Update zum klinischen Einsatz von Inhibitoren mutierter Phosphokinasen beim Melanom.
Cosgarea, Ioana; Ritter, Cathrin; Becker, Jürgen C; Schadendorf, Dirk; Ugurel, Selma
2017-09-01
Die Behandlungsstrategie beim metastasierten Melanom hat sich mit der Identifizierung therapeutisch angreifbarer molekularer Zielstrukturen innerhalb zellulärer Signalwege radikal geändert. Durch die Zulassung von Substanzen, die gezielt an den zentralen Schaltmolekülen, den Phosphokinasen, angreifen, können diese Signalwege selektiv abgeschaltet werden. Dies ist insbesondere bei denjenigen Tumoren von Interesse, deren Signalwege durch aktivierende Mutationen der für die Schaltmoleküle kodierenden Gene konstitutiv aktiviert sind. Aktuell ist diese therapeutische Strategie insbesondere für Patienten bedeutsam, deren Melanome eine Mutation im BRAF-Gen aufweisen. Diese Patienten können durch eine Kombinationstherapie aus Inhibitoren der Phosphokinasen BRAF und MEK langfristig mit sehr guter Krankheitskontrolle behandelt werden. Unter dieser Kombinationstherapie wird aktuell ein progressionsfreies Überleben von über zehn Monaten und ein Gesamtüberleben von mehr als zwei Jahren bei guter Lebensqualität erzielt. Da unter längerfristiger Therapie mit Kinaseinhibitoren jedoch bei einem Großteil der Patienten eine Resistenzbildung auftritt, sind aktuelle klinische Therapiestudien auf die Suche nach geeigneten Kombinationspartnern unter Blockierung anderer Signalwege oder unter Aktivierung der T-Zell-vermittelten Immunantwort ausgerichtet. Der vorliegende Übersichtsartikel stellt sowohl die aktuell verfügbaren als auch die in der klinischen Testung befindlichen zukünftigen Optionen der zielgerichteten Therapie des Melanoms dar. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
Formation of a Malin 1 analogue in IllustrisTNG by stimulated accretion
NASA Astrophysics Data System (ADS)
Zhu, Qirong; Xu, Dandan; Gaspari, Massimo; Rodriguez-Gomez, Vicente; Nelson, Dylan; Vogelsberger, Mark; Torrey, Paul; Pillepich, Annalisa; Zjupa, Jolanta; Weinberger, Rainer; Marinacci, Federico; Pakmor, Rüdiger; Genel, Shy; Li, Yuexing; Springel, Volker; Hernquist, Lars
2018-06-01
The galaxy Malin 1 contains the largest stellar disk known but the formation mechanism of this structure has been elusive. In this paper, we report a Malin 1 analogue in the 100 Mpc IllustrisTNG simulation and describe its formation history. At redshift zero, this massive galaxy, having a maximum circular velocity Vmax of 430 km s-1, contains a 100 kpc gas/stellar disk with morphology similar to Malin 1. The simulated galaxy reproduces well many observed features of Malin 1's vast disk, including its stellar ages, metallicities, and gas rotation curve. We trace the extended disk back in time and find that a large fraction of the cold gas at redshift zero originated from the cooling of hot halo gas, triggered by the merger of a pair of intruding galaxies. Our finding provides a novel way to form large galaxy disks as extreme as Malin 1 within the current galaxy formation framework.
1985-07-30
Flooding of Maline Creek in and around St. Louis, Missouri has been a problem. In an effort to provide significant flood damage mitigation, increase...miles of environmental/recreational trails. The sediment transport characteristics of Maline Creek , were qualitatively evaluated and the effect of...erosion and sedimentation of loess soils since they are common to the Maline Creek watershed.
Rediscovering the Giant Low Surface Brightness Spiral Galaxy Malin 1
NASA Astrophysics Data System (ADS)
Galaz, Gaspar
2018-01-01
I summarize the latest discoveries regarding this ramarkable diffuse and giant galaxy, the largest single spiral in the universe so far. I describe how the latest discoveries could have been done easily 20 years ago, but an incredible summation of facts and some astronomical sociology, keeped many of them undisclosed. I present the most conspicuous features of the giant spiral arms of Malin 1, including stellar density, colors, stellar populations and some modeling describing their past evolution to the current state. I conclude with pending issues regarding stellar formation in Malin 1, and the efforts to detect its elusive molecular gas.
Tiberia, Erica; Turnbull, Julie; Wang, Tony; Ruggieri, Alessandra; Zhao, Xiao-Chu; Pencea, Nela; Israelian, Johan; Wang, Yin; Ackerley, Cameron A.; Wang, Peixiang; Liu, Yan; Minassian, Berge A.
2012-01-01
The solubility of glycogen, essential to its metabolism, is a property of its shape, a sphere generated through extensive branching during synthesis. Lafora disease (LD) is a severe teenage-onset neurodegenerative epilepsy and results from multiorgan accumulations, termed Lafora bodies (LB), of abnormally structured aggregation-prone and digestion-resistant glycogen. LD is caused by loss-of-function mutations in the EPM2A or EPM2B gene, encoding the interacting laforin phosphatase and malin E3 ubiquitin ligase enzymes, respectively. The substrate and function of malin are unknown; an early counterintuitive observation in cell culture experiments that it targets laforin to proteasomal degradation was not pursued until now. The substrate and function of laforin have recently been elucidated. Laforin dephosphorylates glycogen during synthesis, without which phosphate ions interfere with and distort glycogen construction, leading to LB. We hypothesized that laforin in excess or not removed following its action on glycogen also interferes with glycogen formation. We show in malin-deficient mice that the absence of malin results in massively increased laforin preceding the appearance of LB and that laforin gradually accumulates in glycogen, which corresponds to progressive LB generation. We show that increasing the amounts of laforin in cell culture causes LB formation and that this occurs only with glycogen binding-competent laforin. In summary, malin deficiency causes increased laforin, increased laforin binding to glycogen, and LB formation. Furthermore, increased levels of laforin, when it can bind glycogen, causes LB. We conclude that malin functions to regulate laforin and that malin deficiency at least in part causes LB and LD through increased laforin binding to glycogen. PMID:22669944
Singh, Pankaj Kumar; Singh, Sweta; Ganesh, Subramaniam
2012-02-01
Lafora disease (LD), an inherited and fatal neurodegenerative disorder, is characterized by increased cellular glycogen content and the formation of abnormally branched glycogen inclusions, called Lafora bodies, in the affected tissues, including neurons. Therefore, laforin phosphatase and malin ubiquitin E3 ligase, the two proteins that are defective in LD, are thought to regulate glycogen synthesis through an unknown mechanism, the defects in which are likely to underlie some of the symptoms of LD. We show here that laforin's subcellular localization is dependent on the cellular glycogen content and that the stability of laforin is determined by the cellular ATP level, the activity of 5'-AMP-activated protein kinase, and the affinity of malin toward laforin. By using cell and animal models, we further show that the laforin-malin complex regulates cellular glucose uptake by modulating the subcellular localization of glucose transporters; loss of malin or laforin resulted in an increased abundance of glucose transporters in the plasma membrane and therefore excessive glucose uptake. Loss of laforin or malin, however, did not affect glycogen catabolism. Thus, the excessive cellular glucose level appears to be the primary trigger for the abnormally higher levels of cellular glycogen seen in LD.
Le schwannome malin du nerf grand sciatique chez l'enfant
Lechqar, Maryem; Elbiache, Imad; Atarraf, Karima; Bouabdellah, Youssef; Afifi, My Abderahman
2012-01-01
Le schwannome malin est une tumeur très rare chez l'enfant (1 à 2% des tumeurs des tissus mous), elle se développe au dépend des cellules de schwanne. Dans ce travail, les auteurs rapportent un cas de schwannome malin développé au dépend du nerf grand sciatique. La radiographie de la cuisse de face et de profil était normale. L'imagerie par résonance magnétique a identifié une lésion le long du trajet du nerf grand sciatique. La tumeur a été réséquée en totalité emportant le nerf grand sciatique. L'examen anatomo-pathologique a confirmé le diagnostic. PMID:23133710
Tidally induced residual current over the Malin Sea continental slope
NASA Astrophysics Data System (ADS)
Stashchuk, Nataliya; Vlasenko, Vasiliy; Hosegood, Phil; Nimmo-Smith, W. Alex M.
2017-05-01
Tidally induced residual currents generated over shelf-slope topography are investigated analytically and numerically using the Massachusetts Institute of Technology general circulation model. Observational support for the presence of such a slope current was recorded over the Malin Sea continental slope during the 88-th cruise of the RRS ;James Cook; in July 2013. A simple analytical formula developed here in the framework of time-averaged shallow water equations has been validated against a fully nonlinear nonhydrostatic numerical solution. A good agreement between analytical and numerical solutions is found for a wide range of input parameters of the tidal flow and bottom topography. In application to the Malin Shelf area both the numerical model and analytical solution predicted a northward moving current confined to the slope with its core located above the 400 m isobath and with vertically averaged maximum velocities up to 8 cm s-1, which is consistent with the in-situ data recorded at three moorings and along cross-slope transects.
Sánchez-Martín, Pablo; Romá-Mateo, Carlos; Viana, Rosa; Sanz, Pascual
2015-12-01
Lafora disease (LD, OMIM254780, ORPHA501) is a rare neurodegenerative form of epilepsy related to mutations in two proteins: laforin, a dual specificity phosphatase, and malin, an E3-ubiquitin ligase. Both proteins form a functional complex, where laforin recruits specific substrates to be ubiquitinated by malin. However, little is known about the mechanism driving malin-laforin mediated ubiquitination of its substrates. In this work we present evidence indicating that the malin-laforin complex interacts physically and functionally with the ubiquitin conjugating enzyme E2-N (UBE2N). This binding determines the topology of the chains that the complex is able to promote in the corresponding substrates (mainly K63-linked polyubiquitin chains). In addition, we demonstrate that the malin-laforin complex interacts with the selective autophagy adaptor sequestosome-1 (p62). Binding of p62 to the malin-laforin complex allows its recognition by LC3, a component of the autophagosomal membrane. In addition, p62 enhances the ubiquitinating activity of the malin-laforin E3-ubiquitin ligase complex. These data enrich our knowledge on the mechanism of action of the malin-laforin complex as an E3-ubiquitin ligase and reinforces the role of this complex in targeting substrates toward the autophagy pathway. Copyright © 2015 Elsevier Ltd. All rights reserved.
Récidive de mélanome malin unguéal achromique: à propos d'un cas
Benyass, Youssef; Chafry, Bouchaib; Koufagued, Kaldadak; Bouabid, Salim; Benchebba, Driss; Chagar, Belkacem
2015-01-01
Le mélanome malin unguéal représente 1,8 à 8,1% des mélanomes malins cutanés. Sa prise en charge s'adresse aujourd'hui aux praticiens de différentes spécialités. L'acte chirurgical initial est une étape incontournable du traitement curatif. La biopsie de la lésion doit être complète, afin de déterminer de façon exacte la profondeur de l'envahissement en cas de malignité. Nous rapportons un cas de mélanome malin achromique à localisation unguéal chez une femme. La chirurgie initiale consistait en une amputation transphalangienne proximale. L’évolution après deux ans était marquée par une récidive avec extension vers le carpe. Ayant subie une reprise chirurgicale avec une exérèse large. Le traitement des récidives est palliatif et vise à apporter un confort de vie au patient. Le principe du traitement fait appel à l'exérèse chirurgicale des lésions. Des alternatives thérapeutiques sont à l’étude. PMID:26977229
Huebner, Jutta; Mohr, Peter; Simon, Jan-Christoph; Fluck, Michael; Berking, Carola; Zimmer, Lisa; Loquai, Carmen
2016-05-01
In Deutschland wenden 40-90 % aller Krebspatienten Methoden der komplementären and alternativen Medizin (KAM) an. Bis dato gibt es kein Datenmaterial zum Einsatz der KAM bei Melanompatienten. Das Ziel unserer Studie war es, Daten über den Gebrauch, die Informationsquellen und Ziele von Patienten mit metastasierendem Melanom zu erfassen. Einhundertsechsundfünfzig Patienten aus 25 Studienzentren nahmen an der DecOG-MM-PAL Multibasket Studie teil. Die beteiligten Personen wurden auch gebeten, an einer Nebenstudie teilzunehmen, die ihren Gebrauch von KAM erfassen sollte. Dazu wurde während der Behandlung ein standardisierter Fragebogen zu genau festgelegten Zeitpunkten ausgeteilt. Insgesamt gingen 55 Fragebögen von 32 (21 %) Melanompatienten ein. Von diesen gaben 17 (53 %) ein Interesse an KAM an, und sieben (22 %) machten von KAM Gebrauch. Die Hauptinformationsquellen (31 %) waren Familienmitglieder und Freunde, gefolgt von Ärzten (19 %). Die Hauptgründe für die Anwendung von KAM waren die Stärkung des Immunsystems (41 %) und des Körpers (34 %). Nahrungsergänzungsmittel (Vitamine und Spurenelemente) wurden am häufigsten angewendet (28 %). Eine relativ hohe Anzahl an Patienten mit metastasierendem Melanom machte trotz Teilnahme an einer klinischen Studie von KAM Gebrauch. Wechselwirkungen könnten durch biologisch basierte KAM auftreten, und hier besonders bei immunmodulierenden KAM- Strategien. Um Risiken zu vermeiden, sollte die Kommunikation zwischen den Ärzten und den Patienten verbessert werden. © 2016 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
Bhave, Anupama; Bhargava, Roli; Kumar, Rashmi
2011-03-01
To determine correlation between developmental quotients (DQ) (DASII) and social quotients (SQ) (Malin's Vineland Social Maturity Scale (VSMS)). Malin's VSMS and DASII were done in 135 children aged 6 months to 2 years. SQ and DQ motor and mental were correlated using Pearson's correlation coefficient (r). Mean SQ and DQ and age equivalent scores were compared. Correlation coefficients between SQ and DQ (mental and motor were 0.849 and 0.791, respectively. Social age correlated highly with mental age (r = 0.906). Mean SQ was higher than mean DQa. SQ tends to be higher than DQ and correlates best with DQ mental. © 2010 The Authors. Journal of Paediatrics and Child Health © 2010 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
Spirituelles Wohlbefinden und Coping bei Sklerodermie, Lupus erythematodes und malignem Melanom.
Pilch, Michaela; Scharf, Sabina Nadine; Lukanz, Martin; Wutte, Nora Johanna; Fink-Puches, Regina; Glawischnig-Goschnik, Monika; Unterrainer, Human-Friedrich; Aberer, Elisabeth
2016-07-01
Religiös-spirituelles Wohlbefinden ist verbunden mit höherer Vitalität und verminderter Depressionsneigung. In unserer Studie untersuchten wir die Strategien zur Krankheitsbewältigung und die Rolle von Religiosität-Spiritualität (R-S) zur Verbesserung des subjektiven Wohlbefindens. 149 Patienten (107 Frauen), 44 mit systemischer Sklerodermie (SKL), 48 mit Lupus erythematodes (LE) und 57 mit malignem Melanom (MM), Stadium I-II, wurden mittels eines selbstentwickelten Fragebogens zum subjektiven Wohlbefinden, zu den mit der Erkrankung einhergehenden Umständen sowie mit dem Multidimensionalen Inventar (MI-RSB) zu R-S befragt. LE-Patienten sind zum Zeitpunkt der Diagnosestellung stärker belastet als SKL- und MM-Patienten. SKL- und LE-Patienten können erst nach Jahren die Erkrankung akzeptieren. Der Gesamtscore des religiös-spirituellen Befindens liegt bei LE-Patienten signifikant unter dem Wert der Normalbevölkerung. Fotosensitivität und Gelenksschmerzen sind bei LE-Patienten negativ assoziiert mit der Fähigkeit Vergeben zu können. SKL-Patienten mit Gesichtsveränderungen und Lungenbeteiligung zeigen höhere allgemeine Religiosität. MM-Patienten haben höhere Werte für transzendente Hoffnung. Vorträge über die Krankheit und psychologische Betreuung sind die wichtigsten Bedürfnisse von Patienten mit SKL, LE und MM an ihre Betreuer. Religiös-spirituelle Angebote zur Krankheitsverarbeitung scheinen derzeit eine untergeordnete Rolle zu spielen, könnten aber eine wichtige Ressource sein, der man in Zukunft mehr Aufmerksamkeit schenken sollte. © 2016 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
Paragangliome malin orbitaire, à propos d’un cas
Andaloussi, Idriss Benatiya; Maaroufi, Mustapha; Benzagmout, Mohammed; Harmouch, Taoufiq; Abdellaoui, Meryem; Bhallil, Salima; Tizniti, Siham; Elfaiz, Mohammed Chaoui; Amarti, Afaf; Tahri, Hicham
2012-01-01
Les paragangliomes sont des tumeurs neuroendocrines développées aux dépens du système nerveux parasympathique. Ils peuvent se localiser n’ importe où dans l’organisme depuis la tète et cou jusqu’au pelvis. La localisation orbitaire de cette tumeur est très rare. Nous présentons le cas d’un patient âgé de 37 ans qui présente depuis 4 mois une exophtalmie unilatérale droite, d’installation progressive, sans douleur ni baisse de l’acuité visuelle associés. L’examen général montre une tuméfaction sous le cuire chevelu, sans adénopathies locorégionales ni hépato ou splénomégalie. La tomodensitométrie retrouve un processus tumoral occupant le cadran supéro-externe de l’orbite droite, mesurant 38 mm de grand axe, envahissant la paroi supérieure et externe de l’orbite avec une importante ostéolyse. Un body scan révèle alors une métastase pulmonaire. L’examen histopathologique complétés par l’immunohistochimie, réalisé après biopsie, révèle un marquage cytoplasmique par l’anticorps anti-chromogranin, l’anticorps anti-synaptophysine et un marquage des vaisseaux par l’anticorps anti-CD31 soulignant l’architecture en zellbalen des nids tumoraux. Cet aspect est en faveur d’un paragangliome malin. Une exérèse chirurgicale incomplète suivie d’une radiothérapie adjuvante, sont alors réalisés. L’origine exacte de cette tumeur au sein de l’orbite reste très controversée. L’exophtalmie reste le principal signe révélateur. La tomodensitométrie, l’imagerie par résonnance magnétique et la scintigraphie au Metaiodobenzylguanidine radioinonisée à l’iode (MIBG-I131) permettent d’orienter le diagnostic et faire un bilan d’extension de la tumeur. Le diagnostic de certitude repose sur l’histopathologie et l’immunohistochimie. L’excision totale de la lésion est le traitement de choix pour les lésions bien délimitées. Dans les formes plus étendues le traitement repose sur l
Sentinel-Lymphknoten-Biopsie des Melanoms mittels Indocyaningrün und "FOVIS"-System.
Göppner, Daniela; Nekwasil, Stephan; Jellestad, Anne; Sachse, Alexander; Schönborn, Karl-Heinz; Gollnick, Harald
2017-02-01
Der Nachweis metastatischer Infiltrate im Sentinel-Lymphkoten (SLN) gilt als wesentlicher prognostischer Faktor des Melanoms. Alternativ zur Farbstoffmethode mit Patentblau zum Goldstandard der SLN-Biopsie (SLNB) mittels Radiokolloid wird die fluoreszenzoptische Darstellung mit Hilfe von Indocyaningrün (ICG) und Nahinfrarot (NIR)-Kamerasystem kommuniziert. Im Vergleich zur konventionellen Methode wurde die Wertigkeit des ICG-/NIR-Verfahrens in Abhängigkeit vom Body-Mass-Index (BMI) des Patienten und der Konzentration von ICG bezüglich der Visualisierung des Lymphabstroms und des SLNs untersucht. An zehn Patienten wurde die SLNB mittels Technetium-99m, Patentblau und ICG durchgeführt. Die Fluoreszenz-Darstellung von Lymphbahnen und SLN erfolgte in Echtzeit mittels der NIR-Kameratechnik "FOVIS". Je nach erzielter Bildqualität wurde ICG in einer Dosis von 0,25 mg bis 2,5 mg intrakutan appliziert. Neun der zehn SLN wurden fluoreszenzoptisch identifiziert (90 %), alle zehn radioaktiv (100 %), nur acht (80 %) mittels ICG-Grünfärbung bzw. Patenblau-Markierung. Transdermal wurde ein SLN dargestellt (10 %). In Korrelation zum BMI waren höhere ICG-Mengen, bis zu 2,5 mg intrakutan absolut, in der Darstellung der Lymphbahnen von Vorteil. Die SLN-Fluoreszenzmarkierung mit dem ICG/NIR-Kamera-System "FOVIS" stellt eine sichere Alternative zur Farbstoffmethode mit Patentblau ergänzend zur Radiokolloidmethode mit Technetium-99m dar. Weitere Studien zur optimalen Dosierung von ICG und transdermalen Bildgebung in Relation zum BMI sind notwendig. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Garcia, Xavier; Monteys, Xavier; Evans, Rob L.; Szpak, Michal
2014-04-01
During the Irish National Seabed Survey (INSS) in 2003, a gas related pockmark field was discovered and extensively mapped in the Malin Shelf region (NW Ireland). In summer 2006, additional complementary data involving core sample analysis, multibeam and single-beam backscatter classification, and a marine controlled-source electromagnetic survey were obtained in specific locations.This multidisciplinary approach allowed us to map the upper 20 m of the seabed in an unprecedented way and to correlate the main geophysical parameters with the geological properties of the seabed. The EM data provide us with information about sediment conductivity, which can be used as a proxy for porosity and also to identify the presence of fluid and fluid migration pathways. We conclude that, as a whole, the central part of the Malin basin is characterized by higher conductivities, which we interpret as a lithological change. Within the basin several areas are characterized by conductive anomalies associated with fluid flow processes and potentially the presence of microbial activity, as suggested by previous work. Pockmark structures show a characteristic electrical signature, with high-conductivity anomalies on the edges and less conductive, homogeneous interiors with several high-conductivity anomalies, potentially associated with gas-driven microbial activity.
1980-09-01
ILLINOIS MALINE CREEK, MISSOURI SURVEY REPORT 00 C); 7 - ELECTE MADISON,~’ MAY 3 %8 CONT S D ’ a RAKI CUT MAIN REPORT - %" DEPARTMENT OF THE ARMY ST...Investigation St. Louis Metropolitan Area, S. PERFORMING ORG. REPORT NUMBER y~~> Missouri and Illinois Vol One, Main Report 7 .AUTNOR(s) 8 OTATO RN UBRq S...characteristics thereby significantly improving the area’s plant, animal, fish and fowl habitats while also improving the human habitation
López-González, Irene; Viana, Rosa; Sanz, Pascual; Ferrer, Isidre
2017-07-01
Lafora progressive myoclonus epilepsy (Lafora disease, LD) is a fatal rare autosomal recessive neurodegenerative disorder characterized by the accumulation of insoluble ubiquitinated polyglucosan inclusions in the cytoplasm of neurons, which is most commonly associated with mutations in two genes: EPM2A, encoding the glucan phosphatase laforin, and EPM2B, encoding the E3-ubiquitin ligase malin. The present study analyzes possible inflammatory responses in the mouse lines Epm2a -/- (laforin knock-out) and Epm2b -/- (malin knock-out) with disease progression. Increased numbers of reactive astrocytes (expressing the GFAP marker) and microglia (expressing the Iba1 marker) together with increased expression of genes encoding cytokines and mediators of the inflammatory response occur in both mouse lines although with marked genotype differences. C3ar1 and CxCl10 messenger RNAs (mRNAs) are significantly increased in Epm2a -/- mice aged 12 months when compared with age-matched controls, whereas C3ar1, C4b, Ccl4, CxCl10, Il1b, Il6, Tnfα, and Il10ra mRNAs are significantly upregulated in Epm2b -/- at the same age. This is accompanied by increased protein levels of IL1-β, IL6, TNFα, and Cox2 particularly in Epm2b -/- mice. The severity of inflammatory changes correlates with more severe clinical symptoms previously described in Epm2b -/- mice. These findings show for the first time increased innate inflammatory responses in a neurodegenerative disease with polyglucosan intraneuronal deposits which increase with disease progression, in a way similar to what is seen in neurodegenerative diseases with abnormal protein aggregates. These findings also point to the possibility of using anti-inflammatory agents to mitigate the degenerative process in LD.
Mueller, S; Kreuzer, M; Siegrist, M; Mannale, K; Messikommer, R E; Gangnat, I D M
2018-05-18
Currently, there is an intensive ethical discussion about the practice of culling day-old layer cockerels. One solution to avoid this practice could be using dual-purpose types, where males are fattened for meat and females used for egg production. The aim of the present study was to compare fattening performance, carcass conformation, and composition as well as meat quality of Lohmann Dual, a novel dual-purpose type, and 2 traditional dual-purpose types (Belgian Malines and Schweizerhuhn) with 2 broiler types and 1 layer type (Lohmann Brown Plus). Broilers included a conventional line (Ross PM3) and a slower-growing line (Sasso 51) fulfilling requirements of organic farming. Nine birds of each type were fed on a conventional broiler diet. Feed intake and metabolizability of nitrogen and energy were recorded per pen (n = 3), the latter through excreta sampling. For each bird, carcass conformation was assessed, and weights of body, carcass, breast meat, legs, wings, and inner organs were determined. Additionally, breast angle, an indicator for carcass appeal, and skin color were recorded. Meat quality assessment included determinations of thaw and cooking loss, shear force, meat color, and proximate composition of the breast meat. None of the dual-purpose types (20 to 30 g ADG) performed as well in growth as the intensively growing broiler line (68 g ADG). However, Lohmann Dual could compete with the slower-growing broiler line (slower growth but better feed efficiency, similar in carcass weight and breast proportion). Also breast angle was quite similar between Lohmann Dual (100°) and the extensive broiler type (115°C) compared to the intensive broiler line (180°). Meat quality was most favorable in the intensive broilers with the smallest shear force and thawing loss, whereas meat quality was not different between the other types. The Schweizerhuhn performed only at the level of the layer hybrid, and the Belgian Malines was ranked only slightly better.
Elisabeth Wramp, Maria; Langenbruch, Anna; Augustin, Matthias; Zillikens, Detlef; Krengel, Sven
2017-02-01
Kongenitale melanozytäre Nävi (KMN) bedeuten für Patienten und Familien eine psychologische Belastung und bergen zudem medizinische Risiken. Das 2005 gegründete deutschsprachige KMN-Register wurde nun einer Zwischenauswertung bezüglich des Krankheitsverlaufes, der medizinischen Versorgung und der Lebensqualität unterzogen. 100 Patienten, die sich in den Jahren 2005 bis 2012 mit einem Erstmeldebogen registriert hatten, wurde im Rahmen einer prospektiven Kohortenstudie Anfang 2013 ein Folgemeldebogen zugesandt. Außerdem wurden mithilfe standardisierter Fragebögen Daten zu Lebensqualität (dermatology life quality index, DLQI) und Stigmatisierungserfahrungen (perceived stigmatization questionnaire, PSQ; social comfort questionnaire, SCQ) erhoben. 83 % der Patienten oder deren Eltern antworteten (Altersdurchschnitt 11,2 Jahre, Median 6 Jahre; mittleres Follow-up 4,4 Jahre). Im Gesamtkollektiv wurden vier Melanome diagnostiziert, davon zwei zerebrale Melanome im Kindesalter, ein kutanes Melanom im Erwachsenenalter und eines, das sich als proliferierender Knoten erwies. Bei vier Kindern wurde eine neurokutane Melanozytose festgestellt, drei davon mit neurologischer Symptomatik. Chirurgisch behandelt wurden 88 % (73/83). Achtundsiebzig Prozent der Befragten berichteten eine geringe oder keine Beeinträchtigung der Lebensqualität. Die wahrgenommene Stigmatisierung beziehungsweise Beeinträchtigung des sozialen Wohlbefindens war generell ebenfalls gering. Die Ergebnisse geben einen Überblick über die Situation von Patienten mit KMN in Deutschland, Österreich und der Schweiz. Ein Melanom entwickelte sich in 3 %, eine ZNS-Beteiligung bestand in 4 % der Fälle. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
von Bodungen, Uta; Ruess, Katja; Reif, Marcus; Biegel, Ulrike
2017-01-01
Hintergrund: Orale maligne Melanome (OMM) des Hundes zeichnen sich durch schnelles Wachstum, lokale Invasion und hohe Metastasierungsraten aus. Extrakte auf Basis von Viscum album L. (VAE) werden zunehmend in der Krebstherapie sowohl in der Human- als auch in der Veterinärmedizin eingesetzt. Ziel unserer Studie war es zu untersuchen, inwieweit die adjuvante Therapie mit VAE eine therapeutische Option zur Behandlung von OMM ist. Besonderes Augenmerk galt dabei der Überlebenszeit und möglichen Nebenwirkungen. Tiere und Methoden: 26 Hunde mit OMM, die in einem der größten veterinäronkologischen Zentren der Schweiz allesamt eine Strahlentherapie erhielten (teilweise nach operativer Tumorresektion) wurden in die retrospektive Studie eingeschlossen: 18 Hunde wurden mit VAE behandelt (1 ml VAE (Iscador®) in ansteigenden Konzentrationen von 0,1 bis 20 mg/ml subkutan 3-mal pro Woche (VAE-Gruppe), 8 erhielten keine adjuvante Behandlung (Vergleichsgruppe). Wir verglichen die Größenentwicklung der OMM sowie die Überlebenszeit. Ergebnisse: Patienten mit Bestrahlung und adjuvanter VAE-Therapie zeigten mit 236 Tagen eine signifikant längere mediane Überlebenszeit im Vergleich zu Patienten mit Bestrahlung, aber ohne adjuvante VAE-Therapie (49 Tage; Log-Rank-Test: p = 0,0047). Die VAE-Therapie verlängerte die Überlebenszeit um mehr als zwei Drittel (Hazard Ratio (HR) = 0,30, 95%-Konfidenzintervall (KI) 0,11-0,86; p = 0,024), während ein höheres Tumorstadium gemäß UICC (Union internationale contre le cancer) einen statistischen Trend zur Verdopplung des Sterberisikos zeigte (UICC-Stadium III/IV vs. I/II: HR = 2,12, 95%-KI 0,88-5,12; p = 0,095). Zwei Patienten zeigten milde Nebenwirkungen während der VAE-Behandlung. Einer der beiden zeigte 1 Tag lang ein selbstlimitiertes Fieber, bei dem anderen Patienten reduzierten wir die Dosis von einem konzentrierteren zu einem weniger konzentrierten VAE (Serie 0) aufgrund von Müdigkeit, die daraufhin verschwand
Archaeological Investigations at Clayton Lake, Southeast Oklahoma. Phase II.
1982-01-01
Fourche Maline Creek to the north. Even though the excavation results of this site are not included in this report, they are used in the following summary...adaptation style best characterized along the Fourche Maline Creek in LeFlore and Latimer counties. Woodland Period Woodland components are identified from...localized populations. However, these populations and similar groups to the north along the Fourche Maline Creek appear to be generally related. Similar
1983-12-01
tests were conducted for the Maline Creek urban study recently completed by the St. Louis District. Those tests showed that variations in the...were not performed .or expansion and contraction coefficients used in this study. However, such tests were conducted for the Maline Creek urban study...Conservation, letter to Mr. Jack Rasmussen, Chief of Planning Branch, St. -Louis District, Reference to Maline Creek Study, dated 18 June 1979. Griffin, C
Conrad, Franziska; Winkens, Thomas; Kaatz, Martin; Goetze, Steven; Freesmeyer, Martin
2016-08-01
Bei der (18) F-Fluordeoxyglucose-Positronenemissionstomographie/Computertomographie (FDG-PET/CT) ergeben sich häufig Zufallsbefunde. In der vorliegenden Studie konzentrierten wir uns auf mittels FDG-PET/CT erhaltene Zufallsbefunde bei Patienten mit kutanem Melanom und überprüften deren Relevanz hinsichtlich weiterer diagnostischer Maßnahmen und Interventionen. Die Krankenakten von 181 konsekutiven Melanom-Patienten wurden retrospektiv ausgewertet, um das Management von Zufallsbefunden zu dokumentieren. Der Schwerpunkt lag dabei auf den histologischen Befunden. Bei 33 von 181 (18 %) Patienten lagen 39 relevante Zufallsbefunde vor, und zwar im Kolorektalbereich (n = 15 Patienten), in der Schilddrüse (n = 8), der Prostata (n = 2), dem Bewegungsapparat (n = 2), in Lymphknoten (n = 2), der Parotis (n = 1), den Mandeln (n = 1), den Nieren (n = 1) und der Gallenblase (n = 1). Bei 25 Patienten schlossen sich weitere diagnostische Verfahren an, wobei in 21 Fällen ein klinisches Korrelat nachgewiesen wurde. Bei 16 von 21 Patienten ergab sich eine Neoplasie, darunter fünf maligne Läsionen (vier Kolonkarzinome und ein Prostatakarzinom). Die Malignome wurden frühzeitig diagnostiziert und in der Mehrzahl der Fälle erfolgreich entfernt. Der Einsatz der FDG-PET/CT als Routine-Diagnostik wird in den Leitlinien empfohlen und ist indiziert bei malignem Melanom ab Stadium IIC. In dieser Studie wurden auf effektive Weise ansonsten nicht erkannte Krebserkrankungen, insbesondere Kolonkarzinome, detektiert. In den meisten Fällen war eine frühe Intervention möglich. Zufallsbefunde durch FDG-PET/CT sollten, unter Berücksichtigung des Zustands und der Wünsche des Patienten, mit den geeigneten diagnostischen Maßnahmen abgeklärt werden. © 2016 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
1983-11-25
program of survey and excavation on at least 24 sites, 18 of which were black midden mounds, along the Poteau River and Fourche Maline Creek in the area of...evidence, from the Fourche Maline Creek sites. These are deep sites with four feet or more of midden... Evidently, it was not possible to separate this... Maline Creek 15 to 20 mi west of present Wister Lake. At this site, Powell and Rodgers (1980:5-9) carefully examined the stratigraphic context of each
Vilchez, David; Ros, Susana; Cifuentes, Daniel; Pujadas, Lluís; Vallès, Jordi; García-Fojeda, Belén; Criado-García, Olga; Fernández-Sánchez, Elena; Medraño-Fernández, Iria; Domínguez, Jorge; García-Rocha, Mar; Soriano, Eduardo; Rodríguez de Córdoba, Santiago; Guinovart, Joan J
2007-11-01
Glycogen synthesis is normally absent in neurons. However, inclusion bodies resembling abnormal glycogen accumulate in several neurological diseases, particularly in progressive myoclonus epilepsy or Lafora disease. We show here that mouse neurons have the enzymatic machinery for synthesizing glycogen, but that it is suppressed by retention of muscle glycogen synthase (MGS) in the phosphorylated, inactive state. This suppression was further ensured by a complex of laforin and malin, which are the two proteins whose mutations cause Lafora disease. The laforin-malin complex caused proteasome-dependent degradation both of the adaptor protein targeting to glycogen, PTG, which brings protein phosphatase 1 to MGS for activation, and of MGS itself. Enforced expression of PTG led to glycogen deposition in neurons and caused apoptosis. Therefore, the malin-laforin complex ensures a blockade of neuronal glycogen synthesis even under intense glycogenic conditions. Here we explain the formation of polyglucosan inclusions in Lafora disease by demonstrating a crucial role for laforin and malin in glycogen synthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Howington, John
2002-07-01
Vegetation Management for five Substations in the Malin District. BPA proposes total vegetation management (bare ground) in the electrical substations, and, noxious weed management and maintenance of landscaping within the property boundaries of the listed facilities. These facilities are all located within the Malin District of the Redmond Region.
Valles-Ortega, Jordi; Duran, Jordi; Garcia-Rocha, Mar; Bosch, Carles; Saez, Isabel; Pujadas, Lluís; Serafin, Anna; Cañas, Xavier; Soriano, Eduardo; Delgado-García, José M; Gruart, Agnès; Guinovart, Joan J
2011-11-01
Lafora disease (LD) is caused by mutations in either the laforin or malin gene. The hallmark of the disease is the accumulation of polyglucosan inclusions called Lafora Bodies (LBs). Malin knockout (KO) mice present polyglucosan accumulations in several brain areas, as do patients of LD. These structures are abundant in the cerebellum and hippocampus. Here, we report a large increase in glycogen synthase (GS) in these mice, in which the enzyme accumulates in LBs. Our study focused on the hippocampus where, under physiological conditions, astrocytes and parvalbumin-positive (PV(+)) interneurons expressed GS and malin. Although LBs have been described only in neurons, we found this polyglucosan accumulation in the astrocytes of the KO mice. They also had LBs in the soma and some processes of PV(+) interneurons. This phenomenon was accompanied by the progressive loss of these neuronal cells and, importantly, neurophysiological alterations potentially related to impairment of hippocampal function. Our results emphasize the relevance of the laforin-malin complex in the control of glycogen metabolism and highlight altered glycogen accumulation as a key contributor to neurodegeneration in LD. Copyright © 2011 EMBO Molecular Medicine.
[Preliminary study on molecular mechanism of curcumine anti-mouse melanoma].
Gui, Fei; Ma, Wei-Feng; Cai, Shao-Hui; Li, Xiao-Kun; Tan, Yi; Zhou, Chun-Ling; Chen, Hong-Yuan
2008-11-01
To investigate the effects of curcumine on mouse B16 melanoma growth and possible mechanism of Bcl-2, P53 and glutathione in tumor cells. The inhibitory effect on growth of melanoma in vivo were examined by mice melanoma models transplanted B16 cells to C57BL/6J mice. MTT method was used to assay the contribution of curcumine to B16 cells in vitro. The apoptosis and expression of Bcl-2, P53 gene of B16 cells were analyzed by flow cytometry, and HPLC assay was used to detect the change of GSH in B16 melanom tissues of C57BL/6J mouse caused by curcumine. Curcumine had obvious inhibitory effect on the growth of mouse B16 melanoma in time and dose dependent manner and the gene expression of bcl-2 in B16 cells decreased after 24 hours supplied with curcumine, whereas P53 protein expression increased; Curcumine depressed the GSH quantity in melanoma tissues. The growth inhibitory effect of curcumine on mouse melanom is proved in vivo and in vitro respectively. Curcumine can induce some cells to apoptosis which may be relevant to downregulation of bcl-2 expression and upregulation of P53 expression as well as exhaustion of GSH in tumor organization.
Abnormal glycogen chain length pattern, not hyperphosphorylation, is critical in Lafora disease.
Nitschke, Felix; Sullivan, Mitchell A; Wang, Peixiang; Zhao, Xiaochu; Chown, Erin E; Perri, Ami M; Israelian, Lori; Juana-López, Lucia; Bovolenta, Paola; Rodríguez de Córdoba, Santiago; Steup, Martin; Minassian, Berge A
2017-07-01
Lafora disease (LD) is a fatal progressive epilepsy essentially caused by loss-of-function mutations in the glycogen phosphatase laforin or the ubiquitin E3 ligase malin. Glycogen in LD is hyperphosphorylated and poorly hydrosoluble. It precipitates and accumulates into neurotoxic Lafora bodies (LBs). The leading LD hypothesis that hyperphosphorylation causes the insolubility was recently challenged by the observation that phosphatase-inactive laforin rescues the laforin-deficient LD mouse model, apparently through correction of a general autophagy impairment. We were for the first time able to quantify brain glycogen phosphate. We also measured glycogen content and chain lengths, LBs, and autophagy markers in several laforin- or malin-deficient mouse lines expressing phosphatase-inactive laforin. We find that: (i) in laforin-deficient mice, phosphatase-inactive laforin corrects glycogen chain lengths, and not hyperphosphorylation, which leads to correction of glycogen amounts and prevention of LBs; (ii) in malin-deficient mice, phosphatase-inactive laforin confers no correction; (iii) general impairment of autophagy is not necessary in LD We conclude that laforin's principle function is to control glycogen chain lengths, in a malin-dependent fashion, and that loss of this control underlies LD. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
The formation of giant low surface brightness galaxies
NASA Technical Reports Server (NTRS)
Hoffman, Yehuda; Silk, Joseph; Wyse, Rosemary F. G.
1992-01-01
It is demonstrated that the initial structure of galaxies can be strongly affected by their large-scale environments. In particular, rare (about 3 sigma) massive galaxies in voids will have normal bulges, but unevolved, extended disks; it is proposed that the low surface brightness objects Malin I and Malin II are prototypes of this class of object. The model predicts that searches for more examples of 'crouching giants' should be fruitful, but that such galaxies do not provide a substantial fraction of mass in the universe. The identification of dwarf galaxies is relatively unaffected by their environment.
Wang, Yin; Ma, Keli; Wang, Peixiang; Baba, Otto; Zhang, Helen; Parent, Jack M.; Zheng, Pan; Liu, Yang; Minassian, Berge A; Liu, Yan
2013-01-01
Glycogen, the largest cytosolic macromolecule, is soluble because of intricate construction generating perfect hydrophilic-surfaced spheres. Little is known about neuronal glycogen function and metabolism, though progress is accruing through the neurodegenerative epilepsy Lafora disease (LD) proteins laforin and malin. Neurons in LD exhibit Lafora bodies (LBs), large accumulations of malconstructed insoluble glycogen (polyglucosans). We demonstrated that the laforin-malin complex reduces LBs and protects neuronal cells against endoplasmic reticulum stress-induced apoptosis. We now show that stress induces polyglucosan formation in normal neurons in culture and in brain. This is mediated by increased glucose-6-phosphate allosterically hyperactivating muscle glycogen synthase (GS1), and is followed by activation of the glycogen digesting enzyme glycogen phosphorylase. In the absence of laforin, stress-induced polyglucosans are undigested and accumulate into massive LBs, and in laforin-deficient mice stress drastically accelerates LB accumulation and LD. The mechanism through which laforin-malin mediates polyglucosan degradation remains unclear but involves GS1 dephosphorylation by laforin. Our work uncovers the presence of rapid polyglucosan metabolism as part of the normal physiology of neuroprotection. We propose that deficiency in the degradative phase of this metabolism, leading to LB accumulation and resultant seizure predisposition and neurodegeneration, underlies LD. PMID:23546741
Wang, Yin; Ma, Keli; Wang, Peixiang; Baba, Otto; Zhang, Helen; Parent, Jack M; Zheng, Pan; Liu, Yang; Minassian, Berge A; Liu, Yan
2013-08-01
Glycogen, the largest cytosolic macromolecule, is soluble because of intricate construction generating perfect hydrophilic-surfaced spheres. Little is known about neuronal glycogen function and metabolism, though progress is accruing through the neurodegenerative epilepsy Lafora disease (LD) proteins laforin and malin. Neurons in LD exhibit Lafora bodies (LBs), large accumulations of malconstructed insoluble glycogen (polyglucosans). We demonstrated that the laforin-malin complex reduces LBs and protects neuronal cells against endoplasmic reticulum stress-induced apoptosis. We now show that stress induces polyglucosan formation in normal neurons in culture and in the brain. This is mediated by increased glucose-6-phosphate allosterically hyperactivating muscle glycogen synthase (GS1) and is followed by activation of the glycogen digesting enzyme glycogen phosphorylase. In the absence of laforin, stress-induced polyglucosans are undigested and accumulate into massive LBs, and in laforin-deficient mice, stress drastically accelerates LB accumulation and LD. The mechanism through which laforin-malin mediates polyglucosan degradation remains unclear but involves GS1 dephosphorylation by laforin. Our work uncovers the presence of rapid polyglucosan metabolism as part of the normal physiology of neuroprotection. We propose that deficiency in the degradative phase of this metabolism, leading to LB accumulation and resultant seizure predisposition and neurodegeneration, underlies LD.
Jourdain, Anne; Auperin, Anne; Minard-Colin, Véronique; Aladjidi, Nathalie; Zsiros, Josef; Coze, Carole; Gandemer, Virginie; Bertrand, Yves; Leverger, Guy; Bergeron, Christophe; Michon, Jean; Patte, Catherine
2015-06-01
To describe relapsed B-cell lymphoma or leukemia in children/adolescents treated with a "Lymphomes Malins B" regimen and their outcome and to identify prognostic factors for survival, we studied relapses in the LMB89, 96 and 2001 studies of the Société Française d'Oncologie Pédiatrique (Société Française des Cancers de l'Enfant). Therapeutic guidelines at relapse were to obtain a second complete remission and to consolidate the remission with high-dose chemotherapy followed by autologous stem-cell transplantation. Between July 1989 and March 2007, 67 patients of 1322 (5%) relapsed: 57 had Burkitt lymphoma and 10 had large-cell histology. Three patients were initially treated in risk group A, 41 in group B and 23 in group C. Thirty-three patients had a relapse in one site (15 in the central nervous system) and 34 at multiple sites. Sixty-five patients received salvage chemotherapy and 33 achieved complete remission. Forty-one patients also received high-dose chemotherapy followed by autologous (n=33) or allogeneic (n=8) transplantation. With a median follow-up of 6.4 years, the 5-year survival rate was 29.9%. Nineteen patients were still alive, all but one (group A) received consolidation treatment. Multivariate analysis showed the following factors to be significantly associated with better survival: relapse at one site (P=0.0006), large-cell histology (P=0.012), initial prognostic group A or B with lactate dehydrogenase level below twice the normal value (P=0.005), and time to relapse more than 6 months (P=0.04). Copyright© Ferrata Storti Foundation.
IAU Working Group on Wide-Field Imaging.
NASA Astrophysics Data System (ADS)
MacGillivray, H. T.
1991-01-01
Contents: 1. Introduction - The IAU Working Group on Wide-Field Imaging (R. M. West). 2. Reports from the Sub-Sections of the Working Group - a. Sky surveys and patrols (R. M. West). b. Photographic techniques (D. F. Malin). c. Digitization techniques (H. T. MacGillivray). d. Archival and retrieval of wide-field data (B. Lasker). 3. Meeting of the Organising Committee (R. M. West). 4. Wide-field plate archives (M. Tsvetkov). 5. Reproduction of the Palomar Observatory Sky Surveys (R. J. Brucato). 6. Status of the St ScI scan-distribution program (B. Lasker). 7. Pixel addition - pushing Schmidt plates to B = 25 (M. R. S. Hawkins). 8. Photometry from Estar film (S. Phillipps, Q. Parker). 9. ASCHOT - Astrophysical Schmidt Orbital Telescope (H. Lorenz). 10. The Hitchhiker parallel CCD camera (J. Davies, M. Disney, S. Driver, I. Morgan, S. Phillipps).
Synthesis and characterization of triglyceride based thermosetting polymers
NASA Astrophysics Data System (ADS)
Can, Erde
2005-07-01
Plant oils, which are found in abundance in all parts of the world and are easily replenished annually, have the potential to replace petroleum as a chemical feedstock for making polymers. Within the past few years, there has been growing interest to use triglycerides as the basic constituent of thermosetting polymers with the necessary rigidity, strength and glass transition temperatures required for engineering applications. Plant oils are not polymerizable in their natural form, however various functional groups that can polymerize can easily be attached to the triglyceride structure making them ideal cross-linking monomers for thermosetting liquid molding resins. Through this research project a number of thermosetting liquid molding resins based on soybean and castor oil, which is a specialty oil with hydroxyls on its fatty acids, have been developed. The triglyceride based monomers were prepared via the malination of the alcoholysis products of soybean and castor oil with various polyols, such as pentaerythritol, glycerol, and Bisphenol A propoxylate. The malinated glycerides were then cured in the presence of a reactive diluent, such as styrene, to form rigid glassy materials with a wide range of properties. In addition to maleate half-esters, methacrylates were also introduced to the glyceride structure via methacrylation of the soybean oil glycerolysis product with methacrylic anhydride. This product, which contains methacrylic acid as by-product, and its blends with styrene also gave rigid materials when cured. The triglyceride based monomers were characterized via conventional spectroscopic techniques. Time resolved FTIR analysis was used to determine the curing kinetics and the final conversions of polymerization of the malinated glyceride-styrene blends. Dynamic Mechanical Analysis (DMA) was used to determine the thermomechanical behavior of these polymers and other mechanical properties were determined via standard mechanical tests. The use of lignin
Watching Test Drives in California for Rover Mission to Mars
2012-05-11
Michael Malin, left, principal investigator for three science cameras on NASA Curiosity Mars rover, comments to a news reporter during tests with Curiosity mobility-test stand-in, Scarecrow, on Dumont Dunes in California Mojave Desert.
Mars Descent Imager for Curiosity
2010-07-19
A pocketknife provides scale for this image of the Mars Descent Imager camera; the camera will fly on the Curiosity rover of NASA Mars Science Laboratory mission. Malin Space Science Systems, San Diego, Calif., supplied the camera for the mission.
Test Image by Mars Descent Imager
2010-07-19
Ken Edgett, deputy principal investigator for NASA Mars Descent Imager, holds a ruler used as a depth-of-field test target. The instrument took this image inside the Malin Space Science Systems clean room in San Diego, CA, during calibration testing.
2011-11-22
CAPE CANAVERAL, Fla. – John Grotzinger, project scientist for Mars Science Laboratory (MSL) at the California Institute of Technology in Pasadena, Calif., demonstrates the operation of MSL's rover, Curiosity, during a science briefing at NASA's Kennedy Space Center in Florida, part of preflight activities for the MSL mission. Michael Malin, principal investigator for the Mast Camera and Mars Descent Imager investigations on Curiosity from Malin Space Science Systems, looks on at right. MSL’s components include a car-sized rover, Curiosity, which has 10 science instruments designed to search for signs of life, including methane, and help determine if the gas is from a biological or geological source. Launch of MSL aboard a United Launch Alliance Atlas V rocket is scheduled for Nov. 26 from Space Launch Complex 41 on Cape Canaveral Air Force Station in Florida. For more information, visit http://www.nasa.gov/msl. Photo credit: NASA/Kim Shiflett
ERIC Educational Resources Information Center
Ware, Molly
2013-01-01
This paper initiates a forum for Malin Ideland and Claes Malmberg's article titled "Body talk--students' identity construction while discussing a socioscientific issue." Ideland and Malmberg explore issues of health and body through teachers' use of a pedagogical approach that foregrounds exploration of a socioscientific issue. This paper explores…
2011-10-01
GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007
NASA Astrophysics Data System (ADS)
Reiss, D.; Jaumann, R.
The topographic information provided by the Mars Orbiter Laser Altimeter has been used in combination with the Mars Observer Camera imagery to estimate the topo- graphic position of sapping pits and gully heads on the rim of Nirgal Vallis. Hence Nirgal Vallis is understood to be formed by groundwater sapping (1, 2, 3, 4) an aquifer is proposed as water supply. Gullies in the northern rim of Nirgal Vallis as discovered in Mars Observer Camera (MOC) images (5, 6) proof the existence of such an aquifer. Further evidence for sapping in Nirgal Vallis is demonstrated by short hanging tribu- taries with amphitheater-like heads. The basis of these sapping pits defines the con- tact of aquifer to aquiclude during the valley formation. The gully heads are much deeper under the local surface and the correlation of their topographic position with the valley depth indicate the subsidence of the groundwater level following the ver- tical erosion of the valley. This implies the existence of different groundwater tables over time confined by impermeable layers, whereas the gully head level is the most recent groundwater table which still may be erosional active under the conditions of increasing water pressure and ice barrier failure (5). The occurrence of more than one tilted sapping level at different topographic positions which are time-correlated with the erosional notching of the valley, either indicates different aquifers with litholog- ical aquicludes or a climate controlled subsidence of the permafrost layer acting as confining layer. References: (1) Baker et al., 1992, In: Mars, Univ. of Arizona Press. (2) Carr, 1995, JGR 100, 7479. (3) Malin and Carr, 1999, Icarus, 397, 589. (4) Jaumann and Reiss, 2002, LPSC. (5) Malin and Edgett, 2000, Science, 288, 2330. (6) Malin and Edgett, 2001, JGR 106, 23429.
Wang, Peixiang; Israelian, Lori; Xue, Yunlin; Song, Siyuan; Attisano, Liliana; Minassian, Berge A
2016-01-01
Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.
Buck, Stephanie D.
2014-01-01
The Poteau Valley Improvement Authority uses Wister Lake in southeastern Oklahoma as a public water supply. Total phosphorus, total nitrogen, and suspended sediments from agricultural runoff and discharges from wastewater treatment plants and other sources have degraded water quality in the lake. As lake-water quality has degraded, water-treatment cost, chemical usage, and sludge production have increased for the Poteau Valley Improvement Authority. The U.S. Geological Survey (USGS), in cooperation with the Poteau Valley Improvement Authority, investigated and summarized concentrations of total phosphorus, total nitrogen, suspended sediment, and bacteria (Escherichia coli and Enterococcus sp.) in surface water flowing to Wister Lake. Estimates of total phosphorus, total nitrogen, and suspended sediment loads, yields, and flow-weighted mean concentrations of total phosphorus and total nitrogen concentrations were made for the Wister Lake Basin for a 3-year period from October 2010 through September 2013. Data from water samples collected at fixed time increments during base-flow conditions and during runoff conditions at the Poteau River at Loving, Okla. (USGS station 07247015), the Poteau River near Heavener, Okla. (USGS station 07247350), and the Fourche Maline near Leflore, Okla. (USGS station 07247650), water-quality stations were used to evaluate water quality over the range of streamflows in the basin. These data also were collected to estimate annual constituent loads and yields by using regression models. At the Poteau River stations, total phosphorus, total nitrogen, and suspended sediment concentrations in surface-water samples were significantly larger in samples collected during runoff conditions than in samples collected during base-flow conditions. At the Fourche Maline station, in contrast, concentrations of these constituents in water samples collected during runoff conditions were not significantly larger than concentrations during base
A Novel Technique to Calculate UV Opacity at Gale Crater from MSL/REMS Measurements
NASA Astrophysics Data System (ADS)
Vicente-Retortillo, Álvaro; Martínez, Germán M.; Renno, Nilton O.; Lemmon, Mark T.; Mason, Emily L.; de la Torre-Juárez, Manuel
2016-04-01
The Rover Environmental Monitoring Station (REMS) on board the Mars Science Laboratory (MSL) mission carries a UV sensor that for the first time is measuring the solar radiation at the surface of Mars in six bands between 200 and 380 nm [1]. Here we present a novel methodology to calculate the atmospheric opacity by using the UV photodiode output currents measured by this sensor (TELRDR products) and ancillary (ADR) data. We estimate the diffuse and total radiation signals by analyzing the events in which the direct solar beam was temporarily blocked by the masthead or by the mast of the rover. Then we use a radiative transfer model with updated radiative properties of the Martian aerosols ([2], [3]) based on the Monte-Carlo method to retrieve the UV opacity from those measurements. Therefore, this methodology is not sensitive to the degradation of the sensor due to the deposition of dust on it. In addition, by using TELRDR and ADR data, inconsistencies in the processed reduced data (ENVRDR and MODRDR products, in units of W/m2) found when the solar zenith angle relative to REMS rover frame is above 30° are avoided. In order to validate our technique, we compare the UV opacities with those derived from Mastcam observations at 880 nm. We find that both opacities show a good agreement and follow a similar seasonal trend, with the UV opacity showing values generally lower than at 880 nm. The difference between both opacities varies over the year, with the minimum difference occurring during the first half of the winter, when both opacities show their annual lowest values. The temporal variation of this difference may be used to analyze changes in the dust size distribution. [1] Gómez-Elvira, J., Armiens, C., Castañer, L., Domínguez, M., Genzer, M. et al. REMS: the environmental sensor suite for the Mars Science Laboratory rover. Space Sci. Rev., 170 (1-4), 583-640, 2012. [2] Vicente-Retortillo, A., Valero, F., Vázquez, L. and Martínez, G. M. A model to calculate
Cameras Monitor Spacecraft Integrity to Prevent Failures
NASA Technical Reports Server (NTRS)
2014-01-01
The Jet Propulsion Laboratory contracted Malin Space Science Systems Inc. to outfit Curiosity with four of its cameras using the latest commercial imaging technology. The company parlayed the knowledge gained under working with NASA to develop an off-the-shelf line of cameras, along with a digital video recorder, designed to help troubleshoot problems that may arise on satellites in space.
Archaeogeophysical investigations of early Caddo settlement patterning at the Crenshaw site (3MI6)
NASA Astrophysics Data System (ADS)
Samuelsen, John R.
The Teran map, made during Don Domingo Teran de los Rios' expedition for New Spain, shows a Caddo settlement in 1691 with a vacant mound center and many small farmsteads dispersed across the countryside along both banks of the Red River. This map, combined with the 19th Century photographs taken by William Soule, provides a testable model for the settlement pattern of the Caddo people called the Teran-Soule model. This model states that large numbers of people besides a small caretaker population did not inhabit the mound centers, supporting a vacant mound center hypothesis. Recent studies have begun to challenge this hypothesis, using archaeogeophysical techniques to find structures near Middle to Late Caddo mounds. An archaeogeophysical survey of the Crenshaw site along the Great Bend of the Red River was conducted to determine if structures could be found there. Is the settlement pattern at this early Caddo site, occupied between A.D. 700 and 1400, consistent with the late historic model of a vacant mound center? Is there evidence that both Caddo and Fourche Maline occupations existed in horizontally distinct components? The 3.2 hectare survey identified more than 100 possible structures, of which more than 50 are probably structures associated with the Fourche Maline or early Caddo occupations of the site. Several structures were found in linear patterns, including an oval series of possible structures measuring 90 x 85 m in diameter. While cultural affiliation was not determined for most of these features, some can be attributed to Caddo origin based on architectural attributes, such as extended entranceways. This suggests that Crenshaw was not literally vacant, but the presence of extended entranceways suggests that some of the identified features were special use structures, which does not conflict with the vacant mound center hypothesis. However, the large number of possible structures present with unknown cultural affiliations provides ample opportunities
NASA Astrophysics Data System (ADS)
Taschereau, Richard
Cette these concerne les implants permanents pour la prostate. Les isotopes employes, le 103Pd et l'125I, semblent produire les memes resultats cliniques: le premier a cause d'une radiation plus efficace et le second a cause de sa demi-vie plus longue. La recherche utilise le cadre theorique de la microdosimetrie et des simulations Monte Carlo. Elle propose d'employer le spectre d'ejection dans le calcul de l'efficacite; ce changement fait passer l'efficacite relative du 103Pd de 10% a 5%. Elle montre ensuite qu'il est possible d'ameliorer l'efficacite de la radiation de 125I par l'exploitation des rayons X caracteristiques de la capsule. Une source amelioree faite de molybdene et d'yttrium est donnee en exemple. Elle procure une radiation de 5--7% plus efficace, ce qui surclasse les deux sources existantes. Les applications ne se limitent pas au traitement de la prostate; le traitement du melanome oculaire et la curietherapie endovasculaire pourraient en beneficier.
2011-11-22
CAPE CANAVERAL, Fla. – NASA’s Kennedy Space Center in Florida is host to a Mars Science Laboratory (MSL) science briefing as part of preflight activities for the MSL mission. From left, NASA Public Affairs Officer Guy Webster moderates the conference featuring Michael Meyer, lead scientist for NASA Mars Exploration Program; John Grotzinger, project scientist for Mars Science Laboratory California Institute of Technology, Pasadena, Calif.; Michael Malin, principal investigator for the Mast Camera and Mars Descent Imager investigations on Curiosity, Malin Space Science Systems; Roger Wiens, principal investigator for Chemistry and Camera investigation on Curiosity, Los Alamos National Laboratory; David Blake, NASA principal investigator for Chemistry and Mineralogy investigation on Curiosity, NASA Ames Research Center; and Paul Mahaffy, NASA principal investigator for Sample Analysis at Mars investigation on Curiosity, NASA Goddard Space Flight Center. MSL’s components include a car-sized rover, Curiosity, which has 10 science instruments designed to search for signs of life, including methane, and help determine if the gas is from a biological or geological source. Launch of MSL aboard a United Launch Alliance Atlas V rocket is scheduled for Nov. 26 from Space Launch Complex 41 on Cape Canaveral Air Force Station in Florida. For more information, visit http://www.nasa.gov/msl. Photo credit: NASA/Kim Shiflett
2011-11-22
CAPE CANAVERAL, Fla. – NASA’s Kennedy Space Center in Florida is host to a Mars Science Laboratory (MSL) science briefing as part of preflight activities for the MSL mission. From left, NASA Public Affairs Officer Guy Webster moderates the conference featuring Michael Meyer, lead scientist for NASA Mars Exploration Program; John Grotzinger, project scientist for Mars Science Laboratory California Institute of Technology, Pasadena, Calif.; Michael Malin, principal investigator for the Mast Camera and Mars Descent Imager investigations on Curiosity, Malin Space Science Systems; Roger Wiens, principal investigator for Chemistry and Camera investigation on Curiosity, Los Alamos National Laboratory; David Blake, NASA principal investigator for Chemistry and Mineralogy investigation on Curiosity, NASA Ames Research Center; and Paul Mahaffy, NASA principal investigator for Sample Analysis at Mars investigation on Curiosity, NASA Goddard Space Flight Center. MSL’s components include a car-sized rover, Curiosity, which has 10 science instruments designed to search for signs of life, including methane, and help determine if the gas is from a biological or geological source. Launch of MSL aboard a United Launch Alliance Atlas V rocket is scheduled for Nov. 26 from Space Launch Complex 41 on Cape Canaveral Air Force Station in Florida. For more information, visit http://www.nasa.gov/msl. Photo credit: NASA/Kim Shiflett
Ain’t No Neuroscience Mountain High Enough: Experiences of a Neurogardener
ABDULLAH, Jafri Malin
2015-01-01
16 years have passed since the idea was mooted in 1999 by five neurosurgeons in the corridors of Hotel Perdana, Kota Bharu. They were Dato’ Dr Johari Siregar Bin Adnan, Dato’ Professor Dr Ahmad Zubaidi Abdul Latif , Dr Azmin Kass Bin Rosman, Dato’ Dr Mohammed Saffari Bin Mohammed Haspani and Professor Dato’ Dr Jafri Malin Abdullah. They initiated the beginning of the first programme in Neurosurgery in Malaysia. The rest is history. PMID:26715890
Microbial Studies of Biofouling of Treated and Untreated Wood Pilings in the Marine Environment.
1986-02-28
into tropical marine waters. After that, little or no slowing of biofouling can be detected. The wood boring invertebrate , Limnoria, appears to develop a...Malins. 1977. Toxicity and metabolism of naph- thalene: a study with marine larval invertebrates . Proc. Soc. Exptl. Biol. Med. 154: 151. de Serres...of Biofouling of Treated FINAL REPORT ".- L and Untreated Wood Pilings in the ORG.RPORT.UMBEco Marine Environment . PoRMG O...: * I. AUTMOR(6) G
Ain't No Neuroscience Mountain High Enough: Experiences of a Neurogardener.
Abdullah, Jafri Malin
2015-01-01
16 years have passed since the idea was mooted in 1999 by five neurosurgeons in the corridors of Hotel Perdana, Kota Bharu. They were Dato' Dr Johari Siregar Bin Adnan, Dato' Professor Dr Ahmad Zubaidi Abdul Latif , Dr Azmin Kass Bin Rosman, Dato' Dr Mohammed Saffari Bin Mohammed Haspani and Professor Dato' Dr Jafri Malin Abdullah. They initiated the beginning of the first programme in Neurosurgery in Malaysia. The rest is history.
Source regions and water release mechanisms of Martian Valley Networks
NASA Astrophysics Data System (ADS)
Jaumann, R.; Reiss, D.; Sander, T.; Gwinner, K.; Roatsch, T.; Matz, K.-D.; Hauber, E.; Mertens, V.; Hoffmann, H.; Neukum, G.; HRSC Co-Investigator Team
Martian valley networks have been cited as the best evidence that Mars maintained flow of liquid water across the surface. Although internal structures associated with a fluvial origin within valleys like inner channels, terraces, slip-off and undercut slopes are extremely rare on Mars (Carr and Malin, 2000) such features can be identified in high-resolution imagery (e.g. Malin and Edgett, 2001; Jaumann et al., 2005). However, besides internal features the source regions are an important indicator for the flow processes in Martian valleys because they define the drainage area and thus constrain the amount of available water for eroding the valley network. Furthermore, the morphology of the source regions and their topographic characteristics provide information about the origin of the water. On Mars valley networks are thought to be formed by retreating erosion where the water is supplied from the sub-surface. However, the mechanisms that are responsible for the release of ground water are poorly understood. The three dimensional highly resolved data of the High Resolution Stereo Camera (HRSC) on the Mars Express Mission (Neukum et al., 2004) allow the detailed examination of valley network source regions. A valley network in the western Lybia Montes region valley between 1.4°N to 3.5°N and 81.6°E to 82.5°E originates at a highland mountain region and drains down to Isidis Planitia over a distance of 400 km. Most of its distance the valley exhibits an interior channel that allows to constraint discharge and erosion budgets (Jaumann, et al., 2005). The valley was formed in the Noachian/Hesperian between 3.7 and 3.3 billion years. However, discharge and erosion budgets restrict the erosion time to a few million years in total, indicating single events rather than continuous flow over long periods. The source region of the valley is covered by a series of lava flows. Even the upstream part of the valley is covered by lava flows that cover the interior channel
Trace elements biomonitoring in a historical mining district (les Malines, France).
Saunier, Jean-Baptiste; Losfeld, Guillaume; Freydier, Rémi; Grison, Claude
2013-11-01
The aim of this study is to investigate the trace elements (TE) contents of potential biomonitors in a historical Zn-Pb mining district: apiary products (honey, royal-jelly and beeswax) lichen and moss were sampled and analysed. In spite of high TE concentrations in mining waste and soil, apiary products are free of TE contamination originating from historical mining. Lichen/moss show high TE levels, which suggest atmospheric input of local dust. Pb isotopes analysis proved the origin of TE found in lichen/moss to be mainly mining waste. These results help discuss the choice of relevant organisms for monitoring TE in the environment and bring additional data on the potential impacts of brownfields left after mining, especially on food products from apiaries. Copyright © 2013 Elsevier Ltd. All rights reserved.
The Mars Hand Lens Imager (MAHLI) for the 209 Mars Science Laboratory
NASA Technical Reports Server (NTRS)
Edgett, K. S.; Bell, J. F., III; Herkenhoff, K. E.; Heydari, E.; Kah, L. C.; Minitti, M. E.; Olson, T. S.; Rowland, S. K.; Schieber, J.; Sullivan, R. J.
2005-01-01
The MArs Hand Lens Imager (MAHLI) is a small, RGB-color camera designed to examine geologic material at 12.5-75 microns/pixel resolution at the Mars Science Laboratory (MSL) landing site. MAHLI is a PI-led investigation competitively selected by NASA in December 2004 as part of the science payload for the MSL rover launching in 2009. The instrument is being fabricated by, and will be operated by, Malin Space Science Systems of San Diego, California.
Evaluation of the Pulmonary Toxicity of Ambient Particulate Matter from Camp Victory, Iraq
2015-01-01
Middle East resemble those of a U.S. urban dust and are less than those of silica. Therefore, Iraq dust exposure is not highly toxic, but similar to...personnel deployed in or near Iraq (Shorr et al. 2004). The levels and composition of ambient aerosols present in the Middle East and SWA have been...presented in Supplemental File 3. Histology Animals were euthanized as described ear - lier and unlavaged lungs were inflated with for- malin, routinely
Bibliography of Short Wavelength Chemical Laser Research
1993-05-01
a ). The potential energy curves reported in Figure 6 were computed by H . Michaels. Note that...observe a chemiluminescent reaction between H and NF2 that produced both NF( a -X) and NF(b-X) emissions.ŗ 14 Lasant Excitation Mechanism BiF( A -X) NF( a ) + Bi...elimination reaction that directly produces singlet NF: H ( 2S) + NF 2 ( 2BI) -- > HNF 2 -- > HF(’Z) + NF(’ A ) Malins and Setser,"’ and more
Aerodynamic measurement techniques. [laser based diagnostic techniques
NASA Technical Reports Server (NTRS)
Hunter, W. W., Jr.
1976-01-01
Laser characteristics of intensity, monochromatic, spatial coherence, and temporal coherence were developed to advance laser based diagnostic techniques for aerodynamic related research. Two broad categories of visualization and optical measurements were considered, and three techniques received significant attention. These are holography, laser velocimetry, and Raman scattering. Examples of the quantitative laser velocimeter and Raman scattering measurements of velocity, temperature, and density indicated the potential of these nonintrusive techniques.
1998-03-13
Extensive wind-swept plains of the Medusae Fossae formation on Mars. This northern subframe image, frame 3104, is of a 3.0 x 4.7 km area centered near 2.4 degrees north, 163.8 degrees west. Science Magazine, Volume 279, Number 5357, 13 March 1998, M. C. Malin, et. al., "Early Views of the Martian Surface from the Mars Orbiter Camera of Mars Global Surveyor", pp. 1681-1685 (Fig. 1A) http://photojournal.jpl.nasa.gov/catalog/PIA00800
The X-ray halo of an extremely luminous LSB disk galaxy
NASA Technical Reports Server (NTRS)
Weiner, Benjamin J.
2004-01-01
We are continuing to refine our upper limit on emission from halo gas in Malin 2. The upper limit is, of course, below the detected flux, but is made more difficult to quantify by the disk and possible AGN sources. We are also exploring spectral and spatial-size constraints to help separate the sources of emission. On the theory side, more recent work on the X-ray halo luminosity from halo gas leftover from galaxy formation has lowered the prediction for disk galaxies (e.g. Toft et al. 2002, MNRAS, 335, 799). While our upper limit is well below the original prediction, refinements in model have moved the theoretical goalposts, so that the observation may be consistent with newer models. A recent theoretical development, which our observations of Malin 2 appear to support, is that a substantial amount of mass can be accreted onto galaxies without being heated at a virial shock. The previous standard theory was that gas accreting into a halo hits a virial shock and is heated to high temperatures, which could produce X-ray halos in massive galaxies. Recent models show that "smooth accretion" of matter bypasses the virial shocking (Murali e t al. 2002, ApJ, 571, 1; Birnboim & Dekel 2003, MNRAS, 345, 349). Additionally, new hydrodynamical simulations of galaxy mergers by UCSC graduate student T. J. Cox show that hot gas halos can be created by gas blown out from the merger, taking up orbital energy of the merging galaxies (Cox et al. 2004, ApJ, 607, L87). If mergers rather than virial shocking are the origin of hot gas halos, the existence of an X-ray halo should depend more on past merger activity than halo mass. Then it makes sense that elliptical galaxies and poor groups with ellipticals, which are probably formed in mergers, have X-ray gas halos; while a giant, quiescent LSB disk galaxy like Malin 2, which has never suffered a major merger, does not have an X-ray halo. While both the observational expectations and theoretical models have changed since we began this
Annual Variations of the Geomagnetic Field in the Earth's Polar Regions
NASA Astrophysics Data System (ADS)
Ou, Jiaming; Du, Aimin
2017-04-01
The annual variations of the geomagnetic field play an important role in the coupling processes between the solar wind, magnetosphere and ionosphere. The annual variation is a well-established feature of the geomagnetic field, and usually is applied for modeling the conductivity of the lower mantle [Parkinson, 1983], and for long-term space weather forecasting [Bartels, 1932; Malin and Mete Isikara, 1976; Gonzalez et al., 1994]. Considerable effort has been devoted toward understanding the causes of the geomagnetic field variations, but the suggested physical mechanisms differ widely. The annual variation is relatively weak in many magnetic indices, but it has a distinct signature in the geomagnetic components. Thus, we use the components for this analysis. The components have a positive peak in northern summer and a negative dip in winter [Vestine, 1954]. Vestine [1954] suggested that the annual variation is caused by an ionospheric dynamo in which electric currents in the ionosphere are generated by meridional winds. The winds blow from north-to-south during northern summer, and south-to-north in northern winter. Malin and Mete Isikara [1976], using near-midnight geomagnetic data, concluded that the annual variation results from a latitudinal movement of the auroral electrojet or the ring current. Stauning [2011] derived of the seasonal variation of the quiet daily variations and examined the influence of the sector structure of the interplanetary magnetic field. Ziegger and Mursula [1998] have suggested a third mechanism: that the cause is related to an asymmetric solar wind speed distribution across the heliographic equator. In this paper, we study the annual variation problem using long-term magnetic observation and ionospheric conductivity. The sunlight incident on the ionosphere will be calculated. Although a global analysis is done, particular focus will be placed on the polar regions. This study covers the interval 1990-2010, and the cause of the well
NASA Technical Reports Server (NTRS)
Park, Steve
1990-01-01
A large and diverse number of computational techniques are routinely used to process and analyze remotely sensed data. These techniques include: univariate statistics; multivariate statistics; principal component analysis; pattern recognition and classification; other multivariate techniques; geometric correction; registration and resampling; radiometric correction; enhancement; restoration; Fourier analysis; and filtering. Each of these techniques will be considered, in order.
Chao, T.T.; Sanzolone, R.F.
1992-01-01
Sample decomposition is a fundamental and integral step in the procedure of geochemical analysis. It is often the limiting factor to sample throughput, especially with the recent application of the fast and modern multi-element measurement instrumentation. The complexity of geological materials makes it necessary to choose the sample decomposition technique that is compatible with the specific objective of the analysis. When selecting a decomposition technique, consideration should be given to the chemical and mineralogical characteristics of the sample, elements to be determined, precision and accuracy requirements, sample throughput, technical capability of personnel, and time constraints. This paper addresses these concerns and discusses the attributes and limitations of many techniques of sample decomposition along with examples of their application to geochemical analysis. The chemical properties of reagents as to their function as decomposition agents are also reviewed. The section on acid dissolution techniques addresses the various inorganic acids that are used individually or in combination in both open and closed systems. Fluxes used in sample fusion are discussed. The promising microwave-oven technology and the emerging field of automation are also examined. A section on applications highlights the use of decomposition techniques for the determination of Au, platinum group elements (PGEs), Hg, U, hydride-forming elements, rare earth elements (REEs), and multi-elements in geological materials. Partial dissolution techniques used for geochemical exploration which have been treated in detail elsewhere are not discussed here; nor are fire-assaying for noble metals and decomposition techniques for X-ray fluorescence or nuclear methods be discussed. ?? 1992.
BiF/NF2 Kinetics Studies: Mechanism and Conversion Efficiency
1990-08-31
68A, 61 (1964) 9. R. F Heidner III, H . Helvajian , J. S. Holloway, and J. B. Koffend, J. Chem. Phys. 84, 2137 (1986). 10. R. J. Malins and D. W Setser, J...Heidner III, H . Helvajian , J. S. Holloway, and J. B. Koffend, J. Chem. Phys. 93, 7818 (1989). 15. C. H . Corliss and W R. Bozman, Experimental Transition...MS Informal Report, UC-34a, UC-LASL (July 1980). 18. R. F Heidner III, H . Helvajian , J. S. Holloway, and J. B. Koffend, J. Chem. Phys. 93, 7813 (1989
Ultra high speed image processing techniques. [electronic packaging techniques
NASA Technical Reports Server (NTRS)
Anthony, T.; Hoeschele, D. F.; Connery, R.; Ehland, J.; Billings, J.
1981-01-01
Packaging techniques for ultra high speed image processing were developed. These techniques involve the development of a signal feedthrough technique through LSI/VLSI sapphire substrates. This allows the stacking of LSI/VLSI circuit substrates in a 3 dimensional package with greatly reduced length of interconnecting lines between the LSI/VLSI circuits. The reduced parasitic capacitances results in higher LSI/VLSI computational speeds at significantly reduced power consumption levels.
Analytical techniques: A compilation
NASA Technical Reports Server (NTRS)
1975-01-01
A compilation, containing articles on a number of analytical techniques for quality control engineers and laboratory workers, is presented. Data cover techniques for testing electronic, mechanical, and optical systems, nondestructive testing techniques, and gas analysis techniques.
Theorists and Techniques: Connecting Education Theories to Lamaze Teaching Techniques
Podgurski, Mary Jo
2016-01-01
ABSTRACT Should childbirth educators connect education theory to technique? Is there more to learning about theorists than memorizing facts for an assessment? Are childbirth educators uniquely poised to glean wisdom from theorists and enhance their classes with interactive techniques inspiring participant knowledge and empowerment? Yes, yes, and yes. This article will explore how an awareness of education theory can enhance retention of material through interactive learning techniques. Lamaze International childbirth classes already prepare participants for the childbearing year by using positive group dynamics; theory will empower childbirth educators to address education through well-studied avenues. Childbirth educators can provide evidence-based learning techniques in their classes and create true behavioral change. PMID:26848246
Nondestructive evaluation technique guide
NASA Technical Reports Server (NTRS)
Vary, A.
1973-01-01
A total of 70 individual nondestructive evaluation (NDE) techniques are described. Information is presented that permits ease of comparison of the merits and limitations of each technique with respect to various NDE problems. An NDE technique classification system is presented. It is based on the system that was adopted by the National Materials Advisory Board (NMAB). The classification system presented follows the NMAB system closely with the exception of additional categories that have been added to cover more advanced techniques presently in use. The rationale of the technique is explained. The format provides for a concise description of each technique, the physical principles involved, objectives of interrogation, example applications, limitations of each technique, a schematic illustration, and key reference material. Cross-index tabulations are also provided so that particular NDE problems can be referred to appropriate techniques.
Shaher, Z
2007-08-01
Laparoscopic trocars do create wounds. This article aims to review and list different techniques used for closure of the fascia incision at trocar sites. A literature search was performed for articles dealing with closure techniques. The author searched this subject in English on Medline by combining the words "trocar" and "hernia," as well as "Deschamps" and "Reverdin." All articles reporting techniques with their references were reviewed. The articles described many techniques in addition to classical closure using curved needles, including Grice needle, Maciol needles, Endoclose device, Carter-Thomason device, Tahoe ligature device, Endo-Judge device, eXit puncture closure device, Lowsley retractor, spinal cord needles, dual hemostat, suture carrier, Riverdin and Deschamps needles, and Gore-Tex closure device. Three main groups of techniques were found with favor of extracorporeal manipulations under direct visualization. Old methods are sufficient and cost-effective.
New technique to prevent prolonged air leak: use of 'Tachosuture' technique.
Nishida, Tatsuya; Mikami, Iwao; Fujii, Yoshitaka
2017-02-01
Prolonged air leak (defined as air leak >7 days), caused by pulmonary resection or alveolar-pleural fistula, increases postoperative morbidity, prolongs hospital stay and increases healthcare costs. We describe a new technique ('Tachosuture' technique) to prevent prolonged air leak. The key point of this new technique is that air leak is classified into three types and an absorbable suture is added to a TachoSil ® patch in each type to prevent detachment from the lung parenchyma. Between August 2013 and March 2016, 40 patients underwent thoracoscopic surgery using 'Tachosuture' technique. Postoperative air leak always stopped within 3 days (95% confidence interval for the absence of prolonged air leak: 92.5-100%). It is considered that this simple technique is useful to prevent prolonged air leak.
Social capital and health--implications for health promotion.
Eriksson, Malin
2011-02-08
This article is a review of the PhD Thesis of Malin Eriksson, entitled 'Social capital, health and community action - implications for health promotion.' The article presents a theoretical overview of social capital and its relation to health, reviews empirical findings of the links between social capital and (self-rated) health, and discusses the usefulness of social capital in health promotion interventions at individual and community levels. Social capital, conceptualized as an individual characteristic, can contribute to the field of health promotion by adding new knowledge on how social network interventions may best be designed to meet the needs of the target group. The distinction of different forms of social capital, i.e. bonding, bridging, and linking, can be useful in mapping the kinds of networks that are available and health-enhancing (or damaging) and for whom. Further, social capital can advance social network interventions by acknowledging the risk for unequal distribution of investments and returns from social network involvement. Social capital, conceptualized as characterizing whole communities, provides a useful framework for what constitutes health-supporting environments and guidance on how to achieve them. Mapping and mobilization of social capital in local communities may be one way of achieving community action for health promotion. Social capital is context-bound by necessity. Thus, from a global perspective, it cannot be used as a 'cookbook' on how to achieve supportive environments and community action smoothly. However, social capital can provide new ideas on the processes that influence human interactions, cooperation, and community action for health promotion in various contexts. © 2011 Malin Eriksson.
Conductivity and electrochemical stability of concentrated aqueous choline chloride solutions
NASA Astrophysics Data System (ADS)
Grishina, E. P.; Kudryakova, N. O.
2017-10-01
The conductivity and electrochemical stability of choline chloride (ChCl) solutions with water contents ranging from 20 to 39 wt % are studied. Exposing ChCl to moist ambient air yields a highly concentrated aqueous solution that, as an electrolyte, exhibits the properties and variations in conductivity with temperature and concentration characteristic of other similar systems. Its electrochemical stability window, determined by cyclic voltammetry, is comparable to that of ChCl-based deep eutectic solvents (DESs). Products of the electrolysis of ChCl‒H2O mixtures seem to be less toxic than those of Reline, Ethaline, and Maline.
Simulation verification techniques study: Simulation self test hardware design and techniques report
NASA Technical Reports Server (NTRS)
1974-01-01
The final results are presented of the hardware verification task. The basic objectives of the various subtasks are reviewed along with the ground rules under which the overall task was conducted and which impacted the approach taken in deriving techniques for hardware self test. The results of the first subtask and the definition of simulation hardware are presented. The hardware definition is based primarily on a brief review of the simulator configurations anticipated for the shuttle training program. The results of the survey of current self test techniques are presented. The data sources that were considered in the search for current techniques are reviewed, and results of the survey are presented in terms of the specific types of tests that are of interest for training simulator applications. Specifically, these types of tests are readiness tests, fault isolation tests and incipient fault detection techniques. The most applicable techniques were structured into software flows that are then referenced in discussions of techniques for specific subsystems.
EDITORIAL: Imaging Systems and Techniques Imaging Systems and Techniques
NASA Astrophysics Data System (ADS)
Giakos, George; Yang, Wuqiang; Petrou, M.; Nikita, K. S.; Pastorino, M.; Amanatiadis, A.; Zentai, G.
2011-10-01
This special feature on Imaging Systems and Techniques comprises 27 technical papers, covering essential facets in imaging systems and techniques both in theory and applications, from research groups spanning three different continents. It mainly contains peer-reviewed articles from the IEEE International Conference on Imaging Systems and Techniques (IST 2011), held in Thessaloniki, Greece, as well a number of articles relevant to the scope of this issue. The multifaceted field of imaging requires drastic adaptation to the rapid changes in our society, economy, environment, and the technological revolution; there is an urgent need to address and propose dynamic and innovative solutions to problems that tend to be either complex and static or rapidly evolving with a lot of unknowns. For instance, exploration of the engineering and physical principles of new imaging systems and techniques for medical applications, remote sensing, monitoring of space resources and enhanced awareness, exploration and management of natural resources, and environmental monitoring, are some of the areas that need to be addressed with urgency. Similarly, the development of efficient medical imaging techniques capable of providing physiological information at the molecular level is another important area of research. Advanced metabolic and functional imaging techniques, operating on multiple physical principles, using high resolution and high selectivity nanoimaging techniques, can play an important role in the diagnosis and treatment of cancer, as well as provide efficient drug-delivery imaging solutions for disease treatment with increased sensitivity and specificity. On the other hand, technical advances in the development of efficient digital imaging systems and techniques and tomographic devices operating on electric impedance tomography, computed tomography, single-photon emission and positron emission tomography detection principles are anticipated to have a significant impact on a
Simon, Stephane; Lumley, Philip; Tomson, Phillip; Pertot, Wilhelm-Joseph; Machtou, Pierre
2008-03-01
Crown down preparation is the most known and described technique since the introduction of Nickel Titanium (NiTi) rotary instruments in endodontics. This technique gives good results but has limitations, such as not addressing the initial anatomy of oval or dumb-bell shaped canals. The specific design of the Protaper instruments allows use of them with a different technique and, specifically, with a brushing motion in the body of the canal. The recent introduction of hand Protaper files has expanded the range of application of this system, especially in curved canals. The 'hybrid technique', using rotary and hand files, and the advantages of the combination of both instruments, are clearly described in this article. Used with this technique, the Protaper is a very safe system to use, and more controllable, for both inexperienced and experienced practitioners alike, than other systems. To understand the precautions needed with rotary files, and how to use them to preserve the anatomy of the canal and get a tapered shaping, even in severely curved canals.
House, J W
1993-06-01
This article reviews the evolution of the author's stapedectomy technique from total footplate removal with single loop wire prosthesis and Gelfoam seal to small fenestra stapedectomy with platinum ribbon piston prosthesis and blood seal. The author concludes that the microdrill is effective, safe, and cost effective for performing this procedure. Since using this technique, the author has had no cases of sensorineural hearing loss and few complaints of dizziness or vertigo.
Emerging optical nanoscopy techniques
Montgomery, Paul C; Leong-Hoi, Audrey
2015-01-01
To face the challenges of modern health care, new imaging techniques with subcellular resolution or detection over wide fields are required. Far field optical nanoscopy presents many new solutions, providing high resolution or detection at high speed. We present a new classification scheme to help appreciate the growing number of optical nanoscopy techniques. We underline an important distinction between superresolution techniques that provide improved resolving power and nanodetection techniques for characterizing unresolved nanostructures. Some of the emerging techniques within these two categories are highlighted with applications in biophysics and medicine. Recent techniques employing wider angle imaging by digital holography and scattering lens microscopy allow superresolution to be achieved for subcellular and even in vivo, imaging without labeling. Nanodetection techniques are divided into four subcategories using contrast, phase, deconvolution, and nanomarkers. Contrast enhancement is illustrated by means of a polarized light-based technique and with strobed phase-contrast microscopy to reveal nanostructures. Very high sensitivity phase measurement using interference microscopy is shown to provide nanometric surface roughness measurement or to reveal internal nanometric structures. Finally, the use of nanomarkers is illustrated with stochastic fluorescence microscopy for mapping intracellular structures. We also present some of the future perspectives of optical nanoscopy. PMID:26491270
NASA Astrophysics Data System (ADS)
Wieczorek, Piotr; Ligor, Magdalena; Buszewski, Bogusław
Electromigration techniques, including capillary electrophoresis (CE), are widely used for separation and identification of compounds present in food products. These techniques may also be considered as alternate and complementary with respect to commonly used analytical techniques, such as high-performance liquid chromatography (HPLC), or gas chromatography (GC). Applications of CE concern the determination of high-molecular compounds, like polyphenols, including flavonoids, pigments, vitamins, food additives (preservatives, antioxidants, sweeteners, artificial pigments) are presented. Also, the method developed for the determination of proteins and peptides composed of amino acids, which are basic components of food products, are studied. Other substances such as carbohydrates, nucleic acids, biogenic amines, natural toxins, and other contaminations including pesticides and antibiotics are discussed. The possibility of CE application in food control laboratories, where analysis of the composition of food and food products are conducted, is of great importance. CE technique may be used during the control of technological processes in the food industry and for the identification of numerous compounds present in food. Due to the numerous advantages of the CE technique it is successfully used in routine food analysis.
Quality Attribute Techniques Framework
NASA Astrophysics Data System (ADS)
Chiam, Yin Kia; Zhu, Liming; Staples, Mark
The quality of software is achieved during its development. Development teams use various techniques to investigate, evaluate and control potential quality problems in their systems. These “Quality Attribute Techniques” target specific product qualities such as safety or security. This paper proposes a framework to capture important characteristics of these techniques. The framework is intended to support process tailoring, by facilitating the selection of techniques for inclusion into process models that target specific product qualities. We use risk management as a theory to accommodate techniques for many product qualities and lifecycle phases. Safety techniques have motivated the framework, and safety and performance techniques have been used to evaluate the framework. The evaluation demonstrates the ability of quality risk management to cover the development lifecycle and to accommodate two different product qualities. We identify advantages and limitations of the framework, and discuss future research on the framework.
NASA Astrophysics Data System (ADS)
Jacobsen, Jerrold J.; Houston Jetzer, Kelly; Patani, Néha; Zimmerman, John; Zweerink, Gerald
1995-07-01
Significant attention is paid to the proper technique for reading a meniscus. Video shows meniscus-viewing techniques for colorless and dark liquids and the consequences of not reading a meniscus at eye level. Lessons are provided on approaching the end point, focusing on end point colors produced via different commonly used indicators. The concept of a titration curve is illustrated by means of a pH meter. Carefully recorded images of the entire range of meniscus values in a buret, pipet, and graduated cylinder are included so that you can show your students, in lecture or pre-lab discussion, any meniscus and discuss how to read the buret properly. These buret meniscus values are very carefully recorded at the rate of one video frame per hundredth of a milliliter, so that an image showing any given meniscus value can be obtained. These images can be easily incorporated into a computer-based multimedia environment for testing or meniscus-reading exercises. Two of the authors have used this technique and found the exercise to be very well received by their students. Video on side two shows nearly 100 "bloopers", demonstrating both the right way and wrong ways to do tasks associated with titration. This material can be used in a variety of situations: to show students the correct way to do something; to test students by asking them "What is this person doing wrong?"; or to develop multimedia, computer-based lessons. The contents of Titration Techniques are listed below: Side 1 Titration: what it is. A simple titration; Acid-base titration animation; A brief redox titration; Redox titration animation; A complete acid-base titration. Titration techniques. Hand technique variations; Stopcock; Using a buret to measure liquid volumes; Wait before reading meniscus; Dirty and clean burets; Read meniscus at eye level (see Fig. 1); Meniscus viewing techniques--light colored liquids; Meniscus viewing techniques--dark liquids; Using a magnetic stirrer; Rough titration
Electrical termination techniques
NASA Technical Reports Server (NTRS)
Oakey, W. E.; Schleicher, R. R.
1976-01-01
A technical review of high reliability electrical terminations for electronic equipment was made. Seven techniques were selected from this review for further investigation, experimental work, and preliminary testing. From the preliminary test results, four techniques were selected for final testing and evaluation. These four were: (1) induction soldering, (2) wire wrap, (3) percussive arc welding, and (4) resistance welding. Of these four, induction soldering was selected as the best technique in terms of minimizing operator errors, controlling temperature and time, minimizing joint contamination, and ultimately producing a reliable, uniform, and reusable electrical termination.
Simulation verification techniques study
NASA Technical Reports Server (NTRS)
Schoonmaker, P. B.; Wenglinski, T. H.
1975-01-01
Results are summarized of the simulation verification techniques study which consisted of two tasks: to develop techniques for simulator hardware checkout and to develop techniques for simulation performance verification (validation). The hardware verification task involved definition of simulation hardware (hardware units and integrated simulator configurations), survey of current hardware self-test techniques, and definition of hardware and software techniques for checkout of simulator subsystems. The performance verification task included definition of simulation performance parameters (and critical performance parameters), definition of methods for establishing standards of performance (sources of reference data or validation), and definition of methods for validating performance. Both major tasks included definition of verification software and assessment of verification data base impact. An annotated bibliography of all documents generated during this study is provided.
NASA Astrophysics Data System (ADS)
Evans, T. E.
2013-07-01
Large edge-localized mode (ELM) control techniques must be developed to help ensure the success of burning and ignited fusion plasma devices such as tokamaks and stellarators. In full performance ITER tokamak discharges, with QDT = 10, the energy released by a single ELM could reach ˜30 MJ which is expected to result in an energy density of 10-15 MJ/m2on the divertor targets. This will exceed the estimated divertor ablation limit by a factor of 20-30. A worldwide research program is underway to develop various types of ELM control techniques in preparation for ITER H-mode plasma operations. An overview of the ELM control techniques currently being developed is discussed along with the requirements for applying these techniques to plasmas in ITER. Particular emphasis is given to the primary approaches, pellet pacing and resonant magnetic perturbation fields, currently being considered for ITER.
Drilling technique for crystals
NASA Technical Reports Server (NTRS)
Hunter, T.; Miyagawa, I.
1977-01-01
Hole-drilling technique uses special crystal driller in which drill bit rotates at fixed position at speed of 30 rpm while crystal slowly advances toward drill. Technique has been successfully applied to crystal of Rochell salt, Triglycine sulfate, and N-acetyglycine. Technique limits heat buildup and reduces strain on crystal.
Ride quality research techniques: Section on general techniques
NASA Technical Reports Server (NTRS)
1977-01-01
Information is gathered about the methods currently used for the study of ride quality in a variety of transportation modes by a variety of research organizations, including universities, Federal agencies, contracting firms, and private industries. Detailed descriptions of these techniques and their strengths and weaknesses, and identifying the organizations using such methods are presented. The specific efforts of the Group's participants, as well as a variety of feasible approaches not currently in use, are presented as methodological alternatives under the three basic factors which must be considered in ride quality studies: research techniques, research environments, and choice of subjects.
The backcross sterility technique
V. C. Mastro; A. Pellegrini-Toole
1991-01-01
The sterile insect technique (SIT) and the induced inherited (F1) sterility technique have been investigated for a number of lepidopterous pests, including the gypsy moths. Another technique, backcross sterility, which could potentially prove as or more useful for control of pest species has been developed for the control of only one lepidopteran...
Techniques for characterizing lignin
Nicole M. Stark; Daniel J. Yelle; Umesh P. Agarwal
2016-01-01
Many techniques are available to characterize lignin. The techniques presented in this chapter are considered nondegradative, which are commonly applied to lignin. A brief discussion of lignin structure is included with this chapter to aid the reader in understanding why the discussed characterization techniques are appropriate for the study of lignin. Because the...
Separation techniques: Chromatography
Coskun, Ozlem
2016-01-01
Chromatography is an important biophysical technique that enables the separation, identification, and purification of the components of a mixture for qualitative and quantitative analysis. Proteins can be purified based on characteristics such as size and shape, total charge, hydrophobic groups present on the surface, and binding capacity with the stationary phase. Four separation techniques based on molecular characteristics and interaction type use mechanisms of ion exchange, surface adsorption, partition, and size exclusion. Other chromatography techniques are based on the stationary bed, including column, thin layer, and paper chromatography. Column chromatography is one of the most common methods of protein purification. PMID:28058406
Microalgae harvesting techniques: A review.
Singh, Gulab; Patidar, S K
2018-07-01
Microalgae with wide range of commercial applications have attracted a lot of attention of the researchers in the last few decades. However, microalgae utilization is not economically sustainable due to high cost of harvesting. A wide range of solid - liquid separation techniques are available for microalgae harvesting. The techniques include coagulation and flocculation, flotation, centrifugation and filtration or a combination of various techniques. Despite the importance of harvesting to the economics and energy balance, there is no universal harvesting technique for microalgae. Therefore, this review focuses on assessing technical, economical and application potential of various harvesting techniques so as to allow selection of an appropriate technology for cost effectively harvesting of microalgae from their culture medium. Various harvesting and concentrating techniques of microalgae were reviewed to suggest order of suitability of the techniques for four main microalgae applications i.e biofuel, human and animal food, high valued products, and water quality restoration. For deciding the order of suitability, a comparative analysis of various harvesting techniques based on the six common criterions (i.e biomass quality, cost, biomass quantity, processing time, species specific and toxicity) has been done. Based on the order of various techniques vis-a-vis various criteria and preferred order of criteria for various applications, order of suitability of harvesting techniques for various applications has been decided. Among various harvesting techniques, coagulation and flocculation, centrifugation and filtration were found to be most suitable for considered applications. These techniques may be used alone or in combination for increasing the harvesting efficiency. Copyright © 2018 Elsevier Ltd. All rights reserved.
UIAGM Ropehandling Techniques.
ERIC Educational Resources Information Center
Cloutier, K. Ross
The Union Internationale des Associations des Guides de Montagne's (UIAGM) rope handling techniques are intended to form the standard for guiding ropework worldwide. These techniques have become the legal standard for instructional institutions and commercial guiding organizations in UIAGM member countries: Austria, Canada, France, Germany, Great…
Ivezic, Nenad; Potok, Thomas E.
2003-09-30
A method for automatically evaluating a manufacturing technique comprises the steps of: receiving from a user manufacturing process step parameters characterizing a manufacturing process; accepting from the user a selection for an analysis of a particular lean manufacturing technique; automatically compiling process step data for each process step in the manufacturing process; automatically calculating process metrics from a summation of the compiled process step data for each process step; and, presenting the automatically calculated process metrics to the user. A method for evaluating a transition from a batch manufacturing technique to a lean manufacturing technique can comprise the steps of: collecting manufacturing process step characterization parameters; selecting a lean manufacturing technique for analysis; communicating the selected lean manufacturing technique and the manufacturing process step characterization parameters to an automatic manufacturing technique evaluation engine having a mathematical model for generating manufacturing technique evaluation data; and, using the lean manufacturing technique evaluation data to determine whether to transition from an existing manufacturing technique to the selected lean manufacturing technique.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansen, Anders T., E-mail: andehans@rm.dk; Lukacova, Slavka; Lassen-Ramshad, Yasmin
2015-01-01
When standard conformal x-ray technique for craniospinal irradiation is used, it is a challenge to achieve satisfactory dose coverage of the target including the area of the cribriform plate, while sparing organs at risk. We present a new intensity-modulated radiation therapy (IMRT), noncoplanar technique, for delivering irradiation to the cranial part and compare it with 3 other techniques and previously published results. A total of 13 patients who had previously received craniospinal irradiation with standard conformal x-ray technique were reviewed. New treatment plans were generated for each patient using the noncoplanar IMRT-based technique, a coplanar IMRT-based technique, and a coplanarmore » volumetric-modulated arch therapy (VMAT) technique. Dosimetry data for all patients were compared with the corresponding data from the conventional treatment plans. The new noncoplanar IMRT technique substantially reduced the mean dose to organs at risk compared with the standard radiation technique. The 2 other coplanar techniques also reduced the mean dose to some of the critical organs. However, this reduction was not as substantial as the reduction obtained by the noncoplanar technique. Furthermore, compared with the standard technique, the IMRT techniques reduced the total calculated radiation dose that was delivered to the normal tissue, whereas the VMAT technique increased this dose. Additionally, the coverage of the target was significantly improved by the noncoplanar IMRT technique. Compared with the standard technique, the coplanar IMRT and the VMAT technique did not improve the coverage of the target significantly. All the new planning techniques increased the number of monitor units (MU) used—the noncoplanar IMRT technique by 99%, the coplanar IMRT technique by 122%, and the VMAT technique by 26%—causing concern for leak radiation. The noncoplanar IMRT technique covered the target better and decreased doses to organs at risk compared with the other
Ferreira, Mayra Soares; Mangussi-Gomes, João; Ximendes, Roberta; Evangelista, Anne Rosso; Miranda, Eloá Lumi; Garcia, Leonardo Bomediano; Stamm, Aldo C
2018-01-01
Pharyngeal tonsil hyperplasia is the most frequent cause of nasal obstruction and chronic mouth breathing during childhood. Adenoidectomy is the procedure of choice for the resolution of these symptoms. It is not yet known, however, whether the conventional technique ("blind curettage") has been surpassed by more modern adenoidectomy techniques (video-assisted, with the aid of instruments). This study aimed to compare the conventional adenoidectomy technique with two other emerging techniques, performed in a reference otorhinolaryngology center. This is a prospective and observational study of 33 children submitted to adenoidectomy using 3 different techniques that were followed up for a period of 3 months after surgery. The patients were divided into 3 different groups, according to the adenoidectomy technique: Group A (conventional technique - "blind curettage"); Group B (video-assisted adenoidectomy with microdebrider); Group C (video-assisted adenoidectomy with radiofrequency - Coblation ® ). The surgical time of each procedure was measured, being considered from the moment of insertion of the mouth gag until complete hemostasis was achieved. The questionnaire for quality of life OSA-18 was applied to all caregivers on the day of the surgery and 30-90 days after the procedure. Postoperative complications were also analyzed. For the entire patient sample, there was an improvement in quality of life after the surgery (p < 0.05). When analyzing the evolution of OSA-18 index, all groups showed statistically significant improvement, for all assessed domains. There were no statistically significant differences between the 3 techniques assessed for quality of life improvement after the surgery (p > 0.05). Regarding the duration of the procedure, the conventional technique showed the shortest surgical time when compared to the others (p < 0.05). No postoperative complications were noted, for any patient. The adenoidectomy resulted in improvement of quality of
Lafora disease offers a unique window into neuronal glycogen metabolism.
Gentry, Matthew S; Guinovart, Joan J; Minassian, Berge A; Roach, Peter J; Serratosa, Jose M
2018-05-11
Lafora disease (LD) is a fatal, autosomal recessive, glycogen-storage disorder that manifests as severe epilepsy. LD results from mutations in the gene encoding either the glycogen phosphatase laforin or the E3 ubiquitin ligase malin. Individuals with LD develop cytoplasmic, aberrant glycogen inclusions in nearly all tissues that more closely resemble plant starch than human glycogen. This Minireview discusses the unique window into glycogen metabolism that LD research offers. It also highlights recent discoveries, including that glycogen contains covalently bound phosphate and that neurons synthesize glycogen and express both glycogen synthase and glycogen phosphorylase. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Toe of Ganges Chasma Landslide ( 8.0 S, 44.4W)
NASA Technical Reports Server (NTRS)
2001-01-01
This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows shear striations, dark dunes banked up against the toe of the slide and over-riding light-toned ripples and boulders on surface of slide. These features can be used to determine quantitative aspects of surface processes.Malin Space Science Systems and the California Institute of Technology built the MOC using spare hardware from the Mars Observer mission. MSSS operates the camera from its facilities in San Diego, CA. The Jet Propulsion Laboratory's Mars Surveyor Operations Project operates the Mars Global Surveyor spacecraft with its industrial partner, Lockheed Martin Astronautics, from facilities in Pasadena, CA and Denver, CO.Fog dispersion. [charged particle technique
NASA Technical Reports Server (NTRS)
Christensen, L. S.; Frost, W.
1980-01-01
The concept of using the charged particle technique to disperse warm fog at airports is investigated and compared with other techniques. The charged particle technique shows potential for warm fog dispersal, but experimental verification of several significant parameters, such as particle mobility and charge density, is needed. Seeding and helicopter downwash techniques are also effective for warm fog disperals, but presently are not believed to be viable techniques for routine airport operations. Thermal systems are currently used at a few overseas airports; however, they are expensive and pose potential environmental problems.
A novel side branch protection technique in coronary stent implantation: Jailed Corsair technique.
Numasawa, Yohei; Sakakura, Kenichi; Yamamoto, Kei; Yamamoto, Shingo; Taniguchi, Yousuke; Fujita, Hideo; Momomura, Shin-Ichi
2017-06-01
Side branch occlusion, which was one of the common complications in percutaneous coronary interventions, was closely associated with cardiac death and myocardial infarction. Clinical guidelines also support the importance of preservation of physiologic blood flow in SB during PCI to bifurcation lesions. In order to avoid side branch occlusion during stent implantation, we often performed the jailed wire technique, in which a conventional guide wire was inserted to the side branch before stent implantation to the main vessel. However, the jailed wire technique could not always prevent side branch occlusion. In this case report, we described a case of 72-year-old male suffering from angina pectoris. Coronary angiography revealed the diffuse calcified stenosis in the proximal and middle of left anterior descending coronary artery, and the large diagonal branch originated from the middle of the stenosis. To prevent side branch occlusion, we performed a novel side branch protection technique by using the Corsair microcatheter (Asahi Intecc, Nagoya, Japan). In this case report, we illustrated this "Jailed Corsair technique", and discussed the advantage compared to other side branch protection techniques such as the jailed balloon technique. Copyright © 2017 Elsevier Inc. All rights reserved.
Next generation initiation techniques
NASA Technical Reports Server (NTRS)
Warner, Tom; Derber, John; Zupanski, Milija; Cohn, Steve; Verlinde, Hans
1993-01-01
Four-dimensional data assimilation strategies can generally be classified as either current or next generation, depending upon whether they are used operationally or not. Current-generation data-assimilation techniques are those that are presently used routinely in operational-forecasting or research applications. They can be classified into the following categories: intermittent assimilation, Newtonian relaxation, and physical initialization. It should be noted that these techniques are the subject of continued research, and their improvement will parallel the development of next generation techniques described by the other speakers. Next generation assimilation techniques are those that are under development but are not yet used operationally. Most of these procedures are derived from control theory or variational methods and primarily represent continuous assimilation approaches, in which the data and model dynamics are 'fitted' to each other in an optimal way. Another 'next generation' category is the initialization of convective-scale models. Intermittent assimilation systems use an objective analysis to combine all observations within a time window that is centered on the analysis time. Continuous first-generation assimilation systems are usually based on the Newtonian-relaxation or 'nudging' techniques. Physical initialization procedures generally involve the use of standard or nonstandard data to force some physical process in the model during an assimilation period. Under the topic of next-generation assimilation techniques, variational approaches are currently being actively developed. Variational approaches seek to minimize a cost or penalty function which measures a model's fit to observations, background fields and other imposed constraints. Alternatively, the Kalman filter technique, which is also under investigation as a data assimilation procedure for numerical weather prediction, can yield acceptable initial conditions for mesoscale models. The
Reorganizing for Global War: General Malin Craig and the Triangular Infantry Division, 1935-1939
2014-05-22
reduced to a battalion and the signal battalion to a company. The assets that were formerly pooled in the square division’s sanitary trains were...BIBLIOGRAPHY “Arms Before Men,” Time. Army and Navy. August 22, 1938. Clay , Lieutenant Colonel (Ret.) Steven E. The Arms: Major Commands and Infantry
Mathematical Optimization Techniques
NASA Technical Reports Server (NTRS)
Bellman, R. (Editor)
1963-01-01
The papers collected in this volume were presented at the Symposium on Mathematical Optimization Techniques held in the Santa Monica Civic Auditorium, Santa Monica, California, on October 18-20, 1960. The objective of the symposium was to bring together, for the purpose of mutual education, mathematicians, scientists, and engineers interested in modern optimization techniques. Some 250 persons attended. The techniques discussed included recent developments in linear, integer, convex, and dynamic programming as well as the variational processes surrounding optimal guidance, flight trajectories, statistical decisions, structural configurations, and adaptive control systems. The symposium was sponsored jointly by the University of California, with assistance from the National Science Foundation, the Office of Naval Research, the National Aeronautics and Space Administration, and The RAND Corporation, through Air Force Project RAND.
A New Approach to an Old Technique-The S.U.T.R. First Technique.
Jones, Frank; Lewis, Catherine; Knight, Darryl; Bacon, Louise; Patel, Vijay; Moore, Carolyn
2018-04-01
Ventral and incisional hernias of the abdominal wall are common problems treated by surgeons around the globe. Incisional hernias are common postoperative complications of abdominal laparotomies with a reported incidence of up to 20 per cent. The increasing use of prosthetic mesh in open ventral hernia repairs necessitated the development of different operative techniques used in the repairs. It also required that surgeons become facile with placement of the mesh in different anatomical positions on the abdominal wall. One of the most common locations is placement of the mesh in the underlay position. Many surgeons who use the underlay technique have expressed significant concerns. Among these are fear of an inadvertent bowel injury while placing the mesh, poor visualization during mesh placement, and the inability to use the underlay technique for difficult hernias. We present a very useful, if not, novel technique of open hernia repair using mesh in the underlay position that helps to 1) prevent complications, 2) facilitate easier mesh fixation, 3) simplify open repair of atypical ventral hernias, and 4) reduce total operative time while still adhering to the important fundamental principles of a tension-free hernia repair. This technique as we describe it has been compared with the old parachute technique, but we think this is a significant improvement of that seldom used technique. We believe the use of this technique for the underlay position makes open ventral hernia repair safer, faster, and easier; however, our goal for this article is to describe the procedure in detail. In addition, we recently have started using this technique to fix the mesh when doing the retrorectus approach as well.
Volcano deformation--Geodetic monitoring techniques
Dzurisin, Daniel; Lu, Zhong
2007-01-01
This book describes the techniques used by volcanologists to successfully predict several recent volcanic eruptions by combining information from various scientific disciplines, including geodetic techniques. Many recent developments in the use of state-of-the-art and emerging techniques, including Global Positioning System and Synthetic Aperture Radar Interferometry, mean that most books on volcanology are out of date, and this book includes chapters devoted entirely to these two techniques.
Managerial Techniques in Educational Administration.
ERIC Educational Resources Information Center
Lane, John J.
1983-01-01
Management techniques developed during the past 20 years assume the rational bureaucratic model. School administration requires contingent techniques. Quality Circle, Theory Z, and the McKenzie 7-Framework are discussed as techniques to increase school productivity. (MD)
Seeburger, Joerg; Noack, Thilo; Winkfein, Michael; Ender, Joerg; Mohr, Friedrich Wilhelm
2010-01-01
The loop technique facilitates mitral valve repair for leaflet prolapse by implantation of Gore-Tex neo-chordae. The key feature of the technique is a premade bundle of four loops made out of one suture. The loops are available in different lengths ranging from 10 to 26 mm. After assessment of the ideal length of neo-chordae with a caliper the loops are then secured to the body of the papillary muscle over an additional felt pledget. In the following step, the free ends of the loops are distributed along the free margin of the prolapsing segment using one additional suture for each loop.
Kato, Hiroshi; Nakagawa, Kan-Ichi
2010-01-01
Core carrier techniques are unique among the various root canal filling techniques for delivering and compacting gutta-percha in the prepared root canal system. Thermafil (TF), considered the major core carrier device, is provided as an obturator consisting of a master core coated with thermoplasticized gutta-percha. We have devised a thermoplasticized gutta-percha filling technique using a polypropylene core, FlexPoint® NEO (FP), which was developed as a canal filling material that can be sterilized in an autoclave. Therefore, FP can be coated onto thermoplasticized gutta-percha and inserted into the prepared canal as a core carrier. The FP core carrier technique offers many advantages over the TF system: the core can be tested in the root canal and verified radiographically; the core can be adjusted to fit and surplus material easily removed; furthermore the core can be easily removed for retreatment. The clinical procedure of the FP core carrier technique is simple, and similar that with the TF system. Thermoplasticized gutta-percha in a syringe is heated in an oven and extruded onto the FP core carrier after a trial insertion. The FP core carrier is inserted into the root canal to the working length. Excess FP is then removed with a red-hot plastic instrument at the orifice of the root canal. The FP core carrier technique incorporates the clinical advantages of the existing TF system while minimizing the disadvantages. Hence the FP core carrier technique is very useful in clinical practice. This paper describes the FP core carrier technique as a new core based method.
NASA Technical Reports Server (NTRS)
1972-01-01
Developments by the aerospace industry in seals and sealing techniques are announced for possible use in other areas. The announcements presented are grouped as: sealing techniques for cryogenic fluids, high pressure applications, and modification for improved performance.
DCT-based cyber defense techniques
NASA Astrophysics Data System (ADS)
Amsalem, Yaron; Puzanov, Anton; Bedinerman, Anton; Kutcher, Maxim; Hadar, Ofer
2015-09-01
With the increasing popularity of video streaming services and multimedia sharing via social networks, there is a need to protect the multimedia from malicious use. An attacker may use steganography and watermarking techniques to embed malicious content, in order to attack the end user. Most of the attack algorithms are robust to basic image processing techniques such as filtering, compression, noise addition, etc. Hence, in this article two novel, real-time, defense techniques are proposed: Smart threshold and anomaly correction. Both techniques operate at the DCT domain, and are applicable for JPEG images and H.264 I-Frames. The defense performance was evaluated against a highly robust attack, and the perceptual quality degradation was measured by the well-known PSNR and SSIM quality assessment metrics. A set of defense techniques is suggested for improving the defense efficiency. For the most aggressive attack configuration, the combination of all the defense techniques results in 80% protection against cyber-attacks with PSNR of 25.74 db.
Review of advanced imaging techniques
Chen, Yu; Liang, Chia-Pin; Liu, Yang; Fischer, Andrew H.; Parwani, Anil V.; Pantanowitz, Liron
2012-01-01
Pathology informatics encompasses digital imaging and related applications. Several specialized microscopy techniques have emerged which permit the acquisition of digital images (“optical biopsies”) at high resolution. Coupled with fiber-optic and micro-optic components, some of these imaging techniques (e.g., optical coherence tomography) are now integrated with a wide range of imaging devices such as endoscopes, laparoscopes, catheters, and needles that enable imaging inside the body. These advanced imaging modalities have exciting diagnostic potential and introduce new opportunities in pathology. Therefore, it is important that pathology informaticists understand these advanced imaging techniques and the impact they have on pathology. This paper reviews several recently developed microscopic techniques, including diffraction-limited methods (e.g., confocal microscopy, 2-photon microscopy, 4Pi microscopy, and spatially modulated illumination microscopy) and subdiffraction techniques (e.g., photoactivated localization microscopy, stochastic optical reconstruction microscopy, and stimulated emission depletion microscopy). This article serves as a primer for pathology informaticists, highlighting the fundamentals and applications of advanced optical imaging techniques. PMID:22754737
Sensorimotor System Measurement Techniques
Riemann, Bryan L.; Myers, Joseph B.; Lephart, Scott M.
2002-01-01
Objective: To provide an overview of currently available sensorimotor assessment techniques. Data Sources: We drew information from an extensive review of the scientific literature conducted in the areas of proprioception, neuromuscular control, and motor control measurement. Literature searches were conducted using MEDLINE for the years 1965 to 1999 with the key words proprioception, somatosensory evoked potentials, nerve conduction testing, electromyography, muscle dynamometry, isometric, isokinetic, kinetic, kinematic, posture, equilibrium, balance, stiffness, neuromuscular, sensorimotor, and measurement. Additional sources were collected using the reference lists of identified articles. Data Synthesis: Sensorimotor measurement techniques are discussed with reference to the underlying physiologic mechanisms, influential factors and locations of the variable within the system, clinical research questions, limitations of the measurement technique, and directions for future research. Conclusions/Recommendations: The complex interactions and relationships among the individual components of the sensorimotor system make measuring and analyzing specific characteristics and functions difficult. Additionally, the specific assessment techniques used to measure a variable can influence attained results. Optimizing the application of sensorimotor research to clinical settings can, therefore, be best accomplished through the use of common nomenclature to describe underlying physiologic mechanisms and specific measurement techniques. PMID:16558672
NASA Astrophysics Data System (ADS)
Lukman, Iing; Ibrahim, Noor A.; Daud, Isa B.; Maarof, Fauziah; Hassan, Mohd N.
2002-03-01
Survival analysis algorithm is often applied in the data mining process. Cox regression is one of the survival analysis tools that has been used in many areas, and it can be used to analyze the failure times of aircraft crashed. Another survival analysis tool is the competing risks where we have more than one cause of failure acting simultaneously. Lunn-McNeil analyzed the competing risks in the survival model using Cox regression with censored data. The modified Lunn-McNeil technique is a simplify of the Lunn-McNeil technique. The Kalbfleisch-Prentice technique is involving fitting models separately from each type of failure, treating other failure types as censored. To compare the two techniques, (the modified Lunn-McNeil and Kalbfleisch-Prentice) a simulation study was performed. Samples with various sizes and censoring percentages were generated and fitted using both techniques. The study was conducted by comparing the inference of models, using Root Mean Square Error (RMSE), the power tests, and the Schoenfeld residual analysis. The power tests in this study were likelihood ratio test, Rao-score test, and Wald statistics. The Schoenfeld residual analysis was conducted to check the proportionality of the model through its covariates. The estimated parameters were computed for the cause-specific hazard situation. Results showed that the modified Lunn-McNeil technique was better than the Kalbfleisch-Prentice technique based on the RMSE measurement and Schoenfeld residual analysis. However, the Kalbfleisch-Prentice technique was better than the modified Lunn-McNeil technique based on power tests measurement.
NASA Astrophysics Data System (ADS)
Schodl, R.
The development of the laser two focus velocimetry are reviewed. The fundamentals of this nonintrusive fluid flow velocity measurement technique are described. Emphasis is placed upon the advances of this technique. Results of measurements in a very small flow channel and in a small turbocharger compressor rotor are presented. The influence of beam diameter - beam separation ratio on the measuring accuracy and on the measuring time is treated. A multicolor two dimensional system with selectable beam separation is presented. The laser Doppler and the laser two focus techniques are compared.
Island custom blocking technique
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carabetta, R.J.
The technique of Island blocking is being used more frequently since the advent of our new head and neck blocking techniques and the implementation of a newly devised lung protocol. The system presented affords the mould room personnel a quick and accurate means of island block fabrication without the constant remeasuring or subtle shifting to approximate correct placement. The cookie cutter is easily implemented into any department's existing block cutting techniques. The device is easily and inexpensively made either in a machine shop or acquired by contacting the author.
The radiocarbon hydroxyl technique
NASA Technical Reports Server (NTRS)
Campbell, Malcolm J.; Sheppard, John C.
1994-01-01
The Radiocarbon Technique depends upon measuring the rate of oxidation of CO in an essentially unperturbed sample of air. The airborne technique is slightly different. Hydroxyl concentrations can be calculated directly; peroxyl concentrations can be obtained by NO doping.
Photogrammetric techniques for aerospace applications
NASA Astrophysics Data System (ADS)
Liu, Tianshu; Burner, Alpheus W.; Jones, Thomas W.; Barrows, Danny A.
2012-10-01
Photogrammetric techniques have been used for measuring the important physical quantities in both ground and flight testing including aeroelastic deformation, attitude, position, shape and dynamics of objects such as wind tunnel models, flight vehicles, rotating blades and large space structures. The distinct advantage of photogrammetric measurement is that it is a non-contact, global measurement technique. Although the general principles of photogrammetry are well known particularly in topographic and aerial survey, photogrammetric techniques require special adaptation for aerospace applications. This review provides a comprehensive and systematic summary of photogrammetric techniques for aerospace applications based on diverse sources. It is useful mainly for aerospace engineers who want to use photogrammetric techniques, but it also gives a general introduction for photogrammetrists and computer vision scientists to new applications.
EDITORIAL: Imaging systems and techniques Imaging systems and techniques
NASA Astrophysics Data System (ADS)
Yang, Wuqiang; Giakos, George; Nikita, Konstantina; Pastorino, Matteo; Karras, Dimitrios
2009-10-01
The papers in this special issue focus on providing the state-of-the-art approaches and solutions to some of the most challenging imaging areas, such as the design, development, evaluation and applications of imaging systems, measuring techniques, image processing algorithms and instrumentation, with an ultimate aim of enhancing the measurement accuracy and image quality. This special issue explores the principles, engineering developments and applications of new imaging systems and techniques, and encourages broad discussion of imaging methodologies, shaping the future and identifying emerging trends. The multi-faceted field of imaging requires drastic adaptation to the rapid changes in our society, economy, environment and technological evolution. There is an urgent need to address new problems, which tend to be either static but complex, or dynamic, e.g. rapidly evolving with time, with many unknowns, and to propose innovative solutions. For instance, the battles against cancer and terror, monitoring of space resources and enhanced awareness, management of natural resources and environmental monitoring are some of the areas that need to be addressed. The complexity of the involved imaging scenarios and demanding design parameters, e.g. speed, signal-to-noise ratio (SNR), specificity, contrast, spatial resolution, scatter rejection, complex background and harsh environments, necessitate the development of a multi-functional, scalable and efficient imaging suite of sensors, solutions driven by innovation, and operation on diverse detection and imaging principles. Efficient medical imaging techniques capable of providing physiological information at the molecular level present another important research area. Advanced metabolic and functional imaging techniques, operating on multiple physical principles, and using high-resolution, high-selectivity nano-imaging methods, quantum dots, nanoparticles, biomarkers, nanostructures, nanosensors, micro-array imaging chips
21 CFR 820.250 - Statistical techniques.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Statistical techniques. 820.250 Section 820.250...) MEDICAL DEVICES QUALITY SYSTEM REGULATION Statistical Techniques § 820.250 Statistical techniques. (a... statistical techniques required for establishing, controlling, and verifying the acceptability of process...
21 CFR 820.250 - Statistical techniques.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Statistical techniques. 820.250 Section 820.250...) MEDICAL DEVICES QUALITY SYSTEM REGULATION Statistical Techniques § 820.250 Statistical techniques. (a... statistical techniques required for establishing, controlling, and verifying the acceptability of process...
EDITORIAL: Measurement techniques for multiphase flows Measurement techniques for multiphase flows
NASA Astrophysics Data System (ADS)
Okamoto, Koji; Murai, Yuichi
2009-11-01
Research on multiphase flows is very important for industrial applications, including power stations, vehicles, engines, food processing and so on. Multiphase flows originally have nonlinear features because of multiphase systems. The interaction between the phases plays a very interesting role in the flows. The nonlinear interaction causes the multiphase flows to be very complicated. Therefore techniques for measuring multiphase flows are very useful in helping to understand the nonlinear phenomena. The state-of-the-art measurement techniques were presented and discussed at the sixth International Symposium on Measurement Techniques for Multiphase Flows (ISMTMF2008) held in Okinawa, Japan, on 15-17 December 2008. This special feature of Measurement Science and Technology includes selected papers from ISMTMF2008. Okinawa has a long history as the Ryukyus Kingdom. China, Japan and many western Pacific countries have had cultural and economic exchanges through Okinawa for over 1000 years. Much technical and scientific information was exchanged at the symposium in Okinawa. The proceedings of ISMTMF2008 apart from these special featured papers were published in Journal of Physics: Conference Series vol. 147 (2009). We would like to express special thanks to all the contributors to the symposium and this special feature. This special feature will be a milestone in measurement techniques for multiphase flows.
Stöggl, Thomas; Müller, Erich; Lindinger, Stefan
2008-09-01
The aims of the study were to: (1) adapt the "double-push" technique from inline skating to cross-country skiing; (2) compare this new skiing technique with the conventional skate skiing cross-country technique; and (3) test the hypothesis that the double-push technique improves skiing speed in a short sprint. 13 elite skiers performed maximum-speed sprints over 100 m using the double-push skate skiing technique and using the conventional "V2" skate skiing technique. Pole and plantar forces, knee angle, cycle characteristics, and electromyography of nine lower body muscles were analysed. We found that the double-push technique could be successfully transferred to cross-country skiing, and that this new technique is faster than the conventional skate skiing technique. The double-push technique was 2.9 +/- 2.2% faster (P < 0.001), which corresponds to a time advantage of 0.41 +/- 0.31 s over 100 m. The double-push technique had a longer cycle length and a lower cycle rate, and it was characterized by higher muscle activity, higher knee extension amplitudes and velocities, and higher peak foot forces, especially in the first phase of the push-off. Also, the foot was more loaded laterally in the double-push technique than in the conventional skate skiing technique.
Nondestructive testing techniques
NASA Astrophysics Data System (ADS)
Bray, Don E.; McBride, Don
A comprehensive reference covering a broad range of techniques in nondestructive testing is presented. Based on years of extensive research and application at NASA and other government research facilities, the book provides practical guidelines for selecting the appropriate testing methods and equipment. Topics discussed include visual inspection, penetrant and chemical testing, nuclear radiation, sonic and ultrasonic, thermal and microwave, magnetic and electromagnetic techniques, and training and human factors. (No individual items are abstracted in this volume)
Fabrication of fixed implant prostheses using function bite impression technique (FBI technique).
Suzuki, Yasunori; Shimpo, Hidemasa; Ohkubo, Chikahiro; Kurtz, Kenneth S
2012-10-01
The patient was partially edentulous, lacking both the first mandibular molars. The FBI and the conventional impression technique were used for the fabrication of implant-fixed prosthesis replacing the right and left molars, respectively. In the FBI technique, the definitive impression was made under occlusal force and functionally generated path (FGP) recording at the same time. The right and left occlusal contact areas were compared after completing the implant-fixed prosthesis rehabilitation. It has been suggested that accuracy of the impression and maxillomandibular registration is necessary to ensure a satisfactory long-term clinical outcome. The transfer of the exact position of the implants to the working cast is even more important because implants lack the mobility of natural teeth. There are displacement differences between implants and natural teeth under occlusal force. The FBI technique may compensate for this difference in accuracy. Using the FBI technique, a precise prosthesis could be produced by completing simultaneously the maxillomandibular registration, impression and FGP. Copyright © 2012 Japan Prosthodontic Society. All rights reserved.
Laser Doppler measurement techniques for spacecraft
NASA Technical Reports Server (NTRS)
Kinman, Peter W.; Gagliardi, Robert M.
1986-01-01
Two techniques are proposed for using laser links to measure the relative radial velocity of two spacecraft. The first technique determines the relative radial velocity from a measurement of the two-way Doppler shift on a transponded radio-frequency subcarrier. The subcarrier intensity-modulates reciprocating laser beams. The second technique determines the relative radial velocity from a measurement of the two-way Doppler shift on an optical frequency carrier which is transponded between spacecraft using optical Costas loops. The first technique might be used in conjunction with noncoherent optical communications, while the second technique is compatible with coherent optical communications. The first technique simultaneously exploits the diffraction advantage of laser beams and the maturity of radio-frequency phase-locked loop technology. The second technique exploits both the diffraction advantage of laser beams and the large Doppler effect at optical frequencies. The second technique has the potential for greater accuracy; unfortunately, it is more difficult to implement since it involves optical Costas loops.
Interactive algebraic grid-generation technique
NASA Technical Reports Server (NTRS)
Smith, R. E.; Wiese, M. R.
1986-01-01
An algebraic grid generation technique and use of an associated interactive computer program are described. The technique, called the two boundary technique, is based on Hermite cubic interpolation between two fixed, nonintersecting boundaries. The boundaries are referred to as the bottom and top, and they are defined by two ordered sets of points. Left and right side boundaries which intersect the bottom and top boundaries may also be specified by two ordered sets of points. when side boundaries are specified, linear blending functions are used to conform interior interpolation to the side boundaries. Spacing between physical grid coordinates is determined as a function of boundary data and uniformly space computational coordinates. Control functions relating computational coordinates to parametric intermediate variables that affect the distance between grid points are embedded in the interpolation formulas. A versatile control function technique with smooth-cubic-spline functions is presented. The technique works best in an interactive graphics environment where computational displays and user responses are quickly exchanged. An interactive computer program based on the technique and called TBGG (two boundary grid generation) is also described.
Presentation-Oriented Visualization Techniques.
Kosara, Robert
2016-01-01
Data visualization research focuses on data exploration and analysis, yet the vast majority of visualizations people see were created for a different purpose: presentation. Whether we are talking about charts showing data to help make a presenter's point, data visuals created to accompany a news story, or the ubiquitous infographics, many more people consume charts than make them. Traditional visualization techniques treat presentation as an afterthought, but are there techniques uniquely suited to data presentation but not necessarily ideal for exploration and analysis? This article focuses on presentation-oriented techniques, considering their usefulness for presentation first and any other purposes as secondary.
Ethical Use of Gestalt Techniques.
ERIC Educational Resources Information Center
Given, Jane A.
The purpose of this paper is to engender a healthy respect for Gestalt theory and techniques and the use of the techniques in the client's best interest and in the interest of positive professional and self-development in the practitioner. An overview of Gestalt techniques is provided, concentrating on the two category divisions of experiments and…
1989-03-17
along line. As is evident, input resistance of parabolic line differs from input resistance of usual uniform forming line only by presence of term - 1...i.e., the same problem, which stands also before pulse technique in usual understanding of this term , i.e., before microsecond pulse technique...frequencies occurs inequality i,<Lw. Therefore it is possible to record DOC - 88076701 PAGE 17 I L.-Vi=zsV(L,+L.)C z -/L-C (j+ 2Law or, using expression (1.4
Anatomic partial nephrectomy: technique evolution.
Azhar, Raed A; Metcalfe, Charles; Gill, Inderbir S
2015-03-01
Partial nephrectomy provides equivalent long-term oncologic and superior functional outcomes as radical nephrectomy for T1a renal masses. Herein, we review the various vascular clamping techniques employed during minimally invasive partial nephrectomy, describe the evolution of our partial nephrectomy technique and provide an update on contemporary thinking about the impact of ischemia on renal function. Recently, partial nephrectomy surgical technique has shifted away from main artery clamping and towards minimizing/eliminating global renal ischemia during partial nephrectomy. Supported by high-fidelity three-dimensional imaging, novel anatomic-based partial nephrectomy techniques have recently been developed, wherein partial nephrectomy can now be performed with segmental, minimal or zero global ischemia to the renal remnant. Sequential innovations have included early unclamping, segmental clamping, super-selective clamping and now culminating in anatomic zero-ischemia surgery. By eliminating 'under-the-gun' time pressure of ischemia for the surgeon, these techniques allow an unhurried, tightly contoured tumour excision with point-specific sutured haemostasis. Recent data indicate that zero-ischemia partial nephrectomy may provide better functional outcomes by minimizing/eliminating global ischemia and preserving greater vascularized kidney volume. Contemporary partial nephrectomy includes a spectrum of surgical techniques ranging from conventional-clamped to novel zero-ischemia approaches. Technique selection should be tailored to each individual case on the basis of tumour characteristics, surgical feasibility, surgeon experience, patient demographics and baseline renal function.
TECHNIQUES FOR EFFECTIVE TEACHING.
ERIC Educational Resources Information Center
HASTINGS, GERALDINE; AND OTHERS
A COMPENDIUM OF WORKABLE AND REASONABLE TECHNIQUES TO PROVIDE TEACHERS WITH ALTERNATIVES IN SELECTING LEARNING EXPERIENCES IS PRESENTED. MATERIALS ARE DESIGNED TO AID TEACHERS AND LEARNERS IN ALL SUBJECT MATTER AREAS. TEACHING TECHNIQUES DESCRIBED ARE (1) THE CASE STUDY, (2) DISCUSSIONS SUCH AS SYMPOSIUM, COLLOQUIUM, BUZZ SESSIONS, AND…
Techniques for Teachers Section
ERIC Educational Resources Information Center
Tait, A., Ed.
1973-01-01
Includes a simple technique to demonstrate Millikan's oil drop experiment, an environmental studies experiment to measure dissolved oxygen in water samples, and a technique to demonstrate action-reaction. Science materials described are the Pol-A-Star Tomiscope, Nuffield chemistry film loops, air pucks and pH meters. (JR)
Active cleaning technique device
NASA Technical Reports Server (NTRS)
Shannon, R. L.; Gillette, R. B.
1973-01-01
The objective of this program was to develop a laboratory demonstration model of an active cleaning technique (ACT) device. The principle of this device is based primarily on the technique for removing contaminants from optical surfaces. This active cleaning technique involves exposing contaminated surfaces to a plasma containing atomic oxygen or combinations of other reactive gases. The ACT device laboratory demonstration model incorporates, in addition to plasma cleaning, the means to operate the device as an ion source for sputtering experiments. The overall ACT device includes a plasma generation tube, an ion accelerator, a gas supply system, a RF power supply and a high voltage dc power supply.
van Til, Janine; Groothuis-Oudshoorn, Catharina; Lieferink, Marijke; Dolan, James; Goetghebeur, Mireille
2014-01-01
There is an increased interest in the use of multi-criteria decision analysis (MCDA) to support regulatory and reimbursement decision making. The EVIDEM framework was developed to provide pragmatic multi-criteria decision support in health care, to estimate the value of healthcare interventions, and to aid in priority-setting. The objectives of this study were to test 1) the influence of different weighting techniques on the overall outcome of an MCDA exercise, 2) the discriminative power in weighting different criteria of such techniques, and 3) whether different techniques result in similar weights in weighting the criteria set proposed by the EVIDEM framework. A sample of 60 Dutch and Canadian students participated in the study. Each student used an online survey to provide weights for 14 criteria with two different techniques: a five-point rating scale and one of the following techniques selected randomly: ranking, point allocation, pairwise comparison and best worst scaling. The results of this study indicate that there is no effect of differences in weights on value estimates at the group level. On an individual level, considerable differences in criteria weights and rank order occur as a result of the weight elicitation method used, and the ability of different techniques to discriminate in criteria importance. Of the five techniques tested, the pair-wise comparison of criteria has the highest ability to discriminate in weights when fourteen criteria are compared. When weights are intended to support group decisions, the choice of elicitation technique has negligible impact on criteria weights and the overall value of an innovation. However, when weights are used to support individual decisions, the choice of elicitation technique influences outcome and studies that use dissimilar techniques cannot be easily compared. Weight elicitation through pairwise comparison of criteria is preferred when taking into account its superior ability to discriminate between
Remote Leak Detection: Indirect Thermal Technique
NASA Technical Reports Server (NTRS)
Clements, Sandra
2002-01-01
Remote sensing technologies are being considered for efficient, low cost gas leak detection. Eleven specific techniques have been identified for further study and evaluation of several of these is underway. The Indirect Thermal Technique is one of the techniques that is being explored. For this technique, an infrared camera is used to detect the temperature change of a pipe or fitting at the site of a gas leak. This temperature change is caused by the change in temperature of the gas expanding from the leak site. During the 10-week NFFP program, the theory behind the technique was further developed, experiments were performed to determine the conditions for which the technique might be viable, and a proof-of-concept system was developed and tested in the laboratory.
Two sampling techniques for game meat.
van der Merwe, Maretha; Jooste, Piet J; Hoffman, Louw C; Calitz, Frikkie J
2013-03-20
A study was conducted to compare the excision sampling technique used by the export market and the sampling technique preferred by European countries, namely the biotrace cattle and swine test. The measuring unit for the excision sampling was grams (g) and square centimetres (cm2) for the swabbing technique. The two techniques were compared after a pilot test was conducted on spiked approved beef carcasses (n = 12) that statistically proved the two measuring units correlated. The two sampling techniques were conducted on the same game carcasses (n = 13) and analyses performed for aerobic plate count (APC), Escherichia coli and Staphylococcus aureus, for both techniques. A more representative result was obtained by swabbing and no damage was caused to the carcass. Conversely, the excision technique yielded fewer organisms and caused minor damage to the carcass. The recovery ratio from the sampling technique improved 5.4 times for APC, 108.0 times for E. coli and 3.4 times for S. aureus over the results obtained from the excision technique. It was concluded that the sampling methods of excision and swabbing can be used to obtain bacterial profiles from both export and local carcasses and could be used to indicate whether game carcasses intended for the local market are possibly on par with game carcasses intended for the export market and therefore safe for human consumption.
Vascular corrosion casting technique steps.
Verli, Flaviana Dornela; Rossi-Schneider, Tissiana Raquel; Schneider, Felipe Luís; Yurgel, Liliane Soares; de Souza, Maria Antonieta Lopes
2007-01-01
The vascular corrosion casting technique produces a replica of vascular beds of normal or pathological tissues. Once associated with scanning electron microscopy (SEM), this technique provides details of the three-dimensional anatomic arrangement of the vascular replica, which is the main advantage of this method. The present study is intended to describe the steps of the vascular corrosion casting technique and the different ways to perform them. them.
Hyphenated analytical techniques for materials characterisation
NASA Astrophysics Data System (ADS)
Armstrong, Gordon; Kailas, Lekshmi
2017-09-01
This topical review will provide a survey of the current state of the art in ‘hyphenated’ techniques for characterisation of bulk materials, surface, and interfaces, whereby two or more analytical methods investigating different properties are applied simultaneously to the same sample to better characterise the sample than can be achieved by conducting separate analyses in series using different instruments. It is intended for final year undergraduates and recent graduates, who may have some background knowledge of standard analytical techniques, but are not familiar with ‘hyphenated’ techniques or hybrid instrumentation. The review will begin by defining ‘complementary’, ‘hybrid’ and ‘hyphenated’ techniques, as there is not a broad consensus among analytical scientists as to what each term means. The motivating factors driving increased development of hyphenated analytical methods will also be discussed. This introduction will conclude with a brief discussion of gas chromatography-mass spectroscopy and energy dispersive x-ray analysis in electron microscopy as two examples, in the context that combining complementary techniques for chemical analysis were among the earliest examples of hyphenated characterisation methods. The emphasis of the main review will be on techniques which are sufficiently well-established that the instrumentation is commercially available, to examine physical properties including physical, mechanical, electrical and thermal, in addition to variations in composition, rather than methods solely to identify and quantify chemical species. Therefore, the proposed topical review will address three broad categories of techniques that the reader may expect to encounter in a well-equipped materials characterisation laboratory: microscopy based techniques, scanning probe-based techniques, and thermal analysis based techniques. Examples drawn from recent literature, and a concluding case study, will be used to explain the
Programing techniques for CDC equipment
NASA Technical Reports Server (NTRS)
Newsom, J. R.; Tiffany, S. H.
1979-01-01
Five techniques reduce core requirements for fast batch turnaround time and interactive-terminal capability. Same techniques increase program versatility, decrease problem-configuration dependence, and facilitate interprogram communication.
The Use of Expressive Techniques in Counseling
ERIC Educational Resources Information Center
Bradley, Loretta J.; Whiting, Peggy; Hendricks, Bret; Parr, Gerald; Jones, Eugene Gordon, Jr.
2008-01-01
This manuscript explores and identifies the use of expressive techniques in counseling. Although verbal techniques are important, sometimes the best of verbal techniques are not sufficient. Creative, expressive techniques can add a new, important dimension to counseling. Such expressive techniques as cinema, art, and music are described to help…
Microscopy techniques in flavivirus research.
Chong, Mun Keat; Chua, Anthony Jin Shun; Tan, Terence Tze Tong; Tan, Suat Hoon; Ng, Mah Lee
2014-04-01
The Flavivirus genus is composed of many medically important viruses that cause high morbidity and mortality, which include Dengue and West Nile viruses. Various molecular and biochemical techniques have been developed in the endeavour to study flaviviruses. However, microscopy techniques still have irreplaceable roles in the identification of novel virus pathogens and characterization of morphological changes in virus-infected cells. Fluorescence microscopy contributes greatly in understanding the fundamental viral protein localizations and virus-host protein interactions during infection. Electron microscopy remains the gold standard for visualizing ultra-structural features of virus particles and infected cells. New imaging techniques and combinatory applications are continuously being developed to push the limit of resolution and extract more quantitative data. Currently, correlative live cell imaging and high resolution three-dimensional imaging have already been achieved through the tandem use of optical and electron microscopy in analyzing biological specimens. Microscopy techniques are also used to measure protein binding affinities and determine the mobility pattern of proteins in cells. This chapter will consolidate on the applications of various well-established microscopy techniques in flavivirus research, and discuss how recently developed microscopy techniques can potentially help advance our understanding in these membrane viruses. Copyright © 2013 Elsevier Ltd. All rights reserved.
A Comparative of business process modelling techniques
NASA Astrophysics Data System (ADS)
Tangkawarow, I. R. H. T.; Waworuntu, J.
2016-04-01
In this era, there is a lot of business process modeling techniques. This article is the research about differences of business process modeling techniques. For each technique will explain about the definition and the structure. This paper presents a comparative analysis of some popular business process modelling techniques. The comparative framework is based on 2 criteria: notation and how it works when implemented in Somerleyton Animal Park. Each technique will end with the advantages and disadvantages. The final conclusion will give recommend of business process modeling techniques that easy to use and serve the basis for evaluating further modelling techniques.
Wanlass, Paul W; Sikorski, David M; Kizhakkeveettil, Anupama; Tobias, Gene S
2018-03-12
To assess students' opinions of the potential influence of taking elective courses in chiropractic techniques and their future practice preferences. An anonymous, voluntary survey was conducted among graduating students from a doctor of chiropractic program. The survey included questions regarding the chiropractic technique elective courses they had completed and the potential influence of these courses on their chiropractic technique choices in future practice. Surveys were pretested for face validity, and data were analyzed using descriptive and inferential statistics. Of the 56 surveys distributed, 46 were completed, for a response rate of 82%. More than half of the students reported having taken at least 1 elective course in diversified technique (80%), Cox technique (76%), Activator Methods (70%), or sacro-occipital technique (63%). Less than half of the respondents reported taking technique elective courses in Gonstead or Thompson techniques. More than half of the students stated they were more likely to use Activator (72%), Thompson (68%), diversified (57%), or Cox (54%) techniques in their future practice after taking an elective course in that technique. Females stated that they were more likely to use Activator Methods ( p = .006) in future practice. Chiropractic technique elective courses in the doctor of chiropractic curriculum may influence students' choices of future practice chiropractic technique.
Radio techniques for probing the terrestrial ionosphere.
NASA Astrophysics Data System (ADS)
Hunsucker, R. D.
The subject of the book is a description of the basic principles of operation, plus the capabilities and limitations of all generic radio techniques employed to investigate the terrestrial ionosphere. The purpose of this book is to present to the reader a balanced treatment of each technique so they can understand how to interpret ionospheric data and decide which techniques are most effective for studying specific phenomena. The first two chapters outline the basic theory underlying the techniques, and each following chapter discusses a separate technique. This monograph is entirely devoted to techniques in aeronomy and space physics. The approach is unique in its presentation of the principles, capabilities and limitations of the most important presently used radio techniques. Typical examples of data are shown for the various techniques, and a brief historical account of the technique development is presented. An extended annotated bibliography of the salient papers in the field is included.
Landing Techniques in Beach Volleyball
Tilp, Markus; Rindler, Michael
2013-01-01
The aims of the present study were to establish a detailed and representative record of landing techniques (two-, left-, and right-footed landings) in professional beach volleyball and compare the data with those of indoor volleyball. Beach volleyball data was retrieved from videos taken at FIVB World Tour tournaments. Landing techniques were compared in the different beach and indoor volleyball skills serve, set, attack, and block with regard to sex, playing technique, and court position. Significant differences were observed between men and women in landings following block actions (χ2(2) = 18.19, p < 0.01) but not following serve, set, and attack actions. Following blocking, men landed more often on one foot than women. Further differences in landings following serve and attack with regard to playing technique and position were mainly observed in men. The comparison with landing techniques in indoor volleyball revealed overall differences both in men (χ2(2) = 161.4, p < 0.01) and women (χ2(2) = 84.91, p < 0.01). Beach volleyball players land more often on both feet than indoor volleyball players. Besides the softer surface in beach volleyball, and therefore resulting lower loads, these results might be another reason for fewer injuries and overuse conditions compared to indoor volleyball. Key Points About 1/3 of all jumping actions in beach volleyball result in a landing on one foot. Especially following block situations men land on one foot more often than women. Landing techniques are related to different techniques and positions. Landings on one foot are less common in beach volleyball than indoor volleyball. This could be a reason for fewer injuries and overuse conditions. PMID:24149150
Three dimensional scattering center imaging techniques
NASA Technical Reports Server (NTRS)
Younger, P. R.; Burnside, W. D.
1991-01-01
Two methods to image scattering centers in 3-D are presented. The first method uses 2-D images generated from Inverse Synthetic Aperture Radar (ISAR) measurements taken by two vertically offset antennas. This technique is shown to provide accurate 3-D imaging capability which can be added to an existing ISAR measurement system, requiring only the addition of a second antenna. The second technique uses target impulse responses generated from wideband radar measurements from three slightly different offset antennas. This technique is shown to identify the dominant scattering centers on a target in nearly real time. The number of measurements required to image a target using this technique is very small relative to traditional imaging techniques.
Leveraging Experiential Learning Techniques for Transfer
ERIC Educational Resources Information Center
Furman, Nate; Sibthorp, Jim
2013-01-01
Experiential learning techniques can be helpful in fostering learning transfer. Techniques such as project-based learning, reflective learning, and cooperative learning provide authentic platforms for developing rich learning experiences. In contrast to more didactic forms of instruction, experiential learning techniques foster a depth of learning…
Use of communication techniques by Maryland dentists.
Maybury, Catherine; Horowitz, Alice M; Wang, Min Qi; Kleinman, Dushanka V
2013-12-01
Health care providers' use of recommended communication techniques can increase patients' adherence to prevention and treatment regimens and improve patient health outcomes. The authors conducted a survey of Maryland dentists to determine the number and type of communication techniques they use on a routine basis. The authors mailed a 30-item questionnaire to a random sample of 1,393 general practice dentists and all 169 members of the Maryland chapter of the American Academy of Pediatric Dentistry. The overall response rate was 38.4 percent. Analysis included descriptive statistics, analysis of variance and ordinary least squares regression analysis to examine the association of dentists' characteristics with the number of communication techniques used. They set the significance level at P < .05. General dentists reported routinely using a mean of 7.9 of the 18 communication techniques and 3.6 of the seven basic techniques, whereas pediatric dentists reported using a mean of 8.4 and 3.8 of those techniques, respectively. General dentists who had taken a communication course outside of dental school were more likely than those who had not to use the 18 techniques (P < .01) but not the seven basic techniques (P < .05). Pediatric dentists who had taken a communication course outside of dental school were more likely than those who had not to use the 18 techniques (P < .05) and the seven basic techniques (P < .01). The number of communication techniques that dentists used routinely varied across the 18 techniques and was low for most techniques. Practical Implications. Professional education is needed both in dental school curricula and continuing education courses to increase use of recommended communication techniques. Specifically, dentists and their team members should consider taking communication skills courses and conducting an overall evaluation of their practices for user friendliness.
Minor and trace-elements in apiary products from a historical mining district (Les Malines, France).
Losfeld, Guillaume; Saunier, Jean-Baptiste; Grison, Claude
2014-03-01
The trace-elements (TE) contents of honey, royal-jelly and beeswax from a historical Zn-Pb mining district have been investigated to assess potential contamination. In spite of high levels of heavy metal (As, Cd, Tl, Pb) in wastes left after mining stopped, apiary products appear to be relatively free of TE contamination. For honey, the following average levels (±standard error) were observed: Zn 571±440μgkg(-1), Pb 26±20μgkg(-1), Tl 13±10μgkg(-1), Cd 7±6μgkg(-1) and As 3±4μg.kg(-1). These results bring additional data to the potential impact of brownfields left after mining on apiary products. They also bring new data to assess potential risks linked with honey consumption and discuss legal TE contents in honey and other food products from apiaries. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOT National Transportation Integrated Search
1997-08-01
An experimental construction method was evaluated at the Lost River Bridge in Klamath County to reduce the discontinuity between the bridge and the roadway. The method included combining soil in six 300-mm lifts interlaced with geotextile reinforceme...
DOT National Transportation Integrated Search
1993-03-01
The transition from the roadway to the deck of a rigidly supported bridge is of concern to engineers and the travelling public. It is a common occurrence to feel a discontinuity between the roadway and bridge structure. Bridge engineers have tried to...
Point-source inversion techniques
NASA Astrophysics Data System (ADS)
Langston, Charles A.; Barker, Jeffrey S.; Pavlin, Gregory B.
1982-11-01
A variety of approaches for obtaining source parameters from waveform data using moment-tensor or dislocation point source models have been investigated and applied to long-period body and surface waves from several earthquakes. Generalized inversion techniques have been applied to data for long-period teleseismic body waves to obtain the orientation, time function and depth of the 1978 Thessaloniki, Greece, event, of the 1971 San Fernando event, and of several events associated with the 1963 induced seismicity sequence at Kariba, Africa. The generalized inversion technique and a systematic grid testing technique have also been used to place meaningful constraints on mechanisms determined from very sparse data sets; a single station with high-quality three-component waveform data is often sufficient to discriminate faulting type (e.g., strike-slip, etc.). Sparse data sets for several recent California earthquakes, for a small regional event associated with the Koyna, India, reservoir, and for several events at the Kariba reservoir have been investigated in this way. Although linearized inversion techniques using the moment-tensor model are often robust, even for sparse data sets, there are instances where the simplifying assumption of a single point source is inadequate to model the data successfully. Numerical experiments utilizing synthetic data and actual data for the 1971 San Fernando earthquake graphically demonstrate that severe problems may be encountered if source finiteness effects are ignored. These techniques are generally applicable to on-line processing of high-quality digital data, but source complexity and inadequacy of the assumed Green's functions are major problems which are yet to be fully addressed.
Evaluation of Mesoscale Model Phenomenological Verification Techniques
NASA Technical Reports Server (NTRS)
Lambert, Winifred
2006-01-01
Forecasters at the Spaceflight Meteorology Group, 45th Weather Squadron, and National Weather Service in Melbourne, FL use mesoscale numerical weather prediction model output in creating their operational forecasts. These models aid in forecasting weather phenomena that could compromise the safety of launch, landing, and daily ground operations and must produce reasonable weather forecasts in order for their output to be useful in operations. Considering the importance of model forecasts to operations, their accuracy in forecasting critical weather phenomena must be verified to determine their usefulness. The currently-used traditional verification techniques involve an objective point-by-point comparison of model output and observations valid at the same time and location. The resulting statistics can unfairly penalize high-resolution models that make realistic forecasts of a certain phenomena, but are offset from the observations in small time and/or space increments. Manual subjective verification can provide a more valid representation of model performance, but is time-consuming and prone to personal biases. An objective technique that verifies specific meteorological phenomena, much in the way a human would in a subjective evaluation, would likely produce a more realistic assessment of model performance. Such techniques are being developed in the research community. The Applied Meteorology Unit (AMU) was tasked to conduct a literature search to identify phenomenological verification techniques being developed, determine if any are ready to use operationally, and outline the steps needed to implement any operationally-ready techniques into the Advanced Weather Information Processing System (AWIPS). The AMU conducted a search of all literature on the topic of phenomenological-based mesoscale model verification techniques and found 10 different techniques in various stages of development. Six of the techniques were developed to verify precipitation forecasts, one
Apollo Onboard Navigation Techniques
NASA Technical Reports Server (NTRS)
Interbartolo, Michael
2009-01-01
This viewgraph presentation reviews basic navigation concepts, describes coordinate systems and identifies attitude determination techniques including Primary Guidance, Navigation and Control System (PGNCS) IMU management and Command and Service Module Stabilization and Control System/Lunar Module (LM) Abort Guidance System (AGS) attitude management. The presentation also identifies state vector determination techniques, including PGNCS coasting flight navigation, PGNCS powered flight navigation and LM AGS navigation.
Deschênes, Philippe; Chano, Frédéric; Dionne, Léa-Laurence; Pittet, Didier; Longtin, Yves
2017-08-01
The efficacy of the World Health Organization (WHO)-recommended handwashing technique against Clostridium difficile is uncertain, and whether it could be improved remains unknown. Also, the benefit of using a structured technique instead of an unstructured technique remains unclear. This study was a prospective comparison of 3 techniques (unstructured, WHO, and a novel technique dubbed WHO shortened repeated [WHO-SR] technique) to remove C difficile. Ten participants were enrolled and performed each technique. Hands were contaminated with 3 × 10 6 colony forming units (CFU) of a nontoxigenic strain containing 90% spores. Efficacy was assessed using the whole-hand method. The relative efficacy of each technique and of a structured (either WHO or WHO-SR) vs an unstructured technique were assessed by Mann-Whitney U test and Wilcoxon signed-rank test. The median effectiveness of the unstructured, WHO, and WHO-SR techniques in log 10 CFU reduction was 1.30 (interquartile range [IQR], 1.27-1.43), 1.71 (IQR, 1.34-1.91), and 1.70 (IQR, 1.54-2.42), respectively. The WHO-SR technique was significantly more efficacious than the unstructured technique (P = .01). Washing hands with a structured technique was more effective than washing with an unstructured technique (median, 1.70 vs 1.30 log 10 CFU reduction, respectively; P = .007). A structured washing technique is more effective than an unstructured technique against C difficile. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
A review on creatinine measurement techniques.
Mohabbati-Kalejahi, Elham; Azimirad, Vahid; Bahrami, Manouchehr; Ganbari, Ahmad
2012-08-15
This paper reviews the entire recent global tendency for creatinine measurement. Creatinine biosensors involve complex relationships between biology and micro-mechatronics to which the blood is subjected. Comparison between new and old methods shows that new techniques (e.g. Molecular Imprinted Polymers based algorithms) are better than old methods (e.g. Elisa) in terms of stability and linear range. All methods and their details for serum, plasma, urine and blood samples are surveyed. They are categorized into five main algorithms: optical, electrochemical, impedometrical, Ion Selective Field-Effect Transistor (ISFET) based technique and chromatography. Response time, detection limit, linear range and selectivity of reported sensors are discussed. Potentiometric measurement technique has the lowest response time of 4-10 s and the lowest detection limit of 0.28 nmol L(-1) belongs to chromatographic technique. Comparison between various techniques of measurements indicates that the best selectivity belongs to MIP based and chromatographic techniques. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Petro, Andrew J.
1990-01-01
This paper will summarize a range of techniques which have been proposed for controlling the growth of man-made debris in earth orbit. Several techniques developed in studies at the Johnson Space Center will be described in detail. These techniques include the retrieval of inoperative satellites with an orbital maneuvering vehicle and self-disposal devices for satellites and upper stages. Self-disposal devices include propulsive deorbit motors and passive drag-augmentation devices. Concepts for sweeping small debris from the orbital environment will also be described. An evaluation of the technical feasibility and economic practicality of the various control methods will be summarized. In general, methods which prevent the accumulation of large debris objects were found to provide greater promise for control of the debris problem than methods of removing small debris particles.
NASA Technical Reports Server (NTRS)
Hewes, C. R.; Bosshart, P. W.; Eversole, W. L.; Dewit, M.; Buss, D. D.
1976-01-01
Two CCD techniques were discussed for performing an N-point sampled data correlation between an input signal and an electronically programmable reference function. The design and experimental performance of an implementation of the direct time correlator utilizing two analog CCDs and MOS multipliers on a single IC were evaluated. The performance of a CCD implementation of the chirp z transform was described, and the design of a new CCD integrated circuit for performing correlation by multiplication in the frequency domain was presented. This chip provides a discrete Fourier transform (DFT) or inverse DFT, multipliers, and complete support circuitry for the CCD CZT. The two correlation techniques are compared.
Authentication techniques for smart cards
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, R.A.
1994-02-01
Smart card systems are most cost efficient when implemented as a distributed system, which is a system without central host interaction or a local database of card numbers for verifying transaction approval. A distributed system, as such, presents special card and user authentication problems. Fortunately, smart cards offer processing capabilities that provide solutions to authentication problems, provided the system is designed with proper data integrity measures. Smart card systems maintain data integrity through a security design that controls data sources and limits data changes. A good security design is usually a result of a system analysis that provides a thoroughmore » understanding of the application needs. Once designers understand the application, they may specify authentication techniques that mitigate the risk of system compromise or failure. Current authentication techniques include cryptography, passwords, challenge/response protocols, and biometrics. The security design includes these techniques to help prevent counterfeit cards, unauthorized use, or information compromise. This paper discusses card authentication and user identity techniques that enhance security for microprocessor card systems. It also describes the analysis process used for determining proper authentication techniques for a system.« less
A novel technique for performing a tongue-lip adhesion-the tongue suspension technique.
Mann, Robert J; Neaman, Keith C; Hill, Brian; Bajnrauh, Robert; Martin, Matthew D
2012-01-01
The tongue-lip adhesion has undergone several modifications in an attempt to reduce surgical complications and failure rates. Current techniques rely on the use of a button at the tongue base for suspension, which raises concerns about possible aspiration and interference with oral motor function and bottle-feeding. A new technique for tongue-lip adhesion is proposed that adds a tongue suspension to the standard surgical adhesion. A total of 22 patients with Pierre Robin sequence who received a tongue-lip adhesion via a tongue suspension technique were reviewed. The surgical technique differs from the standard surgical approach by the use of a suture weave across the base of the tongue instead of a standard button to suspend the tongue anteriorly. Average age at the time of tongue-lip adhesion was 13.9 days, with a mean operative time of 88.8 minutes. A marked improvement in postoperative oxygenation was seen in the majority of patients. One dehiscence occurred secondary to a traumatic postoperative extubation, eventually requiring a tracheostomy for subglottic stenosis. A technical innovation for performing a tongue-lip adhesion using a tongue suspension in conjunction with a standard transverse adhesion of the lip is described. The advantage of the tongue-lip adhesion with suspension includes immediate postoperative extubation, as well as removal of concerns regarding button aspiration and possible interference in early developmental oral motor function and bottle-feeding. This technique is reproducible, expanding the craniofacial surgeon's armamentarium for the management of difficult airways in Pierre Robin sequence.
Background and survey of bioreplication techniques.
Pulsifer, Drew Patrick; Lakhtakia, Akhlesh
2011-09-01
Bioreplication is the direct reproduction of a biological structure in order to realize at least one specific functionality. Current bioreplication techniques include the sol-gel technique, atomic layer deposition, physical vapor deposition, and imprint lithography and casting. The combined use of a focused ion beam and a scanning electron microscope could develop into a bioreplication technique as well. Some of these techniques are more suitable for reproducing surface features, others for bulk three-dimensional structures. Industrial upscaling appears possible only for imprint lithography and casting (which can be replaced by stamping).
Imaging Techniques in Endodontics: An Overview
Deepak, B. S.; Subash, T. S.; Narmatha, V. J.; Anamika, T.; Snehil, T. K.; Nandini, D. B.
2012-01-01
This review provides an overview of the relevance of imaging techniques such as, computed tomography, cone beam computed tomography, and ultrasound, to endodontic practice. Many limitations of the conventional radiographic techniques have been overcome by the newer methods. Advantages and disadvantages of various imaging techniques in endodontic practice are also discussed. PMID:22530184
Tendon 'turnover lengthening' technique.
Cerovac, S; Miranda, B H
2013-11-01
Tendon defect reconstruction is amongst the most technically challenging areas in hand surgery. Tendon substance deficiency reconstruction techniques include lengthening, grafting, two-stage reconstruction and tendon transfers, however each is associated with unique challenges over and above direct repair. We describe a novel 'turnover lengthening' technique for hand tendons that has successfully been applied to the repair of several cases, including a case of attritional flexor and traumatic extensor tendon rupture in two presented patients where primary tenorrhaphy was not possible. In both cases a good post-operative outcome was achieved, as the patients were happy having returned back to normal activities of daily living such that they were discharged 12 weeks post-operatively. Our technique avoids the additional morbidity and complications associated with grafting, transfers and two stage reconstructions. It is quick, simple and reproducible for defects not exceeding 3-4 cm, provides a means of immediate one stage reconstruction, no secondary donor site morbidity and does not compromise salvage by tendon transfer and/or two-stage reconstruction in cases of failure. To our knowledge no such technique has been previously been described to reconstruct such hand tendon defects. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Neuronavigation. Principles. Surgical technique.
Ivanov, Marcel; Vlad Ciurea, Alexandru
2009-01-01
Neuronavigation and stereotaxy are techniques designed to help neurosurgeons precisely localize different intracerebral pathological processes by using a set of preoperative images (CT, MRI, fMRI, PET, SPECT etc.). The development of computer assisted surgery was possible only after a significant technological progress, especially in the area of informatics and imagistics. The main indications of neuronavigation are represented by the targeting of small and deep intracerebral lesions and choosing the best way to treat them, in order to preserve the neurological function. Stereotaxis also allows lesioning or stimulation of basal ganglia for the treatment of movement disorders. These techniques can bring an important amount of confort both to the patient and to the neurosurgeon. Neuronavigation was introduced in Romania around 2003, in four neurosurgical centers. We present our five-years experience in neuronavigation and describe the main principles and surgical techniques. PMID:20108488
The Technique of Special-Effects Cinematography.
ERIC Educational Resources Information Center
Fielding, Raymond
The author describes the many techniques used to produce cinematic effects that would be too costly, too difficult, too time-consuming, too dangerous, or simply impossible to achieve with conventional photographic techniques. He points out that these techniques are available not only for 35 millimeter work but also to the 16 mm. photographer who…
Reddy, S Srikanth; Revathi, Kakkirala; Reddy, S Kranthikumar
2013-01-01
Conventional casting technique is time consuming when compared to accelerated casting technique. In this study, marginal accuracy of castings fabricated using accelerated and conventional casting technique was compared. 20 wax patterns were fabricated and the marginal discrepancy between the die and patterns were measured using Optical stereomicroscope. Ten wax patterns were used for Conventional casting and the rest for Accelerated casting. A Nickel-Chromium alloy was used for the casting. The castings were measured for marginal discrepancies and compared. Castings fabricated using Conventional casting technique showed less vertical marginal discrepancy than the castings fabricated by Accelerated casting technique. The values were statistically highly significant. Conventional casting technique produced better marginal accuracy when compared to Accelerated casting. The vertical marginal discrepancy produced by the Accelerated casting technique was well within the maximum clinical tolerance limits. Accelerated casting technique can be used to save lab time to fabricate clinical crowns with acceptable vertical marginal discrepancy.
Computerized technique for recording board defect data
R. Bruce Anderson; R. Edward Thomas; Charles J. Gatchell; Neal D. Bennett; Neal D. Bennett
1993-01-01
A computerized technique for recording board defect data has been developed that is faster and more accurate than manual techniques. The lumber database generated by this technique is a necessary input to computer simulation models that estimate potential cutting yields from various lumber breakdown sequences. The technique allows collection of detailed information...
Weighted hybrid technique for recommender system
NASA Astrophysics Data System (ADS)
Suriati, S.; Dwiastuti, Meisyarah; Tulus, T.
2017-12-01
Recommender system becomes very popular and has important role in an information system or webpages nowadays. A recommender system tries to make a prediction of which item a user may like based on his activity on the system. There are some familiar techniques to build a recommender system, such as content-based filtering and collaborative filtering. Content-based filtering does not involve opinions from human to make the prediction, while collaborative filtering does, so collaborative filtering can predict more accurately. However, collaborative filtering cannot give prediction to items which have never been rated by any user. In order to cover the drawbacks of each approach with the advantages of other approach, both approaches can be combined with an approach known as hybrid technique. Hybrid technique used in this work is weighted technique in which the prediction score is combination linear of scores gained by techniques that are combined.The purpose of this work is to show how an approach of weighted hybrid technique combining content-based filtering and item-based collaborative filtering can work in a movie recommender system and to show the performance comparison when both approachare combined and when each approach works alone. There are three experiments done in this work, combining both techniques with different parameters. The result shows that the weighted hybrid technique that is done in this work does not really boost the performance up, but it helps to give prediction score for unrated movies that are impossible to be recommended by only using collaborative filtering.
Overview of hybridization and detection techniques.
Hilario, Elena
2007-01-01
A misconception regarding the sensitivity of nonradioactive methods for screening genomic DNA libraries often hinders the establishment of these environmentally friendly techniques in molecular biology laboratories. Nonradioactive probes, properly prepared and quantified, can detect DNA target molecules to the femtomole range. However, appropriate hybridization techniques and detection methods should also be adopted for an efficient use of nonradioactive techniques. Detailed descriptions of genomic library handling before and during the nonradioactive hybridization and detection are often omitted from publications. This chapter aims to fill this void by providing a collection of technical tips on hybridization and detection techniques.
Invasive and noninvasive dental analgesia techniques.
Estafan, D J
1998-01-01
Although needle-administered local anesthesia has been an essential tool of modern dentistry, it has also been responsible for many patients' fears of dental visits. Several new techniques have recently evolved that may offer viable alternatives. Two of these operate via electronic mechanisms that interfere with pain signals, two others involve transmucosal modes of administration, and a fifth technique involves an intraosseous pathway for anesthesia administration. Each of these techniques has different indications for dental procedures, but none is intended to replace needle administration in dentistry. This overview highlights the salient features of these alternative dental anesthesia techniques.
Chandrasekhar, Shalini; Prasad, Madu Ghanashyam; Radhakrishna, Ambati Naga; Saujanya, Kaniti; Raviteja, N V K; Deepthi, B; Ramakrishna, J
2018-01-01
The aim of this study was to evaluate the efficiency of four different obturating techniques in filling the radicular space in primary teeth. This clinical trial was carried out on 34 healthy, cooperative children (5-9 years) who had 63 carious primary teeth indicated for pulpectomy. They were divided into four groups, such that in each group, a total of 40 canals were allotted for obturation with respective technique. The root canals of selected primary teeth were filled with Endoflas obturating material using either bi-directional spiral (Group 1); incremental technique (Group 2), past inject (Group 3) or lentulo spiral (Group 4) according to the groups assigned. The effectiveness of the obturation techniques was assessed using postoperative radiographs. The assessment was made for a depth of fill in the canal, the presence of any voids using Modified Coll and Sadrian criteria. The obtained data were analyzed by using ANOVA test and unpaired t-test. Bi-directional spiral and lentulo spiral were superior to other techniques in providing optimally filled canals (P< 0.05). The bi-directional spiral was superior to lentulo spiral in preventing overfill (P< 0.05). Based on the present study results, bi-directional spiral can be recommended as an alternate obturating technique in primary teeth.
Advanced Tools and Techniques for Formal Techniques in Aerospace Systems
NASA Technical Reports Server (NTRS)
Knight, John C.
2005-01-01
This is the final technical report for grant number NAG-1-02101. The title of this grant was "Advanced Tools and Techniques for Formal Techniques In Aerospace Systems". The principal investigator on this grant was Dr. John C. Knight of the Computer Science Department, University of Virginia, Charlottesville, Virginia 22904-4740. This report summarizes activities under the grant during the period 7/01/2002 to 9/30/2004. This report is organized as follows. In section 2, the technical background of the grant is summarized. Section 3 lists accomplishments and section 4 lists students funded under the grant. In section 5, we present a list of presentations given at various academic and research institutions about the research conducted. Finally, a list of publications generated under this grant is included in section 6.
Techniques for Connecting Superconducting Thin Films
NASA Technical Reports Server (NTRS)
Mester, John; Gwo, Dz-Hung
2006-01-01
Several improved techniques for connecting superconducting thin films on substrates have been developed. The techniques afford some versatility for tailoring the electronic and mechanical characteristics of junctions between superconductors in experimental electronic devices. The techniques are particularly useful for making superconducting or alternatively normally conductive junctions (e.g., Josephson junctions) between patterned superconducting thin films in order to exploit electron quantum-tunneling effects. The techniques are applicable to both low-Tc and high-Tc superconductors (where Tc represents the superconducting- transition temperature of a given material), offering different advantages for each. Most low-Tc superconductors are metallic, and heretofore, connections among them have been made by spot welding. Most high-Tc superconductors are nonmetallic and cannot be spot welded. These techniques offer alternatives to spot welding of most low-Tc superconductors and additional solutions to problems of connecting most high-Tc superconductors.
Techniques of laparoscopic cholecystectomy: Nomenclature and selection
Haribhakti, Sanjiv P.; Mistry, Jitendra H.
2015-01-01
There are more than 50 different techniques of laparoscopic cholecystectomy (LC) available in literature mainly due to modifications by surgeons in aim to improve postoperative outcome and cosmesis. These modifications include reduction in port size and/or number than what is used in standard LC. There is no uniform nomenclature to describe these different techniques so that it is not possible to compare the outcomes of different techniques. We brief the advantages and disadvantages of each of these techniques and suggest the situation where particular technique would be useful. We also propose a nomenclature which is easy to remember and apply, so that any future comparison will be possible between the techniques. PMID:25883450
Techniques of laparoscopic cholecystectomy: Nomenclature and selection.
Haribhakti, Sanjiv P; Mistry, Jitendra H
2015-01-01
There are more than 50 different techniques of laparoscopic cholecystectomy (LC) available in literature mainly due to modifications by surgeons in aim to improve postoperative outcome and cosmesis. These modifications include reduction in port size and/or number than what is used in standard LC. There is no uniform nomenclature to describe these different techniques so that it is not possible to compare the outcomes of different techniques. We brief the advantages and disadvantages of each of these techniques and suggest the situation where particular technique would be useful. We also propose a nomenclature which is easy to remember and apply, so that any future comparison will be possible between the techniques.
NASA Astrophysics Data System (ADS)
Otberg, Nina; Shapiro, Jerry; Lui, Harvey; Wu, Wen-Yu; Alzolibani, Abdullateef; Kang, Hoon; Richter, Heike; Lademann, Jürgen
2017-05-01
Scalp imaging techniques are necessary tools for the trichological practice and for visualization of permeation, penetration and absorption processes into and through the scalp and for the research on drug delivery and toxicology. The present letter reviews different scalp imaging techniques and discusses their utility. Moreover, two different studies on scalp imaging techniques are presented in this letter: (1) scalp imaging with phototrichograms in combination with laser scanning microscopy, and (2) follicular measurements with cyanoacrylate surface replicas and light microscopy in combination with laser scanning microscopy. The experiments compare different methods for the determination of hair density on the scalp and different follicular measures. An average terminal hair density of 132 hairs cm-2 was found in 6 Caucasian volunteers and 135 hairs cm-2 in 6 Asian volunteers. The area of the follicular orifices accounts to 16.3% of the skin surface on average measured with laser scanning microscopy images. The potential volume of the follicular infundibulum was calculated based on the laser scanning measurements and is found to be 4.63 mm3 per cm2 skin on average. The experiments show that hair follicles are quantitatively relevant pathways and potential reservoirs for topically applied drugs and cosmetics.
NASA Astrophysics Data System (ADS)
Frasinski, Leszek J.
2016-08-01
Recent technological advances in the generation of intense femtosecond pulses have made covariance mapping an attractive analytical technique. The laser pulses available are so intense that often thousands of ionisation and Coulomb explosion events will occur within each pulse. To understand the physics of these processes the photoelectrons and photoions need to be correlated, and covariance mapping is well suited for operating at the high counting rates of these laser sources. Partial covariance is particularly useful in experiments with x-ray free electron lasers, because it is capable of suppressing pulse fluctuation effects. A variety of covariance mapping methods is described: simple, partial (single- and multi-parameter), sliced, contingent and multi-dimensional. The relationship to coincidence techniques is discussed. Covariance mapping has been used in many areas of science and technology: inner-shell excitation and Auger decay, multiphoton and multielectron ionisation, time-of-flight and angle-resolved spectrometry, infrared spectroscopy, nuclear magnetic resonance imaging, stimulated Raman scattering, directional gamma ray sensing, welding diagnostics and brain connectivity studies (connectomics). This review gives practical advice for implementing the technique and interpreting the results, including its limitations and instrumental constraints. It also summarises recent theoretical studies, highlights unsolved problems and outlines a personal view on the most promising research directions.
Sun, Zong-ke; Wu, Rong; Ding, Pei; Xue, Jin-Rong
2006-07-01
To compare between rapid detection method of enzyme substrate technique and multiple-tube fermentation technique in water coliform bacteria detection. Using inoculated and real water samples to compare the equivalence and false positive rate between two methods. Results demonstrate that enzyme substrate technique shows equivalence with multiple-tube fermentation technique (P = 0.059), false positive rate between the two methods has no statistical difference. It is suggested that enzyme substrate technique can be used as a standard method for water microbiological safety evaluation.
Numerical grid generation techniques. [conference
NASA Technical Reports Server (NTRS)
1980-01-01
The state of the art in topology and flow geometry is presented. Solution techniques for partial differential equations are reviewed and included developments in coordinate transformations, conformal mapping, and invariant imbeddings. Applications of these techniques in fluid mechanics, flow geometry, boundary value problems, and fluidics are presented.
Pneumopathie à éosinophile révélant un lymphome non hodgkinien de type B
Fikal, Siham; Sajiai, Hafsa; Serhane, Hind; Aitbatahar, Salma; Amro, Lamyae
2016-01-01
Le diagnostic de pneumonie à éosinophile est rare et l'étiologie maligne reste exceptionnelle. Les étiologies sont variables et sont dominées essentiellement par les affections allergiques et les causes médicamenteuses. Nous rapportons le cas d'un lymphome non hodgkinien de type B révélé par une pneumonie à éosinophile chez un patient de 61 ans. Le diagnostic de pneumonie à éosinophile a été confirmé par un taux d'éosinophile à 56% au lavage bronchoalvéolaire. L'étude immunohistochimique de la biopsie ostéomédullaire a révélé un lymphome malin non hodgkinien à petites cellules de phénotype B. PMID:28154647
Progress in Exosome Isolation Techniques.
Li, Pin; Kaslan, Melisa; Lee, Sze Han; Yao, Justin; Gao, Zhiqiang
2017-01-01
Exosomes are one type of membrane vesicles secreted into extracellular space by most types of cells. In addition to performing many biological functions particularly in cell-cell communication, cumulative evidence has suggested that several biological entities in exosomes like proteins and microRNAs are closely associated with the pathogenesis of most human malignancies and they may serve as invaluable biomarkers for disease diagnosis, prognosis, and therapy. This provides a commanding impetus and growing demands for simple, efficient, and affordable techniques to isolate exosomes. Capitalizing on the physicochemical and biochemical properties of exosomes, a number of techniques have been developed for the isolation of exosomes. This article summarizes the advances in exosome isolation techniques with an emphasis on their isolation mechanism, performance, challenges, and prospects. We hope that this article will provide an overview of exosome isolation techniques, opening up new perspectives towards the development more innovative strategies and devices for more time saving, cost effective, and efficient isolations of exosomes from a wide range of biological matrices.
Submucosal tunneling techniques: current perspectives.
Kobara, Hideki; Mori, Hirohito; Rafiq, Kazi; Fujihara, Shintaro; Nishiyama, Noriko; Ayaki, Maki; Yachida, Tatsuo; Matsunaga, Tae; Tani, Johji; Miyoshi, Hisaaki; Yoneyama, Hirohito; Morishita, Asahiro; Oryu, Makoto; Iwama, Hisakazu; Masaki, Tsutomu
2014-01-01
Advances in endoscopic submucosal dissection include a submucosal tunneling technique, involving the introduction of tunnels into the submucosa. These tunnels permit safer offset entry into the peritoneal cavity for natural orifice transluminal endoscopic surgery. Technical advantages include the visual identification of the layers of the gut, blood vessels, and subepithelial tumors. The creation of a mucosal flap that minimizes air and fluid leakage into the extraluminal cavity can enhance the safety and efficacy of surgery. This submucosal tunneling technique was adapted for esophageal myotomy, culminating in its application to patients with achalasia. This method, known as per oral endoscopic myotomy, has opened up the new discipline of submucosal endoscopic surgery. Other clinical applications of the submucosal tunneling technique include its use in the removal of gastrointestinal subepithelial tumors and endomicroscopy for the diagnosis of functional and motility disorders. This review suggests that the submucosal tunneling technique, involving a mucosal safety flap, can have potential values for future endoscopic developments.
Approximate techniques of structural reanalysis
NASA Technical Reports Server (NTRS)
Noor, A. K.; Lowder, H. E.
1974-01-01
A study is made of two approximate techniques for structural reanalysis. These include Taylor series expansions for response variables in terms of design variables and the reduced-basis method. In addition, modifications to these techniques are proposed to overcome some of their major drawbacks. The modifications include a rational approach to the selection of the reduced-basis vectors and the use of Taylor series approximation in an iterative process. For the reduced basis a normalized set of vectors is chosen which consists of the original analyzed design and the first-order sensitivity analysis vectors. The use of the Taylor series approximation as a first (initial) estimate in an iterative process, can lead to significant improvements in accuracy, even with one iteration cycle. Therefore, the range of applicability of the reanalysis technique can be extended. Numerical examples are presented which demonstrate the gain in accuracy obtained by using the proposed modification techniques, for a wide range of variations in the design variables.
Intraosseous anesthesia: implications, instrumentation and techniques.
Kleber, Christopher H
2003-04-01
The author reviews historical methods and the instruments used to bring about intraosseous anesthesia, or IOA; discusses the criteria for successful use of the intraosseous injection, or IOI, technique; and provides recommendations. Articles from before 1990 consisted of subjective reports of patient types and procedures performed using IOI as a primary technique. Studies published after 1990 yielded subjective findings on indications for expanded clinical use. The author discusses the expansion of the role of IOI relative to integrated local anesthetic delivery systems. The literature and studies verify the efficacy of IOI as a supplemental or primary technique. The author recommends anesthetics and infusion sites, and reports on the patients' perceptions of comfort. IOI can be used as a supplemental or primary technique to bring about local anesthesia in routine dental procedures. It can be used as a supplemental technique with mandibular nerve blocks to enhance deep pulpal anesthesia. It can be used as a primary technique so that patients do not experience numb lips or tongues postoperatively. Dentists can appreciate the immediate onset of anesthesia and reduced dosage levels of anesthetics associated with using IOI.
Optimum coding techniques for MST radars
NASA Technical Reports Server (NTRS)
Sulzer, M. P.; Woodman, R. F.
1986-01-01
The optimum coding technique for MST (mesosphere stratosphere troposphere) radars is that which gives the lowest possible sidelobes in practice and can be implemented without too much computing power. Coding techniques are described in Farley (1985). A technique mentioned briefly there but not fully developed and not in general use is discussed here. This is decoding by means of a filter which is not matched to the transmitted waveform, in order to reduce sidelobes below the level obtained with a matched filter. This is the first part of the technique discussed here; the second part consists of measuring the transmitted waveform and using it as the basis for the decoding filter, thus reducing errors due to imperfections in the transmitter. There are two limitations to this technique. The first is a small loss in signal to noise ratio (SNR), which usually is not significant. The second problem is related to incomplete information received at the lowest ranges. An appendix shows a technique for handling this problem. Finally, it is shown that the use of complementary codes on transmission and nonmatched decoding gives the lowest possible sidelobe level and the minimum loss in SNR due to mismatch.
TECHNIQUES FOR TEACHING CONSERVATION EDUCATION.
ERIC Educational Resources Information Center
BROWN, ROBERT E.; MOUSER, G.W.
CONSERVATION PRINCIPLES, FIELD METHODS AND TECHNIQUES, AND SPECIFIC FIELD LEARNING ACTIVITIES ARE INCLUDED IN THIS REFERENCE VOLUME FOR TEACHERS. CONSERVATION PRINCIPLES INCLUDE STATEMENTS PERTAINING TO (1) SOIL, (2) WATER, (3) FOREST, AND (4) WILDLIFE. FIELD METHODS AND TECHNIQUES INCLUDE (1) PREPARING FOR A FIELD TRIP, (2) GETTING STUDENT…
Emerging Techniques 2: Architectural Programming.
ERIC Educational Resources Information Center
Evans, Benjamin H.; Wheeler, C. Herbert, Jr.
A selected collection of architectural programming techniques has been assembled to aid architects in building design. Several exciting and sophisticated techniques for determining a basis for environmental design have been developed in recent years. These extend to the logic of environmental design and lead to more appropriate and useful…
DOE Office of Scientific and Technical Information (OSTI.GOV)
LaBelle, S.J.; Smith, A.E.; Seymour, D.A.
1977-02-01
The technique applies equally well to new or existing airports. The importance of accurate accounting of emissions, cannot be overstated. The regional oxidant modelling technique used in conjunction with a balance sheet review must be a proportional reduction technique. This type of emission balancing presumes equality of all sources in the analysis region. The technique can be applied successfully in the highway context, either in planning at the system level or looking only at projects individually. The project-by-project reviews could be used to examine each project in the same way as the airport projects are examined for their impact onmore » regional desired emission levels. The primary limitation of this technique is that it should not be used when simulation models have been used for regional oxidant air quality. In the case of highway projects, the balance sheet technique might appear to be limited; the real limitations are in the transportation planning process. That planning process is not well-suited to the needs of air quality forecasting. If the transportation forecasting techniques are insensitive to change in the variables that affect HC emissions, then no internal emission trade-offs can be identified, and the initial highway emission forecasts are themselves suspect. In general, the balance sheet technique is limited by the quality of the data used in the review. Additionally, the technique does not point out effective trade-off strategies, nor does it indicate when it might be worthwhile to ignore small amounts of excess emissions. Used in the context of regional air quality plans based on proportional reduction models, the balance sheet analysis technique shows promise as a useful method by state or regional reviewing agencies.« less
A Survey of Shape Parameterization Techniques
NASA Technical Reports Server (NTRS)
Samareh, Jamshid A.
1999-01-01
This paper provides a survey of shape parameterization techniques for multidisciplinary optimization and highlights some emerging ideas. The survey focuses on the suitability of available techniques for complex configurations, with suitability criteria based on the efficiency, effectiveness, ease of implementation, and availability of analytical sensitivities for geometry and grids. The paper also contains a section on field grid regeneration, grid deformation, and sensitivity analysis techniques.
Myocardial blood flow: Roentgen videodensitometry techniques
NASA Technical Reports Server (NTRS)
Smith, H. C.; Robb, R. A.; Wood, E. H.
1975-01-01
The current status of roentgen videodensitometric techniques that provide an objective assessment of blood flow at selected sites within the coronary circulation were described. Roentgen videodensitometry employs conventional radiopaque indicators, radiological equipment and coronary angiographic techniques. Roentgen videodensitometry techniques developed in the laboratory during the past nine years, and for the past three years were applied to analysis of angiograms in the clinical cardiac catheterization laboratory.
Videogrammetric Model Deformation Measurement Technique
NASA Technical Reports Server (NTRS)
Burner, A. W.; Liu, Tian-Shu
2001-01-01
The theory, methods, and applications of the videogrammetric model deformation (VMD) measurement technique used at NASA for wind tunnel testing are presented. The VMD technique, based on non-topographic photogrammetry, can determine static and dynamic aeroelastic deformation and attitude of a wind-tunnel model. Hardware of the system includes a video-rate CCD camera, a computer with an image acquisition frame grabber board, illumination lights, and retroreflective or painted targets on a wind tunnel model. Custom software includes routines for image acquisition, target-tracking/identification, target centroid calculation, camera calibration, and deformation calculations. Applications of the VMD technique at five large NASA wind tunnels are discussed.
Multigrid techniques for unstructured meshes
NASA Technical Reports Server (NTRS)
Mavriplis, D. J.
1995-01-01
An overview of current multigrid techniques for unstructured meshes is given. The basic principles of the multigrid approach are first outlined. Application of these principles to unstructured mesh problems is then described, illustrating various different approaches, and giving examples of practical applications. Advanced multigrid topics, such as the use of algebraic multigrid methods, and the combination of multigrid techniques with adaptive meshing strategies are dealt with in subsequent sections. These represent current areas of research, and the unresolved issues are discussed. The presentation is organized in an educational manner, for readers familiar with computational fluid dynamics, wishing to learn more about current unstructured mesh techniques.
Compensators: An alternative IMRT delivery technique
Chang, Sha X.; Cullip, Timothy J.; Deschesne, Katharin M.; Miller, Elizabeth P.; Rosenman, Julian G.
2004-01-01
Seven years of experience in compensator intensity‐modulated radiotherapy (IMRT) clinical implementation are presented. An inverse planning dose optimization algorithm was used to generate intensity modulation maps, which were delivered via either the compensator or segmental multileaf collimator (MLC) IMRT techniques. The in‐house developed compensator‐IMRT technique is presented with the focus on several design issues. The dosimetry of the delivery techniques was analyzed for several clinical cases. The treatment time for both delivery techniques on Siemens accelerators was retrospectively analyzed based on the electronic treatment record in LANTIS for 95 patients. We found that the compensator technique consistently took noticeably less time for treatment of equal numbers of fields compared to the segmental technique. The typical time needed to fabricate a compensator was 13 min, 3 min of which was manual processing. More than 80% of the approximately 700 compensators evaluated had a maximum deviation of less than 5% from the calculation in intensity profile. Seventy‐two percent of the patient treatment dosimetry measurements for 340 patients have an error of no more than 5%. The pros and cons of different IMRT compensator materials are also discussed. Our experience shows that the compensator‐IMRT technique offers robustness, excellent intensity modulation resolution, high treatment delivery efficiency, simple fabrication and quality assurance (QA) procedures, and the flexibility to be used in any teletherapy unit. PACS numbers: 87.53Mr, 87.53Tf PMID:15753937
General technique for discrete retardation-modulation polarimetry
NASA Technical Reports Server (NTRS)
Saxena, Indu
1993-01-01
The general theory and rigorous solutions of the Stokes parameters of light of a new technique in time-resolved ellipsometry are outlined. In this technique the phase of the linear retarder is stepped over three discrete values over a time interval for which the Stokes vector is determined. The technique has an advantage over synchronous detection techniques, as it can be implemented as a digitizable system.
[Use of stimulation techniques in pain treatment].
Rosted, Palle; Andersen, Claus
2006-05-15
Stimulation techniques (SB) include manipulation, acupuncture, acupressure, physiotherapy, transcutaneous electrical nerve stimulation, reflexotherapy, laser treatment and epidural stimulation technique. The purpose of this paper is to investigate the scientific evidence for these techniques. The Cochrane Library and Medline were searched for all techniques from 2000 to date. Only randomised controlled studies written in English were included. Search words were used, such as; acupuncture and neck pain, shoulder pain, etc. In total 587 papers were identified for the following diseases; headache, neck pain, shoulder pain, elbow pain, low back pain and knee pain. 415 papers were excluded, and the remaining 172 papers, a total of 20,431 patients, are the basis for this study. The effect of acupuncture and epidural stimulation technique is scientifically well-supported. For the remaining techniques, the scientific evidence is dubious.
Cophasing techniques for extremely large telescopes
NASA Astrophysics Data System (ADS)
Devaney, Nicholas; Schumacher, Achim
2004-07-01
The current designs of the majority of ELTs envisage that at least the primary mirror will be segmented. Phasing of the segments is therefore a major concern, and a lot of work is underway to determine the most suitable techniques. The techniques which have been developed are either wave optics generalizations of classical geometric optics tests (e.g. Shack-Hartmann and curvature sensing) or direct interferometric measurements. We present a review of the main techniques proposed for phasing and outline their relative merits. We consider problems which are specific to ELTs, e.g. vignetting of large parts of the primary mirror by the secondary mirror spiders, and the need to disentangle phase errors arising in different segmented mirrors. We present improvements in the Shack-Hartmann and curvature sensing techniques which allow greater precision and range. Finally, we describe a piston plate which simulates segment phasing errors and show the results of laboratory experiments carried out to verify the precision of the Shack-Hartmann technique.
NASA Astrophysics Data System (ADS)
Cao, L.; Cheng, Q.
2004-12-01
The scale invariant generator technique (SIG) and spectrum-area analysis technique (S-A) were developed independently relevant to the concept of the generalized scale invariance (GSI). The former was developed for characterizing the parameters involved in the GSI for characterizing and simulating multifractal measures whereas the latter was for identifying scaling breaks for decomposition of superimposed multifractal measures caused by multiple geophysical processes. A natural integration of these two techniques may yield a new technique to serve two purposes, on the one hand, that can enrich the power of S-A by increasing the interpretability of decomposed patterns in some applications of S-A and, on the other hand, that can provide a mean to test the uniqueness of multifractality of measures which is essential for application of SIG technique in more complicated environment. The implementation of the proposed technique has been done as a Dynamic Link Library (DLL) in Visual C++. The program can be friendly used for method validation and application in different fields.
40Ar/39Ar technique of KAr dating: a comparison with the conventional technique
Brent, Dalrymple G.; Lanphere, M.A.
1971-01-01
K-Ar ages have been determined by the 40Ar/39Ar total fusion technique on 19 terrestrial samples whose conventional K-Ar ages range from 3.4 my to nearly 1700 my. Sample materials included biotite, muscovite, sanidine, adularia, plagioclase, hornblende, actinolite, alunite, dacite, and basalt. For 18 samples there are no significant differences at the 95% confidence level between the KAr ages obtained by these two techniques; for one sample the difference is 4.3% and is statistically significant. For the neutron doses used in these experiments (???4 ?? 1018 nvt) it appears that corrections for interfering Ca- and K-derived Ar isotopes can be made without significant loss of precision for samples with K/Ca > 1 as young as about 5 ?? 105 yr, and for samples with K/Ca < 1 as young as about 107 yr. For younger samples the combination of large atmospheric Ar corrections and large corrections for Ca- and K-derived Ar may make the precision of the 40Ar/39Ar technique less than that of the conventional technique unless the irradiation parameters are adjusted to minimize these corrections. ?? 1971.
NASA Astrophysics Data System (ADS)
Rahmes, Mark; Yates, J. Harlan; Allen, Josef DeVaughn; Kelley, Patrick
2007-04-01
High resolution Digital Surface Models (DSMs) may contain voids (missing data) due to the data collection process used to obtain the DSM, inclement weather conditions, low returns, system errors/malfunctions for various collection platforms, and other factors. DSM voids are also created during bare earth processing where culture and vegetation features have been extracted. The Harris LiteSite TM Toolkit handles these void regions in DSMs via two novel techniques. We use both partial differential equations (PDEs) and exemplar based inpainting techniques to accurately fill voids. The PDE technique has its origin in fluid dynamics and heat equations (a particular subset of partial differential equations). The exemplar technique has its origin in texture analysis and image processing. Each technique is optimally suited for different input conditions. The PDE technique works better where the area to be void filled does not have disproportionately high frequency data in the neighborhood of the boundary of the void. Conversely, the exemplar based technique is better suited for high frequency areas. Both are autonomous with respect to detecting and repairing void regions. We describe a cohesive autonomous solution that dynamically selects the best technique as each void is being repaired.
Resiliency Techniques in School Practice
ERIC Educational Resources Information Center
Molony, Terry; Henwood, Maureen; Gilroy, Shawn
2010-01-01
School psychologists can help build resilience in youth in many ways. This article offers a list of some easy techniques to use when working with individuals or groups, most based on basic cognitive-behavior therapy (CBT) techniques. They include: (1) Emotional awareness; (2) Emotional Regulation; (3) Cognitive Flexibility; (4) Self-efficacy; and…
Techniques for Improving Cash Management.
ERIC Educational Resources Information Center
Lykins, Ronald G.
1973-01-01
This article deals with several techniques for regulating cash inflow and outflow and investing surplus cash for short periods of time. The techniques are: (1) consolidating checking accounts, (2) determining surplus cash by examining bank balances in conjunction with the cash book, (3) selecting a minimum bank balance, (4) investing a greater…
[Advance in interferogram data processing technique].
Jing, Juan-Juan; Xiangli, Bin; Lü, Qun-Bo; Huang, Min; Zhou, Jin-Song
2011-04-01
Fourier transform spectrometry is a type of novel information obtaining technology, which integrated the functions of imaging and spectra, but the data that the instrument acquired is the interference data of the target, which is an intermediate data and couldn't be used directly, so data processing must be adopted for the successful application of the interferometric data In the present paper, data processing techniques are divided into two classes: general-purpose and special-type. First, the advance in universal interferometric data processing technique is introduced, then the special-type interferometric data extracting method and data processing technique is illustrated according to the classification of Fourier transform spectroscopy. Finally, the trends of interferogram data processing technique are discussed.
The Q sort theory and technique.
Nyatanga, L
1989-10-01
This paper is based on the author's experience of using the Q sort technique with BA Social Sciences (BASS) students, and the community psychiatric nursing (CPN, ENB No 811 course). The paper focuses on two main issues: 1. The theoretical assumptions underpinning the Q Sort technique. Carl Rogers' self theory and some of the values of humanistic psychology are summarised. 2. The actual technique procedure and meaning of results are highlighted. As the Q Sort technique is potentially useful in a variety of sittings some of which are listed in this paper, the emphasis has deliberately been placed in understanding the theoretical underpinning and the operationalisation (sensitive interpretation) of the theory to practice.
Vellinga, T P van Rees; Sterk, W; de Boer, A G E M; van der Beek, A J; Verhoeven, A C; van Dijk, F J H
2008-01-01
The Western Scheldt Tunneling Project in The Netherlands provided a unique opportunity to evaluate two deep-diving techniques with Doppler ultrasound surveillance. Divers used the bounce diving techniques for repair and maintenance of the TBM. The tunnel boring machine jammed at its deepest depth. As a result the work time was not sufficient. The saturation diving technique was developed and permitted longer work time at great depth. Thirty-one divers were involved in this project. Twenty-three divers were examined using Doppler ultrasound. Data analysis addressed 52 exposures to Trimix at 4.6-4.8 bar gauge using the bounce technique and 354 exposures to Trimix at 4.0-6.9 bar gauge on saturation excursions. No decompression incidents occurred with either technique during the described phase of the project. Doppler ultrasound revealed that the bubble loads assessed in both techniques were generally low. We find out, that despite longer working hours, shorter decompression times and larger physical workloads, the saturation-excursion technique was associated with significant lower bubble grades than in the bounce technique using Doppler Ultrasound. We conclude that the saturation-excursion technique with Trimix is a good option for deep and long exposures in caisson work. The Doppler technique proved valuable, and it should be incorporated in future compressed-air work.
Fu, Chi-Yung; Petrich, Loren I.
1997-01-01
An image is compressed by identifying edge pixels of the image; creating a filled edge array of pixels each of the pixels in the filled edge array which corresponds to an edge pixel having a value equal to the value of a pixel of the image array selected in response to the edge pixel, and each of the pixels in the filled edge array which does not correspond to an edge pixel having a value which is a weighted average of the values of surrounding pixels in the filled edge array which do correspond to edge pixels; and subtracting the filled edge array from the image array to create a difference array. The edge file and the difference array are then separately compressed and transmitted or stored. The original image is later reconstructed by creating a preliminary array in response to the received edge file, and adding the preliminary array to the received difference array. Filling is accomplished by solving Laplace's equation using a multi-grid technique. Contour and difference file coding techniques also are described. The techniques can be used in a method for processing a plurality of images by selecting a respective compression approach for each image, compressing each of the images according to the compression approach selected, and transmitting each of the images as compressed, in correspondence with an indication of the approach selected for the image.
Dual kidney transplant techniques: A systematic review.
Cocco, Annelise; Shahrestani, Sara; Cocco, Nicholas; Hameed, Ahmer; Yuen, Lawrence; Ryan, Brendan; Hawthorne, Wayne; Lam, Vincent; Pleass, Henry
2017-08-01
Dual kidney transplantation (DKT) was developed to improve outcomes from transplantation of extended criteria donors (ECD). This study examined which surgical techniques have been reported for DKT and whether any technique had superior patient and graft survival. Electronic databases were searched for published studies mapping to MESH terms: "kidney or renal" AND "transplan*" AND "dual or double." Single case reports, studies of patients less than 18 years old, studies which did not describe the surgical technique, and studies that did not report patient or graft survival were excluded. Fifteen reports of 434 DKT recipients were identified. Three techniques were described: bilateral placement; unilateral placement with separate anastomoses; and unilateral placement with patch anastomoses. Patient survival across all three techniques was over 95% at 1 year, and graft survival was also similar at over 90%. Rates of delayed graft function were between 20% and 30% across all techniques. The three techniques have equivalent delayed graft function as well as patient and graft survival rates. This is an encouraging result as it means that the surgeon can choose to use the technique which is most appropriate for their own skills and for the patient. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Optically Remote Noncontact Heart Rates Sensing Technique
NASA Astrophysics Data System (ADS)
Thongkongoum, W.; Boonduang, S.; Limsuwan, P.
2017-09-01
Heart rate monitoring via optically remote noncontact technique was reported in this research. A green laser (5 mW, 532±10 nm) was projected onto the left carotid artery. The reflected laser light on the screen carried the deviation of the interference patterns. The interference patterns were recorded by the digital camera. The recorded videos of the interference patterns were frame by frame analysed by 2 standard digital image processing (DIP) techniques, block matching (BM) and optical flow (OF) techniques. The region of interest (ROI) pixels within the interference patterns were analysed for periodically changes of the interference patterns due to the heart pumping action. Both results of BM and OF techniques were compared with the reference medical heart rate monitoring device by which a contact measurement using pulse transit technique. The results obtained from BM technique was 74.67 bpm (beats per minute) and OF technique was 75.95 bpm. Those results when compared with the reference value of 75.43±1 bpm, the errors were found to be 1.01% and 0.69%, respectively.
Passive Optical Locking Techniques for Diode Lasers
NASA Astrophysics Data System (ADS)
Zhang, Quan
1995-01-01
Most current diode-based nonlinear frequency converters utilize electronic frequency locking techniques. However, this type of locking technique typically involves very complex electronics, and suffers the 'power-drop' problem. This dissertation is devoted to the development of an all-optical passive locking technique that locks the diode laser frequency to the external cavity resonance stably without using any kind of electronic servo. The amplitude noise problem associated with the strong optical locking has been studied. Single-mode operation of a passively locked single-stripe diode with an amplitude stability better than 1% has been achieved. This passive optical locking technique applies to broad-area diodes as well as single-stripe diodes, and can be easily used to generate blue light. A schematic of a milliwatt level blue laser based on the single-stripe diode locking technique has been proposed. A 120 mW 467 nm blue laser has been built using the tapered amplifier locking technique. In addition to diode-based blue lasers, this passive locking technique has applications in nonlinear frequency conversions, resonant spectroscopy, particle counter devices, telecommunications, and medical devices.
Modified grassline technique for orthodontic space closure.
Lohmiller, Rose Marie
2006-04-01
Use of traditional orthodontic measures in the periodontally compromised dentition can be problematic. This article describes a variation of the Grassline technique, in which the author uses adhesive bonding to harmoniously re-align malpositioned teeth. In this simple, easy-to-learn technique, a cotton thread is used to achieve orthodontic tooth movement. Initial contact with the saliva causes shrinkage of the thread, exercising a minor force that moves the teeth while allowing enough time for the tissues to regenerate. With this moderate, intermittent force, successful treatment is achieved with minimal risk. Moreover, this orthodontic technique has been associated with an increase in bone volume. This article presents this new technique and details methods for maintaining treatment success. The technique also is compared with an approach described in the literature. Two case reports are presented; the technique is employed in the first to close a diastema in a periodontally compromised dentition and in the second to correct the migration of maxillary and mandibular incisors. Photographs and radiographs show the esthetic improvement achieved in both cases using this technique.
Resolution enhancement techniques in microscopy
NASA Astrophysics Data System (ADS)
Cremer, Christoph; Masters, Barry R.
2013-05-01
We survey the history of resolution enhancement techniques in microscopy and their impact on current research in biomedicine. Often these techniques are labeled superresolution, or enhanced resolution microscopy, or light-optical nanoscopy. First, we introduce the development of diffraction theory in its relation to enhanced resolution; then we explore the foundations of resolution as expounded by the astronomers and the physicists and describe the conditions for which they apply. Then we elucidate Ernst Abbe's theory of optical formation in the microscope, and its experimental verification and dissemination to the world wide microscope communities. Second, we describe and compare the early techniques that can enhance the resolution of the microscope. Third, we present the historical development of various techniques that substantially enhance the optical resolution of the light microscope. These enhanced resolution techniques in their modern form constitute an active area of research with seminal applications in biology and medicine. Our historical survey of the field of resolution enhancement uncovers many examples of reinvention, rediscovery, and independent invention and development of similar proposals, concepts, techniques, and instruments. Attribution of credit is therefore confounded by the fact that for understandable reasons authors stress the achievements from their own research groups and sometimes obfuscate their contributions and the prior art of others. In some cases, attribution of credit is also made more complex by the fact that long term developments are difficult to allocate to a specific individual because of the many mutual connections often existing between sometimes fiercely competing, sometimes strongly collaborating groups. Since applications in biology and medicine have been a major driving force in the development of resolution enhancing approaches, we focus on the contribution of enhanced resolution to these fields.
Flood Detection/Monitoring Using Adjustable Histogram Equalization Technique
Riaz, Muhammad Mohsin; Ghafoor, Abdul
2014-01-01
Flood monitoring technique using adjustable histogram equalization is proposed. The technique overcomes the limitations (overenhancement, artifacts, and unnatural look) of existing technique by adjusting the contrast of images. The proposed technique takes pre- and postimages and applies different processing steps for generating flood map without user interaction. The resultant flood maps can be used for flood monitoring and detection. Simulation results show that the proposed technique provides better output quality compared to the state of the art existing technique. PMID:24558332
Optimization technique for problems with an inequality constraint
NASA Technical Reports Server (NTRS)
Russell, K. J.
1972-01-01
General technique uses a modified version of an existing technique termed the pattern search technique. New procedure called the parallel move strategy permits pattern search technique to be used with problems involving a constraint.
Progress in Exosome Isolation Techniques
Li, Pin; Kaslan, Melisa; Lee, Sze Han; Yao, Justin; Gao, Zhiqiang
2017-01-01
Exosomes are one type of membrane vesicles secreted into extracellular space by most types of cells. In addition to performing many biological functions particularly in cell-cell communication, cumulative evidence has suggested that several biological entities in exosomes like proteins and microRNAs are closely associated with the pathogenesis of most human malignancies and they may serve as invaluable biomarkers for disease diagnosis, prognosis, and therapy. This provides a commanding impetus and growing demands for simple, efficient, and affordable techniques to isolate exosomes. Capitalizing on the physicochemical and biochemical properties of exosomes, a number of techniques have been developed for the isolation of exosomes. This article summarizes the advances in exosome isolation techniques with an emphasis on their isolation mechanism, performance, challenges, and prospects. We hope that this article will provide an overview of exosome isolation techniques, opening up new perspectives towards the development more innovative strategies and devices for more time saving, cost effective, and efficient isolations of exosomes from a wide range of biological matrices. PMID:28255367
Techniques for hot structures testing
NASA Technical Reports Server (NTRS)
Deangelis, V. Michael; Fields, Roger A.
1990-01-01
Hot structures testing have been going on since the early 1960's beginning with the Mach 6, X-15 airplane. Early hot structures test programs at NASA-Ames-Dryden focused on operational testing required to support the X-15 flight test program, and early hot structures research projects focused on developing lab test techniques to simulate flight thermal profiles. More recent efforts involved numerous large and small hot structures test programs that served to develop test methods and measurement techniques to provide data that promoted the correlation of test data with results from analytical codes. In Nov. 1988 a workshop was sponsored that focused on the correlation of hot structures test data with analysis. Limited material is drawn from the workshop and a more formal documentation is provided of topics that focus on hot structures test techniques used at NASA-Ames-Dryden. Topics covered include the data acquisition and control of testing, the quartz lamp heater systems, current strain and temperature sensors, and hot structures test techniques used to simulate the flight thermal environment in the lab.
Q-Technique and Graphics Research.
ERIC Educational Resources Information Center
Kahle, Roger R.
Because Q-technique is as appropriate for use with visual and design items as for use with words, it is not stymied by the topics one is likely to encounter in graphics research. In particular Q-technique is suitable for studying the so-called "congeniality" of typography, for various copytesting usages, and for multivariate graphics research. The…
Instrumental Techniques in Archeological Research
1988-09-01
and instruments borrowed from the fields of chemistry , physics, geology, metallurgy, and ceramic engineering yield quantitative data on archeological...artifacts. Early analyses relied primarily on wet chemistry techniques in which samples of artifacts were dissolved into liquid solutions, destroying...other organic and inorganic materials. Advantages and disadvantages are dis- cussed. Each technique is presented with attention to appropriate materials
Stochastic Feedforward Control Technique
NASA Technical Reports Server (NTRS)
Halyo, Nesim
1990-01-01
Class of commanded trajectories modeled as stochastic process. Advanced Transport Operating Systems (ATOPS) research and development program conducted by NASA Langley Research Center aimed at developing capabilities for increases in capacities of airports, safe and accurate flight in adverse weather conditions including shear, winds, avoidance of wake vortexes, and reduced consumption of fuel. Advances in techniques for design of modern controls and increased capabilities of digital flight computers coupled with accurate guidance information from Microwave Landing System (MLS). Stochastic feedforward control technique developed within context of ATOPS program.
The Dermal Apron Technique for Immediate Implant Socket Management: A Novel Technique.
Levin, Barry P
2016-01-01
With immediate implant placement and provisionalization (IIP) in the esthetic zone, measures to counter hard and soft tissue loss are frequently necessary. To reduce the morbidity associated with bone and connective tissue procurement, various exogenous materials are utilized. The "Dermal Apron Technique" presented in this article demonstrates the use of a composite bone particulate (allograft/xenograft) plus a dermal allograft, adapted around screw-retained temporary crowns and secured within a subperiosteal pouch. The purpose is to augment the thickness of peri-implant mucosa for the purpose of preserving ridge dimensions and preventing mucosal recession. Controlled studies are required to further support its use. Clinical significance: Soft tissue health and harmony are critical for successful implant therapy in the esthetic regions of the dentition. Often, autogenous soft tissue grafts are used to augment peri-implant soft tissues. The Dermal Apron Technique is a method, that in specific situations, obviates the need for autogenous grafting. This reduces treatment time and morbidity associated with procurement of these grafts. The Dermal Apron Technique is used simultaneous with immediate placement and provisionalization and can improve long-term esthetic outcomes for patients. © 2016 Wiley Periodicals, Inc.
Spinal anesthesia: an evergreen technique.
Di Cianni, Simone; Rossi, Maria; Casati, Andrea; Cocco, Caterina; Fanelli, Guido
2008-04-01
Spinal anesthesia is a simple technique that provides a deep and fast surgical block through the injection of small doses of local anesthetic solution into the subarachnoid space. The purpose of this review is to provide an overview on recent developments on local anesthetic drugs, side effects, and special techniques of intrathecal anesthesia. Spinal anesthesia can be considered adequately safe, and severe complications are reasonably rare. The cardiovascular effects associated with sympathetic block are more frequent, but successfully treated with volume expansion and administration of vasoactive drugs. It is clear that the total dose of local anesthetic injected into the subarachnoid space is the most important determinant of both therapeutic and unwanted effects of spinal anesthesia. Several studies have also demonstrated the efficacy and safety of using small doses of long acting agents, such as bupivacaine or ropivacaine, to produce an adequately short spinal block in outpatients. Levopivacaine, the pure S(-)-enantiomer of racemic bupivacaine showed a lower risk of cardiovascular and central nervous system (CNS) toxicity than bupivacaine. In the last years we have assisted important changes in the health care organization, with most of the surgical procedures performed on outpatients or on elderly patients with concomitant diseases. This forced us to change the indications and clinical use of intrathecal anesthesia techniques, which have been modified according to the changing needs of surgery. The development of new drugs and special techniques for spinal anesthesia will further improve the clinical use of this old but evergreen technique.
Nuclear techniques in studies of condensed matter
NASA Technical Reports Server (NTRS)
Singh, Jag J.
1987-01-01
Nuclear techniques have played an important role in the studies of materials over the past several decades. For example, X-ray diffraction, neutron diffraction, neutron activation, and particle- or photon-induced X-ray emission techniques have been used extensively for the elucidation of structural and compositional details of materials. Several new techniques have been developed recently. Four such techniques are briefly reviewed which have great potential in the study and development of new materials. Of these four, Mossbauer spectroscopy, muon spin rotation, and positron annihilation spectroscopy techniques exploit their great sensitivity to the local atomic environments in the test materials. Interest in synchrotron radiation, on the other hand, stems from its special properties, such as high intensity, high degree of polarization, and high monochromaticity. It is hoped that this brief review will stimulate interest in the exploitation of these newer techniques for the development of improved materials.
A new technique for solving puzzles.
Makridis, Michael; Papamarkos, Nikos
2010-06-01
This paper proposes a new technique for solving jigsaw puzzles. The novelty of the proposed technique is that it provides an automatic jigsaw puzzle solution without any initial restriction about the shape of pieces, the number of neighbor pieces, etc. The proposed technique uses both curve- and color-matching similarity features. A recurrent procedure is applied, which compares and merges puzzle pieces in pairs, until the original puzzle image is reformed. Geometrical and color features are extracted on the characteristic points (CPs) of the puzzle pieces. CPs, which can be considered as high curvature points, are detected by a rotationally invariant corner detection algorithm. The features which are associated with color are provided by applying a color reduction technique using the Kohonen self-organized feature map. Finally, a postprocessing stage checks and corrects the relative position between puzzle pieces to improve the quality of the resulting image. Experimental results prove the efficiency of the proposed technique, which can be further extended to deal with even more complex jigsaw puzzle problems.
Student Enrollment Forecasting Techniques for Higher Education.
ERIC Educational Resources Information Center
Ahrens, Stephen W.
Various techniques used by state agencies, secondary schools, community colleges, and large universities to forecast enrollments are described and guidelines for constructing forecasting procedures are outlined. The forecasting techniques are divided into three categories: (1) quantitative techniques based on historical data that attempt curve…
Dalbayrak, Sedat; Yaman, Onur; Yılmaz, Mesut
2013-01-01
Context: Treatment of Hangman's fractures is still controversial. Hangman's fractures Type II and IIA are usually treated with surgical procedures. Aim: This study aims at describing the Neurospinal Academy (NSA) technique as an attempt to achieve an approximation of the fracture line to the axis body, which may be used for Type II and IIA patients with severe displacement and angulation. Settings and Design: NSA technique both pars or pedicle screws are placed bicortically to ensure that anterior surface of C2 vertebral body will be crossed 1-2 mm. A rod is prepared in suitable length and curve to connect the two screws. For placing the rod, sufficient amount of bone is resected from the C2 spinous process. C2 vertebral body is pulled back by means of the screws that crossed the anterior surface of C2 vertebral body. Materials and Methods: Hangman II and IIA patient are treated with NSA technique. Result: Angulated and tilted C2 vertebral body was pulled back and approximated to posterior elements. Conclusions: In Hangman's fractures Type II and IIA with severe vertebral body and pedicle displacement, NSA technique is an effective and reliable treatment alternative for the approximation of posterior elements to the C2 vertebral body, which is tilted, angulated, and dislocated. PMID:24744563
Dalbayrak, Sedat; Yaman, Onur; Yılmaz, Mesut
2013-07-01
Treatment of Hangman's fractures is still controversial. Hangman's fractures Type II and IIA are usually treated with surgical procedures. This study aims at describing the Neurospinal Academy (NSA) technique as an attempt to achieve an approximation of the fracture line to the axis body, which may be used for Type II and IIA patients with severe displacement and angulation. NSA technique both pars or pedicle screws are placed bicortically to ensure that anterior surface of C2 vertebral body will be crossed 1-2 mm. A rod is prepared in suitable length and curve to connect the two screws. For placing the rod, sufficient amount of bone is resected from the C2 spinous process. C2 vertebral body is pulled back by means of the screws that crossed the anterior surface of C2 vertebral body. Hangman II and IIA patient are treated with NSA technique. Angulated and tilted C2 vertebral body was pulled back and approximated to posterior elements. In Hangman's fractures Type II and IIA with severe vertebral body and pedicle displacement, NSA technique is an effective and reliable treatment alternative for the approximation of posterior elements to the C2 vertebral body, which is tilted, angulated, and dislocated.
Technique of after-loading interstitial implants.
Syed, A M; Feder, B H
1977-01-01
Interstitial implants are either removable or permanent (and occasionally a combination of both). Permanent implants are generally utilized where tumors are not accessible enough to permit easy removal of sources or where accurate source distribution is less critical. They are useful for cancers of the lung, pancreas, prostate, bladder, lymph nodes, etc. Radon and gold-198 have been largely replaced by iodine-125. Our major interests are in the removable after-loading iridium-192 implant techniques. Template (steel guide) and non-template (plastic tube) techniques are utilized. Templates are preferred where the tumor volume can only be approached from one side and where accurate positioning of sources would otherwise be difficult. They are useful for cancers of the cervix, vagina, urethra, and rectum. Non-template (plastic tube) techniques are preferred where the tumor volume can be approached from at least two sides and where templates are either not feasible or not essential for accurate positioning of sources. The single needle non-template approach is useful for cancers of lip, nodes, and breast (plastic button) and for cancers of the oral cavity and oropharynx (gold button). The paired needle non-template approach is useful for cancers of the gum, retromolar trigone, and base of tongue (loop technique) and for cancers of the palate (arch technique). Procedures for each technique are described in detail.
Evaluation of Noncontact Power Collection Techniques
DOT National Transportation Integrated Search
1972-07-01
An evaluation is made of four basic noncontacting techniques of power collection which have possible applicability in future high speed ground transportation systems. The techniques considered include the electric arc, magnetic induction, electrostat...
[Progress in imaging techniques].
Mishima, Kazuaki; Otsuka, Tsukasa
2013-05-01
Today it is common to perform real-time diagnosis and treatment via live broadcast as a method of education and to spread new technology for diagnosis and therapy in medical fields. Live medical broadcasts have developed along with broadcast technology. In the early days, live video feeds were sent from operating rooms to classrooms and lecture halls in universities and hospitals. However, the development of imaging techniques and communication networks enabled live broadcasts that bi-directionally link operating rooms and meeting halls during scientific meetings and live demonstration courses. Live broadcasts therefore became an important method for education and the dissemination of new medical technologies. The development of imaging techniques has contributed to more realistic live broadcasts through such innovative techniques as three-dimensional viewing and higher-definition 4K technology. In the future, live broadcasts will be transmitted on personal computers using regular Internet connections. In addition to the enhancement of image delivery technology, it will also be necessary to examine the entire image delivery environment carefully, including issues of security and privacy of personal information.
Techniques for Type I Collagen Organization
NASA Astrophysics Data System (ADS)
Anderson-Jackson, LaTecia Diamond
Tissue Engineering is a process in which cells, engineering, and material methods are used in amalgamation to improve biological functions. The purpose of tissue engineering is to develop alternative solutions to treat or cure tissues and organs that have been severely altered or damaged by diseases, congenital defects, trauma, or cancer. One of the most common and most promising biological materials for tissue engineering to develop scaffolds is Type I collagen. A major challenge in biomedical research is aligning Type I collagen to mimic biological structures, such as ligaments, tendons, bones, and other hierarchal aligned structures within the human body. The intent of this research is to examine possible techniques for organizing Type I collagen and to assess which of the techniques is effective for potential biological applications. The techniques used in this research to organize collagen are soft lithography with solution-assisted sonication embossing, directional freezing, and direct poling. The final concentration used for both soft lithography with solution-assisted sonication embossing and direct poling was 1 mg/ml, whereas for directional freezing the final concentration varied between 4mg/ml, 2mg/ml, and 1 mg/ml. These techniques were characterized using the Atomic Force Microscope (AFM) and Helium Ion Microscope (HIM). In this study, we have found that out of the three techniques, the soft lithography and directional freezing techniques have been successful in organizing collagen in a particular pattern, but not alignment. We concluded alignment may be dependent on the pH of collagen and the amount of acetic acid used in collagen solution. However, experiments are still being conducted to optimize all three techniques to align collagen in a unidirectional arrangement.
Selected Logistics Models and Techniques.
1984-09-01
TI - 59 Programmable Calculator LCC...Program 27 TI - 59 Programmable Calculator LCC Model 30 Unmanned Spacecraft Cost Model 31 iv I: TABLE OF CONTENTS (CONT’D) (Subject Index) LOGISTICS...34"" - % - "° > - " ° .° - " .’ > -% > ]*° - LOGISTICS ANALYSIS MODEL/TECHNIQUE DATA MODEL/TECHNIQUE NAME: TI - 59 Programmable Calculator LCC Model TYPE MODEL: Cost Estimating DEVELOPED BY:
NASA Technical Reports Server (NTRS)
Hong, J. P.
1971-01-01
Technique operates regardless of pattern rotation, translation or magnification and successfully detects out-of-register patterns. It improves accuracy and reduces cost of various optical character recognition devices and page readers and provides data input to computer.
Digital techniques for ULF wave polarization analysis
NASA Technical Reports Server (NTRS)
Arthur, C. W.
1979-01-01
Digital power spectral and wave polarization analysis are powerful techniques for studying ULF waves in the earth's magnetosphere. Four different techniques for using the spectral matrix to perform such an analysis have been presented in the literature. Three of these techniques are similar in that they require transformation of the spectral matrix to the principal axis system prior to performing the polarization analysis. The differences in the three techniques lie in the manner in which determine this transformation. A comparative study of these three techniques using both simulated and real data has shown them to be approximately equal in quality of performance. The fourth technique does not require transformation of the spectral matrix. Rather, it uses the measured spectral matrix and state vectors for a desired wave type to design a polarization detector function in the frequency domain. The design of various detector functions and their application to both simulated and real data will be presented.
Laparoscopic (endoscopic) radical prostatectomy: techniques and results
NASA Astrophysics Data System (ADS)
Nelius, Thomas; de Riese, Werner T. W.; Reiher, Frank; Lindenmeir, Tobias; Filleur, Stephanie; Allhoff, Ernst P.
2005-04-01
Laparoscopic radical prostatectomy (LRP) is a relatively new technique for treating organ-confined prostate cancer. Recent progress of laparoscopic/endoscopic techniques allow to perform these complex oncological procedure. Since the first description of LRP in the early 1990s the technique has undergone significant technical modifications. Two operation routes were mainly used: the transperitoneal LRP and the extraperitoneal endoscopic radical prostatectomy (EERPE). Here we review the surgical techniques of both operation routes, and highlight results, outcome and complications. The transperitoneal LRP and the EERPE can be used successfully and reproducibly, giving results comparable with those from the open retropubic procedure. Despite many advantages, transperitoneal LRP is associated with potential intraperitoneal complications. The technical improvements of the EERPE completely obviates these complications. The available data are encouraging and promising, but long-term oncological results will define the definitive role of these new techniques. We truly believe that minimally invasive surgery in treating localized prostate cancer has a bright future and that these techniques will continue to be developed.
Implementing AORN recommended practices for sterile technique.
Kennedy, Lynne
2013-07-01
Using sterile technique helps prevent the surgical environment from becoming contaminated and thus can help reduce the incidence of surgical site infection. The AORN "Recommended practices for sterile technique" provides guidance for setting up, maintaining, and monitoring a sterile field. Topics include the use of surgical attire and personal protective equipment; appropriate selection and evaluation of surgical gowns, gloves, and drape products for each procedure; use of sterile technique to don sterile gowns and gloves; appropriate methods for establishing and monitoring a sterile field; and techniques to ensure that items such as surgical instruments that may be contaminated are not used. Breaks in sterile technique should be corrected immediately unless the actions necessary would endanger the patient. If remedial actions must be delayed, they should be undertaken as soon as possible. Adhering to best practices for sterile technique requires remaining up to date with new approaches and incorporating these into quality initiatives. Copyright © 2013 AORN, Inc. Published by Elsevier Inc. All rights reserved.
Fu, C.Y.; Petrich, L.I.
1997-03-25
An image is compressed by identifying edge pixels of the image; creating a filled edge array of pixels each of the pixels in the filled edge array which corresponds to an edge pixel having a value equal to the value of a pixel of the image array selected in response to the edge pixel, and each of the pixels in the filled edge array which does not correspond to an edge pixel having a value which is a weighted average of the values of surrounding pixels in the filled edge array which do correspond to edge pixels; and subtracting the filled edge array from the image array to create a difference array. The edge file and the difference array are then separately compressed and transmitted or stored. The original image is later reconstructed by creating a preliminary array in response to the received edge file, and adding the preliminary array to the received difference array. Filling is accomplished by solving Laplace`s equation using a multi-grid technique. Contour and difference file coding techniques also are described. The techniques can be used in a method for processing a plurality of images by selecting a respective compression approach for each image, compressing each of the images according to the compression approach selected, and transmitting each of the images as compressed, in correspondence with an indication of the approach selected for the image. 16 figs.
40 CFR 142.46 - Alternative treatment techniques.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Alternative treatment techniques. 142... Administrator Under Section 1415(a) of the Act § 142.46 Alternative treatment techniques. The Administrator may... that an alternative treatment technique not included in such requirement is at least as efficient in...
Neyton, Lionel; Barth, Johannes; Nourissat, Geoffroy; Métais, Pierre; Boileau, Pascal; Walch, Gilles; Lafosse, Laurent
2018-05-19
To analyze graft and fixation (screw and EndoButton) positioning after the arthroscopic Latarjet technique with 2-dimensional computed tomography (CT) and to compare it with the open technique. We performed a retrospective multicenter study (March 2013 to June 2014). The inclusion criteria included patients with recurrent anterior instability treated with the Latarjet procedure. The exclusion criterion was the absence of a postoperative CT scan. The positions of the hardware, the positions of the grafts in the axial and sagittal planes, and the dispersion of values (variability) were compared. The study included 208 patients (79 treated with open technique, 87 treated with arthroscopic Latarjet technique with screw fixation [arthro-screw], and 42 treated with arthroscopic Latarjet technique with EndoButton fixation [arthro-EndoButton]). The angulation of the screws was different in the open group versus the arthro-screw group (superior, 10.3° ± 0.7° vs 16.9° ± 1.0° [P < .001]; inferior, 10.3° ± 0.8° vs 15.7° ± 0.9° [P < .0001]). The angulation of the EndoButtons was 5.7° ± 0.5°; this was different from that of open inferior screws (P = .003). In the axial plane (level of equator), the arthroscopic techniques resulted in lateral positions (arthro-screw, 1.5 ± 0.3 mm lateral [P < .001]; arthro-EndoButton, 0 ± 0.3 mm lateral [P < .0001]) versus the open technique (0.9 ± 0.2 mm medial). At the level of 25% of the glenoid height, the arthroscopic techniques resulted in lateral positions (arthro-screw, 0.3 ± 0.3 mm lateral [P < .001]); (arthro-EndoButton, 0.7 ± 0.3 mm lateral [P < .0001]) versus the open technique (1.0 ± 0.2 mm medial). Higher variability was observed in the arthro-screw group. In the sagittal plane, the arthro-screw technique resulted in higher positions (55% ± 3% of graft below equator) and the arthro-EndoButton technique resulted in lower positions (82% ± 3%, P < .0001) versus the open technique (71% ± 2%). Variability
New techniques for wound debridement.
Madhok, Brijesh M; Vowden, Kathryn; Vowden, Peter
2013-06-01
Debridement is a crucial component of wound management. Traditionally, several types of wound debridement techniques have been used in clinical practice such as autolytic, enzymatic, biodebridement, mechanical, conservative sharp and surgical. Various factors determine the method of choice for debridement for a particular wound such as suitability to the patient, the type of wound, its anatomical location and the extent of debridement required. Recently developed products are beginning to challenge traditional techniques that are currently used in wound bed preparation. The purpose of this review was to critically evaluate the current evidence behind the use of these newer techniques in clinical practice. There is some evidence to suggest that low frequency ultrasound therapy may improve healing rates in patients with venous ulcers and diabetic foot ulcers. Hydrosurgery debridement is quick and precise, but the current evidence is limited and further studies are underway. Debridement using a monofilament polyester fibre pad and plasma-mediated bipolar radiofrequency ablation are both very new techniques. The initial evidence is limited, and further studies are warranted to confirm their role in management of chronic wounds. © 2013 The Authors. International Wound Journal © 2013 John Wiley & Sons Ltd and Medicalhelplines.com Inc.
Measurement of absolute lung volumes by imaging techniques.
Clausen, J
1997-10-01
In this paper, the techniques available for estimating total lung capacities from standard chest radiographs in children and infants as well as adults are reviewed. These techniques include manual measurements using ellipsoid and planimetry techniques as well as computerized systems. Techniques are also available for making radiographic lung volume measurements from portable chest radiographs. There are inadequate data in the literature to support recommending one specific technique over another. Though measurements of lung volumes by radiographic, plethysmographic, gas dilution or washout techniques result in remarkably similar mean results when groups of normal subjects are tested, in patients with disease, the results of these different basic measurement techniques can differ significantly. Computed tomographic and magnetic resonance techniques can also be used to measure absolute lung volumes and offer the theoretical advantages that the results in individual subjects are less affected by variances of thoracic shape than are measurements made using conventional chest radiographs.
Alternative Assessment Techniques.
ERIC Educational Resources Information Center
Lowenthal, Barbara
1988-01-01
Maintaining the precision necessary for administering norm referenced tests can be a problem for the special education teacher who is trained to assist the student. Criterion-referenced tests, observations, and interviews are presented as effective alternative assessment techniques. (JDD)
The Technique of Special Effects in Television.
ERIC Educational Resources Information Center
Wilkie, Bernard
Television, with its special need for movement and continuous shooting, often demands different special effects techniques from those used in films. This book covers the techniques used to create special effects for television which meet these requirements and which also require less time and money than many film techniques. Included are…
ERIC Educational Resources Information Center
Malycha, Charlotte P.; Maier, Günter W.
2017-01-01
Although creativity techniques are highly recommended in working environments, their effects have been scarcely investigated. Two cognitive processes are often considered to foster creative potential and are, therefore, taken as a basis for creativity techniques: knowledge activation and conceptual combination. In this study, both processes were…
[Application of three-dimensional printing technique in orthopaedics].
Luo, Qiang; Lau, Tak Wing; Fang, Xinshuo; Leung, Frankie
2014-03-01
To review the current progress of three-dimensional (3-D) printing technique in the clinical practice, its limitations and prospects. The recent publications associated with the clinical application of 3-D printing technique in the field of surgery, especially in orthopaedics were extensively reviewed. Currently, 3-D printing technique has been applied in orthopaedic surgery to aid diagnosis, make operative plans, and produce personalized prosthesis or implants. 3-D printing technique is a promising technique in clinical application.
Simulations of motor unit number estimation techniques
NASA Astrophysics Data System (ADS)
Major, Lora A.; Jones, Kelvin E.
2005-06-01
Motor unit number estimation (MUNE) is an electrodiagnostic procedure used to evaluate the number of motor axons connected to a muscle. All MUNE techniques rely on assumptions that must be fulfilled to produce a valid estimate. As there is no gold standard to compare the MUNE techniques against, we have developed a model of the relevant neuromuscular physiology and have used this model to simulate various MUNE techniques. The model allows for a quantitative analysis of candidate MUNE techniques that will hopefully contribute to consensus regarding a standard procedure for performing MUNE.
1980-06-01
in evaluators and the evaluation method. Also in Goldman’s study reagents, nitric acid and sodium hypochlorite , were used in retrieving the gutta...Inlo Di-5r7W~f~ IU* Report) DTIC illE LECTE f_ IS. KEY WORDS (Conthue on revere* side It necessay and Identify by block numbei) -. , endodontics ...TECHNIQUES. PART 2: THREE CHLOROFORM-GUTTA PERCHA FILLING TECHNIQUES M. Wong, DDS Resident, Endodontics Dept. of Dentistry - PO Box 59 Madigan Army Medical
[The stamp technique for direct composite restoration].
Perrin, Philippe; Zimmerli, Brigitte; Jacky, Daniel; Lussi, Adrian; Helbling, Christoph; Ramseyer, Simon
2013-01-01
The indications for direct resin composite restorations are nowadays extended due to the development of modern resin materials with improved material properties. However, there are still some difficulties regarding handling of resin composite material, especially in large restorations. The reconstruction of a functional and individual occlusion is difficult to achieve with direct application techniques. The aim of the present publication was to introduce a new "stamp"-technique for placing large composite restorations. The procedure of this "stamp"-technique is presented by three typical indications: large single-tooth restoration, occlusal rehabilitation of a compromised occlusal surface due to erosions and direct fibre-reinforced fixed partial denture. A step-by-step description of the technique and clinical figures illustrates the method. Large single-tooth restorations can be built-up with individual, two- piece silicone stamps. Large occlusal abrasive and/or erosive defects can be restored by copying the wax-up from the dental technician using the "stamp"-technique. Even fiber-reinforced resin-bonded fixed partial dentures can be formed with this intraoral technique with more precision and within a shorter treatment time. The presented "stamp"-technique facilitates the placement of large restoration with composite and can be recommended for the clinical use.
Ultrasound elastography: principles, techniques, and clinical applications.
Dewall, Ryan J
2013-01-01
Ultrasound elastography is an emerging set of imaging modalities used to image tissue elasticity and are often referred to as virtual palpation. These techniques have proven effective in detecting and assessing many different pathologies, because tissue mechanical changes often correlate with tissue pathological changes. This article reviews the principles of ultrasound elastography, many of the ultrasound-based techniques, and popular clinical applications. Originally, elastography was a technique that imaged tissue strain by comparing pre- and postcompression ultrasound images. However, new techniques have been developed that use different excitation methods such as external vibration or acoustic radiation force. Some techniques track transient phenomena such as shear waves to quantitatively measure tissue elasticity. Clinical use of elastography is increasing, with applications including lesion detection and classification, fibrosis staging, treatment monitoring, vascular imaging, and musculoskeletal applications.
Test techniques for evaluating flight displays
NASA Technical Reports Server (NTRS)
Haworth, Loran A.; Newman, Richard L.
1993-01-01
The rapid development of graphics technology allows for greater flexibility in aircraft displays, but display evaluation techniques have not kept pace. Historically, display evaluation has been based on subjective opinion and not on the actual aircraft/pilot performance. Existing electronic display specifications and evaluation techniques are reviewed. A display rating technique analogous to handling qualities ratings was developed and is recommended for future evaluations. The choice of evaluation pilots is also discussed and the use of a limited number of trained evaluators is recommended over the use of a large number of operational pilots.
Matrix Perturbation Techniques in Structural Dynamics
NASA Technical Reports Server (NTRS)
Caughey, T. K.
1973-01-01
Matrix perturbation are developed techniques which can be used in the dynamical analysis of structures where the range of numerical values in the matrices extreme or where the nature of the damping matrix requires that complex valued eigenvalues and eigenvectors be used. The techniques can be advantageously used in a variety of fields such as earthquake engineering, ocean engineering, aerospace engineering and other fields concerned with the dynamical analysis of large complex structures or systems of second order differential equations. A number of simple examples are included to illustrate the techniques.
Secular Climate Change on Mars: An Update
NASA Astrophysics Data System (ADS)
Batterson, C. M.; Kahre, M. A.; Haberle, R. M.; Wilson, R. J.; Kahanpää, H.
2017-12-01
The stability of the South Polar Residual Cap (SPRC) has been in question since Leighton & Murray (1966) theorized that the cap is predominantly CO2 ice in solid-vapor equilibrium with the atmosphere. In 2001, Malin et al. reported a net loss of cap mass that Blackburn et al. (2010) calculated would sublime the SPRC by the end of the decade. Also in 2010, Haberle & Kahre analyzed Phoenix and VL2 pressure data to quantify the net loss of CO2 from the SPRC since the time of the Viking Missions. Though their loss estimates were consistent with Malin et al. (2001), the unclear accuracy of the pressure sensor and limited data available from Phoenix rendered their study inconclusive. This study modifies the process Haberle & Kahre (2010) use to quantify the change in atmospheric mass since VL2 and is improved by the known accuracy and stability of the MSL pressure sensor and its longer data set (two complete Mars Years). Modifications include excluding warm up errors in the MSL data, correcting for rover elevation changes, binning the data into hourly bins for daily averages, and excluding periods when both MSL and VL2 data are not simultaneously present when calculating annual means. An ensemble of Ames GCM simulations are used to define the offset that accounts for dynamical and physical differences between MSL and VL2. From these calculations we find an estimated net loss of 5 Pascals per Mars Decade of atmospheric CO2 , which is comparable to the year 2 MSL sensor accuracy ( 4 Pa). Given this, and the uncertain accuracy of the VL2 sensor, we see no compelling evidence for secular climate change. This result is consistent with Thomas et al's (2016) recent refinements in actual cap loss rates. However, since the Ames GCM runs at fairly coarse horizontal resolution we plan to use the higher-resolution GFDL FMS/FV3 GCM capable of resolving Gale Crater and its circulation to re-calculate the offset and obtain a more accurate loss/gain rate in the near future.
Mars Orbiter Camera Views the 'Face on Mars' - Best View from Viking
NASA Technical Reports Server (NTRS)
1998-01-01
Shortly after midnight Sunday morning (5 April 1998 12:39 AM PST), the Mars Orbiter Camera (MOC) on the Mars Global Surveyor (MGS) spacecraft successfully acquired a high resolution image of the 'Face on Mars' feature in the Cydonia region. The image was transmitted to Earth on Sunday, and retrieved from the mission computer data base Monday morning (6 April 1998). The image was processed at the Malin Space Science Systems (MSSS) facility 9:15 AM and the raw image immediately transferred to the Jet Propulsion Laboratory (JPL) for release to the Internet. The images shown here were subsequently processed at MSSS.
The picture was acquired 375 seconds after the spacecraft's 220th close approach to Mars. At that time, the 'Face', located at approximately 40.8o N, 9.6o W, was 275 miles (444 km) from the spacecraft. The 'morning' sun was 25o above the horizon. The picture has a resolution of 14.1 feet (4.3 meters) per pixel, making it ten times higher resolution than the best previous image of the feature, which was taken by the Viking Mission in the mid-1970's. The full image covers an area 2.7 miles (4.4 km) wide and 25.7 miles (41.5 km) long.This Viking Orbiter image is one of the best Viking pictures of the area Cydonia where the 'Face' is located. Marked on the image are the 'footprint' of the high resolution (narrow angle) Mars Orbiter Camera image and the area seen in enlarged views (dashed box). See PIA01440-1442 for these images in raw and processed form.Malin Space Science Systems and the California Institute of Technology built the MOC using spare hardware from the Mars Observer mission. MSSS operates the camera from its facilities in San Diego, CA. The Jet Propulsion Laboratory's Mars Surveyor Operations Project operates the Mars Global Surveyor spacecraft with its industrial partner, Lockheed Martin Astronautics, from facilities in Pasadena, CA and Denver, CO.The Interaction of Impact Melt, Impact-Derived Sediment, and Volatiles at Crater Tooting, Mars
NASA Technical Reports Server (NTRS)
Mouginis-Mark, P.; Boyce, J.
2010-01-01
We are producing a 1:200K geologic map of Tooting crater, Mars. This work has shown that an incredible amount of information can be gleaned from mapping at even larger scales (1:10K 1:25K) using CTX and HiRISE data. We have produced two new science papers (Morris et al., 2010; Mouginis-Mark and Boyce, 2010) from this mapping, and additional science questions continue to arise from our on-going analysis of Tooting crater: 1) What was the interplay of impact melt and volatile-rich sediments that, presumably, were created during the impact? Kieffer and Simonds [1980] predicted that melt would have been destroyed during impacts on Mars because of the volatiles present within the target we seek to understand if this is indeed the case at Tooting crater. We have identified pitted and fractured terrain that formed during crater modification, but the timing of the formation of these materials in different parts of the crater remains to be resolved. Stratigraphic relationships between these units and the central peak may reveal deformation features as well as overlapping relationships. 2) Morris et al. [2010] identified several lobate flows on the inner and outer walls of Tooting crater. It is not yet clear what the physical characteristics of the source areas of these flows really are; e.g., what are the sizes of the source areas, what elevations are they located at relative to the floor of the crater, are they interconnected, and are they on horizontal or tilted surfaces? 3) What were the details of dewatering of the inner wall of Tooting crater (Fig. 1)? We find evidence within Tooting crater of channels carved by water release, and the remobilization of sediment (which is inferred to have formed during the impact event). Sapping can be identified along the crest of unit 8 near the floor of the crater (Fig. 2a, 2b). This unit displays amphitheater-headed canyons that elsewhere on Mars are typically attributed to water leaking from the substrate [Laity and Malin, 1985
Meandering and material accumulation in the alcove on present day gully evolution
NASA Astrophysics Data System (ADS)
Pasquon, K.; Gargani, J.; Masse, M.; Vincendon, M.; Conway, S. J.; Séjourné, A.
2016-12-01
Since their first observation by Malin and Edgett (2000) [1], martian gullies have been abundantly studied, but their formation mechanism is still under debate [e.g. 2, 3, 4, 5, 6]. Gullies are generally composed of an alcove, a channel and an apron [1, 7] and some of them are active today [8]. Here, we show for the first time active martian meanders. This study was performed using HiRISE images at 25-30 cm/pix and 1 m/pix HiRISE elevation data. We found that this gully has been extremely active over the last 4 martian years. Each year, we observe an accumulation of material in the alcove and then its subsequent mobilisation - causing meander growth, extension of the channel, and growth of the debris apron. Over one martian year the debris apron expanded by almost 150 meters from an initial size of 900 meters. Two different pulses of activity are observed: 1) in the middle of winter when CO2 frost is still present and 2) at the beginning of spring when the seasonal defrosting is coming to an end. This phenomenon is observed on a moderate east-facing slope ( 13°). A correlation between seasonal frost and this gully could be consistent with its development timing. Laboratory experiments have been performed at low pressure to better constrain the potential range of processes involved in such seasonal mobilisation of material on Mars. [1] Malin and Edgett, 2000 Science 288, 2330-2335 ; [2] Costard et al.; 2002. Science 295, 110-113 ; [3] Treiman, 2003. J. Geophys. Res. Planets, 108 (E4), 8031; [4] Heldmann et al., 2005. J. Geophys. Res. Planets, 110 (E5), 004; [5] Hugenholtz et al., 2008. Icarus 197, 65-72 ; [6] Cedillo-Flores et al., 2011. Geophys. Res. Lett. 38, L21202; [7] Harrison et al., 2015. Icarus 252, 236-254; [8] Diniega et al., 2010. Geology 38, 1047-1050.
NASA Astrophysics Data System (ADS)
Lee, P.
2002-12-01
The origin and evolution of the relatively youthful slope gully features on Mars first reported by Malin and Edgett (2000) remain enigmatic. Two prevailing hypotheses concerning their formation involve the discharge of subsurface H2O at the gully sites: groundwater seepage (1) and/or the melting of ground-ice (2, 3). In the course of geologic field investigations on Devon Island, Canadian Arctic, we have identified morphologic and contextual analogs for the martian gullies that result from a radically different mechanism of formation (4). The gullies on Devon result mainly from the episodic melting of transient surface snow and ice deposits, with little contribution from subsurface H2O reservoirs. Timescales for gully formation on Devon Island are š104 years (5). The gullies on Devon suggest that the formation of gully features on Mars might not necessarily have involved discharges of subsurface H2O at the gully sites. Instead, gullies on Mars might be the result of transient surface snow and ice melting, which in turn might be the result of short-term changes in regional surface environmental conditions (on time-scales of š105-108 years?) possibly in association with high obliquity-induced climate change (6, 7) and/or volcanic activity. Acknowledgements: This research was conducted under the auspices of the NASA Haughton-Mars Project (HMP) with support from NASA and the National Geographic Society. References: (1) Malin, M. C. and K. S. Edgett 2000. Science 288, 2330-2335. (2) Mellon, M. T. and R. J. Phillips 2001. J. Geophys. Res. 106, 23165-23179. (3) Costard, F. et al. 2002. Science 295, 110-112. (4) Lee, P. et al. 2001. LPSC. XXXII, Houston, TX, Mar 12-16, 2001. (5) Lee, P, et al. 2002. LPSC XXXIII, Houston, TX, Mar 11-15, 2002. (6) Ward, W. R. (1973) Science 181, 260-262. (7) Touma, J. and J. Wisdom (1993) Science 259, 1294-1296.
NASA Astrophysics Data System (ADS)
Jagoutz, E.
2006-12-01
Large well rounded boulders and angular rock fragments characterizes the Martian landscape as seen on the recent excellent quality photos. Analyzing the different rock-shapes indicates a time sequence of emplacement, fragmentation and transport of different rocks on Mars, which might give interesting insight into transport and weathering processes. Larger commonly well rounded boulders were emplaced onto gravel plains. After emplacement, these rocks were fragmented and disassembled. Nests of angular rock fragments are marking the locations of preexisting larger rocks. Frequently it is possible to reconstruct larger rounded rocks from smaller angular fragments. In other cases transport after fragmentation obscured the relationship of the fragments. However, a strewn field of fragments is still reminiscent of the preexisting rock. Mechanical salt weathering could be a plausible explanation for the insitu fragmentation of larger rounded blocks into angular fragments. Impact or secondary air fall induced fragmentation produces very different patterns, as observed around impact crates on Earth. Salt weathering of rocks is a common process in terrestrial environments. Salt crystallization in capillaries causes fragmentation of rocks, irrespective of the process of salt transportation and concentration. On Earth significant salt weathering can be observed in different climatic environments: in the transition zone of alluvial aprons and salt playas in desserts and in dry valleys of Antarctica. In terrestrial semi-arid areas the salt is transported by salt solution, which is progressively concentrated by evaporation. In Antarctic dry valleys freeze-thaw cycles causes salt transportation and crystallization resulting in rock fragmentation. This salt induced process can lead to complete destruction of rocks and converts rocks to fine sand. The efficient breakdown of rocks is dominating the landscape in some dry valleys of the Earth but possibly also on Mars. (Malin, 1974
A Technique for Machine-Aided Indexing
ERIC Educational Resources Information Center
Klingbiel, Paul H.
1973-01-01
The technique for machine-aided indexing developed at the Defense Documentation Center (DDC) is illustrated on a randomly chosen abstract. Additional text is provided in coded form so that the reader can more fully explore this technique. (2 references) (Author)
Built-in-Test Verification Techniques
1987-02-01
report documents the results of the effort for the Rome Air Development Center Contract F30602-84-C-0021, BIT Verification Techniques. The work was...Richard Spillman of Sp.,llman Research Associates. The principal investigators were Mike Partridge and subsequently Jeffrey Albert. The contract was...two your effort to develop techniques for Built-In Test (BIT) verification. The objective of the contract was to develop specifications and technical
NASA Technical Reports Server (NTRS)
Dumas, A.
1981-01-01
Three major areas that are considered in the development of an overall maintenance scheme of computer equipment are described. The areas of concern related to fault isolation techniques are: the programmer (or user), company and its policies, and the manufacturer of the equipment.
ERIC Educational Resources Information Center
Frank, David A.
2007-01-01
In this essay, I seek to read the rhetorical theories set forth by Belgians Chaim Perelman and Paul de Man as responses to the Holocaust. To accomplish this aspiration, I draw from Dominick LaCapra's framework for the analysis of trauma and its expression in historical and theoretical texts. Reading the rhetorical theories of Perelman and de Man,…
Network acceleration techniques
NASA Technical Reports Server (NTRS)
Crowley, Patricia (Inventor); Maccabe, Arthur Barney (Inventor); Awrach, James Michael (Inventor)
2012-01-01
Splintered offloading techniques with receive batch processing are described for network acceleration. Such techniques offload specific functionality to a NIC while maintaining the bulk of the protocol processing in the host operating system ("OS"). The resulting protocol implementation allows the application to bypass the protocol processing of the received data. Such can be accomplished this by moving data from the NIC directly to the application through direct memory access ("DMA") and batch processing the receive headers in the host OS when the host OS is interrupted to perform other work. Batch processing receive headers allows the data path to be separated from the control path. Unlike operating system bypass, however, the operating system still fully manages the network resource and has relevant feedback about traffic and flows. Embodiments of the present disclosure can therefore address the challenges of networks with extreme bandwidth delay products (BWDP).
Bone tissue engineering scaffolding: computer-aided scaffolding techniques.
Thavornyutikarn, Boonlom; Chantarapanich, Nattapon; Sitthiseripratip, Kriskrai; Thouas, George A; Chen, Qizhi
Tissue engineering is essentially a technique for imitating nature. Natural tissues consist of three components: cells, signalling systems (e.g. growth factors) and extracellular matrix (ECM). The ECM forms a scaffold for its cells. Hence, the engineered tissue construct is an artificial scaffold populated with living cells and signalling molecules. A huge effort has been invested in bone tissue engineering, in which a highly porous scaffold plays a critical role in guiding bone and vascular tissue growth and regeneration in three dimensions. In the last two decades, numerous scaffolding techniques have been developed to fabricate highly interconnective, porous scaffolds for bone tissue engineering applications. This review provides an update on the progress of foaming technology of biomaterials, with a special attention being focused on computer-aided manufacturing (Andrade et al. 2002) techniques. This article starts with a brief introduction of tissue engineering (Bone tissue engineering and scaffolds) and scaffolding materials (Biomaterials used in bone tissue engineering). After a brief reviews on conventional scaffolding techniques (Conventional scaffolding techniques), a number of CAM techniques are reviewed in great detail. For each technique, the structure and mechanical integrity of fabricated scaffolds are discussed in detail. Finally, the advantaged and disadvantage of these techniques are compared (Comparison of scaffolding techniques) and summarised (Summary).
A study of FM threshold extension techniques
NASA Technical Reports Server (NTRS)
Arndt, G. D.; Loch, F. J.
1972-01-01
The characteristics of three postdetection threshold extension techniques are evaluated with respect to the ability of such techniques to improve the performance of a phase lock loop demodulator. These techniques include impulse-noise elimination, signal correlation for the detection of impulse noise, and delta modulation signal processing. Experimental results from signal to noise ratio data and bit error rate data indicate that a 2- to 3-decibel threshold extension is readily achievable by using the various techniques. This threshold improvement is in addition to the threshold extension that is usually achieved through the use of a phase lock loop demodulator.
Advanced Millimeter-Wave Security Portal Imaging Techniques
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheen, David M.; Bernacki, Bruce E.; McMakin, Douglas L.
2012-04-01
Millimeter-wave imaging is rapidly gaining acceptance for passenger screening at airports and other secured facilities. This paper details a number of techniques developed over the last several years including novel image reconstruction and display techniques, polarimetric imaging techniques, array switching schemes, as well as high frequency high bandwidth techniques. Implementation of some of these methods will increase the cost and complexity of the mm-wave security portal imaging systems. RF photonic methods may provide new solutions to the design and development of the sequentially switched linear mm-wave arrays that are the key element in the mm-wave portal imaging systems.
Optical rangefinding applications using communications modulation technique
NASA Astrophysics Data System (ADS)
Caplan, William D.; Morcom, Christopher John
2010-10-01
A novel range detection technique combines optical pulse modulation patterns with signal cross-correlation to produce an accurate range estimate from low power signals. The cross-correlation peak is analyzed by a post-processing algorithm such that the phase delay is proportional to the range to target. This technique produces a stable range estimate from noisy signals. The advantage is higher accuracy obtained with relatively low optical power transmitted. The technique is useful for low cost, low power and low mass sensors suitable for tactical use. The signal coding technique allows applications including IFF and battlefield identification systems.
Cell-Detection Technique for Automated Patch Clamping
NASA Technical Reports Server (NTRS)
McDowell, Mark; Gray, Elizabeth
2008-01-01
A unique and customizable machinevision and image-data-processing technique has been developed for use in automated identification of cells that are optimal for patch clamping. [Patch clamping (in which patch electrodes are pressed against cell membranes) is an electrophysiological technique widely applied for the study of ion channels, and of membrane proteins that regulate the flow of ions across the membranes. Patch clamping is used in many biological research fields such as neurobiology, pharmacology, and molecular biology.] While there exist several hardware techniques for automated patch clamping of cells, very few of those techniques incorporate machine vision for locating cells that are ideal subjects for patch clamping. In contrast, the present technique is embodied in a machine-vision algorithm that, in practical application, enables the user to identify good and bad cells for patch clamping in an image captured by a charge-coupled-device (CCD) camera attached to a microscope, within a processing time of one second. Hence, the present technique can save time, thereby increasing efficiency and reducing cost. The present technique involves the utilization of cell-feature metrics to accurately make decisions on the degree to which individual cells are "good" or "bad" candidates for patch clamping. These metrics include position coordinates (x,y) in the image plane, major-axis length, minor-axis length, area, elongation, roundness, smoothness, angle of orientation, and degree of inclusion in the field of view. The present technique does not require any special hardware beyond commercially available, off-the-shelf patch-clamping hardware: A standard patchclamping microscope system with an attached CCD camera, a personal computer with an imagedata- processing board, and some experience in utilizing imagedata- processing software are all that are needed. A cell image is first captured by the microscope CCD camera and image-data-processing board, then the image
Whole cell entrapment techniques.
Trelles, Jorge A; Rivero, Cintia W
2013-01-01
Microbial whole cells are efficient, ecological, and low-cost catalysts that have been successfully applied in the pharmaceutical, environmental, and alimentary industries, among others. Microorganism immobilization is a good way to carry out the bioprocess under preparative conditions. The main advantages of this methodology lie in their high operational stability, easy upstream separation and bioprocess scale-up feasibility. Cell entrapment is the most widely used technique for whole cell immobilization. This technique-in which the cells are included within a rigid network-is porous enough to allow the diffusion of substrates and products, protects the selected microorganism from the reaction medium, and has high immobilization efficiency (100 % in most cases).
Schlieren technique in soap film flows
NASA Astrophysics Data System (ADS)
Auliel, M. I.; Hebrero, F. Castro; Sosa, R.; Artana, G.
2017-05-01
We propose the use of the Schlieren technique as a tool to analyse the flows in soap film tunnels. The technique enables to visualize perturbations of the film produced by the interposition of an object in the flow. The variations of intensity of the image are produced as a consequence of the deviations of the light beam traversing the deformed surfaces of the film. The quality of the Schlieren image is compared to images produced by the conventional interferometric technique. The analysis of Schlieren images of a cylinder wake flow indicates that this technique enables an easy visualization of vortex centers. Post-processing of series of two successive images of a grid turbulent flow with a dense motion estimator is used to derive the velocity fields. The results obtained with this self-seeded flow show good agreement with the statistical properties of the 2D turbulent flows reported on the literature.
Uranium Detection - Technique Validation Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Colletti, Lisa Michelle; Garduno, Katherine; Lujan, Elmer J.
As a LANL activity for DOE/NNSA in support of SHINE Medical Technologies™ ‘Accelerator Technology’ we have been investigating the application of UV-vis spectroscopy for uranium analysis in solution. While the technique has been developed specifically for sulfate solutions, the proposed SHINE target solutions, it can be adapted to a range of different solution matrixes. The FY15 work scope incorporated technical development that would improve accuracy, specificity, linearity & range, precision & ruggedness, and comparative analysis. Significant progress was achieved throughout FY 15 addressing these technical challenges, as is summarized in this report. In addition, comparative analysis of unknown samples usingmore » the Davies-Gray titration technique highlighted the importance of controlling temperature during analysis (impacting both technique accuracy and linearity/range). To fully understand the impact of temperature, additional experimentation and data analyses were performed during FY16. The results from this FY15/FY16 work were presented in a detailed presentation, LA-UR-16-21310, and an update of this presentation is included with this short report summarizing the key findings. The technique is based on analysis of the most intense U(VI) absorbance band in the visible region of the uranium spectra in 1 M H 2SO 4, at λ max = 419.5 nm.« less
History of the Buttonhole Technique.
Misra, Madhukar
2015-01-01
The constant side method of access cannulation in hemodialysis, popularly known as the 'buttonhole' method, has an interesting history. Dr. Zbylut J. Twardowski, a Polish nephrologist, discovered this technique by pure serendipity in 1972. A patient with a complicated vascular access history and limited options for cannulation was repeatedly 'stuck' at the same sites by a nurse. Soon it was noticed that the cannulation at the same spot became easier with time. Since the needles were being reused, the sharpness of the needles decreased with time and the bluntness of the needle seemed to minimize the damage to the cannulation tract (another serendipity!). This method soon became popular among patients, and many patients started using this technique. This chapter traces the invention of this technique and its subsequent development following Dr. Twardowski's emigration to the USA. © 2015 S. Karger AG, Basel.
ERIC Educational Resources Information Center
Health Education (Washington D.C.), 1985
1985-01-01
Health educators have consistently shown creativity in using innovative teaching techniques. Three articles from the past discuss "new" teaching methods: (1) "A Radio Project Teaches Your Class" (Miller); (2) "An Activity Program in Alcohol Education" (Breg); and (3) "Teaching Health Through Pictures" (Haviland). (CB)
Laser techniques in conservation in Europe
NASA Astrophysics Data System (ADS)
Salimbeni, Renzo
2005-06-01
The state of the art of laser techniques employed in conservation of cultural heritage is continuously growing in Europe. Many research projects organised at the European level have contributed to this achievement, being complementary to the development carried out at national level. The COST Action G7 is playing its unique role since the year 2000 in promoting the experimentation, comparing the experiences and disseminating best practices. This role has been particularly effective for monitoring of the results of many short-term research projects completed along the G7 Action lifetime. After that several laser cleaning techniques have been followed and evaluated it appears now clear an evolution of the systems, a specialization of the cleaning task, the achievement of side-effect free procedures. The validation of these advanced cleaning techniques has been extensive and diffused in many European countries, especially for stone and metals. Laser-based diagnostics have also specialised their tasks toward material analysis, defects detection and multidimensional documentation. Laser and optical methods successfully monitor deterioration effects. In many European countries interdisciplinary networks are managing the experimentation of these techniques giving them a sound scientific approach, but also a technology transfer to end-users. So doing the appreciation for these techniques is growing in all the conservation institutions involved at national level, disseminating a positive evaluation about the benefits provided by laser techniques in conservation. Several laser systems became products for the activity of professional restorers and their increasing sales demonstrate a growing utilisation throughout all Europe.
Aerospace management techniques: Commercial and governmental applications
NASA Technical Reports Server (NTRS)
Milliken, J. G.; Morrison, E. J.
1971-01-01
A guidebook for managers and administrators is presented as a source of useful information on new management methods in business, industry, and government. The major topics discussed include: actual and potential applications of aerospace management techniques to commercial and governmental organizations; aerospace management techniques and their use within the aerospace sector; and the aerospace sector's application of innovative management techniques.
Turbine Engine Flowpath Averaging Techniques
1980-10-01
u~%x AEDC- TMR- 8 I-G 1 • R. P TURBINE ENGINE FLOWPATH AVERAGING TECHNIQUES T. W. Skiles ARO, Inc. October 1980 Final Report for Period...COVERED 00-01-1980 to 00-10-1980 4. TITLE AND SUBTITLE Turbine Engine Flowpath Averaging Techniques 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...property for gas turbine engines were investigated. The investigation consisted of a literature review and review of turbine engine current flowpath
1985-04-01
Colonel Robert Fowler for sponsoring this project, Major Richard Hartson for diligently editing each draft and the men of ACSC Seminar A-li ( Mix 1...and AWC Seminar 15 ( Mix 1) for encouraging the author to introduce relaxation techniques to other military officers through this videotape. Special...anytime and without having to stop what you’re doing. The individuals were usually surprised at how easily deep breathing initiated a feeling of
Dust and ionized gas in active radio elliptical galaxies
NASA Technical Reports Server (NTRS)
Forbes, D. A.; Sparks, W. B.; Macchetto, F. D.
1990-01-01
The authors present broad and narrow bandwidth imaging of three southern elliptical galaxies which have flat-spectrum active radio cores (NGC 1052, IC 1459 and NGC 6958). All three contain dust and extended low excitation optical line emission, particularly extensive in the case of NGC 1052 which has a large H alpha + (NII) luminosity. Both NGC 1052 and IC 1459 have a spiral morphology in emission-line images. All three display independent strong evidence that a merger or infall event has recently occurred, i.e., extensive and infalling HI gas in NGC 1052, a counter-rotating core in IC 1459 and Malin-Carter shells in NGC 6958. This infall event is the most likely origin for the emission-line gas and dust, and the authors are currently investigating possible excitation mechanisms (Sparks et al. 1990).
Developments in caesarean section techniques: a review.
Uzoigwe, S A; Jeremiah, I
2006-01-01
Caesarean section is the most common surgical procedure performed on women world-wide. It is recommended when vaginal delivery might pose a risk to the mother or baby. This review examines the history and developments in caesarean section techniques over the years as well as the difficulties that may be encountered in each stage in our environment. A review of relevant literature was conducted using Pubmed and e-medicine websites for computer search. The following keywords were used: history, development, techniques and caesarean section. Relevant review articles, Cochrane database and chapters in text books were also used to extract information. Though practiced since ancient times, the history of caesarean section remains shrouded in myths as no document describing its indication and techniques is still available. Ancient medical writers like Galen, Hippocrates and Soranus made no mention of the procedure. However, the evidence that it was performed arose from legal texts. The development in its technique was gradual over many years. The development of caesarean section technique occurred with the withdrawal of surgeries from the stronghold of religion in Renaissance time. Operative techniques vary and this has continued to improve through many years of trial and error.
Psychodrama Techniques for Inservice Teacher Training
ERIC Educational Resources Information Center
Kohut, Sylvester, Jr.
1976-01-01
By using psychodrama techniques in inservice programming, improvement in communication among members of the school community occurs. With modification the psychodrama approach can be used with inservice teachers and administrators to improve self-realization and communication. A program using psychodrama techniques is described in the article.…
Techniques For Focusing In Zone Electrophoresis
NASA Technical Reports Server (NTRS)
Sharnez, Rizwan; Twitty, Garland E.; Sammons, David W.
1994-01-01
In two techniques for focusing in zone electrophoresis, force of applied electrical field in each charged particle balanced by restoring force of electro-osmosis. Two techniques: velocity-gradient focusing (VGF), suitable for rectangular electrophoresis chambers; and field-gradient focusing (FGF), suitable for step-shaped electrophoresis chambers.
Eddy current technique for predicting burst pressure
Petri, Mark C.; Kupperman, David S.; Morman, James A.; Reifman, Jaques; Wei, Thomas Y. C.
2003-01-01
A signal processing technique which correlates eddy current inspection data from a tube having a critical tubing defect with a range of predicted burst pressures for the tube is provided. The method can directly correlate the raw eddy current inspection data representing the critical tubing defect with the range of burst pressures using a regression technique, preferably an artificial neural network. Alternatively, the technique deconvolves the raw eddy current inspection data into a set of undistorted signals, each of which represents a separate defect of the tube. The undistorted defect signal which represents the critical tubing defect is related to a range of burst pressures utilizing a regression technique.
Computer-assisted techniques to evaluate fringe patterns
NASA Astrophysics Data System (ADS)
Sciammarella, Cesar A.; Bhat, Gopalakrishna K.
1992-01-01
Strain measurement using interferometry requires an efficient way to extract the desired information from interferometric fringes. Availability of digital image processing systems makes it possible to use digital techniques for the analysis of fringes. In the past, there have been several developments in the area of one dimensional and two dimensional fringe analysis techniques, including the carrier fringe method (spatial heterodyning) and the phase stepping (quasi-heterodyning) technique. This paper presents some new developments in the area of two dimensional fringe analysis, including a phase stepping technique supplemented by the carrier fringe method and a two dimensional Fourier transform method to obtain the strain directly from the discontinuous phase contour map.
Experimental Techniques for Thermodynamic Measurements of Ceramics
NASA Technical Reports Server (NTRS)
Jacobson, Nathan S.; Putnam, Robert L.; Navrotsky, Alexandra
1999-01-01
Experimental techniques for thermodynamic measurements on ceramic materials are reviewed. For total molar quantities, calorimetry is used. Total enthalpies are determined with combustion calorimetry or solution calorimetry. Heat capacities and entropies are determined with drop calorimetry, differential thermal methods, and adiabatic calorimetry . Three major techniques for determining partial molar quantities are discussed. These are gas equilibration techniques, Knudsen cell methods, and electrochemical techniques. Throughout this report, issues unique to ceramics are emphasized. Ceramic materials encompass a wide range of stabilities and this must be considered. In general data at high temperatures is required and the need for inert container materials presents a particular challenge.
Scaling Techniques for Combustion Device Random Vibration Predictions
NASA Technical Reports Server (NTRS)
Kenny, R. J.; Ferebee, R. C.; Duvall, L. D.
2016-01-01
This work presents compares scaling techniques that can be used for prediction of combustion device component random vibration levels with excitation due to the internal combustion dynamics. Acceleration and unsteady dynamic pressure data from multiple component test programs are compared and normalized per the two scaling approaches reviewed. Two scaling technique are reviewed and compared against the collected component test data. The first technique is an existing approach developed by Barrett, and the second technique is an updated approach new to this work. Results from utilizing both techniques are presented and recommendations about future component random vibration prediction approaches are given.
NASA standard: Trend analysis techniques
NASA Technical Reports Server (NTRS)
1990-01-01
Descriptive and analytical techniques for NASA trend analysis applications are presented in this standard. Trend analysis is applicable in all organizational elements of NASA connected with, or supporting, developmental/operational programs. This document should be consulted for any data analysis activity requiring the identification or interpretation of trends. Trend analysis is neither a precise term nor a circumscribed methodology: it generally connotes quantitative analysis of time-series data. For NASA activities, the appropriate and applicable techniques include descriptive and graphical statistics, and the fitting or modeling of data by linear, quadratic, and exponential models. Usually, but not always, the data is time-series in nature. Concepts such as autocorrelation and techniques such as Box-Jenkins time-series analysis would only rarely apply and are not included in this document. The basic ideas needed for qualitative and quantitative assessment of trends along with relevant examples are presented.
Reliability techniques for computer executive programs
NASA Technical Reports Server (NTRS)
1972-01-01
Computer techniques for increasing the stability and reliability of executive and supervisory systems were studied. Program segmentation characteristics are discussed along with a validation system which is designed to retain the natural top down outlook in coding. An analysis of redundancy techniques and roll back procedures is included.
Section summary: Integration of monitoring techniques
Yoshiyuki Kiyono; Rick Turner
2013-01-01
Techniques for monitoring deforestation and associated changes to forest carbon stocks are widespread and well published. In contrast, techniques for monitoring forest degradation are relatively untested in developing countries despite their inclusion in UNFCCC REDD+ negotiations. In the Mekong countries, forest degradation may contribute a substantial portion of the...
Use Management Techniques in Office Practice
ERIC Educational Resources Information Center
Holehan, E. Lee
1977-01-01
Notes that authenticity can be added to student work projects in an office practice class by having the teacher assume the role of the office manager or supervisor and putting office management techniques into practice. Ways in which such techniques may be infused into classes are examined. (TA)
Analytical Electrochemistry: Methodology and Applications of Dynamic Techniques.
ERIC Educational Resources Information Center
Heineman, William R.; Kissinger, Peter T.
1980-01-01
Reports developments involving the experimental aspects of finite and current analytical electrochemistry including electrode materials (97 cited references), hydrodynamic techniques (56), spectroelectrochemistry (62), stripping voltammetry (70), voltammetric techniques (27), polarographic techniques (59), and miscellany (12). (CS)
Techniques for cesarean section.
Hofmeyr, Justus G; Novikova, Natalia; Mathai, Matthews; Shah, Archana
2009-11-01
The effects of complete methods of cesarean section (CS) were compared. Metaanalysis of randomized controlled trials of intention to perform CS using different techniques was carried out. Joel-Cohen-based CS compared with Pfannenstiel CS was associated with reduced blood loss, operating time, time to oral intake, fever, duration of postoperative pain, analgesic injections, and time from skin incision to birth of the baby. Misgav-Ladach compared with the traditional method was associated with reduced blood loss, operating time, time to mobilization, and length of postoperative stay for the mother. Joel-Cohen-based methods have advantages compared with Pfannenstiel and traditional (lower midline) CS techniques. However, these trials do not provide information on serious and long-term outcomes.
[Molecular techniques in mycology].
Rodríguez-Tudela, Juan Luis; Cuesta, Isabel; Gómez-López, Alicia; Alastruey-Izquierdo, Ana; Bernal-Martínez, Leticia; Cuenca-Estrella, Manuel
2008-11-01
An increasing number of molecular techniques for the diagnosis of fungal infections have been developed in the last few years, due to the growing prevalence of mycoses and the length of time required for diagnosis when classical microbiological methods are used. These methods are designed to resolve the following aspects of mycological diagnosis: a) Identification of fungi to species level by means of sequencing relevant taxonomic targets; b) early clinical diagnosis of invasive fungal infections; c) detection of molecular mechanisms of resistance to antifungal agents; and d) molecular typing of fungi. Currently, these methods are restricted to highly developed laboratories. However, some of these techniques will probably be available in daily clinical practice in the near future.
Flexible single-incision surgery: a fusion technique.
Noguera, José F; Dolz, Carlos; Cuadrado, Angel; Olea, José; García, Juan
2013-06-01
The development of natural orifice transluminal endoscopic surgery has led to other techniques, such as single-incision surgery. The use of the flexible endoscope for single-incision surgery paves the way for further refinement of both surgical methods. To describe a new, single-incision surgical technique, namely, flexible single-incision surgery. Assessment of the safety and effectiveness of endoscopic cholecystectomy in a series of 30 patients. This technique consists of a single umbilical incision through which a flexible endoscope is introduced and consists of 2 parallel entry ports that provide access to nonarticulated laparoscopic instruments. The technique was applied in all patients for whom it was prescribed. No general or surgical wound complications were noted. Surgical time was no longer than usual for single-port surgery. Flexible single-incision surgery is a new single-site surgical technique offering the same level of patient safety, with additional advantages for the surgeon at minimal cost.
Chromatographic Techniques for Rare Earth Elements Analysis
NASA Astrophysics Data System (ADS)
Chen, Beibei; He, Man; Zhang, Huashan; Jiang, Zucheng; Hu, Bin
2017-04-01
The present capability of rare earth element (REE) analysis has been achieved by the development of two instrumental techniques. The efficiency of spectroscopic methods was extraordinarily improved for the detection and determination of REE traces in various materials. On the other hand, the determination of REEs very often depends on the preconcentration and separation of REEs, and chromatographic techniques are very powerful tools for the separation of REEs. By coupling with sensitive detectors, many ambitious analytical tasks can be fulfilled. Liquid chromatography is the most widely used technique. Different combinations of stationary phases and mobile phases could be used in ion exchange chromatography, ion chromatography, ion-pair reverse-phase chromatography and some other techniques. The application of gas chromatography is limited because only volatile compounds of REEs can be separated. Thin-layer and paper chromatography are techniques that cannot be directly coupled with suitable detectors, which limit their applications. For special demands, separations can be performed by capillary electrophoresis, which has very high separation efficiency.
A simple technique for laparoscopic gastrostomy.
Murphy, C; Rosemurgy, A S; Albrink, M H; Carey, L C
1992-05-01
While endoscopically placed gastrostomy tubes are routinely simple, they are not always feasible. Endoscopic technique also does not uniformly secure the tube to the abdominal wall, which presents possible complications, including leakage, accidental early tube removal, intraperitoneal catheter migration and necrosis of the stomach or abdominal wall because of excessive traction. Presented herein is a technique that is rapid, simple and eliminates some of these potential complications. The technique is easily combined with other operative procedures, such as tracheostomy, is done under direct vision, can be performed quickly with intravenous sedation and local anesthetic and is a safe method of tube placement for enteral feeding or gastric decompression.
Innovative application of virtual display technique in virtual museum
NASA Astrophysics Data System (ADS)
Zhang, Jiankang
2017-09-01
Virtual museum refers to display and simulate the functions of real museum on the Internet in the form of 3 Dimensions virtual reality by applying interactive programs. Based on Virtual Reality Modeling Language, virtual museum building and its effective interaction with the offline museum lie in making full use of 3 Dimensions panorama technique, virtual reality technique and augmented reality technique, and innovatively taking advantages of dynamic environment modeling technique, real-time 3 Dimensions graphics generating technique, system integration technique and other key virtual reality techniques to make sure the overall design of virtual museum.3 Dimensions panorama technique, also known as panoramic photography or virtual reality, is a technique based on static images of the reality. Virtual reality technique is a kind of computer simulation system which can create and experience the interactive 3 Dimensions dynamic visual world. Augmented reality, also known as mixed reality, is a technique which simulates and mixes the information (visual, sound, taste, touch, etc.) that is difficult for human to experience in reality. These technologies make virtual museum come true. It will not only bring better experience and convenience to the public, but also be conducive to improve the influence and cultural functions of the real museum.
Chromatic changes to artificial irises produced using different techniques
NASA Astrophysics Data System (ADS)
Bannwart, Lisiane Cristina; Goiato, Marcelo Coelho; dos Santos, Daniela Micheline; Moreno, Amália; Pesqueira, Aldiéris Alves; Haddad, Marcela Filié; Andreotti, Agda Marobo; de Medeiros, Rodrigo Antonio
2013-05-01
Ocular prostheses are important determinants of their users' aesthetic recovery and self-esteem. Because of use, ocular prostheses longevity is strongly affected by instability of the iris color due to polymerization. The goal of this study is to examine how the color of the artificial iris button is affected by different techniques of artificial wear and by the application of varnish following polymerization of the colorless acrylic resin that covers the colored paint. We produce 60 samples (n=10) according to the wear technique applied: conventional technique without varnish (PE); conventional technique with varnish (PEV); technique involving a prefabricated cap without varnish (CA); technique involving a prefabricated cap with varnish (CAV); technique involving inverted painting without varnish (PI); and technique involving inverted painting with varnish (PIV). Color readings using a spectrophotometer are taken before and after polymerization. We submitted the data obtained to analyses of variance and Tukey's test (P<0.05). The color test shows significant changes after polymerization in all groups. The PE and PI techniques have clinically acceptable values of ΔE, independent of whether we apply varnish to protect the paint. The PI technique produces the least color change, whereas the PE and CA techniques significantly improve color stability.
Mercedes-Benz pyloroplasty: a new technique.
Vashney, S; Somers, S S
2001-01-01
Closure of large duodeno-pyloro-gastrotomy can be difficult. The resulting 'pyloroplasty' may lead to major deformity at the gastric outlet. We describe a technique that combines features of the Heineke-Mikulicz pyloroplasty and V-Y plasty. The technique is simple and is not associated with any new post-operative problem.
Techniques for Enhancing Web-Based Education.
ERIC Educational Resources Information Center
Barbieri, Kathy; Mehringer, Susan
The Virtual Workshop is a World Wide Web-based set of modules on high performance computing developed at the Cornell Theory Center (CTC) (New York). This approach reaches a large audience, leverages staff effort, and poses challenges for developing interesting presentation techniques. This paper describes the following techniques with their…
Computerized proof techniques for undergraduates
NASA Astrophysics Data System (ADS)
Smith, Christopher J.; Tefera, Akalu; Zeleke, Aklilu
2012-12-01
The use of computer algebra systems such as Maple and Mathematica is becoming increasingly important and widespread in mathematics learning, teaching and research. In this article, we present computerized proof techniques of Gosper, Wilf-Zeilberger and Zeilberger that can be used for enhancing the teaching and learning of topics in discrete mathematics. We demonstrate by examples how one can use these computerized proof techniques to raise students' interests in the discovery and proof of mathematical identities and enhance their problem-solving skills.
ERIC Educational Resources Information Center
Sheard, Michael
2009-01-01
More often than one might at first imagine, a simple trick involving integration by parts can be used to compute indefinite integrals in unexpected and amusing ways. A systematic look at the trick illuminates the question of whether the trick is useful enough to be called an actual technique of integration.
Advanced millimeter-wave security portal imaging techniques
NASA Astrophysics Data System (ADS)
Sheen, David M.; Bernacki, Bruce E.; McMakin, Douglas L.
2012-03-01
Millimeter-wave (mm-wave) imaging is rapidly gaining acceptance as a security tool to augment conventional metal detectors and baggage x-ray systems for passenger screening at airports and other secured facilities. This acceptance indicates that the technology has matured; however, many potential improvements can yet be realized. The authors have developed a number of techniques over the last several years including novel image reconstruction and display techniques, polarimetric imaging techniques, array switching schemes, and high-frequency high-bandwidth techniques. All of these may improve the performance of new systems; however, some of these techniques will increase the cost and complexity of the mm-wave security portal imaging systems. Reducing this cost may require the development of novel array designs. In particular, RF photonic methods may provide new solutions to the design and development of the sequentially switched linear mm-wave arrays that are the key element in the mm-wave portal imaging systems. Highfrequency, high-bandwidth designs are difficult to achieve with conventional mm-wave electronic devices, and RF photonic devices may be a practical alternative. In this paper, the mm-wave imaging techniques developed at PNNL are reviewed and the potential for implementing RF photonic mm-wave array designs is explored.
Questions, Questioning Techniques, and Effective Teaching.
ERIC Educational Resources Information Center
Wilen, William W., Ed.
This book focuses on questioning techniques and strategies teachers may employ to make the difference between active and passive learning in the classroom. There are nine chapters: (1) Why Questions? (Ambrose A. Clegg, Jr.); (2) Review of Research on Questioning Techniques (Meredith D. Gall and Tom Rhody); (3) The Multidisciplinary World of…
Stress Management Techniques for Young Children.
ERIC Educational Resources Information Center
Piper, Francesca M.
The director of a not-for-profit nursery school adapted the adult stress management techniques of exercise and relaxation for use with 3- to 5-year-old children. Specifically, children were taught visualization techniques and yoga exercises involving deep breathing. The goal of the practicum was to rechannel children's negative stress-related…
Enhanced microwave characterisation technique for cryogenic temperatures
NASA Astrophysics Data System (ADS)
Smuk, J. W.; Stubbs, M. G.; Wight, J. S.
1990-12-01
A real-time technique to de-embed broadband S-parameter measurements of MIC/MMIC devices at temperatures down to 13 K is presented. Exceptional accuracy is obtained by using a split-block test fixture and the TRL calibration technique at cryogenic temperatures for the first time. The repeatability of the technique and the measurement of a transmission line at 297 K and 77 K are demonstrated from 0.1 GHz to 20 GHz.
[Surgical techniques in liver transplantation].
Chan, Carlos; Plata-Muñoz, Juan José; Franssen, Bernardo
2005-01-01
Liver transplantation (LT) is probably the biggest surgical aggression that a patient can endure. It was considered only as a last option in the era of experimental LT, yet it evolved into the definitive treatment for some types of acute and chronic end stage liver disease. In terms of technique LT is the most complex of all types of transplantations. The surgical procedure in itself is well established and has changed little through time. Liver transplantation owes its improvement to better and more systematic anesthetic procedures and to perioperative care more than being due to improvement of the surgical technique. The first surgical procedure was described by Thomas Starzl in 1969. His initial work has been strengthened with the development of venous bypass, the refinement in vascular and biliary reconstruction technique and the development of the split liver. Up to date technical aspects of orthotopic liver transplantation are described in the present article.
NASA standard: Trend analysis techniques
NASA Technical Reports Server (NTRS)
1988-01-01
This Standard presents descriptive and analytical techniques for NASA trend analysis applications. Trend analysis is applicable in all organizational elements of NASA connected with, or supporting, developmental/operational programs. Use of this Standard is not mandatory; however, it should be consulted for any data analysis activity requiring the identification or interpretation of trends. Trend Analysis is neither a precise term nor a circumscribed methodology, but rather connotes, generally, quantitative analysis of time-series data. For NASA activities, the appropriate and applicable techniques include descriptive and graphical statistics, and the fitting or modeling of data by linear, quadratic, and exponential models. Usually, but not always, the data is time-series in nature. Concepts such as autocorrelation and techniques such as Box-Jenkins time-series analysis would only rarely apply and are not included in this Standard. The document presents the basic ideas needed for qualitative and quantitative assessment of trends, together with relevant examples. A list of references provides additional sources of information.
Tandon, Nikhil; Kalra, Sanjay; Balhara, Yatan Pal Singh; Baruah, Manash P.; Chadha, Manoj; Chandalia, Hemraj B.; Chowdhury, Subhankar; Jothydev, Kesavadev; Kumar, Prasanna K. M.; V., Madhu S.; Mithal, Ambrish; Modi, Sonal; Pitale, Shailesh; Sahay, Rakesh; Shukla, Rishi; Sundaram, Annamalai; Unnikrishnan, Ambika G.; Wangnoo, Subhash K.
2015-01-01
As injectable therapies such as human insulin, insulin analogs, and glucagon-like peptide-1 receptor agonists are used to manage diabetes, correct injection technique is vital for the achievement of glycemic control. The forum for injection technique India acknowledged this need for the first time in India and worked to develop evidence-based recommendations on insulin injection technique, to assist healthcare practitioners in their clinical practice. PMID:25932385
Liquid Biopsy zur Überwachung von Melanompatienten.
Gaiser, Maria Rita; von Bubnoff, Nikolas; Gebhardt, Christoffer; Utikal, Jochen Sven
2018-04-01
In den letzten sechs Jahren wurden verschiedene innovative systemische Therapien zur Behandlung des metastasierten malignen Melanoms (MM) entwickelt. Die konventionelle Chemotherapie wurde durch neuartige Primärtherapien abgelöst, darunter systemische Immuntherapien (Anti-CTLA4- und Anti-PD1-Antikörper; Zulassung von Anti-PDL1-Antikörpern erwartet) und Therapien, die gegen bestimmte Mutationen gerichtet sind (BRAF, NRAS und c-KIT). Daher stehen die behandelnden Ärzte neuen Herausforderungen gegenüber, beispielsweise der Stratifizierung von Patienten für geeignete Behandlungen und der Überwachung von Langzeit-Respondern auf Progression. Folglich werden zuverlässige Methoden zur Überwachung von Krankheitsprogression oder Behandlungsresistenz benötigt. Lokalisierte und fortgeschrittene Krebserkrankungen können zur Bildung zirkulierender Tumorzellen und Tumor-DNA (ctDNA) führen, die sich in Proben von peripherem Blut nachweisen und quantifizieren lassen (Liquid Biopsy). Im Fall von Melanompatienten können die Ergebnisse von Liquid Biopsy als neuartige prädiktive Biomarker bei therapeutischen Entscheidungen hilfreich sein, insbesondere im Zusammenhang mit mutationsbasierten zielgerichteten Therapien. Die Herausforderungen bei der Anwendung der Liquid Biopsy beinhalten strikte Kriterien für den Phänotyp der zirkulierenden MM-Zellen oder ihrer Fragmente und die Instabilität von ctDNA im Blut. In diesem Übersichtsartikel diskutieren wir die Beschränkungen der Liquid Biopsy hinsichtlich ihrer Anwendung in der Routinediagnostik. © 2018 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
A Biomechanical Modeling Guided CBCT Estimation Technique
Zhang, You; Tehrani, Joubin Nasehi; Wang, Jing
2017-01-01
Two-dimensional-to-three-dimensional (2D-3D) deformation has emerged as a new technique to estimate cone-beam computed tomography (CBCT) images. The technique is based on deforming a prior high-quality 3D CT/CBCT image to form a new CBCT image, guided by limited-view 2D projections. The accuracy of this intensity-based technique, however, is often limited in low-contrast image regions with subtle intensity differences. The solved deformation vector fields (DVFs) can also be biomechanically unrealistic. To address these problems, we have developed a biomechanical modeling guided CBCT estimation technique (Bio-CBCT-est) by combining 2D-3D deformation with finite element analysis (FEA)-based biomechanical modeling of anatomical structures. Specifically, Bio-CBCT-est first extracts the 2D-3D deformation-generated displacement vectors at the high-contrast anatomical structure boundaries. The extracted surface deformation fields are subsequently used as the boundary conditions to drive structure-based FEA to correct and fine-tune the overall deformation fields, especially those at low-contrast regions within the structure. The resulting FEA-corrected deformation fields are then fed back into 2D-3D deformation to form an iterative loop, combining the benefits of intensity-based deformation and biomechanical modeling for CBCT estimation. Using eleven lung cancer patient cases, the accuracy of the Bio-CBCT-est technique has been compared to that of the 2D-3D deformation technique and the traditional CBCT reconstruction techniques. The accuracy was evaluated in the image domain, and also in the DVF domain through clinician-tracked lung landmarks. PMID:27831866
Modified Endonasal Tongue-in-Groove Technique.
Kadakia, Sameep; Ovchinsky, Alexander
2016-10-01
Achieving stable and desirable changes in tip rotation (TR) and tip projection (TP) is among the primary goals of modern day rhinoplasty. The tongue-in-groove (TIG) technique is one technique in rhinoplasty used to improve TR and/or TP. Performing TIG endonasally using a permanent suture can be quite cumbersome as the suture needs to be buried under the skin. We describe a variation of TIG technique for endonasal rhinoplasty using a permanent suture buried in small columellar skin incisions. The technique details are described and the postoperative changes in TR and TP are analyzed for the degree of change and longevity. A retrospective review of the preoperative and postoperative photographs of 12 patients treated with the endonasal TIG technique were analyzed for changes in TR and TP. Out of 12 patients, there were seven females (58.3%) and five males (41.7%), with age ranging from 17 to 49 years. The follow-up ranged from 6 months to 53 months, with mean follow-up of 12.1 months. All patients were treated by the senior author in a major New York City hospital. Postoperative changes in TR and TP were compared by measuring the nasolabial angle as well as the Goode ratio using a photo editing software. Using a t-test and a p-value criteria of 0.05, the difference between the preoperative and postoperative TR (p = 0.0069) and TP (p = 0.026) was found to be statistically significant. None of the study patients developed any complications related to the use of a permanent suture material during the follow-up period. Our modified TIG technique is a quick, reliable, and safe option in the surgical armamentarium to achieve desired changes in TR and/or TP. 4. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Cognitive Support in Teaching Football Techniques
ERIC Educational Resources Information Center
Duda, Henryk
2009-01-01
Study aim: To improve the teaching of football techniques by applying cognitive and imagery techniques. Material and methods: Four groups of subjects, n = 32 each, were studied: male and female physical education students aged 20-21 years, not engaged previously in football training; male juniors and minors, aged 16 and 13 years, respectively,…
Techniques for Forecasting Air Passenger Traffic
NASA Technical Reports Server (NTRS)
Taneja, N.
1972-01-01
The basic techniques of forecasting the air passenger traffic are outlined. These techniques can be broadly classified into four categories: judgmental, time-series analysis, market analysis and analytical. The differences between these methods exist, in part, due to the degree of formalization of the forecasting procedure. Emphasis is placed on describing the analytical method.
Exploring Fencerows--An Outdoor Teaching Technique.
ERIC Educational Resources Information Center
Rillo, Thomas J.
The exploration of fencerows as an outdoor teaching technique is described. The concepts that can be developed as students walk down the fencerows are related to science, life styles, and economy. By dividing a class into small groups, a teacher can employ problem-solving techniques in fencerow exploration. The following group topics are possible…
Communications techniques and equipment: A compilation
NASA Technical Reports Server (NTRS)
1975-01-01
This Compilation is devoted to equipment and techniques in the field of communications. It contains three sections. One section is on telemetry, including articles on radar and antennas. The second section describes techniques and equipment for coding and handling data. The third and final section includes descriptions of amplifiers, receivers, and other communications subsystems.
The Hall Technique for managing carious primary molars.
Innes, Nicola; Evans, Dafydd; Hall, Norna
2009-10-01
The Hall Technique, a method of managing carious primary molars effectively with preformed metal crowns, without the use of local anaesthesia, caries removal or tooth preparation of any kind, is described.The technique is illustrated with a case report.The evidence underpinning the technique is discussed, along with indications and contra-indications for its use, and details of where clinicians can obtain further information on the technique if they are considering using it. Research evidence has indicated that the Hall Technique is effective in managing dental caries in primary molar teeth when used by General Dental Practitioners, and is preferred by them, their child patients and the children's parents to conventional restorative methods for these teeth.
Prostate Cancer Probability Prediction By Machine Learning Technique.
Jović, Srđan; Miljković, Milica; Ivanović, Miljan; Šaranović, Milena; Arsić, Milena
2017-11-26
The main goal of the study was to explore possibility of prostate cancer prediction by machine learning techniques. In order to improve the survival probability of the prostate cancer patients it is essential to make suitable prediction models of the prostate cancer. If one make relevant prediction of the prostate cancer it is easy to create suitable treatment based on the prediction results. Machine learning techniques are the most common techniques for the creation of the predictive models. Therefore in this study several machine techniques were applied and compared. The obtained results were analyzed and discussed. It was concluded that the machine learning techniques could be used for the relevant prediction of prostate cancer.
Simulation techniques in hyperthermia treatment planning
Paulides, MM; Stauffer, PR; Neufeld, E; Maccarini, P; Kyriakou, A; Canters, RAM; Diederich, C; Bakker, JF; Van Rhoon, GC
2013-01-01
Clinical trials have shown that hyperthermia (HT), i.e. an increase of tissue temperature to 39-44°C, significantly enhance radiotherapy and chemotherapy effectiveness (1). Driven by the developments in computational techniques and computing power, personalized hyperthermia treatment planning (HTP) has matured and has become a powerful tool for optimizing treatment quality. Electromagnetic, ultrasound, and thermal simulations using realistic clinical setups are now being performed to achieve patient-specific treatment optimization. In addition, extensive studies aimed to properly implement novel HT tools and techniques, and to assess the quality of HT, are becoming more common. In this paper, we review the simulation tools and techniques developed for clinical hyperthermia, and evaluate their current status on the path from “model” to “clinic”. In addition, we illustrate the major techniques employed for validation and optimization. HTP has become an essential tool for improvement, control, and assessment of HT treatment quality. As such, it plays a pivotal role in the quest to establish HT as an efficacious addition to multi-modality treatment of cancer. PMID:23672453
Multidirectional mobilities: Advanced measurement techniques and applications
NASA Astrophysics Data System (ADS)
Ivarsson, Lars Holger
Today high noise-and-vibration comfort has become a quality sign of products in sectors such as the automotive industry, aircraft, components, households and manufacturing. Consequently, already in the design phase of products, tools are required to predict the final vibration and noise levels. These tools have to be applicable over a wide frequency range with sufficient accuracy. During recent decades a variety of tools have been developed such as transfer path analysis (TPA), input force estimation, substructuring, coupling by frequency response functions (FRF) and hybrid modelling. While these methods have a well-developed theoretical basis, their application combined with experimental data often suffers from a lack of information concerning rotational DOFs. In order to measure response in all 6 DOFs (including rotation), a sensor has been developed, whose special features are discussed in the thesis. This transducer simplifies the response measurements, although in practice the excitation of moments appears to be more difficult. Several excitation techniques have been developed to enable measurement of multidirectional mobilities. For rapid and simple measurement of the loaded mobility matrix, a MIMO (Multiple Input Multiple Output) technique is used. The technique has been tested and validated on several structures of different complexity. A second technique for measuring the loaded 6-by-6 mobility matrix has been developed. This technique employs a model of the excitation set-up, and with this model the mobility matrix is determined from sequential measurements. Measurements on ``real'' structures show that both techniques give results of similar quality, and both are recommended for practical use. As a further step, a technique for measuring the unloaded mobilities is presented. It employs the measured loaded mobility matrix in order to calculate compensation forces and moments, which are later applied in order to compensate for the loading of the
A Generalized Technique in Numerical Integration
NASA Astrophysics Data System (ADS)
Safouhi, Hassan
2018-02-01
Integration by parts is one of the most popular techniques in the analysis of integrals and is one of the simplest methods to generate asymptotic expansions of integral representations. The product of the technique is usually a divergent series formed from evaluating boundary terms; however, sometimes the remaining integral is also evaluated. Due to the successive differentiation and anti-differentiation required to form the series or the remaining integral, the technique is difficult to apply to problems more complicated than the simplest. In this contribution, we explore a generalized and formalized integration by parts to create equivalent representations to some challenging integrals. As a demonstrative archetype, we examine Bessel integrals, Fresnel integrals and Airy functions.
[Rehabilitation, ethics and technique].
De Martini, André
2011-04-01
This paper initially includes the presentation of some ideas on the deficiency and the process of rehabilitation, whereby the latter is defined in its "condition" as a process. A few differences in relation to the idea of a program in the strict sense (defined as a fixed set of previously defined procedures or techniques) will be detected, as well as some ethical implications in the social, health or educational fields for professionals working with the disabled. Thus, the handling of the technique and the use of institutional measures will be discussed in this context, inasmuch as they are related to subjective and educational processes inherent to rehabilitation work. In so doing, we hope to contribute to a better understanding of the role pertaining to these professionals.
NASA Astrophysics Data System (ADS)
Creasey, C. L.; Flegal, A. R.
The combined use of both (1) low-flow purging and sampling and (2) trace-metal clean techniques provides more representative measurements of trace-element concentrations in groundwater than results derived with standard techniques. The use of low-flow purging and sampling provides relatively undisturbed groundwater samples that are more representative of in situ conditions, and the use of trace-element clean techniques limits the inadvertent introduction of contaminants during sampling, storage, and analysis. When these techniques are applied, resultant trace-element concentrations are likely to be markedly lower than results based on standard sampling techniques. In a comparison of data derived from contaminated and control groundwater wells at a site in California, USA, trace-element concentrations from this study were 2-1000 times lower than those determined by the conventional techniques used in sampling of the same wells prior to (5months) and subsequent to (1month) the collections for this study. Specifically, the cadmium and chromium concentrations derived using standard sampling techniques exceed the California Maximum Contaminant Levels (MCL), whereas in this investigation concentrations of both of those elements are substantially below their MCLs. Consequently, the combined use of low-flow and trace-metal clean techniques may preclude erroneous reports of trace-element contamination in groundwater. Résumé L'utilisation simultanée de la purge et de l'échantillonnage à faible débit et des techniques sans traces de métaux permet d'obtenir des mesures de concentrations en éléments en traces dans les eaux souterraines plus représentatives que les résultats fournis par les techniques classiques. L'utilisation de la purge et de l'échantillonnage à faible débit donne des échantillons d'eau souterraine relativement peu perturbés qui sont plus représentatifs des conditions in situ, et le recours aux techniques sans éléments en traces limite l
Microfabrication Techniques for Plastic Microelectromechanical Systems (MEMS)
2003-07-01
micromachining techniques were investigated. Surface micromachining techniques include deposition of thin and thick polymer films using vacuum and spin ...1 2.0 Introduction ...100 4.3.1 Nozzle-diffuser pumps theory
Alchemy of the Oracle: The Delphi Technique.
ERIC Educational Resources Information Center
Wilhelm, William J.
2001-01-01
Discusses the origins and foundations of the Delphi technique. Outlines procedures for using it in research to obtain the insights of experts. Addresses limitations of the technique. (Contains 44 references.) (SK)
The Eight Frame Colored Squiggle Technique
ERIC Educational Resources Information Center
Steinhardt, Lenore
2006-01-01
In this art therapy adaptation of the squiggle technique, the client draws eight colored squiggles on a paper folded into eight frames and then develops them into images utilizing a full range of color. The client is encouraged to write titles on each frame and use them to compose a story. This technique often stimulates emergence of meaningful…
Four-point injection technique for lip augmentation.
Sahan, Ali; Funda, Tamer
2018-06-01
Lip augmentation procedures with hyaluronic acid dermal fillers have become increasingly popular worldwide because full lips are often considered beautiful and youthful. The goal of a lip augmentation procedure is to create smooth lips with adequate volume and a natural appearance. Various techniques for lip augmentation have been utilized and described. In the four-point injection technique, the lips were divided equally into right side and left side. Four entry points were made above the vermilion border for the upper lip and below the vermilion border for the lower lip. The filler was administered with a fanning technique through each entry point. Between January 2017 and November 2017, 50 female patients underwent a nonsurgical lip augmentation procedure with injectable fillers using this technique. Forty-five patients (90%) reported that they were satisfied or extremely satisfied with their lip enhancement procedure. No serious complications were observed. The advantages of this technique are reducing the risk of complications like erythema, edema, and vascular injuries, and providing easy access to injection sites.
Buteyko technique use to control asthma symptoms.
Austin, Gillian
The Buteyko breathing technique is recommended in national guidance for control of asthma symptoms. This article explores the evidence base for the technique, outlines its main principles and includes two cases studies.
Techniques for measurement of thoracoabdominal asynchrony
NASA Technical Reports Server (NTRS)
Prisk, G. Kim; Hammer, J.; Newth, Christopher J L.
2002-01-01
Respiratory motion measured by respiratory inductance plethysmography often deviates from the sinusoidal pattern assumed in the traditional Lissajous figure (loop) analysis used to determine thoraco-abdominal asynchrony, or phase angle phi. We investigated six different time-domain methods of measuring phi, using simulated data with sinusoidal and triangular waveforms, phase shifts of 0-135 degrees, and 10% noise. The techniques were then used on data from 11 lightly anesthetized rhesus monkeys (Macaca mulatta; 7.6 +/- 0.8 kg; 5.7 +/- 0.5 years old), instrumented with a respiratory inductive plethysmograph, and subjected to increasing levels of inspiratory resistive loading ranging from 5-1,000 cmH(2)O. L(-1). sec(-1).The best results were obtained from cross-correlation and maximum linear correlation, with errors less than approximately 5 degrees from the actual phase angle in the simulated data. The worst performance was produced by the loop analysis, which in some cases was in error by more than 30 degrees. Compared to correlation, other analysis techniques performed at an intermediate level. Maximum linear correlation and cross-correlation produced similar results on the data collected from monkeys (SD of the difference, 4.1 degrees ) but all other techniques had a high SD of the difference compared to the correlation techniques.We conclude that phase angles are best measured using cross-correlation or maximum linear correlation, techniques that are independent of waveform shape, and robust in the presence of noise. Copyright 2002 Wiley-Liss, Inc.
Nonuniform sampling techniques for antenna applications
NASA Technical Reports Server (NTRS)
Rahmat-Samii, Yahya; Cheung, Rudolf Lap-Tung
1987-01-01
A two-dimensional sampling technique, which can employ irregularly spaced samples (amplitude and phase) in order to generate the complete far-field patterns is presented. The technique implements a matrix inversion algorithm, which depends only on the nonuniform sampled data point locations and with no dependence on the actual field values at these points. A powerful simulation algorithm is presented to allow a real-life simulation of many reflector/feed configurations and to determine the usefulness of the nonuniform sampling technique for the copolar and cross-polar patterns. Additionally, an overlapped window concept and a generalized error simulation model are discussed to identify the stability of the technique for recovering the field data among the nonuniform sampled data. Numerical results are tailored for the pattern reconstruction of a 20-m offset reflector antenna operating at L-band. This reflector is planned to be used in a proposed measurement concept of large antenna aboard the Space Shuttle, whereby it would be almost impractical to accurately control the movement of the Shuttle with respect to the RF source in prescribed directions in order to generate uniform sampled points. Also, application of the nonuniform sampling technique to patterns obtained using near-field measured data is demonstrated. Finally, results of an actual far-field measurement are presented for the construction of patterns of a reflector antenna from a set of nonuniformly distributed measured amplitude and phase data.
The Trajectory of Techniques: Lessons from the Past.
ERIC Educational Resources Information Center
Crease, Robert P.
1992-01-01
Discusses role of laboratory techniques in scientific investigations. Describes Rutherford's development of scattering techniques and von Wassermann's development of test for syphilis. States that discovering an effect requires a brilliant scientist, however, making it a technique requires that it be made usable by ordinary people. Uses Moseley's…
Selected photographic techniques, a compilation
NASA Technical Reports Server (NTRS)
1971-01-01
A selection has been made of methods, devices, and techniques developed in the field of photography during implementation of space and nuclear research projects. These items include many adaptations, variations, and modifications to standard hardware and practice, and should prove interesting to both amateur and professional photographers and photographic technicians. This compilation is divided into two sections. The first section presents techniques and devices that have been found useful in making photolab work simpler, more productive, and higher in quality. Section two deals with modifications to and special applications for existing photographic equipment.
Contoured technique for lentigo maligna*
Mateus, Monica Jidid; Tortelly, Violeta Duarte; Barcaui, Carlos Baptista; Jourdan, Carla Araujo; Simão, Tassiana; Maceira, Juan Manuel Piñeiro
2015-01-01
The surgical approach to lentigo maligna is a challenge to dermatologists, given the difficulty of clinical delimitation of borders. We report here a case of a 69-year-old female patient presenting with brownish macules on her face, since 10 years ago, with histopathological diagnosis of lentigo maligna. The surgical management employed was excision of visible borders with the contoured technique and immediate submission of these borders for histopathological analysis before complete excision of the tumor. This technique is a variant of staged excision, with lower rates of recurrence and acceptable aesthetic results. PMID:25672308
Nasal hydropulsion: a novel tumor biopsy technique.
Ashbaugh, Elizabeth A; McKiernan, Brendan C; Miller, Carrie J; Powers, Barbara
2011-01-01
Intranasal tumors of dogs and cats pose a diagnostic and therapeutic challenge for small animal practitioners. Multiple nasal biopsy techniques have been described in the past. This report describes a simplified flushing technique to biopsy and debulk nasal tumors, which often also results in immediate clinical relief for the patient. Based on the results of this retrospective study, the authors recommend high-pressure saline hydropulsion as a minimally invasive diagnostic, and potentially therapeutic, technique for nasal tumors in dogs and cats.
The efficacy of the 'mind map' study technique.
Farrand, Paul; Hussain, Fearzana; Hennessy, Enid
2002-05-01
To examine the effectiveness of using the 'mind map' study technique to improve factual recall from written information. To obtain baseline data, subjects completed a short test based on a 600-word passage of text prior to being randomly allocated to form two groups: 'self-selected study technique' and 'mind map'. After a 30-minute interval the self-selected study technique group were exposed to the same passage of text previously seen and told to apply existing study techniques. Subjects in the mind map group were trained in the mind map technique and told to apply it to the passage of text. Recall was measured after an interfering task and a week later. Measures of motivation were taken. Barts and the London School of Medicine and Dentistry, University of London. 50 second- and third-year medical students. Recall of factual material improved for both the mind map and self-selected study technique groups at immediate test compared with baseline. However this improvement was only robust after a week for those in the mind map group. At 1 week, the factual knowledge in the mind map group was greater by 10% (adjusting for baseline) (95% CI -1% to 22%). However motivation for the technique used was lower in the mind map group; if motivation could have been made equal in the groups, the improvement with mind mapping would have been 15% (95% CI 3% to 27%). Mind maps provide an effective study technique when applied to written material. However before mind maps are generally adopted as a study technique, consideration has to be given towards ways of improving motivation amongst users.
Holographic Techniques for Nondestructive Testing of Tires
DOT National Transportation Integrated Search
1972-04-01
Holographic interferometric techniques were used in a development program to evaluate the feasibility of the technique in the nondestructive testing (NDT) of commercial automobile tires. Passenger tires with built-in defects were holographically insp...
Alternative Shapes and Shaping Techniques for Enhanced Transformer Ratios in Beam Driven Techniques
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lemery, F.; Piot, P.
The transformer ration of collinear beam-driven techniques can be significantly improved by shaping the current profile of the drive bunch. To date, several current shapes have been proposed to increase the transformer ratio and produce quasi-uniform energy loss within the drive bunch. Some of these tailoring techniques are possible as a results of recent beam-dynamics advances, e.g., transverse-to-longitudinal emittance exchanger. In ths paper, we propose an alternative class of longitudinal shapes that enable high transformer ratio and uniform energy loss across the drive bunch. We also suggest a simple method based on photocathode-laser shaping and passive shaping in wakefield structuremore » to realize shape close to the theoretically optimized current profiles.« less
A Survey of Techniques for Approximate Computing
Mittal, Sparsh
2016-03-18
Approximate computing trades off computation quality with the effort expended and as rising performance demands confront with plateauing resource budgets, approximate computing has become, not merely attractive, but even imperative. Here, we present a survey of techniques for approximate computing (AC). We discuss strategies for finding approximable program portions and monitoring output quality, techniques for using AC in different processing units (e.g., CPU, GPU and FPGA), processor components, memory technologies etc., and programming frameworks for AC. Moreover, we classify these techniques based on several key characteristics to emphasize their similarities and differences. Finally, the aim of this paper is tomore » provide insights to researchers into working of AC techniques and inspire more efforts in this area to make AC the mainstream computing approach in future systems.« less
Task Oriented Evaluation of Module Extraction Techniques
NASA Astrophysics Data System (ADS)
Palmisano, Ignazio; Tamma, Valentina; Payne, Terry; Doran, Paul
Ontology Modularization techniques identify coherent and often reusable regions within an ontology. The ability to identify such modules, thus potentially reducing the size or complexity of an ontology for a given task or set of concepts is increasingly important in the Semantic Web as domain ontologies increase in terms of size, complexity and expressivity. To date, many techniques have been developed, but evaluation of the results of these techniques is sketchy and somewhat ad hoc. Theoretical properties of modularization algorithms have only been studied in a small number of cases. This paper presents an empirical analysis of a number of modularization techniques, and the modules they identify over a number of diverse ontologies, by utilizing objective, task-oriented measures to evaluate the fitness of the modules for a number of statistical classification problems.
Glycoprotein Enrichment Analytical Techniques: Advantages and Disadvantages.
Zhu, R; Zacharias, L; Wooding, K M; Peng, W; Mechref, Y
2017-01-01
Protein glycosylation is one of the most important posttranslational modifications. Numerous biological functions are related to protein glycosylation. However, analytical challenges remain in the glycoprotein analysis. To overcome the challenges associated with glycoprotein analysis, many analytical techniques were developed in recent years. Enrichment methods were used to improve the sensitivity of detection, while HPLC and mass spectrometry methods were developed to facilitate the separation of glycopeptides/proteins and enhance detection, respectively. Fragmentation techniques applied in modern mass spectrometers allow the structural interpretation of glycopeptides/proteins, while automated software tools started replacing manual processing to improve the reliability and throughput of the analysis. In this chapter, the current methodologies of glycoprotein analysis were discussed. Multiple analytical techniques are compared, and advantages and disadvantages of each technique are highlighted. © 2017 Elsevier Inc. All rights reserved.
Swept Impact Seismic Technique (SIST)
Park, C.B.; Miller, R.D.; Steeples, D.W.; Black, R.A.
1996-01-01
A coded seismic technique is developed that can result in a higher signal-to-noise ratio than a conventional single-pulse method does. The technique is cost-effective and time-efficient and therefore well suited for shallow-reflection surveys where high resolution and cost-effectiveness are critical. A low-power impact source transmits a few to several hundred high-frequency broad-band seismic pulses during several seconds of recording time according to a deterministic coding scheme. The coding scheme consists of a time-encoded impact sequence in which the rate of impact (cycles/s) changes linearly with time providing a broad range of impact rates. Impact times used during the decoding process are recorded on one channel of the seismograph. The coding concept combines the vibroseis swept-frequency and the Mini-Sosie random impact concepts. The swept-frequency concept greatly improves the suppression of correlation noise with much fewer impacts than normally used in the Mini-Sosie technique. The impact concept makes the technique simple and efficient in generating high-resolution seismic data especially in the presence of noise. The transfer function of the impact sequence simulates a low-cut filter with the cutoff frequency the same as the lowest impact rate. This property can be used to attenuate low-frequency ground-roll noise without using an analog low-cut filter or a spatial source (or receiver) array as is necessary with a conventional single-pulse method. Because of the discontinuous coding scheme, the decoding process is accomplished by a "shift-and-stacking" method that is much simpler and quicker than cross-correlation. The simplicity of the coding allows the mechanical design of the source to remain simple. Several different types of mechanical systems could be adapted to generate a linear impact sweep. In addition, the simplicity of the coding also allows the technique to be used with conventional acquisition systems, with only minor modifications.
A novel bit-wise adaptable entropy coding technique
NASA Technical Reports Server (NTRS)
Kiely, A.; Klimesh, M.
2001-01-01
We present a novel entropy coding technique which is adaptable in that each bit to be encoded may have an associated probability esitmate which depends on previously encoded bits. The technique may have advantages over arithmetic coding. The technique can achieve arbitrarily small redundancy and admits a simple and fast decoder.
Techniques for inventorying manmade impacts in roadway environments.
Dale R. Potter; J. Alan. Wagar
1971-01-01
Four techniques for inventorying manmade impacts along roadway corridors were devised and compared. Ground surveillance and ground photography techniques recorded impacts within the corridor visible from the road. Techniques on large- and small-scale aerial photography recorded impacts within a more complete corridor that included areas screened from the road by...
A Comparison of FTNMR and FTIR Techniques.
ERIC Educational Resources Information Center
Ahn, Myong-Ku
1989-01-01
Nuclear magnetic resonance and infrared are two spectroscopic methods that commonly use the Fourier transform technique. Discussed are the similarities and differences in the use of the Fourier transform in these two spectroscopic techniques. (CW)
Validation of helicopter noise prediction techniques
NASA Technical Reports Server (NTRS)
Succi, G. P.
1981-01-01
The current techniques of helicopter rotor noise prediction attempt to describe the details of the noise field precisely and remove the empiricisms and restrictions inherent in previous methods. These techniques require detailed inputs of the rotor geometry, operating conditions, and blade surface pressure distribution. The purpose of this paper is to review those techniques in general and the Farassat/Nystrom analysis in particular. The predictions of the Farassat/Nystrom noise computer program, using both measured and calculated blade surface pressure data, are compared to measured noise level data. This study is based on a contract from NASA to Bolt Beranek and Newman Inc. with measured data from the AH-1G Helicopter Operational Loads Survey flight test program supplied by Bell Helicopter Textron.
Relaxation techniques for stress
... of your body. These sensors measure your skin temperature, brain waves, breathing, and muscle activity. You can ... more about any of these techniques through local classes, books, videos, or online. Alternative Names Relaxation response ...
Comparative study of nail sampling techniques in onychomycosis.
Shemer, Avner; Davidovici, Batya; Grunwald, Marcelo H; Trau, Henri; Amichai, Boaz
2009-07-01
Onychomycosis is a common problem. Obtaining accurate laboratory test results before treatment is important in clinical practice. The purpose of this study was to compare results of curettage and drilling techniques of nail sampling in the diagnosis of onychomycosis, and to establish the best technique and location of sampling. We evaluated 60 patients suffering from distal and lateral subungual onychomycosis and lateral subungual onychomycosis using curettage and vertical and horizontal drilling sampling techniques from three different sites of the infected nail. KOH examination and fungal culture were used for detection and identification of fungal infection. At each sample site, the horizontal drilling technique has a better culture sensitivity than curettage. Trichophyton rubrum was by far the most common pathogen detected by both techniques from all sampling sites. The drilling technique was found to be statistically better than curettage at each site of sampling, furthermore vertical drilling from the proximal part of the affected nail was found to be the best procedure for nail sampling. With each technique we found that the culture sensitivity improved as the location of the sample was more proximal. More types of pathogens were detected in samples taken by both methods from proximal parts of the affected nails.
Use of an algorithm in choosing abdominoplasty techniques.
Fernandes, Júlio Wilson; Damin, Renata; Holzmann, Marcos Vinícius Nasser; Ribas, Gabriel Gomes DE Oliveira
2018-01-01
to validate an algorithm for the choice of the abdominoplasty surgical technique among the five approaches established in the literature, according to the characteristics of the abdominal wall. we conducted a retrospective study of 245 patients undergoing abdominoplasty, for whom the method of choice of the surgical technique was the proposed algorithm, based on the degree of abdominal flaccidity determined by bimanual maneuver. We studied its applications and conveniences, as well as the complications inherent in each group studied. according to the algorithm used, the most frequently chosen technique was "Technique IV" (transverse dermolipectomy of Pitanguy - or with a Baroudi-Kepke incision), in 25.71% of the cases. "Technique I" (mini abdominoplasty) had the lowest incidence and the lowest rate of complications. On the opposite, "Technique III", dermolipectomy with remaining vertical scarring, presented a higher incidence of complications, requiring extreme caution in its indication, particularly in relation to patients' expectations regarding the resulting scar and its legal aspects. Among all conducts, the most frequent complication was seroma, with a 10.2% occurrence, solved by simple syringe aspiration and use of elastic compression mesh. the proposed algorithm facilitated the choice of abdominoplasty techniques, offering satisfactory results, which are in line with the complication rates published in the world literature.
Khater, Nazih; Shen, Jim; Arenas, Javier; Keheila, Mohamed; Alsyouf, Muhannad; Martin, Jacob A; Lightfoot, Michelle A; Li, Roger; Olgin, Gaudencio; Smith, Jason C; Baldwin, D Duane
2016-11-01
Traditional techniques for obtaining percutaneous renal access utilize continuous fluoroscopy. In an attempt to minimize radiation exposure, we describe a novel laser direct alignment radiation reduction technique (DARRT) for percutaneous access and test it in a bench-top model. In this randomized-controlled bench-top study, 20 medical personnel obtained renal accesses using both the conventional bullseye technique and the laser DARRT. The primary endpoint was total fluoroscopy time. Secondary endpoints included insertion time, puncture attempts, course corrections, and subjective procedural difficulty. In the laser DARRT, fluoroscopy was used with the C-arm positioned with the laser beam at a 30° angle. The access needle and hub were aligned with the laser beam. Effective caliceal puncture was confirmed with fluoroscopy and direct vision. The Paired samples Wilcoxon signed rank test was used for statistical analysis with significance at p < 0.05. A total of 120 needle placements were recorded. Fluoroscopy time for needle access using the laser DARRT was significantly lower than the bullseye technique in all groups as follows: attendings (7.09 vs 18.51 seconds; p < 0.001), residents (6.55 vs 13.93 seconds; p = 0.001), and medical students (6.69 vs 20.22 seconds; p < 0.001). Students rated the laser DARRT easier to use (2.56 vs 4.89; p < 0.001). No difference was seen in total access time, puncture attempts, or course corrections between techniques. The laser DARRT reduced fluoroscopy time by 63%, compared with the conventional bullseye technique. The least experienced users found the laser DARRT significantly easier to learn. This novel technique is promising and merits additional testing in animal and human models.
Achieving profound anesthesia using the intraosseous technique.
Coury, K A
1997-10-01
The intraosseous technique has been described as a useful adjunct to primary anesthetic administration. It has several advantages (Table 3) over other supplemental techniques in that it is relatively simple to implement into routine practice, it affords fast, predictable results, and it is relatively painless. The technique has been shown to be very successful in achieving profound pulpal anesthesia when administered as a supplement to the inferior alveolar nerve block and is effective in achieving profound anesthesia in irreversibly inflamed teeth, especially mandibular molars.
Emergency cricothyrotomy-a comparative study of different techniques in human cadavers.
Schober, Patrick; Hegemann, Martina C; Schwarte, Lothar A; Loer, Stephan A; Noetges, Peter
2009-02-01
Emergency cricothyrotomy is the final lifesaving option in "cannot intubate-cannot ventilate" situations. Fast, efficient and safe management is indispensable to reestablish oxygenation, thus the quickest, most reliable and safest technique should be used. Several cricothyrotomy techniques exist, which can be grouped into two categories: anatomical-surgical and puncture. We studied success rate, tracheal tube insertion time and complications of different techniques, including a novel cricothyrotomy scissors technique in human cadavers. Sixty-three inexperienced health care providers were randomly assigned to apply either an anatomical-surgical technique (standard surgical technique, n=18; novel cricothyrotomy scissors technique, n=14) or a puncture technique (catheter-over-needle technique, n=17; wire-guided technique, n=14). Airway access was almost always successful with the anatomical-surgical techniques (success rate in standard surgical group 94%, scissors group 100%). In contrast, the success rate was smaller (p<0.05) with the puncture techniques (catheter-over-needle group 82%, wire-guided technique 71%). Tracheal tube insertion time was faster overall (p<0.05) with anatomical-surgical techniques (standard surgical 78s [54-135], novel cricothyrotomy scissors technique 60s [42-82]; median [IQR]) than with puncture techniques (catheter-over-needle technique 74s [48-145], wire-guided technique 135s [116-307]). We observed fewer complications with anatomical-surgical techniques than with puncture techniques (p<0.001). In inexperienced health care personnel, anatomical-surgical techniques showed a higher success rate, a faster tracheal tube insertion time and a lower complication rate compared with puncture techniques, suggesting that they may be the techniques of choice in emergencies.
Control technique for planetary rover
NASA Technical Reports Server (NTRS)
Nakatani, Ichiro; Kubota, Takashi; Adachi, Tadashi; Saitou, Hiroaki; Okamoto, Sinya
1994-01-01
Beginning next century, several schemes for sending a planetary rover to the moon or Mars are being planned. As part of the development program, autonomous navigation technology is being studied to allow the rover the ability to move autonomously over a long range of unknown planetary surface. In the previous study, we ran the autonomous navigation experiment on an outdoor test terrain by using a rover test-bed that was controlled by a conventional sense-plan-act method. In some cases during the experiment, a problem occurred with the rover moving into untraversable areas. To improve this situation, a new control technique has been developed that gives the rover the ability of reacting to the outputs of the proximity sensors, a reaction behavior if you will. We have developed a new rover test-bed system on which an autonomous navigation experiment was performed using the newly developed control technique. In this outdoor experiment, the new control technique effectively produced the control command for the rover to avoid obstacles and be guided to the goal point safely.
Perioperative Acupuncture and Related Techniques
Chernyak, Grigory V.; Sessler, Daniel I.
2005-01-01
Acupuncture and related techniques are increasingly practiced in conventional medical settings, and the number of patients willing to use these techniques is increasing. Despite more than 30 years of research, the exact mechanism of action and efficacy of acupuncture have not been established. Furthermore, most aspects of acupuncture have yet to be adequately tested. There thus remains considerable controversy about the role of acupuncture in clinical medicine. Acupuncture apparently does not reduce volatile anesthetic requirement by a clinically important amount. However, preoperative sedation seems to be a promising application of acupuncture in perioperative settings. Acupuncture may be effective for postoperative pain relief but requires a high level of expertise by the acupuncture practitioner. Acupuncture and related techniques can be used for treatment and prophylaxis of postoperative nausea and vomiting in routine clinical practice in combination with, or as an alternative to, conventional antiemetics when administered before induction of general anesthesia. Summary Statement: The use of acupuncture for perioperative analgesia, nausea and vomiting, sedation, anesthesia, and complications is reviewed. PMID:15851892
Improvement in Magnetic Techniques for Rail Inspection
DOT National Transportation Integrated Search
1981-06-01
Current inspection of rail for internal defects is carried out by ultrasonic and/or magnetic technique for inspecting rail for internal flaws. The major emphasis was placed on improving the speed and detectability of current techniques. Experimental ...
"Techniques for Teachers" Section
ERIC Educational Resources Information Center
Tait, A.
1972-01-01
A series of short articles describe a method of combined developing/fixing for monochrome film, techniques for thin layer chromatography, experiments with lasers, and safety precautions to be used with lasers in school laboratories. (AL)
Digital Mapping Techniques '07 - Workshop Proceedings
Soller, David R.
2008-01-01
The Digital Mapping Techniques '07 (DMT'07) workshop was attended by 85 technical experts from 49 agencies, universities, and private companies, including representatives from 27 state geological surveys. This year's meeting, the tenth in the annual series, was hosted by the South Carolina Geological Survey, from May 20-23, 2007, on the University of South Carolina campus in Columbia, South Carolina. Each DMT workshop has been coordinated by the U.S. Geological Survey's National Geologic Map Database Project and the Association of American State Geologists (AASG). As in previous year's meetings, the objective was to foster informal discussion and exchange of technical information, principally in order to develop more efficient methods for digital mapping, cartography, GIS analysis, and information management. At this meeting, oral and poster presentations and special discussion sessions emphasized: 1) methods for creating and publishing map products (here, 'publishing' includes Web-based release); 2) field data capture software and techniques, including the use of LIDAR; 3) digital cartographic techniques; 4) migration of digital maps into ArcGIS Geodatabase format; 5) analytical GIS techniques; and 6) continued development of the National Geologic Map Database.
Presentation and Impact of Experimental Techniques in Chemistry
ERIC Educational Resources Information Center
Sojka, Zbigniew; Che, Michel
2008-01-01
Laboratory and practical courses, where students become familiar with experimental techniques and learn to interpret data and relate them to appropriate theory, play a vital role in chemical education. In the large panoply of currently available techniques, it is difficult to find a rational and easy way to classify the techniques in relation to…
Machine Learning Techniques in Clinical Vision Sciences.
Caixinha, Miguel; Nunes, Sandrina
2017-01-01
This review presents and discusses the contribution of machine learning techniques for diagnosis and disease monitoring in the context of clinical vision science. Many ocular diseases leading to blindness can be halted or delayed when detected and treated at its earliest stages. With the recent developments in diagnostic devices, imaging and genomics, new sources of data for early disease detection and patients' management are now available. Machine learning techniques emerged in the biomedical sciences as clinical decision-support techniques to improve sensitivity and specificity of disease detection and monitoring, increasing objectively the clinical decision-making process. This manuscript presents a review in multimodal ocular disease diagnosis and monitoring based on machine learning approaches. In the first section, the technical issues related to the different machine learning approaches will be present. Machine learning techniques are used to automatically recognize complex patterns in a given dataset. These techniques allows creating homogeneous groups (unsupervised learning), or creating a classifier predicting group membership of new cases (supervised learning), when a group label is available for each case. To ensure a good performance of the machine learning techniques in a given dataset, all possible sources of bias should be removed or minimized. For that, the representativeness of the input dataset for the true population should be confirmed, the noise should be removed, the missing data should be treated and the data dimensionally (i.e., the number of parameters/features and the number of cases in the dataset) should be adjusted. The application of machine learning techniques in ocular disease diagnosis and monitoring will be presented and discussed in the second section of this manuscript. To show the clinical benefits of machine learning in clinical vision sciences, several examples will be presented in glaucoma, age-related macular degeneration
Optimization of printing techniques for electrochemical biosensors
NASA Astrophysics Data System (ADS)
Zainuddin, Ahmad Anwar; Mansor, Ahmad Fairuzabadi Mohd; Rahim, Rosminazuin Ab; Nordin, Anis Nurashikin
2017-03-01
Electrochemical biosensors show great promise for point-of-care applications due to their low cost, portability and compatibility with microfluidics. The miniature size of these sensors provides advantages in terms of sensitivity, specificity and allows them to be mass produced in arrays. The most reliable fabrication technique for these sensors is lithography followed by metal deposition using sputtering or chemical vapor deposition techniques. This technique which is usually done in the cleanroom requires expensive masking followed by deposition. Recently, cheaper printing techniques such as screen-printing and ink-jet printing have become popular due to its low cost, ease of fabrication and mask-less method. In this paper, two different printing techniques namely inkjet and screen printing are demonstrated for an electrochemical biosensor. For ink-jet printing technique, optimization of key printing parameters, such as pulse voltages, drop spacing and waveform setting, in-house temperature and cure annealing for obtaining the high quality droplets, are discussed. These factors are compared with screen-printing parameters such as mesh size, emulsion thickness, minimum spacing of lines and curing times. The reliability and reproducibility of the sensors are evaluated using scotch tape test, resistivity and profile-meter measurements. It was found that inkjet printing is superior because it is mask-less, has minimum resolution of 100 µm compared to 200 µm for screen printing and higher reproducibility rate of 90% compared to 78% for screen printing.
Multidisciplinary design optimization using multiobjective formulation techniques
NASA Technical Reports Server (NTRS)
Chattopadhyay, Aditi; Pagaldipti, Narayanan S.
1995-01-01
This report addresses the development of a multidisciplinary optimization procedure using an efficient semi-analytical sensitivity analysis technique and multilevel decomposition for the design of aerospace vehicles. A semi-analytical sensitivity analysis procedure is developed for calculating computational grid sensitivities and aerodynamic design sensitivities. Accuracy and efficiency of the sensitivity analysis procedure is established through comparison of the results with those obtained using a finite difference technique. The developed sensitivity analysis technique are then used within a multidisciplinary optimization procedure for designing aerospace vehicles. The optimization problem, with the integration of aerodynamics and structures, is decomposed into two levels. Optimization is performed for improved aerodynamic performance at the first level and improved structural performance at the second level. Aerodynamic analysis is performed by solving the three-dimensional parabolized Navier Stokes equations. A nonlinear programming technique and an approximate analysis procedure are used for optimization. The proceduredeveloped is applied to design the wing of a high speed aircraft. Results obtained show significant improvements in the aircraft aerodynamic and structural performance when compared to a reference or baseline configuration. The use of the semi-analytical sensitivity technique provides significant computational savings.
Research on evaluation techniques for immersive multimedia
NASA Astrophysics Data System (ADS)
Hashim, Aslinda M.; Romli, Fakaruddin Fahmi; Zainal Osman, Zosipha
2013-03-01
Nowadays Immersive Multimedia covers most usage in tremendous ways, such as healthcare/surgery, military, architecture, art, entertainment, education, business, media, sport, rehabilitation/treatment and training areas. Moreover, the significant of Immersive Multimedia to directly meet the end-users, clients and customers needs for a diversity of feature and purpose is the assembly of multiple elements that drive effective Immersive Multimedia system design, so evaluation techniques is crucial for Immersive Multimedia environments. A brief general idea of virtual environment (VE) context and `realism' concept that formulate the Immersive Multimedia environments is then provided. This is followed by a concise summary of the elements of VE assessment technique that is applied in Immersive Multimedia system design, which outlines the classification space for Immersive Multimedia environments evaluation techniques and gives an overview of the types of results reported. A particular focus is placed on the implications of the Immersive Multimedia environments evaluation techniques in relation to the elements of VE assessment technique, which is the primary purpose of producing this research. The paper will then conclude with an extensive overview of the recommendations emanating from the research.
Literalism, perspectivism, chaotic fragmentalism and psychotherapy techniques.
Leitner, L M
1982-12-01
Literalism and chaotic fragmentalism have been advanced as two concepts to explain psychopathology while perspectivism has been used to explain psychological health (Landfield, 1980 a). It is hypothesized that, to the extent that they are therapeutic, all therapies move clients toward perspectivism and away from literalism and chaotic fragmentalism. Eight major schools of psychotherapy are discussed in terms of the principles of technique which enable them to change literalism and chaotic fragmentalism. The advantages of a unifying theory permitting diversity of techniques are discussed in relation to the ability of the clinician to be flexible yet not confused. Further, the unifying concepts of literalism, perspectivism, and chaotic fragmentalism are used to understand systematically the strengths and weaknesses of many therapeutic techniques. Finally, the implications of the differences in therapeutic techniques for changing different types of literalisms are discussed.
Retinal Image Simulation of Subjective Refraction Techniques.
Perches, Sara; Collados, M Victoria; Ares, Jorge
2016-01-01
Refraction techniques make it possible to determine the most appropriate sphero-cylindrical lens prescription to achieve the best possible visual quality. Among these techniques, subjective refraction (i.e., patient's response-guided refraction) is the most commonly used approach. In this context, this paper's main goal is to present a simulation software that implements in a virtual manner various subjective-refraction techniques--including Jackson's Cross-Cylinder test (JCC)--relying all on the observation of computer-generated retinal images. This software has also been used to evaluate visual quality when the JCC test is performed in multifocal-contact-lens wearers. The results reveal this software's usefulness to simulate the retinal image quality that a particular visual compensation provides. Moreover, it can help to gain a deeper insight and to improve existing refraction techniques and it can be used for simulated training.
Recent advances in lossless coding techniques
NASA Astrophysics Data System (ADS)
Yovanof, Gregory S.
Current lossless techniques are reviewed with reference to both sequential data files and still images. Two major groups of sequential algorithms, dictionary and statistical techniques, are discussed. In particular, attention is given to Lempel-Ziv coding, Huffman coding, and arithmewtic coding. The subject of lossless compression of imagery is briefly discussed. Finally, examples of practical implementations of lossless algorithms and some simulation results are given.
A miniaturized counting technique for anaerobic bacteria.
Sharpe, A N; Pettipher, G L; Lloyd, G R
1976-12-01
A miniaturized counting technique gave results as good as the pour-plate and Most Probable Number (MPN) techniques for enumeration of clostridia spp. and anaerobic isolates from the gut. Highest counts were obtained when ascorbic acid (1%) and dithiothreitol (0.015%) were added to the reinforced clostridial medium used for counting. This minimized the effect of exposure to air before incubation. The miniature technique allowed up to 40 samples to be plated and incubated in one McIntosh-Filde's-type anaerobic jar, compared with 3 or 4 by the normal pour plate.
Research relative to weather radar measurement techniques
NASA Technical Reports Server (NTRS)
Smith, Paul L.
1992-01-01
Research relative to weather radar measurement techniques, which involves some investigations related to measurement techniques applicable to meteorological radar systems in Thailand, is reported. A major part of the activity was devoted to instruction and discussion with Thai radar engineers, technicians, and meteorologists concerning the basic principles of radar meteorology and applications to specific problems, including measurement of rainfall and detection of wind shear/microburst hazards. Weather radar calibration techniques were also considered during this project. Most of the activity took place during two visits to Thailand, in December 1990 and February 1992.
Edge detection techniques for iris recognition system
NASA Astrophysics Data System (ADS)
Tania, U. T.; Motakabber, S. M. A.; Ibrahimy, M. I.
2013-12-01
Nowadays security and authentication are the major parts of our daily life. Iris is one of the most reliable organ or part of human body which can be used for identification and authentication purpose. To develop an iris authentication algorithm for personal identification, this paper examines two edge detection techniques for iris recognition system. Between the Sobel and the Canny edge detection techniques, the experimental result shows that the Canny's technique has better ability to detect points in a digital image where image gray level changes even at slow rate.
Bidirectional Glenn on cardiopulmonary bypass: A comparison of three techniques.
Talwar, Sachin; Kumar, Manikala Vinod; Nehra, Ashima; Malhotra Kapoor, Poonam; Makhija, Neeti; Sreenivas, Vishnubhatla; Choudhary, Shiv Kumar; Airan, Balram
2017-05-01
To analyze the intraoperative and early results of the bidirectional Glenn (BDG) procedure performed on cardiopulmonary bypass (CPB) using three different techniques. Between September 2013 and June 2015, 75 consecutive patients (mean age 42 ± 34.4 months) undergoing BDG were randomly assigned to either technique I: open anastomosis or technique II: superior vena cava (SVC) cannulation or technique III: intermittent SVC clamping. We monitored the cerebral near infrared spectrophotometry (NIRS), SVC pressure, CPB time, intensive care unit (ICU) stay, and neurocognitive function. Patients in technique III had abnormal lower NIRS values during the procedure (57 ± 7.4) compared to techniques I and II (64 ± 7.5 and 61 ± 8.0, P = 0.01). Postoperative SVC pressure in technique III was higher than other two groups (17.6 ± 3.7 mmHg vs. 14.2 ± 3.5 mmHg and 15.3 ± 2.0 mmHg in techniques I and II, respectively = 0.0008). CPB time was highest in technique II (44 ± 18 min) compared to techniques I and III (29 ± 14 min and 38 ± 16 min, P = 0.006), respectively. ICU stay was longer in technique III (30 ± 15 h) compared to the other two techniques (22 ± 8.5 h and 27 ± 8.3 h in techniques I and II, respectively = 0.04). No patient experienced significant neurocognitive dysfunction. All techniques of BDG provided acceptable results. The open technique was faster and its use in smaller children merits consideration. The technique of intermittent clamping should be used as a last resort. © 2017 Wiley Periodicals, Inc.
Applying knowledge compilation techniques to model-based reasoning
NASA Technical Reports Server (NTRS)
Keller, Richard M.
1991-01-01
Researchers in the area of knowledge compilation are developing general purpose techniques for improving the efficiency of knowledge-based systems. In this article, an attempt is made to define knowledge compilation, to characterize several classes of knowledge compilation techniques, and to illustrate how some of these techniques can be applied to improve the performance of model-based reasoning systems.
An unsupervised classification technique for multispectral remote sensing data.
NASA Technical Reports Server (NTRS)
Su, M. Y.; Cummings, R. E.
1973-01-01
Description of a two-part clustering technique consisting of (a) a sequential statistical clustering, which is essentially a sequential variance analysis, and (b) a generalized K-means clustering. In this composite clustering technique, the output of (a) is a set of initial clusters which are input to (b) for further improvement by an iterative scheme. This unsupervised composite technique was employed for automatic classification of two sets of remote multispectral earth resource observations. The classification accuracy by the unsupervised technique is found to be comparable to that by traditional supervised maximum-likelihood classification techniques.
Mitochondrial replacement techniques: egg donation, genealogy and eugenics.
Palacios-González, César
2016-03-01
Several objections against the morality of researching or employing mitochondrial replacement techniques have been advanced recently. In this paper, I examine three of these objections and show that they are found wanting. First I examine whether mitochondrial replacement techniques, research and clinical practice, should not be carried out because of possible harms to egg donors. Next I assess whether mitochondrial replacement techniques should be banned because they could affect the study of genealogical ancestry. Finally, I examine the claim that mitochondrial replacement techniques are not transferring mitochondrial DNA but nuclear DNA, and that this should be prohibited on ethical grounds.
Simulation verification techniques study. Subsystem simulation validation techniques
NASA Technical Reports Server (NTRS)
Duncan, L. M.; Reddell, J. P.; Schoonmaker, P. B.
1974-01-01
Techniques for validation of software modules which simulate spacecraft onboard systems are discussed. An overview of the simulation software hierarchy for a shuttle mission simulator is provided. A set of guidelines for the identification of subsystem/module performance parameters and critical performance parameters are presented. Various sources of reference data to serve as standards of performance for simulation validation are identified. Environment, crew station, vehicle configuration, and vehicle dynamics simulation software are briefly discussed from the point of view of their interfaces with subsystem simulation modules. A detailed presentation of results in the area of vehicle subsystems simulation modules is included. A list of references, conclusions and recommendations are also given.
[Relaxation techniques for chronic pain].
Diezemann, A
2011-08-01
Relaxation techniques are an integral part of the psychological therapy of chronic pain and follow very different objectives. These techniques lead to muscular and vegetative stabilization, serve as distraction from pain, to build up the internal focus of control and thus to improve self-efficacy. Additional targets are improvement of body awareness and stress management, shielding from sensory stimuli and recurrence prevention of migraine as well a sleeping aid. The most commonly used and best studied method is progressive muscle relaxation which has a good compliance because it is easy to learn and has a high plausibility for patients.
Artificial Intelligence Techniques: Applications for Courseware Development.
ERIC Educational Resources Information Center
Dear, Brian L.
1986-01-01
Introduces some general concepts and techniques of artificial intelligence (natural language interfaces, expert systems, knowledge bases and knowledge representation, heuristics, user-interface metaphors, and object-based environments) and investigates ways these techniques might be applied to analysis, design, development, implementation, and…
Laser techniques in high-pressure geophysics
NASA Technical Reports Server (NTRS)
Hemley, R. J.; Bell, P. M.; Mao, H. K.
1987-01-01
Laser techniques in conjunction with the diamond-anvil cell can be used to study high-pressure properties of materials important to a wide range of problems in earth and planetary science. Spontaneous Raman scattering of crystalline and amorphous solids at high pressure demonstrates that dramatic changes in structure and bonding occur on compression. High-pressure Brillouin scattering is sensitive to the pressure variations of single-crystal elastic moduli and acoustic velocities. Laser heating techniques with the diamond-anvil cell can be used to study phase transitions, including melting, under deep-earth conditions. Finally, laser-induced ruby fluorescence has been essential for the development of techniques for generating the maximum pressures now possible with the diamond-anvil cell, and currently provides a calibrated in situ measure of pressure well above 100 gigapascals.
Current trends in explosive detection techniques.
Caygill, J Sarah; Davis, Frank; Higson, Seamus P J
2012-01-15
The detection of explosives and explosive-related compounds has become a heightened priority in recent years for homeland security and counter-terrorism applications. There has been a huge increase in research within this area-through both the development of new, innovative detection approaches and the improvement of existing techniques. Developments for miniaturisation, portability, field-ruggedisation and improvements in stand-off distances, selectivity and sensitivity have been necessary to develop and improve techniques. This review provides a consolidation of information relating to recent advances in explosive detection techniques without being limited to one specific research area or explosive type. The focus of this review will be towards advances in the last 5 years, with the reader being referred to earlier reviews where appropriate. Copyright © 2011. Published by Elsevier B.V.
Hiding text in gray image using mapping technique
NASA Astrophysics Data System (ADS)
Hussein, Hussein L.; Abbass, Ahmed A.; Naji, Sinan A.; Al-augby, Salam; Lafta, Jasim H.
2018-05-01
In order to hide the significant and secret message inside a cover object, Steganography is considered as one of the most used technique because of its strength. This paper presents a new steganography technique that it is difficult to discover or break by a third party. The ASCII Mapping Technique (AMT) is used to create an encoded table by mapping the text message and matching some bits with that of the cover image. The system saves the character parts matching and the location of which part of the pixels. Then change the related flag from zero to one the for matched locations so that they cannot be used again to strength the technique and make it more secure. The proposed technique was tested and showed low computational cost with effective performance to be used for multi-purpose applications.
Use of partial dissolution techniques in geochemical exploration
Chao, T.T.
1984-01-01
Application of partial dissolution techniques to geochemical exploration has advanced from an early empirical approach to an approach based on sound geochemical principles. This advance assures a prominent future position for the use of these techniques in geochemical exploration for concealed mineral deposits. Partial dissolution techniques are classified as single dissolution or sequential multiple dissolution depending on the number of steps taken in the procedure, or as "nonselective" extraction and as "selective" extraction in terms of the relative specificity of the extraction. The choice of dissolution techniques for use in geochemical exploration is dictated by the geology of the area, the type and degree of weathering, and the expected chemical forms of the ore and of the pathfinding elements. Case histories have illustrated many instances where partial dissolution techniques exhibit advantages over conventional methods of chemical analysis used in geochemical exploration. ?? 1984.
Model averaging techniques for quantifying conceptual model uncertainty.
Singh, Abhishek; Mishra, Srikanta; Ruskauff, Greg
2010-01-01
In recent years a growing understanding has emerged regarding the need to expand the modeling paradigm to include conceptual model uncertainty for groundwater models. Conceptual model uncertainty is typically addressed by formulating alternative model conceptualizations and assessing their relative likelihoods using statistical model averaging approaches. Several model averaging techniques and likelihood measures have been proposed in the recent literature for this purpose with two broad categories--Monte Carlo-based techniques such as Generalized Likelihood Uncertainty Estimation or GLUE (Beven and Binley 1992) and criterion-based techniques that use metrics such as the Bayesian and Kashyap Information Criteria (e.g., the Maximum Likelihood Bayesian Model Averaging or MLBMA approach proposed by Neuman 2003) and Akaike Information Criterion-based model averaging (AICMA) (Poeter and Anderson 2005). These different techniques can often lead to significantly different relative model weights and ranks because of differences in the underlying statistical assumptions about the nature of model uncertainty. This paper provides a comparative assessment of the four model averaging techniques (GLUE, MLBMA with KIC, MLBMA with BIC, and AIC-based model averaging) mentioned above for the purpose of quantifying the impacts of model uncertainty on groundwater model predictions. Pros and cons of each model averaging technique are examined from a practitioner's perspective using two groundwater modeling case studies. Recommendations are provided regarding the use of these techniques in groundwater modeling practice.
[Standardization of Blastocystis hominis diagnosis using different staining techniques].
Eymael, Dayane; Schuh, Graziela Maria; Tavares, Rejane Giacomelli
2010-01-01
The present study was carried out from March to May 2008, with the aim of evaluating the effectiveness of different techniques for diagnosing Blastocystis hominis in a sample of the population attended at the Biomedicine Laboratory of Feevale University, Novo Hamburgo, Rio Grande do Sul. On hundred feces samples from children and adults were evaluated. After collection, the samples were subjected to the techniques of spontaneous sedimentation (HPJ), sedimentation in formalin-ether (Ritchie) and staining by means of Gram and May-Grünwald-Giemsa (MGG). The presence of Blastocystis hominis was observed in 40 samples, when staining techniques were used (MGG and Gram), while sedimentation techniques were less efficient (32 positive samples using the Ritchie technique and 20 positive samples using the HPJ technique). Our results demonstrate that HPJ was less efficient than the other methods, thus indicating the need to include laboratory techniques that enable parasite identification on a routine basis.
Novel Diffusivity Measurement Technique
NASA Technical Reports Server (NTRS)
Rashidnia, Nasser
2001-01-01
A common-path interferometer (CPI) system was developed to measure the diffusivity of liquid pairs. The CPI is an optical technique that can be used to measure changes in the gradient of the refraction index of transparent materials. This system uses a shearing interferometer that shares the same optical path from a laser light source to the final imaging plane. Hence, the molecular diffusion coefficient of liquids can be determined using the physical relations between changes in the optical path length and the liquid phase properties. The data obtained with this interferometer were compared with similar results from other techniques and demonstrated that the instrument is superior in measuring the diffusivity of miscible liquids while keeping the system very compact and robust. CPI can also be used for studies in interface dynamics and other diffusion-dominated-process applications.
Park, Maxwell C; Tibone, James E; ElAttrache, Neal S; Ahmad, Christopher S; Jun, Bong-Jae; Lee, Thay Q
2007-01-01
We hypothesized that a transosseous-equivalent repair would demonstrate improved tensile strength and gap formation between the tendon and tuberosity when compared with a double-row technique. In 6 fresh-frozen human shoulders, a transosseous-equivalent rotator cuff repair was performed: a suture limb from each of two medial anchors was bridged over the tendon and fixed laterally with an interference screw. In 6 contralateral matched-pair specimens, a double-row repair was performed. For all repairs, a materials testing machine was used to load each repair cyclically from 10 N to 180 N for 30 cycles; each repair underwent tensile testing to measure failure loads at a deformation rate of 1 mm/sec. Gap formation between the tendon edge and insertion was measured with a video digitizing system. The mean ultimate load to failure was significantly greater for the transosseous-equivalent technique (443.0 +/- 87.8 N) compared with the double-row technique (299.2 +/- 52.5 N) (P = .043). Gap formation during cyclic loading was not significantly different between the transosseous-equivalent and double-row techniques, with mean values of 3.74 +/- 1.51 mm and 3.79 +/- 0.68 mm, respectively (P = .95). Stiffness for all cycles was not statistically different between the two constructs (P > .40). The transosseous-equivalent rotator cuff repair technique improves ultimate failure loads when compared with a double-row technique. Gap formation is similar for both techniques. A transosseous-equivalent repair helps restore footprint dimensions and provides a stronger repair than the double-row technique, which may help optimize healing biology.
Developing a hybrid dictionary-based bio-entity recognition technique.
Song, Min; Yu, Hwanjo; Han, Wook-Shin
2015-01-01
Bio-entity extraction is a pivotal component for information extraction from biomedical literature. The dictionary-based bio-entity extraction is the first generation of Named Entity Recognition (NER) techniques. This paper presents a hybrid dictionary-based bio-entity extraction technique. The approach expands the bio-entity dictionary by combining different data sources and improves the recall rate through the shortest path edit distance algorithm. In addition, the proposed technique adopts text mining techniques in the merging stage of similar entities such as Part of Speech (POS) expansion, stemming, and the exploitation of the contextual cues to further improve the performance. The experimental results show that the proposed technique achieves the best or at least equivalent performance among compared techniques, GENIA, MESH, UMLS, and combinations of these three resources in F-measure. The results imply that the performance of dictionary-based extraction techniques is largely influenced by information resources used to build the dictionary. In addition, the edit distance algorithm shows steady performance with three different dictionaries in precision whereas the context-only technique achieves a high-end performance with three difference dictionaries in recall.
Developing a hybrid dictionary-based bio-entity recognition technique
2015-01-01
Background Bio-entity extraction is a pivotal component for information extraction from biomedical literature. The dictionary-based bio-entity extraction is the first generation of Named Entity Recognition (NER) techniques. Methods This paper presents a hybrid dictionary-based bio-entity extraction technique. The approach expands the bio-entity dictionary by combining different data sources and improves the recall rate through the shortest path edit distance algorithm. In addition, the proposed technique adopts text mining techniques in the merging stage of similar entities such as Part of Speech (POS) expansion, stemming, and the exploitation of the contextual cues to further improve the performance. Results The experimental results show that the proposed technique achieves the best or at least equivalent performance among compared techniques, GENIA, MESH, UMLS, and combinations of these three resources in F-measure. Conclusions The results imply that the performance of dictionary-based extraction techniques is largely influenced by information resources used to build the dictionary. In addition, the edit distance algorithm shows steady performance with three different dictionaries in precision whereas the context-only technique achieves a high-end performance with three difference dictionaries in recall. PMID:26043907
Morales-Conde, Salvador; Cañete-Gómez, Jesús; Gómez, Virginia; Socas Macías, María; Moreno, Antonio Barranco; Del Agua, Isaias Alarcón; Ruíz, Francisco Javier Padillo
2016-10-01
After reports on laparoendoscopic single-site (LESS) cholecystectomy, concerns have been raised over the level of difficulty and a potential increase in complications when moving away from conventional gold standard multiport laparoscopy due to incomplete exposure and larger umbilical incisions. With continued development of technique and technology, it has now become possible to fully replicate this gold standard procedure through an LESS approach. First experiences with the newly developed technique and instrument are reported. Fifteen patients presenting with cholelithiasis without signs of inflammation were operated using all surgical steps considered appropriate for the conventional four-port laparoscopic approach, but applied through a single access device. Operation-centered outcomes are presented. There were no peri- or postoperative complications. Mean operating time was 32.3 minutes. No conversion to regular laparoscopy was required. The critical view of safety was achieved in all cases. Mean skin incision length was 2.2 cm. The application of a standardized technique combined with the use of a four-port LESS device allows us to perform LESS cholecystectomy, giving us a correct exposure of the structures and without increasing the mean operating time combining previously reported advantages of LESS. A universal trait of any new technique should be safety and reproducibility. This will enhance its applicability by large number of surgeons and to large number of patients requiring cholecystectomy.
AN IMPROVED SOCKING TECHNIQUE FOR MASTER SLAVES
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parsons, T.C.; Deckard, L.E.; Howe, P.W.
1962-10-29
A technique for socking a pair of standard Model 8 master-slave manipulators is described. The technique is primarily concerned with the fabrication of the bellows section, which provides for Z motion as well as wris movement and rotation. (N.W.R.)
Analysis of Learning Curve Fitting Techniques.
1987-09-01
1986. 15. Neter, John and others. Applied Linear Regression Models. Homewood IL: Irwin, 19-33. 16. SAS User’s Guide: Basics, Version 5 Edition. SAS... Linear Regression Techniques (15:23-52). Random errors are assumed to be normally distributed when using -# ordinary least-squares, according to Johnston...lot estimated by the improvement curve formula. For a more detailed explanation of the ordinary least-squares technique, see Neter, et. al., Applied
Statistical evaluation of vibration analysis techniques
NASA Technical Reports Server (NTRS)
Milner, G. Martin; Miller, Patrice S.
1987-01-01
An evaluation methodology is presented for a selection of candidate vibration analysis techniques applicable to machinery representative of the environmental control and life support system of advanced spacecraft; illustrative results are given. Attention is given to the statistical analysis of small sample experiments, the quantification of detection performance for diverse techniques through the computation of probability of detection versus probability of false alarm, and the quantification of diagnostic performance.
NASA Astrophysics Data System (ADS)
Shine, R. A.
1997-05-01
Over the last decade, a repertoire of techniques have been developed and/or refined to improve the quality of high spatial resolution solar movies taken from ground based observatories. These include real time image motion corrections, frame selection, phase diversity measurements of the wavefront, and extensive post processing to partially remove atmospheric distortion. Their practical application has been made possible by the increasing availability and decreasing cost of large CCD's with fast digital readouts and high speed computer workstations with large memories. Most successful have been broad band (0.3 to 10 nm) filtergram movies which can use exposure times of 10 to 30 ms, short enough to ``freeze'' atmospheric motions. Even so, only a handful of movies with excellent image quality for more than a hour have been obtained to date. Narrowband filtergrams (about 0.01 nm), such as those required for constructing magnetograms and Dopplergrams, have been more challenging although some single images approach the quality of the best continuum images. Some promising new techniques and instruments, together with persistence and good luck, should continue the progress made in the last several years.
Refining the 'cucumber' technique for laryngeal biopsy.
Robertson, S; Cooper, L; McPhaden, A; MacKenzie, K
2011-06-01
To refine the case selection process for the 'cucumber' mounting system for laryngeal biopsies. We conducted a retrospective audit of cucumber technique specimens taken between January 2002 and December 2008. We analysed the clinical indications for biopsy and the pathological diagnosis, for each specimen, in order to inform our case selection process. The cucumber technique was used for 125 laryngeal specimens. 60 specimens were taken for diagnostic sampling, 46 were taken during endoscopic laser resection, and 19 for overtly benign pathology. The cucumber technique was most useful for the interpretation of margins in endoscopic laser resection specimens. The cucumber technique is most useful for endoscopic resection cases in which tumour, dysplasia or suspicious lesions have been excised. Detailed information on resection margins is invaluable during multidisciplinary team discussions on patient management. Detailed photography of mounted specimens enables both laryngologist and pathologist to orientate and interpret specimens accurately.
Infusing Software Assurance Research Techniques into Use
NASA Technical Reports Server (NTRS)
Pressburger, Thomas; DiVito, Ben; Feather, Martin S.; Hinchey, Michael; Markosian, Lawrence; Trevino, Luis C.
2006-01-01
Research in the software engineering community continues to lead to new development techniques that encompass processes, methods and tools. However, a number of obstacles impede their infusion into software development practices. These are the recurring obstacles common to many forms of research. Practitioners cannot readily identify the emerging techniques that may benefit them, and cannot afford to risk time and effort evaluating and trying one out while there remains uncertainty about whether it will work for them. Researchers cannot readily identify the practitioners whose problems would be amenable to their techniques, and, lacking feedback from practical applications, are hard-pressed to gauge the where and in what ways to evolve their techniques to make them more likely to be successful. This paper describes an ongoing effort conducted by a software engineering research infusion team established by NASA s Software Engineering Initiative to overcome these obstacles. .
In vivo studies of brain development by magnetic resonance techniques.
Inder, T E; Huppi, P S
2000-01-01
Understanding of the morphological development of the human brain has largely come from neuropathological studies obtained postmortem. Magnetic resonance (MR) techniques have recently allowed the provision of detailed structural, metabolic, and functional information in vivo on the human brain. These techniques have been utilized in studies from premature infants to adults and have provided invaluable data on the sequence of normal human brain development. This article will focus on MR techniques including conventional structural MR imaging techniques, quantitative morphometric MR techniques, diffusion weighted MR techniques, and MR spectroscopy. In order to understand the potential applications and limitations of MR techniques, relevant physical and biological principles for each of the MR techniques are first reviewed. This is followed by a review of the understanding of the sequence of normal brain development utilizing these techniques. MRDD Research Reviews 6:59-67, 2000. Copyright 2000 Wiley-Liss, Inc.
A Method to Test Model Calibration Techniques
DOE Office of Scientific and Technical Information (OSTI.GOV)
Judkoff, Ron; Polly, Ben; Neymark, Joel
This paper describes a method for testing model calibration techniques. Calibration is commonly used in conjunction with energy retrofit audit models. An audit is conducted to gather information about the building needed to assemble an input file for a building energy modeling tool. A calibration technique is used to reconcile model predictions with utility data, and then the 'calibrated model' is used to predict energy savings from a variety of retrofit measures and combinations thereof. Current standards and guidelines such as BPI-2400 and ASHRAE-14 set criteria for 'goodness of fit' and assume that if the criteria are met, then themore » calibration technique is acceptable. While it is logical to use the actual performance data of the building to tune the model, it is not certain that a good fit will result in a model that better predicts post-retrofit energy savings. Therefore, the basic idea here is that the simulation program (intended for use with the calibration technique) is used to generate surrogate utility bill data and retrofit energy savings data against which the calibration technique can be tested. This provides three figures of merit for testing a calibration technique, 1) accuracy of the post-retrofit energy savings prediction, 2) closure on the 'true' input parameter values, and 3) goodness of fit to the utility bill data. The paper will also discuss the pros and cons of using this synthetic surrogate data approach versus trying to use real data sets of actual buildings.« less
Robust Feature Selection Technique using Rank Aggregation.
Sarkar, Chandrima; Cooley, Sarah; Srivastava, Jaideep
2014-01-01
Although feature selection is a well-developed research area, there is an ongoing need to develop methods to make classifiers more efficient. One important challenge is the lack of a universal feature selection technique which produces similar outcomes with all types of classifiers. This is because all feature selection techniques have individual statistical biases while classifiers exploit different statistical properties of data for evaluation. In numerous situations this can put researchers into dilemma as to which feature selection method and a classifiers to choose from a vast range of choices. In this paper, we propose a technique that aggregates the consensus properties of various feature selection methods to develop a more optimal solution. The ensemble nature of our technique makes it more robust across various classifiers. In other words, it is stable towards achieving similar and ideally higher classification accuracy across a wide variety of classifiers. We quantify this concept of robustness with a measure known as the Robustness Index (RI). We perform an extensive empirical evaluation of our technique on eight data sets with different dimensions including Arrythmia, Lung Cancer, Madelon, mfeat-fourier, internet-ads, Leukemia-3c and Embryonal Tumor and a real world data set namely Acute Myeloid Leukemia (AML). We demonstrate not only that our algorithm is more robust, but also that compared to other techniques our algorithm improves the classification accuracy by approximately 3-4% (in data set with less than 500 features) and by more than 5% (in data set with more than 500 features), across a wide range of classifiers.
Applications of surface analytical techniques in Earth Sciences
NASA Astrophysics Data System (ADS)
Qian, Gujie; Li, Yubiao; Gerson, Andrea R.
2015-03-01
This review covers a wide range of surface analytical techniques: X-ray photoelectron spectroscopy (XPS), scanning photoelectron microscopy (SPEM), photoemission electron microscopy (PEEM), dynamic and static secondary ion mass spectroscopy (SIMS), electron backscatter diffraction (EBSD), atomic force microscopy (AFM). Others that are relatively less widely used but are also important to the Earth Sciences are also included: Auger electron spectroscopy (AES), low energy electron diffraction (LEED) and scanning tunnelling microscopy (STM). All these techniques probe only the very top sample surface layers (sub-nm to several tens of nm). In addition, we also present several other techniques i.e. Raman microspectroscopy, reflection infrared (IR) microspectroscopy and quantitative evaluation of minerals by scanning electron microscopy (QEMSCAN) that penetrate deeper into the sample, up to several μm, as all of them are fundamental analytical tools for the Earth Sciences. Grazing incidence synchrotron techniques, sensitive to surface measurements, are also briefly introduced at the end of this review. (Scanning) transmission electron microscopy (TEM/STEM) is a special case that can be applied to characterisation of mineralogical and geological sample surfaces. Since TEM/STEM is such an important technique for Earth Scientists, we have also included it to draw attention to the capability of TEM/STEM applied as a surface-equivalent tool. While this review presents most of the important techniques for the Earth Sciences, it is not an all-inclusive bibliography of those analytical techniques. Instead, for each technique that is discussed, we first give a very brief introduction about its principle and background, followed by a short section on approaches to sample preparation that are important for researchers to appreciate prior to the actual sample analysis. We then use examples from publications (and also some of our known unpublished results) within the Earth Sciences
Solomon Technique Versus Selective Coagulation for Twin-Twin Transfusion Syndrome.
Slaghekke, Femke; Oepkes, Dick
2016-06-01
Monochorionic twin pregnancies can be complicated by twin-to-twin transfusion syndrome (TTTS). The best treatment option for TTTS is fetoscopic laser coagulation of the vascular anastomoses between donor and recipient. After laser therapy, up to 33% residual anastomoses were seen. These residual anastomoses can cause twin anemia polycythemia sequence (TAPS) and recurrent TTTS. In order to reduce the number of residual anastomoses and their complications, a new technique, the Solomon technique, where the whole vascular equator will be coagulated, was introduced. The Solomon technique showed a reduction of recurrent TTS compared to the selective technique. The incidence of recurrent TTTS after the Solomon technique ranged from 0% to 3.9% compared to 5.3-8.5% after the selective technique. The incidence of TAPS after the Solomon technique ranged from 0% to 2.9% compared to 4.2-15.6% after the selective technique. The Solomon technique may improve dual survival rates ranging from 64% to 85% compared to 46-76% for the selective technique. There was no difference reported in procedure-related complications such as intrauterine infection and preterm premature rupture of membranes. The Solomon technique significantly reduced the incidence of TAPS and recurrent TTTS and may improve survival and neonatal outcome, without identifiable adverse outcome or complications; therefore, the Solomon technique is recommended for the treatment of TTTS.
New techniques for imaging and analyzing lung tissue.
Roggli, V L; Ingram, P; Linton, R W; Gutknecht, W F; Mastin, P; Shelburne, J D
1984-01-01
The recent technological revolution in the field of imaging techniques has provided pathologists and toxicologists with an expanding repertoire of analytical techniques for studying the interaction between the lung and the various exogenous materials to which it is exposed. Analytical problems requiring elemental sensitivity or specificity beyond the range of that offered by conventional scanning electron microscopy and energy dispersive X-ray analysis are particularly appropriate for the application of these newer techniques. Electron energy loss spectrometry, Auger electron spectroscopy, secondary ion mass spectrometry, and laser microprobe mass analysis each offer unique advantages in this regard, but also possess their own limitations and disadvantages. Diffraction techniques provide crystalline structural information available through no other means. Bulk chemical techniques provide useful cross-checks on the data obtained by microanalytical approaches. It is the purpose of this review to summarize the methodology of these techniques, acknowledge situations in which they have been used in addressing problems in pulmonary toxicology, and comment on the relative advantages and disadvantages of each approach. It is necessary for an investigator to weigh each of these factors when deciding which technique is best suited for any given analytical problem; often it is useful to employ a combination of two or more of the techniques discussed. It is anticipated that there will be increasing utilization of these technologies for problems in pulmonary toxicology in the decades to come. Images FIGURE 3. A FIGURE 3. B FIGURE 3. C FIGURE 3. D FIGURE 4. FIGURE 5. FIGURE 7. A FIGURE 7. B FIGURE 8. A FIGURE 8. B FIGURE 8. C FIGURE 9. A FIGURE 9. B FIGURE 10. PMID:6090115
Inhaler technique maintenance: gaining an understanding from the patient's perspective.
Ovchinikova, Ludmila; Smith, Lorraine; Bosnic-Anticevich, Sinthia
2011-08-01
The aim of this study was to determine the patient-, education-, and device-related factors that predict inhaler technique maintenance. Thirty-one community pharmacists were trained to deliver inhaler technique education to people with asthma. Pharmacists evaluated (based on published checklists), and where appropriate, delivered inhaler technique education to patients (participants) in the community pharmacy at baseline (Visit 1) and 1 month later (Visit 2). Data were collected on participant demographics, asthma history, current asthma control, history of inhaler technique education, and a range of psychosocial aspects of disease management (including adherence to medication, motivation for correct technique, beliefs regarding the importance of maintaining correct technique, and necessity and concern beliefs regarding preventer therapy). Stepwise backward logistic regression was used to identify the predictors of inhaler technique maintenance at 1 month. In total 145 and 127 participants completed Visits 1 and 2, respectively. At baseline, 17% of patients (n = 24) demonstrated correct technique (score 11/11) which increased to 100% (n = 139) after remedial education by pharmacists. At follow-up, 61% (n = 77) of patients demonstrated correct technique. The predictors of inhaler technique maintenance based on the logistic regression model (X(2) (3, N = 125) = 16.22, p = .001) were use of a dry powder inhaler over a pressurized metered-dose inhaler (OR 2.6), having better asthma control at baseline (OR 2.3), and being more motivated to practice correct inhaler technique (OR 1.2). Contrary to what is typically recommended in previous research, correct inhaler technique maintenance may involve more than repetition of instructions. This study found that past technique education factors had no bearing on technique maintenance, whereas patient psychosocial factors (motivation) did.
Ion plating technique improves thin film deposition
NASA Technical Reports Server (NTRS)
Mattox, D. M.
1968-01-01
Ion plating technique keeps the substrate surface clean until the film is deposited, allows extensive diffusion and chemical reaction, and joins insoluble or incompatible materials. The technique involves the deposition of ions on the substrate surface while it is being bombarded with inert gas ions.
Mathematical techniques: A compilation
NASA Technical Reports Server (NTRS)
1975-01-01
Articles on theoretical and applied mathematics are introduced. The articles cover information that might be of interest to workers in statistics and information theory, computational aids that could be used by scientists and engineers, and mathematical techniques for design and control.
Correlative Techniques in Microscopy
USDA-ARS?s Scientific Manuscript database
Imaging is an important component in basic research, product development and understanding structure/function relationships in agricultural commodities and products. An array of microscopes and techniques can be used illustrate the structure and microchemistry of diverse samples. Examples of the var...
Optical Measurement Technique for Space Column Characterization
NASA Technical Reports Server (NTRS)
Barrows, Danny A.; Watson, Judith J.; Burner, Alpheus W.; Phelps, James E.
2004-01-01
A simple optical technique for the structural characterization of lightweight space columns is presented. The technique is useful for determining the coefficient of thermal expansion during cool down as well as the induced strain during tension and compression testing. The technique is based upon object-to-image plane scaling and does not require any photogrammetric calibrations or computations. Examples of the measurement of the coefficient of thermal expansion are presented for several lightweight space columns. Examples of strain measured during tension and compression testing are presented along with comparisons to results obtained with Linear Variable Differential Transformer (LVDT) position transducers.
[Qijie theory of LAI's Tongyuan acupuncture technique].
Zhuang, Juanjuan; Wang, Jihong; Lai, Xinsheng
2016-05-01
Qijie theory is one of the important components of TCM meridian and collateral system. It is the shortcut for the communication from the exterior to the interior and for the transverse connection, strengthens the therapeutic effects of acupuncture and moxibustion on the disorders of internal organs and enlarges the indications of acupoints. Professor LAI Xinsheng originally creats Tongyuan acupuncture technique. It is a kind of acupuncture therapeutic methods, including promoting the circulation of the governor vessel, regulating the mind and conducting qi to the origin. In order to analyze the connection between Tongyuan acupuncture technique and traditional meridian and collateral theory, the connotations of Tongyuan acupuncture technique and qijie, as well as the in-terrelationship between them are taken as the basis in the paper. By tracing the literature records, the original concept of qijie is detected. Through proving clinically Tongyuan acupuncture technique, it is revealed that qijie is the arrowhead on the main road of meridian qi circulation and is the essential connotation of the direct path of the body surface connecting with the deep layers of the body as well as the zangfu organs and tissues. It is summarized that the traditional qijie theory provides the powerful theoretic evidence for the treatment with Tongyuan acupuncture technique.
Security Techniques for the Electronic Health Records.
Kruse, Clemens Scott; Smith, Brenna; Vanderlinden, Hannah; Nealand, Alexandra
2017-08-01
The privacy of patients and the security of their information is the most imperative barrier to entry when considering the adoption of electronic health records in the healthcare industry. Considering current legal regulations, this review seeks to analyze and discuss prominent security techniques for healthcare organizations seeking to adopt a secure electronic health records system. Additionally, the researchers sought to establish a foundation for further research for security in the healthcare industry. The researchers utilized the Texas State University Library to gain access to three online databases: PubMed (MEDLINE), CINAHL, and ProQuest Nursing and Allied Health Source. These sources were used to conduct searches on literature concerning security of electronic health records containing several inclusion and exclusion criteria. Researchers collected and analyzed 25 journals and reviews discussing security of electronic health records, 20 of which mentioned specific security methods and techniques. The most frequently mentioned security measures and techniques are categorized into three themes: administrative, physical, and technical safeguards. The sensitive nature of the information contained within electronic health records has prompted the need for advanced security techniques that are able to put these worries at ease. It is imperative for security techniques to cover the vast threats that are present across the three pillars of healthcare.
Alternative Constraint Handling Technique for Four-Bar Linkage Path Generation
NASA Astrophysics Data System (ADS)
Sleesongsom, S.; Bureerat, S.
2018-03-01
This paper proposes an extension of a new concept for path generation from our previous work by adding a new constraint handling technique. The propose technique was initially designed for problems without prescribed timing by avoiding the timing constraint, while remain constraints are solving with a new constraint handling technique. The technique is one kind of penalty technique. The comparative study is optimisation of path generation problems are solved using self-adaptive population size teaching-learning based optimization (SAP-TLBO) and original TLBO. In this study, two traditional path generation test problem are used to test the proposed technique. The results show that the new technique can be applied with the path generation problem without prescribed timing and gives better results than the previous technique. Furthermore, SAP-TLBO outperforms the original one.
Digital Mapping Techniques '11–12 workshop proceedings
Soller, David R.
2014-01-01
At these meetings, oral and poster presentations and special discussion sessions emphasized: (1) methods for creating and publishing map products (here, "publishing" includes Web-based release); (2) field data capture software and techniques, including the use of LiDAR; (3) digital cartographic techniques; (4) migration of digital maps into ArcGIS Geodatabase formats; (5) analytical GIS techniques; and (6) continued development of the National Geologic Map Database.
Laboratory Reptile Surgery: Principles and Techniques
Alworth, Leanne C; Hernandez, Sonia M; Divers, Stephen J
2011-01-01
Reptiles used for research and instruction may require surgical procedures, including biopsy, coelomic device implantation, ovariectomy, orchidectomy, and esophogostomy tube placement, to accomplish research goals. Providing veterinary care for unanticipated clinical problems may require surgical techniques such as amputation, bone or shell fracture repair, and coeliotomy. Although many principles of surgery are common between mammals and reptiles, important differences in anatomy and physiology exist. Veterinarians who provide care for these species should be aware of these differences. Most reptiles undergoing surgery are small and require specific instrumentation and positioning. In addition, because of the wide variety of unique physiologic and anatomic characteristics among snakes, chelonians, and lizards, different techniques may be necessary for different reptiles. This overview describes many common reptile surgery techniques and their application for research purposes or to provide medical care to research subjects. PMID:21333158
Survey Of Lossless Image Coding Techniques
NASA Astrophysics Data System (ADS)
Melnychuck, Paul W.; Rabbani, Majid
1989-04-01
Many image transmission/storage applications requiring some form of data compression additionally require that the decoded image be an exact replica of the original. Lossless image coding algorithms meet this requirement by generating a decoded image that is numerically identical to the original. Several lossless coding techniques are modifications of well-known lossy schemes, whereas others are new. Traditional Markov-based models and newer arithmetic coding techniques are applied to predictive coding, bit plane processing, and lossy plus residual coding. Generally speaking, the compression ratio offered by these techniques are in the area of 1.6:1 to 3:1 for 8-bit pictorial images. Compression ratios for 12-bit radiological images approach 3:1, as these images have less detailed structure, and hence, their higher pel correlation leads to a greater removal of image redundancy.
Microsurgical techniques in temporal lobe epilepsy.
Alonso Vanegas, Mario A; Lew, Sean M; Morino, Michiharu; Sarmento, Stenio A
2017-04-01
Temporal lobe resection is the most prevalent epilepsy surgery procedure. However, there is no consensus on the best surgical approach to treat temporal lobe epilepsy. Complication rates are low and efficacy is very high regarding seizures after such procedures. However, there is still ample controversy regarding the best surgical approach to warrant maximum seizure control with minimal functional deficits. We describe the most frequently used microsurgical techniques for removal of both the lateral and mesial temporal lobe structures in the treatment of medically intractable temporal lobe epilepsy (TLE) due to mesial temporal sclerosis (corticoamygdalohippocampectomy and selective amygdalohippocampectomy). The choice of surgical technique appears to remain a surgeon's preference for the near future. Meticulous surgical technique and thorough three-dimensional microsurgical knowledge are essentials for obtaining the best results. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.
Laboratory reptile surgery: principles and techniques.
Alworth, Leanne C; Hernandez, Sonia M; Divers, Stephen J
2011-01-01
Reptiles used for research and instruction may require surgical procedures, including biopsy, coelomic device implantation, ovariectomy, orchidectomy, and esophogostomy tube placement, to accomplish research goals. Providing veterinary care for unanticipated clinical problems may require surgical techniques such as amputation, bone or shell fracture repair, and coeliotomy. Although many principles of surgery are common between mammals and reptiles, important differences in anatomy and physiology exist. Veterinarians who provide care for these species should be aware of these differences. Most reptiles undergoing surgery are small and require specific instrumentation and positioning. In addition, because of the wide variety of unique physiologic and anatomic characteristics among snakes, chelonians, and lizards, different techniques may be necessary for different reptiles. This overview describes many common reptile surgery techniques and their application for research purposes or to provide medical care to research subjects.
Enteral Feeding Set Handling Techniques.
Lyman, Beth; Williams, Maria; Sollazzo, Janet; Hayden, Ashley; Hensley, Pam; Dai, Hongying; Roberts, Cristine
2017-04-01
Enteral nutrition therapy is common practice in pediatric clinical settings. Often patients will receive a pump-assisted bolus feeding over 30 minutes several times per day using the same enteral feeding set (EFS). This study aims to determine the safest and most efficacious way to handle the EFS between feedings. Three EFS handling techniques were compared through simulation for bacterial growth, nursing time, and supply costs: (1) rinsing the EFS with sterile water after each feeding, (2) refrigerating the EFS between feedings, and (3) using a ready-to-hang (RTH) product maintained at room temperature. Cultures were obtained at baseline, hour 12, and hour 21 of the 24-hour cycle. A time-in-motion analysis was conducted and reported in average number of seconds to complete each procedure. Supply costs were inventoried for 1 month comparing the actual usage to our estimated usage. Of 1080 cultures obtained, the overall bacterial growth rate was 8.7%. The rinse and refrigeration techniques displayed similar bacterial growth (11.4% vs 10.3%, P = .63). The RTH technique displayed the least bacterial growth of any method (4.4%, P = .002). The time analysis in minutes showed the rinse method was the most time-consuming (44.8 ± 2.7) vs refrigeration (35.8 ± 2.6) and RTH (31.08 ± 0.6) ( P < .0001). All 3 EFS handling techniques displayed low bacterial growth. RTH was superior in bacterial growth, nursing time, and supply costs. Since not all pediatric formulas are available in RTH, we conclude that refrigerating the EFS between uses is the next most efficacious method for handling the EFS between bolus feeds.
Advanced Atmospheric Ensemble Modeling Techniques
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buckley, R.; Chiswell, S.; Kurzeja, R.
Ensemble modeling (EM), the creation of multiple atmospheric simulations for a given time period, has become an essential tool for characterizing uncertainties in model predictions. We explore two novel ensemble modeling techniques: (1) perturbation of model parameters (Adaptive Programming, AP), and (2) data assimilation (Ensemble Kalman Filter, EnKF). The current research is an extension to work from last year and examines transport on a small spatial scale (<100 km) in complex terrain, for more rigorous testing of the ensemble technique. Two different release cases were studied, a coastal release (SF6) and an inland release (Freon) which consisted of two releasemore » times. Observations of tracer concentration and meteorology are used to judge the ensemble results. In addition, adaptive grid techniques have been developed to reduce required computing resources for transport calculations. Using a 20- member ensemble, the standard approach generated downwind transport that was quantitatively good for both releases; however, the EnKF method produced additional improvement for the coastal release where the spatial and temporal differences due to interior valley heating lead to the inland movement of the plume. The AP technique showed improvements for both release cases, with more improvement shown in the inland release. This research demonstrated that transport accuracy can be improved when models are adapted to a particular location/time or when important local data is assimilated into the simulation and enhances SRNL’s capability in atmospheric transport modeling in support of its current customer base and local site missions, as well as our ability to attract new customers within the intelligence community.« less
Active cycle of breathing technique for cystic fibrosis.
Mckoy, Naomi A; Wilson, Lisa M; Saldanha, Ian J; Odelola, Olaide A; Robinson, Karen A
2016-07-05
People with cystic fibrosis experience chronic airway infections as a result of mucus build up within the lungs. Repeated infections often cause lung damage and disease. Airway clearance therapies aim to improve mucus clearance, increase sputum production, and improve airway function. The active cycle of breathing technique (also known as ACBT) is an airway clearance method that uses a cycle of techniques to loosen airway secretions including breathing control, thoracic expansion exercises, and the forced expiration technique. This is an update of a previously published review. To compare the clinical effectiveness of the active cycle of breathing technique with other airway clearance therapies in cystic fibrosis. We searched the Cochrane Cystic Fibrosis Trials Register, compiled from electronic database searches and handsearching of journals and conference abstract books. We also searched the reference lists of relevant articles and reviews.Date of last search: 25 April 2016. Randomised or quasi-randomised controlled clinical studies, including cross-over studies, comparing the active cycle of breathing technique with other airway clearance therapies in cystic fibrosis. Two review authors independently screened each article, abstracted data and assessed the risk of bias of each study. Our search identified 62 studies, of which 19 (440 participants) met the inclusion criteria. Five randomised controlled studies (192 participants) were included in the meta-analysis; three were of cross-over design. The 14 remaining studies were cross-over studies with inadequate reports for complete assessment. The study size ranged from seven to 65 participants. The age of the participants ranged from six to 63 years (mean age 22.33 years). In 13 studies, follow up lasted a single day. However, there were two long-term randomised controlled studies with follow up of one to three years. Most of the studies did not report on key quality items, and therefore, have an unclear risk of
Intraseptal anesthesia: a review of a relevant injection technique.
Woodmansey, Karl
2005-01-01
Although overshadowed by intraosseous anesthesia and the periodontal ligament injection, intraseptal anesthesia remains a useful local anesthesia technique for general dentists. Intraseptal anesthesia can be employed with safety and efficacy as an alternative to conventional local infiltration or regional nerve block injections. It also can serve as an adjunctive technique when conventional techniques fail to achieve adequate local anesthesia. This article reviews the intraseptal anesthesia technique, including its indications and limitations.
Basheti, Iman A; Obeidat, Nathir M; Reddel, Helen K
2017-02-09
Inhaler technique can be corrected with training, but skills drop off quickly without repeated training. The aim of our study was to explore the effect of novel inhaler technique labels on the retention of correct inhaler technique. In this single-blind randomized parallel-group active-controlled study, clinical pharmacists enrolled asthma patients using controller medication by Accuhaler [Diskus] or Turbuhaler. Inhaler technique was assessed using published checklists (score 0-9). Symptom control was assessed by asthma control test. Patients were randomized into active (ACCa; THa) and control (ACCc; THc) groups. All patients received a "Show-and-Tell" inhaler technique counseling service. Active patients also received inhaler labels highlighting their initial errors. Baseline data were available for 95 patients, 68% females, mean age 44.9 (SD 15.2) years. Mean inhaler scores were ACCa:5.3 ± 1.0; THa:4.7 ± 0.9, ACCc:5.5 ± 1.1; THc:4.2 ± 1.0. Asthma was poorly controlled (mean ACT scores ACCa:13.9 ± 4.3; THa:12.1 ± 3.9; ACCc:12.7 ± 3.3; THc:14.3 ± 3.7). After training, all patients had correct technique (score 9/9). After 3 months, there was significantly less decline in inhaler technique scores for active than control groups (mean difference: Accuhaler -1.04 (95% confidence interval -1.92, -0.16, P = 0.022); Turbuhaler -1.61 (-2.63, -0.59, P = 0.003). Symptom control improved significantly, with no significant difference between active and control patients, but active patients used less reliever medication (active 2.19 (SD 1.78) vs. control 3.42 (1.83) puffs/day, P = 0.002). After inhaler training, novel inhaler technique labels improve retention of correct inhaler technique skills with dry powder inhalers. Inhaler technique labels represent a simple, scalable intervention that has the potential to extend the benefit of inhaler training on asthma outcomes. REMINDER LABELS IMPROVE INHALER TECHNIQUE: Personalized
Fade Mitigation Techniques at Ka-Band
NASA Technical Reports Server (NTRS)
Dissanayake, Asoka (Editor)
1996-01-01
Rain fading is the dominant propagation impairment affecting Ka-band satellite links and rain fade mitigation is a key element in the design of Ka-band satellite networks. Some of the common fade mitigation techniques include: power control, diversity, adaptive coding, and resource sharing. The Advanced Communications Technology Satellite (ACTS) provides an excellent opportunity to develop and test Ka-band rain impairment amelioration techniques. Up-link power control and diversity are discussed in this paper.
Applications of CFD and visualization techniques
NASA Technical Reports Server (NTRS)
Saunders, James H.; Brown, Susan T.; Crisafulli, Jeffrey J.; Southern, Leslie A.
1992-01-01
In this paper, three applications are presented to illustrate current techniques for flow calculation and visualization. The first two applications use a commercial computational fluid dynamics (CFD) code, FLUENT, performed on a Cray Y-MP. The results are animated with the aid of data visualization software, apE. The third application simulates a particulate deposition pattern using techniques inspired by developments in nonlinear dynamical systems. These computations were performed on personal computers.
Improving Demonstration Using Better Interaction Techniques
1997-01-14
Programming by demonstration (PBD) can be used to create tools and methods that eliminate the need to learn difficult computer languages. Gamut is a...do this, Gamut uses advanced interaction techniques that make it easier for a software author to express all needed aspects of one’s program. These...techniques include a simplified way to demonstrate new examples, called nudges, and a way to highlight objects to show they are important. Also, Gamut
Classroom Observation Techniques. IDEA Paper No. 4.
ERIC Educational Resources Information Center
Acheson, Keith A.
Techniques for observing the classroom behavior of teachers and students are examined. These techniques provide a framework for analyzing and understanding classroom interaction, for making decisions about what should be happening, and for changing instructional behavior when it is necessary. The observation methods allow collection, analysis, and…
Measuring Speed Using a Computer--Several Techniques.
ERIC Educational Resources Information Center
Pearce, Jon M.
1988-01-01
Introduces three different techniques to facilitate the measurement of speed and the associated kinematics and dynamics using a computer. Discusses sensing techniques using optical or ultrasonic sensors, interfacing with a computer, software routines for the interfaces, and other applications. Provides circuit diagrams, pictures, and a program to…
48 CFR 1631.203-70 - Allocation techniques.
Code of Federal Regulations, 2010 CFR
2010-10-01
... shall consistently apply the methods and techniques established to classify direct and indirect costs... meant to be exhaustive, but rather are examples of allocation methods that may be acceptable under... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Allocation techniques. 1631...
Technique Developed for Optimizing Traveling-Wave Tubes
NASA Technical Reports Server (NTRS)
Wilson, Jeffrey D.
1999-01-01
A traveling-wave tube (TWT) is an electron beam device that is used to amplify electromagnetic communication waves at radio and microwave frequencies. TWT s are critical components in deep-space probes, geosynchronous communication satellites, and high-power radar systems. Power efficiency is of paramount importance for TWT s employed in deep-space probes and communications satellites. Consequently, increasing the power efficiency of TWT s has been the primary goal of the TWT group at the NASA Lewis Research Center over the last 25 years. An in-house effort produced a technique (ref. 1) to design TWT's for optimized power efficiency. This technique is based on simulated annealing, which has an advantage over conventional optimization techniques in that it enables the best possible solution to be obtained (ref. 2). A simulated annealing algorithm was created and integrated into the NASA TWT computer model (ref. 3). The new technique almost doubled the computed conversion power efficiency of a TWT from 7.1 to 13.5 percent (ref. 1).
Ultrasonic non invasive techniques for microbiological instrumentation
NASA Astrophysics Data System (ADS)
Elvira, L.; Sierra, C.; Galán, B.; Resa, P.
2010-01-01
Non invasive techniques based on ultrasounds have advantageous features to study, characterize and monitor microbiological and enzymatic reactions. These processes may change the sound speed, viscosity or particle distribution size of the medium where they take place, which makes possible their analysis using ultrasonic techniques. In this work, two different systems for the analysis of microbiological liquid media based on ultrasounds are presented. In first place, an industrial application based on an ultrasonic monitoring technique for microbiological growth detection in milk is shown. Such a system may improve the quality control strategies in food production factories, being able to decrease the time required to detect possible contaminations in packed products. Secondly, a study about the growing of the Escherichia coli DH5 α in different conditions is presented. It is shown that the use of ultrasonic non invasive characterization techniques in combination with other conventional measurements like optical density provides complementary information about the metabolism of these bacteria.
Mass spectrometry. [review of techniques
NASA Technical Reports Server (NTRS)
Burlingame, A. L.; Kimble, B. J.; Derrick, P. J.
1976-01-01
Advances in mass spectrometry (MS) and its applications over the past decade are reviewed in depth, with annotated literature references. New instrumentation and techniques surveyed include: modulated-beam MS, chromatographic MS on-line computer techniques, digital computer-compatible quadrupole MS, selected ion monitoring (mass fragmentography), and computer-aided management of MS data and interpretation. Areas of application surveyed include: organic MS and electron impact MS, field ionization kinetics, appearance potentials, translational energy release, studies of metastable species, photoionization, calculations of molecular orbitals, chemical kinetics, field desorption MS, high pressure MS, ion cyclotron resonance, biochemistry, medical/clinical chemistry, pharmacology, and environmental chemistry and pollution studies.
CFD Techniques for Propulsion Applications
NASA Technical Reports Server (NTRS)
1992-01-01
The symposium was composed of the following sessions: turbomachinery computations and validations; flow in ducts, intakes, and nozzles; and reacting flows. Forty papers were presented, and they covered full 3-D code validation and numerical techniques; multidimensional reacting flow; and unsteady viscous flow for the entire spectrum of propulsion system components. The capabilities of the various numerical techniques were assessed and significant new developments were identified. The technical evaluation spells out where progress has been made and concludes that the present state of the art has almost reached the level necessary to tackle the comprehensive topic of computational fluid dynamics (CFD) validation for propulsion.
Accuracy of selected techniques for estimating ice-affected streamflow
Walker, John F.
1991-01-01
This paper compares the accuracy of selected techniques for estimating streamflow during ice-affected periods. The techniques are classified into two categories - subjective and analytical - depending on the degree of judgment required. Discharge measurements have been made at three streamflow-gauging sites in Iowa during the 1987-88 winter and used to established a baseline streamflow record for each site. Using data based on a simulated six-week field-tip schedule, selected techniques are used to estimate discharge during the ice-affected periods. For the subjective techniques, three hydrographers have independently compiled each record. Three measures of performance are used to compare the estimated streamflow records with the baseline streamflow records: the average discharge for the ice-affected period, and the mean and standard deviation of the daily errors. Based on average ranks for three performance measures and the three sites, the analytical and subjective techniques are essentially comparable. For two of the three sites, Kruskal-Wallis one-way analysis of variance detects significant differences among the three hydrographers for the subjective methods, indicating that the subjective techniques are less consistent than the analytical techniques. The results suggest analytical techniques may be viable tools for estimating discharge during periods of ice effect, and should be developed further and evaluated for sites across the United States.
A vector scanning processing technique for pulsed laser velocimetry
NASA Technical Reports Server (NTRS)
Wernet, Mark P.; Edwards, Robert V.
1989-01-01
Pulsed laser sheet velocimetry yields nonintrusive measurements of two-dimensional velocity vectors across an extended planar region of a flow. Current processing techniques offer high precision (1 pct) velocity estimates, but can require several hours of processing time on specialized array processors. Under some circumstances, a simple, fast, less accurate (approx. 5 pct), data reduction technique which also gives unambiguous velocity vector information is acceptable. A direct space domain processing technique was examined. The direct space domain processing technique was found to be far superior to any other techniques known, in achieving the objectives listed above. It employs a new data coding and reduction technique, where the particle time history information is used directly. Further, it has no 180 deg directional ambiguity. A complex convection vortex flow was recorded and completely processed in under 2 minutes on an 80386 based PC, producing a 2-D velocity vector map of the flow field. Hence, using this new space domain vector scanning (VS) technique, pulsed laser velocimetry data can be reduced quickly and reasonably accurately, without specialized array processing hardware.
Single-Donor Leukophoretic Technique
NASA Technical Reports Server (NTRS)
Eberhardt, R. N.
1977-01-01
Leukocyte separation-and-retrieval device utilizes granulocyte and monocyte property of leukoadhesion to glass surfaces as basis of their separation from whole blood. Device is used with single donor technique and has application in biological and chemical processing, veterinary research and clinical care.
Techniques in Adlerian Psychology.
ERIC Educational Resources Information Center
Carlson, Jon, Ed.; Slavik, Steven, Ed.
This book is a collection of classic and recent papers (published between 1964 and 1994) reprinted from the "Journal of Juvenile Psychology""Individual Psychologist," and "Individual Psychology." Each of the five sections is introduced by the editor's comments. "General Techniques" contains the following…
Liquidus temperature and optical properties measurement by containerless techniques
NASA Technical Reports Server (NTRS)
Anderson, Collin D.
1993-01-01
Reactive alloy liquidus temperatures measured by conventional, contained techniques are often in error due to reactions with containers and gaseous impurities. This paper describes a new liquidus temperature measurement technique that avoids these problems by employing containerless processing. This technique relies on precise and accurate noncontact temperature measurements (NCTM), which are made possible by spectral emissivity values. The spectral emissivities, epsilon(sub lambda), are measured along with the optical properties (real, n, and imaginary, k, components of the index of refraction) using polarimetric techniques on electromagnetically levitated specimens. Results from work done at Vanderbilt University and Intersonics on the Ti-Al system are presented to demonstrate the above techniques.
Exploring the CAESAR database using dimensionality reduction techniques
NASA Astrophysics Data System (ADS)
Mendoza-Schrock, Olga; Raymer, Michael L.
2012-06-01
The Civilian American and European Surface Anthropometry Resource (CAESAR) database containing over 40 anthropometric measurements on over 4000 humans has been extensively explored for pattern recognition and classification purposes using the raw, original data [1-4]. However, some of the anthropometric variables would be impossible to collect in an uncontrolled environment. Here, we explore the use of dimensionality reduction methods in concert with a variety of classification algorithms for gender classification using only those variables that are readily observable in an uncontrolled environment. Several dimensionality reduction techniques are employed to learn the underlining structure of the data. These techniques include linear projections such as the classical Principal Components Analysis (PCA) and non-linear (manifold learning) techniques, such as Diffusion Maps and the Isomap technique. This paper briefly describes all three techniques, and compares three different classifiers, Naïve Bayes, Adaboost, and Support Vector Machines (SVM), for gender classification in conjunction with each of these three dimensionality reduction approaches.
Sechachalam, Sreedharan; Satku, Mala; Wong, Jian Hao Kevin; Tan, Lester Teong Jin; Yong, Fok Chuan
2017-03-01
Restoration of extra-articular and intra-articular parameters are important considerations during operative fixation of distal radius fractures. Restoration of volar tilt by using visual estimation and the 'lift' technique has previously been described. The aim of our study was to describe a mathematical technique for accurately restoring the volar tilt of the distal radius to acceptable anatomic values. A retrospective review of cases performed using the trigonometry-integrated ' lift' technique (TILT) was performed. This technique uses the pre-operative volar tilt angle as well as the dimensions of the implant to calculate the 'lift' required to restore volar tilt. Intra-operative angles were measured using a marked transparency overlay on fluoroscopic images. Pre-operative and post-operative volar tilt were measured and analysed. Twenty-seven fractures were included in the study, with 20 being classified as Arbeitsgemeinschaft für Osteosynthesefragen (AO) C-type. Pre-'lift' volar tilt ranged from 0° to -20°. Post-'lift' volar tilt ranged from 2° to 16°, with all but three cases ranging from 5° to 15°. The mean volar tilt achieved was 10.2°. The trigonometry-integrated 'lift' technique resulted in reliable intra-operative restoration of anatomic volar tilt in distal radius fractures.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-04
... commercial market (``ECM'') under sections 2(h)(3)-(5) of the Commodity Exchange Act (``CEA'' or the ``Act...\\ significantly broadened the CFTC's regulatory authority with respect to ECMs by creating, in section 2(h)(7) of the CEA, a new regulatory category--ECMs on which significant price discovery contracts (``SPDCs...
Survey of techniques used to preserve biological materials
NASA Technical Reports Server (NTRS)
Feinler, E. J.; Hubbard, R. W.
1972-01-01
The techniques used to preserve biological materials are documented and summarized. The report is presented in a handbook format that categorizes the most important preservation techniques available, and includes a representative sampling of the thousands of applications of these techniques to biological materials and organisms. Details of the information coverage and method of approach are outlined. Data are given in tabular form, and an index and extensive bibliography are included.
Collaborative Learning in the Dance Technique Class
ERIC Educational Resources Information Center
Raman, Tanja
2009-01-01
This research was designed to enhance dance technique learning by promoting critical thinking amongst students studying on a degree programme at the University of Wales Institute, Cardiff. Students were taught Cunningham-based dance technique using pair work together with the traditional demonstration/copying method. To evaluate the study,…
Advanced techniques to prepare seed to sow
Robert P. Karrfalt
2013-01-01
This paper reviews research on improving the basic technique of cold stratification for tree and shrub seeds. Advanced stratification techniques include long stratification, stratification re-dry, or multiple cycles of warm-cold stratification. Research demonstrates that careful regulation of moisture levels and lengthening the stratification period have produced a...
Outcome of different facial nerve reconstruction techniques.
Mohamed, Aboshanif; Omi, Eigo; Honda, Kohei; Suzuki, Shinsuke; Ishikawa, Kazuo
There is no technique of facial nerve reconstruction that guarantees facial function recovery up to grade III. To evaluate the efficacy and safety of different facial nerve reconstruction techniques. Facial nerve reconstruction was performed in 22 patients (facial nerve interpositional graft in 11 patients and hypoglossal-facial nerve transfer in another 11 patients). All patients had facial function House-Brackmann (HB) grade VI, either caused by trauma or after resection of a tumor. All patients were submitted to a primary nerve reconstruction except 7 patients, where late reconstruction was performed two weeks to four months after the initial surgery. The follow-up period was at least two years. For facial nerve interpositional graft technique, we achieved facial function HB grade III in eight patients and grade IV in three patients. Synkinesis was found in eight patients, and facial contracture with synkinesis was found in two patients. In regards to hypoglossal-facial nerve transfer using different modifications, we achieved facial function HB grade III in nine patients and grade IV in two patients. Facial contracture, synkinesis and tongue atrophy were found in three patients, and synkinesis was found in five patients. However, those who had primary direct facial-hypoglossal end-to-side anastomosis showed the best result without any neurological deficit. Among various reanimation techniques, when indicated, direct end-to-side facial-hypoglossal anastomosis through epineural suturing is the most effective technique with excellent outcomes for facial reanimation and preservation of tongue movement, particularly when performed as a primary technique. Copyright © 2016 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Auricular reconstruction for microtia: Part II. Surgical techniques.
Walton, Robert L; Beahm, Elisabeth K
2002-07-01
Reconstruction of the microtic ear represents one of the most demanding challenges in reconstructive surgery. In this review the two most commonly used techniques for ear reconstruction, the Brent and Nagata techniques, are addressed in detail. Unique to this endeavor, the originator of each technique has been allowed to submit representative case material and to address the pros and cons of the other's technique. What follows is a detailed, insightful overview of microtia reconstruction, as a state of the art. The review then details commonly encountered problems in ear reconstruction and pertinent technical points. Finally, a glimpse into the future is offered with an accounting of the advances made in tissue engineering as this technology applies to auricular reconstruction.
Endoscopic colloid cyst excision: surgical techniques and nuances.
Azab, Waleed Abdelfattah; Najibullah, Mustafa; Yosef, Waleed
2017-06-01
Endoscopic excision of colloid cysts is currently well established as a minimally invasive and highly effective technique that is associated with less morbidity in comparison to microsurgical resection. Operative charts and videos of patients undergoing endoscopic colloid cyst excision were retrieved from the senior author's database of endoscopic procedures and reviewed. This revealed nine trans-foraminal and three trans-septal procedures. Description of the surgical techniques was then formulated. Variation of the technique is based on the specific patho-anatomical features of the colloid cyst being resected. For the trans-foraminal approach, we think that the rotational technique is associated with a more complete removal of the cyst wall and consequently lower recurrence rate.
Liposomal Bupivacaine Injection Technique in Total Knee Arthroplasty.
Meneghini, R Michael; Bagsby, Deren; Ireland, Philip H; Ziemba-Davis, Mary; Lovro, Luke R
2017-01-01
Liposomal bupivacaine has gained popularity for pain control after total knee arthroplasty (TKA), yet its true efficacy remains unproven. We compared the efficacy of two different periarticular injection (PAI) techniques for liposomal bupivacaine with a conventional PAI control group. This retrospective cohort study compared consecutive patients undergoing TKA with a manufacturer-recommended, optimized injection technique for liposomal bupivacaine, a traditional injection technique for liposomal bupivacaine, and a conventional PAI of ropivacaine, morphine, and epinephrine. The optimized technique utilized a smaller gauge needle and more injection sites. Self-reported pain scores, rescue opioids, and side effects were compared. There were 41 patients in the liposomal bupivacaine optimized injection group, 60 in the liposomal bupivacaine traditional injection group, and 184 in the conventional PAI control group. PAI liposomal bupivacaine delivered via manufacturer-recommended technique offered no benefit over PAI ropivacaine, morphine, and epinephrine. Mean pain scores and the proportions reporting no or mild pain, time to first opioid, and amount of opioids consumed were not better with PAI liposomal bupivacaine compared with PAI ropivacaine, morphine, and epinephrine. The use of the manufacturer-recommended technique for PAI of liposomal bupivacaine does not offer benefit over a conventional, less expensive PAI during TKA. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
New technique for calibrating hydrocarbon gas flowmeters
NASA Technical Reports Server (NTRS)
Singh, J. J.; Puster, R. L.
1984-01-01
A technique for measuring calibration correction factors for hydrocarbon mass flowmeters is described. It is based on the Nernst theorem for matching the partial pressure of oxygen in the combustion products of the test hydrocarbon, burned in oxygen-enriched air, with that in normal air. It is applied to a widely used type of commercial thermal mass flowmeter for a number of hydrocarbons. The calibration correction factors measured using this technique are in good agreement with the values obtained by other independent procedures. The technique is successfully applied to the measurement of differences as low as one percent of the effective hydrocarbon content of the natural gas test samples.
Cache Energy Optimization Techniques For Modern Processors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mittal, Sparsh
2013-01-01
Modern multicore processors are employing large last-level caches, for example Intel's E7-8800 processor uses 24MB L3 cache. Further, with each CMOS technology generation, leakage energy has been dramatically increasing and hence, leakage energy is expected to become a major source of energy dissipation, especially in last-level caches (LLCs). The conventional schemes of cache energy saving either aim at saving dynamic energy or are based on properties specific to first-level caches, and thus these schemes have limited utility for last-level caches. Further, several other techniques require offline profiling or per-application tuning and hence are not suitable for product systems. In thismore » book, we present novel cache leakage energy saving schemes for single-core and multicore systems; desktop, QoS, real-time and server systems. Also, we present cache energy saving techniques for caches designed with both conventional SRAM devices and emerging non-volatile devices such as STT-RAM (spin-torque transfer RAM). We present software-controlled, hardware-assisted techniques which use dynamic cache reconfiguration to configure the cache to the most energy efficient configuration while keeping the performance loss bounded. To profile and test a large number of potential configurations, we utilize low-overhead, micro-architecture components, which can be easily integrated into modern processor chips. We adopt a system-wide approach to save energy to ensure that cache reconfiguration does not increase energy consumption of other components of the processor. We have compared our techniques with state-of-the-art techniques and have found that our techniques outperform them in terms of energy efficiency and other relevant metrics. The techniques presented in this book have important applications in improving energy-efficiency of higher-end embedded, desktop, QoS, real-time, server processors and multitasking systems. This book is intended to be a valuable guide for both
Biosensing Using Magnetic Particle Detection Techniques
Chen, Yi-Ting; Kolhatkar, Arati G.; Zenasni, Oussama; Xu, Shoujun
2017-01-01
Magnetic particles are widely used as signal labels in a variety of biological sensing applications, such as molecular detection and related strategies that rely on ligand-receptor binding. In this review, we explore the fundamental concepts involved in designing magnetic particles for biosensing applications and the techniques used to detect them. First, we briefly describe the magnetic properties that are important for bio-sensing applications and highlight the associated key parameters (such as the starting materials, size, functionalization methods, and bio-conjugation strategies). Subsequently, we focus on magnetic sensing applications that utilize several types of magnetic detection techniques: spintronic sensors, nuclear magnetic resonance (NMR) sensors, superconducting quantum interference devices (SQUIDs), sensors based on the atomic magnetometer (AM), and others. From the studies reported, we note that the size of the MPs is one of the most important factors in choosing a sensing technique. PMID:28994727
Diffraction analysis of customized illumination technique
NASA Astrophysics Data System (ADS)
Lim, Chang-Moon; Kim, Seo-Min; Eom, Tae-Seung; Moon, Seung Chan; Shin, Ki S.
2004-05-01
Various enhancement techniques such as alternating PSM, chrome-less phase lithography, double exposure, etc. have been considered as driving forces to lead the production k1 factor towards below 0.35. Among them, a layer specific optimization of illumination mode, so-called customized illumination technique receives deep attentions from lithographers recently. A new approach for illumination customization based on diffraction spectrum analysis is suggested in this paper. Illumination pupil is divided into various diffraction domains by comparing the similarity of the confined diffraction spectrum. Singular imaging property of individual diffraction domain makes it easier to build and understand the customized illumination shape. By comparing the goodness of image in each domain, it was possible to achieve the customized shape of illumination. With the help from this technique, it was found that the layout change would not gives the change in the shape of customized illumination mode.
Characterizing odors from cattle feedlots with different odor techniques
USDA-ARS?s Scientific Manuscript database
Odors from cattle feedlots negatively affect local communities. The purpose of this study was to characterize odors and odorants using different odor sampling techniques. Odors were characterized with field olfactometers (Nasal Ranger®), sensory techniques (GC-O) and analytical techniques (sorbent t...
Investigation of advanced phase-shifting projected fringe profilometry techniques
NASA Astrophysics Data System (ADS)
Liu, Hongyu
1999-11-01
The phase-shifting projected fringe profilometry (PSPFP) technique is a powerful tool in the profile measurements of rough engineering surfaces. Compared with other competing techniques, this technique is notable for its full-field measurement capacity, system simplicity, high measurement speed, and low environmental vulnerability. The main purpose of this dissertation is to tackle three important problems, which severely limit the capability and the accuracy of the PSPFP technique, with some new approaches. Chapter 1 provides some background information of the PSPFP technique including the measurement principles, basic features, and related techniques is briefly introduced. The objectives and organization of the thesis are also outlined. Chapter 2 gives a theoretical treatment to the absolute PSPFP measurement. The mathematical formulations and basic requirements of the absolute PSPFP measurement and its supporting techniques are discussed in detail. Chapter 3 introduces the experimental verification of the proposed absolute PSPFP technique. Some design details of a prototype system are discussed as supplements to the previous theoretical analysis. Various fundamental experiments performed for concept verification and accuracy evaluation are introduced together with some brief comments. Chapter 4 presents the theoretical study of speckle- induced phase measurement errors. In this analysis, the expression for speckle-induced phase errors is first derived based on the multiplicative noise model of image- plane speckles. The statistics and the system dependence of speckle-induced phase errors are then thoroughly studied through numerical simulations and analytical derivations. Based on the analysis, some suggestions on the system design are given to improve measurement accuracy. Chapter 5 discusses a new technique combating surface reflectivity variations. The formula used for error compensation is first derived based on a simplified model of the detection process
PID techniques: Alternatives to RICH Methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vavra, J.; /SLAC
2011-03-01
In this review article we discuss the recent progress in PID techniques other than the RICH methods. In particular we mention the recent progress in the Transition Radiation Detector (TRD), dE/dx cluster counting, and Time Of Flight (TOF) techniques. The TRD technique is mature and has been tried in many hadron colliders. It needs space though, about 20cm of detector radial space for every factor of 10 in the {pi}/e rejection power, and this tends to make such detectors large. Although the cluster counting technique is an old idea, it was never tried in a real physics experiment. Recently, theremore » are efforts to revive it for the SuperB experiment using He-based gases and waveform digitizing electronics. A factor of almost 2 improvement, compared to the classical dE/dx performance, is possible in principle. However, the complexity of the data analysis will be substantial. The TOF technique is well established, but introduction of new fast MCP-PMT and G-APD detectors creates new possibilities. It seems that resolutions below 20-30ps may be possible at some point in the future with relatively small systems, and perhaps this could be pushed down to 10-15ps with very small systems, assuming that one can solve many systematic issues. However, the cost, rate limitation, aging and cross-talk in multi-anode devices at high BW are problems. There are several groups working on these issues, so progress is likely. Table 6 summarizes the author's opinion of pros and cons of various detectors presented in this paper based on their operational capabilities. We refer the reader to Ref.40 for discussion of other more general limits from the PID point of view.« less
Novel expansion techniques for skin grafts
Kadam, Dinesh
2016-01-01
The quest for skin expansion is not restricted to cover a large area alone, but to produce acceptable uniform surfaces, robust engraftment to withstand mechanical shear and infection, with a minimal donor morbidity. Ease of the technique, shorter healing period and reproducible results are essential parameters to adopt novel techniques. Significant advances seen in four fronts of autologous grafting are: (1) Dermal–epidermal graft expansion techniques, (2) epidermal graft harvests technique, (3) melanocyte-rich basal cell therapy for vitiligo and (4) robust and faster autologous cell cultures. Meek's original concept that the sum of perimeter of smaller grafts is larger than the harvested graft, and smaller the graft size, the greater is the potential for regeneration is witnessed in newer modification. Further, as graft size becomes smaller or minced, these micrografts can survive on the wound bed exudate irrespective of their dermal orientation. Expansion produced by 4 mm × 4 mm sized Meek micrografts is 10-folds, similarly 0.8 mm × 0.8 mm size micrografts produce 100-fold expansion, which becomes 700-fold with pixel grafts of 0.3 mm × 0.3 mm size. Fractional skin harvest is another new technique with 700 μ size full thickness graft. These provide instant autologous non-cultured graft to cover extensive areas with similar quality of engraftment surface as split skin grafts. Newer tools for epidermal blister graft harvest quickly, with uniform size to produce 7-fold expansions with reproducible results. In addition, donor area heals faster with minimal scar. Melanocyte-rich cell suspension is utilised in vitiligo surgery tapping the potential of hair root melanocytes. Further advances in the cell culture to reduce the cultivation time and provide stronger epidermal sheets with dermal carrier are seen in trials. PMID:27274117
Classroom Techniques for Black Male Student Retention.
ERIC Educational Resources Information Center
Gardenhire, John Fouts
This paper describes and encourages the application of 20 classroom techniques to enhance the retention and success of black male college students. Though retention enhancement programs work best when institution-wide support and commitment are behind them, the techniques described here can be implemented in the classroom with significant results…
Intimate Debate Technique: Medicinal Use of Marijuana
ERIC Educational Resources Information Center
Herreid, Clyde Freeman; DeRei, Kristie
2007-01-01
Classroom debates used to be familiar exercises to students schooled in past generations. In this article, the authors describe the technique called "intimate debate". To cooperative learning specialists, the technique is known as "structured debate" or "constructive debate". It is a powerful method for dealing with case topics that involve…
Variations in aseptic technique and implications for infection control.
Aziz, Anne Marie
Healthcare-acquired infections (HAIs) are a serious concern, costing the NHS 1 billion pounds a year and causing 5000 deaths annually despite increased funding. A contributing factor is the variety of aseptic techniques in use in different hospitals and even within a single hospital. These cause problems for healthcare workers as well as increasing the risk of HAI. This article examines a number of traditional approaches to aseptic technique, highlighting their differences and the implications for infection control. It concludes that improvement in aseptic technique could be achieved by implementation of a single unified approach to aseptic technique that can be standardized and audited annually, such as the aseptic non-touch technique (ANTT), which has been recommended for adoption throughout the UK. It ends with suggestions for measures that could be introduced and strengthened to improve aseptic technique, and ultimately reduce the rate of HAI.
INNOVATIONS IN EQUIPMENT AND TECHNIQUES FOR THE BIOLOGY TEACHING LABORATORY.
ERIC Educational Resources Information Center
BARTHELEMY, RICHARD E.; AND OTHERS
LABORATORY TECHNIQUES AND EQUIPMENT APPROPRIATE FOR TEACHING BIOLOGICAL SCIENCE CURRICULUM STUDY BIOLOGY ARE EMPHASIZED. MAJOR CATEGORIES INCLUDE (1) LABORATORY FACILITIES, (2) EQUIPMENT AND TECHNIQUES FOR CULTURE OF MICRO-ORGANISMS, (3) LABORATORY ANIMALS AND THEIR HOUSING, (4) TECHNIQUES FOR STUDYING PLANT GROWTH, (5) TECHNIQUES FOR STUDYING…
Biometric feature embedding using robust steganography technique
NASA Astrophysics Data System (ADS)
Rashid, Rasber D.; Sellahewa, Harin; Jassim, Sabah A.
2013-05-01
This paper is concerned with robust steganographic techniques to hide and communicate biometric data in mobile media objects like images, over open networks. More specifically, the aim is to embed binarised features extracted using discrete wavelet transforms and local binary patterns of face images as a secret message in an image. The need for such techniques can arise in law enforcement, forensics, counter terrorism, internet/mobile banking and border control. What differentiates this problem from normal information hiding techniques is the added requirement that there should be minimal effect on face recognition accuracy. We propose an LSB-Witness embedding technique in which the secret message is already present in the LSB plane but instead of changing the cover image LSB values, the second LSB plane will be changed to stand as a witness/informer to the receiver during message recovery. Although this approach may affect the stego quality, it is eliminating the weakness of traditional LSB schemes that is exploited by steganalysis techniques for LSB, such as PoV and RS steganalysis, to detect the existence of secrete message. Experimental results show that the proposed method is robust against PoV and RS attacks compared to other variants of LSB. We also discussed variants of this approach and determine capacity requirements for embedding face biometric feature vectors while maintain accuracy of face recognition.
The analytical representation of viscoelastic material properties using optimization techniques
NASA Technical Reports Server (NTRS)
Hill, S. A.
1993-01-01
This report presents a technique to model viscoelastic material properties with a function of the form of the Prony series. Generally, the method employed to determine the function constants requires assuming values for the exponential constants of the function and then resolving the remaining constants through linear least-squares techniques. The technique presented here allows all the constants to be analytically determined through optimization techniques. This technique is employed in a computer program named PRONY and makes use of commercially available optimization tool developed by VMA Engineering, Inc. The PRONY program was utilized to compare the technique against previously determined models for solid rocket motor TP-H1148 propellant and V747-75 Viton fluoroelastomer. In both cases, the optimization technique generated functions that modeled the test data with at least an order of magnitude better correlation. This technique has demonstrated the capability to use small or large data sets and to use data sets that have uniformly or nonuniformly spaced data pairs. The reduction of experimental data to accurate mathematical models is a vital part of most scientific and engineering research. This technique of regression through optimization can be applied to other mathematical models that are difficult to fit to experimental data through traditional regression techniques.
Prosthetic valve sparing aortic root replacement: an improved technique.
Leacche, Marzia; Balaguer, Jorge M; Umakanthan, Ramanan; Byrne, John G
2008-10-01
We describe a modified surgical technique to treat patients with a previous history of isolated aortic valve replacement who now require aortic root replacement for an aneurysmal or dissected aorta. This technique consists of replacing the aortic root with a Dacron conduit, leaving intact the previously implanted prosthesis, and re-implanting the coronary arteries in the Dacron graft. Our technique differs from other techniques in that we do not leave behind any aortic tissue remnant and also in that we use a felt strip to obliterate any gap between the old sewing ring and the newly implanted graft. In our opinion, this promotes better hemostasis. We demonstrate that this technique is safe, feasible, and results in acceptable outcomes.
77 FR 40552 - Federal Acquisition Regulation; Price Analysis Techniques
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-10
... Regulation; Price Analysis Techniques AGENCY: Department of Defense (DoD), General Services Administration... price analysis technique in order to establish a fair and reasonable price. DATES: Interested parties....404-1(b)(2) addresses various price analysis techniques and procedures the Government may use to...
Various diffusion magnetic resonance imaging techniques for pancreatic cancer
Tang, Meng-Yue; Zhang, Xiao-Ming; Chen, Tian-Wu; Huang, Xiao-Hua
2015-01-01
Pancreatic cancer is one of the most common malignant tumors and remains a treatment-refractory cancer with a poor prognosis. Currently, the diagnosis of pancreatic neoplasm depends mainly on imaging and which methods are conducive to detecting small lesions. Compared to the other techniques, magnetic resonance imaging (MRI) has irreplaceable advantages and can provide valuable information unattainable with other noninvasive or minimally invasive imaging techniques. Advances in MR hardware and pulse sequence design have particularly improved the quality and robustness of MRI of the pancreas. Diffusion MR imaging serves as one of the common functional MRI techniques and is the only technique that can be used to reflect the diffusion movement of water molecules in vivo. It is generally known that diffusion properties depend on the characterization of intrinsic features of tissue microdynamics and microstructure. With the improvement of the diffusion models, diffusion MR imaging techniques are increasingly varied, from the simplest and most commonly used technique to the more complex. In this review, the various diffusion MRI techniques for pancreatic cancer are discussed, including conventional diffusion weighted imaging (DWI), multi-b DWI based on intra-voxel incoherent motion theory, diffusion tensor imaging and diffusion kurtosis imaging. The principles, main parameters, advantages and limitations of these techniques, as well as future directions for pancreatic diffusion imaging are also discussed. PMID:26753059
AC electrothermal technique in microchannels
NASA Astrophysics Data System (ADS)
Salari, Alinaghi; Navi, Maryam; Dalton, Colin
2017-02-01
Electrokinetic techniques have a wide range of applications in droplet, particle, and fluid manipulation systems. In general, they can be categorized into different subgroups including electroosmosis, electrothermal, electrophoresis, dielectrophoresis, etc. The AC electrothermal (ACET) technique has been shown to be very effective in applications which involve high conductivity fluids, such as blood, which are typically used in biomedical applications. In the past few years, the ACET effect has received considerable attention. Unlike AC electroosmosis (ACEO), the ACET effect shows plateaus in force in a wide frequency range. In other words, with electrothermal force, velocity is more steady and predictable at different frequencies, compared to ACEO and dielectrophoresis (DEP). Although electrothermal microflows form as a result of Joule heating in the fluid, due to high conduction of heat to the ambience, the temperature rise in the fluid is not so high as to threaten the nature of the biofluids. The average temperature rise resulting from the ACET effect is below 5 °K. In order to generate high strength AC electric fields, microfabricated electrode arrays are commonly used in microchannels. For pumping applications, it is essential to create asymmetry in the electric field, typically by having asymmetrical electrode pairs. There is no defined border between many electrokinetic techniques, and as such the point where electrothermal processes interferes with other electrokinetic techniques is not clear in the literature. In addition, there have been comprehensive reviews on micropumps, electrokinetics, and their subcategories, but the literature lacks a detailed up-to-date review on electrothermal microdevices. In this paper, a brief review is made specifically on electric fields in ACET devices, in order to provide an insight for the reader about the importance of this aspect of ACET devices and the improvements made to date.
Inferior alveolar nerve block: Alternative technique.
Thangavelu, K; Kannan, R; Kumar, N Senthil
2012-01-01
Inferior alveolar nerve block (IANB) is a technique of dental anesthesia, used to produce anesthesia of the mandibular teeth, gingivae of the mandible and lower lip. The conventional IANB is the most commonly used the nerve block technique for achieving local anesthesia for mandibular surgical procedures. In certain cases, however, this nerve block fails, even when performed by the most experienced clinician. Therefore, it would be advantageous to find an alternative simple technique. The objective of this study is to find an alternative inferior alveolar nerve block that has a higher success rate than other routine techniques. To this purpose, a simple painless inferior alveolar nerve block was designed to anesthetize the inferior alveolar nerve. This study was conducted in Oral surgery department of Vinayaka Mission's dental college Salem from May 2009 to May 2011. Five hundred patients between the age of 20 years and 65 years who required extraction of teeth in mandible were included in the study. Out of 500 patients 270 were males and 230 were females. The effectiveness of the IANB was evaluated by using a sharp dental explorer in the regions innervated by the inferior alveolar, lingual, and buccal nerves after 3, 5, and 7 min, respectively. This study concludes that inferior alveolar nerve block is an appropriate alternative nerve block to anesthetize inferior alveolar nerve due to its several advantages.
DOE Office of Scientific and Technical Information (OSTI.GOV)
MAGEE,GLEN I.
Computers transfer data in a number of different ways. Whether through a serial port, a parallel port, over a modem, over an ethernet cable, or internally from a hard disk to memory, some data will be lost. To compensate for that loss, numerous error detection and correction algorithms have been developed. One of the most common error correction codes is the Reed-Solomon code, which is a special subset of BCH (Bose-Chaudhuri-Hocquenghem) linear cyclic block codes. In the AURA project, an unmanned aircraft sends the data it collects back to earth so it can be analyzed during flight and possible flightmore » modifications made. To counter possible data corruption during transmission, the data is encoded using a multi-block Reed-Solomon implementation with a possibly shortened final block. In order to maximize the amount of data transmitted, it was necessary to reduce the computation time of a Reed-Solomon encoding to three percent of the processor's time. To achieve such a reduction, many code optimization techniques were employed. This paper outlines the steps taken to reduce the processing time of a Reed-Solomon encoding and the insight into modern optimization techniques gained from the experience.« less
Exploring the Components of Dynamic Modeling Techniques
ERIC Educational Resources Information Center
Turnitsa, Charles Daniel
2012-01-01
Upon defining the terms modeling and simulation, it becomes apparent that there is a wide variety of different models, using different techniques, appropriate for different levels of representation for any one system to be modeled. Selecting an appropriate conceptual modeling technique from those available is an open question for the practitioner.…
Exploring Small Climates--An Outdoor Science Technique.
ERIC Educational Resources Information Center
Rillo, Thomas J.
The study of climates in small areas as an outdoor science teaching technique is described in this paper. It is suggested that, while teachers are presenting a weather unit to their elementary school classes, they should not overlook the opportunity to make learning more meaningful through outdoor teaching techniques. Explorations of temperatures…
Ambient air contamination: Characterization and detection techniques
NASA Technical Reports Server (NTRS)
Nulton, C. P.; Silvus, H. S.
1985-01-01
Techniques to characterize and detect sources of ambient air contamination are described. Chemical techniques to identify indoor contaminants are outlined, they include gas chromatography, or colorimetric detection. Organics generated from indoor materials at ambient conditions and upon combustion are characterized. Piezoelectric quartz crystals are used as precision frequency determining elements in electronic oscillators.
Extended Techniques in Trumpet Performance and Pedagogy
ERIC Educational Resources Information Center
Cherry, Amy K.
2009-01-01
The impetus for this study was the question of whether extended techniques are actually being taught in college trumpet studio settings as standard skills necessary on the instrument. The specific purposes of this document included: (1) catalogue the extended techniques available to today's trumpet performer, (2) reflect on their current use and…
Long-Term Maintenance of Pharmacists' Inhaler Technique Demonstration Skills
Armour, Carol L; Reddel, Helen K; Bosnic-Anticevich, Sinthia Z
2009-01-01
Objective To assess the effectiveness of a single educational intervention, followed by patient education training, in pharmacists retaining their inhaler technique skills. Methods A convenience sample of 31 pharmacists attended an educational workshop and their inhaler techniques were assessed. Those randomly assigned to the active group were trained to assess and teach correct Turbuhaler and Diskus inhaler techniques to patients and provided with patient education tools to use in their pharmacies during a 6-month study. Control pharmacists delivered standard care. All pharmacists were reassessed 2 years after initial training. Results Thirty-one pharmacists participated in the study. At the initial assessment, few pharmacists demonstrated correct technique (Turbuhaler:13%, Diskus:6%). All pharmacists in the active group demonstrated correct technique following training. Two years later, pharmacists in the active group demonstrated significantly better inhaler technique than pharmacists in the control group (p < 0.05) for Turbuhaler and Diskus (83% vs.11%; 75% vs.11%, respectively). Conclusion Providing community pharmacists with effective patient education tools and encouraging their involvement in educating patients may contribute to pharmacists maintaining their competence in correct inhaler technique long-term. PMID:19513170
A novel capsulorhexis technique using shearing forces with cystotome.
Karim, Shah M R; Ong, Chin T; Sleep, Tamsin J
2010-05-15
To demonstrate a capsulorhexis technique using predominantly shearing forces with a cystotome on a virtual reality simulator and on a human eye. Our technique involves creating the initial anterior capsular tear with a cystotome to raise a flap. The flap left unfolded on the lens surface. The cystotome tip is tilted horizontally and is engaged on the flap near the leading edge of the tear. The cystotome is moved in a circular fashion to direct the vector forces. The loose flap is constantly swept towards the centre so that it does not obscure the view on the tearing edge. Our technique has the advantage of reducing corneal wound distortion and subsequent anterior chamber collapse. The capsulorhexis flap is moved away from the tear leading edge allowing better visualisation of the direction of tear. This technique offers superior control of the capsulorhexis by allowing the surgeon to change the direction of the tear to achieve the desired capsulorhexis size. The EYESI Surgical Simulator is a realistic training platform for surgeons to practice complex capsulorhexis techniques. The shearing forces technique is a suitable alternative and in some cases a far better technique in achieving the desired capsulorhexis.
Computational technique for stepwise quantitative assessment of equation correctness
NASA Astrophysics Data System (ADS)
Othman, Nuru'l Izzah; Bakar, Zainab Abu
2017-04-01
Many of the computer-aided mathematics assessment systems that are available today possess the capability to implement stepwise correctness checking of a working scheme for solving equations. The computational technique for assessing the correctness of each response in the scheme mainly involves checking the mathematical equivalence and providing qualitative feedback. This paper presents a technique, known as the Stepwise Correctness Checking and Scoring (SCCS) technique that checks the correctness of each equation in terms of structural equivalence and provides quantitative feedback. The technique, which is based on the Multiset framework, adapts certain techniques from textual information retrieval involving tokenization, document modelling and similarity evaluation. The performance of the SCCS technique was tested using worked solutions on solving linear algebraic equations in one variable. 350 working schemes comprising of 1385 responses were collected using a marking engine prototype, which has been developed based on the technique. The results show that both the automated analytical scores and the automated overall scores generated by the marking engine exhibit high percent agreement, high correlation and high degree of agreement with manual scores with small average absolute and mixed errors.
Comparison of raised-microdisk whispering-gallery-mode characterization techniques.
Redding, Brandon; Marchena, Elton; Creazzo, Tim; Shi, Shouyuan; Prather, Dennis W
2010-04-01
We compare the two prevailing raised-microdisk whispering-gallery-mode (WGM) characterization techniques, one based on coupling emission to a tapered fiber and the other based on collecting emission in the far field. We applied both techniques to study WGMs in Si nanocrystal raised microdisks and observed dramatically different behavior. We explain this difference in terms of the radiative bending loss on which the far-field collection technique relies and discuss the regimes of operation in which each technique is appropriate.
Evaluation of gravimetric techniques to estimate the microvascular filtration coefficient
Dongaonkar, R. M.; Laine, G. A.; Stewart, R. H.
2011-01-01
Microvascular permeability to water is characterized by the microvascular filtration coefficient (Kf). Conventional gravimetric techniques to estimate Kf rely on data obtained from either transient or steady-state increases in organ weight in response to increases in microvascular pressure. Both techniques result in considerably different estimates and neither account for interstitial fluid storage and lymphatic return. We therefore developed a theoretical framework to evaluate Kf estimation techniques by 1) comparing conventional techniques to a novel technique that includes effects of interstitial fluid storage and lymphatic return, 2) evaluating the ability of conventional techniques to reproduce Kf from simulated gravimetric data generated by a realistic interstitial fluid balance model, 3) analyzing new data collected from rat intestine, and 4) analyzing previously reported data. These approaches revealed that the steady-state gravimetric technique yields estimates that are not directly related to Kf and are in some cases directly proportional to interstitial compliance. However, the transient gravimetric technique yields accurate estimates in some organs, because the typical experimental duration minimizes the effects of interstitial fluid storage and lymphatic return. Furthermore, our analytical framework reveals that the supposed requirement of tying off all draining lymphatic vessels for the transient technique is unnecessary. Finally, our numerical simulations indicate that our comprehensive technique accurately reproduces the value of Kf in all organs, is not confounded by interstitial storage and lymphatic return, and provides corroboration of the estimate from the transient technique. PMID:21346245
Laparoscopic techniques versus open techniques for inguinal hernia repair.
McCormack, K; Scott, N W; Go, P M; Ross, S; Grant, A M
2003-01-01
Inguinal hernia repair is the most frequently performed operation in general surgery. The standard method for inguinal hernia repair had changed little over a hundred years until the introduction of synthetic mesh. This mesh can be placed by either using an open approach or by using a minimal access laparoscopic technique. Although many studies have explored the relative merits and potential risks of laparoscopic surgery for the repair of inguinal hernia, most individual trials have been too small to show clear benefits of one type of surgical repair over another. The objective of this review was to compare minimal access laparoscopic mesh techniques with open techniques. Comparisons of open mesh techniques versus open non-mesh techniques have been considered in a separate Cochrane review. We searched MEDLINE, EMBASE, and The Cochrane Central Controlled Trials Registry for relevant randomised controlled trials. The reference list of identified trials, journal supplements, relevant book chapters and conference proceedings were searched for further relevant trials. Through the EU Hernia Trialists Collaboration (EUHTC) communication took place with authors of identified randomised controlled trials to ask for information on any other recent and ongoing trials known to them. Specialists involved in research on the repair of inguinal hernia were contacted to ask for information about any further completed and ongoing trials. The world wide web was also searched. All published and unpublished randomised controlled trials and quasi-randomised controlled trials comparing laparoscopic groin hernia repair with open groin hernia repair were eligible for inclusion. Trials were included irrespective of the language in which they were reported. Individual patient data were obtained, where possible, from the responsible trialist for all eligible studies. All reanalyses were cross-checked by the reviewers and verified by the trialists before inclusion. Where IPD were unavailable
Ito, Shizuyo; Noguchi, Makoto; Suda, Yoshiyuki; Yamaguchi, Akira; Kohama, Geniku; Yamamoto, Etsuhide
2006-04-01
The aim of this study was to evaluate and compare the maxillary dental arch shape and speech of cleft palate patients following pushback palatoplasty using either the supraperiosteal flap technique or the mucoperiosteal flap technique. Sixty-two patients (29, cleft palate only; 33, unilateral cleft lip, alveolus and palate) operated on by the supraperiosteal technique and 47 patients (23, cleft palate only; 24 unilateral cleft lip, alveolus and palate) by the mucoperiosteal technique were reviewed in this study. Dental arch shape and speech proficiency at preschool and school age were evaluated in all patients. Dental arch shapes were classified as U type (good dental arch shape) and V type (narrow dental arch shape). In cleft palate only patients, U type was observed in 90% of the supraperiosteal group and 83% of the mucoperiosteal group. In unilateral cleft lip, alveolus and palate patients, U type was observed in 85% of the supraperiosteal group, while only in 33% of the mucoperiosteal group. In cleft palate only patients, normal speech at school age was observed 100% of the supraperiosteal group and 83% of the mucoperiosteal group. In unilateral cleft lip, alveolus and palate patients, normal speech at school age was observed in 97% of the supraperiosteal group and 75% of the mucoperiosteal group. Misarticulation was frequently found in patients with the V type of dental arch shape. It is suggested that pushback palatoplasty using the supraperiosteal technique is more advantageous for speech development compared with the mucoperiosteal technique.
Management Techniques for Librarians.
ERIC Educational Resources Information Center
Evans, G. Edward
This textbook on library management techniques is concerned with basic management problems. Examples of problems in planning, organization, and coordination are drawn from situations in libraries or information centers. After an introduction to library management, the history of management is covered. Several styles of management and organization…
Neutron-based nonintrusive inspection techniques
NASA Astrophysics Data System (ADS)
Gozani, Tsahi
1997-02-01
Non-intrusive inspection of large objects such as trucks, sea-going shipping containers, air cargo containers and pallets is gaining attention as a vital tool in combating terrorism, drug smuggling and other violation of international and national transportation and Customs laws. Neutrons are the preferred probing radiation when material specificity is required, which is most often the case. Great strides have been made in neutron based inspection techniques. Fast and thermal neutrons, whether in steady state or in microsecond, or even nanosecond pulses are being employed to interrogate, at high speeds, for explosives, drugs, chemical agents, and nuclear and many other smuggled materials. Existing neutron techniques will be compared and their current status reported.
A comparison of force sensing techniques for planetary manipulation
NASA Technical Reports Server (NTRS)
Helmick, Daniel; Okon, Avi; DiCicco, Matt
2006-01-01
Five techniques for sensing forces with a manipulator are compared analytically and experimentally. The techniques compared are: a six-axis wrist force/torque sensor, joint torque sensors, link strain gauges, motor current sensors, and flexibility modeling. The accuracy and repeatability fo each technique is quantified and compared.
Application Of Iterative Reconstruction Techniques To Conventional Circular Tomography
NASA Astrophysics Data System (ADS)
Ghosh Roy, D. N.; Kruger, R. A.; Yih, B. C.; Del Rio, S. P.; Power, R. L.
1985-06-01
Two "point-by-point" iteration procedures, namely, Iterative Least Square Technique (ILST) and Simultaneous Iterative Reconstructive Technique (SIRT) were applied to classical circular tomographic reconstruction. The technique of tomosynthetic DSA was used in forming the tomographic images. Reconstructions of a dog's renal and neck anatomy are presented.
Dante's Comedy: precursors of psychoanalytic technique and psyche.
Szajnberg, Nathan Moses
2010-02-01
This paper uses a literary approach to explore what common ground exists in both psychoanalytic technique and views of the psyche, of 'person'. While Western literature has developed various views of psyche and person over centuries, there have been crystallizing, seminal portraits, for instance Shakespeare's perspective on what is human, some of which have endured to the present. By using Dante's Commedia, particularly the Inferno, a 14th century poem that both integrates and revises previous models of psyche and personhood, we can examine what features of psyche, and 'techniques' in soul-healing psychoanalysts have inherited culturally. Discovering basic features of technique and model of psyche we share as psychoanalysts permits us to explore why we have differences in variations on technique and models of inner life.
Modified radiotherapy technique in the treatment of medulloblastoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dewit, L.; Van Dam, J.; Rijnders, A.
1984-02-01
Craniospinal irradiation is a standard treatment technique in patients who receive surgery for medulloblastoma. In most centers megavoltage photon irradiation is used, resulting in significant irradiation exposure to critical organs. In order to overcome this difficulty, the authors recently modified the technique applied in their center, by using high energy electrons (20 MeV) for irradiation of the spinal cord. The reliability of this technique was checked by performing dosimetry in a specially constructed wax phantom. Attention was focused upon dose variations at the junction of fields. Furthermore, the influence of vertebrae on the absorbed dose distribution of high energy electronsmore » is presented. This technique seems to be safe and reliable in selected patients (children and teenagers).« less
Predictive Techniques for Spacecraft Cabin Air Quality Control
NASA Technical Reports Server (NTRS)
Perry, J. L.; Cromes, Scott D. (Technical Monitor)
2001-01-01
As assembly of the International Space Station (ISS) proceeds, predictive techniques are used to determine the best approach for handling a variety of cabin air quality challenges. These techniques use equipment offgassing data collected from each ISS module before flight to characterize the trace chemical contaminant load. Combined with crew metabolic loads, these data serve as input to a predictive model for assessing the capability of the onboard atmosphere revitalization systems to handle the overall trace contaminant load as station assembly progresses. The techniques for predicting in-flight air quality are summarized along with results from early ISS mission analyses. Results from groundbased analyses of in-flight air quality samples are compared to the predictions to demonstrate the technique's relative conservatism.
Virtual 3d City Modeling: Techniques and Applications
NASA Astrophysics Data System (ADS)
Singh, S. P.; Jain, K.; Mandla, V. R.
2013-08-01
3D city model is a digital representation of the Earth's surface and it's related objects such as Building, Tree, Vegetation, and some manmade feature belonging to urban area. There are various terms used for 3D city models such as "Cybertown", "Cybercity", "Virtual City", or "Digital City". 3D city models are basically a computerized or digital model of a city contains the graphic representation of buildings and other objects in 2.5 or 3D. Generally three main Geomatics approach are using for Virtual 3-D City models generation, in first approach, researcher are using Conventional techniques such as Vector Map data, DEM, Aerial images, second approach are based on High resolution satellite images with LASER scanning, In third method, many researcher are using Terrestrial images by using Close Range Photogrammetry with DSM & Texture mapping. We start this paper from the introduction of various Geomatics techniques for 3D City modeling. These techniques divided in to two main categories: one is based on Automation (Automatic, Semi-automatic and Manual methods), and another is Based on Data input techniques (one is Photogrammetry, another is Laser Techniques). After details study of this, finally in short, we are trying to give the conclusions of this study. In the last, we are trying to give the conclusions of this research paper and also giving a short view for justification and analysis, and present trend for 3D City modeling. This paper gives an overview about the Techniques related with "Generation of Virtual 3-D City models using Geomatics Techniques" and the Applications of Virtual 3D City models. Photogrammetry, (Close range, Aerial, Satellite), Lasergrammetry, GPS, or combination of these modern Geomatics techniques play a major role to create a virtual 3-D City model. Each and every techniques and method has some advantages and some drawbacks. Point cloud model is a modern trend for virtual 3-D city model. Photo-realistic, Scalable, Geo-referenced virtual 3
Quantitative Image Analysis Techniques with High-Speed Schlieren Photography
NASA Technical Reports Server (NTRS)
Pollard, Victoria J.; Herron, Andrew J.
2017-01-01
Optical flow visualization techniques such as schlieren and shadowgraph photography are essential to understanding fluid flow when interpreting acquired wind tunnel test data. Output of the standard implementations of these visualization techniques in test facilities are often limited only to qualitative interpretation of the resulting images. Although various quantitative optical techniques have been developed, these techniques often require special equipment or are focused on obtaining very precise and accurate data about the visualized flow. These systems are not practical in small, production wind tunnel test facilities. However, high-speed photography capability has become a common upgrade to many test facilities in order to better capture images of unsteady flow phenomena such as oscillating shocks and flow separation. This paper describes novel techniques utilized by the authors to analyze captured high-speed schlieren and shadowgraph imagery from wind tunnel testing for quantification of observed unsteady flow frequency content. Such techniques have applications in parametric geometry studies and in small facilities where more specialized equipment may not be available.
Study of synthesis techniques for insensitive aircraft control systems
NASA Technical Reports Server (NTRS)
Harvey, C. A.; Pope, R. E.
1977-01-01
Insensitive flight control system design criteria was defined in terms of maximizing performance (handling qualities, RMS gust response, transient response, stability margins) over a defined parameter range. Wing load alleviation for the C-5A was chosen as a design problem. The C-5A model was a 79-state, two-control structure with uncertainties assumed to exist in dynamic pressure, structural damping and frequency, and the stability derivative, M sub w. Five new techniques (mismatch estimation, uncertainty weighting, finite dimensional inverse, maximum difficulty, dual Lyapunov) were developed. Six existing techniques (additive noise, minimax, multiplant, sensitivity vector augmentation, state dependent noise, residualization) and the mismatch estimation and uncertainty weighting techniques were synthesized and evaluated on the design example. Evaluation and comparison of these six techniques indicated that the minimax and the uncertainty weighting techniques were superior to the other six, and of these two, uncertainty weighting has lower computational requirements. Techniques based on the three remaining new concepts appear promising and are recommended for further research.
Modulation Characterization Techniques
1991-04-01
34Advanced Communication Processing Techniques" was organized and held in Ruidoso , New Mexico, May 14-17, 1989. Dr. Charles Weber’s participation involved...to attend and deliver presentations at MILCOM . • Dr. Charles Weber travelled to Ruidoso , NM, to chair the session on Modulation...Characterization at the CSI Workshop May 14-17, 1989. 26 r * Dr. Andreas Polydoros travelled to Ruidoso , NM, to attend the CSI Workshop "Advanced Communication
NASA Technical Reports Server (NTRS)
Macneice, Peter
1995-01-01
This is an introduction to numerical Particle-Mesh techniques, which are commonly used to model plasmas, gravitational N-body systems, and both compressible and incompressible fluids. The theory behind this approach is presented, and its practical implementation, both for serial and parallel machines, is discussed. This document is based on a four-hour lecture course presented by the author at the NASA Summer School for High Performance Computational Physics, held at Goddard Space Flight Center.
Bayesian techniques for surface fuel loading estimation
Kathy Gray; Robert Keane; Ryan Karpisz; Alyssa Pedersen; Rick Brown; Taylor Russell
2016-01-01
A study by Keane and Gray (2013) compared three sampling techniques for estimating surface fine woody fuels. Known amounts of fine woody fuel were distributed on a parking lot, and researchers estimated the loadings using different sampling techniques. An important result was that precise estimates of biomass required intensive sampling for both the planar intercept...
Benefit from the minimally invasive sinus technique.
Salama, N; Oakley, R J; Skilbeck, C J; Choudhury, N; Jacob, A
2009-02-01
Sinus drainage is impeded by the transition spaces that the anterior paranasal sinuses drain into, not the ostia themselves. Addressing the transition spaces and leaving the ostia intact, using the minimally invasive sinus technique, should reverse chronic rhinosinusitis. To assess patient benefit following use of the minimally invasive sinus technique for chronic rhinosinusitis. One hundred and forty-three consecutive patients underwent the minimally invasive sinus technique for chronic rhinosinusitis. Symptoms (i.e. blocked nose, poor sense of smell, rhinorrhoea, post-nasal drip, facial pain and sneezing) were recorded using a visual analogue scale, pre-operatively and at six and 12 weeks post-operatively. Patients were also surveyed using the Glasgow benefit inventory, one and three years post-operatively. We found a significant reduction in all nasal symptom scores at six and 12 weeks post-operatively, and increased total quality of life scores at one and three years post-operatively (25.2 and 14.8, respectively). The patient benefits of treatment with the minimally invasive sinus technique compare with the published patient benefits for functional endoscopic sinus surgery.
Electrical Load Profile Analysis Using Clustering Techniques
NASA Astrophysics Data System (ADS)
Damayanti, R.; Abdullah, A. G.; Purnama, W.; Nandiyanto, A. B. D.
2017-03-01
Data mining is one of the data processing techniques to collect information from a set of stored data. Every day the consumption of electricity load is recorded by Electrical Company, usually at intervals of 15 or 30 minutes. This paper uses a clustering technique, which is one of data mining techniques to analyse the electrical load profiles during 2014. The three methods of clustering techniques were compared, namely K-Means (KM), Fuzzy C-Means (FCM), and K-Means Harmonics (KHM). The result shows that KHM is the most appropriate method to classify the electrical load profile. The optimum number of clusters is determined using the Davies-Bouldin Index. By grouping the load profile, the demand of variation analysis and estimation of energy loss from the group of load profile with similar pattern can be done. From the group of electric load profile, it can be known cluster load factor and a range of cluster loss factor that can help to find the range of values of coefficients for the estimated loss of energy without performing load flow studies.
Application of split window technique to TIMS data
NASA Technical Reports Server (NTRS)
Matsunaga, Tsuneo; Rokugawa, Shuichi; Ishii, Yoshinori
1992-01-01
Absorptions by the atmosphere in thermal infrared region are mainly due to water vapor, carbon dioxide, and ozone. As the content of water vapor in the atmosphere greatly changes according to weather conditions, it is important to know its amount between the sensor and the ground for atmospheric corrections of thermal Infrared Multispectral Scanner (TIMS) data (i.e. radiosonde). On the other hand, various atmospheric correction techniques were already developed for sea surface temperature estimations from satellites. Among such techniques, Split Window technique, now widely used for AVHRR (Advanced Very High Resolution Radiometer), uses no radiosonde or any kind of supplementary data but a difference between observed brightness temperatures in two channels for estimating atmospheric effects. Applications of Split Window technique to TIMS data are discussed because availability of atmospheric profile data is not clear when ASTER operates. After these theoretical discussions, the technique is experimentally applied to TIMS data at three ground targets and results are compared with atmospherically corrected data using LOWTRAN 7 with radiosonde data.
Techniques for trapping, aging, and banding wintering canvasbacks
Haramis, G.M.; Derleth, E.L.; McAuley, D.G.
1982-01-01
Techniques used to trap, band, and determine age of Canvasbacks during winter on Chesapeake Bay are presented. Canvasbacks were captured with welded-wire traps baited with corn. Two trap designs were used and traps and trapping techniques are described. Ducks were dipnetted from traps and held in modified poultry crates that provided seclusion and ventilation and allowed birds to dry unsoiled. Carney's (1964) wing plumage methodology was found most efficient in determining age of Canvasbacks during large-scale bandings. This technique was rapid and was easily taught to inexperienced personnel. In contrast, the cloacal technique could be performed efficiently only by experienced and skillful banders. Band wear was observed to vary widely on individual birds and rounding of bands was recognized as an important technique in extending band life. Bands were placed upside down on the tarsus so that wear along the upper edge would be less likely to destroy band numbers. In 5 winter seasons, over 17,000 Canvasbacks were captured. Mortality rate for the program was .3%.
A Corona Discharge Initiated Electrochemical Electrospray Ionization Technique
Lloyd, John R.; Hess, Sonja
2009-01-01
We report here the development of a corona discharge (CD) initiated electrochemical (EC) electrospray ionization (ESI) technique using a standard electrospray ion source. This is a new ionization technique distinct from ESI, electrochemistry inherent to ESI, APCI, and techniques using hydroxyl radicals produced under atmospheric pressure conditions. By maximizing the observable CD at the tip of a stainless steel ESI capillary, efficient electrochemical oxidation of electrochemically active compounds is observed. For electrochemical oxidation to be observed, the ionization potential of the analyte must be lower than Fe. Ferrocene labeled compounds were chosen as the electrochemically active moiety. The electrochemical cell in the ESI source was robust and generated ions with selectivity according to the ionization potential of the analytes and up to zeptomolar sensitivity. Our results indicate that CD initiated electrochemical ionization has the potential to become a powerful technique to increase the dynamic range, sensitivity and selectivity of ESI experiments. Synopsis Using a standard ESI source a corona discharge initiated electrochemical ionization technique was established resulting from the electrochemistry occurring at the CD electrode surface. PMID:19747843
The Scharff-technique: eliciting intelligence from human sources.
Oleszkiewicz, Simon; Granhag, Pär Anders; Montecinos, Sebastian Cancino
2014-10-01
This study is on how to elicit intelligence from human sources. We compared the efficacy of two human intelligence gathering techniques: the Scharff-technique (conceptualized as four different tactics) and the Direct Approach (a combination of open and direct questions). Participants (N = 60) were asked to take on the role of "sources" and were given information about a planned terrorist attack. They were to reveal part of this information in an upcoming interview. Critically, the participants were instructed to strike a balance between not revealing too much or too little information. As predicted, the participants revealed significantly more, and more precise, new information when interviewed with the Scharff-technique (vs. the Direct Approach). Furthermore, and as predicted, the participants in the Scharff condition underestimated how much new information they revealed whereas the participants in the Direct Approach overestimated how much new information they revealed. The study provides rather strong support for the Scharff-technique as an effective human intelligence gathering technique. PsycINFO Database Record (c) 2014 APA, all rights reserved.
Transverse vibration technique to identify deteriorated wood floor systems
R.J. Ross; X. Wang; M.O. Hunt; L.A. Soltis
2002-01-01
The Forest Products Laboratory, USDA Forest Service, has been developing nondestructive evaluation (NDE) techniques to identify degradation of wood in structures and the performance characteristics that remain in the structure. This work has focused on using dynamic testing techniques, particularly stress wave and ultrasonic transmission NDE techniques for both...
A lightweight network anomaly detection technique
Kim, Jinoh; Yoo, Wucherl; Sim, Alex; ...
2017-03-13
While the network anomaly detection is essential in network operations and management, it becomes further challenging to perform the first line of detection against the exponentially increasing volume of network traffic. In this paper, we develop a technique for the first line of online anomaly detection with two important considerations: (i) availability of traffic attributes during the monitoring time, and (ii) computational scalability for streaming data. The presented learning technique is lightweight and highly scalable with the beauty of approximation based on the grid partitioning of the given dimensional space. With the public traffic traces of KDD Cup 1999 andmore » NSL-KDD, we show that our technique yields 98.5% and 83% of detection accuracy, respectively, only with a couple of readily available traffic attributes that can be obtained without the help of post-processing. Finally, the results are at least comparable with the classical learning methods including decision tree and random forest, with approximately two orders of magnitude faster learning performance.« less
A lightweight network anomaly detection technique
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jinoh; Yoo, Wucherl; Sim, Alex
While the network anomaly detection is essential in network operations and management, it becomes further challenging to perform the first line of detection against the exponentially increasing volume of network traffic. In this paper, we develop a technique for the first line of online anomaly detection with two important considerations: (i) availability of traffic attributes during the monitoring time, and (ii) computational scalability for streaming data. The presented learning technique is lightweight and highly scalable with the beauty of approximation based on the grid partitioning of the given dimensional space. With the public traffic traces of KDD Cup 1999 andmore » NSL-KDD, we show that our technique yields 98.5% and 83% of detection accuracy, respectively, only with a couple of readily available traffic attributes that can be obtained without the help of post-processing. Finally, the results are at least comparable with the classical learning methods including decision tree and random forest, with approximately two orders of magnitude faster learning performance.« less
Arched needle technique for inferior alveolar mandibular nerve block.
Chakranarayan, Ashish; Mukherjee, B
2013-03-01
One of the most commonly used local anesthetic techniques in dentistry is the Fischer's technique for the inferior alveolar nerve block. Incidentally this technique also suffers the maximum failure rate of approximately 35-45%. We studied a method of inferior alveolar nerve block by injecting a local anesthetic solution into the pterygomandibular space by arching and changing the approach angle of the conventional technique and estimated its efficacy. The needle after the initial insertion is arched and inserted in a manner that it approaches the medial surface of the ramus at an angle almost perpendicular to it. The technique was applied to 100 patients for mandibular molar extraction and the anesthetic effects were assessed. A success rate of 98% was obtained.
Comparative evaluation of workload estimation techniques in piloting tasks
NASA Technical Reports Server (NTRS)
Wierwille, W. W.
1983-01-01
Techniques to measure operator workload in a wide range of situations and tasks were examined. The sensitivity and intrusion of a wide variety of workload assessment techniques in simulated piloting tasks were investigated. Four different piloting tasks, psychomotor, perceptual, mediational, and communication aspects of piloting behavior were selected. Techniques to determine relative sensitivity and intrusion were applied. Sensitivity is the relative ability of a workload estimation technique to discriminate statistically significant differences in operator loading. High sensitivity requires discriminable changes in score means as a function of load level and low variation of the scores about the means. Intrusion is an undesirable change in the task for which workload is measured, resulting from the introduction of the workload estimation technique or apparatus.
An intercomparison of five ammonia measurement techniques
NASA Technical Reports Server (NTRS)
Williams, E. J.; Sandholm, S. T.; Bradshaw, J. D.; Schendel, J. S.; Langford, A. O.; Quinn, P. K.; Lebel, P. J.; Vay, S. A.; Roberts, P. D.; Norton, R. B.
1992-01-01
Results obtained from five techniques for measuring gas-phase ammonia at low concentration in the atmosphere are compared. These methods are: (1) a photofragmentation/laser-induced fluorescence (PF/LIF) instrument; (2) a molybdenum oxide annular denuder sampling/chemiluminescence detection technique; (3) a tungsten oxide denuder sampling/chemiluminescence detection system; (4) a citric-acid-coated denuder sampling/ion chromatographic analysis (CAD/IC) method; and (5) an oxalic-acid-coated filter pack sampling/colorimetric analysis method. It was found that two of the techniques, the PF/LIF and the CAD/IC methods, measured approximately 90 percent of the calculated ammonia added in the spiking tests and agreed very well with each other in the ambient measurements.
Laparoscopic feeding jejunostomy: also a simple technique.
Albrink, M H; Foster, J; Rosemurgy, A S; Carey, L C
1992-01-01
Placement of feeding tubes is a common procedure for general surgeons. While the advent of percutaneous endoscopic gastrostomy has changed and improved surgical practice, this technique is contraindicated in many circumstances. In some patients placement of feeding tubes in the stomach may be contraindicated due to the risks of aspiration, gastric paresis, or gastric dysmotility. We describe a technique of laparoscopic jejunostomy tube placement which is easy and effective. It is noteworthy that this method may be used in patients who have had previous abdominal operations, and it has the added advantage of a direct peritoneal view of the viscera. We suggest that qualified laparoscopic surgeons learn the technique of laparoscopic jejunostomy.
Barriers impacting the utilization of supervision techniques in genetic counseling.
Masunga, Abigail; Wusik, Katie; He, Hua; Yager, Geoffrey; Atzinger, Carrie
2014-12-01
Clinical supervision is an essential element in training genetic counselors. Although live supervision has been identified as the most common supervision technique utilized in genetic counseling, there is limited information on factors influencing its use as well as the use of other techniques. The purpose of this study was to identify barriers supervisors face when implementing supervision techniques. All participants (N = 141) reported utilizing co-counseling. This was most used with novice students (96.1%) and intermediate students (93.7%). Other commonly used techniques included live supervision where the supervisor is silent during session (98.6%) which was used most frequently with advanced students (94.0%), and student self-report (64.7%) used most often with advanced students (61.2%). Though no barrier to these commonly used techniques was identified by a majority of participants, the most frequently reported barriers included time and concern about patient's welfare. The remaining supervision techniques (live remote observation, video, and audio recording) were each used by less than 10% of participants. Barriers that significantly influenced use of these techniques included lack of facilities/equipment and concern about patient reactions to technique. Understanding barriers to implementation of supervisory techniques may allow students to be efficiently trained in the future by reducing supervisor burnout and increasing the diversity of techniques used.
Assessing Classroom Assessment Techniques
ERIC Educational Resources Information Center
Simpson-Beck, Victoria
2011-01-01
Classroom assessment techniques (CATs) are teaching strategies that provide formative assessments of student learning. It has been argued that the use of CATs enhances and improves student learning. Although the various types of CATs have been extensively documented and qualitatively studied, there appears to be little quantitative research…
Merchandising Techniques and Libraries.
ERIC Educational Resources Information Center
Green, Sylvie A.
1981-01-01
Proposes that libraries employ modern booksellers' merchandising techniques to improve circulation of library materials. Using displays in various ways, the methods and reasons for weeding out books, replacing worn book jackets, and selecting new books are discussed. Suggestions for learning how to market and 11 references are provided. (RBF)
ERIC Educational Resources Information Center
Burack, A. S., Ed.
Forty novelists share their ideas and experience on various aspects of writing book-length fiction in this volume. Problems of technique, plotting, theme, characterization, planning, flashbacks, pace, suspense, dialogue, setting, and point of view are discussed by these contemporary authors. Some of the chapters and authors include: (1)…
Application of filtering techniques in preprocessing magnetic data
NASA Astrophysics Data System (ADS)
Liu, Haijun; Yi, Yongping; Yang, Hongxia; Hu, Guochuang; Liu, Guoming
2010-08-01
High precision magnetic exploration is a popular geophysical technique for its simplicity and its effectiveness. The explanation in high precision magnetic exploration is always a difficulty because of the existence of noise and disturbance factors, so it is necessary to find an effective preprocessing method to get rid of the affection of interference factors before further processing. The common way to do this work is by filtering. There are many kinds of filtering methods. In this paper we introduced in detail three popular kinds of filtering techniques including regularized filtering technique, sliding averages filtering technique, compensation smoothing filtering technique. Then we designed the work flow of filtering program based on these techniques and realized it with the help of DELPHI. To check it we applied it to preprocess magnetic data of a certain place in China. Comparing the initial contour map with the filtered contour map, we can see clearly the perfect effect our program. The contour map processed by our program is very smooth and the high frequency parts of data are disappeared. After filtering, we separated useful signals and noisy signals, minor anomaly and major anomaly, local anomaly and regional anomaly. It made us easily to focus on the useful information. Our program can be used to preprocess magnetic data. The results showed the effectiveness of our program.
FURAU, Cristian; FURAU, Gheorghe; DASCAU, Voicu; CIOBANU, Gheorghe; ONEL, Cristina; STANESCU, Casiana
2013-01-01
ABSTRACT Objectives: Cesarean section has become recently the first choice for delivery in many clinics in Romania and worldwide. The purpose of our study is to assess the benefits of introducing the adapted Vejnovic uterine suture technique into daily practice. Material and Methods: A total of 1703 out of the 1776 cesarean section performed in the period January, 2012 - March, 2013 in the Obstetric Department of the Emergency Clinical County Hospital of Arad were retrospectively analyzed based on the cesarean section registries, birth registries and patient's personal medical records. We compared results between the group of patients undergoing adapted Vejnovic cesarean section technique and the group of patients operated in a classic manner. Outcomes: The cesarean section rate in the studied period was 56.48%. Adapted Vejnovic cesarean section technique was performed in 548 cases (30.86% of the cases), furthermore in the last 3 months studied it reached 57.27%. Mean APGAR score was better in the adapted Vejnovic cesarean section group (8.43) compared with the reference group (8.34). No significant differences were seen between the two groups regarding maternal age, gestation, weeks of gestation, newborn weight, anesthesia and indications for cesarean section. Exteriorizing the uterus helped the incidental diagnosis of 35 uterine myoma, 22 adnexal masses and 13 uterine malformations. Conclusion: In a society with a constant growth of cesarean rate, the adapted Vejnovic cesarean section technique is becoming popular amongst clinicians for its advantages, but further studies need to be developed for its standardization. PMID:24371494
An Improved Fungal Mounting Technique for Nomarski Microscopy.
ERIC Educational Resources Information Center
Fairclough, Andrew; And Others
1985-01-01
Conventional sellotape techniques for fungal mounting produce interference patterns when using Normarsky microscopy. A technique is described which overcomes this problem and produces a permanent mount with a completely clear background. (Author/JN)
A Versatile Technique for Solving Quintic Equations
ERIC Educational Resources Information Center
Kulkarni, Raghavendra G.
2006-01-01
In this paper we present a versatile technique to solve several types of solvable quintic equations. In the technique described here, the given quintic is first converted to a sextic equation by adding a root, and the resulting sextic equation is decomposed into two cubic polynomials as factors in a novel fashion. The resultant cubic equations are…
Transverse vibration techniques : logs to structural systems
Robert J. Ross
2008-01-01
Transverse vibration as a nondestructive testing and evaluation technique was first examined in the early 1960s. Initial research and development efforts focused on clear wood, lumber, and laminated products. Out of those efforts, tools were developed that are used today to assess lumber properties. Recently, use of this technique has been investigated for evaluating a...