate vaccine antibody responses in infants after completion of the routine primary infant immunisation schedule, which included two doses of meningococcal group C (MenC) conjugate (MCC) vaccine at 3 and 4 months. Any of the three licensed MCC vaccines could be used for either dose, depending on local availability. Healthy term infants registered at participating general practices (GPs) in Hertfordshire and Gloucestershire, UK, were recruited prospectively to provide a single blood sample four weeks after primary immunisation, which was administered by the GP surgery. Vaccination history was obtained at blood sampling. MenC serum bactericidal antibody (SBA) and IgG antibodies against Haemophilus influenzae b (Hib), pertussis toxin (PT), diphtheria toxoid (DT), tetanus toxoid (TT) and thirteen pneumococcal serotypes were analysed according to MCC vaccines received. MenC SBA responses differed significantly (P<0.001) according to MCC vaccine schedule as follows: MenC SBA geometric mean titres (GMTs) were significantly lower in infants receiving a diphtheria cross-reacting material-conjugated MCC (MCC-CRM) vaccine followed by TT-conjugated MCC (MCC-TT) vaccine (82.0; 95% CI, 39-173; n=14) compared to those receiving two MCC-CRM (418; 95% CI, 325-537; n=82), two MCC-TT (277; 95% CI, 223-344; n=79) or MCC-TT followed by MCC-CRM (553; 95% CI, 322-949; n=18). The same group also had the lowest Hib geometric mean concentrations (0.60 μg/mL, 0.27-1.34) compared to 1.85 μg/mL (1.23-2.78), 2.86 μg/mL (2.02-4.05) and 4.26 μg/mL (1.94-9.36), respectively. Our results indicate that MCC vaccines with different carrier proteins are not interchangeable. When several MCC vaccines are available, children requiring more than one dose should receive MCC vaccines with the same carrier protein or, alternatively, receive MCC-TT first wherever possible.

  9. The epidemiology of measles in Poland: prevalence of measles virus antibodies in the population.

    PubMed Central

    Janaszek, W.; Gut, W.; Gay, N. J.

    2000-01-01

    WHO has adopted a goal of eliminating indigenous measles from the European Region by the year 2007. The strategy focuses on reducing the proportion of susceptible individuals in the population to low levels and maintaining these low levels of susceptibility. Routine vaccination against measles for children aged 13-15 months was introduced in Poland in 1975, and a second dose added in 1991. High coverage (> 95%) is achieved with both doses. In order to assess progress towards measles elimination in Poland, a serological survey was performed to evaluate the impact of vaccination on the susceptibility profile of population. Three thousand residual serum samples from individuals aged 1-30 years were collected from hospitals in six selected voivodeships (administration units) in Poland. These were tested for measles-specific IgG using a commercial ELISA. Overall 4% (120/3000) were negative for measles virus antibody. The highest proportion of negatives (8.2%) occurred among cohorts born 1977-81--the only cohorts in which susceptibility exceeded the WHO targets. 'Catch-up' vaccination strategies should target these cohorts. PMID:11117962

  10. Comparison of accelerated and rapid schedules for monovalent hepatitis B and combined hepatitis A/B vaccines in children with cancer.

    PubMed

    Köksal, Yavuz; Varan, Ali; Aydin, G Burca; Sari, Neriman; Yazici, Nalan; Yalcin, Bilgehan; Kutluk, Tezer; Akyuz, Canan; Büyükpamukçu, Münevver

    2007-12-01

    The aim of this study was to determine the efficacy of immunization against hepatitis A and B infections with "rapid" or "accelerated" schedules in children with cancer receiving chemotherapy. Fifty-one children were recruited to receive either vaccination schedule, in the "rapid vaccination schedule"; hepatitis B (group I) or combined hepatitis A/B vaccines (group III) were administered at months 0, 1, 2, and 12; in the "accelerated vaccination schedule," hepatitis B (group II) or combined hepatitis A/B (group IV) vaccines were administered on days 0, 7, 21, and 365 intramuscularly. The seroconversion rates at months 1 and 3 were 35.7 and 57.1% in group I and 25 and 18.8% in group II, respectively. Group I developed higher seroconversion rates at month 3. In group III the seroconversion rates for hepatitis B at months 1 and 3 were 54.5 and 60% and in group IV 50 and 70%, respectively. For hepatitis A, the seroconversion rates at months 1 and 3 were 81.8 and 90% in group III and 80 and 88.9% in group IV, respectively. The accelerated vaccination schedule seems to have no advantage in children receiving cancer chemotherapy except for high antibody levels at month 1. In conclusion, the accelerated vaccination schedules are not good choices for cancer patients. The combined hepatitis A/B vaccine is more effective than monovalent vaccine in cancer patients, which probably can be explained by an adjuvant effect of the antigens. The seroconversion of hepatitis A by the combined hepatitis A/B vaccination is very good in cancer patients.

  11. Malnutrition and overcrowding/intensive exposure in severe measles infection: review of community studies.

    PubMed

    Aaby, P

    1988-01-01

    Most hospital studies of measles mortality suggest that high case fatality ratios are associated with malnutrition. However, no community study has documented this association. On the contrary, several community studies from Africa and Asia have found no relation between nutritional status and risk of severe or fatal measles. Instead, overcrowding and intensive exposure may be more important determinants of measles mortality. Clustering of several cases in the family and/or intensive exposure were associated with high measles mortality in community studies in West Africa, Bangladesh, and England. Thus sociocultural factors that concentrate many susceptible children in the home may increase the case-fatality ratio in measles. Conversely, this ratio will be lower when measles cases are dispersed. Siblings in rural areas, where long intervals separate epidemics, run a higher risk of contracting measles simultaneously than do their urban counterparts. Measles vaccination increases herd immunity and diminishes the clustering of several cases in a family. Vaccination may therefore reduce mortality even among unvaccinated children who contract measles. Crowding and intensive exposure may partly explain regional and historical variations in measles mortality; community studies suggest that mortality is high when a high proportion of measles patients have secondary cases (acquired through exposure at home).

  12. Measles control and elimination in Somalia: the good, the bad, and the ugly.

    PubMed

    Kamadjeu, Raoul; Assegid, Kebede; Naouri, Boubker; Mirza, Imran Raza; Hirsi, Abdurazak; Mohammed, Abdurahman; Omer, Mohammed; Dualle, Abdi Hassan; Mulugeta, Abraham

    2011-07-01

    Despite enormous challenges, Somalia has been successfully implementing accelerated measles control activities since 2005. Through innovative strategies and with the support of local and international partners, the country has shown potentials of implementing measles mortality reduction activities in complex emergencies. Measles incidence has been reduced by >80% after the measles catch-up campaigns of 2005-2007, and national reported measles routine immunization coverage with first dose measles containing vaccine has reached 59% for the first time in 2009. However, the near collapse of the health care system and the ongoing insecurity continue to hamper the implementation of recommended measles control and elimination strategies in some parts of the country, making these achievements fragile. Somalia exemplifies the challenges in meeting measles elimination goals in the World Health Organization Eastern Mediterranean region. As the region is entering its 2010 measles elimination goals, it appears necessary to establish realistic and flexible interim goals for measles control in Somalia that will take into consideration the specificities of the country. Maintaining flexibility in conducting field operations, securing financial resources, multiplying opportunities for measles vaccination, and improving disease monitoring systems will remain vital to sustain and improve current achievements.

  13. Monte Carlo simulation of the transmission of measles: Beyond the mass action principle

    NASA Astrophysics Data System (ADS)

    Zekri, Nouredine; Clerc, Jean Pierre

    2002-04-01

    We present a Monte Carlo simulation of the transmission of measles within a population sample during its growing and equilibrium states by introducing two different vaccination schedules of one and two doses. We study the effects of the contact rate per unit time ξ as well as the initial conditions on the persistence of the disease. We found a weak effect of the initial conditions while the disease persists when ξ lies in the range 1/L-10/L (L being the latent period). Further comparison with existing data, prediction of future epidemics and other estimations of the vaccination efficiency are provided. Finally, we compare our approach to the models using the mass action principle in the first and another epidemic region and found the incidence independent of the number of susceptibles after the epidemic peak while it strongly fluctuates in its growing region. This method can be easily applied to other human, animal, and plant diseases and includes more complicated parameters.

  14. Two measles outbreaks after importation--Utah, March-June 2011.

    PubMed

    2013-03-29

    Before licensure of a measles vaccine in 1963, more than 500,000 measles cases on average were reported in the United States each year during 1951-1962. By 1993, through measles vaccination and control efforts, only 312 cases were reported nationwide. In 2000, the last year in which an outbreak had occurred in Utah, measles was declared "not endemic in the United States," but measles importations continue to occur, leading to outbreaks, especially among unvaccinated persons. Many U.S. health-care personnel have never seen a measles patient, which might hamper diagnosis and delay reporting. During March-June 2011, local health departments collaborated with the state health department in Utah to investigate two measles outbreaks comprising 13 confirmed cases. The first outbreak, with seven confirmed cases, was associated with an unvaccinated U.S. resident who traveled internationally; the second, with six confirmed cases, had an undetermined source. The genotype D4 sequences obtained from these two outbreaks differed by a single nucleotide, suggesting two separate importations. Health-care providers should remind their patients of the importance of being current with measles, mumps, and rubella (MMR) vaccination; this is especially important before international travel. Measles should be considered in the differential diagnosis of febrile rash illness, especially in unvaccinated persons with recent international travel. Reporting a confirmed or suspected case immediately to public health authorities is critical to limit the spread of measles.

  15. Measles-rubella mass immunization campaign in Albania, November 2000.

    PubMed

    Bino, Silvia; Kakarriqi, Eduard; Xibinaku, Miriam; Ion-Nedelcu, Nicolae; Bukli, Mariana; Emiroglu, Nedret; Uzicanin, Amra

    2003-05-15

    In 2000, Albania resolved to eliminate measles by 2007 by use of a four-step program: by conducting a "catch-up" vaccination campaign for all children aged 1-14 years, achieving and sustaining high coverage (>/=95%) among children aged 1 year with the first dose of a measles-containing vaccine, by introducing a routine second dose of measles-containing vaccine for children at age 5 years, and by improving measles surveillance. This catch-up campaign took place in November 2000: 867,000 doses of measles-rubella vaccine were administered for an estimated coverage of 99%. In all, 231 campaign-related adverse events were reported: syncope, 206; allergic reactions, 10; fever, 8; encephalitis/encephalopathy, 2; and aseptic meningitis, seizures, Guillain-Barré syndrome, anaphylaxis, and arthralgia, 1 each. All resolved without sequelae. This report describes the status of measles and rubella/congenital rubella syndrome control in Albania before 2000 and reports on implementation of the catch-up campaign.

  16. About Rubella (German Measles, Three-Day Measles)

    MedlinePlus

    ... CDC Cancel Submit Search The CDC Rubella (German Measles, Three-Day Measles) Note: Javascript is disabled or is not supported ... Q&A References & Resources Related Link Global Health – Measles, Rubella, and Congenital Rubella Syndrome (CRS) About Rubella ...

  17. [Measles and subcutaneous emphysema. Presentation of 3 cases].

    PubMed

    Montesano-Delfín, J R; Mascareñas-Ponce, A

    1991-03-01

    This is a three case study report of children with measles which later progressed to bronchopneumonia and subcutaneous emphysema. All three children were from farming families, and none had been previously vaccinate against measles. For a period of six months, 183 cases of measles were treated at our hospital of which only three worsened to subcutaneous emphysema, demonstrating an incidence rate of 1.6%; they also showed to have bronchopneumonia, with severe coughing episodes; which made us recall the possible physiopathology principle of the pressure gradient theory behind this complication proposed by Bloch in 1968. The factors related to our patients suggested a more severe and aggresive type of measles with a greater probability of having complications. The prognostic value of the severity of this type of measles in the presence of subcutaneous emphysema is limited and its management should be primarly focused on treating the added bronchial problem.

  18. Immunization Schedules for Adults

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Adults in Easy-to-read Formats ... previous immunizations. View or Print a Schedule Recommended Immunizations for Adults (19 Years and Older) by Age ...

  19. Lack of Measles Transmission to Susceptible Contacts from a Health Care Worker with Probable Secondary Vaccine Failure - Maricopa County, Arizona, 2015.

    PubMed

    Jones, Jefferson; Klein, Ron; Popescu, Saskia; Rose, Karen; Kretschmer, Melissa; Carrigan, Alice; Trembath, Felicia; Koski, Lia; Zabel, Karen; Ostdiek, Scott; Rowell-Kinnard, Paula; Munoz, Esther; Sunenshine, Rebecca; Sylvester, Tammy

    2015-08-07

    On January 23, 2015, the Maricopa County Department of Public Health (MCDPH) was notified of a suspected measles case in a nurse, a woman aged 48 years. On January 11, the nurse had contact with a patient with laboratory-confirmed measles associated with the Disneyland theme park-related outbreak in California. On January 21, she developed a fever (103°F [39.4°C]), on January 23 she experienced cough and coryza, and on January 24, she developed a rash. The patient was instructed to isolate herself at home. On January 26, serum, a nasopharyngeal swab, and a urine specimen were collected. The following day, measles infection was diagnosed by real time reverse transcription polymerase chain reaction testing of the nasopharyngeal swab and urine specimen and by detection of measles-specific immunoglobulin (Ig)M and IgG in serum by enzyme-linked immunosorbent assay. Because of her symptoms and laboratory results, the patient was considered to be infectious.

  20. Progress in implementing measles mortality reduction strategies--India, 2010-2011.

    PubMed

    2011-09-30

    In 2005, an estimated 92,000 deaths occurred in India from measles among children aged <5 years. Estimates from 2008 indicate that 77% of global measles mortality was attributable to measles deaths in the World Health Organization (WHO) South-East Asia Region, the majority of which occurred in India. These figures highlight the importance of India in attaining regional and global measles mortality reduction targets. In 2008, the Indian National Technical Advisory Group on Immunization (NTAGI) recommended introduction of a second dose of measles-containing vaccine (MCV2), delivered through routine vaccination in states with ≥80% coverage with the first dose of measles-containing vaccine (MCV1), or through mass vaccination campaigns in states with <80% MCV1 coverage. Based on these recommendations, the government of India initiated MCV2 introduction in late 2010. This report provides an update on MCV1 coverage, progress in implementing MCV2, and measles outbreak surveillance activities conducted in eight states during 2006-2010. India has initiated implementation of a measles mortality reduction strategy, but the pace of implementation is variable across states. Strong national and state leadership and commitment to rapid reduction of measles mortality are essential to achieve the full benefits of this strategy.

  1. Administration of thimerosal-containing vaccines to infant rhesus macaques does not result in autism-like behavior or neuropathology.

    PubMed

    Gadad, Bharathi S; Li, Wenhao; Yazdani, Umar; Grady, Stephen; Johnson, Trevor; Hammond, Jacob; Gunn, Howard; Curtis, Britni; English, Chris; Yutuc, Vernon; Ferrier, Clayton; Sackett, Gene P; Marti, C Nathan; Young, Keith; Hewitson, Laura; German, Dwight C

    2015-10-06

    Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder. Some anecdotal reports suggest that ASD is related to exposure to ethyl mercury, in the form of the vaccine preservative, thimerosal, and/or receiving the measles, mumps, rubella (MMR) vaccine. Using infant rhesus macaques receiving thimerosal-containing vaccines (TCVs) following the recommended pediatric vaccine schedules from the 1990s and 2008, we examined behavior, and neuropathology in three brain regions found to exhibit neuropathology in postmortem ASD brains. No neuronal cellular or protein changes in the cerebellum, hippocampus, or amygdala were observed in animals following the 1990s or 2008 vaccine schedules. Analysis of social behavior in juvenile animals indicated that there were no significant differences in negative behaviors between animals in the control and experimental groups. These data indicate that administration of TCVs and/or the MMR vaccine to rhesus macaques does not result in neuropathological abnormalities, or aberrant behaviors, like those observed in ASD.

  2. Business travelers: vaccination considerations for this population.

    PubMed

    Chen, Lin H; Leder, Karin; Wilson, Mary E

    2013-04-01

    Illness in business travelers is associated with reduced productivity on the part of the employee as well as the employer. Immunizations offer a reliable method of preventing infectious diseases for international business travelers. The authors review the travel patterns of business travelers, available data on illnesses they encounter, their potential travel-associated risks for vaccine-preventable diseases and recommendations on immunizations for this population. Routine vaccines (e.g., measles, tetanus and influenza) should be reviewed to assure that they provide current coverage. The combined hepatitis A and hepatitis B vaccine with a rapid schedule offers options for those with time constraints. Other vaccine recommendations for business travelers need to focus on their destinations and activities and underlying health, taking into account the concept of cumulative risk for those with frequent travel, multiple trips or long stays.

  3. Study of a measles outbreak in Granada with preventive measures applied by the courts, Spain, 2010 to 2011.

    PubMed

    Navarro, E; Mochón, M M; Galicia, M D; Marín, I; Laguna, J

    2013-10-24

    Measles had practically been eliminated in Granada since the systematic vaccination of children with two doses introduced in 1984. However, in 2009 the disease returned in the form of small outbreaks. This study describes the measles outbreak that occurred in Granada from October 2010 to August 2011 and the measures imposed to control it. Information was sourced from the records of the Andalusian epidemiological surveillance system. A total of 308 cases were recorded, representing an incidence rate of 33.6 cases per 100,000 inhabitants. The first wave of the epidemic took place in Granada city, with the majority of cases occurring among families who lived in the Albaycín neighbourhood and were opposed to vaccination for ideological and/or religious reasons. The initial cases were in unvaccinated children aged 1 to 13 years. The outbreak later spread throughout the province. To control the outbreak, the vaccination schedule for the exposed children was brought up to date. The Regional Ministry of Health decided to take legal action in order to ensure vaccination of those in the initial nucleus of the outbreak.

  4. Field study on the efficacy of two different vaccination schedules with HYORESP in a Mycoplasma hyopneumoniae-infected commercial pig unit.

    PubMed

    Kyriakis, S C; Alexopoulos, C; Vlemmas, J; Sarris, K; Lekkas, S; Koutsoviti-Papadopoulou, M; Saoulidis, K

    2001-11-01

    A trial was carried out with HYORESP a Mycoplasma hyopneumoniae (M. hyo) vaccine in order to confirm the benefit of vaccination under field conditions in a commercial industrial farrow-to-finish unit, contaminated with M. hyo. Infection with M. hyo was confirmed through positive blood and colostrum samples [enzyme-linked immunosorbent assay (ELISA) test] combined with positive gross lesions of the lung at slaughter. Two different vaccination schedules were tested. Pigs were randomly allocated to three groups: control non-vaccinated group (n = 130, given a placebo injection at 3, 25 and 70 days of age); early vaccinated group (n = 128, given vaccination at 3 and 25 days of age and a placebo at 70 days of age); late vaccinated group (n = 132, given a placebo at 3 and 25 days of age and vaccination at 70 days of age). Both growth rate and feed conversion ratio were signifcantly (P < 0.05) improved in the vaccinated groups compared with the control group. The lung lesion score was also significantly (P < 0.05) improved in both vaccinated groups. In this trial, it was clearly demonstrated that vaccination is highly effective in improving performance in pig units infected with M. hyo. The improvement in the feed conversion ratio in the vaccinated groups was especially impressive: -0.411 (13% improvement) in the group vaccinated twice at 3 and 25 days of age; -0.162 (5% improvement) in the group vaccinated once at 70 days of age. Performances were better when two shots were given early in life compared with one shot later--probably due to an infection taking place rather early in life for most of the pigs. Moreover, a significant reduction in the cost of supportive (injectable) medication was noticed in vaccinated pigs. In conclusion, HYORESP proved to be a very efficacious tool to control M. hyo in infected herds with its remarkable flexibility that allows the vaccination schedule to be adapted to the specific field conditions.

  5. Overcoming barriers to HPV vaccination: non-inferiority of antibody response to human papillomavirus 16/18 vaccine in adolescents vaccinated with a two-dose vs. a three-dose schedule at 21 months.

    PubMed

    Lazcano-Ponce, Eduardo; Stanley, Margaret; Muñoz, Nubia; Torres, Leticia; Cruz-Valdez, Aurelio; Salmerón, Jorge; Rojas, Rosalba; Herrero, Rolando; Hernández-Ávila, Mauricio

    2014-02-03

    For middle and low-income countries, the cost of HPV vaccines remains challenging. We conducted an open-label nonrandomized clinical trial evaluating immune response to the HPV-16/18 AS04-adjuvanted vaccine administered on a standard (months (M) 0-1-6) versus extended schedule (M 0-6-60) at 7, 21, 60, 72 and 120 months post-vaccination. Participants were females recruited in Morelos, Mexico: 474 girls aged 9-10 years and 500 women aged 18-24 years receiving a standard schedule, and 1026 girls aged 9-10 years receiving an extended schedule (currently the girls in the extended schedule had received only the first 2 doses). This report presents the interim analysis results for non-inferiority between the regimes conducted with the current available data at 21 months after the first dose, with serum antibodies assessed by ELISA. A pre-stated margin of non-inferiority was defined by post-vaccination geometric mean titer (GMT) ratio (upper 95% confidence interval [CI]≤2.0) between the standard and the two-dose schedule in girls at month 21. Immune response to the vaccine was strongest in adolescent girls and in the 3-dose group. Statistical non-inferiority of the two-dose versus three-dose groups was demonstrated. At 21 months, comparing the adolescent 2-dose versus 3-dose groups, the GMT ratio and 95% CI were 1.66 (1.55-1.81) and 1.67 (1.51-1.86) for HPV16 and 18, respectively. The two-dose regimen was non-inferior when compared to the three-dose response in same-age girls and with women aged 18-24 years after 21 months of follow-up. The reduction in the number of doses from the current three-dose schedule may lower overall costs associated with the vaccination and increase accessibility and compliance with the recommended dosing of the HPV vaccine.

  6. Sustained outbreak of measles in New South Wales, 2012: risks for measles elimination in Australia

    PubMed Central

    Hope, Kirsty; Clark, Penelope; Nguyen, Oanh; Rosewell, Alexander; Conaty, Stephen

    2014-01-01

    Objective On 7 April 2012, a recently returned traveller from Thailand to Australia was confirmed to have measles. An outbreak of measles subsequently occurred in the state of New South Wales, prompting a sustained and coordinated response by public health authorities. The last confirmed case presented on 29 November 2012. This report describes the outbreak and its characteristics. Methods Cases were investigated following Australian protocols, including case interviews and assessment of contacts for post-exposure prophylaxis. Results Of the 168 cases identified, most occurred in south-western and western Sydney (92.9%, n = 156). Notable features of this outbreak were the disproportionately high number of cases in the 10–19-year-old age group (29.2%, n = 49), the overrepresentation among people of Pacific Islander descent (21.4%, n = 36) and acquisition in health-care facilities (21.4%, n = 36). There were no reported cases of encephalitis and no deaths. Discussion: This was the largest outbreak of measles in Australia since 1997. Its occurrence highlights the need to maintain vigilant surveillance systems for early detection and containment of measles cases and to maintain high population immunity to measles through routine childhood immunization. Vaccination campaigns targeting susceptible groups may also be necessary to sustain Australia’s measles elimination status. PMID:25635228

  7. Photos of Measles and People with Measles

    MedlinePlus

    ... Lab Tools Serology Specimens for Detection by RT-PCR or Virus Isolation Measles Lab Manual Vero/hSLAM ... Help: How do I view different file formats (PDF, DOC, PPT, MPEG) on this site? Adobe PDF ...

  8. The measles outbreak in Bulgaria, 2009-2011: An epidemiological assessment and lessons learnt.

    PubMed

    Muscat, Mark; Marinova, Lili; Mankertz, Annette; Gatcheva, Nina; Mihneva, Zafira; Santibanez, Sabine; Kunchev, Angel; Filipova, Radosveta; Kojouharova, Mira

    2016-01-01

    Measles re-emerged in a nationwide outbreak in Bulgaria from 2009 to 2011 despite reported high vaccination coverage at national level. This followed an eight-year period since the last indigenous cases of measles were detected. The Bulgarian National Centre of Infectious and Parasitic Diseases collated measles surveillance data for 2009-2011. We analysed data for age group, sex, ethnicity, diagnosis confirmation, vaccination, hospitalisation, disease complications, and death and describe the outbreak control measures taken. The outbreak started in April 2009 following an importation of measles virus and affected 24,364 persons, predominantly Roma. Most cases (73%) were among children < 15 years old. Vaccination status was available for 52% (n = 12,630) of cases. Of children 1-14 years old, 22% (n = 1,769) were unvaccinated and 70% (n = 5,518) had received one dose of a measles-containing vaccine. Twenty-four measles-related deaths were reported. The Roma ethnic group was particularly susceptible to measles. The magnitude of the outbreak resulted primarily from the accumulation of susceptible children over time. This outbreak serves as a reminder that both high vaccination coverage and closing of immunity gaps across all sections of the population are crucial to reach the goal of measles elimination.

  9. Decline in measles case fatality ratio after the introduction of measles immunization in rural Senegal.

    PubMed

    Samb, B; Aaby, P; Whittle, H; Seck, A M; Simondon, F

    1997-01-01

    The epidemiology of measles has been investigated in Niakhar, a rural area of Senegal, during two periods, 1983-1986 and 1987-1990. Following a major increase in immunization coverage beginning in 1987, the case fatality ratio for all ages declined fourfold from the first to the second period (relative risk (RR) = 0.24, 95% confidence interval (CI) 0.13-0.46). The measles incidence for children under 10 years of age declined by 69% (95% CI 65-72) and the risk of dying of measles by 91% (95% CI 82-95). Vaccinated children who contracted measles had significantly lower case fatality ratio than unvaccinated children with measles (p = 0.038). Children infected by an immunized case tended to have lower case fatality ratio than those infected by an unimmunized index case (p = 0.104) and immunized index cases generated fewer secondary cases than unimmunized index cases (p < 0.001). Respiratory complications were more common in secondary cases infected by an index case with respiratory complications than by an index case without such complications (RR = 1.60, 95% CI 1.08-2.37), which suggests that severe cases give rise to further severe cases. As expected, there was a significant increase in the proportion of vaccinated cases in the second period (RR = 1.41, 95% CI 1.00-1.98). Mean age at infection increased from 4 to 7 years between the two periods and the change in age structure accounted for 20% of the decline in case fatality ratio. Measles immunization may contribute to lower mortality directly through reduced incidence and indirectly through increases in age at infection, less severe infection for immunized cases and changes in transmission patterns leading to reduced severity of measles.

  10. [Advances in measles virus for cancer therapy].

    PubMed

    Zhou, Duo; Zhao, Zheng-yan

    2015-07-01

    Oncolytic virotherapy is a novel cancer therapy. Vaccine-attenuated strains of measles virus(MV)is an ideal candidate for oncolytic virotherapy which has an excellent safety record. Vaccine-attenuated MV uses CD46 and Nectin-4 molecule as major entry receptors into cells. Vaccine-attenuated MV can selectively infect and kill a wide variety of cancer cells in vitro and in vivo. With the development of molecular cloning, scientists have successfully rescued cDNA of vaccine-attenuated MV and increased its oncolytic efficiency with molecular engineering techniques. Phase I clinical trials of virotherapy for ovarian cancer and multiple myeloma with vaccine-attenuated MV are underway. The preliminary results indicate the promising antitumor potential of vaccine-attenuated MV.

  11. Antibody neutralization of retargeted measles viruses.

    PubMed

    Lech, Patrycja J; Pappoe, Roland; Nakamura, Takafumi; Tobin, Gregory J; Nara, Peter L; Russell, Stephen J

    2014-04-01

    The measles virus (MV) vaccine lineage is a promising oncolytic but prior exposure to the measles vaccine or wild-type MV strains limits treatment utility due to the presence of anti-measles antibodies. MV entry can be redirected by displaying a polypeptide ligand on the Hemagglutinin (H) C-terminus. We hypothesized that retargeted MV would escape neutralization by monoclonal antibodies (mAbs) recognizing the H receptor-binding surface and be less susceptible to neutralization by human antisera. Using chimeric H proteins, with and without mutations that ablate MV receptor binding, we show that retargeted MVs escape mAbs that target the H receptor-binding surface by virtue of mutations that ablate infection via SLAM and CD46. However, C-terminally displayed domains do not mediate virus entry in the presence of human antibodies that bind to the underlying H domain. In conclusion, utility of retargeted oncolytic measles viruses does not extend to evasion of human serum neutralization.

  12. Acute Measles Encephalitis in an Immigrant Syrian Child: Case Report and Review of the Literature.

    PubMed

    Al-Qayoudhi, Abdullah; Al-Kindi, Hanan; Meki, Nabil; Al-Maani, Amal

    2016-03-01

    The introduction of measles vaccination programs and broad coverage worldwide has meant this infection a rare encounter for pediatricians. In Oman, with almost 100% measles vaccination coverage for children, this infection disappeared from the list of fever and rash differential diagnoses. Encephalitis is a well-known complication of measles infection and sometimes can be the only manifestation especially in adults. We report a seven-year-old Syrian immigrant who was admitted to the Royal Hospital, Muscat, with acute encephalitis secondary to wild measles infection. Although she had a classical presentation of measle infection, the diagnosis was missed in the private and regional hospital she attended before getting referred to Royal Hospital. She was later identified to be exposed to an outbreak of the infection in an unvaccinated population. Magnetic resonance imaging showed high signal intensity of both basal ganglia suggestive of measles encephalitis. The diagnosis was confirmed by detection of measles virus from her urine and blood, and a throat swab. The isolated measles virus was D8 serotype, which was prevalent in Syria around the same time. The child was treated with steroids and vitamin A. She achieved full recovery despite her severe presentation. A high degree of suspicion for measles infection should be maintained in unvaccinated children with a compatible presentation of the infection or its complications. There might be a role for steroid use in cases of acute measles encephalitis.

  13. An exploration of individual- and population-level impact of the 2-dose HPV vaccination schedule in pre-adolescent girls.

    PubMed

    Donken, Robine; Bogaards, Johannes A; van der Klis, Fiona R M; Meijer, Chris J L M; de Melker, Hester E

    2016-06-02

    Since 2014, several countries have implemented a 2-dose schedule for Human papillomavirus (HPV) vaccination. Licensure of the 2-dose schedule was based on non-inferiority results from immunobridging studies, comparing the antibody levels of the 2-dose schedule in young girls to those of the 3-dose schedule in young adults. Since licensure, additional data on antibody levels and other aspects of the immune response and clinical effectiveness have become available. This review will discuss the current outcomes on immunogenicity and effectiveness together with an exploration on the population impact of 2-dose schedules from a cost-effectiveness perspective. The 2-dose schedule has important benefits, such as easier logistics, reduced expenditure, potentially higher acceptance and fewer side effects. Policymakers and registration authorities should consider whether these benefits outweigh the likely differences on individual- and population-level impact between the 2- and 3-dose schedules.

  14. Examination of the Safety of Pediatric Vaccine Schedules in a Non-Human Primate Model: Assessments of Neurodevelopment, Learning, and Social Behavior

    PubMed Central

    Curtis, Britni; Liberato, Noelle; Rulien, Megan; Morrisroe, Kelly; Kenney, Caroline; Yutuc, Vernon; Ferrier, Clayton; Marti, C. Nathan; Mandell, Dorothy; Burbacher, Thomas M.; Sackett, Gene P.

    2015-01-01

    Background In the 1990s, the mercury-based preservative thimerosal was used in most pediatric vaccines. Although there are currently only two thimerosal-containing vaccines (TCVs) recommended for pediatric use, parental perceptions that vaccines pose safety concerns are affecting vaccination rates, particularly in light of the much expanded and more complex schedule in place today. Objectives The objective of this study was to examine the safety of pediatric vaccine schedules in a non-human primate model. Methods We administered vaccines to six groups of infant male rhesus macaques (n = 12–16/group) using a standardized thimerosal dose where appropriate. Study groups included the recommended 1990s Pediatric vaccine schedule, an accelerated 1990s Primate schedule with or without the measles–mumps–rubella (MMR) vaccine, the MMR vaccine only, and the expanded 2008 schedule. We administered saline injections to age-matched control animals (n = 16). Infant development was assessed from birth to 12 months of age by examining the acquisition of neonatal reflexes, the development of object concept permanence (OCP), computerized tests of discrimination learning, and infant social behavior. Data were analyzed using analysis of variance, multilevel modeling, and survival analyses, where appropriate. Results We observed no group differences in the acquisition of OCP. During discrimination learning, animals receiving TCVs had improved performance on reversal testing, although some of these same animals showed poorer performance in subsequent learning-set testing. Analysis of social and nonsocial behaviors identified few instances of negative behaviors across the entire infancy period. Although some group differences in specific behaviors were reported at 2 months of age, by 12 months all infants, irrespective of vaccination status, had developed the typical repertoire of macaque behaviors. Conclusions This comprehensive 5-year case–control study, which closely examined

  15. Monitoring progress toward measles elimination by genetic diversity analysis of measles viruses in China 2009-2010.

    PubMed

    Zhang, Y; Wang, H; Xu, S; Mao, N; Zhu, Z; Shi, J; Huang, G; Liu, C; Bo, F; Feng, D; Lu, P; Liu, Y; Wang, Y; Lei, Y; Chen, M; Chen, H; Wang, C; Fu, H; Li, C; He, J; Gao, H; Gu, S; Wang, S; Ling, H; Liu, Y; Ding, Z; Ba, Z; Feng, Y; Zheng, H; Tang, X; Lei, Y; Xiong, Y; Bellini, W J; Rota, P A; Jee, Y; Xu, W

    2014-09-01

    With the achievement of high coverage for routine immunization and supplementary immunization activities (SIAs), measles incidence in mainland China reached its lowest level in 2010. The proportion of measles cases in the vaccination-targeted population decreased during 2007-2010 after the SIAs. More than 60% of measles cases were in adults or infants, especially in the coastal and eastern provinces during 2009 and 2010. A total 567 isolates of measles virus were obtained from clinical specimens from 27 of 31 provinces in mainland China during 2009 and 2010. Except for two vaccine-associated cases, one genotype D4 strain, two genotype D9 strains, and four genotype D11 strains, the other 558 strains were genotype H1 cluster H1a. Genotype H1 has been the only endemic genotype detected in China since surveillance began in 1993. Only genotype H1 was found in mainland China during 1993-2008, except for one detection of genotype H2. More recently, multiple genotypes of imported measles were detected even with the background of endemic genetotype H1 viruses. Analysis of the 450-nucleotide sequencing window of the measles virus N gene showed that the overall genetic diversity of the recent geneotype H1 strains decreased between 2008 and 2010. The lower genetic diversity of H1 strains suggested that enhanced vaccination may have reduced the co-circulating lineages of endemic genotype H1 strains in mainland China.

  16. An outbreak of measles in an undervaccinated community.

    PubMed

    Gahr, Pamala; DeVries, Aaron S; Wallace, Gregory; Miller, Claudia; Kenyon, Cynthia; Sweet, Kristin; Martin, Karen; White, Karen; Bagstad, Erica; Hooker, Carol; Krawczynski, Gretchen; Boxrud, David; Liu, Gongping; Stinchfield, Patricia; LeBlanc, Julie; Hickman, Cynthia; Bahta, Lynn; Barskey, Albert; Lynfield, Ruth

    2014-07-01

    Measles is readily spread to susceptible individuals, but is no longer endemic in the United States. In March 2011, measles was confirmed in a Minnesota child without travel abroad. This was the first identified case-patient of an outbreak. An investigation was initiated to determine the source, prevent transmission, and examine measles-mumps-rubella (MMR) vaccine coverage in the affected community. Investigation and response included case-patient follow-up, post-exposure prophylaxis, voluntary isolation and quarantine, and early MMR vaccine for non-immune shelter residents >6 months and <12 months of age. Vaccine coverage was assessed by using immunization information system records. Outreach to the affected community included education and support from public health, health care, and community and spiritual leaders. Twenty-one measles cases were identified. The median age was 12 months (range, 4 months to 51 years) and 14 (67%) were hospitalized (range of stay, 2-7 days). The source was a 30-month-old US-born child of Somali descent infected while visiting Kenya. Measles spread in several settings, and over 3000 individuals were exposed. Sixteen case-patients were unvaccinated; 9 of the 16 were age-eligible: 7 of the 9 had safety concerns and 6 were of Somali descent. MMR vaccine coverage among Somali children declined significantly from 2004 through 2010 starting at 91.1% in 2004 and reaching 54.0% in 2010 (χ(2) for linear trend 553.79; P < .001). This was the largest measles outbreak in Minnesota in 20 years, and aggressive response likely prevented additional transmission. Measles outbreaks can occur if undervaccinated subpopulations exist. Misunderstandings about vaccine safety must be effectively addressed.

  17. Effect of schedule on reactogenicity and antibody persistence of acellular and whole-cell pertussis vaccines: value of laboratory tests as predictors of clinical performance.

    PubMed

    Miller, E; Ashworth, L A; Redhead, K; Thornton, C; Waight, P A; Coleman, T

    1997-01-01

    The performance of four acellular pertussis vaccines containing between two and five pertussis antigens combined with diphtheria and tetanus toxoids was compared with that of British whole-cell diphtheria/tetanus/pertussis (DTP) vaccine both in laboratory assays for potency, toxicity and immunogenicity, and for reactogenicity and immunogenicity in infants. Clinical responses were evaluated in double blind randomized Phase II trials using 3/5/9 month and 2/3/4 month schedules. The acellular DTPs had much lower toxicity than whole-cell DTP in laboratory tests and were significantly less pyrogenic than whole-cell DTP under both schedules. Local reactions were not consistently lower in acellular than whole-cell vaccinees and varied with the source of the diphtheria and tetanus antigens used. Differences in endotoxin level and content of active pertussis toxin (PT) between acellular DTP vaccines were not clinically significant. The reactogenicity advantage of the acellular vaccines was substantially reduced under the 2/3/4 month schedule due to the reduced reactogenicity of the whole-cell DTP vaccine when given at a younger age. There was no relationship between antigen content measured in micrograms per dose and ELISA antibody responses to filamentous haemagglutinin (FHA) and PT in infants, nor was murine immunogenicity predictive of immunogenicity in humans. Antibody response to PT was attenuated in the whole-cell group under the 2/3/4 month schedule but was unaffected in the group receiving acellular vaccines with individually purified components; antibody response to pertactin (69 kDa antigen) was similar in recipients of the whole-cell and component acellular vaccines under the 2/3/4 month schedule. PT antibody persistence until 4-5 years of age was significantly better in recipients of the component acellular than either the whole-cell vaccine or the co-purified acellular vaccine under the 3/5/9 month schedule. However, diphtheria antitoxin levels were reduced in

  18. Human Vaccines & Immunotherapeutics

    PubMed Central

    Riedmann, Eva M

    2014-01-01

    Measles vaccination: Targeted and non-targeted benefits CDC reports: 2-dose regimen of chickenpox vaccine is a success Positive preliminary results from the CAPiTA study Seasonal flu vaccine associate with reduced stroke risk HPV vaccine shown to halve cervical abnormalities Global prize for mobile mast vaccine storage project Developmental pathway of potent HIV-neutralizing antibodies Burkholderia vaccine: US Dep of Defense collaborates with Bavarian Nordic

  19. Extensive Nosocomial Transmission of Measles Originating in Cruise Ship Passenger, Sardinia, Italy, 2014.

    PubMed

    Filia, Antonietta; Bella, Antonino; Cadeddu, Giovanna; Milia, Maria Rafaela; Del Manso, Martina; Rota, Maria Cristina; Magurano, Fabio; Nicoletti, Loredana; Declich, Silvia

    2015-08-01

    We report a measles outbreak in Sardinia, Italy, that originated in a cruise ship passenger. The outbreak showed extensive nosocomial transmission (44 of 80 cases). To minimize nosocomial transmission, health care facilities should ensure that susceptible health care workers are vaccinated against measles and should implement effective infection control procedures.

  20. Extensive Nosocomial Transmission of Measles Originating in Cruise Ship Passenger, Sardinia, Italy, 2014

    PubMed Central

    Bella, Antonino; Cadeddu, Giovanna; Milia, Maria Rafaela; Del Manso, Martina; Rota, Maria Cristina; Magurano, Fabio; Nicoletti, Loredana; Declich, Silvia

    2015-01-01

    We report a measles outbreak in Sardinia, Italy, that originated in a cruise ship passenger. The outbreak showed extensive nosocomial transmission (44 of 80 cases). To minimize nosocomial transmission, health care facilities should ensure that susceptible health care workers are vaccinated against measles and should implement effective infection control procedures. PMID:26196266

  1. Economic Costs of Measles Outbreak in the Netherlands, 2013-2014.

    PubMed

    Suijkerbuijk, Anita W M; Woudenberg, Tom; Hahné, Susan J M; Nic Lochlainn, Laura; de Melker, Hester E; Ruijs, Wilhelmina L M; Lugnér, Anna K

    2015-11-01

    In 2013 and 2014, the Netherlands experienced a measles outbreak in orthodox Protestant communities with low measles-mumps-rubella vaccination coverage. Assessing total outbreak costs is needed for public health outbreak preparedness and control. Total costs of this outbreak were an estimated $4.7 million.

  2. Attenuated oncolytic Measles Virus strains as cancer therapeutics

    PubMed Central

    Msaouel, P.; Iankov, I.D.; Dispenzieri, A.; Galanis, E.

    2011-01-01

    Attenuated measles virus vaccine strains have emerged as a promising oncolytic vector platform, having shown significant anti-tumor activity against a broad range of malignant neoplasms. Measles virus strains derived from the attenuated Edmonston-B (MV-Edm) vaccine lineage have been shown to selectively infect, replicate in and lyse cancer cells while causing minimal cytopathic effect on normal tissues. This review summarizes the preclinical data that led to the rapid clinical translation of oncolytic measles vaccine strains and provides an overview of early clinical data using this oncolytic platform. Furthermore, novel approaches currently under development to further enhance the oncolytic efficacy of MV-Edm strains, including strategies to circumvent immunity or modulate immune system responses, combinatorial approaches with standard treatment modalities, virus retargeting as well as strategies for in vivo monitoring of viral replication are discussed. PMID:21740361

  3. Booster vaccination of pre-school children with reduced-antigen-content diphtheria-tetanus-acellular pertussis-inactivated poliovirus vaccine co-administered with measles-mumps-rubella-varicella vaccine

    PubMed Central

    Ferrera, Giuseppe; Cuccia, Mario; Mereu, Gabriele; Icardi, Giancarlo; Bona, Gianni; Esposito, Susanna; Marchetti, Federico; Messier, Marc; Kuriyakose, Sherine; Hardt, Karin

    2012-01-01

    Background: Pertussis occurs in older children, adolescents and adults due to waning immunity after primary vaccination. Booster vaccination for pre-school children has been recommended in Italy since 1999. In this study (NCT00871000), the immunogenicity, safety and reactogenicity of a booster dose of reduced-antigen content diphtheria-tetanus-acellular pertussis-inactivated poliovirus vaccine (dTpa-IPV; GSK Biologicals Boostrix™-Polio; 3-component pertussis) vs. full-strength DTPa-IPV vaccine (sanofi-pasteur—MSD Tetravac™; 2-component pertussis) was evaluated in pre-school Italian children.   Methods: Healthy children aged 5–6 y primed in a routine vaccination setting with three doses of DTPa-based vaccines were enrolled and randomized (1:1) in this phase IIIb, booster study to receive a single dose of dTpa-IPV or DTPa-IPV; the MMRV vaccine was co-administered. Antibody concentrations/titers against diphtheria, tetanus, pertussis and poliovirus 1–3 were measured before and one month post-booster. Reactogenicity and safety was assessed. Results: 305 subjects were enrolled of whom 303 (dTpa-IPV = 151; DTPa-IPV = 152) received booster vaccination. One month post-booster, all subjects were seroprotected/seropositive for anti-diphtheria, anti-tetanus, anti-PT, anti-FHA and anti-poliovirus 1–3; 99.3% of dTpa-IPV and 60.4% of DTPa-IPV subjects were seropositive for anti-PRN; 98–100% of subjects were seropositive against MMRV antigens post-booster. Pain at the injection site (dTpa-IPV: 63.6%; DTPa-IPV: 63.2%) and fatigue (dTpa-IPV: 26.5%; DTPa-IPV: 23.7%) were the most commonly reported solicited local and general symptoms, during the 4-d follow-up period. No SAEs or fatalities were reported. Conclusions: The reduced-antigen-content dTpa-IPV vaccine was non-inferior to full-strength DTPa-IPV vaccine with respect to immunogenicity. The vaccine was well-tolerated and can be confidently used as a booster dose in pre-school children. PMID:22327497

  4. Children and Adolescents Unvaccinated Against Measles: Geographic Clustering, Parents' Beliefs, and Missed Opportunities

    PubMed Central

    Marcuse, Edgar K.; Seward, Jane F.; Zhao, Zhen; Orenstein, Walter A.

    2015-01-01

    Objective We evaluated the extent to which children and adolescents were not vaccinated against measles (“unvaccinated”), clustering within U.S. counties, and factors associated with unvaccination, including parents' vaccine-related beliefs and missed opportunities. Methods We analyzed data from the 2010–2013 National Immunization Survey (NIS) and NIS-Teen Survey of households with 19- to 35-month-old children and 13- to 17-year-old adolescents, respectively. We used provider-reported vaccination histories to assess measles vaccination status. Results In 2013, 7.5% of children and 4.5% of adolescents were unvaccinated against measles. Four-fifths (80.0%) of unvaccinated children lived in counties containing 41.9% of the nation's children, and 80.0% of unvaccinated adolescents lived in counties containing 30.4% of the nation's adolescents. Multivariable statistical analyses found that 74.6% of children who were unvaccinated against measles missed being vaccinated for reasons other than parents' negative vaccine-related beliefs, and 89.6% could be deemed as having at least one missed opportunity for being vaccinated against measles because they were administered at least one dose of other recommended vaccines after 12 months of age. Among adolescents, multivariable analyses found that only demographic factors, not vaccine-related parental beliefs, were independently associated with being unvaccinated. Conclusions Reasons other than negative vaccine-related beliefs, including missed opportunities, accounted for the vast majority of unvaccinated children and adolescents. PMID:26327727

  5. Immunization of seronegative infants with hepatitis A vaccine (HAVRIX; SKB): a comparative study of two dosing schedules.

    PubMed

    Troisi, C L; Hollinger, F B; Krause, D S; Pickering, L K

    1997-10-01

    Hepatitis A virus (HAV) infection is of public health significance among infants and diapered children. Although two licensed HAV vaccines are available, they have not been assessed widely in children under the age of 2 years and are not currently licensed for this age group. The purpose of this study was to evaluate the immunogenicity and reactogenicity of HAV vaccine in seronegative infants. Fifty-three healthy infants were immunized with 360 ELISA Units (EL.U.) of an inactivated HAV vaccine at 2, 4, and 6 (Group 1) or 2, 4, and 15 months of age (Group 2). These injections were not received on the same day that participants received their routine childhood immunizations. HAV serum antibodies were detected using a modified radioimmunoassay procedure and concentrations were calculated using a World Health Organization serum anti-HAV reference standard. No serious-systemic or local reactions were noted among the immunized infants. Three months following the third immunization, seroconversion rates were 100% and 93% in groups 1 and 2, respectively. No significant differences were observed in the geometric mean anti-HAV concentrations between the two groups at comparable time points, i.e. 2 months after the second dose, 3 months after the third dose, and 19 months after the first dose. Three infants, not included in the data presented above, had preexisting maternal antibodies; one never responded to the vaccine and the other two did not respond until maternal antibody levels had become reduced. The results indicate that the inactivated HAV vaccine is highly immunogenic in seronegative infants and could be included in the routine harmonized infant immunization schedule.

  6. Fatal measles infection in marmosets pathogenesis and prophylaxis.

    PubMed Central

    Albrecht, P; Lorenz, D; Klutch, M J; Vickers, J H; Ennis, F A

    1980-01-01

    Moustached marmosets (Saguinus mystax) were infected intranasally with either of two low-passaged, wildlike strains of measles virus, strain Edmonston or strain JM. The infection resulted in 25 and 100% mortality, respectively, 12 to 14 days after infection. Clinical signs, gross pathological findings, and histology lacked the characteristic features of measles in other primates. A deficient immune response and widespread gastroenterocolitis appeared to be the main causes for the fatal outcome. Fluorescent-antibody staining detected large amounts of measles antigen in lymphatic tissues, the gastrointestinal and respiratory tracts, the salivary glands, pancreas, liver, kidney, and other visceral tissues. Live attenuated or inactivated measles vaccine proved equally effective in preventing fatal measles in marmosets. Challenge with live virus of animals which were primed 1 year previously with inactivated alum-absorbed vaccine resulted in a precipitous response, with a 100- to 1,000-fold increase in antibody titers. This vigorous booster response suggests the existence of a primary deficiency in lymphocyte cooperation in marmosets, which upon adequate priming is followed by extensive clonal expansion and antibody synthesis. Marmosets appear to be the most susceptible primate species to measles infection. They are capable of distinguishing differences in virulence of virus strains with a level of sensitivity not available in other animals. Images Fig. 1 Fig. 2 Fig. 3 PMID:6769812

  7. Measles, Mumps, and Rubella - Vaccine Use and Strategies for Elimination of Measles, Rubella, and Congenital Rubella Syndrome and Control of Mumps: Recommendations of the Advisory Committee on Immunization Practices (ACIP). Vol. 47/No. RR-8.

    DTIC Science & Technology

    2007-11-02

    occurred, insufficient evi- dence exists to indicate a causal relation between RA 27/3 vaccine and peripheral neuropathies (149,190). When acute...MMWRseries of publications is published by the Epidemiology Program Office, Centers for Disease Control and Prevention (CDC), U.S. Department of...Director Epidemiology and Surveillance Division John R. Livengood, M.D., M.P.H. Director The production of this report as an MMWR serial publication was

  8. The laboratory confirmation of suspected measles cases in settings of low measles transmission: conclusions from the experience in the Americas.

    PubMed Central

    Dietz, Vance; Rota, Jennifer; Izurieta, Héctor; Carrasco, Peter; Bellini, William

    2004-01-01

    The Americas have set a goal of interrupting indigenous transmission of measles using a strategy developed by the Pan American Health Organization (PAHO). This strategy includes recommendations for vaccination activities to achieve and sustain high immunity in the population and is complemented by sensitive epidemiological surveillance systems developed to monitor illnesses characterized by febrile rash, and to provide effective virological and serological surveillance. A key component in ensuring the success of the programme has been a laboratory network comprising 22 national laboratories including reference centres. Commercially available indirect enzyme immunoassay kits (EIA) for immunoglobulin M (IgM)-class antibodies are currently being used throughout the region. However, because there are few or no true measles cases in the region, the positive predictive value of these diagnostic tests has decreased. False-positive results of IgM tests can also occur as a result of testing suspected measles cases with exanthemata caused by Parvovirus B19, rubella and Human herpesvirus 6, among others. In addition, as countries maintain high levels of vaccination activity and increased surveillance of rash and fever, the notification of febrile rash illness in recently vaccinated people can be anticipated. Thus, managers in the measles elimination programme must be prepared to address the interpretation of a positive result of a laboratory test for measles IgM when clinical and epidemiological data may indicate that the case is not measles. The interpretation of an IgM-positive test under different circumstances and the definition of a vaccine-related rash illness in a setting of greatly reduced, or absent, transmission of measles is discussed. PMID:15640921

  9. [VACCINE-ASSOCIATED PARALYTIC POLIOMYELITIS IN RUSSIAN FEDERATION DURING THE PERIOD OF CHANGES IN VACCINATION SCHEDULE (2006-2013 yy.)].

    PubMed

    Ivanova, O E; Eremeeva, T P; Morozova, N S; Shakaryan, A K; Gmyl, A P; Yakovenko, M L; Korotkova, E A; Chernjavskaja, O P; Baykova, O Yu; Silenova, O V; Krasota, A Yu; Krasnoproshina, L I; Mustafina, A N; Kozlovskaja, L I

    2016-01-01

    The results of virologic testing of clinical materials and epidemiological analysis of vaccine-associated paralytic poliomyelitis (VAPP) cases obtained in 2006-2013 during AFP surveillance are presented. Among the 2976 cases of AFP 30 cases were VAPP. 15 cases were observed in OPV recipients, whereas 15 cases were observed in non-vaccinated contacts. The age of the patients varied from 4 months to 5.5 years (13.6 ± 12.4 months old). Children younger than 1 year constituted 63.3% of the group; boys were dominant (73.3%); 53.3% of children were vaccinated with OPV; the time period between receipt of OPV and onset of palsy was from 2 to 32 days (18.7 ± 8.2). Lower paraparesis was documented in 48.3% of patients; lower monoparesis in 37.9%; upper monoparesis, in 6.9%; tetraparesis with bulbar syndrome, in 6%. The majority of the patients (85.7%) had an unfavorable premorbid status. The violations of the humoral immunity were found in 73.9% cases: CVID (52.9%), hypogammaglobulinemia (41.2%); selective lgA deflciency (5.9%). In 70.6% cases damage to humoral immunity was combined with poor premorbid status. The most frequently observed (76%, p < 0.05) represented the single type of poliovirus--type 2 (44%) and type 3 (32%). All strains were of the vaccine origin, the divergence from the homotypic Sabin strains fell within the region of the gene encoding VPI protein, which did not exceed 0.5% of nucleotide substitutions except vaccine derived poliovirus type 2--multiple recombinant (type 2/type 3/ type 2/type 1) with the degree of the divergence of 1.44% isolated from 6-month old unvaccinated child (RUS08063034001). The frequency of the VAPP cases was a total of 1 case per 3.4 million doses of distributed OPV in 2006-2013; 2.2 cases per 1 million of newborns were observed. This frequency decreased after the introduction of the sequential scheme of vaccination (IPV, OPV) in 2008-2013 as compared with the period of exclusive use of OPV in 2006-2007: 1 case per 4.9 million

  10. Measles in Vietnamese refugee children in Hong Kong.

    PubMed

    Taylor, W R

    1999-06-01

    From September 1991-January 1992, there was a measles epidemic in an established refugee camp for 7000 Vietnamese 'Boat People' living in Hong Kong. This 16 week outbreak occurred against a backdrop of poor uptake of measles vaccination and overcrowded living conditions. Two hundred and sixty-two children were affected (155 boys, 107 girls); 235 children (89.7 %) were < 2 years old, age range 5-39 months. Children age 6-11 months had the highest crude attack rate (AR) of 54.3%. The highest age specific crude AR was 83.8% in children aged 14 months. Measles complications affected 234 (89.3%) children. Sixty-six children (25.2%) were admitted to hospital. There were two deaths from pneumonia, giving a case fatality rate of 0.76%. Measles control in refugee camps continues to be a public health challenge.

  11. Guidelines on Vaccinations in Paediatric Haematology and Oncology Patients

    PubMed Central

    Cesaro, Simone; Giacchino, Mareva; Fioredda, Francesca; Barone, Angelica; Battisti, Laura; Bezzio, Stefania; Frenos, Stefano; De Santis, Raffaella; Livadiotti, Susanna; Marinello, Serena; Zanazzo, Andrea Giulio; Caselli, Désirée

    2014-01-01

    Objective. Vaccinations are the most important tool to prevent infectious diseases. Chemotherapy-induced immune depression may impact the efficacy of vaccinations in children. Patients and Methods. A panel of experts of the supportive care working group of the Italian Association Paediatric Haematology Oncology (AIEOP) addressed this issue by guidelines on vaccinations in paediatric cancer patients. The literature published between 1980 and 2013 was reviewed. Results and Conclusion. During intensive chemotherapy, vaccination turned out to be effective for hepatitis A and B, whilst vaccinations with toxoid, protein subunits, or bacterial antigens should be postponed to the less intensive phases, to achieve an adequate immune response. Apart from varicella, the administration of live-attenuated-virus vaccines is not recommended during this phase. Family members should remain on recommended vaccination schedules, including toxoid, inactivated vaccine (also poliomyelitis), and live-attenuated vaccines (varicella, measles, mumps, and rubella). By the time of completion of chemotherapy, insufficient serum antibody levels for vaccine-preventable diseases have been reported, while immunological memory appears to be preserved. Once immunological recovery is completed, usually after 6 months, response to booster or vaccination is generally good and allows patients to be protected and also to contribute to herd immunity. PMID:24868544

  12. A Review of Factors Affecting Vaccine Preventable Disease in Japan

    PubMed Central

    Ching, Michael SL

    2014-01-01

    Japan is well known as a country with a strong health record. However its incidence rates of vaccine preventable diseases (VPD) such as hepatitis B, measles, mumps, rubella, and varicella remain higher than other developed countries. This article reviews the factors that contribute to the high rates of VPD in Japan. These include historical and political factors that delayed the introduction of several important vaccines until recently. Access has also been affected by vaccines being divided into government-funded “routine” (eg, polio, pertussis) and self-pay “voluntary” groups (eg, hepatitis A and B). Routine vaccines have higher rates of administration than voluntary vaccines. Administration factors include differences in well child care schedules, the approach to simultaneous vaccination, vaccination contraindication due to fever, and vaccination spacing. Parental factors include low intention to fully vaccinate their children and misperceptions about side effects and efficacy. There are also provider knowledge gaps regarding indications, adverse effects, interval, and simultaneous vaccination. These multifactorial issues combine to produce lower population immunization rates and a higher incidence of VPD than other developed countries. This article will provide insight into the current situation of Japanese vaccinations, the issues to be addressed and suggestions for public health promotion. PMID:25628969

  13. Assessment of the Epidemiology and Burden of Measles in Southern Mozambique

    PubMed Central

    Mandomando, Inácio; Naniche, Denise; Pasetti, Marcela F.; Cuberos, Lilian; Sanz, Sergi; Vallès, Xavier; Sigauque, Betuel; Macete, Eusébio; Nhalungo, Delino; Kotloff, Karen L.; Levine, Myron M.; Alonso, Pedro L.

    2011-01-01

    Measles has been a major killer among vaccine-preventable diseases in children < 5 years of age in developing countries. Despite progress in global efforts to reduce mortality, measles remains a public health problem. Hospital-based measles surveillance was conducted in Manhica, Mozambique (July 2001–September 2004). Suspected cases and community-based controls were enrolled, and blood was collected for immunoglobulin M (IgM) confirmation. Two hundred fifty-three suspected cases and 477 controls were enrolled, with 85% (216 of 253) cases reported during a measles outbreak. Measles-IgM confirmation was 30% among suspected cases and 5% in controls. Fifty-eight percent (14 of 24) of laboratory-confirmed cases had records indicating previous measles vaccination. Mortality was 3% (8 of 246) among cases and 1% among controls (6 of 426). Forty-five percent (33 of 74) of cases were < 24 months of age and 22% occurred in infants < 9 months of age and were associated with a high case-fatality rate (25%). Our data suggest that improved diagnostics, new tools to protect infants < 9 months of age, and a supplemental dose of measles vaccine could assist measles control. PMID:21734140

  14. Hepatitis-B vaccine introduction into the routine immunization schedule--Andhra Pradesh experience.

    PubMed

    Kiran, V

    2004-01-01

    Hepatitis B is a viral infection of the liver and is serious global public health problem with a high risk of death from cirrhosis of the liver and liver cancer, diseases that kill about one million persons each year globally. Globally, of the 2 billion people who have been infected with the hepatitis B virus (HBV), more than 350 million have chronic (lifelong) infections. It is preventable with safe and effective vaccines that have been available since 1982. Although the vaccine will not cure chronic hepatitis, it is 95% effective in preventing chronic infections from developing, and is the first vaccine against a major human cancer. More than 160 countries have already added this vaccine to their routine immunization programmes. Available epidemiologic studies in India and AP indicate that India is in intermediate endemic status (with a prevalence of 2 to 7%) and the best way to reduce the prevalence as per the strategies outlined by WHO is to introduce Hep-B vaccine into routine immunization. AP is the first State in India to introduce Hep-B vaccine in the routine immunization in a phased manner. In-spite of the initial apprehensions and slow take up, the program is proven to be successful and Govt. of India has made budgetary provisions in the 10th plan for introduction in rest of India.

  15. Travellers returning with measles from Thailand to Finland, April 2012: infection control measures.

    PubMed

    Kantele, A; Valtonen, K; Davidkin, I; Martelius, T; Võželevskaja, N; Skogberg, K; Liesmaa, I; Lyytikäinen, O

    2012-05-31

    Countries with no autochthonous measles run the risk of the virus being imported by travellers and transmitted to unprotected citizens. In April 2012, two travellers from Finland and one from Estonia were diagnosed with measles after returning from Phuket, Thailand. They were contagious on their return flights and subsequently exposed several individuals, prompting extensive infection control measures. Two secondary cases were detected: one child who had received one vaccine dose and another who was fully vaccinated.

  16. [Surveillance Plan on Recent Outbreak of Measles and Rubella in Catalonia, Spain].

    PubMed

    Jané, Mireia; Torner, Nuria; Vidal, Ma José

    2015-01-01

    Measles and rubella are two immuno-preventive illnesses. In Catalonia, since 1988 all children are given two doses of measles and rubella vaccine with high levels of vaccination coverage. The measles elimination programme has been carried out since 1990 in Catalonia. This programme includes achieving and keeping high immunization levels among population with high vaccination coverage, intense epidemiological surveillance and an immediate response to the appearance of a case or outbreak. In 2014, the measles incidence rate was 1.9 cases/ 100,000 inhabitants. There were 4 recent outbreaks in 2006, 2011, 2013 and 2014 that affected 381, 289, 31 and 124 people respectively. All outbreaks were triggered by an imported case. In 2011 and 2014 measles outbreaks, 6% and 5.5% of affected people were health care workers. All outbreaks presented a great variety of measles genotypes. Concerning rubella elimination programme, since 2002, 68 cases of postnatal rubella and 5 cases of congenital rubella were confirmed. Regarding measles and rubella surveillance and control, in addition to strengthen vaccination coverage, it is essential immediate notification, within the first 24 hours since suspicion and laboratory confirmation. In addition there is a need to enforce vaccination among health care workers as well as in other susceptible and unvaccinated people. It is recommended to vaccinate all people who were born after 1966 and who have not been vaccinated with two doses of trivalent measles-mumps-rubella vaccine. Furthermore, we have to emphasize that the progress concerning genotypes study allows identifying various imported cases from other European countries with active outbreaks, aspect that makes easier the surveillance of these illnesses.

  17. Measles outbreak in a refugee settlement in Calais, France: January to February 2016.

    PubMed

    Jones, G; Haeghebaert, S; Merlin, B; Antona, D; Simon, N; Elmouden, M; Battist, F; Janssens, M; Wyndels, K; Chaud, P

    2016-01-01

    We report a measles outbreak in a refugee settlement in Calais, France, between 5 January and 11 February 2016. In total, 13 confirmed measles cases were identified among migrants, healthcare workers in hospital and volunteers working on site. A large scale vaccination campaign was carried out in the settlement within two weeks of outbreak notification. In total, 60% of the estimated target population of 3,500 refugees was vaccinated during the week-long campaign.

  18. [Must we expect an epidemic of measles in the near future in Southern Tyrol?].

    PubMed

    Kreidl, Peter; Morosetti, Giulia

    2003-01-01

    Measles, Mumps and Rubella (MMR) vaccination is recommended in Italy. A country-wide study of the 1996 birth cohort revealed that coverage with MMR vaccine in the autonomous Province of Bolzano is the third lowest in Italy (after Campania and Calabria). The aim of the study was to evaluate the situation regarding measles in order to plan and implement necessary strategies. To assess MMR vaccine coverage, routine vaccination data were evaluated for quality and validity, and subsequently MMR coverage rates were calculated by birth cohort (1996-99) and commune. In addition, a descriptive epidemiologic analysis of all reported measles cases was performed. Hospital discharge records were used to estimate the complications and costs of hospital admitted measles cases. MMR vaccine coverage rates vary between rural (40%) and urban (80%) areas. Furthermore, communes with more than 50% Italian speaking inhabitants have higher MMR vaccine coverage than communes mainly populated by German speaking persons. In 1997 and 1999, epidemics with 1,889 and 992 cases, respectively, were reported. Five- to nine-year-old children were the most affected age group. Most cases were reported from communes with vaccine coverage rates below 40%. Six percent of measles cases, reported between January 1996 and October 2001 were admitted to hospital. The mean period of admission for measles cases was 4.6 days (range 1 to 84 days), the mean estimated costs 1,987.18 Euro per patient. The total amount of direct costs was estimated to be 386,437.72 Euros. Due to low vaccine coverage rates, especially in rural areas, and the ongoing circulation of the measles virus in the population, it is likely that an extensive measles epidemic will occur in the near future, resulting in evitable suffering of patients and extensive costs for the public health system. Only an effective immunization campaign will be able to prevent a future epidemic.

  19. Pattern of susceptibility to measles in Italy. Serological Study Group.

    PubMed Central

    Salmaso, S.; Gabutti, G.; Rota, M. C.; Giordano, C.; Penna, C.; Mandolini, D.; Crovari, P.

    2000-01-01

    On the basis of seroprevalence and incidence data we describe the distribution of individuals susceptible and immune to measles in Italy in 1996-97. In regions where vaccination coverage was at least 70%, approximately 10% of 3-year-old children were susceptible to measles, whereas 40% were in this category in regions with lower vaccination coverage. Seroprevalence among children older than 4 years was similar for the two groups of regions; in the age group 20-39 years it was approximately 95%. During 1990-96 in the regions with lower vaccination coverage the incidence was highest among children aged 4-6 years, and the median age of cases was 7 years; in the regions with higher vaccination coverage, however, the incidence remained at around 5% for the age group 4-16 years, and the overall median age was 10 years. These data confirm the partial reduction in measles incidence in Italy, although transmission has still not been interrupted. The size and geographical distribution of the current pool of susceptible individuals can be expected to present an obstacle to measles elimination if appropriate vaccination strategies, such as catch-up campaigns, are not adopted. PMID:10994277

  20. Measles to the Rescue: A Review of Oncolytic Measles Virus

    PubMed Central

    Aref, Sarah; Bailey, Katharine; Fielding, Adele

    2016-01-01

    Oncolytic virotherapeutic agents are likely to become serious contenders in cancer treatment. The vaccine strain of measles virus is an agent with an impressive range of oncolytic activity in pre-clinical trials with increasing evidence of safety and efficacy in early clinical trials. This paramyxovirus vaccine has a proven safety record and is amenable to careful genetic modification in the laboratory. Overexpression of the measles virus (MV) receptor CD46 in many tumour cells may direct the virus to preferentially enter transformed cells and there is increasing awareness of the importance of nectin-4 and signaling lymphocytic activation molecule (SLAM) in oncolysis. Successful attempts to retarget MV by inserting genes for tumour-specific ligands to antigens such as carcinoembryonic antigen (CEA), CD20, CD38, and by engineering the virus to express synthetic microRNA targeting sequences, and “blinding” the virus to the natural viral receptors are exciting measures to increase viral specificity and enhance the oncolytic effect. Sodium iodine symporter (NIS) can also be expressed by MV, which enables in vivo tracking of MV infection. Radiovirotherapy using MV-NIS, chemo-virotherapy to convert prodrugs to their toxic metabolites, and immune-virotherapy including incorporating antibodies against immune checkpoint inhibitors can also increase the oncolytic potential. Anti-viral host immune responses are a recognized barrier to the success of MV, and approaches such as transporting MV to the tumour sites by carrier cells, are showing promise. MV Clinical trials are producing encouraging preliminary results in ovarian cancer, myeloma and cutaneous non-Hodgkin lymphoma, and the outcome of currently open trials in glioblastoma multiforme, mesothelioma and squamous cell carcinoma are eagerly anticipated. PMID:27782084

  1. Seroprevalences of Specific IgG Antibodies to Measles, Mumps, and Rubella in Korean Infants.

    PubMed

    Cho, Hye Kyung; Lee, Hyunju; Kim, Han Wool; Kim, Sung Soon; Kang, Hae Ji; Kim, In Tae; Kim, Kyung Hyo

    2016-12-01

    In this study, the seroprevalences of measles, mumps, and rubella antibodies in infants were determined to assess the immunization strategy and control measures for these infectious diseases. Serum samples from infants < 1 year of age and their mothers were collected to measure the concentrations of specific IgG antibodies to measles, mumps, and rubella by enzyme-linked immunosorbent assay. For selected infant serum samples, measles-specific neutralizing antibody levels were determined by using the plaque reduction neutralization test. The sera from 295 of infants and 80 of their mothers were analyzed. No infants had past measles, mumps, or rubella infections. Almost all infants < 2 months of age were positive for measles and rubella IgG antibodies. However, seroprevalence of measles and rubella antibodies decreased with age, and measles IgG and rubella IgG were barely detectable after 4 months of age. The seroprevalence of mumps antibodies was lower than that of measles and rubella antibodies in infants ≤ 4 months old, and mumps IgG was barely detectable after 2 months of age. The seropositivity of measles-specific neutralizing antibody was 63.6% in infants aged 2 months and undetectable in infants ≥ 6 months old. Because the seropositivity rates of measles, mumps, and rubella antibodies were low after the first few months of age in Korean infants, active immunization with vaccines is strongly recommended for infants aged 6-11 months when measles is epidemic. Timely administration of the first dose of measles-mumps-rubella vaccine at 12 months of age should be encouraged in non-epidemic situations.

  2. Do vaccines save lives? Yes they do!

    PubMed

    Lernout, Tinne; Theeten, Heidi; Leuridan, Elke; Van Damme, Pierre

    2014-01-01

    Since their introduction and widespread use, vaccines have been very successful in reducing morbidity and mortality of the diseases they target, at an individual level and through herd immunity. The impact on the mortality has been rapid and easy to measure for some diseases, such as diphtheria, pertussis and measles. For other diseases, including hepatitis B and human papillomavirus infections, deaths averted occur many years after vaccination, and it takes years until the full potential of the vaccine can be established. Finally, in middle and high income countries, the impact of vaccination against some diseases, like invasive pneumococcal disease and rotavirus gastro-enteritis, is measured by decrease in incidence of the disease and reduction in hospitalization rather than impact on mortality. But in the countries with the highest incidence of these diseases, mortality remains high due to low availability of these vaccines, and millions of deaths could be averted by optimal use of vaccines in these regions. Major challenges for vaccination programmes are to maintain and strengthen trust in the benefits of vaccination and adapt immunization schedules according to the changing epidemiological landscape.

  3. Vaccine Policy Issues

    DTIC Science & Technology

    2005-05-19

    evidence “favors rejection” of the idea that either the measles- mumps-rubella vaccine or thimerosal-containing vaccines cause autism (IOM...Immunization Safety Review: Vaccines and Autism , Washington, D.C., National Academies Press, 2004). 46ACIP’s rotavirus vaccine fact sheet is at [http...that the vaccines or preservatives or packaging might cause autism and other neurodevelopmental disorders. One focus has been on thimerosal, a mercury

  4. Complications of Measles (Rubeola)

    MedlinePlus

    ... Specimens for Detection by RT-PCR or Virus Isolation Measles Lab Manual Vero/hSLAM Cell Line Genetic ... brain) that can lead to convulsions and can leave the child deaf or with intellectual disability. For ...

  5. Vaccine Hesitancy.

    PubMed

    Jacobson, Robert M; St Sauver, Jennifer L; Finney Rutten, Lila J

    2015-11-01

    Vaccine refusal received a lot of press with the 2015 Disneyland measles outbreak, but vaccine refusal is only a fraction of a much larger problem of vaccine delay and hesitancy. Opposition to vaccination dates back to the 1800 s, Edward Jenner, and the first vaccine ever. It has never gone away despite the public's growing scientific sophistication. A variety of factors contribute to modern vaccine hesitancy, including the layperson's heuristic thinking when it comes to balancing risks and benefits as well as a number of other features of vaccination, including falling victim to its own success. Vaccine hesitancy is pervasive, affecting a quarter to a third of US parents. Clinicians report that they routinely receive requests to delay vaccines and that they routinely acquiesce. Vaccine rates vary by state and locale and by specific vaccine, and vaccine hesitancy results in personal risk and in the failure to achieve or sustain herd immunity to protect others who have contraindications to the vaccine or fail to generate immunity to the vaccine. Clinicians should adopt a variety of practices to combat vaccine hesitancy, including a variety of population health management approaches that go beyond the usual call to educate patients, clinicians, and the public. Strategies include using every visit to vaccinate, the creation of standing orders or nursing protocols to provide vaccination without clinical encounters, and adopting the practice of stating clear recommendations. Up-to-date, trusted resources exist to support clinicians' efforts in adopting these approaches to reduce vaccine hesitancy and its impact.

  6. Proceedings of the Consensus Day Meeting: Implications for Rotavirus Vaccination in the 2014 Apulian Lifetime Immunization Schedule. Foggia, 17 April 2015.

    PubMed

    Martinelli, D; Fortunato, F; Cappelli, M G; Gallone, M S; Tafuri, S; Prato, R

    2015-01-01

    Recommendations for vaccination against rotavirus (RV) were issued in Apulia in 2006; the vaccine was free of charge to children who entered day care or nursery school by 1 year of age or those affected by chronic diseases for which diarrhea caused by rotavirus can increase the risk of complications and hospitalization. In 2014, vaccination became available to all healthy children with only a copayment. However, there has not been a significant increase in vaccination coverage. On April 17, 2015, Apulian public health physicians and paediatricians met to share strategies to promote the RV vaccine indications provided in the regional immunization schedule. During the meeting, presentation of data reports were interspersed with discussions that were led with a "bottom-up" approach. The discussants responded to pre-planned questions raised by the participants and encouraged by the discussion.

  7. Postpartum live virus vaccination: lessons from veterinary medicine.

    PubMed

    Yazbak, F Edward; Diodati, Catherine J M

    2002-09-01

    Pregnant rubella-susceptible women are often revaccinated during the postpartum period with the Measles, Mumps, and Rubella vaccine (MMR). It is known that the rubella virus from vaccine is secreted in breast milk and persists in the nose and throat for up to 28 days but it is not known whether the measles and mumps viruses are similarly secreted. It is probable the measles virus from vaccine is.

  8. Immunization Schedules for Infants and Children

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Infants and Children United States, 2017 ... any questions. View or Print a Schedule Recommended Immunizations for Children (Birth through 6 years) Schedule for ...

  9. Vaccinations in adults with chronic inflammatory joint disease: Immunization schedule and recommendations for patients taking synthetic or biological disease-modifying antirheumatic drugs.

    PubMed

    Morel, Jacques; Czitrom, Séverine Guillaume; Mallick, Auriane; Sellam, Jérémie; Sibilia, Jean

    2016-03-01

    The risk of infection associated with autoimmune diseases is further increased by the use of biotherapies. Recommendations to minimize this risk include administering the full complement of vaccines on the standard immunization schedule, as well as the pneumococcal and influenza vaccines. Adults with chronic inflammatory joint disease (IJD) may receive a 13-valent pneumococcal conjugate vaccine, as well as a live attenuated vaccine against recurrent herpes zoster, recently licensed by European regulatory authorities. Live attenuated vaccines can be given only after an interval without immunosuppressant and/or glucocorticoid therapy. The effectiveness of vaccines, as assessed based on titers of protective antibodies, varies across vaccine types and disease-modifying antirheumatic drugs (DMARDs). Thus, methotrexate and rituximab are usually associated with decreased vaccine responses. The risks associated with vaccines are often considerably exaggerated by the media, which serve lobbies opposed to immunizations and make some patients reluctant to accept immunizations. Increasing immunization coverage may diminish the risk of treatment-related infections. A physician visit dedicated specifically to detecting comorbidities in patients with chronic IJD may result in improved immunization coverage. In this review, we discuss immunizations for adults with chronic IJD based on the treatments used, as well as immunization coverage. Many questions remain unanswered and warrant investigation by studies coordinated by the French networks IREIVAC (Innovative clinical research network in vaccinology) and IMIDIATE (Immune-Mediated Inflammatory Disease Alliance for Translational and Clinical Research).

  10. Contagious Comments: What Was the Online Buzz About the 2011 Quebec Measles Outbreak?

    PubMed Central

    Pereira, Jennifer A.; Quach, Susan; Dao, Huy Hao; Kwong, Jeffrey C.; Deeks, Shelley L.; Crowcroft, Natasha S.; Quan, Sherman D.; Guay, Maryse

    2013-01-01

    Background Although interruption of endemic measles was achieved in the Americas in 2002, Quebec experienced an outbreak in 2011 of 776 reported cases; 80% of these individuals had not been fully vaccinated. We analyzed readers’ online responses to Canadian news articles regarding the outbreak to better understand public perceptions of measles and vaccination. Methods We searched Canadian online English and French news sites for articles posted between April 2011 and March 2012 containing the words “measles” and “Quebec”. We included articles that i) concerned the outbreak or related vaccination strategies; and ii) generated at least ten comments. Two English and two bilingual researchers coded the unedited comments, categorizing codes to allow themes to emerge. Results We analyzed 448 comments from 188 individuals, in response to three French articles and six English articles; 112 individuals expressed positive perceptions of measles vaccination (2.2 comments/person), 38 were negative (4.2 comments/person), 11 had mixed feelings (1.5 comments/person), and 27 expressed no opinion (1.1 comments/person). Vaccine-supportive themes involved the success of vaccination in preventing disease spread, societal responsibility to vaccinate for herd immunity, and refutation of the autism link. Those against measles vaccination felt it was a personal rather than societal choice, and conveyed a distrust of vaccine manufacturers, believing that measles infection is not only safe but safer than vaccination. Commenters with mixed feelings expressed uncertainty of the infection’s severity, and varied in support of all vaccines based on perceived risk/benefit ratios. Conclusion The anti-vaccine minority’s volume of comments translates to a disproportionately high representation on online boards. Public health messages should address concerns by emphasizing that immunization is always a personal choice in Canada, and that the pharmaceutical industry is strictly

  11. Missed Opportunities for Measles, Mumps, and Rubella (MMR) Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk

    PubMed Central

    Mokdad, Ali H.; Gagnier, Marielle C.; Colson, K. Ellicott; Dansereau, Emily; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Haakenstad, Annie; Johanns, Casey K.; Palmisano, Erin B.; Hernandez, Bernardo; Iriarte, Emma

    2015-01-01

    Background Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11–59 months of age from large household surveys in Mesoamerica. Methods Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR) and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities. Results El Salvador had the highest proportion of children with a vaccine card (91.2%) while Nicaragua had the lowest (76.5%). Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06–2.47). In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24–0.88 and OR 0.25, 95% CI: 0.096–0.65, respectively). Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador. Conclusions Our study found high levels

  12. Frequently Asked Questions about Measles in the U.S.

    MedlinePlus

    ... are a(n)— school-aged child (grades K-12) adult who was not vaccinated as a child and will be in a setting that poses a high risk for measles transmission, including students at post-high school education institutions, healthcare personnel, and international travelers. You received ...

  13. Mitigating measles outbreaks in West Africa post-Ebola.

    PubMed

    Truelove, Shaun A; Moss, William J; Lessler, Justin

    2015-01-01

    The Ebola outbreak in 2014-2015 devastated the populations, economies and healthcare systems of Guinea, Liberia and Sierra Leone. With this devastation comes the impending threat of outbreaks of other infectious diseases like measles. Strategies for mitigating these risks must include both prevention, through vaccination, and case detection and management, focused on surveillance, diagnosis and appropriate clinical care and case management. With the high transmissibility of measles virus, small-scale reactive vaccinations will be essential to extinguish focal outbreaks, while national vaccination campaigns are needed to guarantee vaccination coverage targets are reached in the long term. Rapid and multifaceted strategies should carefully navigate challenges present in the wake of Ebola, while also taking advantage of current Ebola-related activities and international attention. Above all, resources and focus currently aimed at these countries must be utilized to build up the deficit in infrastructure and healthcare systems that contributed to the extent of the Ebola outbreak.

  14. Measles among migrants in the European Union and the European Economic Area

    PubMed Central

    Williams, Gemma A.; Bacci, Sabrina; Shadwick, Rebecca; Tillmann, Taavi; Rechel, Bernd; Noori, Teymur; Suk, Jonathan E.; Odone, Anna; Ingleby, Jonathan D.; Mladovsky, Philipa; Mckee, Martin

    2015-01-01

    Aims: Progress towards meeting the goal of measles elimination in the EU and the European Economic Area (EEA) by 2015 is being obstructed, as some children are either not immunized on time or never immunized. One group thought to be at increased risk of measles is migrants; however, the extent to which this is the case is poorly understood, due to a lack of data. This paper addresses this evidence gap by providing an overview of the burden of measles in migrant populations in the EU/EEA. Methods: Data were collected through a comprehensive literature review, a country survey of EU/EEA member states and information from measles experts gathered at an infectious disease workshop. Results: Our results showed incomplete data on measles in migrant populations, as national surveillance systems do not systematically record migration-specific information; however, evidence from the literature review and country survey suggested that some measles outbreaks in the EU/EEA were due to sub-optimal vaccination coverage in migrant populations. Conclusions: We conclude that it is essential that routine surveillance of measles cases and measles, mumps and rubella (MMR) vaccination coverage become strengthened, to capture migrant-specific data. These data can help to inform the provision of preventive services, which may need to reach out to vulnerable migrant populations that currently face barriers in accessing routine immunization and health services. PMID:26563254

  15. Elevated levels of measles antibodies in children with autism.

    PubMed

    Singh, Vijendra K; Jensen, Ryan L

    2003-04-01

    Virus-induced autoimmunity may play a causal role in autism. To examine the etiologic link of viruses in this brain disorder, we conducted a serologic study of measles virus, mumps virus, and rubella virus. Viral antibodies were measured by enzyme-linked immunosorbent assay in the serum of autistic children, normal children, and siblings of autistic children. The level of measles antibody, but not mumps or rubella antibodies, was significantly higher in autistic children as compared with normal children (P = 0.003) or siblings of autistic children (P measles vaccine virus revealed that the antibody was directed against a protein of approximately 74 kd molecular weight. The antibody to this antigen was found in 83% of autistic children but not in normal children or siblings of autistic children. Thus autistic children have a hyperimmune response to measles virus, which in the absence of a wild type of measles infection might be a sign of an abnormal immune reaction to the vaccine strain or virus reactivation.

  16. Instant Childhood Immunization Schedule

    MedlinePlus

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  17. Resurgence of measles in a country of elimination: interim assessment and current control measures in the Republic of Korea in early 2014.

    PubMed

    Yang, Tae Un; Kim, Ju Whi; Eom, Hye Eun; Oh, Hyun-Kyung; Kim, Eun Seong; Kang, Hae Ji; Nam, Jeong-Gu; Kim, Ki Soon; Kim, Sung Soon; Lee, Chan Kyu; Park, Young-Joon; Park, Ok

    2015-04-01

    Since the beginning of 2014, the Republic of Korea has experienced a resurgence of measles cases. Among the 220 cases confirmed as measles during epidemiological weeks 1-20 (December 29, 2013 to May 17, 2014), 10 imported cases were identified. The predominant genotype was B3, which reflects the circulating measles virus in adjacent countries. Even with the verification of measles elimination in March 2014 by the World Health Organization, recent importation has been related to international travel. Targeted control measures have been implemented in addition to proper isolation and patient care. A vigilant surveillance system and high levels of vaccine coverage should be maintained to sustain the measles elimination status.

  18. Antibody persistence and immune memory in adults, 15 years after a three-dose schedule of a combined hepatitis A and B vaccine.

    PubMed

    Van Damme, P; Leroux-Roels, G; Crasta, P; Messier, M; Jacquet, J-M; Van Herck, K

    2012-01-01

    A combined hepatitis A and B vaccine is available since 1996. Two separate open-label primary studies evaluated the immunogenicity and safety of this hepatitis A and B vaccine (720 EI.U of HAV and 20 µg of HBsAg) in 306 healthy subjects aged 17-43 years who received three doses of the vaccine following a 0, 1, and 6 months schedule. These subjects were followed up annually for the next 15 years to evaluate long-term persistence of anti-HAV and anti-HBs antibodies. The subjects whose antibody concentrations fell below the cut-offs between Year 11 and Year 15 (anti-HAV: <15 mIU/ml; anti-HBs: <10 mIU/ml) were offered an additional dose of the appropriate monovalent hepatitis A and/or B vaccine. In subjects who received the additional vaccine dose, a blood sample was collected 1 month after vaccination. At the Year 15 time point, all subjects in Study A and Study B were seropositive for anti-HAV antibodies and 89.3% and 92.9% of subjects in the respective studies had anti-HBs antibody concentrations ≥10 mIU/ml. Four subjects (two in each study) received an additional dose of monovalent hepatitis B vaccine and mounted anamnestic responses to vaccination. No vaccine-related serious adverse events were reported. This study confirms the long-term immunogenicity of the three-dose regimen of the combined hepatitis A and B vaccine, as eliciting long-term persistence of antibodies and immune memory against hepatitis A and B for up to at least 15 years after a primary vaccination.

  19. Measles outbreak in Venezuela: a new challenge to postelimination surveillance and control?

    PubMed

    Sarmiento, Héctor; Cobo, Oswaldo Barrezueta; Morice, Ana; Zapata, Roger; Benitez, María Victoria; Castillo-Solórzano, Carlos

    2011-09-01

    The circulation of wild measles virus was interrupted in Venezuela in February 2007 after the catch-up vaccination (1994) and monitoring (1998) and in response to the measles outbreak in 2001. Traditionally, the routine coverage with measles-mumps-rubella vaccine does not exceed 85%. In February 2006, a measles outbreak started by importation in the State Miranda; this extended to 7 states and lasted 50 weeks with an intermediate period of 17 weeks without reported cases. New cases were reported in the States Guarico and Amazon. The pattern of circulation of the silent period was determined through the use of retrospective search for measles; this showed that 57% of suspected cases did not enter the surveillance system. Molecular epidemiology made it possible to identify B3 as only genotype, which also circulated in Spain. The epidemiological and clinical characteristics of measles have been modified; these determine outbreaks identified late, of slow expansion, silent, and with limited case-fatality, compared with classical outbreaks. The outbreak spread by that behavior was not recognized and the classical control measures did not result. The beginning of a broader and intense vaccination was delayed, partly by weaknesses in the sensitivity of the system. It is crucial to recognize the new behavior of measles and the effectiveness of the classical control measures, and especially to establish criteria for interruption of the circulation to control an outbreak in this stage of elimination.

  20. A Measles Outbreak in an Underimmunized Amish Community in Ohio.

    PubMed

    Gastañaduy, Paul A; Budd, Jeremy; Fisher, Nicholas; Redd, Susan B; Fletcher, Jackie; Miller, Julie; McFadden, Dwight J; Rota, Jennifer; Rota, Paul A; Hickman, Carole; Fowler, Brian; Tatham, Lilith; Wallace, Gregory S; de Fijter, Sietske; Parker Fiebelkorn, Amy; DiOrio, Mary

    2016-10-06

    Background Although measles was eliminated in the United States in 2000, importations of the virus continue to cause outbreaks. We describe the epidemiologic features of an outbreak of measles that originated from two unvaccinated Amish men in whom measles was incubating at the time of their return to the United States from the Philippines and explore the effect of public health responses on limiting the spread of measles. Methods We performed descriptive analyses of data on demographic characteristics, clinical and laboratory evaluations, and vaccination coverage. Results From March 24, 2014, through July 23, 2014, a total of 383 outbreak-related cases of measles were reported in nine counties in Ohio. The median age of case patients was 15 years (range, <1 to 53); a total of 178 of the case patients (46%) were female, and 340 (89%) were unvaccinated. Transmission took place primarily within households (68% of cases). The virus strain was genotype D9, which was circulating in the Philippines at the time of the reporting period. Measles-mumps-rubella (MMR) vaccination coverage with at least a single dose was estimated to be 14% in affected Amish households and more than 88% in the general (non-Amish) Ohio community. Containment efforts included isolation of case patients, quarantine of susceptible persons, and administration of the MMR vaccine to more than 10,000 persons. The spread of measles was limited almost exclusively to the Amish community (accounting for 99% of case patients) and affected only approximately 1% of the estimated 32,630 Amish persons in the settlement. Conclusions The key epidemiologic features of a measles outbreak in the Amish community in Ohio were transmission primarily within households, the small proportion of Amish people affected, and the large number of people in the Amish community who sought vaccination. As a result of targeted containment efforts, and high baseline coverage in the general community, there was limited spread beyond

  1. EuSANH workshop "Reasons behind the differences in national vaccination schedules for under-five", European Public Health pre-conference workshop, Malta, 8 November 2012.

    PubMed

    Theeten, H; Nohynek, H; Coenen, T M M

    2013-10-01

    Vaccination schedules for under-five children in the EU member states differ markedly, mainly as a consequence of differences in programme organization, decision making and history, and to a limited extent by epidemiological differences. There is little willingness towards unification since little evidence exists to prefer one schedule over the others, but the differences might impact on public confidence. Monitoring key determinants influencing individual decision making on immunization ('soft impacts') is thus as important as other existing monitoring systems of the 'hard' impacts of immunization programmes, and both should focus on the impact of these schedule differences. Harmonization of vaccination schedules is not the main issue, but the reasons behind the differences should be explained in an understandable and coherent way to the public. Scientists and advisory bodies should look over the country borders and communicate any crucial information, in order to improve scientific consensus on immunization schedules and programmes. These were the main conclusions of a members' experts panel of the European network of independent science advisory bodies on health (EuSANH), at a workshop in November 2012.

  2. MHealth to Improve Measles Immunization in Guinea-Bissau: Study Protocol for a Randomized Controlled Trial

    PubMed Central

    Ravn, Henrik; Batista, Celso Soares Pereira; Rodrigues, Amabelia

    2016-01-01

    Background Recent studies have revealed a low measles vaccination (MV) rate in the Republic of Guinea-Bissau (West Africa) that has not increased in accordance with the increasing coverage of other vaccinations. Measles is the deadliest of all childhood rash/fever illnesses and spreads easily, implying that if the vaccination coverage is declining there is a significant risk of new measles outbreaks [27]. Meanwhile, mobile health (mHealth; the use of mobile phones for health interventions) has generated much enthusiasm, and shown potential in improving health service delivery in other contexts. Objective The aim of this study is to evaluate the efficiency of mHealth as a tool for improving MV coverage while contributing to the mHealth evidence base. Methods This study will take place at three health centers in different regions of Guinea-Bissau. Participants, defined as mothers of the children receiving the MV, will be enrolled when they arrive with their children at the health center to receive the Bacillus Calmette-Guérin vaccination, usually within one month of the child’s birth. Enrolment will continue until a study population of 990 children has been reached. The participants will be randomly assigned to a control arm or one of two intervention arms. Each of the three groups will have 330 participants, distributed equally between health centers. Participants in the first intervention arm will receive a scheduled short message service (SMS) text message reminding them of the MV. Participants in the second intervention arm will receive a voice call in addition to the SMS message, while the control arm will receive no interventions. The MV is scheduled to be administered at 9 months of age. Although the vaccine would still be effective after 12 months, local policy in Guinea-Bissau prevents children aged >12 months from receiving the vaccination, and thus the study will follow-up with participants after the children reach 12 months of age. Children who have

  3. Child vaccination policies in Europe: a report from the Summits of Independent European Vaccination Experts.

    PubMed

    Schmitt, Heinz J; Booy, Robert; Weil-Olivier, Catherine; Van Damme, Pierre; Cohen, Robert; Peltola, Heikki

    2003-02-01

    Despite the proven safety and efficacy of vaccines, common vaccine-preventable diseases such as measles are not yet controlled in all European countries. This is largely due to three factors. First, vaccination systems differ widely throughout Europe and they vary between highly centralised and totally decentralised systems. Both have advantages and disadvantages, but without doubt they can all work locally. "Harmonisation" in this field is neither a prerequisite nor a guarantee for success. Second, perception of vaccination--and this includes education of the public--is most crucial. In this field the media play an important part, but their ability or will to communicate complicated scientific matters in an appropriate way to the public is often insufficient. Third, political will may be the single most important factor for success in vaccination. Only if the European Union comes up with and implements common vaccination goals with firm deadlines can the best health through vaccination of all Europeans be accomplished. The system as well as the schedule used would then be of minor importance.

  4. Randomized trial of the immunogenicity and safety of the Hepatitis B vaccine given in an accelerated schedule coadministered with the human papillomavirus type 16/18 AS04-adjuvanted cervical cancer vaccine.

    PubMed

    Leroux-Roels, Geert; Haelterman, Edwige; Maes, Cathy; Levy, Jack; De Boever, Fien; Licini, Laurent; David, Marie-Pierre; Dobbelaere, Kurt; Descamps, Dominique

    2011-09-01

    The human papillomavirus type 16/18 (HPV-16/18) AS04-adjuvanted cervical cancer vaccine is licensed for females aged 10 years and above and is therefore likely to be coadministered with other licensed vaccines, such as hepatitis B. In this randomized, open-label study, we compared the immunogenicity of the hepatitis B vaccine administered alone (HepB group) or with the HPV-16/18 AS04-adjuvanted vaccine (HepB+HPV group) in healthy women aged 20 to 25 years (clinical trial NCT00637195). The hepatitis B vaccine was given at 0, 1, 2, and 12 months (an accelerated schedule which may be required by women at high risk), and the HPV-16/18 vaccine was given at 0, 1, and 6 months. One month after the third dose of hepatitis B vaccine, in the according-to-protocol cohort (n = 72 HepB+HPV; n = 76 HepB), hepatitis B seroprotection rates (titer of ≥10 mIU/ml) were 96.4% (95% confidence interval [CI], 87.5 to 99.6) and 96.9% (CI, 89.2 to 99.6) in the HepB+HPV and HepB groups, respectively, in women initially seronegative for anti-hepatitis B surface antigen (HBs) and anti-hepatitis B core antigen (HBc). Corresponding geometric mean titers of anti-HBs antibodies were 60.2 mIU/ml (CI, 40.0 to 90.5) and 71.3 mIU/ml (CI, 53.9 to 94.3). Anti-HBs antibody titers rose substantially after the fourth dose of hepatitis B vaccine. All women initially seronegative for anti-HPV-16 and anti-HPV-18 antibodies seroconverted after the second HPV-16/18 vaccine dose and remained seropositive up to 1 month after the third dose. Both vaccines were generally well tolerated, with no difference in reactogenicity between groups. In conclusion, coadministration of the HPV-16/18 AS04-adjuvanted vaccine did not affect the immunogenicity or safety of the hepatitis B vaccine administered in an accelerated schedule in young women.

  5. A Review of Measles

    ERIC Educational Resources Information Center

    Dardis, Melissa R.

    2012-01-01

    Measles, once a common childhood illness that many older school nurses could recognize without difficulty, needs review again after reemerging from Europe and other continents. A highly contagious disease, which has been referenced since the seventh century, the virus can cause serious illness and death, despite the fact that it is vaccine…

  6. The state of measles and rubella in the WHO European Region, 2013.

    PubMed

    Muscat, M; Shefer, A; Ben Mamou, M; Spataru, R; Jankovic, D; Deshevoy, S; Butler, R; Pfeifer, D

    2014-05-01

    Measles and rubella persist in the World Health Organization European Region despite long-standing and widespread use of vaccines against them. Our aim was to review the epidemiology of measles and rubella in relation to the goal of eliminating these diseases from the Region by 2015. We report on the number of measles and rubella cases by country in 2012 and present an analysis of preliminary measles and rubella surveillance data for 2013. We analysed data of these diseases for 2013 by age group, diagnosis confirmation (clinical, laboratory-confirmed and epidemiologically linked), and vaccination, hospitalization and importation status. We also report on measles-related deaths. For 2012, there were 26,785 [corrected] measles cases and 29,601 rubella cases reported in the Region. For 2013, these figures were 31,520 and 39,367 respectively. Most measles cases in 2013 (96%; n = 30,178) were reported by nine countries: Georgia (7830), Germany (1773), Italy (2216), the Netherlands (2499), Romania (1074), the Russian Federation (2174), Turkey (7404), Ukraine (3308) and the United Kingdom (1900). In 2013, most measles cases were among unvaccinated persons and over one in three patients were aged 20 years and older. For 2013, almost all rubella cases were reported by Poland (n = 38,585; 98%). High population immunity and high-quality surveillance are the cornerstones to eliminate measles and rubella. Without sustained political commitment and accelerated action by Member States and partners, the elimination of measles and rubella in the WHO European Region may not be achieved.

  7. Clinical Impact of Vaccine Development.

    PubMed

    Nambiar, Puja H; Daza, Alejandro Delgado; Livornese, Lawrence L

    2016-01-01

    The discovery and development of immunization has been a singular improvement in the health of mankind. This chapter reviews currently available vaccines, their historical development, and impact on public health. Specific mention is made in regard to the challenges and pursuit of a vaccine for the human immunodeficiency virus as well as the unfounded link between autism and measles vaccination.

  8. [Immunization Programme and Coverage against Measles and Rubella in Spain. Challenges for Achieving their Elimination].

    PubMed

    Limia Sánchez, Aurora; Molina Olivas, Marta

    2015-01-01

    The World Health Organization had established the achievement and sustainability of very high coverage with two doses of vaccine against measles and at least one against rubella as one of the key strategies for the elimination of both measles and rubella. The current immunization programme in Spain includes the immunization with two doses of combined vaccine against measles, mumps and rubella at 12 months and 3-4 years of age. Since 2000 coverage with first dose is over the target of 95% but the coverage with the second dose remains between 90 and 95%. In 2014, at subnational level three regions had coverage below the objective and only eight regions achieved the objective for the second dose. The challenges and some activities to strengthen the immunization programme in order to achieve the elimination of measles and rubella are discussed.

  9. The Costs and Valuation of Health Impacts of Measles and Rubella Risk Management Policies.

    PubMed

    Thompson, Kimberly M; Odahowski, Cassie L

    2016-07-01

    National and global health policymakers require good information about the costs and benefits of their investments in measles and rubella immunization programs. Building on our review of the existing measles and rubella health economics literature, we develop inputs for use in regional and global models of the expected future benefits and costs of vaccination, treatment, surveillance, and other global coordination activities. Given diversity in the world and limited data, we characterize the costs for countries according to the 2013 World Bank income levels using 2013 U.S. dollars (2013$US). We estimate that routine immunization and supplemental immunization activities will cost governments and donors over 2013$US 2.3 billion per year for the foreseeable future, with high-income countries accounting for 55% of the costs, to vaccinate global birth cohorts of approximately 134 million surviving infants and to protect the global population of over 7 billion people. We find significantly higher costs and health consequences of measles or rubella disease than with vaccine use, with the expected disability-adjusted life year (DALY) loss for case of disease generally at least 100 times the loss per vaccine dose. To support estimates of the economic benefits of investments in measles and/or rubella elimination or control, we characterize the probabilities of various sequelae of measles and rubella infections and vaccine adverse events, the DALY inputs for health outcomes, and the associated treatment costs. Managing measles and rubella to achieve the existing and future regional measles and rubella goals and the objectives of the Global Vaccine Action Plan will require an ongoing commitment of financial resources that will prevent adverse health outcomes and save the associated treatment costs.

  10. [Modification of pertussis vaccination schedule in Chile, immunization of special groups and control strategies: Commentary from the Consultive Committee of Immunizations of The Chilean Society of Infectious Diseases].

    PubMed

    Potin, Marcela; Cerda, Jaime; Contreras, Lily; Muñoz, Alma; Ripoll, Erna; Vergara, Rodrigo

    2012-06-01

    In Chile, an increased number of notifications of cases of whooping cough was detected at the beginning of October 2010, and maintained through 2012. Accumulated cases during 2011 were 2,581 (15.0 per 100,000), which is greater than the number of cases registered during the period 2008-2010 (2,460 cases). On the other hand, the local sanitary authority introduced a modification of pertussis vaccination schedule (starting 2012), which consists in the replacement of the second booster of pertussis vaccine (DTwP, administered to 4-year-old children) as well as diphtheria-tetanus toxoid (dT, administered to second grade scholars) for an acellular pertussis vaccine with reduced antigenic content (dTpa), which will be administrated to first grade scholars. The Consultive Committee of Immunizations considers that the modification is adequate, since it extends the age of protection, reducing at least in theory the infection in older scholars and adolescents -who are significant sources of transmission of Bordetella pertussis to infants- using an adequate vaccine formulation (acellular pertussis vaccine). The available evidence regarding vaccination in special groups (adolescents and adults, health-care workers and pregnant women) and cocooning strategy are commented.

  11. Poliomyelitis, measles and neonatal tetanus: a hospital based epidemiological study.

    PubMed

    El Shazly, M K; Atta, H Y; Kishk, N A

    1997-01-01

    Vaccine-preventable diseases constitute a major health problem contributing to the morbidity and mortality in many developing countries including Egypt. WHO adopted resolutions to eradicate poliomyelitis by the year 2000, eliminate neonatal tetanus by the year 1995, and reduce measles mortality by 95% and morbidity by 90%, compared to the pre-immunization levels by 1995. Evaluation of preventive programs for these diseases necessitates availability of up to date information on their occurrence. The present study was undertaken to determine the current epidemiological features of poliomyelitis, neonatal tetanus and measles, to identify the trends of these diseases as well as to determine their outcomes and hospital loads. Data about the admitted cases of poliomyelitis, neonatal tetanus and measles were collected from the hospital register of Alexandria fever hospital for five successive years (1992-96). Available information on age, sex, residence, diagnosis, outcome of treatment, dates of admission and discharge were collected. The total number of cases of the three diseases admitted to the hospital during the period 1992-96 were 1406, measles represented 85.4%, neonatal tetanus 13.9% and poliomyelitis 0.7%. The results revealed that in the year 1994 only one case of poliomyelitis was admitted and since then no other cases were reported. The number of measles cases increased gradually in the latter years and about 78% of them were older than five years of age. A significant increase in the age of measles occurrence was observed. A gradual decline in the number of neonatal tetanus cases was observed. These cases were more apt to occur among early neonates but still clustered in certain geographical areas. The results of the study pinpoint the long term impact of the well run program aiming at eradicating poliomyelitis in Alexandria. However, for elimination of neonatal tetanus and controlling measles morbidity, further activities are required including strengthening

  12. [The State of Measles and Rubella in the WHO European region].

    PubMed

    Muscat, Mark; Ben Mamou, Myriam; Shefer, Abigail; Jankovic, Dragan; Deshevoy, Sergei; Butler, Robb

    2015-01-01

    The long-standing and widespread use of vaccines against measles has resulted in a dramatic decline in cases and measles mortality worldwide compared with the pre-vaccination era.All regions of the World Health Organization (WHO) have measles elimination goals and the WHO regions of the Americas, Europe and Western Pacific also have rubella elimination goals. This article aims to report on progress toward elimination of measles and rubella in the WHO European Region based on the latest available data. We also discuss current challenges and actions needed to reach this goal in the Region. Despite substantial progress made towards controlling measles and rubella, the countries of the WHO European Region continue to face challenges in interrupting endemic transmission of these diseases. Widespread outbreaks and endemic transmission of measles and rubella persisted in some countries of the Region in 2014 and have continued in 2015. Interrupting endemic transmission in each and every country is necessary to declare elimination for the entire Region. High population immunity and high-quality surveillance are the cornerstones to eliminate measles and rubella. In the absence of sustained political commitment and implementation of the required strategies by all countries, the goal of eliminating these diseases in the WHO European Region is at stake.

  13. [The historical development of immunization in Germany. From compulsory smallpox vaccination to a National Action Plan on Immunization].

    PubMed

    Klein, S; Schöneberg, I; Krause, G

    2012-11-01

    In the German Reich, smallpox vaccinations were organized by the state. A mandatory vaccination throughout the empire was introduced in 1874, which was continued in the Federal Republic of Germany (FRG) and the German Democratic Republic (GDR) until 1982/1983. From 1935, health departments were responsible for vaccinations. In the GDR, immunization was tightly organized: The state made great efforts to achieve high vaccination rates. Responsibilities were clearly defined at all levels and for all ages. While vaccination was initially mandatory only at the regional level, the legally mandated immunization schedule later contained compulsory vaccinations, e.g., against measles. In the beginning there were mandatory vaccinations in the FRG at the Länder level. Since 1961, the Federal Epidemics Act has impeded obligatory vaccinations. Instead, voluntary vaccinations based on recommendations were stressed. Since the 1980s, vaccinations have been shifted from the public health service sector to office-based physicians. Today, public health authorities offer mainly supplementary vaccinations. In 2007, protective immunizations were introduced as compulsory benefits of the statutory health insurance (SHI). Recently, the German federal states developed a National Vaccination Plan to support immunization strategies.

  14. Measles surveillance in Taiwan, 2012-2014: Changing epidemiology, immune response, and circulating genotypes.

    PubMed

    Cheng, Wen-Yueh; Wang, Hsiao-Chi; Wu, Ho-Sheng; Liu, Ming-Tsan

    2016-05-01

    In Taiwan, although the coverage rate of two doses of measles-containing vaccine has been maintained at over 95% since 2001, measles outbreaks occurred in 2002, 2009, and 2011. The present study reports that 43 cases were confirmed by laboratory testing in Taiwan in 2012-2014 and that adults have emerged as one of groups susceptible to measles virus (MV) infection, who may have discrepant humoral immune reactions--indicated by the level of IgM and IgG antibodies compared to a naïve, susceptible measles case. Thirty-seven of 43 cases confirmed by RT-PCR were further characterized by genotyping. In Taiwan, genotype H1 was the major strain in circulation prior to 2010, while D9 was the most frequently detected MV genotype between 2010 and 2011. The genotyping data collected between 2012 and 2014 revealed that H1 rebounded in 2012 after an absence in 2011 and was imported from China and Vietnam. In 2014, genotype B3 first appeared in Taiwan following import from the Philippines and became the most frequently detected strain. Genotype D8, linked to importation from various countries, including India, Indonesia, Thailand, and Vietnam, showed sequence divergence. D9 was imported from Malaysia in 2014. The MV genotypes detected in Taiwan reflected the genotypes of circulating endemic measles strains in neighboring countries. A significant rise in the number of measles cases and in measles with genotypes imported from surrounding countries indicated that measles resurged in Asia in 2014.

  15. Cell mediated immunity after measles in Guinea-Bissau: historical cohort study.

    PubMed Central

    Shaheen, S. O.; Aaby, P.; Hall, A. J.; Barker, D. J.; Heyes, C. B.; Shiell, A. W.; Goudiaby, A.

    1996-01-01

    OBJECTIVE: To investigate whether children who have had measles have reduced general cell mediated immunity three years later compared with vaccinated children who have not had measles. DESIGN: Historical cohort study. SETTING: Bissau, Guinea-Bissau. SUBJECTS: 391 children aged 3-13 years who were living in Bissau during a measles epidemic in 1991 and still lived there. These included 131 primary cases and 139 secondary cases from the epidemic and 121 vaccinated controls with no history of measles. MAIN OUTCOME MEASURES: General cell mediated immunity assessed by measurement of delayed type hypersensitivity skin responses to seven recall antigens. Anergy was defined as a lack of response to all antigens. RESULTS: 82 out of 268 cases of measles (31%) were anergic compared with 20 of the 121 vaccinated controls (17%) (odds ratio adjusted for potential confounding variables 2.2 (95% confidence interval 1.2 to 4.0); P 0.009). The prevalence of anergy was higher in secondary cases (33% (46/138)) than in primary cases (28% (36/130)), although this difference was not significant. Anergy was more common in the rainy season (unadjusted prevalence 31% (91/291) than in the dry season (11% (11/98)) (adjusted odds ratio 4.8 (2.2 to 10.3)). This seasonal increase occurred predominantly in the case of measles. CONCLUSION: Reduced general cell mediated immunity may contribute to the higher long term mortality in children who have had measles compared with recipients of standard measles vaccine and to the higher child mortality in the rainy season in west Africa. PMID:8892416

  16. Measles imported to the United States by children adopted from China.

    PubMed

    Su, Qiru; Zhang, Yanyang; Ma, Yating; Zheng, Xiang; Han, Tongwu; Li, Feng; Hao, Lixin; Ma, Chao; Wang, Huaqing; Li, Li; Luo, Huiming

    2015-04-01

    In July 2013, the National Immunization Program of China was notified by the US Centers for Disease Control and Prevention that measles was detected in 3 newly adopted, special needs children with cerebral palsy (CP) from China. We report an investigation of measles transmission in China that led to infection of these children. Interviews were conducted with welfare institute staff and panel physicians; health records of the potentially exposed population were reviewed; and immunization coverage was assessed among institute residents. Five residents with CP, all unvaccinated against measles, among who were the 3 adoptees, were linked epidemiologically into 3 generations of measles transmission antecedent to the US outbreak. In a random sample of residents, first dose of measles containing vaccine (MCV1) and MCV2 coverage was 16 of 17 (94%) and 7 of 11 (64%) among children with CP, and 100% (32 of 32) and 96% (21 of 22) among children without CP. Vaccinators reported reluctance to vaccinate children with CP because the China pharmacopeia lists encephalopathy as a contraindication to vaccination. Panel physicians reported to investigators no necessity of vaccination for adoptees to the United States if US parents sign an affidavit exempting the child from vaccination. We recommend that the China pharmacopeia vaccine contraindications be reviewed and updated, the United States should reconsider allowing vaccination exemptions for internationally adopted children unless there are true medical contraindications to vaccination, and US pediatricians should counsel adopting parents to ensure that their child is up-to-date on recommended vaccinations before coming to the United States.

  17. Vaccines

    MedlinePlus Videos and Cool Tools

    Vaccinations are injections of antigens into the body. Once the antigens enter the blood, they circulate along ... suppressor T cells stop the attack. After a vaccination, the body will have a memory of an ...

  18. Vaccines and autism: evidence does not support a causal association.

    PubMed

    DeStefano, F

    2007-12-01

    A suggested association between certain childhood vaccines and autism has been one of the most contentious vaccine safety controversies in recent years. Despite compelling scientific evidence against a causal association, many parents and parent advocacy groups continue to suspect that vaccines, particularly measles-mumps-rubella (MMR) vaccine and thimerosal-containing vaccines (TCVs), can cause autism.

  19. Immunization Schedules for Preteens and Teens

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Preteens and Teens United States, 2017 ... on track. View or Print a Schedule Recommended Immunizations for Preteens and Teens (7-18 years) Recommended ...

  20. Your Baby's First Vaccines

    MedlinePlus

    ... Link Vaccines & Immunizations Immunization Schedules Your Child's First Vaccines Format: Select one PDF [335 KB] RTF [260 ... child will get one or more of these vaccines today: DTaP Hib Hepatitis B Polio PCV13 Why ...

  1. Meningococcal Vaccine (For Parents)

    MedlinePlus

    ... Your 1- to 2-Year-Old Your Child's Immunizations: Meningococcal Vaccines KidsHealth > For Parents > Your Child's Immunizations: ... who are at increased risk for meningococcal disease. Immunization Schedule Vaccination with meningococcal conjugate vaccine is recommended: ...

  2. Randomized, double-blind, active-controlled study evaluating the safety and immunogenicity of three vaccination schedules and two dose levels of AV7909 vaccine for anthrax post-exposure prophylaxis in healthy adults.

    PubMed

    Hopkins, Robert J; Kalsi, Gurdyal; Montalvo-Lugo, Victor M; Sharma, Mona; Wu, Yukun; Muse, Derek D; Sheldon, Eric A; Hampel, Frank C; Lemiale, Laurence

    2016-04-19

    AV7909 vaccine being developed for post-exposure prophylaxis of anthrax disease may require fewer vaccinations and reduced amount of antigen to achieve an accelerated immune response over BioThrax(®) (Anthrax Vaccine Adsorbed). A phase 2, randomized, double-blind, BioThrax vacccine-controlled study was conducted to evaluate the safety and immunogenicity of three intramuscular vaccination schedules and two dose levels of AV7909 in 168 healthy adults. Subjects were randomized at a 4:3:2:4:2 ratio to 5 groups: (1) AV7909 on Days 0/14; (2) AV7909 on Days 0/28; (3) AV7909 on Days 0/14/28; (4) half dose AV7909 on Days 0/14/28; and (5) BioThrax vaccine on Days 0/14/28. Vaccinations in all groups were well tolerated. The incidences of adverse events (AEs) were 79% for AV7909 subjects and 65% for BioThrax subjects; 92% of AV7909 subjects and 87% of BioThrax subjects having AEs reported Grade 1-2 AEs. No serious AEs were assessed as potentially vaccine-related, and no AEs of potential autoimmune etiology were reported. There was no discernible pattern indicative of a safety concern across groups in the incidence or severity of reactogenicity events. Groups 2-4 achieved success for the primary endpoint, demonstrated by a lower 95% confidence limit of the percentage of subjects with protective toxin neutralizing antibody NF50 values (≥0.56) to be ≥40% at Day 63. Group 1 marginally missed the criterion (lower bound 95% confidence limit of 39.5%). Immune responses were above this threshold for Groups 1, 3 and 4 at Day 28 and all groups at Day 42. Further study of an AV7909 two-dose schedule given 2 weeks apart is warranted in light of the favorable tolerability profile and immunogenicity response relative to three doses of BioThrax vaccine, as well as preliminary data from nonclinical studies indicating similar immune responses correlate with higher survival for AV7909 than BioThrax vaccine.

  3. Monitoring the process of measles elimination by serosurveillance data: The Apulian 2012 study.

    PubMed

    Tafuri, S; Gallone, M S; Gallone, M F; Pappagallo, M T; Larocca, A; Germinario, C

    2016-04-19

    In 2003 Italy adopted the National Plan for Measles and Congenital Rubella Elimination, but some outbreaks of measles are still occurring, as the target coverage rate (≥ 95%) for new-borns has currently not been achieved. In order to support the monitoring of the measles elimination programme, the authors carried out a survey about the seroprevalence of measles among Apulia young adults. The study was carried out from May 2011 to June 2012 among blood donors of the Department of Transfusion Medicine of Policlinico General Hospital in Bari. Subjects were enrolled by a convenience sampling. For each enrolled patient we collected a 5 mL serum sample. Collected sera were tested by chemiluminescence (CLIA) for anti-Measles IgG. We enrolled 1764 subjects; 1362 (77.2%) were male with a mean age of 38.4 ± 11.7 years. Anti-Measles IgG titre was >16.5UA/mL in 95.1% (95% CI=94.1-96.1) of enrolled subjects with a Geometric Mean Titre (GMT) of 2.3 ± 0.4, which did not differ dividing the enrolled subjects into age groups. As our data showed, the universal routine vaccination changed the epidemiological pattern among adults, in particular young adults (18-24 years), who showed lowest seropositivity rates; in these groups of population there is a risk of the onset of outbreaks due to the presence of susceptible population. This is a paradox linked to the vaccination strategy: when coverage rates keep sub-optimal, measles is more likely to affect young adults and a higher percentage of complications is expected. According to our data, health authorities have to plan a mop-up strategy to actively offer measles vaccination to susceptible young adults.

  4. Healthcare Workers and Post-Elimination Era Measles: Lessons on Acquisition and Exposure Prevention

    PubMed Central

    Gohil, Shruti K.; Okubo, Sandra; Klish, Stephen; Dickey, Linda; Huang, Susan S.; Zahn, Matthew

    2016-01-01

    Background. When caring for measles patients, N95 respirator use by healthcare workers (HCWs) with documented immunity is not uniformly required or practiced. In the setting of increasingly common measles outbreaks and provider inexperience with measles, HCWs face increased risk for occupational exposures. Meanwhile, optimal infection prevention responses to healthcare-associated exposures are loosely defined. We describe measles acquisition among HCWs despite prior immunity and lessons from healthcare-associated exposure investigations during a countywide outbreak. Methods. Primary and secondary cases, associated exposures, and risk factors were identified during a measles outbreak in Orange County, California from, 30 January 2014 to 21 April 2014. We reviewed the effect of different strategies in response to hospital exposures and resultant case capture. Results. Among 22 confirmed measles cases, 5 secondary cases occurred in HCWs. Of these, 4 had direct contact with measles patients; none wore N95 respirators. Four HCWs had prior evidence of immunity and continued working after developing symptoms, resulting in 1014 exposures, but no transmissions. Overall, 13 of 15 secondary cases had face-to-face contact with measles patients, 8 with prior evidence of immunity. Conclusions. HCWs with unmasked, direct contact with measles patients are at risk for developing disease despite evidence of prior immunity, resulting in potentially large numbers of exposures and necessitating time-intensive investigations. Vaccination may lower infectivity. Regardless of immunity status, HCWs should wear N-95 respirators (or equivalent) when evaluating suspected measles patients. Those with direct unprotected exposure should be monitored for symptoms and be furloughed at the earliest sign of illness. PMID:26354971

  5. Health burden and economic impact of measles-related hospitalizations in Italy in 2002–2003

    PubMed Central

    Filia, Antonietta; Brenna, Antonio; Panà, Augusto; Maggio Cavallaro, Gianluca; Massari, Marco; Ciofi degli Atti, Marta L

    2007-01-01

    Background A large measles outbreak occurred in Italy in 2002–2003. This study evaluates the health burden and economic impact of measles-related hospitalizations in Italy during the specified period. Methods Hospital discharge abstract data for measles hospitalizations in Italy during 2002–2003 were analysed to obtain information regarding number and rates of measles hospitalizations by geographical area and age group, length of hospital stay, and complications. Hospitalization costs were estimated on the basis of Diagnosis-Related Groups. Results A total of 5,154 hospitalizations were identified, 3,478 (67%) of which occurred in children <15 years of age. Most hospitalizations occurred in southern Italy (71 %) and children below 1 year of age presented the greatest hospitalization rates (46.2/100,000 and 19.0/100,000, respectively in 2002 and 2003). Pneumonia was diagnosed in 594 cases (11.5%) and encephalitis in 138 cases (2.7%). Total hospital charges were approximately € 8.8 million. Conclusion The nationwide health burden associated with measles during the 2002–2003 outbreak was substantial and a high cost was incurred by the Italian National Health Service for the thousands of measles-related hospitalizations which occurred. By assuming that hospital costs represent 40–50% of the direct costs of measles cases, direct costs of measles for the two years combined were estimated to be between €17.6 – 22.0 million, which equates to the vaccination of 1.5–1.9 million children (3–4 birth cohorts) with one dose of MMR. The high cost of measles and the severity of its complications fully justify the commitment required to reach measles elimination. PMID:17650298

  6. Complete Genome Sequence of a Wild-Type Measles Virus Isolated during a 2016 Winter Outbreak in a Refugee Settlement in Calais, France

    PubMed Central

    Hamel, Justine; Antona, Denise; Vabret, Astrid

    2017-01-01

    ABSTRACT Measles outbreaks are regularly reported in European countries despite efforts to improve vaccination coverage. In January 2016, an outbreak occurred in a refugee settlement in Calais, France. We report here the complete genome sequence of a wild-type measles virus isolated from a health care worker (MVi/Calais. FRA/01.16) infected during this outbreak. PMID:28280010

  7. Immunogenicity and safety of a live attenuated shingles (herpes zoster) vaccine (Zostavax®) in individuals aged ≥ 70 years: a randomized study of a single dose vs. two different two-dose schedules.

    PubMed

    Vesikari, Timo; Hardt, Roland; Rümke, Hans C; Icardi, Giancarlo; Montero, Jordi; Thomas, Stéphane; Sadorge, Christine; Fiquet, Anne

    2013-04-01

    Disease protection provided by herpes zoster (HZ) vaccination tends to reduce as age increases. This study was designed to ascertain whether a second dose of the HZ vaccine, Zostavax(®), would increase varicella zoster virus (VZV)-specific immune response among individuals aged ≥ 70 y. Individuals aged ≥ 70 y were randomized to receive HZ vaccine in one of three schedules: a single dose (0.65 mL), two doses at 0 and 1 mo, or two doses at 0 and 3 mo. VZV antibody titers were measured at baseline, 4 weeks after each vaccine dose, and 12 mo after the last dose. In total, 759 participants (mean age 76.1 y) were randomized to receive vaccination. Antibody responses were similar after a single dose or two doses of HZ vaccine [post-dose 2/post-dose 1 geometric mean titer (GMT) ratios for the 1-mo or 3-mo schedules were 1.11, 95% confidence interval (CI) 1.02-1.22 and 0.78, 95% CI 0.73-0.85], respectively). The 12-mo post-dose 2/12-mo post-dose 1 GMT ratio was similar for the 1-mo schedule and for the 3-mo schedule (1.06, 95% CI 0.96-1.17 and 1.08, 95% CI 0.98-1.19, respectively). Similar immune responses were observed in participants aged 70-79 y and those aged ≥ 80 y. HZ vaccine was generally well tolerated, with no evidence of increased adverse event incidence after the second dose with either schedule. Compared with a single-dose regimen, two-dose vaccination did not increase VZV antibody responses among individuals aged ≥ 70 y. Antibody persistence after 12 mo was similar with all three schedules.

  8. FastStats: Measles

    MedlinePlus

    ... States, 2015, table 33 [PDF - 9.8 MB] Vaccination: Children Percent of children ages 19-35 months ... States, 2015, table 66 [PDF - 9.8 MB] Vaccination: Adolescents Percent of adolescents ages 13-17 years ...

  9. Randomized trials to study the nonspecific effects of vaccines in children in low-income countries.

    PubMed

    Shann, Frank; Nohynek, Hanna; Scott, J Anthony; Hesseling, Anneke; Flanagan, Katie L

    2010-05-01

    The Expanded Program on Immunization (EPI) has led to large reductions in morbidity and mortality among children in low-income countries. However, the basic EPI schedule may no longer be optimal because of changes in vaccines, programs, and epidemiologic circumstances. In addition, evidence has accumulated that some EPI vaccines may have nonspecific effects that increase or decrease mortality from subsequent infections with other unrelated organisms. There is therefore a need for randomized trials to evaluate the effects of alternative EPI schedules on all-cause mortality, as well as vaccine efficacy against the target diseases. We have reviewed the available literature on the nonspecific effects of vaccines on mortality, and compiled a list of potential trials that might address this issue. We have then ranked the trials based on the potential importance of the results and the ethical and practical considerations. Trials of early BCG vaccination in low-birth-weight babies, early measles vaccination, and altered timing of DTP vaccination all have a high priority.

  10. [Report on a measles epidemic in the Ústí nad Labem Region].

    PubMed

    Trmal, J; Limberková, R

    2015-09-01

    The Czech Republic is a measles free country where only isolated, mostly imported cases have been reported. A measles epidemic that occurred in the Ústí nad Labem Region is presented, with the first case diagnosed early in February 2014 and the last one reported in August 2014. The index case and source of infection to other susceptible patients was an adult male with a history of travel to India. The diagnosis of measles was difficult to make as the patient presented with feverish condition due to co-infection with dengue fever, chikungunya, and measles. The primary measles outbreak occurred in contacts and spread to health workers of the Masaryk Hospital in Ústí nad Labem. The infection further spread to the general population of adults. In total, 305 persons presented with suspected measles. One hundred and eighty-six and of them (61%) met the criteria for a confirmed case (positive clinical symptoms and laboratory test). Fifty (16.4%) patients developed typical clinical symptoms and were epidemiologically linked to confirmed cases, but turned out to be antibody negative. In 69 (22.6%) patients, measles were ruled out. Cases were confirmed by the detection of IgM and IgG antibodies against the measles virus or by RT--PCR. Nearly all cases were verified by the National Reference Laboratory for Rubella, Measles, Mumps, and Parvovirus B 19 of the National Institute of Public Health in Prague. In response to the epidemic, apart from common anti-epidemic measures, emergency vaccination was provided to health professionals of the Masaryk Hospital in Ústí nad Labem. Within two weeks after vaccination, a considerable decline in cases was seen in the vaccinated group. Measles most often occurred in persons born in 1970-1980, but were also observed in the smallest, non-vaccinated children (32 cases). Isolated cases also emerged in duly vaccinated children and adolescents. General recommendations are provided based on practical experience from the epidemic.

  11. The optimal age of measles immunisation in low-income countries: a secondary analysis of the assumptions underlying the current policy

    PubMed Central

    Martins, Cesário L; Garly, May-Lill; Rodrigues, Amabelia; Benn, Christine S; Whittle, Hilton

    2012-01-01

    Objective The current policy of measles vaccination at 9 months of age was decided in the mid-1970s. The policy was not tested for impact on child survival but was based on studies of seroconversion after measles vaccination at different ages. The authors examined the empirical evidence for the six underlying assumptions. Design Secondary analysis. Data sources and methods These assumptions have not been research issues. Hence, the authors examined case reports to assess the empirical evidence for the original assumptions. The authors used existing reviews, and in December 2011, the authors made a PubMed search for relevant papers. The title and abstract of papers in English, French, Portuguese, Spanish, German and Scandinavian languages were assessed to ascertain whether the paper was potentially relevant. Based on cumulative measles incidence figures, the authors calculated how many measles cases had been prevented assuming everybody was vaccinated at a specific age, how many ‘vaccine failures’ would occur after the age of vaccination and how many cases would occur before the specific age of vaccination. In the combined analyses of several studies, the authors used the Mantel–Haenszel weighted RR stratifying for study or age groups to estimate common trends. Setting and participants African community studies of measles infection. Primary and secondary outcomes Consistency between assumptions and empirical evidence and the predicted effect on mortality. Results In retrospect, the major assumptions were based on false premises. First, in the single study examining this point, seronegative vaccinated children had considerable protection against measles infection. Second, in 18 community studies, vaccinated measles cases (‘vaccine failures’) had threefold lower case death than unvaccinated cases. Third, in 24 community studies, infants had twofold higher case death than older measles cases. Fourth, the only study examining the assumption that ‘vaccine

  12. Cost analysis of measles in refugees arriving at Los Angeles International Airport from Malaysia.

    PubMed

    Coleman, Margaret S; Burke, Heather M; Welstead, Bethany L; Mitchell, Tarissa; Taylor, Eboni M; Shapovalov, Dmitry; Maskery, Brian A; Joo, Heesoo; Weinberg, Michelle

    2017-01-09

    Background On August 24, 2011, 31 US-bound refugees from Kuala Lumpur, Malaysia (KL) arrived in Los Angeles. One of them was diagnosed with measles post-arrival. He exposed others during a flight, and persons in the community while disembarking and seeking medical care. As a result, 9 cases of measles were identified. Methods We estimated costs of response to this outbreak and conducted a comparative cost analysis examining what might have happened had all US-bound refugees been vaccinated before leaving Malaysia. Results State-by-state costs differed and variously included vaccination, hospitalization, medical visits, and contact tracing with costs ranging from $621 to $35,115. The total of domestic and IOM Malaysia reported costs for US-bound refugees were $137,505 [range: $134,531 - $142,777 from a sensitivity analysis]. Had all US-bound refugees been vaccinated while in Malaysia, it would have cost approximately $19,646 and could have prevented 8 measles cases. Conclusion A vaccination program for US-bound refugees, supporting a complete vaccination for US-bound refugees, could improve refugees' health, reduce importations of vaccine-preventable diseases in the United States, and avert measles response activities and costs.

  13. From regional pulse vaccination to global disease eradication: insights from a mathematical model of poliomyelitis.

    PubMed

    Browne, Cameron J; Smith, Robert J; Bourouiba, Lydia

    2015-07-01

    Mass-vaccination campaigns are an important strategy in the global fight against poliomyelitis and measles. The large-scale logistics required for these mass immunisation campaigns magnifies the need for research into the effectiveness and optimal deployment of pulse vaccination. In order to better understand this control strategy, we propose a mathematical model accounting for the disease dynamics in connected regions, incorporating seasonality, environmental reservoirs and independent periodic pulse vaccination schedules in each region. The effective reproduction number, Re, is defined and proved to be a global threshold for persistence of the disease. Analytical and numerical calculations show the importance of synchronising the pulse vaccinations in connected regions and the timing of the pulses with respect to the pathogen circulation seasonality. Our results indicate that it may be crucial for mass-vaccination programs, such as national immunisation days, to be synchronised across different regions. In addition, simulations show that a migration imbalance can increase Re and alter how pulse vaccination should be optimally distributed among the patches, similar to results found with constant-rate vaccination. Furthermore, contrary to the case of constant-rate vaccination, the fraction of environmental transmission affects the value of Re when pulse vaccination is present.

  14. Abnormal measles-mumps-rubella antibodies and CNS autoimmunity in children with autism.

    PubMed

    Singh, Vijendra K; Lin, Sheren X; Newell, Elizabeth; Nelson, Courtney

    2002-01-01

    Autoimmunity to the central nervous system (CNS), especially to myelin basic protein (MBP), may play a causal role in autism, a neurodevelopmental disorder. Because many autistic children harbor elevated levels of measles antibodies, we conducted a serological study of measles-mumps-rubella (MMR) and MBP autoantibodies. Using serum samples of 125 autistic children and 92 control children, antibodies were assayed by ELISA or immunoblotting methods. ELISA analysis showed a significant increase in the level of MMR antibodies in autistic children. Immunoblotting analysis revealed the presence of an unusual MMR antibody in 75 of 125 (60%) autistic sera but not in control sera. This antibody specifically detected a protein of 73-75 kD of MMR. This protein band, as analyzed with monoclonal antibodies, was immunopositive for measles hemagglutinin (HA) protein but not for measles nucleoprotein and rubella or mumps viral proteins. Thus the MMR antibody in autistic sera detected measles HA protein, which is unique to the measles subunit of the vaccine. Furthermore, over 90% of MMR antibody-positive autistic sera were also positive for MBP autoantibodies, suggesting a strong association between MMR and CNS autoimmunity in autism. Stemming from this evidence, we suggest that an inappropriate antibody response to MMR, specifically the measles component thereof, might be related to pathogenesis of autism.

  15. Global Measles and Rubella Laboratory Network Support for Elimination Goals, 2010-2015.

    PubMed

    Mulders, Mick N; Rota, Paul A; Icenogle, Joseph P; Brown, Kevin E; Takeda, Makoto; Rey, Gloria J; Ben Mamou, Myriam C; Dosseh, Annick R G A; Byabamazima, Charles R; Ahmed, Hinda J; Pattamadilok, Sirima; Zhang, Yan; Gacic-Dobo, Marta; Strebel, Peter M; Goodson, James L

    2016-05-06

    In 2012, the World Health Assembly endorsed the Global Vaccine Action Plan (GVAP)* with the objective to eliminate measles and rubella in five World Health Organization (WHO) regions by 2020. In September 2013, countries in all six WHO regions had established measles elimination goals, and additional goals for elimination of rubella and congenital rubella syndrome were established in three regions (1). Capacity for surveillance, including laboratory confirmation, is fundamental to monitoring and verifying elimination. The 2012-2020 Global Measles and Rubella Strategic Plan of the Measles and Rubella Initiative(†) calls for effective case-based surveillance with laboratory testing for case confirmation (2). In 2000, the WHO Global Measles and Rubella Laboratory Network (GMRLN) was established to provide high quality laboratory support for surveillance (3). The GMRLN is the largest globally coordinated laboratory network, with 703 laboratories supporting surveillance in 191 countries. During 2010-2015, 742,187 serum specimens were tested, and 27,832 viral sequences were reported globally. Expansion of the capacity of the GMRLN will support measles and rubella elimination efforts as well as surveillance for other vaccine-preventable diseases (VPDs), including rotavirus, and for emerging pathogens of public health concern.

  16. Hepatitis B vaccination: a completed schedule enough to control HBV lifelong? Milan, Italy, 17-18 November 2011.

    PubMed

    FitzSimons, David; Hendrickx, Greet; Vorsters, Alex; Van Damme, Pierre

    2013-01-11

    The Viral Hepatitis Prevention Board (VHPB) organized an international meeting in Milan in November 2011 on the question of whether completing a course of hepatitis B vaccination confers lifelong protection against hepatitis B virus infection and its complications. Presentations covered vaccine efficacy including factors influencing long-term protection; breakthrough infections; the immunological effect of natural boosting; the effectiveness of universal hepatitis B vaccination in different countries, and issues relating to national, regional and global policies on booster vaccination. Findings from four continents were presented at the meeting, with data now extending to follow-up for nearly 30 years after full primary vaccination. The results reported add to the extensive and growing body of knowledge, demonstrating that in spite of subsequent decline and ultimate loss of detectable serum anti-HBs, a full primary course of hepatitis B vaccine confers complete protection against acute clinical disease and chronic hepatitis B infection for long periods of time. Our understanding of the role and functions of T and B cells in protective immunity deepens, although the picture is still complex. A framework for future work in several areas emerged from the meeting, including monitoring and surveillance of vaccination programmes, breakthrough infections, hepatitis B in immigrant populations, and vaccine-escape viral mutants. One further concrete recommendation is the setting up of a working group to standardize definitions on terms such as "immunity", "protection", "immune memory", "non-responders", "long-term", "anamnestic response", "breakthrough" and "vaccine failure".

  17. Economic evaluation of vaccination programme of mumps vaccine to the birth cohort in Japan.

    PubMed

    Hoshi, Shu-ling; Kondo, Masahide; Okubo, Ichiro

    2014-07-16

    The most common preventative measure against mumps is vaccination with mumps vaccine. In most parts of the world, mumps vaccine is routinely delivered through live attenuated Measles-Mumps-Rubella (MMR) vaccine. In Japan, receiving mumps vaccine is voluntary and vaccine uptake rate is less than 30%. The introduction of mumps vaccine into routine vaccination schedule has become one of the current topics in health policy and has raised the need to evaluate efficient ways in protecting children from mumps-related diseases in Japan. We conducted a cost-effectiveness analysis with Markov model and calculated incremental cost effectiveness ratios (ICERs) of 11 different programmes; a single-dose programme at 12-16 months and 10 two-dose programmes with second dose uptakes at ages 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11. Our base-case analyse set the cost per shot at ¥6951 (US$72; 1US$=96.8). Results show that single-dose programme dominates status quo. On the other hand, ICERs of all 10 two-dose programmes are under ¥6,300,000 (US$65,082) per QALY from payer's perspective while it ranged from cost-saving to <¥7,000,000 (US$72,314) per QALY from societal perspective. By adopting WHO's classification that an intervention is cost-effective if ICER (in QALY) is between one and three times of GDP as a criterion, either of the vaccination programme is concluded as cost-effective from payer's or societal perspectives. Likewise, to uptake second dose at 3-5 years old is more favourable than an uptake at any other age because of lower incremental cost-effectiveness ratios.

  18. Immunogenicity of reduced dose priming schedules of serogroup C meningococcal conjugate vaccine followed by booster at 12 months in infants: open label randomised controlled trial

    PubMed Central

    Khatami, Ameneh; McKenna, Jennifer; Campbell, Danielle; Attard-Montalto, Simon; Birks, Jacqueline; Voysey, Merryn; White, Catherine; Finn, Adam; Macloed, Emma; Faust, Saul N; Kent, Alison Louise; Heath, Paul T; Borrow, Ray; Snape, Matthew D; Pollard, Andrew J

    2015-01-01

    Objective To determine whether the immunogenicity of a single dose infant priming schedule of serogroup C meningococcal (MenC) conjugate vaccine is non-inferior to a two dose priming schedule when followed by a booster dose at age 12 months. Design Phase IV open label randomised controlled trial carried out from July 2010 until August 2013 Setting Four centres in the United Kingdom and one centre in Malta. Participants Healthy infants aged 6-12 weeks followed up until age 24 months. Interventions In the priming phase of the trial 509 infants were randomised in a 10:10:7:4 ratio into four groups to receive either a single MenC-cross reacting material 197 (CRM) dose at 3 months; two doses of MenC-CRM at 3 and 4 months; a single MenC-polysaccharide-tetanus toxoid (TT) dose at 3 months; or no MenC doses, respectively. Haemophilus influenzae type b (Hib)-MenC-TT vaccine was administered to all infants at 12 months of age. All infants also received the nationally routinely recommended vaccines. Blood samples were taken at age 5, 12, 13, and 24 months. Main outcome measure MenC serum bactericidal antibody assay with rabbit complement (rSBA) one month after the Hib-MenC-TT vaccine. Non-inferiority was met if the lower 95% confidence limit of the difference in the mean log10 MenC rSBA between the single dose MenC-CRM and the two dose MenC-CRM groups was >−0.35. Results The primary objective was met: after a Hib-MenC-TT booster dose at 12 months of age the MenC rSBA geometric mean titres induced in infants primed with a single MenC-CRM dose were not inferior to those induced in participants primed with two MenC-CRM doses in infancy (660 (95% confidence interval 498 to 876) v 295 (220 to 398)) with a corresponding difference in the mean log10 MenC rSBA of 0.35 (0.17 to 0.53) that showed superiority of the single over the two dose schedule). Exploration of differences between the priming schedules showed that one month after Hib-MenC-TT vaccination, MenC rSBA ≥1:8 was

  19. Measles outbreak in Greater Manchester, England, October 2012 to September 2013: epidemiology and control.

    PubMed

    Pegorie, M; Shankar, K; Welfare, W S; Wilson, R W; Khiroya, C; Munslow, G; Fiefield, D; Bothra, V; McCann, R

    2014-12-11

    This paper describes the epidemiology and management of a prolonged outbreak of measles across the 2.7 million conurbation of Greater Manchester in the United Kingdom. Over a period of one year (from October 2012 to September 2013), over a thousand suspected measles cases (n = 1,073) were notified across Greater Manchester; of these, 395 (37%) were laboratory-confirmed, 91 (8%) were classed as probable, 312 (29%) were classed as possible and 275 (26%) excluded. Most confirmed and probable cases occurred in children within two age groups—infants (too young to be eligible for measles-mumps-rubella (MMR) vaccination according to the national immunisation programme) and children aged 10-19 years (low vaccine uptake in this cohort because of unfounded alleged links between the MMR vaccine and autism). During this one year period, there were a series of local outbreaks and many of these occurred within the secondary school setting. A series of public health measures were taken to control this prolonged outbreak: setting up incident management teams to control local outbreaks, a concerted immunisation catch-up campaign (initially local then national) to reduce the pool of children partially or totally unprotected against measles, and the exclusion of close contacts from nurseries and school settings for a period of 10 days following the last exposure to a case of measles.

  20. An Agent-Based Model of School Closing in Under-Vacccinated Communities During Measles Outbreaks.

    PubMed

    Getz, Wayne M; Carlson, Colin; Dougherty, Eric; Porco Francis, Travis C; Salter, Richard

    2016-04-01

    The winter 2014-15 measles outbreak in the US represents a significant crisis in the emergence of a functionally extirpated pathogen. Conclusively linking this outbreak to decreases in the measles/mumps/rubella (MMR) vaccination rate (driven by anti-vaccine sentiment) is critical to motivating MMR vaccination. We used the NOVA modeling platform to build a stochastic, spatially-structured, individual-based SEIR model of outbreaks, under the assumption that R0 ≈ 7 for measles. We show this implies that herd immunity requires vaccination coverage of greater than approximately 85%. We used a network structured version of our NOVA model that involved two communities, one at the relatively low coverage of 85% coverage and one at the higher coverage of 95%, both of which had 400-student schools embedded, as well as students occasionally visiting superspreading sites (e.g. high-density theme parks, cinemas, etc.). These two vaccination coverage levels are within the range of values occurring across California counties. Transmission rates at schools and superspreading sites were arbitrarily set to respectively 5 and 15 times background community rates. Simulations of our model demonstrate that a 'send unvaccinated students home' policy in low coverage counties is extremely effective at shutting down outbreaks of measles.

  1. An Agent-Based Model of School Closing in Under-Vacccinated Communities During Measles Outbreaks

    PubMed Central

    Getz, Wayne M.; Carlson, Colin; Dougherty, Eric; Porco, Travis C.; Salter, Richard

    2016-01-01

    The winter 2014–15 measles outbreak in the US represents a significant crisis in the emergence of a functionally extirpated pathogen. Conclusively linking this outbreak to decreases in the measles/mumps/rubella (MMR) vaccination rate (driven by anti-vaccine sentiment) is critical to motivating MMR vaccination. We used the NOVA modeling platform to build a stochastic, spatially-structured, individual-based SEIR model of outbreaks, under the assumption that R0 ≈ 7 for measles. We show this implies that herd immunity requires vaccination coverage of greater than approximately 85%. We used a network structured version of our NOVA model that involved two communities, one at the relatively low coverage of 85% coverage and one at the higher coverage of 95%, both of which had 400-student schools embedded, as well as students occasionally visiting superspreading sites (e.g. high-density theme parks, cinemas, etc.). These two vaccination coverage levels are within the range of values occurring across California counties. Transmission rates at schools and superspreading sites were arbitrarily set to respectively 5 and 15 times background community rates. Simulations of our model demonstrate that a ‘send unvaccinated students home’ policy in low coverage counties is extremely effective at shutting down outbreaks of measles. PMID:27668297

  2. Vaccination status of tribal mothers and their under five children.

    PubMed

    Rahman, M; Banerjee, M; Rahman, M; Akhter, F U

    2006-01-01

    A study was done to find out the vaccination status of the tribal mothers and their under 5 children in some selected villages of Durgapur upazila under Netrakona district. It was a cross sectional study in which 92 tribal mothers and 91 under 5 children were included. The study was carried out in 4 different tribal villages under Netrakona district from February to June 2001. According to National EPI schedule, it was revealed that 58.2% of the children were fully vaccinated, 26.4% incompletely and 15.4% not vaccinated. The individual vaccine coverage was 84.6% for BCG, 68.1% for OPV and DPT, 58.2% for Measles. Considering the literacy, most of the respondents (78.3%) were illiterate and 21.7% had some basic education. None of the mother completed 5 doses of TT coverage. The individual TT coverage was found 78.3% for TT(1), 67.4% for TT(2), 17.4% for TT(3) and 1.1% for TT(4). This study observed that the vaccination status in the tribal children was satisfactory in relation to National coverage, but the vaccination status of the tribal mothers was not satisfactory in our national context.

  3. Stability of the age distribution of measles cases over time during outbreaks in Bangladesh, 2004-2006.

    PubMed

    Wiesen, Eric; Wannemuehler, Kathleen; Goodson, James L; Anand, Abhijeet; Mach, Ondrej; Thapa, Arun; O'Connor, Patrick; Linayage, Jayantha; Diorditsa, Serguei; Hasan, A S M Mainul; Uzzaman, Sharif; Jalil Mondal, M D Abdul

    2011-07-01

    Despite recommendations from WHO to conduct measles outbreak response vaccination campaigns based on the age distribution of cases at the beginning of an outbreak, few data exist to specifically examine whether the age distribution of cases remains constant over time in a measles outbreak. This analysis explores this question with use of measles outbreak surveillance data from Bangladesh from the period 2004-2006. Pearson χ(2) tests were conducted of age distributions over 2 periods during 41 large laboratory-confirmed measles outbreaks. Statistically significant changes in age distribution over time were observed in 24% of the outbreaks. No single pattern was detected in the shifts in age distribution; however, an increase in the proportion of cases occurring among infants <9 months of age was evident in 6 outbreaks. These findings suggest a need to consider the possibility of a shift in the age distribution over time when planning an outbreak response vaccination campaign.

  4. Introduction of rubella-containing-vaccine to Madagascar: implications for roll-out and local elimination.

    PubMed

    Wesolowski, Amy; Mensah, Keitly; Brook, Cara E; Andrianjafimasy, Miora; Winter, Amy; Buckee, Caroline O; Razafindratsimandresy, Richter; Tatem, Andrew J; Heraud, Jean-Michel; Metcalf, C Jessica E

    2016-04-01

    Few countries in Africa currently include rubella-containing vaccination (RCV) in their immunization schedule. The Global Alliance for Vaccines Initiative (GAVI) recently opened a funding window that has motivated more widespread roll-out of RCV. As countries plan RCV introductions, an understanding of the existing burden, spatial patterns of vaccine coverage, and the impact of patterns of local extinction and reintroduction for rubella will be critical to developing effective programmes. As one of the first countries proposing RCV introduction in part with GAVI funding, Madagascar provides a powerful and timely case study. We analyse serological data from measles surveillance systems to characterize the epidemiology of rubella in Madagascar. Combining these results with data on measles vaccination delivery, we develop an age-structured model to simulate rubella vaccination scenarios and evaluate the dynamics of rubella and the burden of congenital rubella syndrome (CRS) across Madagascar. We additionally evaluate the drivers of spatial heterogeneity in age of infection to identify focal locations where vaccine surveillance should be strengthened and where challenges to successful vaccination introduction are expected. Our analyses indicate that characteristics of rubella in Madagascar are in line with global observations, with an average age of infection near 7 years, and an impact of frequent local extinction with reintroductions causing localized epidemics. Modelling results indicate that introduction of RCV into the routine programme alone may initially decrease rubella incidence but then result in cumulative increases in the burden of CRS in some regions (and transient increases in this burden in many regions). Deployment of RCV with regular supplementary campaigns will mitigate these outcomes. Results suggest that introduction of RCV offers a potential for elimination of rubella in Madagascar, but also emphasize both that targeted vaccination is likely to be

  5. Association Between Vaccine Refusal and Vaccine-Preventable Diseases in the United States

    PubMed Central

    Phadke, Varun K.; Bednarczyk, Robert A.; Salmon, Daniel A.; Omer, Saad B.

    2016-01-01

    IMPORTANCE Parents hesitant to vaccinate their children may delay routine immunizations or seek exemptions from state vaccine mandates. Recent outbreaks of vaccine-preventable diseases in the United States have drawn attention to this phenomenon. Improved understanding of the association between vaccine refusal and the epidemiology of these diseases is needed. OBJECTIVE To review the published literature to evaluate the association between vaccine delay, refusal, or exemption and the epidemiology of measles and pertussis, 2 vaccine-preventable diseases with recent US outbreaks. EVIDENCE REVIEW Search of PubMed through November 30, 2015, for reports of US measles outbreaks that have occurred since measles was declared eliminated in the United States (after January 1, 2000), endemic and epidemic pertussis since the lowest point in US pertussis incidence (after January 1, 1977), and for studies that assessed disease risk in the context of vaccine delay or exemption. FINDINGS We identified 18 published measles studies (9 annual summaries and 9 outbreak reports), which described 1416 measles cases (individual age range, 2 weeks-84 years; 178 cases younger than 12 months) and more than half (56.8%) had no history of measles vaccination. Of the 970 measles cases with detailed vaccination data, 574 cases were unvaccinated despite being vaccine eligible and 405 (70.6%) of these had nonmedical exemptions (eg, exemptions for religious or philosophical reasons, as opposed to medical contraindications; 41.8%of total). Among 32 reports of pertussis outbreaks, which included 10 609 individuals for whom vaccination status was reported (age range, 10 days-87 years), the 5 largest statewide epidemics had substantial proportions (range, 24%–45%) of unvaccinated or undervaccinated individuals. However, several pertussis outbreaks also occurred in highly vaccinated populations, indicating waning immunity. Nine reports (describing 12 outbreaks) provided detailed vaccination data on

  6. Evaluation of Mexico's Universal Vaccination Program.

    PubMed

    1998-04-01

    This article summarizes findings from an evaluation of Mexico's Universal Vaccination Program during 1990-97, the progress achieved, the lessons learned, and objectives under decentralization. The evaluation assessed the cold chain and logistics systems, and the feasibility of vaccine production within Gerencia General de Biologicos y Reactivos. In 1996, 97% of children aged 1-4 years completed the full immunization schedule. Over the past 7 years, the incidence of preventable diseases declined. There were no poliomyelitis cases in the prior 7 years, no diphtheria cases in the prior 6 years, and a gradual decline in morbidity due to measles in the prior 5 years. Several government sectors are giving high priority to vaccination activities. Sufficient resources have been allocated for immunization. The government is planning on adding new vaccines that would benefit the adult population and/or prevent congenital defects. There is close coordination within institutions of the National Health System and with other public health organizations, such as PAHO and UNICEF. It is recommended that the central government perform high quality epidemiological surveillance and improve rapid analysis capacity, especially at the local and regional levels. Improvement is needed in the reporting capacity at the local level, to feed recent data to the central level in a timely fashion, and to use analysis to improve operations. Epidemiological training is needed at the operations level, as is private sector involvement at all levels. Underreporting of morbidity occurs. Regionalization must be monitored to ensure maximizing of resources.

  7. Measles (Rubeola) Cases and Outbreaks

    MedlinePlus

    ... outbreak linked to two Disney theme parks in Orange County, California... MMWR: 2014 Outbreaks Measles Outbreak in ... Family and a Possibly Associated International Traveler — Orange County, Florida, December 2012-January 2013 MMWR . Sep ...

  8. Measles (Rubeola): Signs and Symptoms

    MedlinePlus

    ... Lab Tools Serology Specimens for Detection by RT-PCR or Virus Isolation Measles Lab Manual Vero/hSLAM ... Help: How do I view different file formats (PDF, DOC, PPT, MPEG) on this site? Adobe PDF ...

  9. The National Childhood Vaccine Injury Act: A Chance for Families.

    ERIC Educational Resources Information Center

    Gage, Jack; And Others

    1989-01-01

    The article describes the National Childhood Vaccine Injury Act which provides for recovery awards for vaccine-related injuries caused by diphtheria, pertussis, tetanus, polio, measles, mumps, and rubella vaccines. A Vaccine Injury Table lists types of disabilities covered and time periods for first symptoms. The claims process, legal assistance,…

  10. Measles among U.S.-bound refugees from Malaysia--California, Maryland, North Carolina, and Wisconsin, August-September 2011.

    PubMed

    2011-09-23

    On August 26, 2011, California public health officials notified CDC of a suspected measles case in an unvaccinated male refugee aged 15 years from Burma (the index patient), who had lived in an urban area of Kuala Lumpur, Malaysia, which is experiencing ongoing measles outbreaks. Currently, approximately 92,000 such refugees are living in urban communities in Malaysia. Resettlement programs in the United States and other countries are ongoing. The health and vaccination status of urban refugees are largely unknown.

  11. Hospital preparedness in community measles outbreaks-challenges and recommendations for low-resource settings.

    PubMed

    Shakoor, Sadia; Mir, Fatima; Zaidi, Anita K M; Zafar, Afia

    2015-01-01

    We have reviewed various strategies involved in containment of measles in healthcare facilities during community outbreaks. The strategies that are more applicable to resource-poor settings, such as natural ventilation, mechanical ventilation with heating and air-conditioning systems allowing unidirectional air-flow, and protection of un-infected patients and healthcare workers (HCWs), have been examined. Ventilation methods need innovative customization for resource-poor settings followed by validation and post-implementation analysis for impact. Mandatory vaccination of all HCWs with two doses of measles-containing vaccine, appropriate post-exposure prophylaxis of immunocompromised inpatients, and stringent admission criteria for measles cases can contribute toward reduction of nosocomial and secondary transmission within facilities.

  12. Hospital preparedness in community measles outbreaks—challenges and recommendations for low-resource settings

    PubMed Central

    Shakoor, Sadia; Mir, Fatima; Zaidi, Anita K. M.; Zafar, Afia

    2015-01-01

    We have reviewed various strategies involved in containment of measles in healthcare facilities during community outbreaks. The strategies that are more applicable to resource-poor settings, such as natural ventilation, mechanical ventilation with heating and air-conditioning systems allowing unidirectional air-flow, and protection of un-infected patients and healthcare workers (HCWs), have been examined. Ventilation methods need innovative customization for resource-poor settings followed by validation and post-implementation analysis for impact. Mandatory vaccination of all HCWs with two doses of measles-containing vaccine, appropriate post-exposure prophylaxis of immunocompromised inpatients, and stringent admission criteria for measles cases can contribute toward reduction of nosocomial and secondary transmission within facilities. PMID:25882388

  13. Mothers and vaccination: knowledge, attitudes, and behaviour in Italy.

    PubMed Central

    Angelillo, I. F.; Ricciardi, G.; Rossi, P.; Pantisano, P.; Langiano, E.; Pavia, M.

    1999-01-01

    The study evaluates knowledge, attitudes, and behaviour of mothers regarding the immunization of 841 infants who attended public kindergarten in Cassino and Crotone, Italy. Overall, 57.8% of mothers were aware about all four mandatory vaccinations for infants (poliomyelitis, tetanus, diphtheria, hepatitis B). The results of a multiple logistic regression analysis showed that this knowledge was significantly greater among mothers with a higher education level and among those who were older at the time of the child's birth. Respondents' attitudes towards the utility of vaccinations for preventing infectious diseases were very favourable. Almost all children (94.4%) were vaccinated with all three doses of diphtheria-tetanus (DT), oral poliovirus vaccine (OPV), and hepatitis B. The proportion of children vaccinated who received all three doses of OPV, DT or diphtheria-tetanus-pertussis (DTP), and hepatitis B vaccines within 1 month of becoming age-eligible ranged from 56.6% for the third dose of hepatitis B to 95.7% for the first dose of OPV. Results of the regression analysis performed on the responses of mothers who had adhered to the schedule for all mandatory vaccinations indicated that birth order significantly predicted vaccination nonadherence, since children who had at least one older sibling in the household were significantly less likely to be age-appropriately vaccinated. The coverage for the optional vaccines was only 22.5% and 31% for measles-mumps-rubella and for all three doses against pertussis, respectively. Education programmes promoting paediatric immunization, accessibility, and follow-up should be targeted to the entire population. PMID:10212512

  14. Study of adverse events following immunisation with universal and newer vaccines in the Serampore IMA Child Clinic over a period of 7 years.

    PubMed

    Das, Pradip Kumar

    2013-04-01

    Immunisation is an important part of childcare practice. It is one of the most beneficial and cost effective measures for the prevention of diseases. From the previous retrospective studies, it was evident that smallpox has been completely eradicated throughout now-a-days with the wholehearted and sincere efforts of healthcare providers by applying efficient and safe vaccine against smallpox, same is true also to polio which is now close to worldwide eradication and measles and rubella are no longer endemic in certain parts of the world. Not only has that with the introduction of safer and more efficient newer vaccines, the incidence of most other vaccine preventable disease of childhood also reduced considerably. The aim of the present study is to estimate the incidence and clinical presentation of adverse events following immunisation with universal and newer vaccines for a period of seven years using prospective active surveillance. Children under the age of 7 years were taken for universal and newer scheduled vaccinations given in the Serampore IMA Child Clinic under the supervision of the clinicians maintaining strictly the guidelines of Expanded Programme of Immunisation (Government of India). This study of adverse events following immunisation in the Serampore IMA Child Clinic confirms that the adverse events such as fever (0.37%), pain and swelling at the site of injection (0.32%0, urticarial rash (0.02%), anaphylactic shock (0.003%) are negligible. There were only two reports of anaphylaxis following preschool and infant schedule vaccines, including measles, mumps and rubella (MMR), Haemophilus influenzae type B vaccines and typhoid vaccines in approximately 52,000 infants received over a period of 7 years starting from 1st April, 2005 to 31st March, 2012 and there were no deaths or longterm effects reported during the post follow-up period in the Serampore IMA Child Clinic.

  15. Immunological recovery after measles.

    PubMed Central

    Wesley, A; Coovadia, H M; Henderson, L

    1978-01-01

    Twenty-two children with measles were studied at the stage of the rash and 6 weeks later, and results compared with matched controls. The total lymphocyte count and lymphocyte subpopulations with T- and B-cell markers and those with absence of both markers (null cells) were significantly below control levels in the acute phase. At 6 weeks the B-cell and null-cell counts were still significantly diminished. The function of T cells assessed by 14C uptake of phytohaemagglutinin-stimulated lymphocytes and the delayed skin hypersensitivity reaction to dinitrochlorobenzene was impaired during the acute stage, and this persisted for 6 weeks. Over the 6 weeks of study there was a small but significant rise in serum IgG, IgM and complement factors. PMID:688697

  16. Antibodies against poliomyelitis and measles viruses in immunized and unimmunized children, Ghana 1976-78*

    PubMed Central

    Böttiger, M.; Litvinov, S.; Assaad, F.; Lundbeck, H.; Heller, L.; Beausoleil, E. G.

    1981-01-01

    The serological response of children to two doses of live oral poliomyelitis vaccine (the first at age 3-8 months and the second at age 9-14 months) and to one dose of measles vaccine (at age 9-14 months) was determined in two regions of Ghana. The seroconversion rates after two doses of poliomyelitis vaccine were lower than expected—24% for poliovirus type 1, 60% for type 2, and 52% for type 3; 23% of the subjects were triple negative. A third dose of the vaccine increased the seroconversion rates to 36%, 73%, and 61% for poliovirus types 1, 2, and 3, respectively; the rate for triple negatives fell to 8%. In the course of the study it was found that there was an intensive circulation of wild polioviruses and that a high proportion of 3-8 month-old infants had maternal antibodies. The seroconversion rate following one dose of measles vaccine was about 90%, a response similar to that obtained in temperate climates. The two main conclusions drawn from the study were: (1) two doses of poliomyelitis vaccine are inadequate to provide protection against poliomyelitis in developing countries; and (2) in developing countries measles vaccine should be given as soon as possible after the age of 8 months. PMID:6976234

  17. MMR Vaccine (Measles, Mumps, and Rubella)

    MedlinePlus

    ... in women), and mild fever. If a woman gets rubella while she is pregnant, she could have a miscarriage or her baby could be born with serious birth defects. These diseases spread from person to person through the air. You can easily ...

  18. Seroprevalence of measles, rubella, and varicella in refugees.

    PubMed

    Barnett, Elizabeth D; Christiansen, Demian; Figueira, Marisol

    2002-08-15

    Immigrant children who enter the United States without immunization records may be required to receive vaccines for diseases to which they are already immune or for which they have previously received immunization. We tested 669 newly arrived refugees (age range, 0-20 years) for antibody to measles, rubella, and varicella, to determine the seroprevalence of antibodies to these diseases in this group of immigrants. Five hundred forty-nine (82%) of 669 patients had antibody to measles, 545 (82%) of 668 had antibody to rubella, and 430 (64%) of 668 had antibody to varicella. Antibody to all 3 diseases increased with increasing age. No clinically significant differences in presence of antibody were noted by region of origin.

  19. Measles epidemic in Brazil in the post-elimination period: Coordinated response and containment strategies.

    PubMed

    Lemos, Daniele Rocha Queiroz; Franco, Aidée Ramirez; de Sá Roriz, Maria Lúcia Feitosa; Carneiro, Ana Karine Borges; de Oliveira Garcia, Márcio Henrique; de Souza, Fábia Lidiana; Duron Andino, Regina; de Góes Cavalcanti, Luciano Pamplona

    2017-03-23

    The measles virus circulation was halted in Brazil in 2001 and the country has a routine vaccination coverage against measles, mumps and rubella higher than 95%. In Ceará, the last confirmed case was in 1999. This article describes the strategies adopted and the effectiveness of surveillance and control measures implemented during a measles epidemic in the post-elimination period. The epidemic started in December 2013 and lasted 20 months, reaching 38 cities and 1,052 confirmed cases. The D8 genotype was id